Datasets:

tomekkorbak

/

pii-pile-chunk3-1850000-1900000

like 0

[ "2003 Liechtenstein constitutional referendum\n\nA constitutional referendum regarding the Prince’s powers was held in Liechtenstein on 14 March 2003. ", "The referendum had two questions; a \"Princely Initiative\" and a \"Constitution Peace Initiative\". ", "The first question passed with 64.32% in favour and the second question was rejected by 83.44% of voters.", "\n\nThe Princely Initiative asked voters whether to approve an extension of the power of the Prince to dismiss the government, nominate judges and veto legislation.", "\n\nThe Constitution Peace Initiative asked voters whether to approve or disapprove of constitutional modifications, including modifications which would have restricted the Prince’s powers. ", "The BBC stated that the referendum in effect made Liechtenstein into an \"absolute monarchy\". ", "In December 2012 the Venice commission of the Council of Europe published a comprehensive report analysing the amendments, opining that they were not compatible with the European standard of democracy. ", "Prince Hans-Adam II had threatened to leave the country and live in exile in Vienna, Austria if the voters had chosen to restrict his powers.", "\n\nResults\n\nPrincely Initiative\n\nConstitution Peace Initiative\n\nReferences\n\nExternal links\n\nCategory:2003 referendums\nCategory:2003 elections in Europe\nCategory:2003 in Liechtenstein\nCategory:Referendums in Liechtenstein\nCategory:Liechtenstein monarchy\nCategory:March 2003 events in Europe" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.00013696128560993425, 0, 0, 0, 0.000028293345405160706, 0.00023124060585038734, 0.000024266543716178507, 0.0000502992807202857, 0.00003616898148148148 ]

[ "{\n \"meta:license\": [\n \"Copyright 2019 Adobe Systems Incorporated. ", "All rights reserved.\",", "\n \"This work is licensed under a Creative Commons Attribution 4.0 International (CC BY 4.0) license\",\n \"you may not use this file except in compliance with the License. ", "You may obtain a copy\",\n \"of the License at https://creativecommons.org/licenses/by/4.0/\"\n ],\n \"$schema\": \"http://json-schema.org/draft-06/schema#\",\n \"$id\": \"https://ns.adobe.com/xdm/adcloud/searchads/aggregateperformancebyadbykeyword\",\n \"title\": \"Search Advertising Aggregate Performance Measures By Ad and Keyword\",\n \"type\": \"object\",\n \"meta:extensible\": false,\n \"meta:abstract\": false,\n \"meta:extends\": [\"https://ns.adobe.com/xdm/data/time-series\"],\n \"description\": \"Search Advertising Aggregate Performance Measures by Ad and Keyword is a collection of measures pulled from Search Advertising Platforms.\",", "\n \"definitions\": {\n \"aggregateperformancebyadbykeyword\": {\n \"properties\": {\n \"searchads:accountId\": {\n \"title\": \"Account Identifier\",\n \"type\": \"string\",\n \"description\": \"Identifier that defines Customer/Client ID setup on the Search Advertising Platform.\"", "\n },\n \"searchads:campaignId\": {\n \"title\": \"Campaign Identifier\",\n \"type\": \"string\",\n \"description\": \"Campaign ID on the search advertising platform..\"\n },\n \"searchads:adgroupId\": {\n \"title\": \"Ad Group Identifier\",\n \"type\": \"string\",\n \"description\": \"Ad Group ID on the search advertising platform.\"", "\n },\n \"searchads:termId\": {\n \"title\": \"Search Term Identifier\",\n \"type\": \"string\",\n \"description\": \"Search Term ID on the search advertising platform.\"", "\n },\n \"searchads:term\": {\n \"title\": \"Search Term\",\n \"type\": \"string\",\n \"description\": \"Search Term targeted for the Ad.\"", "\n },\n \"searchads:matchType\": {\n \"title\": \"Term Match Type\",\n \"type\": \"string\",\n \"description\": \"Match Type associated to the Search Term being targeted for the Ad.\",", "\n \"enum\": [\n \"Broad\",\n \"Phrase\",\n \"Exact\",\n \"Advanced\",\n \"Standard\",\n \"Website\",\n \"Product Target\",\n \"Product Group\",\n \"Content\",\n \"SiteCpc\",\n \"SiteCpm\",\n \"Category\",\n \"Search\",\n \"Adgroup\",\n \"Dynamic Ad Target\",\n \"Unknown\"\n ],\n \"meta:enum\": {\n \"Broad\": \"Broad\",\n \"Phrase\": \"Phrase\",\n \"Exact\": \"Exact\",\n \"Advanced\": \"Advanced\",\n \"Standard\": \"Standard\",\n \"Website\": \"Website\",\n \"Product Target\": \"Product Target\",\n \"Product Group\": \"Product Group\",\n \"Content\": \"Content\",\n \"SiteCpc\": \"SiteCpc\",\n \"Sitecpm\": \"SiteCpm\",\n \"Category\": \"Category\",\n \"Search\": \"Search\",\n \"Adgroup\": \"Adgroup\",\n \"Dynamic Ad Target\": \"Dynamic Ad Target\",\n \"Unknown\": \"Unknown\"\n }\n },\n \"searchads:adId\": {\n \"title\": \"Ad Identifier\",\n \"type\": \"string\",\n \"description\": \"Ad ID on the search advertising platform.\"", "\n },\n \"searchads:searchEngineId\": {\n \"title\": \"Search Engine Identifier\",\n \"type\": \"integer\",\n \"description\": \"The application-specified identifier used to identify the Search Advertising Platform Name.\"", "\n },\n \"searchads:clicks\": {\n \"$ref\": \"https://ns.adobe.com/xdm/data/measure\",\n \"description\": \"Count of Clicks for a given ad displayed on the network.\"", "\n },\n \"searchads:impressions\": {\n \"$ref\": \"https://ns.adobe.com/xdm/data/measure\",\n \"description\": \"Count of impressions for a given ad displayed on the network.\"", "\n },\n \"searchads:totalCost\": {\n \"$ref\": \"https://ns.adobe.com/xdm/data/measure\",\n \"description\": \"Total Advertising Spend for a given ad displayed on the network. ", "The spend is in the account currency configured on the network.\"", "\n },\n \"searchads:avgPosition\": {\n \"$ref\": \"https://ns.adobe.com/xdm/data/measure\",\n \"description\": \"Average Position of the Ad displayed on the network.\"", "\n },\n \"searchads:topPageBid\": {\n \"$ref\": \"https://ns.adobe.com/xdm/data/measure\",\n \"description\": \"Top of the Page Bid Estimator. ", "The measure is computed by the network and is not an additive measure.\"", "\n },\n \"searchads:qualityScore\": {\n \"$ref\": \"https://ns.adobe.com/xdm/data/measure\",\n \"description\": \"Quality Score of the Keyword assigned by the network - range 1 to 10. ", "This is not an additive measure.\"", "\n },\n \"searchads:device\": {\n \"title\": \"Device\",\n \"$ref\": \"https://ns.adobe.com/xdm/context/device\",\n \"description\": \"The device from where the ad was displayed.\"", "\n }\n }\n }\n },\n \"allOf\": [\n {\n \"$ref\": \"https://ns.adobe.com/xdm/data/time-series\"\n },\n {\n \"$ref\": \"#/definitions/aggregateperformancebyadbykeyword\"\n }\n ],\n \"meta:status\": \"stable\"\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.0004081632653061224, 0, 0.00003265306122448979, 0.000025930852787955636, 0.00002252150804017837, 0, 0, 0, 0, 0.000004084566872528837, 0.000016796560064498793, 0.00002953686200378072, 0.00002657030502710171, 0.000026298487836949376, 0, 0.000029218407596785978, 0.000038103947568968146, 0, 0.000024266543716178507, 0, 0.000024507401235173024, 0.000040217981459510544 ]

[ "Matryoshka nesting doll Kung Fu Panda Free worldwide shipping\n\n$54.90\n\n5 piece matryoshka doll set, featuring heroes from Kung Fu Panda movie. ", "This set is made by hand in Russia. ", "It is made of linden wood and then painted by a professional matryoshka doll artist. ", "It is a funny matryoshka doll, and each smaller piece of the set fits into the next larger one. ", "Each matryoshka is polished with 3-5 layers of crystal clear lacquer.", "The biggest matryoshka is 17 cm!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.000048902146804244705, 0, 0, 0, 0.00021003990758244068, 0 ]

[ "Q:\n\nComparing text files character-by-character in C\n\nI'm writing a small program which does as follows:\nWhen executed, takes as arguments, two text files.", "\nCompares each text file character by character, displaying to the user whether each comparison was successful or not.", "\nWhen two characters (in the same position) are not the same, this is told to the user, and the program finishes.", "\nIf the two text files are the same entirely, this is also told the user, and the program ends. ", " \n#include <stdio.h>\n#include <stdlib.h>\n\nint main(int argc, char *argv[]) // define main procedure, taking an command line argument\n{\n int ch, ch2; // index for current character\n FILE *fp; // pointer to file\n FILE *fp2;\n unsigned long count = 0;\n\nif (argc !", "= 3) //\n{\n printf(\"Usage: %s filename \\n\", argv[0]);\n exit(EXIT_FAILURE);\n}\n\nif ((fp = fopen(argv[1], \"r\")) == NULL) // check for 'cannot open' error in first file\n{\n printf(\"Can't open %s\\n\", argv[1]);\n exit(EXIT_FAILURE);\n}\nelse if ((fp2 = fopen(argv[2], \"r\")) == NULL) // check for 'cannot open' error in second file\n{\n printf(\"Can't open %s\\n\", argv[2]);\n exit(EXIT_FAILURE);\n}\n\nwhile ((ch = getc(fp) !", "= EOF) || (ch2 = getc(fp2) !", "= EOF)) // while both files still have characters remaining\n{\n printf(\"\\n %d %d \\n\", ch, ch2); // print both characters (debugging purposes)\n if (ch == ch2) // if two characters are same at current position\n {\n printf(\"FILES ARE SAME AT POSITION %d\", count); // report to user\n count++; // increase count\n }\n else\n {\n printf(\"FILES ARE NOT NOT NOT SAME AT POSITION %d\", count); // report that files are not same at current position\n fclose(fp); // close files\n fclose(fp2);\n exit(EXIT_FAILURE); // exit\n }\n}\n\nfclose(fp);\nfclose(fp2);\nprintf(\"FILES ARE THE SAME THROUGHOUT!\");", "\n\nreturn 0;\n\nHowever, the program display random characters not in the file when comparing, causing infinite loops and false execution.", "\nAm my file pointers incorrect, or have I messed up a data type somewhere causing this?", "\n\nA:\n\nFirst You should change your while loop from \nwhile ((ch = getc(fp) !", "= EOF) || (ch2 = getc(fp2) !", "= EOF))\n\nto\nwhile (((ch = getc(fp)) !", "= EOF) || ((ch2 = getc(fp2)) !", "= EOF))\n\nAs !", "= has higher precedence than =, your while loop has a problem always\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0.000013417595835178253, 0.00002143347050754458, 0.0012755102040816326, 0.000004913473727655978, 0, 0, 0, 0.0012755102040816326, 0.0007304601899196494, 0.0011111111111111111, 0.00591715976331361, 0 ]

[ "Bronchogenic cyst.", "\nTwo recent patients with bronchogenic cysts, presenting in an atypical manner, stimulated our review of this subject. ", "Twenty patients with bronchogenic cysts have been treated at the Boston Floating Hospital over the past 20 yr. ", "Of these patients, 19 out of 20 were symptomatic, the most common symptom being fever (6 out of 20). ", "Half of our patients had no respiratory symptoms but only one was found to have an asymptomatic mass on chest x-ray. ", "The majority of theses cysts were found within the pulmonary parenchyma, the right lung being affected three times more commonly than the left. ", "These facts are at odds with the reports in the literature. ", "Three were found in the neck. ", "Bronchogenic cysts are generally thought to be small, solitary, and limited in area. ", "However, a significant number in our series (8 out of 20) were large, multiple or multicystic, and involved segments, lobes, multiple lobes, and, on one occasion, an entire lung. ", "The correct pre-operative diagnosis was made in only 30% of the cases. ", "The fact that the diagnosis was often missed led to long delays in treatment resulting in recurrent infectious complications and repeated hospitalizations. ", "The most common cause of error in diagnosis was failure to follow a pneumonia to complete resolution. ", "Despite the frequent delays in diagnosis, surgical treatment was curative in all patients." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0.00008116224332440549, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Barry Trotz Is Best Fit as Next Head Coach of Washington Capitals\n\nThe Washington Capitals' brain trust of owner Ted Leonsis and president Dick Patrick must not allow the hiring of a general manager to overshadow the hiring of a head coach.", "\n\nThe pressure-packed search for a GM has many qualified candidates, as I detailed in my column last week. ", "Add to that list the name of Ray Shero, the former GM for the rival Pittsburgh Penguins as of May 16. ", "With Shero, there are at least 12 GM candidates to choose from.", "\n\nThe equally important search for a head coach, on the other hand, has decidedly fewer candidates. ", "Thankfully, the most prominent candidate is also the best fit for the job.", "\n\nIn addition, Trotz compiled some strong numbers during his extensive time in Nashville. ", "Take a look at Trotz's rank among active coaches, as well as his rank among all NHL coaches:\n\nBarry Trotz's Rank Among 351 NHL Coaches: Regular Season\n\nCATEGORY\n\nSTAT\n\nACTIVE\n\nALL-TIME\n\nGames Played\n\n1,196\n\n4th\n\n13th\n\nWins\n\n557\n\n4th\n\n13th\n\nLosses\n\n479\n\n1st\n\n8th\n\nPoints\n\n1,274\n\n4th\n\n14th\n\nPoints %\n\n.533\n\n23rd\n\n100th\n\nHockey-Reference.com\n\nAnd now for his postseason ranks, which are decidedly less impressive:\n\nBarry Trotz's Rank Among 351 NHL Coaches: Postseason\n\nCATEGORY\n\nSTAT\n\nACTIVE\n\nALL-TIME\n\nGames Played\n\n50\n\n18th\n\n55th\n\nWins\n\n19\n\n18th\n\n62nd\n\nLosses\n\n31\n\n14th\n\n46th\n\nWin-Loss %\n\n.380\n\n25th\n\n135th\n\nHockey-Reference.com\n\nThese numbers may not look like much, even though Trotz was nominated for the Jack Adams Award on two separate occasions. ", "However, Katie Carrera pointed out that Trotz was coaching \"a budget-minded team that wasn’t spending to the salary cap,\" a fact that may put some Capitals fans at ease.", "\n\nBut another fact will be rather disconcerting to the DC faithful.", "\n\nThe Nashville Predators did not score a lot of goals under Barry Trotz. ", "Case in point: Nashville finished in the bottom half of the league in goal scoring in 11 of the 15 seasons that Trotz coached in Nashville. ", "Furthermore, the Preds finished in the bottom third of the league in goal scoring in eight of those 11 seasons.", "\n\nTrotz himself addressed this criticism when he spoke to Carrera on May 12:\n\nI think I’m very adaptable. ", "When we had Paul Kariya for a couple years and we were a little deeper at forward we were a pretty high scoring team. ", "You need balance and if you have dynamic people – I’ve always tried to assess the talent and say ‘Okay, how can we get better as a group and how can we win hockey games?’ ", "I’ve played a number of different systems based on our personnel but I like the personnel to dictate the strength. ", "In Nashville, our strength was in net and defense. ", "So our team would take the personality of the top players and that was most often on the back end.", "\n\nDespite this explanation, I know for certain that some Capitals fans will bemoan the fact that Trotz is even being considered as the team's next head coach. ", "These detractors will cite Trotz's track record of coaching offensively challenged hockey teams while predicting that his presence behind the Capitals' bench will negatively affect the offensive output of one Alex Ovechkin.", "\n\nEnough already.", "\n\nI've grown sick and tired of reading comments on various websites over the past two years in which Capitals fans have bashed the short (but successful) tenure of another defensive-minded head coach by the name of Dale Hunter.", "\n\nTheir reasoning?", "\n\nHunter shackled the immense offensive talents of the team's captain and best player, causing the worst slump of Ovechkin's career as he scored only 38 goals in 2011-12.", "\n\nNever mind that Ovechkin was already slumping—under the guidance of the great Bruce Boudreau, no less. ", "Gabby, an offensive wizard as a head coach, was forced to alter his coaching style to a more defensive approach only after the 2010-11 season, when Ovechkin scored just 32 goals. ", "That still stands as the lowest total in Ovechkin's career when counting 82-game seasons.", "\n\nShortsighted Caps fans don't seem to care. ", "They only care that Ovechkin did not win the third Hart Trophy of his career or return to the 50-goal plateau until Hunter and his defense-first mentality had left DC.", "\n\nIf my memory serves me correctly (and it does), the Capitals under the defensive-minded Dale Hunter won seven playoff games. ", "And that was in one year. ", "Meanwhile, the Capitals under the offensive-minded Adam Oates won three playoff games in one trip to the postseason. ", "And that was over the course of two years.", "\n\nIt quickly becomes obvious that Capitals fans who choose to criticize defensive-minded coaches have their priorities mixed up. ", "They are seemingly more intent on seeing Alex Ovechkin fill his trophy case at the detriment of the team as a whole. ", "I, for one, would rather see the Washington Capitals fill their trophy case instead.", "\n\nBarry Trotz needs the opportunity to prove that the two are not mutually exclusive." ]

{ "pile_set_name": "Pile-CC" }

[ 0.00008680555555555555, 0.00008734387282732115, 0.0002883506343713956, 0.0005039052658100277, 0, 0, 0.0001234567901234568, 0.000015957418515215396, 0.0001400511186583103, 0, 0.00018261504747991235, 0.0000510204081632653, 0.00008116224332440549, 0.00017799928800284797, 0.00007181844297615628, 0, 0, 0, 0, 0.00007911079466793244, 0.00006032697218926582, 0, 0.00003881309553843467, 0, 0.00006920415224913494, 0.00018140589569160998, 0.00003121001217190475, 0.00012624668602449185, 0, 0.0000717128617017462, 0.000124000248000496, 0, 0.00014610271020527432, 0, 0.00006009254251547383, 0.00007305135510263716, 0.0001417233560090703, 0.00013840830449826988 ]

[ "Q:\n\nCSS background-clip property not being applied in React when background is dinamically changing\n\nIf you want to jump into live code i prepared this CodeSandBox here: \nhttps://codesandbox.io/s/0j99m3m50\nHere's what I am doing:\nI have React component with state object having two properties (users, gradient) with values\nthis.state = {\n users: \"programmer\",\n gradient: \"linear-gradient(120deg, #f093fb 0%, #f5576c 100%)\"\n};\n\nAnd I am rendering user on an h1 JSX tag, but I should see the text clipped to each random gradient background, however it is not working, why?", "\nrender() {\n const gradually = this.state.gradient;\n const userGradient = {\n background: `${gradually}`,\n WebkitBackgroundClip: \"text !", "important\",\n backgroundClip: \"text !", "important\",\n color: \"transparent\"\n };\n\n return (\n <div>\n <h1 style={userGradient} className=\"text\">\n {this.state.users}\n </h1>\n </div>\n );\n}\n\nA:\n\nYou need to add a unique key on your h1 tag to force a repaint. ", "The key could be the same value as your gradually var. ", "You can also get rid of the !", "important on your clips.", "\nHere's a link to working changes to your sandbox: https://codesandbox.io/s/css-background-clip-not-being-applied-n34o0\nconst gradually = this.state.gradient;\nconst userGradient = {\n background: `${gradually}`,\n WebkitBackgroundClip: \"text\", // Removed !", "important\n backgroundClip: \"text\", // Removed !", "important\n color: \"transparent\"\n};\n\nreturn (\n <div>\n <h1\n style={userGradient}\n className=\"text\"\n key={gradually} // Add key\n >\n {this.state.users}\n </h1>\n </div>\n);\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.00000904224537037037, 0, 0, 0, 0, 0, 0, 0.0000152587890625, 0, 0 ]

[ "Q:\n\nROC Area Under Curve (AUC) in SVM - different results between R functions\n\nI have two questions relating to ROC AUC values in SVM training and testing.", "\n\nAfter training and testing an SVM in caret I've found differences between the AUC values calculated by caret, pROC and the ggplot2 extension plotROC. ", "The max AUC from training in caret is less than either AUC from testing. ", "Is this normal? ", "Intuitively I would have thought that testing AUC would be lower than in training because of some level of poor fitting to unseen data.", "\nDoes anyone have an explanation for the differences between AUC from pROC and the ggplot2 extension plotROC that are both calculated on the testing prediction? ", "I've had a look at the documentation for both pROC and plotROC (and the code for plotROC's calculate_roc function) but haven't been able to determine a reason. ", "Or have I made a coding error in calculating the AUCs?", "\n\nReproducible example:\nLoad the GermanCredit dataset that has 2 classes and various feature variables.", "\ndata(\"GermanCredit\") \n# Remove zero variance variables (prior knowledge)\ngc <- GermanCredit %>% select(-Purpose.", "Vacation, -Personal.", "Female.", "Single)\n\nTraining/testing partition.", "\nset.seed(71)\ngc_i <- createDataPartition(gc$Class, p = 0.8, list = FALSE)\n\nOPTIONAL: For parallel processing, set the number of cores (workers) and set seeds within resampling as running parallel processing.", "\nregisterDoMC(cores = 2)\n# Set seeds for reproducibility \n## In this case B = (5 repeats of 5-Fold CV) +1 = 51; M = 1 (only one parameter combination being used)\nset.seed(456)\nseeds1 <- vector(mode = \"list\", length = 26)\nfor(i in 1:25) seeds1[[i]] <- sample.int(1000, 25) ## 5*5 parameters from tuneLength=5\n## For the last model:\nseeds1[[26]] <- sample.int(1000, 1)\n\nTraining\ngc_ctrl1 <- trainControl(method = \"repeatedcv\",\n number = 5,\n repeats = 5,\n classProbs = TRUE,\n summaryFunction = twoClassSummary,\n savePredictions = TRUE,\n seeds = seeds1) # optional\n\ngc_train1 <- train(Class~., gc[gc_i, ],\n method = \"svmRadial\",\n # train() use its default method of calculating an analytically derived estimate for sigma\n tuneLength = 5,# 5 arbitrary values for C and sigma = 25 models\n trControl = gc_ctrl1,\n preProc = c(\"center\", \"scale\"),\n metric = \"ROC\",\n verbose = FALSE)\n\nmax(gc_train1$results[,\"ROC\"])\n# 0.7800372\n\nUsing train1 best model to test.", "\n# Confusion matrix using `caret::confusionMatrix`\ngc_pred <- predict(gc_train1, newdata = gc[-gc_i,] %>% select(-Class), type = \"raw\")\ngc_CM <- confusionMatrix(gc_pred, gc[-gc_i,]$Class)\n\nROC and AUC using pROC\n# ROC using pROC\ngc_prob <- predict(gc_train1, newdata = gc[-gc_i,] %>% select(-Class), type = \"prob\")\ngc_pROC <- roc(response = gc[-gc_i,]$Class, predictor = gc_prob[, \"Good\"])\nplot(gc_pROC)\ngc_pROC$auc\n# Area under the curve: 0.8376\n\nROC and AUC using plotROC (ggplot2 extension)\n# ROC using plotROC (ggplot2 extension)\ngc_prob_ex <- extractProb(list(gc_train1), gc[-gc_i,] %>% select(-Class))\ngc_ggROC <- ggplot(gc_prob_ex, aes(d=obs, m=Good)) + geom_roc() \ngc_ggROC_styled <- gc_ggROC + annotate(\"text\", x = .75, y = .25, \n label = paste(\"AUC =\", round(calc_auc(gc_ggROC)$AUC, 2)))\ngc_ggROC_styled\n# Area under the curve: 0.96\n\nA:\n\nQ1.", "\nThere are many possible causes for this. ", "There's noise associated with point estimates of evaluation metrics, and these might make your performance on test data seem better than on train data. ", "Now, on average, it's not reasonable to expect a model behaves better on data it has never seen than on data it was trained on. ", "The maximum AUC you see on test data might be an artifact, created by a specific distribution of the samples in a fold.", "\nQ2.", "\nWhile I never used ggplot like that, it seems gc_prob_ex receives the predictions from the train set and not from the test set.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.00008324661810613944, 0.00008656509695290859, 0.00018765246762994932, 0, 0.00005486968449931413, 0.000038578758535550326, 0, 0, 0.00009425959091337542, 0, 0, 0.02040816326530612, 0, 0.00002311390532544379, 0.0000014992222784430576, 0.0000027167859335691503, 0, 0, 0, 0.0000706164818868724, 0, 0, 0 ]

[ "Rayer Bazaar\n\nRayer Bazaar is a well-known thoroughfare in Dhaka, the capital city of Bangladesh. ", "It is generally regarded as one of the historical areas of the city. ", "Rayer Bazaar was founded during the colonial period most probably in the 19th century. ", "It was the potters who first started to live here beside the Turag River. ", "This Place was most probably named after someone titled Ray. ", "It was easy to find the clays used to make pots in this area and spread it around by boats as it was situated near the river.", "\n\nAddress\nRayer Bazaar Bodhdhobhumi is located in Mohammadpur near Beribadh area in Dhaka District. ", "This area is mainly an extension of the Turag River. ", "The Martyred Intellectuals Memorial was established here on 14 December 1993 by ex Prime Minister Begum Khaleda Zia.", "\n\nHistory\nDuring the Mughal period this place was famous for pottery and most of the potters of this region used to live in Rayer Bazar, because the famous \"lal mati\" (Red Clay) was available in this place a lot. ", "During the Mughal and British Colonial period, the red clay was not available in the neighbourhoods. ", "As a result, the Potters of Rayer Bazar have a long tradition of working with this red clay. ", "According to Dr. Wise, this place was known as \"Kumartoli\" during the Mughal period.", "\n\nIn the night of 14 December 1971, many of Bangladesh's intellectuals including professors, journalists, doctors, artists, engineers, and writers were rounded up in Dhaka. ", "They were taken blindfolded to torture cells in Mirpur, Mohammadpur, Nakhalpara, Rajarbagh and other locations in different sections of the city. ", "Later they were executed and thrown out in the swamps, at Rayerbazar.", "\n\nMartyred Intellectuals Memorial\n\nIn memory of the martyred intellectuals of 1971, a Memorial is created in there. ", "The 'Al-Badr' and 'Al-Shams' Group helped the West Pakistan Army to locate the intellectuals and slaughtered them and many other innocent peoples at night. ", "After the massacre they brought the corpses and left them into the swamps of Rayer Bazaar. ", "After the Liberation War, the people of Dhaka found out that all the dead bodies of many great intellectuals and innocent people are piled up in here.\"", "\nMartyred Intellectuals Memorial is the memorial built for the memory of the martyred intellectuals of 1971. ", "The memorial is built in the Boddhobhumi at Rayer Bazaar.", "\n\nPresent condition\nRayer Bazaar has become a densely populated area at present. ", "The area has mainly become a slum. ", "The area is heavily polluted and living standard is very much low in this area. \"", "The old pottery tradition is almost over. ", "We can hardly find two or three potters in here\". ", " The tannery at Hajaribaag near the Rayer Bazaar Boddhobhumi is one of the main reasons for polluting the area. ", "The overgrowth of population has even created severe water problem in this area.", "\n\nReferences\n\nExternal links\n Historical places, National Tourism Organisation, Govt. ", "of Bangladesh.", "\n\nCategory:Dhaka" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0002082465639316951, 0, 0.0001321178491214163, 0, 0.0002687449610319807, 0, 0.0002, 0, 0.00014863258026159333, 0.00002204148206925434, 0.0000980296049406921, 0.00011562030292519367, 0.0002834467120181406, 0, 0.00004691311690748733, 0, 0.00007431629013079666, 0.00008218277449046679, 0.00012075836251660429, 0.00004385772553835358, 0, 0.0006155740227762388, 0.00030483158055174517, 0, 0, 0, 0, 0, 0, 0.00027041644131963225, 0, 0.00390625 ]

[ "Everything about my first and main wedding day (there were three!) ", "reminds me of a series of made-for-stage vignettes. ", "The day itself was so full of action, but the moments were so singular in each scene–so distinct. ", "If I were to stage the show, I’d start it with that restaurant scene from this blog, I think. ", "Followed up by the hotel room search-for-the-shoe scene and then the bicycles-built-for-two scene, both from this blog.", "\n\nThen I’d be up to this scene, starting at 6am:\n\nThe sun is just rising. ", "The smoke is starting to clear from the enormous explosion of deafening fireworks that greeted our arrival. ", "Everything still looks cloudy, though, through the weak morning light. ", "My ears are still ringing…\n\nWe had just arrived at my in-laws’ home on the back of a bicycle-built-for-two. ", "The wheels of the bike rolled alongside of a long red carpet and then crossed it before someone cried out, “Don’t ride on the carpet! ", "Too dirty!”", "\n\nWe were quickly ushered off the bike and I paused, worried about touching my feet on the ground as per the stories about bad luck, but no one seemed concerned about that. ", "They just wanted me up and off the bike like it was a prop that was now out of synch with the scene. ", "I tentatively let the pavement find my feet and hoped that I didn’t need to go looking for wood to knock on in exchange for breaking that particular pact with the luck goddesses! (", "There was a serious internal clashing of cultures happening in my superstitious brain in that moment!)", "\n\nWe were rushed into the apartment to get into our formal wear.", "\n\nThe MC was there when we arrived. ", "He was some sort of television personality in Shandong province, but Guo Jian had never heard of him. ", "His voice boomed and crackled in the speakers, loud enough to cause feedback in fact, as he welcomed the small crowd of extended family and pajama-clad neighbours who had gathered to watch this affair. ", "He wore pink pants and flapper-style black and white shoes all topped with a red and black silk jacket that shimmered when he moved. ", "I kept expecting him to pull interlocking colourful scarves out of his sleeves.", "\n\nWe only had ten minutes to get changed into our formal wear and I remember feeling that it was similar to changing clothes backstage between scenes in a musical. ", "Quick and efficient, I was even helped into my nylons by my mother-in-law like she was “crew” and I was the female lead.", "\n\nThen, back in the courtyard, we were corralled to the far end of the red carpet—Guo Jian and I, our friends Valentina and Liyang (our equivalent to best man and maid of honour) and then my friend Cheryl, who was there from Canada to stand up for me as my queer witness.", "\n\nWhen the two confetti machines burst like shotguns I almost hit the ground. ", "I hadn’t known that was coming. ", "The colourful twisted paper fell swirling around as I recovered my surprise. ", "Someone handed us a red fabric bow (or knot?) ", "to which we each held an end linking us together like a parade banner and then we were cued to slowly make our way to the end of the red carpet. ", "Our friends trailed us ceremoniously. ", "I don’t even remember if there was music. ", "At the end of the carpet, there sat both sets of parents with the ridiculously loud MC standing off to one side.", "\n\nThe parents were seated in chairs with a table between them. ", "On the table were some flowers, some seeds on plates, and then a traditional Chinese tea set. ", "My mom and dad looked surprised. ", "I had warned them that there’d be a tea ceremony, but they had no idea what they were expected to do and I think they were nervous. ", "What’s more, they had been told to dress casually and my mom told me later that she was so upset to have worn “slacks” (who calls them that anymore?), ", "especially when the cameras started flashing in every direction. ", "She still mentions that when she sees those pictures. (", "It’s okay mom!)", "\n\nThe ceremony began with a showing of our marriage licenses to the camera and crowd.", "\n\nThe next section is characterized by bowing. ", "It became the common thread in each of the next steps.", "\n\nFirst we were told to bow to each other, then bow towards each other and touch noses (I have no idea what that’s about!) ", "and then bow towards each other and, yes, finally, to kiss. ", "It was so strange to kiss at a bowing angle, I have to say. ", "Our midriffs were five feet apart, our heads with chins jutted outwards like birds were only able to find each other’s faces briefly to land a quick peck before having to save ourselves from falling over!", "\n\nIt’s a an old tradition to honour both sets of the parents by bowing down to them as authority figures and elders. ", "Then there was the bowing to the four directions.", "\n\nThen there was the bowing to the crowd.", "\n\nThen there was more bowing to each other.", "\n\nBowing. ", "I’m not big on it. ", "I don’t really believe in bowing down to anyone, to be honest. ", "I did it out of respect for his culture in the moment, but I vowed then and there to never bow down to his culture in my overall life. ", "In fact, it was that tiny pact in my head that enabled me to do it at all. ", "Sometimes we get through these moments in silent negotiation with ourselves. ", "My inner voices had already had the peace talks.", "\n\nThe only thing I hadn’t thought about with this portion of the day was my dress. ", "It was fairly fitted. ", "Okay, it was tight. ", "I mean, dangerously so. ", "As I got down on my knees and bowed forward to both sets of parents, I pleaded with the universe to keep my dress from splitting at the seams. ", "Mercifully, the universe granted my wish.", "\n\nPhew.", "\n\nThen, I had to say, “mama (mom) and baba (dad), please drink this tea” (in Chinese) to his parents as I served them a cup each. ", "He had to say and do the same with my parents and he stumbled in English much to everyone’s glee. ", "Everyone clapped, even the man in his plaid flannel pj’s whom I’d never met before and who mustn’t have ever seen a real live foreigner before because he wouldn’t stop staring at me with the open-faced, unabashed curiosity of a four-year old.", "\n\nThe outdoor portion of the morning ceremony was pretty much complete then. ", "The MC bellowed voraciously as though he needed to fill all pockets of audio space with his voice first, for a while, and he did so with a lot of formal language and gusto that I couldn’t understand because of the crackling speakers anyway. ", "That was only our first taste of him. ", "He would be a repeat character in the afternoon at the banquet. ", "Great.", "\n\nThen the formal photos began. ", "We posed in group shot after group shot.", "\n\nRemember, I hadn’t slept a wink. ", "Neither had Guo Jian. ", "The photos show me straining to stay awake and keep my eyes and smile from drooping.", "\n\nThen we all headed upstairs. ", "Guo Jian carried me over the door frame to his parent’s apartment as per tradition. ", "I had been there before, of course. ", "The crowd that had beat us up there cheered. ", "And like herding sheep, we were barked into the “marriage bedroom,” his parent’s spare room that we’d barely ever slept in, and then I was told to wait on the edge of the bed until the auspicious moment when the noodles would be brought out.", "\n\nYes, I said noodles.", "\n\n(The noodle portion is a whole other blog.)", "\n\nAs we waited for 6:36 in the morning to roll around—the fated hour—it was all I could do not to fall backwards onto the bed and disappear into a dream state.", "\n\nThe flashing cameras kept me awake.", "\n\nThat and the fact that I really couldn’t move that much in my dress!" ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00009611687812379854, 0, 0, 0, 0, 0.00006944444444444444, 0.000013616372326084883, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00017777777777777779, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Q:\n\njQuery with Selenium form validation\n\nI am trying to validate my form using Selenium ID but it's not passing the first name. ", "I need it to only accept first name in letters no numbers. ", " Below is the code:\nfunction validateFrName(){\n\n if (frName.val() == \"1\"){\n frName.addClass(\"error\");\n $(\"#firstNameErrorMsg\").text(\"First name can only contain letters.\");", "\n $(\"#firstNameErrorMsg\").addClass(\"error\");\n return false;\n\n } else if (frName.val().length <3){\n frName.addClass(\"error\");\n $(\"#firstNameErrorMsg\").text(\"Please enter your first name.\");", "\n $(\"#firstNameErrorMsg\").addClass(\"error\");\n return false;\n }else{\n frName.removeClass(\"error\");\n $(\"#firstNameErrorMsg\").text(\"OK\");\n $(\"#firstNameErrorMsg\").removeClass(\"error\");\n return true;\n }\n}\n\nA:\n\nSee this jsFiddle http://jsfiddle.net/vHzKn/1/\nThe problem is with how you are grabbing the frName.", "\nI have added a variable called firstName and assigned it the value of the textbox with the id of frName\nvar firstName = $(\"#frName\").val();\n\nI then validate based on the firstName variable.", "\nPlease note that the code sample in the jsfiddle doesn't find all numbers etc... that is a separate question. ", "You should probably use a javascript validation library for that.", "\nEDIT: Look at Check whether an input string contains number to find a regex to determine if a number exists in a string.", "\nSee this super simple jsfiddle with a jquery example: http://jsfiddle.net/XCYL7/\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0.000016050205041369406, 0, 0, 0, 0, 0.0001451589490492089 ]

[ "O conteúdo visual de uma marca são os principais valores que transmitidos para o público, é importante compreender o que é realmente o Branding, e quais são as diferenças entre Logotipo x Branding.", "\n\nPor que um dos aspectos mais importantes é o Logotipo?", "\n\nQuando visualizamos um logotipo, qual é a primeira coisa que vem à mente?", "\n\nAtravés do logotipo as marcas são representadas. ", "Como exemplo – a marca Nike, os arcos dourados do McDonald’s (M) ou a sereia verde da Starbucks.", "\n\nA seguir o Logotipo da Nike: E as diferenças entre um logotipo e uma marca.", "\n\nO logotipo se chama Swoosh. ", "Por mais que pareça um sinal de “correto”, é a representação da asa na estátua da deusa grega da vitória, cujo nome é Nike.", "\n\nA marca da Nike conecta com seus clientes – entre comerciais, patrocínios de celebridades esportivas, embalagens de produtos, design de lojas, colocação de produtos na TV e em filmes, patrocínios, gráficos na loja, hang-tags, a música em seus vídeos, o design do site, anúncios impressos, fotografias de produtos, entre outros.", "\n\nA Nike diz que sua missão é “levar inspiração e inovação para todos os atletas do mundo”, e diz que “se você tem um corpo, você é um atleta”\n\nA Maçã Mordida\n\nA Marca Apple é representada por uma “maça mordida”. ", "Com o logo criado, a agência fez todo o processo de estratégia de Branding para uma posição de destaque no mercado global.", "\n\nOs produtos da Apple sempre são baseados em criatividade e expressão, e pensados no que será melhor para os consumidores, e no que eles tem preferência, antes mesmo deles próprios saberem disso conscientemente. ", "E Qualquer que seja a novidade lançada pela Apple, os consumidores confiam. ", "Incrível não é mesmo?", "\n\nVenda felicidade: Coca-Cola\n\nAs marcas criam relacionamentos com os consumidores, através de experiências e comunicação. ", "E dão enfase em construir relacionamentos emocionais com os consumidores porque isso é um marketing poderoso e funciona.", "\n\nA Coca-Cola leva essa mensagem para todos os pontos de contato com o cliente, desde a fanpage no Facebook até as máquinas de venda,\n\nVeja relacionados:\n\nE o que é , qual a importância do Branding?", "\n\nBranding: É o processo ativo de moldar as percepções que os consumidores têm sobre sua empresa. ", "São todos os passos que você toma para construir consciência e reputação em torno da sua empresa, sobre seus produtos ou serviços.", "\n\nResumidamente: Branding é o processo de estruturação de uma marca;\n\nPortanto, é importante definir a lógica sobre sua empresa, mas antes considere algumas perguntas a si mesmo. ", "Qual é o impacto que você quer causar em seus clientes ?", "\n\nQual é o objetivo da sua marca? ", "Entre outras, que deve orientar seus passos ao tomar a decisão para construir sua marca.", "\n\nNo entanto, é muito importante que o design do seu logotipo esteja conectado com parte da comunicação perante ao público, e o conjunto de composições gráficas.", "\n\nMas o que é exatamente a marca?", "\n\nEmbora um logotipo seja importante para uma empresa, uma marca inclui todos os pontos de contato que seus clientes têm com sua empresa. ", "É um conjunto de percepções, ideias e sentimentos distintos que as pessoas têm sobre a sua empresa, que a diferencia das alternativas.", "\n\nE qual a importância da marca? ", "Seus clientes não conhecem sua empresa apenas na forma de um logotipo flutuando pela web. ", "Eles identificam sua marca através de seu site, ou seu produto, serviço, sua embalagem do produto, seus comerciais.", "\n\nSua marca é o sobre o que as pessoas pensam de você. “", "Uma marca não é mais o que dizemos ao consumidor – é o que os consumidores dizem uns aos outros.”", "\n\nVeja também: DG ESSENTIAL – Para Designer’s iniciantes\n\nSobre a Identidade da Marca:\n\nIdentidade de marca : é uma coleção de expressões tangíveis de sua empresa, como seu logotipo, cores, tipografias e voz.", "\n\nEntão, ao criar a identidade de marca para sua empresa , veja se cada elemento está em sintonia de comunicação para a percepção que deseja transmitir em seus clientes.", "\n\nPor fim Logotipo x Branding –\n\n‘ Branding ‘. ", "Resumidamente, podemos dizer que são todos os aspectos do que compõe uma marca em integração ao design. ", "Logotipo – Fontes – Esquemas de cores – manual estilo da marca.", "\n\nE entre outros aspectos. ", "Isso é exclusivo para cada projeto, mas pode incluir itens publicitários como: tags, sinalização, site, tipo de papel e acabamentos, uniformes, outdoors, embalagens de produtos etc. ", "Profissional em Design de Logotipos\n\nE aí você já sabia da diferencia do logotipo x branding, e seu o potencial ? ", "Tem alguma experiência interessante sobre o tema que deseja compartilhar conosco? ", "Então deixe o seu comentário e compartilhe ..e ative o sininho para receber novos conteúdos em primeira mão.", "\n\nPronto para começar seu projeto e carreira de Design Profissional?", "\n\nTorne-se um especialista qualificado em Logotipos – Saiba Mais:(DESIGN de Logotipos Profissional) em Parceria com o Go_Marketing_Design" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.000051534437888118735, 0.00031887755102040814, 0.00035555555555555557, 0, 0.0003255208333333333, 0.000168662506324844, 0, 0.0001321964439156587, 0.00001847728679520699, 0.00002204148206925434, 0, 0.00008816592827701735, 0.00034626038781163435, 0, 0.0001321964439156587, 0, 0.00007652280379553107, 0, 0.0000591715976331361, 0.00009363003651571424, 0, 0, 0, 0.000038578758535550326, 0, 0, 0, 0.0009182736455463728, 0, 0.00007561436672967865, 0, 0.00010628122010840684, 0.00002311390532544379, 0, 0, 0.00009245562130177516, 0, 0, 0.00006037918125830214, 0, 0, 0.00008573388203017832, 0.00021626297577854672, 0 ]

[ "Postsynthetic substitution reactions, including galvanic replacement and cation exchange, applied to colloidal nanocrystals,^[@ref1]−[@ref14]^ represent a simple and versatile tool to achieve nanoarchitectures not readily accomplishable by other methods. ", "The galvanic replacement is predominantly applied to form noble metal nanocrystals, such as Au nanocages and nanoboxes, by reacting solutions of appropriate salts with nanocrystals as \"nanotemplates\".^[@ref1]−[@ref7]^ The cation exchange is a similar process, however, usually applied to compound semiconductors.^[@ref8]−[@ref14]^ By cation exchange procedures, e.g., nanorod superlattices of regularly spaced Ag~2~S quantum dots in CdS colloidal quantum rods,^[@ref9]^ nonepitaxial hybrid nanostructures with gold nanoparticle cores and CdS shells,^[@ref15]^ or branched nanocrystals with either CdSe or Cu~2-*x*~Se central cores and Cu~2~S pods,^[@ref16]^ have been demonstrated. ", "In contrast to the galvanic replacement where often substantial morphology changes are observed (e.g., hollow structures are obtained from solid nanoparticles)^[@ref3],[@ref4]^ during cation exchange the nanocrystal shape is nearly preserved.^[@ref12],[@ref14],[@ref16]^ The latter is caused by an anionic framework conservation, which might result from the larger ionic size of the anions in the lattice, causing their lower diffusion velocity as compared to that of the cations.^[@ref17]^ As will be discussed below, also the coordinating solvent applied during cation exchange might contribute to the anionic framework conservation. ", "Cation exchange reactions have been applied also to improve the properties of semiconductor nanocrystals. ", "Treating PbX (X = S, Se, Te) with Cd^2+^ ions results, e.g., in the formation of protective CdX shells, causing a significant increase of the photoluminescence quantum yield of these materials.^[@ref18],[@ref19]^\n\nWhile the high potential for tailoring of material properties by the cation exchange treatment has been demonstrated for ionic semiconductors (primarily chalcogenides),^[@ref8]−[@ref20]^ here it is applied to ionic magnetic oxide materials. ", "In particular, ferrite-based single component nanocrystals and multicomponent core/shell nanocrystal hererostructures were chosen as starting materials for the cation exchange treatments (Figure [1](#fig1){ref-type=\"fig\"}), because of their high potential in biomedical sciences^[@ref21]−[@ref31]^ and their highly reproducible synthesis by facile solution-phase thermolysis routes.^[@ref32]−[@ref35]^ Synthesizing them as nanoheterostructures allows obtaining physical properties which are unreachable in bulk materials.^[@ref36]^ Two examples for such nanoheterostructures with properties not reachable in bulk are presented in the following to demonstrate the cation exchange procedure. ", "The first example are nanoheterostructures combining ferrites with coinage metals (Figure [1](#fig1){ref-type=\"fig\"}b) exhibiting combined plasmonic and magnetic properties.^[@ref37]−[@ref39]^ The second example are core/shell nanocrystals combining magnetic materials of different magnetic phases (Figure [1](#fig1){ref-type=\"fig\"}c), showing pronounced exchange bias effects.^[@ref40]−[@ref43]^ The latter can be used to overcome some fundamental limitations of nanomaterials such as the superparamagnetic limit for a given nanocrystal size^[@ref41]^ and are essential for the operation of magneto-electronic devices such as spin valves and magnetic tunnel junctions.^[@ref44]^\n\n{#fig1}\n\nThe structural similarity between Fe~3~O~4~, more precisely written as Fe^II^Fe^III^~2~O~4~, to metal-doped spinel-type ferrites, M^II^Fe^III^~2~O~4~ (M abbreviates the transition metals Co, Ni, or Mn), allows the magnetic engineering of iron oxide nanocrystals by replacing the Fe^2+^ by M^2+^.^[@ref26],[@ref32],[@ref45]^ While uniform M^II^Fe^III^~2~O~4~ nanocrystals are usually synthesized from mixtures of appropriate precursors,^[@ref26],[@ref32],[@ref45]^ synthesizing core/shell structures with M^II^Fe^III^~2~O~4~ shells covering either noble metal seeds or cores of other magnetic metal oxides is hardly achievable by conventional seeded-growth methods. ", "For such cases the cation exchange procedure offers an elegant way to obtain the desired morphologies and magnetic doping levels by a simple post synthetic treatment, as is shown below. ", "Applied to Fe~3~O~4~, the cation exchange is especially attractive when it is performed with Co^2+^, because even though the mass magnetization of CoFe~2~O~4~ is almost identical to that of pure magnetite, several other important parameters such as the coercivity and the magnetic blocking temperature are significantly increased, due to the higher spin--orbit coupling.^[@ref46]^ Thus, even small compositional modifications due to the cation exchange can be sensitively traced by inspecting the magnetic properties of the nanocrystals. ", "While here the Fe^2+^ is replaced by Co^2+^ the same procedure can be easily expanded to further transition metals, in order to fine-tune the nanocrystals magnetic properties, and optimize them for different requirements of potential applications, including magnetic hyperthermia,^[@ref27]^ or spin-electronic device developments,^[@ref44]^ or for the rapidly increasing research field of magnonics.^[@ref47]^\n\nTo perform the Fe^2+^ to Co^2+^ cation exchange the nanocrystals, stabilized by oleic acid (OA), are treated by the following procedure: 1.2 g of CoCl~2~ are dispersed in 28 mL of oleylamine. ", "This mixture is degassed under vacuum and heated to 120 °C for 20 min to completely dissolve the CoCl~2~. After cooling the solution down to room temperature in an argon atmosphere, 20 mg of nanocrystals dispersed in 0.5 mL of chloroform are added to the mixture, which is then degassed under vacuum again and heated for 20 min to 100 °C to remove the chloroform, before 1.5 mL trioctylphosphine (TOP) is injected under Ar atmosphere. ", "The reaction is taking place at temperatures between 200 and 220 °C, and the Co content in the final nanocrystals can be controlled by both, reaction temperature and time, which was varied between 5 and 80 min. ", "This procedure results in a cation exchange reaction which greatly preserves the nanocrystals core/shell structures, sizes and shapes (Figure S1--S3, [Supporting Information](#notes-1){ref-type=\"notes\"} show examples of Fe~3~O~4~ nanocrystals after the cation exchange process). ", "Significant morphological changes are observed, however, when the reaction temperature increases above 220 °C, because the nanocrystals start to dissolve and to form aggregates of much smaller nanocrystals, or when the treatment time exceeds 80 min (Figures S3, [Supporting Information](#notes-1){ref-type=\"notes\"}). ", "Also the addition of TOP was found to be of crucial importance, because in its absence at the reaction temperature the nanocrystals undergo fast digestive ripening leading to amorphous and small polydisperse nanoparticles (Figure S4, [Supporting Information](#notes-1){ref-type=\"notes\"}). ", "Because of the high affinity of Co^2+^ and Fe^2+^ to oleylamine^[@ref48]^ not only the soluble salts are nicely dissolved but also insoluble compounds like iron oxide can be etched by solvation of Fe^2+^ with oleylamine at high temperature. ", "In contrast, TOP has a significantly lower affinity to Fe^2+^ and Co^2+^.^[@ref48]^ Thus, addition of TOP ligands to the oleylamine dispersion influences the equilibrium between solvated Fe^2+^ or Co^2+^ ions and cobalt/iron in the lattice. ", "As was shown before for the case of cation exchange in CdSe nanocrystals treated by Pd^2+^, and Pt^4+^ also in the present case by changing the solvent environment the thermodynamics of cation solvation is modified.^[@ref49]^ Another plausible effect of TOP may be related to its strongly reductive power and the ability to scavenge the traces of oxygen, thus protecting the Fe^2+^ ions in the lattice. ", "It should be noted that in contrast to the cations Co^2+^ and Fe^2+^ the anion O^2-^ does not react with oleylamine, because both, the O^2-^ and the olylamine represent bases according to the theory of Pearson.^[@ref50]^ This might be another important reason why the anion framework is preserved during the cation exchange process.", "\n\nThe cation exchange is stopped by cooling down the nanocrystal solution. ", "Chloroform is added to the solution and the nanocrystals are aggregated by ethanol together with acetone for the washing procedure. ", "Few drops of OA are added to improve the colloidal stability in the chloroform solvent. ", "The whole washing procedure is repeated 6 times and finished by filtration. ", "This procedure removes the CoCl~2~ and aggregates of other byproducts from the nanocrystal solution, to allow accurate determination of the Co content in the nanocrystals, probed by (i) EDX on relatively thick nanocrystal films, (ii) by Rutherford backsattering spectrometry (RBS) performed on nanocrystal (sub)monolayers, and (iii) by atomic absorption spectroscopy (AAS) performed from nanocrystals which are completely dissolved in acidic solutions. ", "The Co concentrations are deduced from all three methods, and for the presented samples the scatter between the data is less than ±1%.", "\n\nTo facilitate a comparison between the results of the three nanocrystal systems under investigation (Figures [1](#fig1){ref-type=\"fig\"} and S1 ([Supporting Information](#notes-1){ref-type=\"notes\"})), we have chosen in all cases spherically shaped nanocrystals with mean diameters close to 20 nm. ", "The first system represents homogeneous magnetite nanocrystals with a mean diameter of 21 nm (Figures [1](#fig1){ref-type=\"fig\"}a, S1a, S2, and S3 ([Supporting Information](#notes-1){ref-type=\"notes\"})), synthesized by thermal decomposition of iron-oleate in the presence of oleic acid.^[@ref33]^ In this case the cation exchange results in a rather homogeneous Co alloying of the nanocrystals, by replacing a part of the Fe^2+^, residing on the octahedral sites of the inverse spinel structure of magnetite, by Co^2+^ (sketched in Figure [1](#fig1){ref-type=\"fig\"}d). ", "This scenario is confirmed by the energy dispersive X-ray (EDX) analysis, performed after cation exchange by scanning transmission electron microscopy (STEM). ", "The EDX line profile in Figure [1](#fig1){ref-type=\"fig\"}e shows an almost as smooth Co distribution across the nanocrystal as is also found for Fe. ", "After 30 min of reaction with CoCl~2~ at 220 °C in this sample a Co content of 8% is detected, e.g., in the RBS spectrum in Figure [2](#fig2){ref-type=\"fig\"}a by the appearance of a distinct Co peak on the right-hand side of the Fe peak. ", "TEM images confirm that the size and shape of the nanocrystals is almost preserved (Figure [2](#fig2){ref-type=\"fig\"}b,c; the inset in Figure [2](#fig2){ref-type=\"fig\"}d shows the nanocrystals after Co exchange and a direct comparison of the nanocrystals before and after treatment is given in Figure S2, [Supporting Information](#notes-1){ref-type=\"notes\"}). ", "While the Co alloying causes only subtle effects with respect to nanocrystal morphology, it is greatly affecting their magnetic properties. ", "The magnetic response changes because of strong spin--orbit couplings at the Co^2+^ sites and the concomitant increase of the magnetic anisotropy. ", "The latter has a direct effect on the temperature dependence of the zero-field-cooling magnetization, showing the typical behavior of magnetic nanocrystals (Figure [2](#fig2){ref-type=\"fig\"}d). ", "At low temperature the magnetic moments of the individual nanocrystals, resulting from the ferromagnetically coupled M^2+^ ion spins (the magnetic moments of the Fe^3+^ ions are antiferromagnetically coupled in ferrites and thus do not contribute to the magnetization), are blocked and are pointing randomly into all directions, so that the total magnetization of the sample is zero. ", "With increasing temperature the sample magnetization, given here per weight of the magnetic ions (Fe and Co), increases and at high temperatures the thermal energy of the nanocrystals overcomes the magnetic anisotropic energy barrier between different magnetic easy axes and between the spin up and spin down direction within the same easy axis, respectively. ", "As a consequence the magnetization typically shows a superparamagnetic behavior with a 1/*T* dependence of the sample magnetization (for the present sample the 1/T dependence can be expected to occur well above 300 K, whereas for the nanocrystals described in the next paragraph it is clearly displayed in Figure [3](#fig3){ref-type=\"fig\"}a). ", "Thus, the magnetization as a function of temperature exhibits a maximum at the so defined blocking temperature *T*~B~. For the Fe~3~O~4~ nanocrystals with a size of 21 nm this blocking temperature is found at 250 K, whereas the Co treatment increases *T*~B~ by 60 to 310 K. This causes also an opening of the hysteresis loop close to room temperature, which is observed after cation exchange but is completely absent for the initial Fe~3~O~4~ nanocrystals (inset in Figure [2](#fig2){ref-type=\"fig\"}e). ", "From the opening of the hysteresis loops the values of the coercivity field, *H*~C,~ and remanent magnetization, *M*~R~, are measured at zero magnetization and zero external field, respectively (indicated in the inset of Figure [2](#fig2){ref-type=\"fig\"}e). ", "Both values are strongly temperature dependent, and at all temperatures, *H*~C~ is at least twice as high after the Co treatment (Figure [2](#fig2){ref-type=\"fig\"}e, the corresponding hysteresis data before and after Co^2+^ treatment are shown in Figure S5, [Supporting Information](#notes-1){ref-type=\"notes\"}). ", "Thus, the Co treatment results in an overall increase of coercivity, remanence and blocking temperature, due to an increased magneto-crystalline anisotropy. ", "The latter is directly probed by measuring the relaxation of the nanocrystals magnetic moment, after aligning them by an external magnetic field.^[@ref51]^ If the nanoparticles are immobilized, magnetorelaxometry experiments provide a purely Neél relaxation time τ~N~ due to flipping of the magnetic moments within the nanocrystals caused by thermal activation. ", "The flipping time is exponentially proportional to the magnetocrystalline anisotropy energy.^[@ref51]^ After Co^2+^ treatment of the nanocrystals, room temperature flux gate magnetometry detects an increase in τ~N~ (Figure S6, [Supporting Information](#notes-1){ref-type=\"notes\"}). ", "An even more significant increase of τ~N~ due to the Co^2+^ treatment of magnetite nanocrystals is observed for smaller nanocrystal sizes (Figure S6b, [Supporting Information](#notes-1){ref-type=\"notes\"}). ", "In Figure S7 ([Supporting Information](#notes-1){ref-type=\"notes\"}), the results for 9 nm large nanocrystals are summarized, showing also an increase of *T*~B~ from 150 to 206 K and an increase of the coercivity by a factor of 5.7. ", "It should be noted that these observed modifications of the magnetic properties are solely due to the exchange of the Fe^2+^ to the Co^2+^ ions and not due to different states of nanocrystal aggregation. ", "The latter is ruled out by concentration dependent magnetization measurements, showing almost no dependence of the normalized magnetization versus temperature, at least when the dilution of nanocrystals is performed in a good solvent (Figure S8, [Supporting Information](#notes-1){ref-type=\"notes\"}).", "\n\n{ref-type=\"notes\"}), before (b) and after Co treatment (c), are almost identical. (", "d) Zero field cooled magnetization data, measured at an applied field of 100 Oe, evidence an increase of the blocking temperature *T*~B~ upon Co^2+^ treatment, as is indicated by the arrows. ", "Inset: TEM image of the nanocrystals after Co^2+^ treatment. (", "e) Temperature dependent coercivity field, extracted from the data shown in Figure S5, [Supporting Information](#notes-1){ref-type=\"notes\"}. ", "The inset shows exemplarily the 260 K hysteresis loops, exhibiting an opening after Co^2+^ treatment while being absent before the treatment. *", "M*~R~ and *H*~C~ are indicated for the hysteresis loop obtained after Co treatment.](nl-2012-04115r_0006){#fig2}\n\nThe second system investigated here represents a nanoheterostructure, formed by a gold core and a relatively uniform magnetite shell (Figures [1](#fig1){ref-type=\"fig\"}b, S1b, and S9 ([Supporting Information](#notes-1){ref-type=\"notes\"})). ", "Such magnetic--plasmonic core shell nanoparticles have attracted great interest because the localized surface plasmon of the gold cores provide an optical addressability for tracking or monitoring of the magnetic nanoparticles.^[@ref38]^ The gold/Fe~3~O~4~ core/shell nanocrystals are grown by decomposition of iron pentacarbonyl on gold seed nanocrystals, and subsequent in situ oxidation of the iron shell into Fe~3~O~4.~^[@ref39]^ The shortcoming of these core/shell nanocrystals is the relatively small magnetic moment observed at room temperature due to their limited shell thickness and their small magnetic blocking temperature.^[@ref39]^ Applying the Fe^2+^ to Co^2+^ cation exchange to these nanocrystals improves both of these parameters, *T*~B~ from 68 K to about 110 K and the room temperature magnetization from 0.62 emu/g to 1.08 emu/g (at a field of 100 Oe, Figure [3](#fig3){ref-type=\"fig\"}a). ", "These improvements, together with an increase of the coercivity at low temperatures (inset in Figure [3](#fig3){ref-type=\"fig\"}a), is obtained here by doping of the nanocrystal shell by 11% of Co, as is deduced also by RBS (Figure S9, [Supporting Information](#notes-1){ref-type=\"notes\"}). ", "Because of the high chemical stability of the gold core, it is not affected by any treatments with Co^2+^ precursors (Figure [1](#fig1){ref-type=\"fig\"}d,f). ", "Thus, the optical properties of the nanoheterostrucures, dominated by the plasmonic feature of the gold nanocrystal core, are almost preserved. ", "As shown in Figure [3](#fig3){ref-type=\"fig\"}b, the plasmon resonance found at 553 nm before Co^2+^ treatment, shifts only by 33 nm due to a change of the dielectric function of the nanocrystal shells. ", "While the inert gold core is unaffected by the Co treatment, the shell becomes more polycrystalline during the cation exchange process (Figures [3](#fig3){ref-type=\"fig\"}c and S9 ([Supporting Information](#notes-1){ref-type=\"notes\"})), which is important because defects in the lattice structure facilitate cation diffusion from the nanocrystals surfaces to their interior.^[@ref20],[@ref52]^ That such a diffusion is indeed taking place is not only evidenced by the EDX line scans shown in Figure [1](#fig1){ref-type=\"fig\"}e,f but is confirmed also by the following experiments performed on FeO/CoFe~2~O~4~ core/shell nanocrystals.", "\n\n{#fig3}\n\nThe situation is completely different in the third system, which are magnetic heterostructure nanocrystals combining antiferromagnetic (AFM) and ferrimagnetic components. ", "This combination is of special interest because it provides a set of unique magnetic properties by exchange coupling via the heterostructures interface,^[@ref40]−[@ref43]^ These exchange bias effects are important for giant magnetoresistance devices or spin valves,^[@ref58]^ which are applied e. g., in magnetic-random access memories (MRAMS) or in the read heads of hard discs. ", "The present samples are spherical core/shell nanocrystals with FeO (Wüstite) in the center and CoFe~2~O~4~ shells (Figure [1](#fig1){ref-type=\"fig\"}c).^[@ref43]^ These nanocrystals exhibit a cubic NaCl crystal structure in the core, while the shell is formed by an inverse spinel structure. ", "Interestingly, these nanocrystals are grown by thermolysis of a mixture of iron- and cobalt oleate, which initially was expected to result in homogeneously Co-doped magnetite nanocrystals as those shown above, obtained by the cation exchange treatment of Fe~3~O~4~ nanocrystals. ", "The hysteresis loops of these FeO/CoFe~2~O~4~ exhibit in particular very pronounced effects due to the exchange coupling, primarily anomalously large vertical shifts, VS, but dependent on temperature also increased coercivity (Figure [4](#fig4){ref-type=\"fig\"}a). ", "These VSs are observed, when prior to the measurements all magnetic moments in the samples are aligned at high temperatures by an applied external field, which is maintained during cooling down. ", "After cooling the samples, the hysteresis loops are measured by varying and reversing the external magnetic field. ", "The vertical shifts of the hysteresis loops observed after field cooling indicate that a part of the ferromagnetic spins, which are present in our samples in the CoFe~2~O~4~ shell, are pinned by exchange interactions via the interface to the spins of the antiferromagnetic FeO core, which does not reverse under reversal of the external magnetic field.^[@ref43]^ VSs are observed when the *effective* Zeeman energy (difference between Zeemen energy and anisotropy energy) of the ferro- or ferrimagnetic material is smaller than the anisotropy energy of the antiferromagnetic material as well as smaller than the interface exchange energy.^[@ref53]^ In the present nanocrystals, this condition is fulfilled because of the large magnetic anisotropy present in CoFe~2~O~4~, which reduces the effective Zeeman energy in this material. ", "In the present sample at 5 K, the VS is very pronounced and it amounts to 60% of the maximum magnetization, *M*~max~, measured at an applied field of 1 T. This value is as high as the highest value reported for specially designed layered heterostructure systems.^[@ref54]^\n\n{#fig4}\n\nWhile the exchange bias effects are very pronounced at low temperatures, they are unfortunately limited to temperatures below 200 K, which is the Neél temperature of the FeO core (*T*~N~(FeO)), at which the AF to paramagnetic phase transition occurs. ", "To increase the maximum temperature where exchange bias effects can be found, which is mandatory because any application of these materials in devices such as spin valves requires this effect to be present at room temperature, the core material has to be modified. ", "One possibility is given by changing the core from FeO toward Fe~1-*x*~Co~*x*~O, because CoO has a Neél temperature close to room temperature.^[@ref55]^ This modification of the core is again performed by the cation exchange procedure. ", "In this case it hardly affects the CoFe~2~O~4~ shell, because it is already free of Fe^2+^ but predominantly affects the FeO core material. ", "Indeed, after the cation-exchange treatment a rather uniform distribution of Co across the nanocrystal diameter is found (Figure [1](#fig1){ref-type=\"fig\"}g). ", "This indicates that in this case the Co^2+^ cation exchange converts the FeO to Co~*x*~Fe~1-*x*~O (sketched in Figure [1](#fig1){ref-type=\"fig\"}d).", "\n\nThe Co doping of the Wüstite cores is confirmed by the magnetic properties of the nanocrystals after the Co^2+^ treatment. ", "The hysteresis loops still show the characteristic features of exchange bias in the form of vertical loop shifts (Figure [4](#fig4){ref-type=\"fig\"}b). ", "At 5 K, the VS even increased to 78% of *M*~max~., which is the to the best of our knowledge the highest value ever reported for any system.^[@ref54]^ The value of the magnetization also increased, and the characteristic exchange bias effects are observed even above the Neél temperature of FeO (*T*~N~(FeO)). ", "For the starting material, the latter can be clearly identified by an abrupt increase of the temperature dependent magnetization, measured after sample cooling in zero field and applying during the measurement a small field of 100 Oe (Figure [5](#fig5){ref-type=\"fig\"}a). ", "This abrupt magnetization increase close to 190 K is caused by the AF to paramagnetic phase transition of the core material, since in the AF phase all magnetic moments are canceling each other, whereas in the paramagnetic phase they contribute to the magnetization, because the small external field aligns them into field direction. ", "The maximum of this curve, found close to 240 K corresponds to the superparamagnetic blocking temperature of the CoFe~2~O~4~ shell T~B~(CoFe~2~O~4~). ", "While *T*~N~ of the core and *T*~B~ of the shell are well resolved in the magnetization data of the initial material, the Co^2+^ treatment results in a shift of both parameters to higher temperatures. ", "While *T*~N~ cannot be clearly identified, (green and blue lines in Figure [5](#fig5){ref-type=\"fig\"}a) *T*~B~ still corresponds to the magnetization maximum. ", "For the sample with the highest averaged Co^2+^ content of 27% it is found at 323 K, well above room temperature. ", "Thus, the hysteresis loop of this sample shows a finite opening at 300 K, whereas initial nanocrystals show only a superparamagnetic behavior (inset in Figure [5](#fig5){ref-type=\"fig\"}b).", "\n\nTo obtain an estimate for the Neél temperature of the core after Co^2+^ treatment, a closer inspection of the exchange bias effects is required. ", "In the present sample, the exchange bias across the interface affects two parameters, the opening of the hysteresis loop (*H*~o~, indicated in Figure [4](#fig4){ref-type=\"fig\"}b) measured at the center of the loop, (which is eventually shifted in vertical direction), and the vertical shift of the loop (indicated in Figure [4](#fig4){ref-type=\"fig\"}a). ", "Also the hysteresis opening *H*~o~ shows a characteristic feature close to the Neél temperature. ", "For the initial material a peak is observed in *H*~o~ versus *T* close to *T*~N~ indicating an enhancement of the coercivity. ", "This enhancement is again caused by the exchange interaction via the interface, because close to *T*~N~ the anisotropy energy of the antiferromagnet becomes strongly reduced. ", "As soon as it is smaller than the exchange interaction across the interface, the antiferromagnetically aligned spins of the cores rotate coherently with the ferromagnetically aligned spins of the shells under field reversal,^[@ref53]^ thus enhancing the coercivity of the whole particles. ", "Above *T*~N~ the core is in the paramagnetic state and the hysteresis opening is solely caused by the anisotropy energy of the ferromagnetic shell. ", "After Co^2+^ treatment the opening of the hysteresis loop is increased at all temperatures, at the maximum of H~o~ versus temperature the opening amounts 5143 Oe, which is 18.8 times larger than for the initial material. ", "Similarly, the VS of the hysteresis loop increased by the Co^2+^ treatment at all temperatures. ", "At low temperature it increases from 6.97 to 43.51 emu/g (Figure [5](#fig5){ref-type=\"fig\"}c) and a finite vertical shift of the hysteresis loop is observed even up to room temperature (inset in Figure [5](#fig5){ref-type=\"fig\"}c). ", "Since the VS is a results solely from the exchange interaction between core and shell of different magnetic phases, its observation at room temperature confirms the presence of an antiferromagnetic phase at least for a part of the nanocrystal batch. ", "Thus, the Co^2+^ treatment shifted the AF phase transition temperature from 200 K, as observed for the initial material, to room temperature, which is only possible if the FeO cores of the nanocrystals have been changed to be rich of CoO. This fact evidence that the Fe^2+^ to Co^2+^ exchange can act quite efficiently even through an protective nanocrystal shell. ", "This result is also of interest, because the observation of exchange bias effects is also the precondition for any application of these materials in spin valve based devices.^[@ref58]^\n\n{#fig5}\n\nOverall, by the Co^2+^ treatment the Co content in the FeO/CoFe~2~O~4~ nanocrystals increased from 18% to 27%, as is evidenced by AAS and RBS (Figure S10, [Supporting Information](#notes-1){ref-type=\"notes\"}). ", "It changed, however, also the morphology of the nanocrystals. ", "From inspections of TEM images (Figure S11, [Supporting Information](#notes-1){ref-type=\"notes\"}) the morphological changes are hardly seen, because of the polydispersity of the core/shell dimensions. ", "However, the changes are clearly revealed by synchrotron X-ray diffraction, performed at beamline P02/Hasylab Hamburg with 60 keV X-ray photons. ", "The diffraction patterns shown in Figure [6](#fig6){ref-type=\"fig\"}a can be well fitted by assuming separate phases of CoFe~2~O~4~ and of Fe~1-*x*~Co~*x*~O~4~, by allowing the lattice parameters to vary with respect to that of bulk. ", "By zooming out the region around a momentum transfer of 2.5 Å^--1^ the effect of the Co^2+^ treatment can be monitored (Figure [6](#fig6){ref-type=\"fig\"}b). ", "Here the narrow peak at 2.53 Å^--1^ corresponds to the FeO core and that at 2.46 5 Å^--1^ to the CoFe~2~O~4~ shell. ", "For the core peak the Co^2+^ treatment results in a shift to larger diffraction angles, corresponding to a decrease of the lattice parameter, indicating the incorporation of Co into the cubic lattice of FeO (bulk FeO has a lattice parameter of 0.4332 nm while that of CoO is 0.4214 nm).^[@ref56],[@ref57]^ The second peak shows a much smaller peak shift, but a rather pronounced narrowing of its width, and an increase of its intensity, both indicating an increase of the dimensions of the CoFe~2~O~4~ shell. ", "From a fit of the data in Figure [6](#fig6){ref-type=\"fig\"}a the initial nanocrystals exhibit a core volume which is 41% of the nanocrystals total volume, whereas after the Co^2+^ treatment for 80 min the core volume shrinks to an average value of 8% (aliquots taken for shorter treatment times indicate that this shrink of the core and growth of shell is a continuous process). ", "This increase of the CoFe~2~O~4~ phase during Co exchange explains also the observed increase of the magnetic moment of the nanocrystals (Figure [4](#fig4){ref-type=\"fig\"} and [5](#fig5){ref-type=\"fig\"}) because the antiferromagnetic core does not contribute to the magnetization. ", "All these observations, however, confirm that the Co is able to diffuse into the nanocrystals sufficiently far to change the core composition from FeO toward Fe~1-*x*~Co~*x*~O, with increased Neél temperature. ", "The growth of the CoFe~2~O~4~ shell in expense of the core we attribute to a partial oxidation of the Fe^2+^ present in the Fe~1-*x*~Co~*x*~O core after cation exchange. ", "This process requires oxygen to diffuse through the shell to the core, which is facilitated by the cation exchange, producing defects in the shell acting as diffusion channels.^[@ref20],[@ref52]^ Thus, the oxidation takes place after the samples are exposed to the ambient after the cation exchange is finished. ", "Before the cation exchange process, these defect related diffusion channels were obviously absent, because the Fe~3~O~4~/FeO core/shell nanocrystals we found to have a stable morphology and composition for several years.", "\n\n{#fig6}\n\nIn conclusion, the cation exchange process is demonstrated here to be a valuable tool for tuning and improving the magnetic properties of different metal oxide based colloidal nanocrystals. ", "Demonstrated is an increase of the superparamagnetic blocking temperature, of magnetic remanence and coercivity as well as of various exchange bias effects, by replacing Fe^2+^ by Co^2+^, due to an enhancement of the magnetocrystalline anisotropy. ", "Outstanding are the demonstrated vertical shifts of the hysteresis loops in Co^2+^ treated core/shell nanocrystals, which amounts up to 78% of the saturation magnetization at low temperature, representing a substantially higher value than in any other system. ", "The sizes and shapes of the nanocrystals are almost preserved. ", "In homogeneous ferrite nanocrystals a rather homogeneous Co doping is achieved, whereas in nanocrystal heterostructures specific compounds of the nanocrystals can be selectively manipulated. ", "In gold/iron-oxide core/shell nanocrystals exclusively the shell is modified by the cation exchange, whereas in FeO/CoFe~2~O~4~ nanocrystals the core undergoes severe changes. ", "Thus, the cation exchange process enables to obtain novel nanoheterostructures with tunable magnetic properties, which are not achievable by direct synthesis. ", "While nanocrystal materials with exchange bias effects at room temperature are of primary interest for applications in spin-valves and magneto-ectronic nanodevices based on them, the Fe^2+^ to Co^2+^ cation exchange process demonstrated here for metal-oxides can be easily expanded to further transition metal ions, for designing optimized materials for a large range of applications.", "\n\nDetailed experimental methods and Figures S1--S11 (STEM and TEM images, hysteresis loops, magnetization relaxation, solvent dependent magnetization, and Rutherford backscattering data). ", "This material is available free of charge via the Internet at <http://pubs.acs.org>.", "\n\nSupplementary Material\n======================\n\n###### \n\nnl304115r_si_001.pdf\n\nThe authors declare no competing financial interest.", "\n\nWe thank Oleksandr Mykytiuk for his art work in Figure [1](#fig1){ref-type=\"fig\"} and the abstract graphics. ", "Financial support from the Austrian Science Fund FFG via the \"Austrian Nano Inititative\" (Project NSI-NanoShape II) and from the FWF (project SFB IRON) is acknowledged. ", "The work was also supported by two electron microscopy centers, at ETH Zurich (EMEZ) and at EMPA. ", "M.I.B. acknowledges financial support from Swiss SNF (Marie-Heim Vögtlin grant). ", "We thank the staff at beamline P02 at Petra III/Hasylab Hamburg (P. Walter and A.-C. Dippel) for assistance with the synchrotron experiments. ", "D.K. acknowledges financial support by the Austrian Academy of Science.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.00003075740099961553, 0.00002579957172710933, 0.000014833274000237331, 0, 0.000024151672503320856, 0.000010501995379122034, 0.000010718366349474479, 0, 0.0004938271604938272, 0.00008680555555555555, 0.00010973936899862826, 0.000013240590353788575, 0, 0.000010364699216428739, 0.00001925144867151253, 0, 0.00002246131039284832, 0, 0, 0, 0.00006886933764914516, 0.00006886933764914516, 0.00003078647119309891, 0.000027217302946726665, 0, 0.0000573921028466483, 0, 0, 0.000009746161230745241, 0, 0, 0.000012354792578476097, 0.00007911079466793244, 0.00009008603216071348, 0.0000706164818868724, 0.0000154320987654321, 0, 0.00004627701420704336, 0, 0, 0.00000771604938271605, 0, 0, 0, 0.00002041462095152548, 0, 0.000015262049387991818, 0.00002514964036014285, 0.00004712979545668771, 0, 0.00004805843906189927, 0, 0, 0, 0.0001220703125, 0, 0.00002684635829149776, 0.000027411529289219047, 0.0005202913631633714, 0, 0.000048902146804244705, 0.000007979826997350698, 0.000006037918125830214, 0.000023781212841854935, 0.000040569597143900364, 0, 0.000024507401235173024, 0.000012518025957378626, 0, 0.00031887755102040814, 0.000044444444444444447, 0.00012624668602449185, 0, 0.00035555555555555557, 0.000008964107712718276, 0.000020775623268698063, 0.000023618048912979298, 0, 0.000014348025711662075, 0, 0, 0.000005792391982750257, 0.000013127494223902542, 0.00011306461642828876, 0.000008939386489905198, 0, 0.000053863832232117214, 0.0000510204081632653, 0.00003955539733396622, 0.00009255402841408673, 0.000064, 0, 0.00003121748178980229, 0, 0.000009018027036045055, 0.000044444444444444447, 0.00002475186257765897, 0, 0.00007694675284702985, 0, 0.00009255402841408673, 0, 0.00010628122010840684, 0, 0, 0.000011973036721303624, 0, 0.00004094920251428104, 0.00010850694444444444, 0, 0, 0.00002251829611559392, 0.000028293345405160706, 0.000332409972299169, 0.000014133077053536095, 0, 0, 0.000148720999405116, 0.00007574445983379501, 0, 0.00002475186257765897, 0.0001426872770511296, 0.000018419937740610438, 0.000040569597143900364, 0.00014863258026159333, 0.00001929898371551754, 0.000006961800600107211, 0.000012664479933131545, 0.000022675736961451248, 0.00003460207612456747, 0.000020545693622616697, 0, 0, 0.0002295684113865932, 0.00030483158055174517, 0, 0.00007971938775510203, 0.00000970487475859124, 0.000032518210197710714, 0.000014792899408284025, 0, 0, 0, 0, 0.000013563368055555555, 0.00005658669081032141, 0.0001417233560090703, 0, 0.00008116224332440549, 0.00007002555932915514, 0.0002082465639316951, 0.00030483158055174517, 0.00009918666931164451, 0.00019837333862328903, 0 ]

[ "Comparison of two extraction methods for the determination of selective serotonin reuptake inhibitors in sewage sludge by hollow fiber liquid-phase microextraction.", "\nThis paper presents two procedures for the determination of four selective serotonin reuptake inhibitors (citalopram, paroxetine, fluoxetine, and sertraline) and one metabolite (norfluoxetine) in sewage sludge utilizing three-phase hollow fiber liquid-phase microextraction (HF-LPME). ", "First, direct HF-LPME was used for extraction, clean-up, and preconcentration. ", "The pharmaceuticals were extracted from slurry samples into an organic phase and then back-extracted into an aqueous phase in the lumen of the hollow fiber. ", "Second, a procedure combining pressurized hot water extraction and HF-LPME for clean-up and preconcentration was developed for the same analytes and matrix. ", "The extracts were subsequently analyzed by liquid chromatography-mass spectrometry. ", "For direct HF-LPME, limits of detection were between 1 and 12 ng g(-1) (dry weight) and the relative standard deviation (RSD) values were 3-12%. ", "For the second method, limits of detection were approximately 6 ng g(-1) for all the compounds and RSD values were 8-12%. ", "The methods were validated by comparison of results for the same samples. ", "Sewage sludge from a Swedish wastewater treatment plant was analyzed by both methods; average concentrations were similar for citalopram, paroxetine, and fluoxetine with values of approximately 530, 40, and 200 ng g(-1) , respectively." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0.000012225536701061176, 0.0001602307322544464, 0, 0.000040569597143900364, 0, 0.00004756242568370987, 0, 0, 0 ]

[ "Schools closing Taliban leader killed\n\nJALALABAD (Pajhwok): A Taliban commander, who ordered all schools closed in the Haskamina district of eastern Nangarhar province, has been killed in a US drone strike, an official said on Monday.", "\n\nThe commander had ordered closed 28 schools in the town over the past one week to put pressure on the government to release his detained brother.", "\n\nHowever, the commander named Aimal was killed last night in a US drone attack in the Gurguri area, 301st zone border police commander Mohammad Ayub Hussainkhel told Pajhwok Afghan News. ", "Aimal was killed along with three accomplices in the incident, he said.", "\n\nHussainkhel said the slain commander had few days ago invited tribal elders to warn them against sending their children to school.", "\n\n“Aimal was an active commander in the area and had been involved in direct engagements with security forces.”", "\n\nA resident of the district, Rabbani Shinwari, told Pajhwok Afghan News the slain Taliban commander had closed all schools in the district. ", "He said tribal elders had many times visited Aimal to allow the schools to be reopened, but he would instead threaten them.", "\n\nHe said intelligence officials had detained Aimal’s brother Abdul Khaliq and Aimal had threatened the government that he would not allow the schools to be reopened until his brother was released." ]

{ "pile_set_name": "Pile-CC" }

[ 0.00005478851632697786, 0, 0.00011317338162064282, 0, 0.0000573921028466483, 0, 0.0001508978421608571, 0.00006609822195782934, 0.00007730165683217811 ]

[ "The gunman who killed five police officers in Dallas has been unmasked as a pervert accused of stalking a female colleague when he was in the US Army.", "\n\nMicah Johnson, 25, shot dead the officers in a killing spree that began during a march by the campaign group Black Lives Matter, held to protest against the shooting of black people by police.", "\n\nNow it has emerged that in 2014, Johnson was sent home in disgrace from Afghanistan by the US military after a female soldier begged for protection from him. ", "Another colleague has revealed how the killer used to ‘steal girls’ panties’.", "\n\nScroll down for video\n\nDallas gunman Micah Johnson (left) sexually harassed female soldier Anna Ma (right) and was sent home in disgrace from Afghanistan\n\nJohnson, 25, shot dead five officers in a killing spree that began during a march by the campaign group Black Lives Matter\n\nAnna Ma, 25, accused Johnson of sexual harassment, according to a military lawyer who represented Johnson when he returned home in June 2014\n\nJohnson, a private in the American Army, was deployed to Afghanistan in November 2013 with the 420th Engineer Brigade.", "\n\nWhile he was there, his colleague Anna Ma, 25, accused him of sexual harassment, according to a military lawyer who represented Johnson when he returned home in June 2014.", "\n\nDallas-based Bradford Glendening said: ‘He made unwanted sexual advances towards her.", "\n\n‘It was all verbal. ", "He was bothering and harassing her.’", "\n\nAccording to legal documents, Anna begged for a ‘protective order against Johnson pertaining to myself, my family home and any other place of residence I may reside at’.", "\n\nWells Newsome, who served alongside Johnson in Afghanistan, wrote on Facebook: ‘We all knew he was a pervert cuz [sic] he got caught stealing girls’ panties, but murdering cops is a different story.’", "\n\nJohnson waived his right to a military court hearing in the wake of the allegations. ", "Despite the claims, he left the Army in April 2015 with an honourable discharge. ", "Glendening said: ‘Someone really screwed up – but to my client’s benefit.’", "\n\nThe shootings on Thursday night were feared to be the work of a group of armed radicals, but it now appears that Johnson was acting alone before he was cornered by police and killed by a bomb carried by a robot.", "\n\nAfter his military career, Johnson worked as a driver for a group providing hospital transport for mentally disabled people.", "\n\nBut privately, his festering hatred of white people had begun. ", "On Facebook, he identified himself as a ‘black nationalist’ and gave a black power salute.", "\n\nAnna begged for a ‘protective order against Johnson pertaining to myself, my family home and any other place of residence I may reside at’, according to legal documents\n\n‘He made unwanted sexual advances towards her. ", "It was all verbal. ", "He was bothering and harassing her’\n\nHe ‘liked’ several pages including the New Black Panther Party, the African American Defense League and the Nation of Islam. ", "He attended a gym called Academy of Combat Warrior Acts, which teaches martial arts and weapons classes.", "\n\nPolice raided Johnson’s home on Friday and found a cache of guns, a hand-written journal listing ‘combat tactics’, body armour and bomb-making equipment.", "\n\nLast night, Anna Ma declined to comment, saying: ‘You should focus on the victims and their families. ", "I’m not answering any questions.’", "\n\nGun stores across Dallas reported a sharp increase in trade yesterday. ", "One owner said business was up 20 per cent with customers including off-duty police officers.", "\n\nAnd there were fears of copycat attacks across America, with officers shot and wounded in Missouri, Georgia and Tennessee.", "\n\nJohnson, a private in the American Army, was deployed to Afghanistan in November 2013 with the 420th Engineer Brigade. ", "Right, a photo on Facebook showed him wearing a dashiki and raising his fist" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.000044444444444444447, 0.00002657030502710171, 0.0000390625, 0, 0.00002733351327896242, 0.00006682481873767917, 0.0001321178491214163, 0, 0, 0.00006839711364180432, 0.00004950372515531794, 0.0001321178491214163, 0.00015241579027587258, 0, 0.00002204148206925434, 0.00006298815822625346, 0, 0, 0.00004170054836221096, 0, 0.00011431184270690443, 0.00009245562130177516, 0.00004162330905306972, 0.00009245562130177516, 0, 0, 0, 0, 0.00020490403660952122, 0 ]

[ "In her new Hulu series I Love You, America, the comic will attempt to reach across the aisle and, hopefully, generate laughs in the process\n\nOne significant shift in political discourse over the last decade or so is the way conservatism has established something of a stranglehold over the notion of patriotism. ", "Issues ranging from terrorism, policing and even standing for the national anthem at football games have been framed in the same familiar way. ", "The message is that if you really love your country, you’ll support stricter immigration policies, stand in obeisance when you hear The Star-Spangled Banner, and offer unbridled support for law enforcement.", "\n\nBut the comic Sarah Silverman, with a new Hulu show aptly called I Love You, America, is out to prove that patriotism transcends partisanship. ", "The show, which premieres on 12 October, is being billed as a “social-politics sandwich”, stacked with the meaty perspectives of Americans across the ideological spectrum. ", "As Silverman explained recently, it’s not quite sketch comedy, not quite standup, and not quite a talkshow.", "\n\nAlways say the unsayable: life lessons from Sarah Silverman Read more\n\nInstead, it’s a kind of comic cross-country pilgrimage, reveling in awkward and often obstinate encounters between people who see eye-to-eye on practically nothing. ", "In one episode, Silverman, who is Jewish, will dine with a family who have never met a Jew. ", "In another, she’ll host Megan Phelps-Roper, a former member of the Westboro Baptist church. ", "The comic’s inclination to engage with those who disagree with and even offend her materialized in the wake of Donald Trump’s election. ", "As her sister, Susan, told the New York Times: “She was sobbing, beside herself, like her guts were coming out, but in that conversation, she said we have to start listening to each other and can’t go on like this in our own echo chambers.” ", "Silverman, generally sarcastic and idiosyncratic, seems ennobled by the country’s intense polarization, too. “", "You’ve never changed someone’s mind by arguing,” she added.", "\n\nThere’s no hiding Silverman’s own political allegiance, nor will she try to. ", "The comic was a vocal supporter of Bernie Sanders during the Democratic primary and went on to speak at the Democratic national convention, where Hillary Clinton accepted the party’s presidential nomination. ", "She has railed against discriminatory voter ID laws, advocated for more gun control, and tweeted angry, earnest missives in response to Donald Trump.", "\n\nUnlike other comedians who feel stifled by “political correctness”, Silverman – who was widely derided 16 years ago for using a racial slur to characterize Chinese people – now welcomes the challenge of making comedy that’s sensitive, smart and wary of the rules of contemporary discourse. “", "If you’re so scared of changing with the times, then you’re old,” she told the New York Times. “", "There are comedians I love to pieces who roll their eyes. ‘", "Oh, another word I can’t say.’ ", "You don’t know enough words?”", "\n\nI Love You, America comes with an official hymn, too, released on Monday ahead of the show’s premiere. ", "In it, Silverman’s sings the country’s praises and its pitfalls, offering something of a mission statement for her new project. “", "I love you America, from sea to shining sea, from the east coast to the west coast, and whatever’s in between,” she sings in top-to-bottom denim, parroting the “coastal elite” persona by which many entertainment figures are characterized.", "\n\nAfter listing all the ethnicities and religions she loves, Silverman pauses for some introspection: “Wait a minute, what am I doing? ", "I’m listing kinds of people. ", "I’m categorizing human beings and putting them into little individual boxes. ", "Whether I mean it or not, I’m part of the problem.”", "\n\nAcknowledging that is the first step to making formidable political commentary, even more so now, as people have zeroed in on the fault lines of progressive punditry, among them a tendency to revert to smugness. ", "But Silverman’s willingness to implicate herself in the country’s schisms doesn’t guarantee the show will be any good. ", "And despite her standup bona fides, on display in her Netflix comedy special Sarah Silverman: A Speck of Dust, Silverman knows the current television lineup is replete with comics discussing the state of the union, from Stephen Colbert to Samantha Bee and even Chelsea Handler, whose Netflix series – a similar mix of talkshow and travelogue – focuses less on celebrity fluff than it does Trumplandia.", "\n\n\n\nWhy can't rightwing comics break into US late-night TV? ", "Read more\n\nFor Silverman, I Love You, America will have to offer something considerably different if it hopes to spread optimism in an age of paranoia and helplessness. ", "She won’t be detailing the daily chaos of the administration, in the style of late-night comedy, nor will she offer any kind of prescription for the resistance. ", "As she told the Times: “I am interested in hearing about people’s feelings, and as corny and hippy-granola as it sounds, it is the root of everything.”", "\n\nWhile she may be right about that, one wonders if viewers, too, are interested in how people feel. ", "It seems like every week we get a new gonzo-style piece about the “flyover” state Trump voter, and most merely recycle their sentiments of isolation, economic displacement and animus towards the DC “swamp”. ", "For liberals, too, there’s no shortage of outlets for catharsis and advocacy. ", "In short, contemporary politics is all feeling; what it lacks is empathy. ", "Thus, Silverman’s task – to use the former as a vehicle for the latter – is a noble one. ", "And she most certainly has her work cut out for her." ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0, 0.00004756242568370987, 0, 0.00008734387282732115, 0.0000176541204717181, 0.00011814744801512288, 0.00023629489603024575, 0.00005406574394463668, 0.00003443466882457258, 0, 0, 0.0001602307322544464, 0.00002311390532544379, 0.00004504301608035674, 0.000011648359328588568, 0.00010850694444444444, 0, 0, 0, 0, 0.00006009254251547383, 0, 0.00005486968449931413, 0, 0, 0, 0, 0, 0.00003109433399046026, 0, 0.00003501277966457757, 0, 0.00004385772553835358, 0, 0.00002333776750916007, 0, 0, 0.00012624668602449185, 0 ]

[ "1. ", "Field of the Invention\nThe present invention relates to peripheral input devices for a computer. ", "The invention concerns, more particularly, an input device that senses angular displacement of the input device relative to a support surface. ", "The invention has application to moving a pointer image, such as a cursor, relative to a computer display or scrolling an image relative to the computer display, for example.", "\n2. ", "Description of Background Art\nAs the field of computer science has matured, a variety of peripheral input devices have been developed to facilitate the use of computer systems and the entry of information into computer systems. ", "One particular type of input device is conventionally referred to as a pointing device. ", "Examples of pointing devices include a mouse, touchpad, trackball, and stylus, for example. ", "Among other functions, a pointing device is utilized to move a pointer image, such as a cursor, relative to a display screen. ", "More particularly, movement of the pointing device or a component associated with the pointing device generates position data corresponding with the movement of the pointing device. ", "The position data is then transmitted to the computer system and processed by the computer system so as to be rendered on the display screen as movement of the pointer image. ", "By utilizing the pointing device, therefore, the user can move the pointer image to a desired location on the display screen. ", "A command key on the pointing device can then be activated to manipulate data or other images rendered on the display screen.", "\nMany traditional display screens permit only a single data file, such as a text document, digital photograph, spreadsheet, or Web page, to be conveniently displayed as an image on the display screen. ", "When configuring a conventional pointing device for use with a traditional display screen, the user balances the velocity of the pointer image with the accuracy of movement of the pointer image. ", "In general, the velocity of the pointer image is inversely-related to the accuracy of movement of the pointer image. ", "Accordingly, an increase in the velocity of the pointer image engenders a corresponding decrease in the accuracy with which the pointer image may be placed at a desired location. ", "For this reason, the user generally configures the pointing device to move the pointer image at the highest velocity that also permits the pointer image to be accurately placed in a desired location on the display screen.", "\nIn contrast with many traditional display screens, a modern display screen may exhibit significantly greater dimensions and resolution, which permits relatively large quantities of data to be rendered. ", "When configuring a conventional pointing device for use with a modern display screen, the balance between the velocity of the pointer image and the accuracy of movement of the pointer image remains relevant. ", "Accordingly, the user generally configures the pointing device to move the pointer image at the highest velocity that also permits the pointer image to be accurately placed in a desired location on the display screen. ", "Although this balance between velocity and movement is suitable for working with a relatively small, traditional display screen, the user may find that the velocity is insufficient to efficiently permit the user to move the pointer image between areas that are separated by a relatively large distance on the relatively large, modern display screen. ", "Accordingly, the velocity of the pointer image may not be sufficient to efficiently move the pointer image from one portion of the display screen to another portion of the display screen.", "\nWhen using a mouse, for example, with the relatively large, modern display screen, the user may be required to perform multiple movements of the mouse to cause a desired movement in the pointer image. ", "For example, translating the mouse across the width of a support surface may only move the pointer image a portion of the desired distance on the display screen. ", "The user may then be required to repetitively lift the mouse from the support surface and reposition the mouse on the support surface to induce additional movement in the pointer image. ", "Similarly, multiple movements of a trackball may be required to cause a desired movement in the pointer image." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Philip Williams (snooker player)\n\nPhilip Williams (born 3 June 1967) is a Welsh former professional snooker player. ", "He was a professional for most seasons between 1993/94 and 2003/04, but failed to establish himself, his highest ranking position being 104. ", "His best performances both came in 2001, when he reached the last 64 of both the Benson & Hedges Championship and the British Open.", "\n\nAs an amateur, he won the Welsh Championship in 2006. ", "He then reached the quarter-final at the amateur 2006 IBSF World Snooker Championship in Amman, Jordan, where he was eliminated by Kurt Maflin 6–3. ", "In the '2008 IBSF World Snooker Championship he was beaten by Alok Kumar. ", "In the 2009 IBSF World Snooker Championship he was eliminated in the semi-finals by Alfred Burden of England. ", "In 2010 he won the IBSF World Masters Championship in Damascus, Syria, beating Thailand's Chuchart Trairattanapradit 6 - 4.", "\n\nHe is mentioned in a book on Welsh snooker players written by Andrew Pagett.", "\n\nIn 2013 he was a surprise qualifier for the Last 16 of the WPBSA World Seniors Championship - his qualifying tournament wins included defeats of 2 former top 16 players, Gary Wilkinson and Patsy Fagan.", "\n\nReferences\n\nExternal links \nSnooker Player Profile for Philip Williams\nIBSF profile\n\nCategory:Living people\nCategory:1968 births\nCategory:Welsh snooker players" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.00022294887039239002, 0.0000502992807202857, 0.00005827166249053085, 0, 0.00004565376186997809, 0.00018261504747991235, 0.00008264462809917355, 0.00006609822195782934, 0.00016436554898093358, 0.00004853308743235701, 0.000038578758535550326 ]

[ "Content on this page was developed during the 2009-2010 H1N1 pandemic and has not been updated. ", "The H1N1 virus that caused that pandemic is now a regular human flu virus and continues to circulate seasonally worldwide.", "\n\nThe English language content on this website is being archived for historic and reference purposes only.", "\n\nFor current, updated information on seasonal flu, including information about H1N1, see the CDC Seasonal Flu website.", "\n\nCDC Estimates of 2009 H1N1 Influenza Cases, Hospitalizations and Deaths in the United States\n\nDuring the pandemic, CDC provided estimates of the numbers of 2009 H1N1 cases, hospitalizations and deaths on seven different occasions. ", "Final estimates were published in 2011. ", "These final estimates were that from April 12, 2009 to April 10, 2010 approximately 60.8 million cases (range: 43.3-89.3 million), 274,304 hospitalizations (195,086-402,719), and 12,469 deaths (8868-18,306) occurred in the United States due to pH1N1. ", "These final estimates are available at: Estimating the burden of 2009 pandemic influenza A (H1N1) in the United States (April 2009-April 2010), Shrestha SS, et al., ", "Clin Infect Dis. ", "2011 Jan 1;52 Suppl 1:S75-82.", "\n\nBelow are links to the different estimates published, including the final estimates.", "\n\nApril – October 17, 2009 Estimates\n\nApril – November 14, 2009 Estimates\n\nApril – December 12, 2009 Estimates\n\nApril 2009 – January 16, 2010 Estimates\n\nApril 2009 – February 13, 2010 Estimates\n\nApril 2009 – March 13, 2010 Estimates\n\nFinal Estimates Published in May 2011" ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0, 0, 0.000036839875481220875, 0, 0, 0.000036730945821854914, 0.0034602076124567475, 0, 0, 0 ]

[ " \r\n\r\n\t\r\n\t\r\n\t\r\n\t\r\n\tOSCN Found Document:BURNS v. CLINE\r\n\r\n\t\r\n\t\r\n\t\r\n\r\n\t\r\n\t\r\n\t\r\n\t\r\n\t\r\n\t\r\n\t\r\n\t\r\n\r\n\t\r\n\r\n\r\n\t\t\t\t\t\r\n\t\r\n \n\n\n\nOSCN navigation\n\n\n\n\r\n Home\n\r\n Courts\n\r\n \r\n\t Court Dockets\r\n\t\t\t \n\r\n Legal Research\n\r\n Calendar\n\r\n Help\n\n\n\n\n\n\n\r\n\t\t\t\t\t\tPrevious Case\n\r\n\t\t\t\t\t\tTop Of Index\n\r\n\t\t\t\t\t\tThis Point in Index\n\r\n\t\t\t\t\t\tCitationize\n\r\n\t\t\t\t\t\tNext Case\n\r\n\t\t\t\t\t\tPrint Only\n\n\n\n\n\n\n\n\nBURNS v. CLINE2016 OK 99Case Number: 114679Decided: 10/04/2016THE SUPREME COURT OF THE STATE OF OKLAHOMA\r\nCite as: 2016 OK 99, __ P.3d __\n\nNOTICE: THIS OPINION HAS NOT BEEN RELEASED FOR PUBLICATION. ", "UNTIL RELEASED, IT IS SUBJECT TO REVISION OR WITHDRAWAL. ", "\n\n\nLARRY A. BURNS, D.O., on behalf of himself and his patients, Plaintiff/Appellant,\nv.\nTERRY L. CLINE, in his official capacity as Oklahoma Commissioner of Health, and GREG MASHBURN, in his official capacity as District Attorney for Cleveland, Garvin and McClain Counties, Defendants/Appellees.", "\n\n\nON APPEAL FROM THE DISTRICT COURT OF OKLAHOMA COUNTY,\nTHE HONORABLE JUDGE THOMAS PRINCE, PRESIDING\n\n\n¶0 The plaintiff, Larry A. Burns, D.O., (Burns) challenges Senate Bill No. ", "642, Okla. Sess. ", "L. 2015, Ch. ", "387 (West) (\"SB 642\"), as violating the single subject rule mandated by Okla. Const. ", "art. ", "5, §57. ", "Burns appeals from summary adjudication in favor of defendants and the denial of his request for declaratory judgment that SB 642 is unconstitutional and his request for permanent stay. ", "We granted certiorari and we hold that SB 642 is unconstitutional and violates the single-subject rule of Okla. Const. ", "art. ", "5, §57.", "\n\n\nMOTION TO RETAIN PREVIOUSLY GRANTED;\nDISTRICT COURT'S JUDGMENT REVERSED AND\nREMANDED WITH DIRECTIONS\n\n\nJ. Blake Patton, Oklahoma City, Oklahoma, for Appellant\nZoe Levine, New York, New York, for Appellant\nSarah A. Greenwalt, Office of the Attorney General, Oklahoma City, Oklahoma, for Appellees\n\n\n\nWATT, J.:\n\n¶1 The issue before this Court concerns the constitutionality of SB 642, passed by the Legislature and signed into law by the Governor on June 4, 2015. ", "The effective date of the legislation was November 1, 2015. ", "This legislation includes one section modifying an existing statute relating to abortions, and enacts three unrelated new sections in this same title. ", "We reverse the district court's findings and hold the statute unconstitutional as it violates the single subject rule set forth in Okla. Const. ", "art. ", "5, §57. ", "\nPROCEDURAL HISTORY\n¶2 Prior to filing the declaratory action giving rise to this appeal, Burns filed an application with this court to assume original jurisdiction, seeking declaratory and injunctive relief against the defendants, Terry L. Cline, in his official capacity as Oklahoma Commissioner of Health, and Greg Mashburn, in his official capacity as District Attorney for Cleveland, Garvin, and McClain Counties (defendants/State). ", "In the petition for original jurisdiction, Burns asked this Court to find SB 642 unconstitutional and to issue a permanent injunction blocking its enforcement.1 On October 26, 2015, this Court assumed original jurisdiction and ordered a stay of the enforcement of the legislation for 30 days.2 After Burns filed his petition for declaratory relief in district court, this Court ordered the stay to remain in effect.3 This appeal arises from Burns' petition for injunction filed in district court and its grant of summary judgment finding SB 642 constitutional and denying injunctive relief. ", "This Court issued an order retaining this appeal on March 2, 2016.", "\nSTANDARD OF REVIEW\n¶3 We determine we have authority to address the constitutionality of SB 642. ", "Under Douglas v. Cox Retirement Properties, Inc., 2013 OK 37, 302 P.3d 789, we acknowledge the heavy burden placed on those who raise constitutional challenges to legislation. ", "This Court favors a statutory construction that upholds the constitutionality of a statute. ", "Oliver v. Hofmeister, 2016 OK 15, ¶ 5, 368 P.3d 1270, 1272. ", "This Court does not consider the \"propriety, desirability or wisdom\" in a statute. ", "Douglas, 2013 OK 37, ¶3, 302 P.3d at 792. ", "The function of this Court is limited to a determination of whether legislative provision is valid and nothing further. ", "Douglas, supra.", "\nANALYSIS\n¶4 Art. ", "5, § 57 of the Oklahoma Constitution provides: \"Every act of the Legislature shall embrace but one subject, which shall be clearly expressed in its title....\" 4 This clause is commonly referred to as the \"single subject rule\". ", "The purpose of this constitutional provision is not to impede legislation. ", "Rather it is to insure transparency in the legislative process.5 The single subject rule is to prevent the Legislature from making a bill \"veto proof\" by appending unpopular legislation within popular bills.6\n¶5 We have stated the purposes of this rule are:\n\n\n1) to ensure that the legislators or voters of Oklahoma are adequately notified of the potential effect of the legislation; and\n\n\n2) to prevent 'logrolling', the practice of assuring the passage of a law by creating one choice in which a legislator or voter is forced to assent to an unfavorable provision to secure passage of a favorable one, or conversely, forced to vote against a favorable provision to ensure that an unfavorable provision is not enacted.7\n¶6 The recognition of this doctrine extends back to statehood.8 This constitutional provision acts as a safeguard against enacting legislation which, if introduced as a single bill, could never command the approval of a majority of the legislature.9\n¶7 Defendants advance two theories in support of their argument that SB 642 is constitutional. ", "First, defendants attempt to argue that this legislation does not violate the single subject rule because it is germane, relative and cognate to one subject, the protection of women's reproductive health. ", "Defendants next contend that SB 642 is simply comprehensive legislation, and that this Court has found that comprehensive legislation does not necessarily violate Okla. Const. ", "art. ", "5, §57. ", "Upon careful review of Oklahoma jurisprudence, we find defendants' arguments are not in accord with our prior decisions on the single subject rule.", "\n \nLegislation Must be Germane, Relative and Cognate to Satisfy \nart. ", "5 §57 of the Oklahoma Constitution\n¶8 Defendants posit that SB 642 is constitutional under the single subject rule, because all sections in this legislation relate to protecting the reproductive health of women. ", "To reinforce this point, the State argues that all four sections in SB 642 simply create enforcement mechanisms and put \"teeth into existing laws designed to protect women's reproductive health.", "\"10\n¶9 Burns asserts this law fails to satisfy the constitutional mandate of art. ", "5, §57. ", "Specifically, plaintiff argues that the different provisions of SB 642 impose directives to different state entities for different purposes,11 similar to the law struck down in Oklahoma Capitol. ", "Plaintiff urges that the provisions of this law are so unrelated that legislators voting on the bill were presented with an \"all or nothing choice\" suggestive of logrolling, the very thing this constitutional provision is designed to prevent. ", "Oklahoma Capitol, supra.; ", "In re Initiative Petition No. ", "382, 2006 OK 45 ¶14, 142 P.3d 400, 407-408; Nova Health Systems v. Edmondson, 2010 OK 21, ¶1, 233 P.3d 380, 381-382, (hereinafter Nova Health).", "\n¶10 The sections of SB 642 contain the following provisions:\n\n\n(a) Section 1, amends 63 O.S. 2011 §1-740.4b, adding powers to the Attorney General (A.G.) or the District Attorney (D.A.) to enjoin certain conduct relating to requisite consents for minors seeking abortions;\n(b) Section 2, adds a new section of law, authorizing the Oklahoma Bureau of Investigations (OSBI) to create a new forensic protocol for statutory rape investigations;\n(c) Section 3, adds a new section of law creating a new licensing and inspection scheme for abortion facilities, directing the Oklahoma State Department of Health (OSDH) to develop requisite regulatory protocols;\n(d) Section 4, adds a new broad-sweeping section, imposing felony penalties as well as civil penalties up to One Hundred Thousand Dollars for a violation of any existing regulation relating to abortion statutes contained in 63 O.S. 2011 §§1-737.7 to 1-737.16.", "\n\n\n¶11 We have consistently found legislation is related to one subject when the provisions are \"germane, relative, and cognate to a readily apparent common theme and purpose.", "\"12 However, it is not enough for defendants to simply articulate some rational connection between similar or related provisions.13 Instead, our focus is \"whether it appears that either the proposal is misleading or provisions in the proposal are so unrelated that many of those voting on the law would be faced with an unpalatable all-or-nothing choice.", "\"14\n¶12 Section 1 amends 63 O.S. 2011 §1-740.4b, dealing with the consent required for an abortion to be performed on a minor and delineating civil and criminal penalties for any violation. ", "The amendment creates a new class of people subject to this prohibition and adds new authority to both the A.G. and D.A. Sections 2 and 3 both place new duties and directives on OSBI and OSDH respectively. ", "Section 4 is a very broad sweeping provision that provides for substantial civil as well as criminal penalties for any violation of any statute contained in 63 O.S. 2011 §§1-737.7 to 1-737.16.", "\n¶13 We reject defendants' arguments and find this legislation violates the single subject rule as each of these sections is so unrelated and misleading that a legislator voting on this matter could have been left with an unpalatable all-or-nothing choice.15 The heart of the single subject rule is to insure constitutional protection that each piece of legislation enacted is worthy of the approval of the voter and to prevent the enactment of unpopular provisions by logrolling or attaching it to a favorable bill. ", "We also find this legislation violates the single subject rule under Oklahoma Capitol, supra., ", "as it delegates authority to three different state agencies.", "\n'Comprehensive' Legislation Is Not Determinative of Whether a Bill is\nConstitutional Under Okla. Const. ", "art. ", "5, §57.", "\n¶14 Although we have already concluded that this legislation fails for violating the single subject rule, we will briefly address defendants' second contention. ", "Defendants assert that SB 642 is simply comprehensive legislation, and that this Court has found that comprehensive legislation does not necessarily violate Okla. Const. ", "art. ", "5, §57. ", "In this loosely reasoned argument, the State relies on Coates v. Fallin, 2013 OK 108, 316 P.3d 924, (hereinafter \"Coates\") and Thomas v. Henry, 2011 OK 53, 260 P.3d 1251, (hereinafter \"Thomas\"). ", "Defendants' position is not supported by these cases.", "\n¶15 Defendants' interpretation of Coates is misleading and not in accord with this Court's findings and narrow pronouncement in this published order. ", "The central constitutional challenge in Coates was whether Senate Bill 1062, 2013 Okla. Sess. ", "Laws, Ch. ", "208, (SB 1062), as a multiple subject bill, violated Okla. Const. ", "art. ", "5, §57. ", "SB 1062 repealed the Workers' Compensation Code,16 replacing it with three separate acts.17 The petitioner in Coates urged enacting legislation with three separate acts was unconstitutional logrolling under art., ", "5 §57. ", "We examined SB 1062 under the guidance of Thomas, supra., ", "emphasizing, the relevant inquiry is not how many acts are in a particular bill, but rather whether the multiple parts reflect a common closely akin theme or purpose. ", "The analysis of this bill revealed that all sections related to the common theme of workers' compensation or the protection of workers against work-related injuries. ", "This Court decreed SB 1062 did not violate the single subject rule.18 The focus of the inquiry is not the number of sections in a particular bill, but rather whether the multiple parts reflect a common, closely akin theme or purpose. ", "Coates does not stand for the proposition proffered by defendants, that comprehensive legislation does not violate the single subject rule. ", "Whether or not legislation is comprehensive is not the determinative factor for constitutional challenge under art. ", "5, §57. ", "We reject defendants' argument on this point.", "\n¶16 The State also relies on Thomas, supra. ", "for the same principle. ", "Their reliance on this case for the proposition that comprehensive legislation does not violate the single subject rule is likewise misplaced. ", "Thomas incorporated the same principles already enumerated in this opinion for determining if legislation is germane, relative and cognate. ", "In fact, we clearly stated, \"[t]he question is not how similar two provisions in a proposed law are, but whether it appears either that the proposal is misleading or that the provisions in the proposal are so unrelated that many of those voting on the law would be faced with an unpalatable all-or-nothing choice.\" ", "Thomas, 2011 OK 53, ¶26, 260 P.3d 1251, 1260.", "\nThis Court Previously Struck Down Comparable Abortion Legislation as\nViolating the Single Subject Rule\n¶17 The legislation before us is indistinguishable from legislation we determined violated the single subject rule in Nova Health, supra.19 In Nova Health, we examined the \"Freedom of Conscience Act\" and its multiple sections. ", "Most sections in the Freedom of Conscience Act contained some reference to abortion procedures. ", "However, a common connection or theme is not sufficient to satisfy the single subject rule where the legislation is potentially misleading or leaves the Legislature with an all-or-nothing choice.20\n¶18 We find that each of the four sections of SB 642, lack a common purpose and are not germane, relative and cognate. ", "Although each section relates in some way to abortion, the broad sweep of each section does not cure the single subject defects in this bill. ", "Although defendants urge that SB 642 does not constitute logrolling, we find the provisions are so unrelated that those voting on this bill were faced with a constitutionally prohibited all-or-nothing choice to ensure the passage of favorable legislation.", "\nCONCLUSION\n¶19 We conclude that SB 642 contains different and unrelated purposes contrary to the single subject requirement of Okla. Const., ", "art. ", "5, §57. ", "Although we understand the power of the Legislature in enacting new laws, we are bound to uphold our Constitution. ", "SB 642 is unconstitutional and void.", "\n\nTRIAL COURT'S ORDER GRANTING DEFENDANTS' \nCROSS-MOTION FOR SUMMARY JUDGMENT AND DENYING\nPLAINTIFF'S MOTION FOR SUMMARY JUDGMENT IS REVERSED;\nCAUSE REMANDED FOR FURTHER PROCEEDINGS \nCONSISTENT WITH TODAY'S PRONOUNCEMENT\n\n\nREIF, C.J., WATT, WINCHESTER, EDMONDSON, COLBERT, JJ. - ", "CONCUR\nCOMBS, V.C.J., KAUGER, TAYLOR, GURICH, JJ. - ", "CONCURRING SPECIALLY\n\n\nFOOTNOTES\n\n1 Larry Burns, D.O., Petitioner, v. Terry L. Cline, in his official capacity as Oklahoma Commissioner of Health, and Greg Mashburn, in his official capacity as District Attorney for Cleveland, Garvin and McClain Counties, Respondents, Case No. ", "114,312, filed September 25, 2015.", "\n\n\n2 See, Corrected Order, filed October 28, 2015, \"Original jurisdiction is assumed. ", "The enforcement of Senate Bill 642, which amends 63 O.S. §1-740.4b, and enacts 63 O.S. §§1-749, 1-749.1 and 1-750, is stayed for 30 days from the date of this order. ", "If, within that 30 days, the petitioner files a petition for declaratory and injunctive relief in the Oklahoma County District Court, and notifies this Court of the filing of the petition, the stay shall continue in effect. ", "If no petition is filed, the stay shall be dissolved. ", "This Court does not express any opinion on the constitutionality of Senate Bill 642 at this time.\"", "\n\n\n3 See, Order, Case No. ", "114,312, filed November 16, 2015, \"Petitioner's motion to continue stay in effect is granted. ", "The Court notes that petitioner has filed a petition in the Oklahoma County District Court on November 3, 2015, in Burns v. Cline, case no. ", "CV-2015-2050. ", "This Court's stay of the enforcement of Senate Bill 642 remains in effect until further order from this Court\".", "\n\n\n4 The Oklahoma Constitution , art. ", "5, §57 provides:\nEvery act of the Legislature shall embrace but one subject, which shall be clearly expressed in its title, except general appropriation bills, general revenue bills, and bills adopting a code, digest, or revision of statutes; and no law shall be revived, amended, or the provisions thereof extended or conferred, by reference to its title only; but so much thereof as is revived, amended, extended, or conferred shall be re-enacted and published at length: Provided, That if any subject be embraced in any act contrary to the provisions of this section, such act shall be void only as to so much of the law as may not be expressed in the title thereof.", "\n\n\n5 Fent v. Fallin, 2013 OK 107, ¶ 4, 315 P.3d 1023, 1025 (citation omitted).", "\n\n\n6 Id.\n\n\n7 Fent v. State ex rel. ", "Oklahoma Capitol Improvement Authority, (hereinafter \"Oklahoma Capitol\"), 2009 OK 15, ¶ 14, 214 P.3d 799, 804 (citations omitted)\n\n\n8 In re County Commissioners of Counties Comprising Seventh Judicial Dist.", ",1908 OK 207, 98 P. 557.", "\n\n\n9 Oklahoma Capitol, 2009 OK 15, ¶ 15, 214 P.3d 799, 804-805 (citation omitted).", "\n\n\n10 See Record, Defendants' Combined Response to Plaintiff's Motion for Summary Judgment, and Defendants' Cross-Motion for Summary Judgment.", "\n\n\n11 See, SB 642, Oklahoma State Bureau of Investigation, Oklahoma State Board of Health and the Oklahoma Attorney General.", "\n\n\n12 Oklahoma Capitol, 2009 OK 15, ¶16, 214 P.3d at 805.", "\n\n\n13 Id.\n\n\n14 Oklahoma Capitol, 2009 OK 15, ¶ 15, 214 P.3d 799, 804-805 (citation omitted).", "\n\n\n15 Oklahoma Capitol, 2009 OK 15, ¶16, 214 P.3d at 805.", "\n\n\n16 85 O.S. 2011, §301 et seq.", "\n\n\n17 Administrative Workers' Compensation Act, 85A O.S. Supp.2014 §301 et seq., ", "Oklahoma Employee Injury Benefit Act, 85A O.S. Supp.2014, 201, et seq., ", "and the Workers' Arbitration Compensation Act, 85A O.S. Supp.2014 §301 et seq.", "\n\n\n18 This Court specifically noted that \"[u]ntil such time as a case or controversy or a justiciable issue is presented to this Court, we are without jurisdiction to rule further with regard to the Act.\" ", "Coates, 2013 OK 108, ¶3, 316 P.3d 924, 925.", "\n\n\n19 This Court resolved the issues in Nova by a \"Disposition by Order\" .", "\n\n\n20 See, Nova Health, 2010 OK 21, 233 P.3d 380, footnote 5, \"The choice, often known as 'Hobson's choice' is an apparently free choice that offers no real alternative; in the parlance of our times, a 'take it or leave it'. ", "The phrase finds its origin in the practice of an English livery stable proprietor named Thomas Hobson, ... who required that his customers choose the horse nearest the stable door or none at all.\" (", "Citation omitted).", "\n\n\n\n\n \n\n\nCOMBS, V.C.J., concurring specially, with whom KAUGER, TAYLOR, and GURICH, JJ., ", "join:\n\n¶1 I agree with the majority's conclusion that Senate Bill No. ", "642, 2015 Okla. Sess. ", "Laws c. 387 (SB 642) is unconstitutional, not only because it violates Okla. Const. ", "art. ", "5, § 57, but also because it continues to place undue burdens on access to abortion under the guise of protecting the health of women.1 The United States Supreme Court ruling in Planned Parenthood of Southeastern Pa. v. Casey, 505 U.S. 833, 112 S.Ct. ", "2791, 120 L.Ed.2d 674 (1992), reinforced by Whole Woman's Health v. Hellerstedt, __ U.S. __, 136 S.Ct. ", "2292, 195 L.Ed.2d 665 (2016), requires lower courts consider the burdens a law imposes on abortion access together with the benefits the law confers. ", "Hellerstedt, 136 S.Ct. ", "at 2309. ", "By virtue of the Supremacy Clause, we are bound by the decisions of the United States Supreme Court with respect to the federal Constitution and federal law, and we must pronounce rules of law that conform to extant Supreme Court jurisprudence. ", "Akin v. Missouri Pacific Railroad Co., 1998 OK 102, ¶30, 977 P.2d 1040; United States v. Home Fed. ", "S. & L. Ass'n of Tulsa, 1966 OK 135, ¶18, 418 P.2d 319.", "\n¶2 The Supremacy Clause of the United States Const. ", "art. ", "VI, cl. ", "2 provides:\n\n\nThis Constitution, and the Laws of the United States which shall be made in Pursuance thereof; and all Treaties made, or which shall be made, under the Authority of the United States, shall be the supreme Law of the Land; and the Judges in every State shall be bound thereby, any Thing in the Constitution or Laws of any State to the Contrary notwithstanding.", "\n\n\nAdditionally, Okla. Const. ", "art. ", "1, § 1 requires compliance with federal constitutional law on issues of federal law, and provides:\n\n\nThe State of Oklahoma is an inseparable part of the Federal Union, and the Constitution of the United States is the supreme law of the land.", "\n\n\nIn In re Initiative Petition No. ", "349, State Question No. ", "642, 1992 OK 122, ¶13, 838 P.2d 1, this Court stated:\n\n\nWe are doubly bound to uphold the law of the land. ", "Our limited role, like the role of all state courts in such cases, is to apply federal constitutional law, not to make it nor to guess what it may become. ", "By virtue of our constitutional oath of office, we have solemnly sworn to uphold the Constitution of the United States. (", "Footnotes omitted).", "\n\n\n¶3 SB 642 is constitutionally infirm not only because it violates Okla. Const. ", "art. ", "5, § 57, but also because it violates the standard set by the Supreme Court of the United States in Casey, and more recently revisited in Hellerstedt. ", "In Casey, 505 U.S. at 878, a plurality of the Court concluded a provision of law is constitutionally invalid if the purpose or effect of the provision is to place a substantial obstacle in the path of a woman seeking an abortion before the fetus attains viability. ", "The United States Supreme Court also stated: \"[u]nnecessary health regulations that have the purpose or effect of presenting a substantial obstacle to a woman seeking an abortion impose an undue burden on the right.\" ", "Casey, 505 U.S. at 878.", "\n¶4 In Hellerstedt, the United States Supreme Court revisited the rule recognized by the plurality in Casey, and applied it to a Texas statute directly regulating abortion providers. ", "The Court examined two provisions: 1) an admitting privileges requirement that effectively required physicians providing abortions to have admitting privileges at a hospital within 30 miles; and 2) a surgical-center requirement mandating abortion facilities meet the minimum standards for ambulatory surgery centers under Texas law. ", "Hellerstedt, 136 S.Ct. ", "at 2300. ", "After a detailed analysis, the United States Supreme Court determined neither provision conferred medical benefits sufficient to justify the burdens upon access that each imposed, and therefore each violated the Federal Constitution, Amdt. ", "14, § 1. ", "Hellerstedt, 136 S.Ct. ", "at 2300, 2309-2318. ", "This binding precedent, mandates our review of the provisions of SB 642 to determine whether the provisions confer medical benefits sufficient to justify the burdens on access imposed by their terms.", "\n¶5 SB 642 contains four provisions that subject abortion providers to new requirements, and penalize them substantially for violations. ", "Section 1 of SB 642 amends 63 O.S. 2011 § 1-740.4b, making it a felony when a person \"intentionally causes, aids, abets or assists an unemancipated minor to obtain an abortion without the consent required by Section 1-740.2 of this title.\" ", "Further, Section 1 amends 63 O.S. 2011 § 1-740.4b to grant broad powers to the Attorney General, a district attorney, or any person adversely affected to enjoin conduct in violation of that section. ", "The inclusion of such all-inclusive power to enforce to any person adversely affected greatly expands the threat of litigation to a limited very specific profession in a method not heretofore seen.", "\n¶6 Section 2 of SB 642 creates a new section of law, to be codified at 63 O.S. § 1-749, authorizing the Oklahoma State Bureau of Investigation to create a new forensic protocol for statutory rape investigations and requiring abortion providers to preserve fetal tissue when an abortion is performed on a minor less than 14 years of age. ", "Section 2 further declares that failure to comply with the new section or resulting rules is both: 1) unprofessional conduct; and 2) a felony. ", "This provision forces a limited section of health care providers to become agents of law enforcement and failure to perform these requirements would lead to both professional discipline and a violation of criminal law. ", "What other areas of the medical profession have such far reaching requirements?", "\n¶7 Most troubling are Sections 3 and 4 of SB 642. ", "Section 3 adds a new section of law to be codified at 63 O.S. § 1-749.1, granting sweeping authority to the State Board of Health to promulgate policies and procedures for conducting licensure and re-licensure inspections of abortion facilities. ", "Section 3 further grants the State Commissioner of Health inspection authority, and provides in pertinent part:\n\n\nC. If the State Commissioner of Health determines that there is reasonable cause to believe a licensee, licensed abortion facility or abortion facility that is required to be licensed in this state is not adhering to the requirements of Section 1-729a et seq. ", "of Title 63 of the Oklahoma Statutes, local fire ordinances or rules or any other law, administrative rule or regulation relating to abortion, the Commissioner and any duly designated employee or agent of the Commissioner including employees of county or city-county health departments and county or municipal fire inspectors, consistent with standard medical practices, may enter on and into the premises of the licensee, licensed abortion facility or abortion facility that is required to be licensed in this state during regular business hours of the licensee or abortion facility to determine compliance with the provisions of Section 1-729a et seq. ", "of Title 63 of the Oklahoma Statutes, local fire ordinances or rules, and any other law, administrative rule or regulation relating to abortion.", "\n\n\nAdditionally, Section 3 provides for the closure of abortion facilities that fail to comply with any of the new requirements, as well as existing ones:\n\n\nE. If an inspection or investigation conducted pursuant to this section reveals that an applicant, licensee or licensed abortion facility is not adhering to the requirements of this section, the provisions of Title 1-729a et seq. ", "of Title 63 of the Oklahoma Statutes, local fire ordinances or rules and any other law, administrative rule or regulation relating to abortion, the Commissioner may take action to deny, suspend, revoke or refuse to renew a license to operate an abortion facility.", "\n\n\n¶8 Section 4 of SB 642 also creates a new section of law, to be codified at 63 O.S. § 1-750. ", "This provision is primarily punitive, and punishes any person who intentionally, knowingly or recklessly violates \"any provision or requirement of this act, Section 1-729a et seq. ", "of Title 63 of the Oklahoma Statutes or any regulation adopted under Section 1-729a et seq. ", "of Title 63 of the Oklahoma Statutes.\" ", "Section 4 makes such a violation a felony, and subject to a civil penalty or a fine up to $100,000.00.", "\n¶9 Sections 3 and 4 of SB 642 both reference 63 O.S. § 1-729a, which regulates termination of pregnancy through the use of certain medications. ", "Section 4 provides severe penalties for any intentional, knowing or reckless violation of 63 O.S. § 1-729a. ", "The constitutionality of the bill which most recently modified 63 O.S. § 1-729a (2014 Okla. Sess. ", "Laws c. 121, 375-80 (HB 2684)), was considered by this Court in Okla. Coal. ", "for Repro. ", "Justice v. Cline, 2016 OK 17, 368 P.3d 1278. ", "While I agreed with the majority's determination that the bill was not unconstitutional on the narrow grounds the Court considered, I wrote separately to emphasize the dangerous line the Legislature insisted on walking. ", "I noted, specifically, that \"[w]hile H.B. 2684 does not prohibit all medication abortions, it nonetheless binds Oklahoma physicians and their patients to the FDA's final printed labeling, regardless of whether evidence and the judgment of the medical community indicate it is not the best method for providing medication abortion.\" ", "Cline, 2016 OK 17, ¶2 (Combs, V.C.J., concurring specially). ", "I also noted that little had changed in the statute from its prior incarnation, which this Court previously considered:\n\n\nIn Cline II, 2013 OK 93, this Court examined a prior statute requiring adherence to the FDA's final printed labeling for abortion-inducing drugs. ", "We noted with disapproval the law's drastic interference in the role of physicians and agreed with the determination of the district court that restricting the use of abortion-inducing drugs to the regime in the final printed labeling \"'is so completely at odds with the standard that governs the practice of medicine that it can serve no purpose other than to prevent women from obtaining abortions and to punish and discriminate against those who do.'\" ", "Cline II, 2013 OK 93, ¶27 (quoting Okla. Coal. ", "for Repro. ", "Justice v. Cline, No. ", "CV-2011-1722, slip op., ", "¶7 (Dist. ", "Ct. ", "Okla. Cnty. ", "May 11, 2012)). ", "H.B. 2684 requires adherence to a protocol in contravention of prevailing medical standards; one that simultaneously shrinks the window in which medication abortion is accessible to the women of Oklahoma. ", "This Court's above-quoted statement from Cline II remains apt.", "\n\n\nCline, 2016 OK 17, ¶4 (Combs, V.C.J., concurring specially).", "\n¶10 The Legislature's substitution of its judgment for that of physicians concerning best practices by requiring adherence to a protocol in contravention of prevailing medical standards, is troubling. ", "With SB 642, any intentional deviation from that protocol becomes a felony, and subjects providers to closure and a potentially enormous fine. ", "Further, there are other pitfalls that arise with any required adherence to 63 O.S. Supp. ", "2014 § 1-729a because it has potentially become unclear what protocol physicians are required to follow. ", "Section 1-729a contains a findings component that notes specific details of the FDA's original final printed labelling for Mifeprex, an abortion-inducing drug. ", "For example, 63 O.S. Supp. ", "2014 § 1-729a(A)(4) provides:\n\n\nAs approved by the FDA, and as outlined in the Mifeprex final printed labeling (FPL), an abortion by mifepristone consists of three two-hundred-milligram tablets of mifepristone taken orally, followed by two two-hundred-microgram tablets of misoprostol taken orally, through forty-nine (49) days LMP (a gestational measurement using the first day of the woman's \"last menstrual period\" as a marker). ", "The patient is to return for a follow-up visit in order to confirm that the abortion has been completed. ", "This FDA-approved protocol is referred to as the \"Mifeprex regimen\" or the \"RU-486 regimen\"\n\n\nHowever, the FDA changed these requirements on March 29, 2016, when it approved a supplemental application by the company that markets Mifeprex. ", "Questions and Answers on Mifeprex, March 30, 2106, http://www.fda.gov/Drugs/DrugSafety/PostmarketDrugSafetyInformationforPatientsandProviders/ucm492705.htm.2 The findings contained in 63 O.S. Supp. ", "2014 § 1-729a are no longer in accord with the current FDA label, which has changed in several ways, including but not limited to: 1) permitting use through 70 days' gestation instead of 49; 2) specifying a single 200mg dose on day one instead of three; 3) and allowing home administration of Misoprostol. ", "Mifeprex Label, 2016, Ref. ", "ID: 3909592, available at http://www.accessdata.fda.gov/drugsatfda_docs/label/2016/020687s020lbl.pdf.", "\n¶11 Sections 3 and 4 of SB 642 compel compliance with 63 O.S. Supp. ", "2014 § 1-729a, with providers facing closure and potentially a felony for failing to comply. ", "Meanwhile, the detailed findings of 63 O.S. Supp. ", "2014 § 1-729a (based on the outdated FDA final printed labelling) which are used to justify adherence to the FDA final printed labelling, are now not only at odds with the prevailing standard of care but also at odds with the current FDA-approved regime itself. ", "This raises the specter of substantial ambiguity in a statute that abortion providers will be forced to adhere to lest they be subjected to strict penalties.", "\n¶12 While the articulated goal of SB 642 is to protect the health of women, it creates an open-ended array of regulatory hurdles that subject practitioners to harsh penalties for any potential violation. ", "It is an inescapable conclusion that SB 642 will make it considerably more difficult for providers to operate, and accordingly will make it more difficult for the women of Oklahoma to exercise their federally-recognized constitutional right to control their own reproductive futures. ", "I would find SB 642 unconstitutional not only because it violates Okla. Const. ", "art. ", "5, § 57, but also because it places an undue burden on the right of women to choose. ", "Hellerstedt, 136 S.Ct. ", "at 2300; Casey, 505 U.S. at 874.", "\n\nFOOTNOTES\n\n1 In public law controversies, this Court is free to decide a case on all dispositive issues, regardless of whether they were tendered below. ", "Ashikian v. State ex rel. ", "Okla. Horse Racing Comm'n, 2008 OK 64, ¶17 n.45, 188 P.3d 148; Davis v. GHS Health Maint. ", "Org., ", "Inc., 2001 OK 3, ¶¶25-26, 22 P.3d 1204; Simpson v. Dixon, 1993 OK 71, ¶26 n.55, 853 P.2d 176. ", "Accordingly, this Court is not limited to Appellant's claim concerning Okla. Const. ", "art. ", "5, § 57 if the record compels a conclusion that SB 642 is unconstitutional on other grounds. ", "See Simpson, 1993 OK 71, ¶26.", "\n\n\n2 Title 12 O.S. 2011 § 2202 permits the courts to take judicial notice of facts whether requested or not, which are not subject to dispute when they are capable of accurate and ready determination by resort to sources whose accuracy cannot reasonably be questioned. ", "Actions taken by the FDA and disclosed on its own website present such a situation. ", "As the United States Court of Appeals for the Tenth Circuit has pointed out, it is not uncommon for courts to take judicial notice of factual information found on the World Wide Web. ", "O'Toole v. Northrop Grumman Corp., 499 F.3d 1218, 1225 (10th Cir. ", "2007).", "\n\n\n\n\nCitationizer© Summary of Documents Citing This Document\n\n\nCite\nName\nLevel\n\n\nNone Found.", "\n\n\nCitationizer: Table of Authority\n\n\nCite\nName\nLevel\n\n\nOklahoma Supreme Court Cases\n CiteNameLevel\n 1992 OK 122, 838 P.2d 1, 63 OBJ 2386, Initiative Petition No. ", "349, State Question No. ", "642, In reDiscussed\n 2001 OK 3, 22 P.3d 1204, 73 OBJ 156, DAVIS v. GHS HEALTH MAINTENANCE ORGANIZATION, INC.Discussed\n 1993 OK 71, 853 P.2d 176, 64 OBJ 1721, Simpson v. DixonDiscussed at Length\n 1908 OK 207, 98 P. 557, 22 Okla. 435, In re COUNTY COM'RS OF COUNTIES COMPRISING SEVENTH JUDICIAL DIST.Discussed\n 1966 OK 135, 418 P.2d 319, UNITED STATES v. HOME FED. ", "S. & L. ASS'N OF TULSADiscussed\n 2006 OK 45, 142 P.3d 400, IN RE: INITIATIVE PETITION NO. ", "382, STATE QUESTION NO. ", "729Discussed\n 2008 OK 64, 188 P.3d 148, ASHIKIAN v. STATE ex rel. ", "OKLAHOMA HORSE RACING COMM.Discussed\n 2009 OK 15, 214 P.3d 799, FENT v. STATE ex rel. ", "OKLAHOMA CAPITOL IMPROVEMENT AUTHORITYDiscussed at Length\n 2010 OK 21, 233 P.3d 380, NOVA HEALTH SYSTEMS v. EDMONDSONDiscussed at Length\n 2011 OK 53, 260 P.3d 1251, THOMAS v. HENRYDiscussed at Length\n 2013 OK 37, 302 P.3d 789, DOUGLAS v. COX RETIREMENT PROPERTIES, INC.Discussed at Length\n 2013 OK 93, 313 P.3d 253, CLINE v. OKLAHOMA COALITION FOR REPRODUCTIVE JUSTICEDiscussed\n 2013 OK 108, 316 P.3d 924, COATES v. FALLINDiscussed at Length\n 2013 OK 107, 315 P.3d 1023, FENT v. FALLINDiscussed\n 2016 OK 15, 368 P.3d 1270, OLIVER v. HOFMEISTERDiscussed\n 2016 OK 17, 368 P.3d 1278, OKLAHOMA COALITION FOR REPRODUCTIVE JUSTICE v. CLINEDiscussed at Length\n 1998 OK 102, 977 P.2d 1040, 69 OBJ 3512, Akin v. Missouri Pacific Railroad Co.Discussed\nTitle 12. ", "Civil Procedure\n CiteNameLevel\n 12 O.S. 2202, Judicial Notice of Adjudicative FactsCited\nTitle 63. ", "Public Health and Safety\n CiteNameLevel\n 63 O.S. 1-740.4b, Criminal Violations - Penalties - Defenses - Civil Liability - InjunctionDiscussed at Length\n 63 O.S. 1-729a, Legislative Findings - Regulation of Mifepristone RU-486 and Abortion-Inducing DrugsDiscussed at Length\n 63 O.S. 1-737.7, Short TitleDiscussed at Length\n 63 O.S. 1-749, Abortion on Minor Less Than Fourteen Years of AgeDiscussed\n 63 O.S. 1-749.1, Inspections and Investigations of Facilities - Complaints - Denial, Suspension, or Revocation of LicenseDiscussed\n 63 O.S. 1-750, Criminal and Civil Penalties for ViolationsCited\nTitle 85. ", "Workers' Compensation\n CiteNameLevel\n 85 O.S. 301, Repealed by Laws 2013, SB 1062, c. 208, § 171, eff. ", "February 1, 2014Cited\nTitle 85A. Workers' Compensation\n CiteNameLevel\n 85A O.S. 301, Arbitration Agreements - ValidityDiscussed\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0000026183219698159845, 0, 0.00006894570525711002, 0.00015605006085952372, 0.0034602076124567475, 0, 0.00013840830449826988, 0, 0, 0, 0.0000706164818868724, 0, 0, 0.000046248121170077466, 0, 0, 0, 0, 0, 0.00002085027418110548, 0.000020041170289823953, 0.0002295684113865932, 0, 0.00003228305785123967, 0.00011814744801512288, 0.0002777777777777778, 0.0001451589490492089, 0.0017006802721088435, 0.00006944444444444444, 0.0044444444444444444, 0, 0.000019406547769217335, 0, 0.0000017600118272794793, 0, 0.00006456611570247934, 0, 0, 0, 0, 0.000022249911000355996, 0.00002657030502710171, 0.000148720999405116, 0, 0, 0, 0.0014792899408284025, 0.0011111111111111111, 0.00009780429360848941, 0.0000035911112813563865, 0, 0, 0, 0.000023564897728343855, 0, 0, 0.00011080332409972299, 0, 0, 0, 0, 0, 0.00006920415224913494, 0, 0, 0.00007889546351084813, 0, 0.00013157317661506075, 0.00022634676324128565, 0, 0.0002295684113865932, 0, 0, 0.000066124446207763, 0, 0, 0, 0, 0.00001826283877565929, 0, 0, 0, 0, 0.0009876543209876543, 0, 0, 0.0000510204081632653, 0, 0.0004938271604938272, 0.000018254670913920098, 0, 0.00000995133795738837, 0, 0, 0.00004959333465582226, 0, 0, 0.00007561436672967865, 0, 0.00007708020195012912, 0.0011094674556213018, 0.00006469644428342218, 0, 0.00013520822065981613, 0.00007257947452460445, 0, 0, 0.0002082465639316951, 0.0014792899408284025, 0.00011317338162064282, 0.0001020408163265306, 0.00510204081632653, 0.00024348672997321648, 0, 0.0000022343323033061418, 0, 0, 0.000023564897728343855, 0, 0.000148720999405116, 0.00014878000396746676, 0.00013007284079084286, 0.0006155740227762388, 0, 0.0006155740227762388, 0, 0.00015241579027587258, 0.00038580246913580245, 0.00016436554898093358, 0.000023795359904818562, 0.001081665765278529, 0.0003652300949598247, 0.00003950617283950617, 0.000050503775157193, 0, 0.0002524933720489837, 0.0002040816326530612, 0, 0.0002834467120181406, 0, 0.00004761829177314646, 0.00009425959091337542, 0, 0.001890359168241966, 0, 0.000049979175343606825, 0.0002040608101214162, 0.0003305785123966942, 0, 0, 0.015625, 0.000021562722365574395, 0.0011111111111111111, 0, 0.00003443466882457258, 0, 0.001736111111111111, 0.0001746877456546423, 0, 0, 0, 0.000148720999405116, 0, 0.00008771545107670716, 0.00002847988608045568, 0.00002123638216993353, 0.001890359168241966, 0.00005972110245155126, 0.000009018027036045055, 0.001890359168241966, 0, 0.00001736111111111111, 0, 0.001890359168241966, 0, 0, 0, 0, 0, 0, 0.000008753194916144393, 0, 0, 0, 0, 0.000016524555489457336, 0.000014298378563870856, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0005193905817174514, 0, 0.0004938271604938272, 0.00004132231404958677, 0.000009072434315575556, 0, 0.000055691690799732676, 0, 0.0004526935264825713, 0, 0.002066115702479339, 0.001736111111111111, 0, 0, 0, 0, 0, 0.0005202913631633714, 0.00025195263290501383, 0.000024507401235173024, 0, 0, 0, 0.000078125, 0, 0.000016075102880658434, 0, 0.00007002678524535634, 0.000025507601265177026, 0.000021359306249733008, 0.0027434842249657062, 0.0000980296049406921, 0, 0, 0, 0.00004370374686789814, 0, 0, 0, 0.0001602307322544464, 0, 0, 0.001890359168241966, 0.0009765625, 0.00004162330905306972, 0, 0.0001234567901234568, 0, 0.00022634676324128565, 0.00042517006802721087, 0, 0, 0, 0.000013819598955238318, 0.0001417233560090703, 0.00005972110245155126, 0.0004591368227731864, 0, 0.00011814744801512288, 0.00010380622837370242, 0.001736111111111111, 0.00003517930893765523, 0.0001234567901234568, 0, 0, 0.00013520822065981613, 0.000015622803043322032, 0.0001020304050607081, 0.00002466997061532389, 0.0002827787727401263, 0 ]

[ "“Furious 7” is pulling out all the stops as Universal is aiming to make one of the greatest action movies of all time and, judging by the trailers, it might just succeed. ", "One of the ways it turned things up to 11 this time around is by including bold new faces like UFC champion Ronda Rousey.", "\n\nMany may remember the 28-year-old MMA fighter as the first-ever UFC Women’s Bantamweight Champion. ", "Others may recall her film debut in the all-star 2014 flick “The Expendables 3.” ", "Now, in her second film role, she’s squaring off against some of our favorite fast-driving criminals in “Furious 7.”", "\n\nAccording to ScreenRant, Rousey will play Kara, a fearsome baddie who is trying to prevent our heroes from stopping whatever villainy Deckard Shaw (Jason Statham) has cooked up. ", "As seen in the film’s trailer, fans can look forward to an intense throwdown between Kara and Letty (Michelle Rodriguez).", "\n\n“I think the Ronda Rousey aspect is the game-changer,” Rodriguez says in a behind-the-scenes video breaking down their evening-gown fight scene.", "\n\nRousey was equally impressed with her female co-stars. ", "Speaking with Entertainment Tonight, she confessed that she wasn’t expecting to work with a truckload of powerful women when she signed on for “Furious 7.”", "\n\n\"By the end of the day I was really impressed,\" she said. \"", "I thought I was going to be working with a bunch of porcelain dolls. ", "These were women who were so passionate about what they did, they were down to do whatever to make it look right.\"", "\n\nWhile Rousey was excited to join the “Fast and Furious” family, most people know by now that she and the rest of the “Furious 7” newbies entered the franchise at a very tumultuous time. ", "In November 2013, right in the middle of filming the soon-to-be action hit, star Paul Walker died in a tragic high-speed car accident. ", "The late actor was honored at the film’s South by Southwest premiere.", "\n\n\"I was only filming while he was still with us,\" Rousey told ET of Walker. \"", "The atmosphere was very cheery and family-like, and everyone was there just to help each other. ", "He was a joy to be around, and you could tell that everybody wasn’t there for themselves; they were there for each other. ", "I'm just lucky to have been one of the last people to witness that.\"", "\n\nRousey will join newcomers Statham, Kurt Russell, Nathalie Emmanuel, Tony Jaa and Djimon Hounsou when the “Fast and Furious” gang drives back into theaters on April 3. ", "Current early projections say the film will gross between $110 and $115 million during its opening weekend, shattering the previous movie, which broke a series record at $97 million." ]

{ "pile_set_name": "Pile-CC" }

[ 0.00003419855682090216, 0.00013660269107301415, 0.0001960592098813842, 0, 0, 0.0001234567901234568, 0.00020490403660952122, 0, 0, 0, 0, 0, 0, 0.000028293345405160706, 0.00005486968449931413, 0, 0.00016436554898093358, 0, 0, 0, 0.00017301038062283736, 0 ]

[ "inder when 1286767 is divided by 673?", "\n664\nWhat is the remainder when 3686188 is divided by 17722?", "\n12\nCalculate the remainder when 3791317 is divided by 40.", "\n37\nCalculate the remainder when 1745969 is divided by 1443.", "\n1382\nCalculate the remainder when 4822175 is divided by 236.", "\n223\nCalculate the remainder when 25029 is divided by 4114.", "\n345\nWhat is the remainder when 729275 is divided by 240578?", "\n7541\nCalculate the remainder when 1762330 is divided by 587149.", "\n883\nCalculate the remainder when 784592 is divided by 6178.", "\n6164\nCalculate the remainder when 176611 is divided by 43777.", "\n1503\nCalculate the remainder when 9983284 is divided by 8666.", "\n52\nCalculate the remainder when 50754492 is divided by 2961.", "\n2952\nWhat is the remainder when 2897104 is divided by 41987?", "\n1\nCalculate the remainder when 2458994 is divided by 3580.", "\n3114\nWhat is the remainder when 360692 is divided by 22503?", "\n644\nCalculate the remainder when 55538737 is divided by 161.", "\n16\nCalculate the remainder when 11075401 is divided by 43950.", "\n1\nWhat is the remainder when 1572443 is divided by 2749?", "\n15\nCalculate the remainder when 83099 is divided by 82200.", "\n899\nWhat is the remainder when 139880598 is divided by 9325373?", "\n3\nCalculate the remainder when 231473 is divided by 1526.", "\n1047\nCalculate the remainder when 444000 is divided by 3264.", "\n96\nCalculate the remainder when 613465 is divided by 714.", "\n139\nWhat is the remainder when 30592547 is divided by 657?", "\n656\nWhat is the remainder when 2002349 is divided by 2002311?", "\n38\nCalculate the remainder when 21676 is divided by 20718.", "\n958\nWhat is the remainder when 664066 is divided by 3046?", "\n38\nWhat is the remainder when 4094593 is divided by 87119?", "\n0\nWhat is the remainder when 217656 is divided by 4029?", "\n90\nWhat is the remainder when 10798 is divided by 634?", "\n20\nCalculate the remainder when 870890 is divided by 118.", "\n50\nWhat is the remainder when 240309 is divided by 233?", "\n86\nWhat is the remainder when 113359 is divided by 1494?", "\n1309\nWhat is the remainder when 498505 is divided by 99696?", "\n25\nWhat is the remainder when 5290866 is divided by 12135?", "\n6\nWhat is the remainder when 480563 is divided by 822?", "\n515\nWhat is the remainder when 638824 is divided by 127762?", "\n14\nCalculate the remainder when 6384082 is divided by 6384048.", "\n34\nCalculate the remainder when 886368 is divided by 14.", "\n0\nWhat is the remainder when 36464626 is divided by 582?", "\n580\nCalculate the remainder when 3012 is divided by 745.", "\n32\nWhat is the remainder when 151499 is divided by 594?", "\n29\nWhat is the remainder when 63940174 is divided by 1271?", "\n1248\nCalculate the remainder when 310497 is divided by 3230.", "\n417\nWhat is the remainder when 121941117 is divided by 160?", "\n157\nCalculate the remainder when 1516378627 is divided by 4745.", "\n4742\nCalculate the remainder when 140695 is divided by 500.", "\n195\nCalculate the remainder when 2487 is divided by 2122.", "\n365\nWhat is the remainder when 3538526 is divided by 104?", "\n30\nWhat is the remainder when 395881 is divided by 130026?", "\n5803\nCalculate the remainder when 336129 is divided by 752.", "\n737\nWhat is the remainder when 40869 is divided by 6333?", "\n2871\nWhat is the remainder when 293097 is divided by 26634?", "\n123\nCalculate the remainder when 1498679 is divided by 93665.", "\n39\nCalculate the remainder when 1167220 is divided by 1008.", "\n964\nCalculate the remainder when 6892 is divided by 1341.", "\n187\nWhat is the remainder when 43964 is divided by 11981?", "\n8021\nCalculate the remainder when 12607924 is divided by 1045.", "\n1044\nWhat is the remainder when 11817532 is divided by 291?", "\n22\nWhat is the remainder when 2295973 is divided by 3993?", "\n3991\nCalculate the remainder when 75016 is divided by 594.", "\n172\nCalculate the remainder when 1787373 is divided by 15147.", "\n27\nWhat is the remainder when 448580 is divided by 685?", "\n590\nCalculate the remainder when 962566 is divided by 6.", "\n4\nWhat is the remainder when 1080896 is divided by 12714?", "\n206\nWhat is the remainder when 15267438 is divided by 3649?", "\n22\nCalculate the remainder when 978545 is divided by 180.", "\n65\nCalculate the remainder when 10238 is divided by 1684.", "\n134\nCalculate the remainder when 236940 is divided by 4307.", "\n55\nWhat is the remainder when 1071261 is divided by 1068430?", "\n2831\nCalculate the remainder when 109077 is divided by 232.", "\n37\nCalculate the remainder when 425545 is divided by 870.", "\n115\nWhat is the remainder when 155869 is divided by 2284?", "\n557\nWhat is the remainder when 8576286 is divided by 18?", "\n6\nCalculate the remainder when 27242058 is divided by 213.", "\n210\nWhat is the remainder when 93829 is divided by 705?", "\n64\nWhat is the remainder when 14830096 is divided by 207?", "\n202\nCalculate the remainder when 311019391 is divided by 103673127.", "\n10\nCalculate the remainder when 98979903 is divided by 110964.", "\n15\nWhat is the remainder when 48318015 is divided by 6039751?", "\n7\nWhat is the remainder when 6535789 is divided by 933683?", "\n8\nCalculate the remainder when 8831927 is divided by 670.", "\n657\nWhat is the remainder when 928886 is divided by 454?", "\n2\nWhat is the remainder when 531313 is divided by 492?", "\n445\nCalculate the remainder when 8631804 is divided by 4136.", "\n4108\nCalculate the remainder when 380005 is divided by 299.", "\n275\nCalculate the remainder when 2835 is divided by 2251.", "\n584\nCalculate the remainder when 735259 is divided by 5570.", "\n19\nCalculate the remainder when 20947 is divided by 4143.", "\n232\nWhat is the remainder when 15573629 is divided by 136?", "\n133\nCalculate the remainder when 126337 is divided by 4676.", "\n85\nWhat is the remainder when 2083998 is divided by 2939?", "\n247\nCalculate the remainder when 466049 is divided by 1299.", "\n1007\nWhat is the remainder when 294680998 is divided by 1164747?", "\n7\nWhat is the remainder when 50239197 is divided by 10?", "\n7\nWhat is the remainder when 10583142 is divided by 1223?", "\n523\nWhat is the remainder when 2579517 is divided by 32?", "\n29\nCalculate the remainder when 121350809 is divided by 289.", "\n287\nCalculate the remainder when 160292 is divided by 86.", "\n74\nWhat is the remainder when 5076154 is divided by 1015221?", "\n49\nWhat is the remainder when 63345625 is divided by 3976?", "\n3969\nCalculate the remainder when 21910884 is divided by 10955422.", "\n40\nWhat is the remainder when 7324794 is divided by 499?", "\n472\nCalculate the remainder when 340724303 is divided by 24.", "\n23\nCalculate the remainder when 3777912 is divided by 1357.", "\n24\nCalculate the remainder when 57980 is divided by 107.", "\n93\nCalculate the remainder when 549318 is divided by 16151.", "\n184\nWhat is the remainder when 95939 is divided by 8690?", "\n349\nWhat is the remainder when 170317 is divided by 56510?", "\n787\nWhat is the remainder when 2028192 is divided by 14804?", "\n44\nCalculate the remainder when 38440480 is divided by 1671325.", "\n5\nCalculate the remainder when 193929 is divided by 4388.", "\n857\nCalculate the remainder when 22642 is divided by 277.", "\n205\nWhat is the remainder when 2974820 is divided by 156569?", "\n9\nCalculate the remainder when 46870 is divided by 7786.", "\n154\nWhat is the remainder when 474049 is divided by 469663?", "\n4386\nCalculate the remainder when 39308 is divided by 38838.", "\n470\nCalculate the remainder when 3007703 is divided by 845.", "\n348\nCalculate the remainder when 1197384 is divided by 1197376.", "\n8\nCalculate the remainder when 14562723 is divided by 160.", "\n3\nCalculate the remainder when 4591018 is divided by 765169.", "\n4\nCalculate the remainder when 67450 is divided by 13412.", "\n390\nCalculate the remainder when 2076628 is divided by 2.", "\n0\nCalculate the remainder when 24377702 is divided by 18.", "\n14\nWhat is the remainder when 78371635 is divided by 72?", "\n67\nCalculate the remainder when 29714 is divided by 734.", "\n354\nWhat is the remainder when 23392471 is divided by 137?", "\n132\nCalculate the remainder when 207864 is divided by 73.", "\n33\nCalculate the remainder when 2343754 is divided by 22.", "\n6\nWhat is the remainder when 3514717 is divided by 733?", "\n715\nWhat is the remainder when 112686 is divided by 112649?", "\n37\nWhat is the remainder when 259432 is divided by 4776?", "\n1528\nCalculate the remainder when 3210886 is divided by 3300.", "\n3286\nWhat is the remainder when 503165 is divided by 313?", "\n174\nWhat is the remainder when 715052 is divided by 118950?", "\n1352\nCalculate the remainder when 11412 is divided by 3352.", "\n1356\nCalculate the remainder when 3346984 is divided by 453.", "\n220\nCalculate the remainder when 5597837 is divided by 187.", "\n179\nWhat is the remainder w" ]

{ "pile_set_name": "DM Mathematics" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0002777777777777778, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00029726516052318666, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Oil Field EquipmentOil Field ServiceOil Well DrillingOilfield Equipment ManufacturingStallion Oil Field Services\n\nAction Towing\n\n261 County Road 112Carthage, TX, 75633\n\n9034438989\n\nPublic email (click to show)\n\nAs a towing service, we pride ourselves on offering excellent customer service in emergencies and 24 hours a day, 7 days week. ", "Action Towing is a reputable tow truck service in Marshall that has decades of experience and drivers with a stellar record for transporting all manner of vehicles. ", "Whether you have a heavy duty equipment load or you need winch out services, we have state of the art equipment to handle the tasks. ", "And our drivers have deep knowledge of the region so they always show up in a timely manner with a great attitude and accurate solutions for your car and truck problems.", "\n\nAction Truck & Auto LLC in Carthage TX can virtually take on any type of motor vehicle with multiple issues. ", "Many of these issues may include brake repairs, full engine repairs, DOT inspections and then some! ", "Like we’ve said our team of pros is committed to providing you with a quick assessment and then get to repairing your problem on the fly.", "\n\nOur Business directory offers quality and professionally edited company listings, which are organized in the most relevant categories that enable customers to easily, locate businesses and businesses to easily find customers. ", "With Focus on rising consumer demand, our directory has continuously evolved to a feature rich listing of over 20 million American businesses." ]

{ "pile_set_name": "Pile-CC" }

[ 0.000026259584748433177, 0.00007346189164370983, 0, 0, 0.00008116224332440549, 0.0001, 0, 0, 0 ]

[ "<a class=\"anchor\" name=\"memcached\"></a>\r\n<div class=\"row\">\r\n <div class=\"col-lg-12\">\r\n <h1><img src=\"<?php echo $neardHomepage->getResourcesPath() . '", "/img/memcached.png'; ?", ">\" /> <?", "php echo $neardLang->getValue(Lang::MEMCACHED); ?", "> <small></small></h1>\r\n </div>\r\n</div>\r\n<div class=\"row\">\r\n <div class=\"col-lg-6\">\r\n <div class=\"list-group\">\r\n <span class=\"list-group-item memcached-checkport\">\r\n <span class=\"loader\" style=\"float:right\"><img src=\"<?php echo $neardHomepage->getResourcesPath() . '", "/img/loader.gif'; ?", ">\" /></span>\r\n <i class=\"fa fa-bar-chart-o\"></i> <?", "php echo $neardLang->getValue(Lang::STATUS); ?", ">\r\n </span>\r\n <span class=\"list-group-item memcached-versions\">\r\n <span class=\"loader\" style=\"float:right\"><img src=\"<?php echo $neardHomepage->getResourcesPath() . '", "/img/loader.gif'; ?", ">\" /></span>\r\n <i class=\"fa fa-puzzle-piece\"></i> <?", "php echo $neardLang->getValue(Lang::VERSIONS); ?", ">\r\n </span>\r\n </div>\r\n </div>\r\n</div>" ]

{ "pile_set_name": "Github" }

[ 0.000042165626581211, 0, 0, 0, 0.000012486109203511094, 0, 0, 0, 0.00002986055122577563, 0, 0, 0, 0 ]

[ "Menu\n\nTake-Two Interactive Software, Inc. today announced that David Ismailer has been appointed as the new President of 2K, a wholly-owned label of the Company that develops and publishes interactive entertainment for consumers around the globe.", "\n\nMr. Ismailer began working with Take-Two in 2002 as Vice President and Senior Counsel. ", "In 2005, the year that 2K was formed, he was appointed the label’s Chief Operating Officer and Senior Vice President of Publishing Operations. ", "During his tenure in that position for more than a decade, Mr. Ismailer oversaw 2K’s day-to-day operations and diversification, including building and supporting 2K’s world-class teams, and their ability to deliver consistently some of the industry’s most critically and commercially successful franchises such as BioShock, Borderlands, Carnival Games, Mafia, NBA 2K, Sid Meier’s Civilization, WWE 2K and XCOM. ", "Prior to joining Take-Two, he was an attorney at Morrison Cohen, where he practiced M&A and intellectual property law.", "\n\nMr. Ismailer holds a Bachelor of Business Administration from the University of Michigan and a J.D. from the Benjamin Cardozo School of Law.", "\n\n“David is one of our most driven and dedicated leaders, who has a proven track record of success and an overwhelmingly profound sense of team,” said Strauss Zelnick, Chairman and CEO of Take-Two. “", "Since the formation of 2K, he has played an integral role in its evolution to become one of the industry’s premier labels that is renowned throughout the world for its portfolio of iconic franchises. ", "We are confident that under David’s leadership, 2K will continue to flourish and reach exciting new heights for many years to come.”", "\n“Having been at 2K since day one, I’ve had the pleasure of working alongside some of the most talented and committed professionals in our industry,” said David Ismailer, President of 2K. “I am immensely proud of what we have achieved together. ", "My goal is to enable and empower our teams further, and to provide them with the opportunity to build upon our rich history of creating innovative and engaging entertainment experiences for audiences around the world.”" ]

{ "pile_set_name": "Pile-CC" }

[ 0.000016524555489457336, 0.00012624668602449185, 0.000048902146804244705, 0.00004143948946548979, 0.00007181844297615628, 0.00019837333862328903, 0.0000252518875785965, 0, 0.0000573921028466483, 0.000016659725114535613, 0 ]

[ "Woodbridge Veterinary Group\n\nWoodbridge Veterinary Group\n\nLocation\n\nContact Info\n\nAbout Business\n\nThe Woodbridge Veterinary Group has been caring for pets and their people since 1982. ", "We are committed to the human-animal bond by providing the highest standards of pet health care and education available. ", "It means that we emphasize prevention as well as healing. ", "Our facility is inspected and certified yearly by the New Jersey Veterinary Medical Association to ensure that your pet receives the best health care available. ", "We provide continuing education programs to our doctors and staff, and have established a consistent program of procedures and techniques that have been proven to keep your pets healthy. ", "There is a full range of medical and surgical services available to ensure every pet’s health." ]

{ "pile_set_name": "Pile-CC" }

[ 0.00005907372400756144, 0, 0, 0.000038578758535550326, 0, 0 ]

[ "Garlin Gilchrist II tapped as Gretchen Whitmer’s running mate\n\nThe right loss can lead to the perfect win, as Democratic gubernatorial nominee Gretchen Whitmer announced Garlin Gilchrist II as her running mate in the 2018 election. ", "Gilchrist, who has never held elected office and narrowly lost the 2017 race for Detroit City Clerk in November to Janice Winfrey, has a proven background in technology and community organizing that can help move Michigan’s government into the 21st century and get things done for families across the state.", "\n\nGilchrist, 35, is the former director of Innovation and Emerging Technology for the city of Detroit and serves as executive director for the Center of Social Media Responsibility at the University of Michigan.", "\n\n“I’m so proud to partner with Gretchen (Whitmer) as we work together to build a better Michigan for everyone,” said Gilchrist. “", "I was born in Detroit. ", "I love this state, but like many young adults, after I graduated from U of M, I left Michigan behind for better opportunity. ", "In 2014, my wife Ellen and I made the affirmative decision to come back to Detroit to help rebuild our city, to help repair our state, and to raise our children as Michiganders. ", "I’m humbled and honored to join Gretchen Whitmer on the campaign trail, to bring people together from the UP to Detroit to solve problems and get things done for my children and for yours.”", "\n\nGilchrist was born in Detroit and attended Detroit Public Schools until his family moved to Farmington when he was 8-years-old. ", "He graduated high school and went on to attend the University of Michigan School of Engineering on a full academic scholarship. ", "After college, he moved to Washington to work as a software engineer at Microsoft and serve as the Social Media Manager for the 2008 Obama campaign. ", "Gilchrist also worked as a community organizer in Washington, D.C. at the Center for Community Change and MoveOn.org, where he spearheaded projects to protect and expand Medicaid.", "\n\nIn 2014, Gilchrist and his wife, Ellen, made the decision to move back to Detroit to raise their family and help contribute to the future of the city. ", "He served as the Detroit’s first-ever Director of Innovation & Emerging Technology and created a system for Detroiters to report problems in their communities, from potholes to broken street lights to clogged storm drains.", "\n\nGilchrist emerged as a leading candidate in recent weeks as Whitmer focused on picking her running mate following her win in the Aug. 7 primary. ", "The selection of Gilchrist would add a Detroiter and racial and gender diversity to a statewide ticket dominated by white women.", "\n\n“Garlin Gilchrist is a proven problem solver. ", "He shares my commitment to public service, dedication to family, and love of Michigan and I’m proud to have him as a partner,” said Whitmer. “", "Garlin came back to Detroit and got to work solving problems that actually made a difference in people’s lives – from designing a system to report potholes, to fixing broken fire hydrants, to making city government more open and transparent. ", "He is exactly the kind of young, innovative, and progressive problem-solver I need working with me in the governor’s office to move our state government forward and get things done for Michigan families, like fixing the damn roads, cleaning up our drinking water, repealing the retirement tax, and making sure every Michigander has a great public education that gets them on a path to a high wage skill.”", "\n\nIn his race for Detroit City clerk in 2017, even as a newcomer, Gilchrist significantly outraised incumbent Janice Winfrey, with $308,794 mostly from small donations from contributors across the country while Winfrey raised only $29,300. ", "But he ultimately lost the race by 1,482 votes, out of nearly 100,000 ballots cast.", "\n\nGilchrist’s selection is a nod to the growing movement of often young and liberal progressives in the state. ", "He will help bring young people out to vote and help mobilize African-American voters in Detroit.", "\n\n“He brings a lot of what Democratic Party needs — somebody with a lot of energy,” Detroit political consultant Jamaine Dickens said. “", "He is somebody who is thoughtful and who thinks through issues. ", "And he proved himself to run a good campaign.”", "\n\nThe Michigan Democratic Party will officially vote on the Lieutenant Governor nominee at this Sunday’s convention in East Lansing." ]

{ "pile_set_name": "Pile-CC" }

[ 0.00007431629013079666, 0.000021220384301159695, 0.00006738393117854496, 0.0001183431952662722, 0, 0.000064, 0.00003156167150612296, 0.000055989473978891965, 0.0000591715976331361, 0.00006103515625, 0.00009008603216071348, 0.000124840048687619, 0.00008543722499893203, 0.00002029056083110137, 0.00004627701420704336, 0.00006103515625, 0, 0.00004959333465582226, 0.00001707533638412677, 0.000006126850308793256, 0.00005208333333333334, 0, 0, 0, 0.00010813148788927336, 0, 0, 0.0000573921028466483 ]

[ "Thank you Alex. ", "I had already followed the instructions in your link prior to calling today. ", "Vodafone representatives have already told me today there is an issue regarding Wi-Fi calling with the latest firmware on this phone so why are you sending me to a link that does not help the situation? ", "If you could explain that to me in some kind of detail that would help me and any other people looking for a solution that would be really helpful.", "\n\nJust for the record, the instructions in your link are out of date for Android 7 on the Galaxy S7. ", "These are the instructions provided but I can't see Phone after choosing Application:\n\nGo to Settings, scroll down and choose the Application icon\n\nChoose Phone and scroll down until you see Wi-Fi Calling – select the box beside this option\n\nA pop-up will appear asking you to confirm if you want to enable Wi-Fi Calling – tap OK\n\nI had to go to Settings > Application > Menu > Show System Apps > And then Phone.....and Wi-Fi Calling still isn't there because Vodafone have cocked up the firmware.", "\n\n3) (For some reason accessing the phone settings via the applications menu) Settings->Applications->\"vertical dots\"->Show system apps->(scroll down to Phone, there are 3)->Tap the top one (280KB)->More settings->(scroll down to bottom). *", "NOTE - This is the exact same settings menu as number 1.*", "\n\n4) Texting CALLING to 97888.", "\n\n5) Using the MyVodafone app to turn off wi-fi calling, waiting and then re-enabling and waiting for confirmation.", "\n\nThe guide on the website to enable wifi calling does not correlate to the newest android system. ", "Nougart (7) has different settings menus and different options, such that the guide on the vodafone website isnt possible to follow step-by-step. ", "This is pretty unacceptable bearing in mind that Nougart has been out so long.", "\n\nMy issue is STILL not sorted, I have followed the steps from the private message one of the moderators sent, and my email recieved no reply.", "\n\nThis is a vodafone issue, something on their firmware is not allowing this to work, surely someone must have a simple patch.", "\n\nLeave the remaining 4 settings as they are. ", "Then press 3 dots and save the added APN\n\nThen select the added APN and restart the phone. ", "WI FI calling will appear once new APN embeds and gets registered. ", "I did this on my phone after Factory Reset and Wi Fi calling option appeared afer about 40 minutes and when I go into APN settings the added APN is appearing as embedded thus if you click on it, you can not change the settings apart from deleting it completely. ", "Hope this helps\n\nThe other way of doing this is asking Vodafone to send Configuration settings message for MMS and Browser . ", "It is basically the same as the manual process I have described in a previous post but sent by network and once you receive them, simply press install and restart the phone . ", "I had same issues with A5 and S7 edge, it is all to do with correct config settings and not the firmware. ", "Simple solution should be text WEB to 40127 and trigger config settings to be sent to you. ", "But when I sent the text the reply was your phone is not capable of receiving automated settings please complete set up manually.", "\n\nIf your phones were supplied by Vodafone then I would have thought WiFi calling would have been enabled as standard as you should have all the Vodafone software already. ", "As for myself my S7 edge is from CPW not Vodafone and l have WiFi calling enabled and working with android 7 without any problems. ", "Once WiFi calling is set up and working and you have it enabled it will come on automatically when you don't have a strong signal. ", "The only thing l can think of is there must be some kind of problem with the Vodafone software which is not allowing the WiFi calling features to work.", "\n\nI'm glad you replied Stevie, because it has cemented in my mind how utterly useless vodafone is. ", "You got your S7 elsewhere, and you managed to enable wifi calling....this is despite the claims vodafone make that you must get your phone direct from them for wifi calling on their network to be available. ", "This makes me incredibly angry, but I thank you for the information nonetheless.", "\n\nI have followed the advice given and text WEB for the configuration settings, which i promptly received and installed. ", "Prior to this I followed the steps to manually create an APN. ", "Neither way has made the option appear, after restarting and everything, I've waited longer than 40 minutes (good few hours) and still nothing.", "\n\nChanging the APN settings and asking Vodafone to send a Configuration settings message is essentially the same thing and this will not help us because the option for Wi-Fi Calling is completely missing from our phones. ", "The cause of the problem is the firmware that Vodafone have pushed out to our handsets and they will need to provide a patch / update to rectify this. ", "Changing settings will not make an option appear in a settings menu that was not there before.", "\n\nFirst was my wife's phone brand new Galaxy A5 2017 and Wi Fi calling option was not available in the menu. ", "Wi Fi calling option appeared after asked Vodafone for 20 times to send me correct config settings. ", "I swapped sim card around few times and config message finally arrived. ", "installed restarted and Wi Fi calling option magiacally appeared.", "\n\nExactly the same issue with my recently upgraded s7 edge . ", "No wi fi calling option in the menu and phone would not receive the config text even after swapping sim cards. ", "I than copied the settings for APN from my wife's phone and after doing factory reset registered APN as I have described in a previous post. ", "Result was the Wi Calling option appeared. ", "I will attach few pictures to confirm\n\nI have fixed the issue on my handset. ", "It seems the problem was caused by the Samsung Touchwiz Launcher that Vodafone have tinkered with I must add before Vodafone blame Samsung! ", "All I did to resolve the problem was to install a different launcher. ", "I installed the Google Now Launcher from Google Play and the Wi-Fi Calling feature appeared and it works really well. ", "Here are the steps I took to resolve it which I hope will be able to help other people:\n\n1) Open the Google Play app\n\n2) Search for Google Now Launcher and install it\n\n3) Open Google Now Launcher and it will ask you to select a home app\n\n4) Choose Google Now Launcher\n\n5) Now open the Phone app and tap on the three dots in the top right corner\n\n6) Settings\n\n7) Wi-Fi Calling should be near the bottom where you can enable it\n\nIn my opinion Google Now Launcher is much better than the Samsung Touchwiz anyway. ", "It's seems to be a bit smoother and also has some pretty cool additional features such as screen search.", "\n\nAlso, out of curiosity I just uninstalled Google Now Launcher and reverted back to Touchwiz and the Wi-Fi Calling setting stayed in place so if you don't like Google Now Launcher you don't have to use it.", "\n\nGlad to hear you found a solution that works for you. ", "My personal opinion is that mobile companies shouldn't be allowed to mess around with any of the updates apart from testing them nor should they add any bloatware that is not needed and 99% of there customers do not want in the first place and that's the main reason I always buy my phones unbranded & simfree and swap networks every so often.", "\n\nBrand new S7, Vodafone supplied, updated to Android 7 as soon as it came out the box, no wifi calling option, Vodafone online hopeless - 'take it to the nearest shop', telephone support just as bad, fobbed me off to Samsung after he had problem identifying his Android versions, Samsung said its Vodafone's problem. ", "Not at all impressed, wifi calling was one of the main reasons for going with Vodafone." ]

{ "pile_set_name": "Pile-CC" }

[ 0.00390625, 0, 0.000024266543716178507, 0, 0.0000980296049406921, 0.000024290612892647634, 0.00001736111111111111, 0, 0, 0, 0, 0.00004691311690748733, 0.00016436554898093358, 0, 0, 0, 0.00024151672503320857, 0.0002227667631989307, 0.000029135831245265425, 0.000192, 0, 0.00008899964400142399, 0.00012075836251660429, 0, 0.00010140616549486209, 0.00017481498747159256, 0.00005827166249053085, 0.00008771545107670716, 0, 0, 0, 0, 0.0002601456815816857, 0, 0.00006142380377142156, 0.00004385772553835358, 0, 0, 0.0001, 0, 0, 0, 0, 0.0001005985614405714, 0, 0, 0.0002040816326530612, 0, 0.00014363688595231256, 0.000015378700499807765, 0, 0.00007069469318503158, 0, 0, 0.00006922194533444087, 0.0002642356982428326 ]

[ "Q:\n\nHow to quantify phase distortion of a filter specific to a signal?", "\n\nFor example, a EKG input signal is filtered with a known transfer function that does not have linear phase. ", "How do you quantify the phase distortion of the output signal given you have the input? ", "I know that the phase response of the transfer function gives the phase delay at all frequencies but I'm not sure how to make use of this.", "\n\nA:\n\nFor a phase distortion metric I recommend using “group delay variation”. ", "The definition of Group Delay is the negative derivative of phase with respect to frequency. ", "The Group Delay is the delay in time that “group” of signals over a band of frequencies would have. ", "A frequency response that is linear in phase (constant group delay with no variation) is not considered a distortion since all the frequency components would have the same delay so no actual distortion of the signal results. ", "When the phase is not linear versus frequency (as in your plots) different frequency components of the signal arrive at different times at the output of the system, which can result in considerable distortion. ", "Group Delay variation can be quantified as peak variation, peak to peak, or rms as in any other distortion metric.", "\nAs MattL points out in the comments below, a more comprehensive metric would be deviation from linear phase, where linear phase strictly means proportional to frequency with no phase offset term. ", "If a phase offset exists, it would not appear in the result for the group delay computation yet indeed contribute to a distortion due to a varying delay versus frequency (the Hilbert Transformer is an excellent example of this: in order for all frequency components to have a 90° relationship with the input waveform, each component must have a different delay). ", "For further details on this see Matt's answer here:\nGroup Delay for Hilbert Transformer and Resulting Dispersion \n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0.00008264462809917355, 0, 0, 0, 0.00011562030292519367, 0.0001, 0, 0, 0.00007694675284702985, 0, 0.00000758903839294523, 0.0001512287334593573 ]

[ "The Most Ridiculous Item On The Menu\n\nApril 22, 2011\n\nThe scarcely believable monstrosity that is paper roast, and how it nearly killed me.", "\n\nI assumed they'd made a typographic error. ", "On the menu board above the washbasins in Sree Aryaas Hotel, opposite Varkala railway station, there was something called paper roast. ", "Surely they meant pepper? ", "I chuckled to myself, imagining the edges of a newspaper curling up and catching fire inside an oven, then I carried on eating my masala dosa.", "\n\nThat was over two years ago, when I was new to India and the often curious way in which dishes are named. '", "Fish fry' instead of 'fried fish'. '", "Egg roast', 'egg curry' and 'egg masala', three different types of egg-in-spicy-gravy that at some restaurants taste exactly the same. ", "The difference was that with these, the name offered a clear idea of what it represented. ", "But paper roast? ", "That could be anything.", "\n\nI started seeing it more and more on restaurant menus. ", "It became a cat-and-mouse game that I failed to acknowledge, a cosmic attraction between a South Indian dish and a young and impressionable foreigner. ", "The interesting thing was that it was always the most expensive item on the menu, usually around Rs. ", "60 (by comparison, a masala dosa is anywhere between Rs. ", "20-30). ", "This made it impossible to ignore.", "\n\nFinally, this week I went to a restaurant near my office with my friend Ron for moral support and took the plunge. “", "Paper roast,” I said when the waiter looked at me. ", "The words felt funny coming out of my mouth, like a secret code. ", "They may as well have been. ", "I still had no idea what I was in for.", "\n\nRon's masala dosa came, and he finished it before my paper roast arrived. ", "Though his masala dosa looked tasty – as all masala dosas do – this only heightened the suspense. ", "If something takes so long to make, it must be good.", "\n\nAnd then it came, my very own paper roast, and it made my mouth drop open in shock. ", "It was a dosa – a pancake made of rice flour – but the biggest, crispiest dosa one could conceive of. ", "It arrived brought by two people and on three trays: two for the metre-long tube of dosa, one for the condiments (sambar and two kinds of chutney). ", "If I'd held it up and stood next to it, all 6'5” of me, it would've been more than half my height. ", "If I unrolled it and pressed it flat, it would have been as big as our table for four. ", "It was, without question, the most ridiculous thing I'd ever seen in a restaurant.", "\n\nConsidered thought and debate are no help when confronted with the task of eating paper roast, so I relied on intuition. ", "I first broke it into two halves so it would fit on one tray, where it resembled a pair of outsize shotgun barrels. ", "Ron snapped a quick photo before I tucked in. ", "I looked manic and a little terrified.", "\n\n'Paper' was not a misnomer. ", "The dosa was wafer-thin, and it had been fried in ghee to crisp perfection. ", "I broke a piece off hesitantly and placed it in my mouth... and it was of course absolutely delicious. ", "The next piece was used to test the sambar. ", "World class. ", "Then the chutneys. ", "Not earth-shattering, but good enough. ", "Put it all together, and I'd found my new culinary obsession.", "\n\nMy pace quickened as I grew accustomed to the required technique, flattening a section a little and then shovelling in the shards created. ", "Very soon, a sharp and poorly chewed piece of dosa lodged in my throat. ", "These things ought to carry a health warning, I thought. '", "Contains sharp pieces. ", "Not suitable for children under the age of 8.' ", "They could add 'May cause heart attack on sight' underneath. ", "Paper roast was like the South Indian version of those challenge hamburgers at Texan diners, the ones that take several pounds of beef and are free if you can finish them. (", "The shard remained in my oesophagus for the remainder of the evening.)", "\n\nThrough the ebb and flow of conversation with Ron, I kept on eating, barely pausing for more than five seconds at a time. ", "Half an hour passed. ", "I still had paper roast left on my tray. ", "It was still just as crispy and delicious, as if to taunt me. ", "I wasn't full yet, so I vowed to finish it and carried on, but I experienced an emotion I've never felt during a meal before: boredom. ", "This thing was so big and took so long to eat that even though I was having it for the first time, I got bored while eating it.", "\n\nPaper roast, the dosa that goes to 11. ", "Paper roast, the meal of a lifetime, so stupendous you only need to eat it once. ", "Paper roast, the food that defeats you through sheer perseverance. ", "It wasn't me that persevered at carrying on until there was nothing more left; it was the paper roast. ", "When it was finally finished, fully 40 minutes after it was brought out, I said to Ron, “That was fantastic. ", "I'll never eat it again.”", "\n\n15 Comments\n\nBy delia\n\n20.01.12 05:46 PM\n\nLaughed and had tears running down my cheeks reading your post. ", "Thanks it was real funny. ", "I love to see the expressions of others when I order this dosa and the waiter brings it out especially here in Australia where it is not seen by many.", "\n\nBy Barnaby Haszard Morris\n\n17.12.11 01:59 PM\n\nI have never had that one, though I've seen it! ", "Surely you have to flatten it to eat?", "\n\nBy So\n\n15.12.11 01:44 AM\n\nHahaha, loved the post !! ", "Thats my fav kind of dosa thou :) I love the paper roast in all shapes and sizes. ", "Have you ever tried the one that comes rolled up like a cone and they stand it on your plate like a circus hat ?? :)", "\n\nBy Cutting Kahlua\n\n01.06.11 07:38 PM\n\nHow cute! ", "I have seen paper dosa offered at many restaurants, so I never dared to try it. ", "Maybe with a large group of people someday. ", "You are really funny.", "\n\nBy Rajesh\n\n24.05.11 02:27 PM\n\nAm very curious on your first experience eating PUTTU.", "\n\nBy JJ\n\n26.04.11 12:29 PM\n\n:D That was a really good article. :))", "\n\nNever even eaten anything like that. ", "Will surely try it next time am in some good place with friends. ", "it's impossible for one person like me to finish it\n\nBy priya\n\n26.04.11 11:15 AM\n\nI love paper roast..But i guess you definitely need some company to finish it off. ", "At the same time it is delicious. ", "May be the shard which got stuck in your throat spoiled the fun!", "\n\nBy Rituparna\n\n25.04.11 08:58 PM\n\nI love a paper roast/dosa but yes it does get really boring. ", "The next time ask a friend to share. ", "That way you get to eat the yummy dosa without getting bored. :-)", "\n\nI ordered Paper Roast Dosa after reading this. ", "I couldn't finish it (the dosa).", "\n\nBy Deepa\n\n23.04.11 05:22 PM\n\nDear Morris\n\nI have laughed my heart out...thats a great tale of a paper roast. ", "I remember my mouth dropping at its sight even tho I am a South Indian and I had ne'er seen such a mammoth of a dosa to appear before me(that was few years back!). ", "I some restaurants they do have a smaller version of it...we do have here in Dubai.", "\n\nIt's not the dosa that will get you. ", "It's the potato filling that makes it heavy.", "\n\nBy umesh derebail\n\n22.04.11 10:22 AM\n\nLolz, paper dosa is meant for two persons at least i believe. ", "I think it is a novel idea to keep the hungry at bay. ", "Of course for a person who is not used to the concept it would be a shocker of his life." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0.00005486968449931413, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00007181844297615628, 0.00038446751249519417, 0, 0, 0, 0.00017313019390581717, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0004725897920604915, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00006503642039542143, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00008416799932665601, 0, 0.00008573388203017832, 0, 0, 0, 0, 0.0003429355281207133, 0, 0, 0.0004, 0, 0, 0, 0.00013520822065981613, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0004164931278633902, 0, 0.00008116224332440549, 0, 0, 0, 0, 0, 0.0003429355281207133, 0 ]

[ "Die Kreuzen\n\nDie Kreuzen (/ˈdiːˈkɹɔɪtsn̩/) is an American rock band from Milwaukee, Wisconsin formed in 1981. ", "The name, which was taken from a German Bible, is grammatically incorrect German for \"the crosses.\" ", "They began as a hardcore punk group and evolved musically to alternative rock.", "\n\nHistory\nThe band was originally called \"The Stellas\". ", "It consisted of Dan Kubinski on vocals, Brian Egeness on guitar, Keith Brammer on bass guitar, and Erik Tunison on drums.", "\n\nAfter contributing tracks to the Charred Remains and The Master Tape compilations, the band's debut release was the Cows and Beer EP. ", "Their 21-song eponymous debut album was released in 1984, and included new versions of the tracks from Cows and Beer. ", "The 1986 follow-up, October File, saw the band move away from hardcore into slower, more conceptual work. ", "Their third album, Century Days (1988), saw the band incorporate piano and a horn section.", "\n\nIn 1989, as a side project, Brammer joined the band Wreck. ", "Other members worked on side projects, including Kubinski and Egeness's Cheap Trick tribute band Chick Treat. ", "On April 1, 1992, Egeness left the band. ", "Shortly thereafter, the rest of the band members formed the band Chainfall, along with guitarist Charles Jordan (of S.O.D.A and Nerve Twins). ", "Kubinski and Tunison later played in Fuckface, while Brammer played with the Carnival Strippers. ", "Kubinski went on to form a new band, Custom Grand. ", "Kubinski now plays in Decapitado. ", " Egeness has composed scores for the movies The Astonished Man (2008), Wake Before I Die (2011), and The Weather Outside (2011).", "\n\nThe majority of their records were produced by future Nirvana and Smashing Pumpkins producer, Butch Vig. ", "All of their records, with the exception of their first 7\" on Version Sound, were released by the Chicago record label, Touch & Go Records.", "\n\nIn 2005, a tribute to Die Kreuzen was released, Lean Into It - A Tribute to Die Kreuzen, featuring covers of Die Kreuzen songs by Napalm Death, Mike Watt, Voivod, Season to Risk, and Vic Bondi, among others. ", "The album features liner notes by Thurston Moore, who states, \"Man, there was a point there when Die Kreuzen were the best band in the USA\".", "\n\nIn 2011, Die Kreuzen was inducted into the Wisconsin Area Music Industry (WAMI) Hall of Fame. ", "In their acceptance speech, they named a handful of current artists that they thought deserved consideration: IfIHadAHiFi, Northless, the Zebras, and Zola Jesus.", "\n\nDie Kreuzen resumed playing shows, performing at sold-out show May 26, 2012, at Turner Hall in Milwaukee, WI. ", "They recently played the 2013 Roadburn Festival in Tilburg, Holland and the Afterburner show the following day. ", "After their return to the states, Die Kreuzen played a secret show at a small Milwaukee club as a warm up to their May 25 concert at The Double Door in Chicago, Ill and their much anticipated return to Turner Hall on May 26, 2012. ", "Die Kreuzen scheduled shows in Green Bay and Madison, WI and Minneapolis, MN (with Negative Approach, Mudhoney and The Melvins) later on in the summer of 2013. ", "Die Kreuzen also played at McAuliffe's Pub in Racine, Wisconsin, July 17, 2013. ", "A book entitled The Crossing: The Oral History of Die Kreuzen is currently in production with a tentative 2016 completion date.", "\n\nMusical style\nThe band were initially a hardcore punk band but took in elements of heavy metal, gothic rock, shoegaze and alternative rock. ", "They have been described as \"anticipating the grunge rock sound of the '90s\" and were credited with bringing intelligence and lyrical diversity to the heavy metal genre. ", "In 1986, Robert Palmer of The New York Times described Die Kreuzen as \"one of the new bands recasting the legacy of 70's Gothic-metal (Black Sabbath, etc.) ", "for this modern age\".", "\n\nDiscography\n\nAlbums\n Die Kreuzen (1984)\n October File (1986, CD included first album)\n Century Days (1988)\n Cement (1991)\n Internal (1993) (promo-only)\n\nEPs\n Cows and Beer (1982)\n Gone Away (1989)\n\n7\" singles\n \"Gone Away\"/\"Different ways\" (live) (1989)\n \"Pink Flag\"/\"Land of Treason\" (1990)\n \"Big Bad Days\"/\"Gone Away\" (acoustic) (1991)\n\nDemo releases\nDemo Tape (1982)\n\nCompilation appearances\nCharred Remains compilation tape (1981, Version Sound): \"Pain\", \"Hate Me\"\nThe Master Tape LP (1982, Affirmation): \"On the Street\", \"All White\", \"Fighting\"\nAmerica's Dairyland tape (1983, Last Rites): \"Think For Me\", \"Enemies\", \"Rumors\"\nCode Blue tape (1984, Last Rites): \"Fuck Up\", \"Live Wire\", \"Champs\"\nSugar Daddy Live Split Series Vol. ", "5 split 12\" with the Melvins, Negative Approach and Necros (2012, Amphetamine Reptile Records): \"In School\"\n\nSee also\nWreck (band)\n\nReferences\n\nExternal links\nOfficial website\nBrian Egeness's Official website\nBrian Egeness on IMDB\nDecapitado official website\nAmerican Hardcore - film containing early footage of the band\nInterview with bassist Keith Brammer at Perfect Sound Forever\nAlbini, Steve (1986) \"DIE KREUZEN: PUTTING WITH POTATOES\" (interview), Forced Exposure, Issue No.", " 10\nTrofobya, Klaus \"Die Kreuzen Review\", Head Heritage\nConan Neutron's Protonic Reversal Episode 106 - Keith Brammer (Die Kreuzen) \n\nCategory:Alternative rock groups from Wisconsin\nCategory:Hardcore punk groups from Wisconsin\nCategory:Musical groups from Illinois\nCategory:Musical groups established in 1981\nCategory:Musical groups disestablished in 1992\nCategory:Touch and Go Records artists" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.00008264462809917355, 0, 0, 0, 0.0002732053821460283, 0.00010813148788927336, 0.00007181844297615628, 0, 0, 0.0002687449610319807, 0.0003305785123966942, 0.000594883997620464, 0.00014878000396746676, 0.0003188436603252205, 0.0007689350249903883, 0.0017301038062283738, 0, 0.0002620316184819635, 0.00005175715542673775, 0.00013605442176870748, 0.0001020408163265306, 0.00021701388888888888, 0.00007715751707110065, 0.00015943877551020407, 0.00007831466833737959, 0.00003748055696107644, 0.0001953125, 0.0003125, 0, 0, 0, 0.00016436554898093358, 0, 0.000011106483409690407, 0.00003472222222222222, 0.0000323731458280727 ]

[ "\nTurbocharged Raspberry Pi 2 unleashed - mmastrac\nhttp://www.theregister.co.uk/2015/02/02/raspberry_pi_model_2/\n======\nschappim\nWhat's the same:\n\n\\- Same form factor as the model B+ (your enclosures and daughter boards\nshould still fit).", "\n\n\\- Same full size HDMI port\n\n\\- Same 10/100 Ethernet port\n\n\\- Same CSI camera port and DSI display ports\n\n\\- Same micro USB power supply connection\n\nWhat has changed:\n\n\\- A new turbocharged Broadcom BCM2836 900MHz quad-core system-on-chip with\nperformance at least 6x that of the B+.", "\n\n\\- 1GB of RAM\n\nSource: [http://raspberry.piaustralia.com.au/products/raspberry-\npi-2-...](http://raspberry.piaustralia.com.au/products/raspberry-pi-2-model-b)\n\n~~~\narbuge\nUnder the \"Same\" column, it looks like you need to add \"Same price - $35\".", "\n\nI stocked up on B+s over Christmas - oh well...\n\nThe \"at least 6x\" performance claim should be \"at least 3x\" by the way, and\neven that is an estimate, not a guarantee. ", "The 3x is on a single thread\ncomparison, the 6x is on a somewhat synthetic multicore benchmark test.", "\n\n~~~\nhayksaakian\nCan you return them? ", "If its less than 30 day...?", "\n\n~~~\nksrm\nIn the EU, the consumer rights directive allows you to return most goods\nbought online up to 14 days after delivery.", "\n\n------\nzumtar\nInteresting to see a Broadcom logo and chip markings visible on the CPU now.", "\n\nLove 'em or hate 'em, I suspect Broadcom are very happy about this as those\nchip markings are prime marketing real estate.", "\n\nConsidering the phenomenal success of the previous Raspberry Pi units this\nprobably formed part of the negotiations for the CPU price.", "\n\nThere are of course other considerations such as trace lengths and\navailability of packages for both the CPU and LPDDR2 but that logo being\ndirectly in the hands of the engineers of tomorrow makes a big difference.", "\n\nThe previous models used a PoP (Package-on-Package) stack of the CPU and SDRAM\nand now they've moved to discrete SoC and DDR2 packages (with the DDR2 chip\nnow on the underside of the PCB).", "\n\n~~~\npjc50\nOne of the announcement posts said \"this Broadcom chip will be available for\nsale subject to meeting MOQ\". ", "So I'm expecting someone will do a kickstarter\nto buy 10k of them and reship them as singles. ", "No longer doing POP moves it\nfrom \"nope\" territory into something the average small assembly house should\nbe able to cope with. ", "Not that you need to do this given that the compute\nmodule exists, but I'm sure someone will want to do it.", "\n\n------\nwyager\nI wish they would release one with DMA based gigabit Ethernet. ", "That always\nseems to be the bottleneck for me.", "\n\n~~~\n20kleagues\nIt would have been much sense with the newer CPU. ", "My old Pi hiccups at very\nhigh IO over ethernet, specially when I am processing the incoming streams.", "\n\n~~~\ngeerlingguy\nSame here; I've found the CPU to generally be the limiting factor, with IO\n(network or disk) only sometimes coming into play. ", "The somewhat faster CPU\ncould definitely help in this regard, but doesn't the network jack go through\na USB 2.0 bus? ", "If that's the case, that's probably the limiting factor.", "\n\n------\nrasz_pl\nWonder if they fixed USB problems (dma/internal bus bottlenecking or\nsomething). ", "Info about quad core CPU is a bit sketchy, either its one of\nCortex cores, or BCM tweaked ARM11/bumped L1 cache to max 64KB value and/or\nadded proper L2 cache.", "\n\nSo many unknowns.", "\n\nEdit:\n\nMilhouse, Team-Kodi Member: \"ARMv7 and NEON instructions\"\n[http://forum.kodi.tv/showthread.php?tid=217040&pid=1911780#p...](http://forum.kodi.tv/showthread.php?tid=217040&pid=1911780#p..).", "\n\nWOOOHOOO now we are cooking, Broadcom is back in business, first hiring real\nflesh and blood open source GPU drivers developer, now this. ", "Next thing you\nknow they will open up DSI port specification or something :o\n\n~~~\ntonylemesmer\nSome good detail here from one of the RPi / Broadcom engineers:\n\n[http://jamesrandominfo.blogspot.co.uk/2015/02/raspberry-\npi-2...](http://jamesrandominfo.blogspot.co.uk/2015/02/raspberry-pi-2-b-first-\nimpressions.html)\n\n------\ntbrock\nWhy would anyone buy this over the much more powerful ARMv7 odroid-C1 for $35\nthat has been out for months now?", "\n\n~~~\nbayesianhorse\nThe Raspberry Pi is a platform optimized for and bundled with its community.", "\nThe Raspberry Foundation can produce/license any conceivable number of these\ndevices at the same price point. ", "The difference of for example $35 vs $70\ndoesn't matter very much for individual buyers. ", "It does matter when dealing\nwith educational budgets and a desire for predictable spending. ", "Even when a\nschool/hobbyist course requires students to buy their own devices, even $5\ndifferences can be a big deal.", "\n\nThe fixed price, high bulk, cooperation with education initiatives and\ngovernments, all translates to a relatively homogeneous, unfragmented \"fleet\"\nof devices, which just isn't the norm in small computers.", "\n\nBeagle Bone, the Odroid series, and several other products are technically\nsuperior in most ways. ", "But they don't have a comparable community size, and\naren't focused on the educational sector as much. ", "In some ways, these models\nattach to the Raspberry Pi community.", "\n\n~~~\npjc50\nYou've got it exactly. ", "The whole thing is modeled on the original BBC computer\nlearning project of 30 years ago. ", "The physical Pi device is just a platform\nfor the delivery of educational material. ", "People miss this because most of the\ncommentators here don't need the educational material as they're not\nschoolkids or educators.", "\n\nThe Foundation is doing this in a highly vertically integrated way because it\ngives them predictability and a guarantee that the hardware meets the\neducational needs and also the \"marketing\" needs of turning kids into\nenthusiasts. ", "That's why Minecraft for the Pi is important, for example.", "\n\n~~~\nDanBC\nOne important difference is cost - the BBC micros were expensive compared to\ntheir competition.", "\n\n------\nAl__Dante\nIt's a 900MHz quad-core ARM Cortex-A7 CPU. ", "ARM7, it's official:\n[http://www.raspberrypi.org/raspberry-pi-2-on-\nsale/](http://www.raspberrypi.org/raspberry-pi-2-on-sale/)\n\n~~~\nescap\n\"For the last six months [ RPi team has ] been working closely with Microsoft\nto bring the forthcoming Windows 10 to Raspberry Pi 2. ", "Microsoft will have\nmuch more to share over the coming months. ", "The Raspberry Pi 2-compatible\nversion of Windows 10 will be available free of charge to makers.", "\n\nVisit WindowsOnDevices.com today to join the Windows Developer Program for IoT\nand receive updates as they become available.\"", "\n\n[http://dev.windows.com/en-\nus/featured/raspberrypi2support](http://dev.windows.com/en-\nus/featured/raspberrypi2support)\n\n~~~\njenscow\nI wonder if Microsoft have helped in making the PI capable of running Windows\n10, for the same price.", "\n\n~~~\nbenn_88\nNo, it's just Broadcom and the Raspberry Pi engineering team that made the\nproduct happen. ", "At the point we knew Pi 2 would be happening, the conversation\nwith MS started and they started work porting Windows to it - with a little\nhelp from our engineers.", "\n\n\\- Ben from Raspberry Pi\n\n------\nnathan_f77\nAwesome!! ", "I just wish they would release one with onboard Wifi instead of\nethernet. ", "I have no statistics to back this up, but I'm pretty sure that USB\nWifi adapters would be the most common accessory.", "\n\n~~~\nsdenton4\nI use the onboard ethernet pretty constantly, mainly because I find the\nwireless to be finicky and hard to troubleshoot when you're running a headless\nsetup. ", "I can always plug in an ethernet cable, though...\n\n~~~\ngorgas\nAgree. ", "However Finally I was able to keep an uptime greater than 2 months on\nmy Pi by using a wifi dongle and a bunch of cron scripts to keep alive the\nconnection when my router reboots or the dongle 'freezes' which seems is a\ncommon issue when using RPi of any kind :(\n\n~~~\ngcb0\nthat's probably a bad dongle.", "\n\ni connect my htpc via a Wi-Fi USB dongle as well. ", "it runs both Linux and\nwindows 7. ", "and despite the os and drivers one model always hang after a day or\nso. ", "another one, different model from same brand is online for months at a\ntime.", "\n\nit's mostly badly designed/tested hardware.", "\n\n~~~\ngorgas\nI was expecting a answer like \"my dongle X just works on the Pi\" :-) I do not\ndoubt it is a problem with the hardware or the drivers, I just say it is a\ncommon problem with many dongle vendors specially in the Pi. ", "I know I could\nbuy a RPi-certified dongle, but I do not like wasting hardware if I can fix it\njust with a few scripts. ", "No offense :)\n\n~~~\nTheOtherHobbes\nWiFi on the Pi 'just doesn't work.'", "\n\nYou can get it working for a while, but it's nowhere near the reliability of\nstandard domestic WiFi.", "\n\nI've built various sensor/hardware projects and tried various dongles, and\nI've _always_ had to switch back to a cabled connection.", "\n\n------\nlucaspiller\nHere is the official announcement:\n\n[http://www.raspberrypi.org/raspberry-pi-2-on-\nsale/](http://www.raspberrypi.org/raspberry-pi-2-on-sale/)\n\nIt has an ARMv7 processor.", "\n\n------\nseba_dos1\nThe most important info is missing: does it still require a non-free blob to\neven just boot Linux?", "\n\n~~~\nwmf\nBroadcom is still Broadcom.", "\n\n~~~\nuserbinator\nIt doesn't look like BCM is intending to release any more\ndatasheets/programming information either, which is not surprising. ", "There will\nprobably never be any detailed information released, officially or otherwise,\non any BCM SoCs, even after they're long EOL'd.", "\n\nAs far as openness is concerned the RPi is basically a smartphone/tablet SoC\ndevboard, with most of the hardware proprietary - while its Chinese\ncompetitors (Allwinner, Mediatek, Rockchip, etc.) ", "are officially quite closed\ntoo, the docs for many of their SoCs are available (admittedly leaked; but\nthey seem to be turning a blind eye to it.) ", "They're also at least a Cortex-A7.", "\n\nI wonder how the RPi2 compares to this:\n\n[https://www.olimex.com/Products/OLinuXino/A20/A20-OLinuXino-...](https://www.olimex.com/Products/OLinuXino/A20/A20-OLinuXino-\nLIME/open-source-hardware)\n\nDual 1GHz A7s, 512MB, SATA, HDMI, USB, Ethernet (integrated on SoC, not\nthrough USB), fully open-source, in the same price range.", "\n\n~~~\nlovelearning\nOr this:\n[http://www.hardkernel.com/main/products/prdt_info.php?g_code...](http://www.hardkernel.com/main/products/prdt_info.php?g_code=G141578608433)\n\nQuad core, 1 GB. ", "Released just 2 months ago. ", "Same price as the Pi.", "\n\n~~~\ndataminded\nIt's not just the hardware peripherals, tutorials, books and community count\nfor a lot also.", "\n\n~~~\nlovelearning\nAgreed. ", "Among all the SBC forums, the Pi's is the friendliest community I've\ncome across. ", "You're almost guaranteed to get a reply and it's usually a useful\none.", "\n\n~~~\nuserbinator\nTry asking for something as simple as electrical specifications on the GPIO\npins (Broadcom released the GPIO registers, but oddly enough not the\nelectrical specs):\n\n[http://www.raspberrypi.org/forums/viewtopic.php?f=28&t=63362](http://www.raspberrypi.org/forums/viewtopic.php?f=28&t=63362)\n\n------\nwyldfire\nHow does this compare with the ODROID-C1?", "\n\n[http://www.hardkernel.com/main/products/prdt_info.php?g_code...](http://www.hardkernel.com/main/products/prdt_info.php?g_code=G141578608433)\n\n~~~\ntmuir\nThe ODROID-C1 looks very nice. ", "My main hesitations would be available drivers\nand community size. ", "They may have drivers for everything, I don't know. ", "It is\nnice to see that a somewhat recent kernel is available though (3.10).", "\n\nI recently ported several projects I had from beaglebone black to an Olinuxino\nA10 Lime. ", "A lot of stuff was relatively painless, but I was never able to get\nNode.js to install. ", "I also got bit in the ass because I laid out and ordered\nPCBs assuming all of the SPI channels had drivers, when only one was there (of\ncourse, not the one I chose).", "\n\nEmbedded Linux constantly reminds you that you are standing on the shoulders\nof giants, and you can go from feeling like a wizard to feeling like an idiot\nreal quick when some part of the system isn't working. ", "That's where having the\ncommunities like beaglebone's and raspberry pi's really pay off.", "\n\n~~~\npapaf\nDriver support in the Odroid C1 downloadable Ubuntu image is complete (as far\nas I can tell) and Ubuntu runs quite well.", "\n\nI was unable to get X running on Arch Linux despite the drivers being\navailable.", "\n\n------\nWhitneyLand\nARMv6 still? ", "I don't see how that's necessary to save on the BOM. ", "I hope\nlegacy code was not the deciding factor here.", "\n\n~~~\nlovelearning\nAccording to [1], these will be ARMv7 architecture Cortex-A7 cores. ", "Looks like\nwe'll know for sure only when the foundation announces a public release.", "\n\n[1]: [http://www.cnx-software.com/2015/02/02/raspberry-\npi-2-model-...](http://www.cnx-software.com/2015/02/02/raspberry-\npi-2-model-b/)\n\n~~~\nMaxious\nLinked article on the Register has been updated to confirm ARMv7/NEON\n[http://pastebin.com/raw.php?i=v0LVywBi](http://pastebin.com/raw.php?i=v0LVywBi)\n\n------\nbayesianhorse\nAny news if the Raspbery Pi 2 will have USB 3.0 ports? ", "That seems to be a good\nselling point for the Odroid XU3 currently...\n\nUSB 3.0 ports would mean better performance as NAS or multimedia recording\nsolution, as well as alleviating some of the current troubles with usb\nperformance.", "\n\n~~~\ntomaskafka\nAre they necessary? ", "My Radxa (quadcore 1.7 GHz ARMv7) cannot exceed 6 MB/s\nread from HDD no matter how hard it tries with NTFS formatted disc (for\ncomparison, Raspberry Pi A was doing about 600 kB/s max in a same\nconfiguration).", "\n\nBoth are far under USB 2.0 speed.", "\n\n------\nrcarmo\nWell well. ", "I'm going to hold off an wait until someone can benchmark this\nagainst the ODROID-C1, though, largely because the original Pi design had a\nfew shortcuts and I'd like to avoid any teething issues (been using ODROIDs\nfor a while, got full hardware support in Ubuntu and Android and don't have to\nput up with Debian 7.x).", "\n\n------\n20kleagues\nFinally more power for graphics. ", "I am seeing some interesting VR projects with\nthe more horsepower, especially since VR is THE thing right now. ", "And the pi is\nlight enough for head-mounting!", "\n\n~~~\nmappu\nI'd love to see this happen. ", "But i think that's very wishful thinking, outside\nof some very simple scenes - my R9 270 struggles to maintain framerate with\nsome DK2 demos and the pi's VC4 isn't remotely in the same league.", "\n\n~~~\n20kleagues\nI think we will need to look at streaming scenes from a more powerful machine\nrather than creating them on board. ", "I don't believe we are ready in any way to\nprocess that much information on such a small system at this time (HoloLens\nalso gives out quite a lot of heat from its on board processor). ", "The old pi\nhad trouble streaming higher bitrates, though then we still have the same\nethernet so I am not sure how much is possible.", "\n\n------\nyAnonymous\nARMv7... so Ubuntu will finally run on this. ", "No more hours of compiling\nsoftware.", "\n\n~~~\nsime\nYes and looks like Snappy Ubuntu Core is already ready to run on it as well:\n[https://insights.ubuntu.com/2015/02/02/snappy-ubuntu-core-\non...](https://insights.ubuntu.com/2015/02/02/snappy-ubuntu-core-on-raspberry-\npi-2/)\n\n------\nsagarm\nThe only place I've found to buy this thing so far is here: [http://uk.rs-\nonline.com/web/p/processor-microcontroller-deve...](http://uk.rs-\nonline.com/web/p/processor-microcontroller-development-kits/8326274/)\n\nWhere can I buy this thing in the US?", "\n\nAny info on whether there will be an RPi-compatible Python library for\naccessing GPIO?", "\n\n------\naceperry\nNice update, and still at the $35 price point. ", "Too bad it's still ARMv6. ", "It\nwould be nice to have ARMv7 which is where all of the high performance stuff\nis.", "\n\nEdit. ", "I take that back, it will be ARMv7 arch. ", "Other articles state that the\nnew Broadcom SOC will be using A7s. ", "That makes it huge for this price point.", "\n\n------\nmrmondo\nStill no GbE which is a massive disappointment for me.", "\n\n------\nbugsense\nInstall resin.io on it and smile :) I could even use them for light-weight app\nserver :)\n\n------\nmajc2\nWill it run some version of flash? (", "and yes I tried gnash to no avail).", "\n\nI spent the weekend explaining to an 8 and 6 y/o that they can't share and\nlook at other Scratch projects at scratch.mit.edu on the RPi :(\n\n~~~\nandybak\nNot sure if this might help:\n[https://news.ycombinator.com/item?id=8982251](https://news.ycombinator.com/item?id=8982251)\n\nProbably a performance hit - but with the js performance arms race - maybe\nnot!", "\n\n~~~\n0942v8653\nThat's Scratch 1.4—normal Raspbian comes with it built-in, actually—the\ntrouble is Scratch 2.0, which is fully flash-based.", "\n\n~~~\nandybak\nWow. ", "That was an unusual technology choice to make in 2013.", "\n\n------\nprogramminggeek\nAm I weird for wanting to use this for really simple web hosting?", "\n\n~~~\n20kleagues\nNope. ", "The Pi makes a lot of sense for a simple web server with a robust\nSQL/NOSQL database backend running with Node/Go. ", "If you have a good internet\nconnection with a good upload speed, you can easily run a server able to take\na couple of hundred hits a minute. ", "It is certainly a better option than using\nthe cloud for prototyping, where a wrong for loop can instantiate loads of\ninstances and bill you a hell lot.", "\n\n~~~\nnkozyra\nThe Pi does not make sense for any level of consumer-targeted production (dev,\nstage or live) beyond \"oh hey, it works.\" \"", "A couple of hundred hits a minute\"\nis also not impressive in the least, even for something of the Pi's stature.", "\n\nI also don't think the stack would matter all that much at this point - IO\nblocking would be happening at the application level, not the architectural.", "\nNode, Go, Ruby, Python, PHP ... it really wouldn't matter. ", "SQL versus NoSQL is\nalso a non-issue in this case.", "\n\nI also wouldn't take something very underpowered instead of the cloud just\nbecause I hadn't configured my cloud host to keep things within reason (ie no\nautoscaling at all, which is what you'd expect for hobby-level prototyping.", "\n\ntldr; don't eschew better options for the Pi unless you don't understand how\nyour cloud host works.", "\n\n~~~\n20kleagues\nI agree it makes no sense for consumer-targeted production. ", "I have played with\nthe pi and run a small robot to collect intermittent data from twitter and\nstore it on Mongo, which I can remotely access using the web service. ", "At the\nsame time, I would not want to go all the way to the cloud for such a small\nthing. ", "I guess it depends on the use-case.", "\n\n------\nAceJohnny2\nARM11/(ARMv6)? ", "I thought that core was a dead-end that was quickly replaced by\nthe Cortex-A (ARMv7) series. ", "Surprised to see ARMv6 in new hardware in this\nage...\n\n~~~\nchadzawistowski\nThe RPi2 uses an ARMv7 Cortex A7 processor, not an ARMv6.", "\n\n~~~\nAceJohnny2\nThanks, I see the article has been updated (it stated ARM11 this morning), but\ntoo late to edit my comment.", "\n\n------\nryan-allen\nWhile a bit more expensive, I purchased a Hummingboard [1] instead of a Pi,\nand the performance was great! ", "I had a NodeJS/Postgresql app running on it for\nkicks. ", "I was surprised at how quick it was.", "\n\n[1] [http://www.solid-run.com/products/hummingboard/linux-sbc-\nspe...](http://www.solid-run.com/products/hummingboard/linux-sbc-\nspecifications/)\n\n~~~\nnacs\n> While a bit more expensive\n\nActually at least twice as expensive (starts at $70 compared to the RPi's\n$35).", "\n\nAnd with the new RPi announced here, it's basically twice the price for\nquarter/half the CPU power of the Pi (single/dual core vs 4 core RPi).", "\n\n------\nlmedinas\nThis update is very welcome and for sure it will make people create more\ninteresting \"projects\". ", "Personally i'm very excited to get one of these to run\nowncloud at decent performance in my home. ", "Also the possibility to install\nmore Linux distributions or even Windows 10 will open much possibilities for\ndevelopment. ", "Well Done!!", "\n\n------\ncpks\nI really want 2gb. ", "I'm surprised there isn't a market of Pi-like devices, with\ncompatible software, but higher price points and higher specs.", "\n\n~~~\nRadioactiveMan\nThese could interest you: Odroid-C1[1] with 1GB RAM for $35 or U3[2] with 2GB\nfor $69\n\n[1][http://www.hardkernel.com/main/products/prdt_info.php?g_code...](http://www.hardkernel.com/main/products/prdt_info.php?g_code=G141578608433)\n[2][http://www.hardkernel.com/main/products/prdt_info.php?g_code...](http://www.hardkernel.com/main/products/prdt_info.php?g_code=G138745696275)\n\n------\nGnewt\nAnyone know where this can be purchased now?", "\n\n~~~\njamestnz\nFrom the usual Pi manufacturing partners, e.g.:\n\n[http://www.element14.com/community/community/raspberry-\npi/ra...](http://www.element14.com/community/community/raspberry-pi/raspberry-\npi-bplus?ICID=rpimain-topban-BPlus)\n\nEDIT: apologies, it looks like this link in fact contains the \"old\" B+ not the\none discussed here, my bad.", "\n\n------\nSSilver2k2\nExcited to see how well this will help my distro PiPlay (and PetRock's\nRetroPie).", "\n\nCan't wait to get my hands on the hardware\n\n-Shea\n\n------\nThiz\nRemove the ethernet port. ", "Remove the double stacked usb ports. ", "Use single rows\nof micro USB or Lightning, 4 on one side. ", "Make it flatter, simpler, more\nbeautiful. ", "Encase it in alluminum. ", "Steve Jobs would do it and push it through\nour throats. ", "And we would love it.", "\n\nOr at least make it a premium choice, and make extra money from those who love\nbeauty.", "\n\n~~~\nvlunkr\nI don't agree with encasing it for a couple of reasons. ", "1) The goal is to get\nmaximum functionality out of minimal cost. ", "If you want to encase it you can\nbuy a case yourself. ", "2) Not including a case has encouraged the community to\nget creative and sell cases, or patterns to 3D print one. ", "Inspiring creativity\nis another goal of the foundation.", "\n\nI wouldn't mind if it was a little smaller, but again, they want to keep the\ncost down.", "\n\n------\nphkahler\nHow is the wayland/weston support going? ", "This thing should be quite capable\nnow.", "\n\n------\nropable\nMaybe the Kano will be able to perform worth a damn, now (post-upgrade).", "\n\n------\ndavexunit\nIt still requires proprietary firmware to function at all. ", "No thanks. ", "Please\nfix this serious flaw!", "\n\nEdit: And to make things worse, they are giving away gratis Windows 10\nlicenses for it!", "\n\n~~~\nFrankenPC\nThis is actually a great boon. ", "The Windows development environment is\nincredibly inviting to beginners and it has a lot of power. ", "Linux may be more\nflexible and open, but it's really hard to get started with when you have no\nexperience programming.", "\n\n~~~\ndavexunit\nMicrosoft says \"you are not allowed to learn about our software\". ", "Besides\nbeing an inferior programming environment, it is also an anti-educational one.", "\n\n------\nexabrial\nNeed gigabit!", "\n\n~~~\nviraptor\nJust curious, (if you can share) what are you doing on your RPi that saturates\nthe 100Mb?", "\n\n~~~\nwerkshy\nI run mine as a NAS, and the performance is pretty terrible. ", "The portability\nis great though! ", "I'm somewhat nomadic at the moment so it's great to have a\n1TB NAS that I can pack in my laptop bag (1TB external 2.5\" drive + rpi:\nminimal weight too)\n\n------\ngregorymichael\nHow do I purchase this in the US?", "\n\n~~~\nmikefivedeuce\nElement14 should have it\n\n------\nhigherpurpose\nWhy didn't they just skip to Cortex A53? ", "It would've been worth waiting a year\nlonger for that.", "\n\n------\nbrudgers\nThe headline gave me hope. ", "Alas no button on the front for overclocking. ", "I am\nwistfully disappointed.", "\n\n~~~\nglynjackson\nReally? ", "Build a button yourself to overlock! ", "The Pi is about giving you the\ntools, now, go forth and build.", "\n\n~~~\nbrudgers\nFirst I want to revel in inch thick _Computer Shopper_ whist.", "\n\n" ]

{ "pile_set_name": "HackerNews" }

[ 0.00003560682938987697, 0.000024622960911049555, 0.00004917307282532085, 0, 0, 0, 0, 0.000124000248000496, 0, 0, 0, 0.00002143347050754458, 0.000055401662049861494, 0.0001412329637737448, 0, 0, 0, 0.0001602307322544464, 0, 0, 0, 0.00009645061728395061, 0, 0, 0.00010412328196584755, 0.0001582215893358649, 0, 0.00010306887577623747, 0.0001530612244897959, 0.000010283780934898524, 0, 0.00008116224332440549, 0, 0, 0, 0, 0.0001, 0, 0, 0, 0.0001234567901234568, 0, 0, 0.000018419937740610438, 0, 0.00008734387282732115, 0, 0.00005446548930433953, 0.00025195263290501383, 0, 0.000124000248000496, 0.00008901707347469244, 0.00009070294784580499, 0.000037637848620572846, 0.0006377551020408163, 0.00018261504747991235, 0.00014863258026159333, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00021003990758244068, 0.00009611687812379854, 0, 0.000055401662049861494, 0, 0.0007304601899196494, 0.000048225308641975306, 0.00005406574394463668, 0.00010306887577623747, 0.00004627701420704336, 0, 0.00004675999962592, 0.00005658669081032141, 0, 0, 0, 0, 0.000148720999405116, 0, 0.000044790826838663444, 0.000057810151462596836, 0, 0, 0, 0, 0, 0, 0, 0.00012913223140495868, 0, 0.000148720999405116, 0.0008650519031141869, 0, 0, 0, 0, 0.000041551246537396125, 0.00005720714707957514, 0, 0.00011556952662721894, 0, 0, 0.000029666548000474663, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.000020160965145723457, 0.00012913223140495868, 0.0002366863905325444, 0, 0, 0, 0, 0.0002295684113865932, 0, 0.00019837333862328903, 0, 0, 0.000023671253629592223, 0.0001035143108534755, 0, 0, 0, 0, 0.0001512287334593573, 0, 0, 0, 0, 0, 0.0005555555555555556, 0.0008, 0, 0, 0, 0, 0, 0, 0, 0, 0.0000573921028466483, 0, 0, 0, 0, 0.000028054819116553746, 0, 0, 0, 0, 0, 0, 0, 0.000024045860264696827, 0.000016999719504628174, 0.00029408881482207626, 0, 0.0007304601899196494, 0.00029726516052318666, 0, 0, 0.00031887755102040814, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00012624668602449185, 0.00016436554898093358, 0, 0, 0, 0, 0, 0, 0.000148720999405116, 0, 0, 0, 0.00017777777777777779, 0, 0, 0, 0, 0, 0, 0.0012755102040816326, 0, 0, 0, 0.00017313019390581717, 0 ]

[ "plant-inspired food + lifestyle\n\nVegan Pop Up Dallas No. ", "1 | Dinner + Floral Workshop\n\nFinally, I’m sharing the highlights from this Dallas vegan pop up event that I went to back in November! ", "My apologies for posting this so late–grad school has been my only priority these past few months. ", "My finals ended last week and I still don’t feel caught up on rest yet. ", "But enough about my life as a design student–let’s talk about this amazing event!", "\n\nlots of flowers and leaves\n+\nall the delicious food\n+\nsweet, inspiring people\n+\ncozy, lovely atmosphere at Common Desk\n\nOur evening began with a delightful floral workshop taught by Lauren Clinkscales of The Backyard Bouquet. ", "Lauren’s focus on seasonal, local and foraged plants gives her floral designs an authentic sense of season and place. ", "We found beauty in seasonal finds such as kale blossoms, vibrant fall foliage, mums, young wheat, and fragrant sprigs of rosemary.", "\n\nWe made a huge, beautiful mess with our creations. ", "Plants were scattered everywhere!", "\n\nBefore the end of the evening, my dear friends Courtney Garza and Zak Shelton each shared their stories about their journeys to a compassionate vegan lifestyle. ", "More than half the attendees were not vegan, which absolutely thrilled me. ", "I am so glad that they got to experience such a beautiful array of vegan dishes and discuss compassionate choices, in such a friendly and inviting atmosphere.", "\n\nAfter that evening, I think we could all agree that a fun dinner with friends can be enjoyed without animal cruelty. ", "I love events like this because they bring people together and inspire the community!", "\n\nAnother world is not only possible, she is on her way. ", "On a quiet day, I can hear her breathing.", "\n— Arundhati Roy\n\nI couldn’t resist taking a photo of the gorgeous aftermath. ", "I left the event feeling inspired and invigorated, and I’m sure I wasn’t the only one!", "\n\nI had the best time and I look forward to more experiences like this in the future, as the Dallas vegan scene continues to bloom and grow!", "\n\nSpeaking of blooming and growing, my aforementioned friends Courtney and Zak have recently launched their passion project called The Harvest Hands. ", "This project is dedicated to bringing compassionate folks together and raising awareness of a more conscious lifestyle, through a variety of events and experiences.", "\n\nI love Courtney and Zak so much–they are dreaming up big and beautiful things! ", "Their first event was last week, and I will be sharing the experience with you tomorrow on the blog. ", "Here’s a sneak peek:" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0, 0, 0.000038473376423514926, 0, 0.0000591715976331361, 0, 0, 0.00007527569724114569, 0, 0, 0, 0, 0, 0, 0.00016436554898093358, 0, 0, 0.00008888888888888889, 0, 0.00030483158055174517, 0, 0 ]

[ "Purification and subunit structure of alkaline phosphatase from bovine enamel organ.", "\nA highly-purified alkaline-phosphatase preparation having a specific activity of 703 U/mg protein was obtained from bovine enamel organ by a series of procedures: butanol extraction, isoelectric and acetone precipitation, ion-exchange, concanavalin A affinity and gel-filtration chromatography. ", "The purified enzyme showed the same properties as kidney-type isozyme and contained carbohydrate moieties which react with concanavalin A. Analysis by polyacrylamide gel electrophoresis showed that the purified enzyme split into half the size of the native molecule (160,000 in mol. ", "wt) after being heated in sodium dodecyl sulphate (SDS) solution and the subunit had no catalytic activity. ", "The results indicate that the enzyme is a dimeric glycoprotein comprised of two identical subunits, each having a molecular weight of 80,000." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0.000011413440467494522, 0.000012486109203511094, 0.00008573388203017832, 0 ]

[ "The evaluation and nonsurgical management of impotence.", "\nThe evaluation of patients with erectile dysfunction and the increasing number of nonsurgical options for its treatment have been reviewed. ", "If nonsurgical options are unsuccessful or unsatisfactory to the patient, then a number of surgical alternatives are available including penile prostheses, and in a selected small number of patients, vascular reconstructive surgical procedures. ", "Hopefully, in the future, a better understanding of erectile dysfunction will result in additional therapeutic options, both nonsurgical and surgical." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0 ]

[ "Cholangiocarcinoma (CCA) is a fatal disease, with a five year survival of 0-30%. ", "For a majority of patients chemotherapy is the only therapeutic option, and virtually all patients relapse. ", "Gemcitabine is the frontline agent for treatment of CCA and the combination of gemcitabine and cisplatin is the current treatment standard. ", "Neither gemcitabine alone or gemcitabine and cisplatin produce durable remissions. ", "The molecular etiology of this disease is poorly understood, and tumors that respond initially uniformly relapse. ", "To facilitate molecular characterization and development of effective therapies for CCA, we established a panel of patient-derived xenograft (PDX) models of CCA. ", "We propose to use these models to investigate the anti-tumor efficacy and mechanism of action of the novel compound JQ1, an agent that has not been evaluated for the treatment of CCA. ", "Further, data in this application indicate that the combination of JQ1 + gemcitabine will produce synergistic cytotoxicity in CCA tumors; therefore, we will evaluate the anti-tumor efficacy of this combination using our unique panel of CCA models. ", "JQ1 is an inhibitor of BET (bromodomain and extra-terminal domain) proteins, which regulate the association of transcriptional aggregates to acetylated lysine residues of histones at specific chromosomal loci. ", "The rationale for combining JQ1 and gemcitabine is compelling. ", "Firstly, JQ1 inhibits the activity of BET proteins and also inhibits expression of c-Myc, an oncogenic transcription factor that contributes to the tumorigenic phenotype of many solid tumors and likely plays a role in gemcitabine resistance. ", "Secondly, data in this application document the novel finding that JQ1 down-regulates the DNA damage response protein Chk1. ", "This finding is of particular relevance in that multiple studies in the literature demonstrate that inhibition of Chk1 sensitizes solid tumor cells to gemcitabine. ", "Thirdly, unpublished data from our lab indicate that JQ1 induces DNA damage by a mechanism distinct from that of gemcitabine, suggesting the potential for at least additive induction of DNA damage by these two agents. ", "Fourthly, our in vitro data show that JQ1 + gemcitabine are very strongly synergistic in pancreatic cancer cells, a cell type closely related to CCA. ", "We hypothesize that JQ1 and gemcitabine will induce synergistic cytotoxicity in CCA tumors. ", "We will evaluate the anti-tumor efficacy of this combination using our PDX CCA models, and determine if the observed downregulation of c-Myc and Chk1 is critical to the cytotoxicity of JQ1 and to the synergy of JQ1 and gemcitabine. ", "We will also determine whether this combination produces synergistic anti-tumor cytotoxicity in gemcitabine-resistant as well as -sensitive tumors, and will generate expression profiles of gemcitabine-sensitive and -resistant CCA tumors, with a long-range goal of identifying biomarkers of sensitivity or resistance to gemcitabine and JQ1." ]

{ "pile_set_name": "NIH ExPorter" }

[ 0.00030483158055174517, 0, 0.0000510204081632653, 0, 0, 0.00011431184270690443, 0.00002953686200378072, 0.000032518210197710714, 0.000022675736961451248, 0, 0.00001707533638412677, 0.00006503642039542143, 0.000037180249851279, 0, 0.000044444444444444447, 0.00011814744801512288, 0.000055737217598097505, 0.0000087016298152644 ]

[ "Maruti Swift and Dzire likely to witness further growth in sales with added safety features\n\nNikhil PuthranSunday 29 November 2015, 13:46 PM\n\nCountry’s largest carmaker Maruti Suzuki India on Tuesday said it will offer dual airbags and anti-lock braking system (ABS) as an option in all variants of Swift and Dzire, including the base variant. ", "The company has launched Swift hatchback with optional package priced between Rs 4.9 lakh and Rs 6.43 lakh while Dzire with added safety features would be retailed between Rs 5.4 lakh and Rs 7.06 lakh.", "\n\n“Offering driver and co-driver airbags and ABS across all variants of Swift and Dzire, will further strengthen their popularity among customers,” MSI Executive Director R S Kalsi said to PTI in a statement. ", "Swift and Dzire are two of the most popular cars in India and both have played an instrumental role in shaping the Indian automobile industry, he added. ", "Swift, has been a bestseller through the decade, surpassing its own records year after year while DZire, launched in 2008, is India’s best-selling entry sedan for the last three years.", "\n\nTogether, Swift and Dzire, have handsomely contributed towards enhancing Maruti Suzuki’s market share in the Indian passenger vehicle market, the company said. ", "In 2014-15, Swift and Dzire maintained an average sale of over 17,000 units each per month." ]

{ "pile_set_name": "Pile-CC" }

[ 0.000025351541373715522, 0.00002475186257765897, 0.000022893248780934502, 0, 0.00002953686200378072, 0.000038103947568968146, 0.00012075836251660429 ]

[ "Introduction {#Sec1}\n============\n\nThe murine double minute (MDM) family members are key regulators of levels and activity of the oncosuppressor p53 \\[[@CR1]\\]. ", "MDM2, acting as specific E3 ubiquitin ligase and as transcriptional repressor, is the best known among them. ", "MDM2 overexpression has been observed in many human tumors characterized by tumor protein 53 (TP53) wild-type (wt) status, supporting the model of multiple means of p53 inactivation in tumor cells \\[[@CR2]\\]. ", "In recent years, another member of the MDM family, MDM4 (also named MDMX) has come into the limelight and its function in the inactivation of p53 has been revealed by molecular and genetic approaches \\[[@CR1], [@CR3]\\]. ", "In particular, MDM4 can negatively regulate p53-mediated cell cycle arrest, a role that distinguishes its function from that of MDM2, more related to the suppression of p53-mediated apoptotic response \\[[@CR1], [@CR3]--[@CR5]\\]. ", "However, others have reported on the antiproliferative and proapoptotic effect of MDM4 in the presence of wild-type TP53 under conditions such as stress \\[[@CR6], [@CR7]\\]. ", "Studies aimed at characterizing the human MDM4 (also named HDMX) status in human tumors have shown amplification of its locus in the presence of wild-type TP53 in breast cancers, glioblastoma, retinoblastoma, and soft-tissue sarcomas \\[[@CR8]--[@CR11]\\], confirming that it may contribute to p53 inactivation during tumorigenesis. ", "The impact of human MDM4 on tumor properties as well as its behavior during tumor progression however still poorly explored.", "\n\nIn addition to the full-length (fl) protein, different splice variants of MDM4 have been described, two of which detected in human tumors. ", "A short form named MDM4-S (a.k.a. ", "HDMX-S) was identified first \\[[@CR12]\\]. ", "This variant derives from an alternative splicing that produces a truncated protein, containing essentially the p53-binding domain. ", "It is a more potent inhibitor of p53 transcriptional activity than wt MDM4 and although present in both normal and tumor tissues, it is overexpressed specifically in tumor samples \\[[@CR11], [@CR12]\\]. ", "Recently, our group has characterized another MDM4-splicing form, HDMX211 (hereafter named MDM4-211), in a thyroid tumor cell line and in some lung cancers \\[[@CR13]\\]. ", "This form derives from an aberrant splicing and produces a protein containing essentially the RING finger COOH-terminus, where the MDM2 binding site resides. ", "As a consequence, this variant is able to stabilize MDM2 protein levels, thus contributing to inactivation of p53. ", "These data, while underlying the complexity of MDM4 expression in human tumors, strongly encourage studies on the comparative analysis of this protein and its derivative forms in human cancer.", "\n\nThyroid tumors represent over 90% of all endocrine cancers and are characterized by different genetic alterations, among which TP53 mutations are confined quite exclusively to the infrequent anaplastic and poorly differentiated histotype \\[[@CR14]\\]. ", "According to current models of human carcinogenesis that consider inactivation of the oncosuppressor p53, a common feature of almost all tumors, MDM2 amplification and/or overexpression have been reported in thyroid tumors too \\[[@CR15]--[@CR17]\\]. ", "However, the overall frequency of MDM2 overexpression is only about 30%, suggesting the existence of other pathways of p53 inactivation.", "\n\nThe aim of our study has been to analyze papillary thyroid carcinomas (PTC), the most frequent thyroid cancer, for the presence of MDM4 and its derivative forms to investigate alterations of these proteins in this tumor histotype and correlate them with histopathological features. ", "In addition, we have analyzed MDM2 levels to assess the potential relationship between alterations of the two MDM family members. ", "Our data have revealed the aberrant presence of variants MDM4-S and MDM4-211 messenger RNA (mRNA) in PTC as well as lack of correlation between MDM4 and MDM2 mRNA levels. ", "Of note, levels of MDM4 mRNA were significantly downregulated in tumor samples in comparison to normal counterparts, and such downregulation appears significantly associated with tumor stage.", "\n\nMaterials and methods {#Sec2}\n=====================\n\nTissue samples and patients {#Sec3}\n---------------------------\n\nFifty-seven papillary thyroid carcinomas and 57 matched normal thyroid tissue samples from the contra-lateral lobe (CTRL) of 57 patients were studied. ", "In addition, to confirm statistical analyses, 26 papillary thyroid carcinomas and three normal thyroid tissues from independent individuals were analyzed. ", "All specimens were obtained from patients undergoing surgery at the University of Perugia from 1997 to 2007. ", "Before the surgical procedure, all patients signed informed consent forms for collection of fresh thyroid samples for genetic studies. ", "All specimens were sampled from the primary tumor at the time of surgery, snap frozen, and stored at −80°C until use. ", "Tumors containing at least 70% of tumor cells based on the hematoxylin--eosin staining were selected. ", "All normal thyroid tissue from the contra-lateral lobe were histopathologically analyzed for the presence of tumor. ", "Available medical records of the patients were consulted to gain information about the clinical features of the disease and, when possible, the tumor stage was defined according to the sixth edition of the \"American Joint Committee on Cancer\" Cancer Staging Manual (American Joint Committee on Cancer 2002) based on pathological tumor--node--metastasis parameters and distinguishing patients in two groups: (1) patient age \\< 45 years (stage I and II), (2) patient age ≥ 45 years (stage I, II, III, IV).", "\n\nThe total of 83 papillary thyroid carcinomas included 55 of the classic variant, 20 of the follicular variant, five of other variants (tall cell, solid, diffuse sclerosing), and three showing the coexistence of PTC histology with areas of dedifferentiation. ", "The mean period of follow-up was 45.8 ± 30.4 months.", "\n\nGenetic analysis of TP53 mutation, BRAF mutations and ret/PTC rearrangements {#Sec4}\n----------------------------------------------------------------------------\n\nAnalysis of the *TP53* gene status was performed as follows: exons 5, 6, 7, and 8 of *p53* gene were sequentially amplified by polymerase chain reaction (PCR) assay with the use of AmpliTaq Gold (Applied Biosystems) and following primer sets: exon 5 sense: TTCCTCTTCCTACAGTACTC; exon 5 antisense: GCCCCAGCTGTTCAC; exon 6 sense: ACTGATTGCTCTTAG; exon 6 antisense: AGTTGCAAACCAGAC; exon 7 sense: AGTTGTGTTATCTCCTAG; exon 7 antisense: CAAGTGGCTCCTGAC; exon 8 sense: TCCTATCCTGAGTAG; exon 8 antisense: GTCCTGCTTGCTTAC. ", "Purified PCR products were sequenced in both directions with the use of the BigDye terminator Cycle sequencing Kit (version 1.1, Applied Biosystems) and an ABI Genetic Analyzer (Model 3130, Applied Biosystems). ", "Sequence data were analyzed by means of SeqScape software (version 2.1, Applied Biosystems) followed by manual review.", "\n\nSearch for mutations of BRAF was conducted by single-stranded conformational polymorphism (SSCP) screening of real-time (RT)-PCR products of exons 15, followed by sequencing, as previously described \\[[@CR18]\\]. ", "Screening for ret/PTC 1 and ret/PTC 3 rearrangements was performed by RT-PCR using primers spanning the breakpoints, as previously described \\[[@CR18]\\].", "\n\nQuantitative real-time PCR {#Sec5}\n--------------------------\n\nTotal RNA was extracted with Trizol™ (Invitrogen Corp., Carlsbad, CA, USA), according to the manufacturer's instructions. ", "The expression of MDM2, MDM4, and MDM4-211 in tumors and matching normal thyroid samples was measured by quantitative real-time PCR (qRT-PCR), based on TaqMan methodology, using the ABI PRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, CA) according to Giglio et al. ", "\\[[@CR13]\\]. ", "Briefly, custom-designed TaqMan primers and probes (Applied Biosystems) specific for MDM4, MDM2, and MDM4-211 were used. ", "Our results are expressed as relative units of target mRNA, referred to a sample called calibrator, chosen to represent 1× expression of the target gene. ", "The calibrator used was the lowest value in the tissue collection under study. ", "All analyzed samples express *n*-fold mRNA relative to the calibrator. ", "Each sample mRNA was normalized relative to the β-actin mRNA. ", "Predesigned TaqMan primers and probe (Applied Biosystems) for the housekeeping gene ß-actin were used. ", "Each sample was treated with deoxyribonuclease (DNase) I amplification grade (Invitrogen) and tested before and after DNase treatment.", "\n\nComparative analysis of flMDM4 and MDM4-S was driven by qRT-PCR according to Bartel et al., ", "\\[[@CR11]\\] using specific probes and SYBR Master mix (Applied Biosystems) with evaluation of dissociation curves. ", "A MDM4-S-to-flMDM4 ratio of \\>1.5 was considered indicative of overexpressed MDM4-S.\n\nWestern blot analysis {#Sec6}\n---------------------\n\nTumor and normal tissue pairs whose material was sufficient for western blot analysis were selected. ", "All samples were homogenized with Tissue Lyser (Qiagen) and western blots were performed according to Giglio et al. ", "\\[[@CR13]\\]. ", "Briefly, samples were lysed in radio-immunoprecipitation assay buffer (50 mM Tris--Cl pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 0.5% Na desoxicholate, 0.1% sodium dodecyl sulfate (SDS), 1 mM ethylenediaminetetraacetic acid) supplemented with a cocktail of protease inhibitors (Boehringer). ", "Whole lysates were boiled in SDS Laemnli sample buffer, resolved by SDS-polyacrylamide gel electrophoresis on precast 10% gels (Invitrogen) and subsequently transferred to polyvinylidene fluoride membranes (Millipore). ", "After protein transfer, membranes were blocked for 30 min with Tris-buffered saline containing 0.1% Tween-20 and 5% nonfat dry milk and incubated with specific antibodies. ", "The following primary antibodies were used: rabbit anti-MDM4 polyclonal antibody R1 (raised against full-length MDM4 protein) and (Bethyl Laboratories) mouse anti-MDM2 monoclonal antibody 2A10 and monoclonal antibody Ab-1 (oncogene), mouse anti-α-tubulin monoclonal antibody DM-1A (Sigma), and mouse α-actin monoclonal antibody AC-40 (Sigma). ", "MDM4 was probed with both Bethyl and R1 antibodies, giving similar results although, in comparison, the polyclonal antibody R1 was more sensitive. ", "The homemade R1 antibody has been raised using the entire MDM4 protein. ", "Experiments of epitope mapping by using MDM4-deletion mutants have shown that R1 does not recognize the NH2-terminus of MDM4. ", "It is therefore unable to recognize the MDM4-S form.", "\n\nStatistical analysis {#Sec7}\n--------------------\n\nStatistic analysis was carried out using the Analyze-it software for Microsoft Excel (Analyze-it Software, Ltd.). ", "Spearman rank correlations and Kendall rank correlation (for measure of linear association) were used to evaluate the correlation between not-normally-distributed variables. ", "To compare groups, we used the Wilcoxon Signed-Ranks test for related samples (57 tumors vs. matched thyroid normal tissues) and Mann--Whitney *U* test for independent samples (83 tumors vs. 60 normal thyroid samples). ", "A probability of *p* \\< 0.05 was considered as statistically significant. ", "Intraindividual variation was calculated by utilizing the T-to-N ratio that derives from the ratio of corrected tumor (mRNA or protein) levels to corrected normal tissue levels of MDM4 and MDM2.", "\n\nResults {#Sec8}\n=======\n\nAnalysis of MDM4 and MDM2 levels in papillary thyroid tumors {#Sec9}\n------------------------------------------------------------\n\nA group of 57 thyroid tumors samples and 57 matched normal thyroid tissues from the CTRL were analyzed. ", "All tumors were of papillary histotype (PTC). ", "The mean age of the studied population was 49.4 ± 16.81 (SD); the female percentage was 72%. ", "The histopathological features of the 57 tumors are shown in Table [1](#Tab1){ref-type=\"table\"}. ", "Tumor stage was defined according to the sixth edition of the \"American Joint Committee on Cancer.", "\"^.^Table 1Histopathological features of the 57 Papillary Thyroid Tumors (PTC) Yes, *n* (%)No, *n* (%)ND, *n* (%)BRAF mutation35 (61)20 (35)2 (3)Ret/PTC rearrangement5 (9)50 (88)2 (3)TP53 mutation0 (0)57 (100)0Extra-thyroidal invasion15 (26)41 (72)1 (2)Multifocality24 (42)32 (56)1 (2)Nodal metastasis24 (42)33 (58)0Distant metastasis6 (10)35 (62)16 (28)Tumor stage of patients \\<45 years (*n* = 20)I15 (75)05 (25)II0 (0)15 (75)5 (25)Tumor stage of patients ≥45 years (*n* = 37*)*I8 (22)18 (48)11 (30)II2 (5)24 (65)11 (30)III3 (8)23 (62)11 (30)IV13 (35)13 (35)11 (30)HistologyClassic38 (67)19 (33)0Follicular13 (23)44 (77)0Other4 (7)53 (93)0Dedifferentiated2 (3)55 (97)0*ND* Not determined\n\nAll samples were screened for the presence of TP53 mutations (limitedly to exons 5--8 where 80% of mutations occur), BRAF mutations (by SSCP followed by sequence analysis), and for ret/PTC 1 and ret/PTC 3 rearrangements (by RT-PCR; Table [2](#Tab2){ref-type=\"table\"}). ", "MDM4 and flMDM2 mRNA levels were evaluated by qRT-PCR, using specific primers and probes. ", "MDM4 primers were chosen in a region not present in the variant forms MDM4-S, HDMX-G \\[[@CR19]\\] MDM4-211, XALT1, and XALT2 \\[[@CR20]\\] to amplify specifically the fl product. ", "Similarly, the chosen MDM2 primers do not amplify the MDM2-A, MDM2-B, MDM2-C, MDM2-D, and MDM2-E alternative spliced forms and most of the aberrantly spliced forms \\[[@CR21]\\]. ", "Table 2Tumor sample dataSampleM4M4 T/NMDM4-S/flM4MDM4-211MDM4-211 to flM4M2 T/NM4 to M2TP53 statusBRAF mutRet/PTC rearr.", "Patient status^a^Tumor stageMultifocalityN1M1Histology^b^19.420.91.81.360.1411.3wt+−13−−−2218.961.35.21.42.5wt−−44+++4329.341.60.49.030.311.53.5wt−−11−−−2414.931.79.71.12wt−+11+−−154.390.30.90.41.1wt−−44−++3611.160.41.30.51.9wt−−44−++3712.600.80.78.940.710.73.9wt−−11++−184.440.40.82.10.7wt+−n.d.n.d.−−n.d.1915.511.40.61.41.6wt+−14++−1108.630.30.60.91.3wt−−n.d.n.d.+−n.d.1115.960.21.20.90.7wt−−24−+−1128.110.51.110.9wt+−31++−1136.250.41.310.161.80.8wt+−n.d.n.d.−+n.d.2146.130.41.50.80.9wt+−n.d.n.d.−−n.d.1158.340.31.60.61.2wt−−11−+−1163.820.21.41.230.320.80.5wt+−31−−−11718.8310.80.38.8wt+−24++−2186.321.20.71.11.2wt+−11−−−1193.610.21.82.60.1wt−−11−−−2205.120.330.90.8wt+−n.d.1+−−1218.40.54.20.61.1wt−+2n.d.+−n.d.1225.10.3n.d.\\*10.6wt−+13−−−1237.060.90.92.60.7wt+−n.d.n.d.−−n.d.1248.850.60.111.4wt+−11+−−1256.210.60.12.30.6wt−−n.d.n.d.+−n.d.1269.6110.11.21.1wt+−11−−−2277.110.30.60.41.6wt+−n.d.n.d.++n.d.1283.530.2n.d.0.21.4wt+−12−−−2295.760.42.20.71.2wt+−n.d.n.d.+−n.d.13010.7111.91.2wt+−11−−−13111.470.3n.d.0.80.9wt−+31++−13214.421.5n.d.2.41.4wt+−11−−−1333.920.30.20.41.7wt+−34−−+13411.960.710.52.8wt−−11−−−2353.690.11.81.170.320.40.7wt+−14++−2368.030.42.70.71.4wt+−11−−−13721.3320.40.85.6wt−−11++−4385.560.44.71.60.6wt+−34++−2391.120.11.12.40wt−−14−+−24013.981.41.43.50.9wt+−11+−−2415.840.33.610.6wt+−34−++1427.360.31.31.830.250.90.8wt+−11−−−1434.770.31.20.80.8wt−+3n.d.−+n.d.4442.450.12.20.70.4wt+−13−+−1455.120.30.70.80.7wt+−34−++1463.10.32.11.60.2wt+−11−−−14710.271.12.419.60.1wt+−11++−24812.131.12.41.12.2wt+−n.d.n.d.+−n.d.1497.940.81.60.82.2wt−−31++−15014.720.82.80.82.2wt+−34n.d.+−15115.671112.2wt+−12−−−15266.493.60.63.62.2wt+−1n.d.+−n.d.15328.941.41.71.42.2wt+−1n.d.−−n.d.1543.720.40.32.80.5wt−−1n.d.++n.d.4555.30.40.71.80.5wt+−11−−−1562.040.60.92.30.3wtn.d.n.d.1n.d.+−n.d.1576.870.7n.d.1.40.8wtn.d.n.d.1n.d.−−n.d.1*n*.*d*. ", "Not determined, *N1* nodal metastasis, *M1* distant metastasis^a^1, recovered; 2, recurrence occurred, 3,disease persistence, 4, expired^b^1, classic variant; 2, follicular variant; 3, dedifferentiated variant; 4, other\n\nMDM4 and MDM2 mRNA levels in normal tissues followed a normal distribution according to Kurtosis analysis (Fig.", " [1](#Fig1){ref-type=\"fig\"}a,b). ", "On the contrary, MDM4 and MDM2 values in tumor samples were not normally distributed (*p* \\< 0.0001; Fig.", " [1](#Fig1){ref-type=\"fig\"}c,d). ", "Comparative analysis by Wilcoxon signed-ranks test for paired samples revealed a highly significant difference in the distribution of MDM4 values between tumor and CTRL groups (Wilcoxon's *W*  **=** 1,385, *p* \\< 0.0001; Fig. [", "1](#Fig1){ref-type=\"fig\"}e). ", "Conversely, comparison of MDM2 values did not show significant difference (*p*  **=** 0.61; Fig.", " [1](#Fig1){ref-type=\"fig\"}f), in spite of the presence of four upper outliers in the tumor sample set. ", "There was no correlation between MDM4 and MDM2 mRNA tumor levels indicating that the alterations of the two transcripts are independent from one another (data not shown). ", "Fig.", " 1**a--d** Frequency histograms showing the distribution of the mRNA levels of the indicated genes in the indicated sample groups. ", "Relative units of target mRNA are referred to a sample called calibrator, chosen to represent 1× expression of the target gene. ", "Each sample mRNA was normalized relative to the β-actin mRNA. ", "The *superimposed line* shows the normal distribution curve. ", "For each distribution, the mean (*M*) ± standard deviation (*SD*) is shown. **", "e**, **f** Comparison of MDM4 and MDM2 levels, respectively, between control and tumor samples. ", "Each plot shows graphically the central location and scatter--dispersion of the values of each group: the *line series* shows parametric statistics (mean and confidence interval of mean) while the *notched box and whiskers* show nonparametric statistics (median, confidence interval of median, and interquartile range). *", "Crosses* and *circles* indicate possible outliers, between 1.5 and 3 interquartile range and over 3 interquartile range, respectively. *", "p* value was calculated according to Wilcoxon signed-ranks test\n\nTo confirm the decrease of MDM4 mRNA levels in PTC in comparison to CTRL, we analyzed these levels in an additional 26 independent PTC and three normal thyroid samples. ", "Comparison of tumor and CTRL groups still resulted in a highly significant correlation (Mann--Whitney for independent samples *U*  **=** 634, *p* \\< 0.0001) and confirmed previous results of a strong downregulation of MDM4 expression in tumor samples. ", "Indeed, study of prediction by receive operator characteristics curves (ROC curves) indicated that the use of MDM4 mRNA levels as potential diagnostic test has a highly significant ability to discriminate between normal and tumor tissues (area under the ROC 0.84, *p* \\< 0.0001 Fig.", " [2](#Fig2){ref-type=\"fig\"}). ", "Fig.", " 2Receive operator characteristics curves for MDM4 levels between normal and tumor samples, assessing variable MDM4 levels as diagnostic test. ", "The plot shows sensitivity of the test against specificity. *", "p* value was 0.0001. ", "For each decision threshold, the percentage of tumor cases correctly identified as such (true positives) against the percentage of normal cases incorrectly diagnosed as tumor (false positives) is shown\n\nTo ascertain whether the decrease of MDM4 mRNA in tumor samples results in decreased protein levels, we analyzed whole-cell extracts from 20 available pairs of tumors and CTRLs (Fig.", " [3](#Fig3){ref-type=\"fig\"}). ", "In 16 out of 20 pairs, the tumor-to-CTRL ratio of densitometric values of the MDM4 protein levels correlated significantly with the observed ratio of the mRNA levels (Kendall tau **=** 0.7, *p*  **=** 0.0002). ", "Interestingly, western blot confirmed the decrease of MDM4 mRNA in tumor relative to normal tissue in seven samples, reinforcing previous observations. ", "Notably, in three samples (44, 27, and 33), we observed an increase of MDM4 proteins in tumor compared to CTRL despite equal or even lower levels of corresponding tumor mRNA relative to CTRL, indicating MDM4 protein stabilization independent of transcription. ", "Western blot analysis revealed also the presence of an additional species of about 58 kDa in some tumor samples (Fig.", " [3](#Fig3){ref-type=\"fig\"}, arrows). ", "This band was recognized also by a mix of three monoclonal antibodies to MDM4 (6B1A, 11F4D, and 12G11G, data not shown), suggesting it may be a MDM4 variant. ", "However, its size does not correspond to any of the MDM4 variant forms described so far. ", "Fig.", " 3Western blot of WCE derived from 20 couples of tumor (T) and matching control (N). ", "The values derive from the ratio of densitometric value of MDM4--actin, both at the protein and mRNA levels. *", "Asterisks* mark tumor samples expressing MDM4-211 mRNA; *section sign*s mark tumor samples showing increased levels of MDM2 protein with no increased levels of the corresponding mRNA. *", "Arrows* mark a lower weight protein of about 58 kDa, recognized by different αMDM4 antibodies\n\nFurther, western blot revealed frequent overexpression of the MDM2 protein in tumors that did not show overexpression of the mRNA (Fig.", " [3](#Fig3){ref-type=\"fig\"}, samples marked by section signs).", "\n\nAnalysis of intraindividual variation of MDM4 and MDM2 levels {#Sec10}\n-------------------------------------------------------------\n\nPrevious data were obtained by comparing tumors versus CTRLs. ", "We then analyzed the intraindividual variation of MDM4 and MDM2 mRNA levels for each tumor (T) and its matched CTRL (N) by calculating the relative ratio, T to N. The range of MDM4 T-to-N ratios varied from 0.1 to 3.6 (Fig.", " [4](#Fig4){ref-type=\"fig\"}a and Table [2](#Tab2){ref-type=\"table\"}). ", "The majority of tumor samples showed a decrease of MDM4 levels compared to the corresponding CTRLs (29 out of 57 samples having a ratio of \\<0.5), confirming the previously observed decrease of tumor MDM4 expression at individual levels too. ", "In other tumor histotypes, amplification of MDM4 gene and overexpression of the mRNA have been reported. ", "In this PTC group, MDM4 overexpression (as defined by a T-to-N ratio of ≥5) was not detectable; in only two cases, the ratio of T to N showed a value of ≥2 (2 and 3.6, respectively). ", "On the contrary, comparison of MDM2 mRNA levels showed tumor values twofold higher than matching CTRL in 11 samples, among which one had a ratio of \\>19, suggesting an amplification event (Fig.", " [4](#Fig4){ref-type=\"fig\"}b and Table [2](#Tab2){ref-type=\"table\"}). ", "Moreover, only six samples (10%) showed a ratio of \\<0.5, indicating that downregulation of MDM2 levels in PTC tumor is a rare event in comparison to that of MDM4. ", "Notably, in two of these tumors, western blot analysis did not confirm the mRNA MDM2 decrease (Fig.", " [3](#Fig3){ref-type=\"fig\"}; samples 35, 27). ", "Fig.", " 4**a**, **b** Frequency histograms showing the distribution of the T-to-N ratios derived from tumor--CTRL levels of the indicated genes. ", "The *superimposed line* shows the normal distribution curve. ", "For each distribution, the mean ± standard deviation is shown\n\nCorrelation of MDM4 and MDM2 with tumor histopathological features {#Sec11}\n------------------------------------------------------------------\n\nWe then investigated whether tumor MDM4 and MDM2 mRNA levels as well as the T-to-N ratio varied according to tumor properties by correlating them with the histopathological features of samples as reported in Table [1](#Tab1){ref-type=\"table\"}. ", "First, we examined their association with BRAF mutations and ret/PTC rearrangements, two hallmarks of thyroid carcinogenesis. ", "BRAF mutation were detected in 35 out of 57 patients, ret/PTC rearrangements in 5 out of 57 (Table [2](#Tab2){ref-type=\"table\"}). ", "All BRAF mutations but one involved a heterozygous T \\> A transversion at nucleotide 1799, resulting in the prototypic valine-to-glutamic-acid substitution at position 600 (BRAF^V600E^). ", "In one case, the in-frame insertion at position 1796 of an additional codon, coding for Valine, was detected (BRAF^V599Ins^). ", "This was shown to be a \"gain-of-function\" mutation in all super imposable to BRAF^V600E^ \\[[@CR22]\\]. ", "No association was found between MDM4 and MDM2 expression, BRAF mutations, and ret/PTC rearrangements suggesting that these oncogenic hits are independent events. ", "We then analyzed the correlation between MDM4 or MDM2 expression with the other tumor histopathological features. ", "This revealed association of MDM4 with multifocality of tumors: specifically, tumors presenting as multifocal show higher values than nonmultifocal (Spearman rank correlation rs **=** 0.29, *p*  **=** 0.032; Fig.", " [5](#Fig5){ref-type=\"fig\"}a, Table [3](#Tab3){ref-type=\"table\"}). ", "This association was not evident when we correlated multifocality with the MDM4 levels of matching normal tissues (*p*  **=** 0.23), indicating that this tumor property is not attributable to a patient predisposition given by individual MDM4 expression levels but rather it is a specific feature of tumor cells. ", "Fig.", " 5**a** Vertical box-whisker plots showing MDM4 levels between nonmultifocal (no) and multifocal (yes) tumors. ", "Each plot shows graphically the central location and scatter--dispersion of the values of each group: the *line series* shows parametric statistics (mean and confidence interval of mean) while the *notched box and whiskers* show nonparametric statistics (median, confidence interval of median, and interquartile range). *", "Crosses* and *circles* indicate possible outliers, between 1.5 and 3 interquartile range and over 3 interquartile range, respectively. *", "p* value was calculated according to Spearman test. **", "b** Vertical box-whisker plots showing tumor--CTRL MDM4 mRNA levels in stage 1 compared to other stages of tumors. ", "Each plot shows graphically the central location and scatter--dispersion of the values of each group: the *line series* shows parametric statistics (mean and confidence interval of mean) while the *notched box and whiskers* show nonparametric statistics (median, confidence interval of median, and interquartile range). *", "Crosses* and *circles* indicate possible outliers, between 1.5 and 3 interquartile range and over 3 interquartile range, respectively. *", "p* value was calculated according to Spearman testTable 3Summary of significant correlations of MDM4 and MDM4 T--N values with histopathological features MultifocalityTumor StagePresenceAbsenceIII--IV*n* = 24*n* = 32*n = 23n = 18*MDM4 T--NMean ± SD0.9 ± 0.760.56 ± 0.430.81 ± 0.540.51 ± 0.43Median ± IQR0.63 ± 0.830.38 ± 0.60.65 ± 0.810.3 ± 0.58MDM4Mean ±SD12.4 ± 12.68.1 ± 6.410.28 ± 5.98.38 ± 5.9Median ± IQR8.74 ± 8.76.19 ± 5.18.85 ± 5.445.7 ± 8.0\n\nWe also correlated MDM4 T-to-N ratio with tumor features. ", "We observed an even stronger association between this parameter and multifocality (Spearman correlation coefficient rs = 0.32, *p* = 0.01, Table [3](#Tab3){ref-type=\"table\"}), confirming previous observations. ", "Further, we found a significant correlation of MDM4 T-to-N ratio with tumor stage (Spearman correlation coefficient, rs = 0.35 for *n* = 41, *p* = 0.02; Fig.", " [5](#Fig5){ref-type=\"fig\"}b); in particular, stage I tumors showed the highest ratio, indicating downregulation of MDM4 levels in late-stage tumors in comparison to early-stage ones (Table [3](#Tab3){ref-type=\"table\"}).", "\n\nOn the contrary, MDM2 levels as well as MDM2 T-to-N ratio did not show correlation with any histopathological parameter.", "\n\nCharacterization of MDM4 variants in thyroid tumors {#Sec12}\n---------------------------------------------------\n\nWe have analyzed the presence of the MDM4 variant forms, MDM4-S and MDM4-211, in the same sample group. ", "So far, these are the only variant forms of MDM4 detected in human tumors. ", "MDM4-S is a splicing variant present both in normal and tumor tissues; however, in tumor cells, MDM4-S is overexpressed and, as a consequence, the ratio MDM4-S to flMDM4 is \\>1. ", "At first, we performed comparative analysis of flMDM4 and MDM4-S by qRT-PCR in CTRL samples. ", "In agreement with the literature, we detected both transcripts in all samples with a ratio MDM4-S to fl-MDM4 ranging from 0.09 to 0.79 with only two samples showing values of 1.14 and 1.05 (data not shown). ", "On the basis of these results, we considered overexpression as defined by a ratio of ≥1.5 The same analysis in PTC detected MDM4-S in all but five samples; the resulting MDM4-S-to-flMDM4 ratio was ≥1.5 in 20 out of 57 of tumors (35%; Table [2](#Tab2){ref-type=\"table\"}). ", "The same percentage resulted from the analysis of the additional group of 26 tumors (9 out of 26), in agreement with other reports \\[[@CR11]\\]. ", "Statistical analysis did not reveal any significant association of MDM4-S-to-flMDM4 ratio with the features described in Table [1](#Tab1){ref-type=\"table\"}.", "\n\nThe second variant form we investigated was MDM4-211 (HDMX211), previously isolated from a thyroid tumor cell line \\[[@CR13]\\]. ", "MDM4-211 mRNA was present in 7 out of 57 original tumor samples and in 8 out of 26 additional samples analyzed with an overall frequency of 18% (Table [2](#Tab2){ref-type=\"table\"} and data not shown). ", "Its mRNA was not detected in any of the CRTL samples, thus confirming its specific presence in tumor tissue. ", "In agreement with our previous reports \\[[@CR13]\\], western blot analysis of available tumor and CTRL samples confirmed enhanced levels of the oncoprotein MDM2 in tumors expressing MDM4-211 (Fig.", " [3](#Fig3){ref-type=\"fig\"}, samples marked by \\*). ", "In our tumor set, the presence of MDM4-211 did not correlate with any of the properties described in Table [1](#Tab1){ref-type=\"table\"} nor with the expression of the form MDM4-S, indicating that the presence of these two variants is an independent event.", "\n\nSome authors have hypothesized that the presence of MDM4 variants may correlate with lower level of flMDM4 \\[[@CR11]\\]. ", "We therefore assessed the presence and expression of MDM4-S and MDM4-211 in correlation with flMDM4 and with the MDM4 T-to-N ratio. ", "We observed no significant correlation but rather a slight association between low levels of both MDM4-S and flMDM4 (*p* = 0.056).", "\n\nDiscussion {#Sec13}\n==========\n\nIn this study, we have analyzed the expression of MDM4 and MDM2 mRNAs in a group of 57 papillary thyroid tumors in comparison to matching normal tissues. ", "We observed that MDM4 levels are significantly lower in tumor samples than in control. ", "Specifically, tumor samples expressing levels of MDM4 lower than matching control are very frequent (51%) and this decrease in expression appears to correlate significantly with higher tumor stages (stage I in comparison to the other), indicating that it occurs with tumor progression. ", "These data led us to hypothesize that a robust presence of MDM4 might exert an antagonistic role in PTC evolution. ", "To date, the majority of the literature has reported amplification of MDM4 in the presence of wt TP53 in different tumor histotypes \\[[@CR3]\\], partly in contrast with our data. ", "However, a different status of MDM4 in some cancer has also been reported. ", "In a gene profiling analysis, MDM4 downregulation was observed in prostate tumors with poor prognosis in comparison to those with good prognosis in agreement with the hypothesis that MDM4 may be detrimental to tumor progression \\[[@CR23]\\]. ", "Moreover, two studies reported low levels of MDM4 protein in chronic myeloid leukemia tumor samples and in tumor cell lines \\[[@CR24], [@CR25]\\]. ", "It would be interesting to know whether those cell lines have features resembling those of advanced-stage tumors. ", "Some authors have suggested that low MDM4 expression levels may be correlated to the presence of a mutated TP53 \\[[@CR11], [@CR25]\\]. ", "However, lack of detection of any of the most frequent mutation of TP53 gene in this PTC group does not support this hypothesis, at least in this type of cancer. ", "Similarly, in the prestate tumor study TP53 was found to be wild type by sequencing (A. Farsetti, personal communication).", "\n\nThese data counteract the holistic view of MDM4 as a p53 inactivation tool and suggest that its function may be more complex than previously considered, at least in some tissues. ", "Thus far, molecular studies indicating MDM4 functions different from negative regulation of 53 have provided evidence that MDM4 may display antiproliferative or proapoptotic activities, under stress conditions \\[[@CR6], [@CR7]\\]. ", "Further, a recent work has shown for MDM4 a role in suppressing tumorigenesis through the control of bipolar mitosis \\[[@CR26]\\]. ", "Whether these mechanisms occur in PTC remain to be elucidated.", "\n\nIn the analysis of tumor MDM4 expression levels, we found that high levels of MDM4 are associated with multifocal tumors. ", "Different hypothesis have been postulated to explain the origin of these tumors. ", "Certainly, multifocality is related to the high proliferative potential of thyrocites. ", "MDM4 has been reported as inhibitor of p53-mediated growth arrest \\[[@CR1]\\]; thus, it might be hypothesized that the presence of MDM4 may predispose to multifocality and tumor development, while a decrease in its expression may confer an advantage to tumor progression. ", "Interestingly, one study has documented a statistically significant association of MDM4 amplification with low-grade astrocytomas, thus supporting the hypothesis that high levels of MDM4 may represent an early advantageous event for tumor development \\[[@CR27]\\]. ", "Further, the association between MDM4 levels and tumor multifocality is of particular clinical relevance. ", "Indeed, the possibility of early diagnosis of tumor multifocality might allow discrimination between partial or total thyroid gland ablation. ", "The extension of this type of analysis to a broader set of samples, including benign lesions, should help to confirm these findings and to investigate potential applications of this molecule in clinical practice.", "\n\nIn addition, we have observed with high frequency the aberrant presence of MDM4 alternatively spliced forms, whose oncogenic activity has been assessed so far only in vitro. ", "In our analysis, the aberrant presence of these variants did not correlate with any of the histopathological features. ", "In a study with primary sarcomas, the MDM4-S-to-flMDM4 ratio correlated with enhanced cell proliferative potential and decreased patient survival \\[[@CR11]\\]. ", "The high incidence of patient survival in PTC (only three deaths in our group, Table [2](#Tab2){ref-type=\"table\"}) does not allow to confirm this association. ", "For MDM4-211, this is the first frequency report in a large group of tumor samples and indicates that its presence is appreciable in PTC (18%). ", "Interestingly, these MDM4 variants forms show in vitro an even stronger inhibitory activity toward p53 than the full-length protein. ", "Their presence may concur to modify the activity of flMDM4, making more complex the assessment of its function in tumor cells. ", "It has to be mentioned that in many PTC samples we observed the presence of a MDM4 minor form whose nature is unclear, supporting the hypothesis that MDM4 variants may concur to MDM4 oncogenic functions.", "\n\nConversely, MDM2 mRNA levels were increased in majority of tumor samples. ", "In particular, we observed with high frequency enhanced protein levels in tumor samples that do not show enhanced mRNA levels. ", "This is in accord with previous reports and confirms that in thyroid tumors MDM2 overexpression takes place frequently by mechanisms other than enhanced transcription \\[[@CR28]\\]. ", "At least in some of these samples, the simultaneous presence of MDM4-211 variant may cause such upregulation. ", "These data further confirm the general view of the antagonistic role of MDM2 toward the oncosuppressor p53. ", "Finally, in this study, we did not find any correlation between MDM2 and MDM4 mRNA levels, suggesting that the alterations we observed occur independently from one another.", "\n\nOverall, our results reveal that MDM4 alterations, particularly the presence of its variant forms with p53-inhibitory properties, are present at high frequency in PTC confirming the general model of different ways of p53 inactivation in human tumors. ", "However, our data represent the first statistical report of a strongly significant downregulation of flMDM4 expression in cancer and particularly in advanced-stage tumors, suggesting that this protein may play additional roles besides p53 inactivation at least in PTC. ", "In view of the suggested strategies for abrogation of MDM4 in human tumors \\[[@CR1], [@CR3]\\], our findings counsel acquisition of more information on the molecular functions of this protein in different human tumors in order to carefully evaluate the application of such therapies.", "\n\nWe are grateful to Dr. Silvia Bacchetti and Dr. Silvia Soddu for helpful discussion. ", "A.P and S.G. equally contributed to this work.", "\n\n**Funding** This work has been supported by grants from the Italian Association for Cancer Research and Ministero dell'Università e della Ricerca. ", "F. Mancini is a recipient of a Fondazione Italiana per la Ricerca sul Cancro fellowship.", "\n\n**Open Access** This article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.00007715751707110065, 0.00008416799932665601, 0.000022893248780934502, 0.00010330578512396694, 0.00009534524513262523, 0.00010023722810651875, 0.000027382006370880152, 0.00006503642039542143, 0.0000502992807202857, 0.0008650519031141869, 0.0011337868480725624, 0, 0.00007352220370551907, 0.0001400511186583103, 0.0000400576830636116, 0.00007561436672967865, 0.00002712673611111111, 0.000015622803043322032, 0.0000483863163497363, 0, 0.00002479666732791113, 0.0000591715976331361, 0.00017099278410451078, 0.000027411529289219047, 0, 0, 0.00008416799932665601, 0, 0, 0.00009611687812379854, 0, 0.00001976214284867337, 0, 0, 0.000015138408304498269, 0.00008984524157139328, 0.00014363688595231256, 0.00004367193641366058, 0.00008543722499893203, 0.00008579027138322515, 0.00008439429012345679, 0.00591715976331361, 0.00034150672768253537, 0, 0, 0, 0, 0.00009425959091337542, 0.00011138338159946535, 0.00022634676324128565, 0.00007561436672967865, 0.00005208333333333334, 0.00014863258026159333, 0.00591715976331361, 0.000012225536701061176, 0.00006255082254331645, 0, 0.00003399943900925635, 0.00009255402841408673, 0.00019290123456790122, 0.00018896447467876037, 0, 0.0000717128617017462, 0, 0.00002085027418110548, 0, 0.00005314061005420342, 0.000029135831245265425, 0, 0, 0, 0.00010412328196584755, 0.000004340277777777778, 0.0001234567901234568, 0.000193698347107438, 0.00006383861597880558, 0.00006944444444444444, 0, 0.000036289737262302225, 0, 0.00027210884353741496, 0, 0.00007762619107686934, 0, 0.00010850694444444444, 0, 0.00003419855682090216, 0.0625, 0, 0, 0, 0, 0, 0.00021701388888888888, 0, 0, 0.00003652567755131858, 0.00003149407911312673, 0.00002514964036014285, 0, 0.0625, 0.00009780429360848941, 0, 0, 0.00002023950075898128, 0, 0.000022675736961451248, 0.000043282548476454294, 0.00002958579881656805, 0.00007305135510263716, 0, 0.0000801153661272232, 0.00012624668602449185, 0.0625, 0.00013840830449826988, 0.00008264462809917355, 0.000029218407596785978, 0.00001890359168241966, 0, 0.00007652280379553107, 0.00008043596291902109, 0.0002040816326530612, 0.000051226009152380304, 0.00009070294784580499, 0.00005972110245155126, 0.00002684635829149776, 0, 0.000037180249851279, 0.0001020304050607081, 0, 0.0625, 0, 0, 0.000019665586698197158, 0, 0, 0, 0.00006298815822625346, 0.00009611687812379854, 0.00007527569724114569, 0.00007694675284702985, 0.00004449982200071199, 0.0002227667631989307, 0.000020545693622616697, 0.0625, 0.00008116224332440549, 0, 0, 0, 0.00007561436672967865, 0, 0, 0.00002691272587466359, 0.000022675736961451248, 0.00008113919428780073, 0.000020661157024793387, 0.00006718624025799517, 0.00008264462809917355, 0.00017777777777777779, 0.0000946850145183689, 0.00011562030292519367, 0.00002333776750916007, 0.00004084911697825465, 0.000048225308641975306, 0.00008218277449046679, 0.0001183431952662722, 0.00002475186257765897, 0, 0.00007889546351084813, 0, 0.0000461361014994233, 0.00013437248051599034, 0.0001721763085399449, 0.0000591715976331361, 0.00005658669081032141, 0.0001321178491214163, 0.000012225536701061176, 0.0001512287334593573, 0.0000946850145183689, 0.00017777777777777779, 0.000051652003236858867, 0.000140739350722462, 0, 0.00016707507239919803, 0, 0.00006718624025799517, 0.000030524098775983637, 0.00007561436672967865, 0.0001183431952662722, 0, 0.00013007284079084286, 0, 0, 0.00004084911697825465, 0.00004304407713498623, 0.00008899964400142399, 0, 0, 0.00003228305785123967, 0, 0.00003955539733396622, 0, 0.000048225308641975306, 0.00005653230821414438, 0, 0.00007279963114853551, 0, 0, 0.0000617283950617284, 0.00008264462809917355, 0.00008573388203017832, 0.00006760411032990806, 0.000015622803043322032, 0, 0.000037724460540214275, 0.0002642356982428326, 0.0004725897920604915, 0.00009008603216071348, 0.00025826446280991736, 0.000014907350814686723, 0 ]

[ "Q:\n\nGet Server time and insert into Mysql table via a Form\n\nI have a form that posts the Date, Title, Message and Image into an SQL table. ", "It all works fine, except the form, it has a field that I have to manually enter the date and time.", "\nWhat I want to know is how can I get the PHP to get the date & time (GMT time) of when the form button is pressed and post it into the \"time\" section of my sql table instead of me doing it manually, I'm using this as a ultra lightweight CMS blog.", "\nThis is my insert.php\nmysql_query(\"INSERT INTO Blog\n(Date, Title, Message, Image) \nVALUES('$_POST[Date]', '$_POST[Title]' , '$_POST[Message]' , '$_POST[Image]' ) \")\nor die(mysql_error()); \necho \"1 record added\";\nThis is my form\n\n<form action=\"insert.php\" method=\"post\">\n<span class=\"label\">Date: </span> <input type=\"text\" class=\"dateField\" name=\"Date\" />\n<span class=\"label\">Title: </span> <input type=\"text\" class=\"titleField\" name=\"Title\" />\n<span class=\"label\">Message: </span> <textarea name=\"Message\" class=\"messageField\" maxlength=\"1000\" cols=\"0\" rows=\"0\"></textarea>\n<span class=\"label\">Image URL: </span> <input type=\"text\" class=\"ImageField\" name=\"Image\" />\n<input type=\"submit\" class=\"submitBtn\"/>\n</form>\n\nI want the server to add the Time/Date instead of me typing it in manually. ", "Is this easily done?", "\n\nA:\n\nmysql_query(\"INSERT INTO Blog (Date, Title, Message, Image) \n VALUES(now(), '\" . ", "$_POST[Title] . \"' , '\" . ", "$_POST[Message] . \"' , ", "\n '\" . ", "$_POST[Image] . \"' ) \") ", "or die(mysql_error());\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0001035143108534755, 0, 0.000032782048550213904, 0.00000433385724852071, 0, 0.00010412328196584755, 0, 0, 0, 0, 0 ]

[ "Q:\n\nIs drawing an arrow from a quiver an item interaction?", "\n\nSo in a given turn in combat, you can interact with an item once per turn for free, then any subsequent interactions with the same or another item costs an Action (which, unless you can Action Surge or are hasted, this is your only Action). ", "\nIs drawing an arrow from a quiver to fire it from your bow an item interaction, or is this just part of the Attack Action with the bow?", "\nFor example, let's say I have a Ranger (low level, so that he doesn't yet have Extra Attack, not that it should affect this question, but let's keep it simple anyway) and he has a longbow and a shortsword. ", "On his previous turn, he drew his sword with his free item interaction (whilst his bow was still in his other hand, since it only requires two handed to use, not to hold) and slew a nearby enemy that was badly injured (not worth an arrow). ", "\nCombat continues and it's his turn again; he wants to sheath his sword and fire at another enemy at distance with his bow (which he's still holding). ", "By sheathing the sword and thus using up his free item interaction, can he now not draw an arrow without wasting his Action, thus not being able to actually fire the arrow?", "\nAlso, I'm aware of the \"drop the sword\" option, but this situation is illustrative of the rule I'm trying to discern, so I don't care about how to actually have him fire an arrow or not.", "\n\nA:\n\nDrawing an arrow from a quiver is part of the action of attacking with a longbow\nLongbows (and all ranged weapons that fire projectiles) have the ammunition property which says:\n\nDrawing the ammunition from a quiver, case, or other container is part of the attack (you need a free hand to load a one-handed weapon).", "\n\nThus, it is not an object interaction or anything else. ", "It is simply considered part of your attack.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0.00003387017561686058, 0.00005406574394463668, 0.00004667553501832014, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Main Menu\n\nSecondary Menu\n\nAuthor Options:\n\nHelp with some engineering issues on a folding tail gate ramp? ", "Answered\n\nI'm building a folding ramp to replace my tailgate on my truck. ", "It's going to be used to load/unload a ztr lawn mower. (", "It's been built primarily from discarded bed frames, with the addition of some expanded steel grating.)", "\n\nBecause these mowers are back heavy, and low to the ground, a longer ramp is needed than you need to load a conventional mower.", "\n\nMy solution is a spring loaded 8' ramp that is comprised of two 4' sections that fold down and out.", "\n\nIt functions, it fits, the mower goes up and down it ok.", "\n\nThe problem is that it is so heavy, that after it comes down about 2/3 of the travel, it is very difficult to control.", "\n\nWhen it comes down hard, it puts tremendous stress on the center - where the two sections of ramp meet. ", "It can be hard enough to break it.", "\n\nI know my welding isn't the best, but that's really not the issue here. ", "This is a design problem. ", "I'm going to post a few pictures, to better illustrate my situation, and to show some of the things I've tried to soften the blow.", "\n\nThe picture of the partially folded ramp was taken at the point where it begins to get difficult to lower without losing control.", "\n\nSo, to clarify, I need a way to lower and raise the ramp with more control, and or soften the blow towards the middle.", "\n\nThe springs I'm using are 140lb garage door extension springs, the largest springs available at any big box home center.", "\n\nI need to get this finished yesterday, so I'm going to try some things while I'm waiting for a response, like move the springs back further in the bed to put more tension on the whole thing. ", "I'll also post this to the welding web forum, but I started here because I've got a lot of faith in the ingenuity of the instructables community.", "\n\nIf we get the bugs out of this thing and anyone wants it in instructable form, I'll do my best.", "\n\nThat's just what I ended up doing, and it's been functioning smoothly for weeks.", "\n\nI can't thank everyone enough. ", "There have been so many well thought out answers that I don't think it would be fair to select just one as the best. ", "If the good people at Instructables, would let me pick a dozen, I'd try to narrow it down.", "\n\nFor the springs, I ended up with a neater, safer, design, based on the gorilla lift patent application.", "\n\nHere's some pictures of the whole thing in it's current state. ", "It just needs a sign. ", "Thanks to all of your help, I got it finished, and it got me my first paid welding job, which is now also finished.", "\n\nThe vertical component of the force from the springs is small compared to the horizontal component. ", "I suggest raising the points where the springs attach to the truck by around a foot. ", "Not knowing the spring constant I can only approximate on the adjustment.", "\n\nTo stop the ramp from breacking in the middel I would have to small metal pieces on either side of the ramp and when you unfold it you slide a piece of steel in the slot and it will help control and the strength.", "\n\nThe problem has been identified. ", "Initially by NachoMahma, on up. ", "The angle of the spring is the problem here. ", "Think of it this way, the shallower the angle, the focus of torque is further away from the work end of the spring. ", "The most efficient is 90 deg. ", "to the attachment point up to about 45 deg. ", "After that, the spring becomes effectively weaker as the torque multiplies exponentially, moving the apparent attachment point away from the true attachment point. ", "At some point, the spring cannot overcome the force and becomes invisible in the system. ", "The best way to mod your setup is to redesign it so the angle stays in the 90-45 deg. ", "arc. ", "Try relocating the springs to the bottom of the bed at the sides, attatched to the front. ", "then connect some cable to the loose end and feed it through 2 pulleys, one near the bottom of the bed and a second mounted approximately 2 feet above the top of the side. ", "Then connect the cable to your original mounting point on the ramp. ", "That should solve most all of your problems, including making it more safe. ", "I also like the idea of putting some wheels or rollers on the end of the ramp.", "\n\nHere's a rough drawing of what I mean: Picture. ", "Use it if you want, modify it if you see fit. ", "You could even enclose the spring to make it even more safe. ", "I would use a pulley with a cable guide (looks like a U-strap over the pulley) for the lower pulley and then put a cable clamp on the cable near that pulley (between the pulley and spring) when the ramp is fully extended so that IF the spring were to break, the cable would be stopped from flying around and hurting someone.", "\n\nIf you were to attach our spring to the front of the bed and then put a sheve (roller in a yoke) to the other end of the spring. ", "You will need to mount a frame to the end of the bed about the height of the ramp about four feet high. ", "Then attach the cable to this frame then run it through the sheve then to another roller mounted just above the cable mount. ", "Now run your cable up to another roller at the top of the frame and now to your ramp. ", "You will find this well give you more control and you well need to adjust the spring as it may be to strong.", "\n\nAnotherBrian has the right idea replace the hinges with, or just add, torsion springs, like you find on a roll-up garage door only smaller. ", "If the torsion springs are strong enough you can eliminate the long garage door springs.", "\n\nI would add torsion springs to the center fold as well. ", "Also it's a good idea to make the springs replaceable. ", "If they break you will be able to repair them.", "\n\nIf you connect a wire rope to the point near where the spring is connected to the tail gate with a length connected to a stantion connected over the weight baring legwith another wire rope connected to the point at the eyebolt as the ramp extends it should complete the process. ", "captmichaelpierce@gmail.com\n\nA torsion spring located in the hinge between the ramp and truck bed (replacing the two extension springs) would be the perfect solution here. ", "It's resistance would increase as the ramp is pulled down which sould correctly balance the increasing torque.", "\n\nI've designed one of these for 40K# equipment but to make it more user friendly I split it into 2 ramps. ", "Also, the use of steel makes the system naturally heavy. ", "The 2 ramps and a nitrogen damper cylinder should at least help\n\nstand on the tailgate, grab the middle of the springs and pull them up in the air! ", "allthough i cant see where youve mounted the ends of the springs you need to raise the height of the 'car end' of the springs by about 1 foot! ", "its that simple! (", "the radius of the hinge relative to the mounting point for the car end of the springs has too small of a diameter, increasing the diameter of the mechanism by raising the mounting points will give you tention on the spring for a longer degree of travel on the ramp. ", "if i was doing it ide cantilever the end of the ramp too like on one of those fold out toolboxes which would bring the weight of the end of the ramp closer to the top of it, see crude pic) BUT...thats how to fix that idea when you could just use a winch instead!", "\n\nI will agree with the winch idea previously stated. ", "It will allow for much more control of the lowering of your ramp. ", "If you wanted to speed things up a little bit, perhaps you could attach a bicycle disk brake or two to the shaft of the winch and let the winch freewheel while regulating its speed with the brake. ", "I'm not sure what kind of force/weight you are dealing with so more than one brake caliper might be necessary but something along those lines seems feasible to me.", "\n\nI have a small trailer with a folding tailgate and agree that it can be unwieldy. ", "This is how I do it. ", "I raise the back section to a verticle position and lower it as one unit. ", "Your gate may be too heavy to do this but it works for me. ", "You may also want to align and weld some pieces of pipe to each side of the gate near the hinge point to drop a pin (rod) through. ", "This may also strenghthen the gate. ", "Be careful not to pinch your fingers.", "\n\nWell I don't know if this would help, but the equation of a spring constant is F=-kx, F=force, k= constant, x=distance (0 distance is when the spring is at rest, don't worry about the negative). ", "If you attach the spring to the ceiling and attach a mass the spring will stretch (obviously). ", "Multiply the mass by gravity and you will have the Force F=mg (gravity =32 f/s^2 or 16m/s^2 in metric). ", "F/x =k and you will have the spring constant. ", "Average multiple Forces and distances to find a precise constant. ", "If you know the weight of the gate (I would measure it in kilograms to make it easier ie 2.2lbs=1kg) The reason I explain this is because you will know how much force is being applied when the spring is @ a certain distance. ", "The gait is using a torque that will change with the angle of gait. ", "Technically torque=Frsin(angle), but I would take force*radius of the gait*cos(angle of the gait). ", "90 degrees would be straight up. ", "cos(90)= zero. ", "It would also be easier to make the gait one piece because you would have to figure the math multiple times. ", "Well good luck. ", "I know this is a long complicated answer, but you will find most of this on Wikipedia. ", "Good luck\n\nthe winch is probably better but for an alternate solution. ", "if you know how to configure pullies you could use pullies and some parachord or strong woven rope that is easy on the hands. ", "two pullies would cut the weight in half and be faster than winching. ", "you could make it so that your in the box of the truck out of the way while lowering it. ", "or off to the side of the truck.", "\n\nI strongly agree with Paganwonder, get some safety cables on those springs or someone is going to get seriously injured for life. ", "I've seen pics of dudes with half their face ripped off. ", "You are not the first one to try this route. ", "Everyone elses answer was hydraulics. ", "Or, turn your ramp into a \"Tiliting\" trailer, as much time as you spent you are already half way there you just need some wheels. ", "Good Luck.", "\n\nOn the first picture there is a post stick up in the side of the bed. ", "Lengthen this post to the length of the ramp folded up. ", "Attach a pulley to the top and a boat winch to the bottom of the post. ", "Not attach a cable thru the pulley and hook it to the hinge point of the ramp. ", "Now you can control the lowering and raising of the ramp\n\nI'd leave the springs but you need to run a cable thru them like on a garage door since they are streatched and if they break and they do often they are a huge hazard.", "\n\n+1 Great plan, especially the cable within the springs to prevent taking your head off in the event of failure. ", "What about springs or gas struts under the hinge point to assist with smooth opening/closing in conjunction with the winch?", "\n\n. ", "As the rear section swings out, the amount of leverage you gain is overwhelming your springs. . ", "Add some rollers to the back edge of the ramp (the edge that touches the ground. ", "Use size/shape appropriate for surface you will be using ramp on. ", "Adjust everything so the rear edge contacts the ground a little before the shown position. . ", "May still need to add springs and/or shock absorbers/dampers between the two pieces of ramp. . ", "All that's just off the top of my head. ", "I may have missed an important detail or two." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0009765625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00004959333465582226, 0, 0, 0, 0, 0, 0.00003380205516495403, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0044444444444444444, 0, 0, 0.0001321178491214163, 0, 0, 0, 0, 0, 0.0000573921028466483, 0, 0, 0, 0, 0, 0, 0.00031887755102040814, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Meta\n\nCategory: Venezuelan News\n\nRecently a Danilo Diaz Granados on facebook posted on 14 hostages have finally been freed from a prison in Lara Sate after a 4 day stand off with criminal gangs. ", "When a grenade was set off in the prison cafeteria, many individuals were sent to the hospital. ", "Criminal gangs then managed to take 14 public workers hostage. ", "These public workers were helping inmates with legal and educational needs. ", "All of the prisoners who were a part of this will be facing trials and will have time added on to their sentences.", "\n\nThe great scandal in all of this is the fact that firearms were smuggled into the prison from an inside source. ", "All security workers are being questioned now. ", "This is something that is making individuals all over Venezuela question the nature of those who work for the government. ", "It is alarming to think that an inside source could have been a part of the problem. ", "Venezuela Analysis by Diaz Granados reports that there is a push since 2011 to give inmates better living conditions and more recreational opportunities." ]

{ "pile_set_name": "Pile-CC" }

[ 0.00005259697567389875, 0, 0, 0, 0, 0, 0, 0, 0, 0.00008543722499893203 ]

[ "NEO is the only brand that developed a speedriding harness with a dedicated geometry specifically designed to favour the practice of skiing. ", "Going from the sitting to standing positions becomes natural, fast and very easy. ", "New this season, leg straps go into a sleeve for more comfort; they are to be donned and can be adjusted.", "\n\nAlong with its famous technical clothing brand Picture Organic Clothing, NEO integrated the geometry of its harness to ski pants and jacket, which were specially designed by both Picture and NEO R&D teams.", "\n\nPut your harness on before your ski suit, pass the 2 carabiners through the dedicated zip pockets, and you are ready to go riding. ", "Very simple to implement, this ski suit gives you a freedom of movement that you never felt before. ", "The original geometry of the Body favouring the skiing position goes perfectly well with this NEO / Picture original idea. ", "You will even find in the trousers a pocket dedicated to the fast packing bag of your wing.", "\n\nTo complete this exceptional product, NEO revolutions again the practice of speedriding offering the first Airbag avalanche rescue backpack developed with the specialized brand ARVA.", "\n\nThis NEO ARVA Reactor backpack has a capacity of 32L and can easily hold your folded wing. ", "You can finally attach you speed bag to the shoulder of this backpack when you have to carry it between two runs." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0000502992807202857, 0, 0, 0.00007001330252748022, 0, 0, 0.00006609822195782934, 0, 0.00005907372400756144, 0, 0 ]

[ "<Application x:Class=\"NumericScaleOverview.", "App\"\r\n xmlns=\"http://schemas.microsoft.com/winfx/2006/xaml/presentation\"\r\n xmlns:x=\"http://schemas.microsoft.com/winfx/2006/xaml\"\r\n StartupUri=\"MainWindow.xaml\">\r\n <Application.", "Resources>\r\n \r\n </Application.", "Resources>\r\n</Application>\r\n" ]

{ "pile_set_name": "Github" }

[ 0, 0.00004286694101508916, 0, 0 ]

[ "This invention relates to devices for the treatment of heart disease and particularly to endo-arterial prosthesis, which are commonly called stents.", "\nSeveral interventional treatment modalities are presently used for heart disease including balloon and laser angioplasty, atherectomy and by-pass surgery.", "\nIn typical balloon angioplasty procedures, a guiding catheter having a preformed distal tip is percutaneously introduced through the femoral artery into the cardiovascular system of a patient in a conventional Seldinger technique and advanced within the cardiovascular system until the distal tip of the guiding catheter is seated in the ostium of a desired coronary artery. ", "A guidewire is positioned within an inner lumen of a dilatation catheter and then both are advanced through the guiding catheter to the distal end thereof. ", "The guidewire is first advanced out of the distal end of the guiding catheter into the patient\"\"s coronary vasculature until the distal end of the guidewire crosses a lesion to be dilated, then the dilatation catheter having an inflatable balloon on the distal portion thereof is advanced into the patient\"\"s coronary anatomy over the previously introduced guidewire until the balloon of the dilatation catheter is properly positioned across the lesion. ", "Once in position across the lesion, the balloon which is made of relatively inelastic materials, is inflated to a predetermined size with radiopaque liquid at relatively high pressure (e.g., greater than 4 atmospheres) to compress the arteriosclerotic plaque of the lesion against the inside of the artery wall and to otherwise expand the inner lumen of the artery. ", "The balloon is then deflated so that blood flow can be resumed through the dilated artery and the dilatation catheter can be removed therefrom. ", "Further details of dilatation catheters, guidewires, and devices associated therewith for angioplasty procedures can be found in U.S. Pat. ", "No. ", "4,323,071 (Simpson-Robert); U.S. Pat. ", "No. ", "4,439,185 (Lindquist); U.S. Pat. ", "No. ", "4,516,972 (Samson); U.S. Pat. ", "No. ", "4,538,622 (Samson, et al.); ", "U.S. Pat. ", "No. ", "4,554,929 (Samson, et al.); ", "U.S. Pat. ", "No. ", "4,616,652 (Simpson); U.S. Pat. ", "No. ", "4,638,805 (Powell); and U.S. Pat. ", "No. ", "4,748,982 (Horzewski, et al.) ", "which are hereby incorporated herein in their entirety by reference thereto.", "\nA major problem which can occur during balloon angioplasty procedures is the formation of intimal flaps which can collapse and occlude the artery when the balloon is deflated at the end of the angioplasty procedure. ", "Another major problem characteristic of balloon angioplasty procedures is the large number of patients which are subject to restenosis in the treated artery. ", "In the case of restenosis, the treated artery may again be subjected to balloon angioplasty or to other treatments such as by-pass surgery, if additional balloon angioplasty procedures are not warranted. ", "However, in the event of a partial or total occlusion of a coronary artery by the collapse of a dissected arterial lining after the balloon is deflated, the patient is put in an extremely dangerous situation requiring immediate medical attention, particularly in the coronary arteries.", "\nA major focus of recent development work in the treatment of heart disease has been directed to endoprosthetic devices called stents. ", "Stents are generally cylindrically shaped intravascular devices which are placed within a damaged artery to hold it open. ", "The device can be used to prevent restenosis and to maintain the patency of blood vessel immediately after intravascular treatments. ", "In some circumstances, they can also be used as the primary treatment device where they are expanded to dilate a stenosis and then left in place.", "\nHowever, the rapid and effective delivery of a stent to the desire location within the patient\"\"s vasculature has been found to be difficult, particularly in those situations in which an intimal flap has occluded an artery. ", "Attempts to advance a stent into regions of coronary arteries occluded by dissected arterial linings have not been very successful.", "\nThe two basic methods and systems have been developed for delivering stents to desired locations within body lumens. ", "One method and system involves compressing or otherwise reducing the diameter of an expandable stent, disposing the compressed stent within a lumen provided in the distal end of a tubular catheter, advancing the catheter through the patient\"\"s vasculature until the distal end of the catheter is immediately adjacent to the desired vascular location and then pushing the stent out the distal end of the catheter into the desired location. ", "Once out of the catheter, the compressed stent expands or is expanded to thereby hold open the artery or other body lumen into which it is placed.", "\nAnother method and system involves disposing a compressed or otherwise small diameter stent about an expandable member such as a balloon on the distal end of a catheter, advancing the catheter through the patient\"\"s vascular system until the stent is in the desired location within a blood vessel and then expanding the expandable member on the catheter to expand the stent within the blood vessel. ", "The expanded expandable member is then contracted and the catheter withdrawn, leaving the expanded stent within the blood vessel, holding open the passageway thereof.", "\nThe following references illustrate various types of stents and stent delivery systems. ", "The list is meant to be exemplary, not exhaustive on the subject.", "\nWhat has been needed and heretofore unavailable is a stent delivery system which can be quickly and easily used in a wide variety of situations and particularly in emergency situations where a dissected arterial lining has collapsed and has occluded the flow of blood to a vital organ. ", "The present invention satisfies this need.", "\nThis invention is directed to an improved stent delivery system which can quickly and easily position a stent into an occluded region of a blood vessel.", "\nThe stent delivery system of the invention includes an elongated sheath having an inner lumen extending therein, a first port in its distal end which is adapted to receive a guidewire and a second port spaced proximally from the distal end of the delivery sheath which is also adapted to receive a guidewire, both of the ports being in fluid communication with the inner lumen of the sheath. ", "The delivery system also includes an intravascular catheter slidably disposed within the inner lumen of the delivery sheath, the catheter having an expandable member on the distal extremity thereof, such as an inflatable balloon, which is adapted to receive an expandable stent on the exterior thereof. ", "The catheter has a first port in its distal end adapted to receive a guidewire and a second port spaced proximally from the distal end of the catheter adapted to receive a guidewire, with both of these ports being in communication with an inner lumen extending within the interior of the catheter. ", "The second guidewire receiving port should be spaced proximally from the expandable member on the distal extremity of the catheter. ", "Means may be provided to adjust the relative axial positions of the catheter and sheath to expose the expandable stent on the expandable member of the catheter so that the stent can be expanded against the blood vessel wall by expanding the expandable member.", "\nPreferably, both the delivery sheath and the intravascular catheter have slits in the walls, thereof which extend distally from their proximal ports to facilitate the removal of these devices from the guidewire upon the withdrawal of the delivery system from the patient\"\"s vascular system after the delivery of a stent.", "\nIn a typical situation, the guidewire used to deliver a dilatation catheter through the patient\"\"s vascular system to a stenotic region therein is left disposed within the patient after the dilatation catheter has been removed therefrom. ", "To maintain access to the stenotic region, the distal end of the guidewire should be left crossing the stenotic region where the stent is to be placed. ", "The proximal end of the guidewire, which extends out of the patient, is inserted through the port in the distal end of the intravascular catheter which has a stent mounted on the expandable member. ", "The intravascular catheter is disposed within the inner lumen of the delivery sheath with the distal end of the catheter extending out the port in the distal end of the delivery sheath to facilitate the insertion of the proximal end of the guidewire. ", "The relative axial position between the delivery sheath and intravascular catheter is adjusted so that the expandable member on the distal extremity of the intravascular catheter with the expandable stent mounted thereon is pulled back into the inner lumen of the delivery sheath. ", "The delivery sheath and the catheter therein are then advanced through the patient\"\"s vascular system, preferably over a guide wire which extends rom outside the patient to the ostium of the desired coronary artery, over a guidewire which extends from outside the patient to the ostium of the desired coronary artery, until the stent mounted on the expandable member of the intravascular catheter is positioned within the stenotic region of the patient\"\"s blood vessel.", "\nThe relative axial positions of the delivery sheath and the intravascular catheter having the stent thereon is adjusted to urge the distal end of the vascular catheter out of the distal end of the sheath to expose the expandable stent. ", "Either the catheter can be advanced distally with respect to the sheath or the sheath can be withdrawn proximally with respect to the catheter or both movements can be employed. ", "Once the stent is completely out of the delivery sheath, the expandable member on the intravascular catheter can be expanded to expand the stent against stenotic mass within the blood vessel. ", "After expanding the stent, the expandable member on the vascular catheter is contracted so that the catheter can be removed from the patient\"\"s blood vessel, leaving the expanded stent in its desired position therein.", "\nThe delivery sheath and the intravascular catheter may be withdrawn together or the sheath may be withdrawn first followed by withdrawal of the catheter. ", "They are removed over the guide wire until the proximal guide wire port on the sheath and/or the catheter exits the proximal end of the guiding catheter, the sheath and the catheter can be peeled away from the guidewire with the guidewire sliding through the slits which extend distally from the proximal ports thereof. ", "The sheath and the intravascular catheter are pulled proximally out of the proximal end of the guiding catheter a sufficient distance to expose the guide wire. ", "The exposed section of the guidewire is secured, e.g., manually held, in place so that the sheath and the intravascular catheter can be pulled off the proximal end of the guidewire.", "\nThe delivery system of the invention can effectively deliver a stent to a desired location within a patient\"\"s blood vessel, it can allow the stent to be secured within the desired location, and it can be easily and quickly removed. ", "These and other advantages of the invention will become more apparent from the following detailed description of the invention, when taken in conjunction with the accompanying exemplary drawings." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0.00004162330905306972, 0, 0, 0, 0, 0, 0, 0, 0.0006925207756232687, 0, 0, 0, 0.0011111111111111111, 0, 0.0012755102040816326, 0, 0, 0.0012755102040816326, 0, 0, 0.0010405827263267429, 0, 0.0008650519031141869, 0, 0.0011111111111111111, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "[Indication for preventive measures in benign colonic diseases].", "\nFor non-malignant colon diseases the indications for preventive measures can be of tumorous and non-tumorous nature. ", "In case of ulcerative colitis and Crohn's colitis local and systemic complications may demand a colectomy. ", "The operative procedures in this case are proctomucosectomy with ileumpouch or ileorectostomy , if continence can be preserved. ", "Mucosal proctectomy with ileumpouch will prevent the obligatory malignant change in familial adenomatosis. ", "The preventive resection in diverticulitis bewares of the complication of the progressive phlegmonous infection of the colonic wall." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0.00008734387282732115, 0, 0, 0 ]

[ "Q:\n\nHow to interpret the check in a method that illustrates the indexOf method of a list\n\nCan someone explain the purpose of checking next == null if e == null is true? ", "\nAnd when e == null is false, why do we need to check whether e equals next? ", "\nThe last question, why method checks whether e equals next but if true it return previousIndex? ", "I thought that it return nextIndex.", "\npublic int indexOf(E e) {\n for (ListIterator<E> it = listIterator(); it.hasNext(); ){\n if (e == null ? ", "it.next() == null : e.equals(it.next()))\n return it.previousIndex();}\n// Element not found\nreturn -1;\n}\n\nThanks\n\nA:\n\nThe ternary operator here is used to do a null-safe equals-check.", "\nSometimes, when you don't control the content of the List it's necessary to do such checks because you can't use the e.equals(obj) when eis null.", "\nBetter would be if the List would not return nullvalues.", "\nTo figure out we it does we can refactor it.", "\nIn the first step we replace the expression of the if statement by a method call.", "\nBecause we don't know what it does we call the method foo, we'll rename it later. ", "It will return a boolean and takes two arguments of type E one for the e and one for the it.next().", "\nAfter the refactoring it looks something like: \npublic int indexOf(E e) {\n for (ListIterator<E> it = listIterator(); it.hasNext(); ){\n if (foo(e, it.next())\n return it.previousIndex();}\n // Element not found\nreturn -1;\n}\n\npublic boolean foo(E e, E next) {\n // in the first step we take the expression as it is\n return e == null ? ", "next == null : e.equals(next);\n}\n\nThen we split the ?: ", "operator into if else statements\npublic boolean foo(E e, E next) {\n if (e == null) \n return next == null;\n else \n return e.equals(next);\n}\n\nNow we see what it does. ", "If the passed Element e is null it checks if next also is null and in this case it returns true, false otherwise.", "\nIf eitself is not null it compares e with next using the equals method of E.\nSo it's a null-safe or null-aware equals comparison.", "\nWe now after we know what it does we rename foo into something useful like isEqual\net voilà \npublic int indexOf(E e) {\n for (ListIterator<E> it = listIterator(); it.hasNext(); ){\n if (isEqual(e, it.next()))\n return it.previousIndex();}\n // Element not found\n return -1;\n }\n\n// null safe equals check\npublic boolean isEqual(E e, E next) {\n if (e == null) \n // when e is null check if next / it.next() is also null\n return next == null;\n else \n // else compare left and right\n return e.equals(next);\n\n}\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0, 0.000027700831024930747, 0.00004691311690748733, 0, 0, 0, 0, 0, 0.000008401596303297626, 0, 0, 0, 0, 0.0000032348222141711094 ]

[ "Earl Wilber Sutherland, Jr.\n\n(1915–74). ", "U.S. pharmacologist and physiologist Earl Sutherland was the recipient of the 1971 Nobel Prize for Physiology or Medicine. ", "He devoted his research to the study of hormones, leading to his discovery that they control body functions by regulating the level of a substance called cyclic AMP, which in turn controls the cellular activity of each organ.", "\n\nEnable free complete viewings of premium articles from Britannica Online for Kids when linked from your website or blog-post.", "\n\nNow readers of your website, blog-post, or any other web content can enjoy full access to this article on Earl Wilber Sutherland, Jr. , or any other Britannica Online for Kids premium article for free, even if they do not have a membership. ", "Just copy the HTML code fragment provided below to create the link and then paste it within your web content. ", "For more details about this feature, visit our Webmaster and Blogger Tools page.." ]

{ "pile_set_name": "Pile-CC" }

[ 0.000625, 0.00006609822195782934, 0, 0, 0.00003387017561686058, 0, 0.00030483158055174517 ]

[ "<div class=\"navbar-wrapper\">\n <nav class=\"navbar\">\n <div class=\"container\">\n <div class=\"navbar-header\">\n <div class=\"navbar-brand\">\n <a href=\"/home\" class=\"navbar-brand\">\n {{ $main_company['name'] }}\n <br>\n \n </a>\n </div>\n </div>\n @include('partial.navigation_help')\n </div>\n </nav>\n</div>" ]

{ "pile_set_name": "Github" }

[ 0.000004340277777777778 ]

[ "Assessing the impact of essential tremor on upper limb function.", "\nWe compared the impact of essential tremor on the performance of three manual tasks: drawing spirals, holding a cup full of water and a joystick-controlled tracking test. ", "Tremor amplitude and frequency were measured by accelerometry during the tracking test, when holding the cup and whilst a standard posture was maintained. ", "The inter-relationships between tremor amplitude, frequency and task impairment were then examined. ", "The results showed that the amplitude and frequency of essential tremor (measured from the principal spectral peak) changed with different activities, with the mildest postural tremors changing most in frequency (by up to 4-5 Hz). ", "The amplitude of tremor decreased in almost every case during the tasks, relative to posture, and this decrement was greatest for the most severe tremors. ", "We also demonstrate that for practical purposes, such as routine clinical situations and therapeutic trails, the effect of essential tremor upon upper limb function can be usefully assessed by two simple complementary techniques: rating spirals and measuring the volume of water split from a cup. ", "The impairments in carrying out these tasks and the tracking test were highly correlated with one another and also with the amplitude and frequency of postural tremor. ", "The concept of tremor \"suppressability\" is introduced: the relative percentage decrease in the amplitude of a particular tremor during the performance of a specific task compared to that recorded whilst holding a standard posture." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Product options:\n\nProduct Information\n\nHyacinths are usually thought of as indoor bulbs, but they are very easy and reliable outdoors too. ", "When planted in beds or borders, they will fill your garden with powerful fragrance each April and of course their majestic flowers can be cut to make magnificent indoor cut flower displays too! ", "They are really easy to grow once planted, leave them in the ground and theyll flower for many years getting bigger and better each year!" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0 ]

[ "Huang Shuai was featured in numerous revolutionary posters, magazines and books, and was invited to speak at rallies staged by the revolutionary left.", "\n\nHuang Shuai, who became a household name after inadvertently triggering a crackdown on academia during China’s Cultural Revolution, has died at the age of 56.", "\n\nShe was a mere fifth-grader when a letter complaining against her primary school teacher made her a poster child of “the fight against revisionist elements,” which saw hundreds of teachers and academics sent to the countryside and forced into hard labor.", "\n\nHer legacy as “a little daring general of the anti-establishment struggle” haunted Huang for much of her life.", "\n\nThe former editor at a publishing house affiliated with the Beijing Institute of Technology died of an unidentified form of cancer on Dec. 10, Law & Life, a bimonthly magazine, reported.", "\n\nThe news of Huang’s death, which went unnoticed among the post-1970s generation, triggered an outpouring of grief mixed with pain among those who lived through the most tumultuous decade of modern Chinese history, from 1966 to 1976.", "\n\nHuang was a student at Zhongguancun No. ", "1 Primary School in Beijing’s Haidian district when she wrote a letter to editors at the state-controlled Beijing Daily in 1973, complaining about how she had been isolated from the rest of her class at the behest of her teacher.", "\n\nThe teacher’s order came in response to Huang’s critical comments written in an open diary, in which she wrote that the teacher was wrong when he threatened to cane her for breaking minor school rules, according to several history books.", "\n\nHuang claimed she had nightmares and cried at night over the mistreatment, and expressed in the letter her resolve to “fight on as a junior Red Guard.”", "\n\n“What have I done terribly wrong to deserve this punishment?” ", "she asked in the letter. “", "Are youth in Mao Zedong’s era still condemned to be the slaves of an old education system dictated by rigid teaching measures?”", "\n\nIn a rare interview with Shanghai-based Xinmin Evening News in 2009, Huang said she wrote the letter simply in the hope that it would help resolve the issue between the teacher and her. ", "She said she immediately regretted her actions after posting the letter because she was wrong in the first place and her teacher had treated her well in general.", "\n\nBut it was too late, and she could do little after the populist forces on the left — led by Mao’s wife, Jiang Qing, and her accomplices — quickly seized upon it and blew it up into something beyond a dispute between a student and a teacher.", "\n\nInstead, the row was upheld as an example of the class struggle between proletariat and bourgeoisie, and the divergence of two paths guided by traditionalism and revisionism.", "\n\nThe Beijing Daily and the People’s Daily, both controlled by the revolutionary left at the time, later published excerpts of her letter with an editor’s note, catapulting the 13-year-old into the national limelight. ", "Soon Huang became a poster child for the far left’s campaign against China’s establishment.", "\n\nHuang was featured in numerous revolutionary posters, magazines and books, and was invited to speak at rallies staged by the revolutionary left.", "\n\nMany schoolteachers and university professors lived in fear amid this anti-establishment furor, because anything they might do to discipline students could be dismissed as “rigid or an act of revisionism.” ", "This may have forced them to write long confessions or self-criticisms, or face public humiliation.", "\n\nHuang is among several infamous icons of the Cultural Revolution, who were used by the left to whip up zealous ideological campaigns that pit “leftists against rightists” — or workers, peasants and soldiers against scholars. ", "Often these were violent confrontations.", "\n\nMassive disruptions across the spectrum of Chinese political, social and economic life during this tumultuous decade pushed the country to the verge of collapse.", "\n\nResearch institutions, universities and schools were among those hardest hit as scholars, teachers and artists were targeted for physical abuse or were sent to factories and labor camps in remote rural areas for reeducation.", "\n\nQi Hongrui, Huang’s teacher, was lucky to keep his job after he apologized over the episode, he said in media interviews back in 2006.", "\n\nHe never thought of punishing Huang though he admitted that he was young himself and might have been a little harsh on her. ", "Qi said he recalled visiting Huang at her home on a day she was sick, and even the day when her letter was published on Beijing Daily.", "\n\nQi said Huang and several of her classmates visited him after she was admitted to college.", "\n\n“We spent the entire day rowing in a lake inside the Summer Palace,” he said. “", "We didn’t touch on what had happened between us as we felt we had both made peace with that incident,” he said.", "\n\nBut in a twist of fate, Huang was briefly targeted for criticism and even bullied over her role shortly after the end of the Cultural Revolution. ", "Her father, a zealous leftist, was sent to prison, though there is little information on the reason for his downfall.", "\n\nHuang was nearly barred from attending college after a background check linked to her activities during the Cultural Revolution, although she had passed the national college entrance exams in 1979. ", "She was eventually allowed to enter the Beijing Institute of Technology, her top choice, after rumored intervention from someone high-up in the administration. ", "This figure is supposed to be Hu Yaobang, the Communist Party's general secretary at the time, who noted that she was too young to be held accountable for what had happened during the Cultural Revolution.", "\n\nHuang had kept up the hobby of writing a diary, but her mother, who was horrified by what had happened to her, is said to have knelt down in front of her when she entered college, begging her to stop and burn all her previous journals, Huang wrote in a collection of diary entries published in 1993.", "\n\nHuang said she didn’t return to her hobby until she went to study in Japan two years after her graduation from the Beijing Institute of Technology in 1984. ", "She was part of an army of Chinese youth leaving to study abroad in the 1980s and she stayed in Japan until 1998.", "\n\nInformation about her life after the Cultural Revolution is hard to come by. ", "Her years in college and in Japan helped shield her from the public glare, she told Xinmin Evening News in the 2009 interview.", "\n\nShe had married and had a son who was born in Japan in 1996, according to the newspaper.", "\n\nWhen asked by the newspaper about her thoughts on what happened to her during the Cultural Revolution, she said “during my entire adolescence, what I felt the most was my own hurt, the pain of that era and the pain that others went through.”", "\n\nContact reporter Li Rongde (rongdeli@caixin.com)" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.000044444444444444447, 0.000078125, 0, 0.00007971938775510203, 0.000028293345405160706, 0.00001826283877565929, 0.0005668934240362812, 0.000019069049026525047, 0.000017506696311339085, 0.00008543722499893203, 0, 0, 0, 0.00005658669081032141, 0, 0.00003415067276825354, 0, 0.000042083999663328004, 0.00012075836251660429, 0.00004691311690748733, 0, 0, 0.000019406547769217335, 0, 0, 0, 0.00010813148788927336, 0.00006298815822625346, 0.00016707507239919803, 0.00011814744801512288, 0, 0, 0.00004565376186997809, 0, 0.000025, 0.0000390625, 0.00004805843906189927, 0.00002207481153629651, 0.0000801153661272232, 0, 0, 0.00006298815822625346, 0.0001234567901234568, 0, 0.0008 ]

[ "Atomic masses of tritium and helium-3.", "\nBy measuring the cyclotron frequency ratios of (3)He(+) to HD(+) and T(+) to HD(+), and using HD(+) as a mass reference, we obtain new atomic masses for (3)He and T. Our results are M[(3)He]=3.016 029 322 43(19) u and M[T]=3.016 049 281 78(19) u, where the uncertainty includes an uncertainty of 0.12 nu in the mass reference. ", "Allowing for cancellation of common systematic errors, we find the Q value for tritium β decay to be (M[T]-M[(3)He])c(2)=18 592.01(7) eV. This allows an improved test of systematics in measurements of tritium β decay that set limits on neutrino mass." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0.00000929506246281975, 0 ]

[ "Introduction\n============\n\nLung cancer is the leading cause of cancer-related death worldwide, and approximately 85% of all diagnosed lung cancer cases are non-small cell lung cancer (NSCLC) ([@b1-or-44-01-0185],[@b2-or-44-01-0185]). ", "Great progress in therapeutic strategies has been made over the past decades including the discovery of epidermal growth factor receptor (EGFR)-tyrosine kinase inhibitors (TKIs), which have dramatically changed the prognosis of advanced NSCLC patients harboring specific *EGFR*-activating mutations ([@b3-or-44-01-0185],[@b4-or-44-01-0185]). ", "However, patients who initially respond to EGFR-TKIs eventually acquire resistance, resulting in progression and relapse ([@b5-or-44-01-0185],[@b6-or-44-01-0185]). ", "Several mechanisms are believed to be responsible for acquired EGFR-TKI resistance. ", "The secondary *EGFR* T790M mutation that can eliminate inhibition of the respective TKIs accounts for half of the potential mechanisms ([@b7-or-44-01-0185]). ", "The remaining resistance mechanisms under non-T790M mutation status can be classified into three types. ", "Phenotypic or histological changes include small cell lung cancer (SCLC) transformation and epithelial to mesenchymal transition (EMT) process. ", "Accumulating studies point to a molecular association between EMT and TKI resistance. ", "Tissue samples of lung cancer patients who develop acquired resistance to erlotinib were found to consist of EMT features ([@b8-or-44-01-0185]). ", "Activation of AXL receptor tyrosine kinase (*AXL*) and transforming growth factor-β (TGF-β) is associated with the EMT process in EGFR-TKI-resistant NSCLC ([@b9-or-44-01-0185]). ", "In terms of compensatory bypass signaling pathways, insulin-like growth factor 1 receptor (IGF1R)/MEK, *AXL*/PI3K/AKT, hepatocyte growth factor receptor (HGFR)/MAPK pathways were found to be involved in TKI resistance ([@b10-or-44-01-0185]). ", "It has been reported that the InsR/IGF1R pathway confers resistance to gefitnib resistance in glioblastoma through AKT regulation ([@b11-or-44-01-0185]). ", "Point mutations of target genes also contribute to non-T790M mutations such as *HER2* amplification, *MET* amplification, *BRAF* mutation and *PIK3CA* mutation ([@b12-or-44-01-0185]). ", "Osimertinib is a third-generation EGFR-TKI used for the treatment of patients with the T790M mutation; however no special treatment has been discovered for patients harboring non-T790M mutations ([@b13-or-44-01-0185],[@b14-or-44-01-0185]). ", "Therefore, further elucidation of other potential mechanisms that are critical for the development of effective therapeutic strategies targeting patients without the T790M mutation is urgent.", "\n\nMicroRNAs are a class of small non-coding RNAs that play essential roles in tumor development and progression via the regulation of various networks that are associated with multiple cellular functions, such as proliferation, migration, and metabolism ([@b15-or-44-01-0185]). ", "Accumulating evidence has shown that a number of microRNAs may have a specific role in lung cancer pathogenesis and biological and pathological behaviors as well as in modulating the response to anticancer treatments, particularly EGFR-TKIs ([@b16-or-44-01-0185],[@b17-or-44-01-0185]). ", "It is reported that circulating miR-21 expression in the peripheral blood of patients significantly increased from the baseline to high levels with the progression of disease following treatment with EGFR-TKI. ", "Mechanically, miR-21 was found to induce EGFR-TKI resistance via downregulating *PTEN* and *PDCD4* and activating the PI3K/AKT pathway ([@b18-or-44-01-0185]). ", "MicroRNAs have also been reported to reverse drug resistance in addition to contributing to gefitinib resistance in tumor cells. ", "miR-506-3p was identified to reverse gefitinib resistance by targeting Yes-associated protein 1 in the PC9GR cell line ([@b19-or-44-01-0185]). ", "miR-497 was reported to enhance the sensitivity of NSCLC cells to gefitinib by targeting *IGFR-1* ([@b20-or-44-01-0185]).", "\n\nIn the present study, we mainly focused on the identification of new microRNAs underlying non-T790M mutation-induced gefitinib resistance. ", "Here, we found that the PC9GR cell line acquired a secondary T790M mutation, herein the non-T790M mutated HCC827GR cell line was selected for our experiments. ", "Our results showed that miRNA-625-3p was significantly downregulated in HCC827GR cells compared to that noted in the HCC827 cells. ", "Overexpression of miRNA-625-3p was found to enhance sensitivity to gefitinib and inhibit the migratory and invasive abilities of HCC827GR cells. ", "Furthermore, a functional assay also indicated that miRNA-625-3p could directly target *AXL* to reverse the EMT process. ", "Taken together, these results suggest that the modulation of miRNA-625-3p may be a potential strategy to overcome gefitinib acquired resistance in NSCLC.", "\n\nMaterials and methods\n=====================\n\n### Cell culture and reagents\n\nThe NSCLC cell line HCC827 and 293T cells were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). ", "To establish the gefitinib-resistant cell strain HCC827GR, HCC827 cells were exposed to gefitinib as previously described ([@b21-or-44-01-0185]). ", "The NSCLC cell line PC9 and PC9 gefitinib-resistant (PC9GR) cell line were obtained from Professor Caicun Zhou (Shanghai Pulmonary Hospital) as a gift and were maintained in Dulbecco\\'s modified Eagle\\'s medium (DMEM; Gibco, Carlsbad, CA, USA) supplemented with 10% foetal bovine serum (FBS) (Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin/streptomycin (Gibco; Thermo Fisher Scientific, Inc.). ", "All cell lines were cultured at 37°C in a humidified atmosphere containing 5% CO~2~. Among all cell lines, both HCC827 and PC9 cell lines contain exon 19 deletions (del 19). ", "PC9GR cells contain the T790M mutation while HCC827 do not. ", "Detailed mutation information is documented in [Table SII](#SD1-or-44-01-0185){ref-type=\"supplementary-material\"}. ", "The EGFR inhibitor gefitinib was purchased from Selleck, at doses of 0--40 µM (Selleck Chemicals).", "\n\n### Next-generation DNA sequencing\n\nThe DNAseq was performed by Geneseeq Co. DNA from cell lines was profiled and then analyzed using a capture-based targeted sequencing panel. ", "Human genomic regions totalling 1.4 megabases in size, including selected exons and introns of 357 genes, were captured using 120-bp probes. ", "DNA was fragmented into segments 200 to 250 bp in length, captured by the 120-bp probes, and sequenced by obtaining paired 2×150-bp reads. ", "After DNA extraction with the QIAamp DNA Mini Kit (Qiagen), DNA concentrations were measured using the Qubit dsDNA assay (Invitrogen; Thermo Fisher Scientific, Inc.). ", "The DNA quality was confirmed by checking that the A260/A280 ratio was 1.8:2.0. ", "The appropriate concentration value for samples was higher than 100 ng/µl and 4 mg DNA was needed for each sample. ", "DNA was hybridized with the capture probes (the bait), selected using magnetic beads, and polymerase chain reaction (PCR)-amplified. ", "Then, a Qubit and Agilent 2100 bioanalyzer (Agilent Technologies) was used to perform high-sensitivity assays assessing DNA quality and size range. ", "All samples were sequenced on a HiSeq 4000 platform (Illumina, Inc.) and pair-end reads were obtained. ", "For tissue samples, we aimed to achieve an average sequencing depth of 2,000× for all targeted regions.", "\n\n### miRNA library construction and RNA sequencing\n\n#### Sample preparation\n\nTotal RNA was extracted from HCC827 and HCC827GR cells by TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) separately. ", "The RNA quality was checked by a Bioanalyzer 2200 (Agilent Technologies) and stored at −80°C. ", "RNA with RNA integrity number (RIN) \\>6.0 was appropriate for miRNA purification. ", "miRNA was purified by the miRNeasy Mini Kit (Qiagen), and the purity was validated by gel electrophoresis.", "\n\nThe complementary DNA (cDNA) libraries for single-end sequencing were prepared using the Ion Total RNA-Seq Kit v2.0 (Life Technologies; Thermo Fisher Scientific, Inc.) according to the manufacturer\\'s instructions. ", "The cDNA library was size selected by PAGE gel electrophoresis for miRNA sequencing. ", "The cDNA libraries were then processed for the proton sequencing process according to commercially available protocols. ", "Samples were diluted and mixed, and the mixture was processed on a OneTouch 2 Instrument (Life Technologies; Thermo Fisher Scientific, Inc.) and enriched on a OneTouch 2 ES station (Life Technologies; Thermo Fisher Scientific, Inc.) to prepare the template-positive Ion PI™ Ion Sphere™ Particles (Life Technologies; Thermo Fisher Scientific, Inc.) according to the instructions for the Ion PI™ Hi-Q OT2 200 Kit (Life Technologies; Thermo Fisher Scientific, Inc.). ", "After enrichment, the mixed template-positive Ion PI™ Ion Sphere™ Particles of the samples were loaded onto 1 v3 Proton Chip (Life Technologies; Thermo Fisher Scientific, Inc.) and sequenced on Proton Sequencers according to the protocol for the Ion PI Hi-Q Sequencing 200 Kit (Life Technologies; Thermo Fisher Scientific, Inc.) by NovelBio Corp. Laboratory, Shanghai.", "\n\n#### Filtering and miRNA mapping\n\nWe performed filtering of the raw reads after sequencing to obtain clean data using the following criteria: i) 30% base quality \\<20, ii) the sequences shorter than 15 bp or longer than 33 bp were discarded, and iii) presence of the adaptor sequence. ", "Utilizing the BWA software BSA-backtrack) ([@b22-or-44-01-0185]), we mapped the clean data to the human miRNA database (miRBase v21.0) ([@b23-or-44-01-0185]) and the human genome (GRCh38, NCBI) ([@b24-or-44-01-0185]).", "\n\n#### RNA sequencing mapping/mapping of pair-end reads\n\nBefore read mapping, clean reads were obtained from the raw reads by removing the adaptor sequences, reads with \\>5% ambiguous bases (noted as N) and low-quality reads containing more than 20% of bases with quality of \\<20. ", "The clean reads were then aligned to the human genome (version: GRCh38) using the HISAT2 programme ([@b25-or-44-01-0185]). ", "Dif-Gene-Finder ([@b26-or-44-01-0185]) and Target Analysis were described in our previous study ([@b27-or-44-01-0185]).", "\n\n#### Cell transfection\n\nTransient transfection of miR-625-3p mimics, miR-NC, control siRNA and *AXL* siRNA was carried out using Lipofectamine 2000 Reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer\\'s protocols. ", "The target siRNA sequences are: si-NC, 5′-UUCUCCGAACGUGUCACGUTT-3′; si-*AXL*: 5′-ACAGCGAGAUUUAUGACUATT-3′. The sequences of miR-625-3p are as follows: Sense, GACUAUAGAACUUUCCCCCUC A and antisense, UGAGGGGGAAAGUUCUAUAGUC; for miR-NC, sense, UUUGUACUACACAAAAGUACUG and antisense, CAGUACUUUUGUGUAGUACAAA. ", "All mimics were synthesized by Guangzhou Ribo BioCompany (Guangzhou, China). ", "siRNAs were provided by GenePharma Co. Cells were plated in 6-well plates (2×10^5^ cells/well) in advance. ", "At 50% confluence, the cells were transfected with 0.1 nmol miR-625-3p mimics, miR-NC or 100 pmol siRNAs using Lipofectamine 2000 transfection reagent in medium without serum. ", "After 6 h, the medium was changed to RPMI-1640 supplemented with 10% FBS. ", "After 48 h, the cells were collected for subsequent experiments.", "\n\n#### Cell growth inhibition assay\n\nAfter transfection with miR-625-3p mimics, miR-NC or siRNAs, the cells were seeded in 96-well plates (3×10^3^ cells/well) overnight. ", "Gefitinib was added in a dose-dependent manner, and the cells were incubated for 72 h. Then, we used the Cell Counting Kit-8 assay kit (CCK-8, Boster) to assess cell proliferation according to the manufacturer\\'s instructions. ", "Each sample was plated in triplicate, and three independent experiments were performed. ", "The half maximal inhibitory concentration (IC~50~) was defined as the concentration needed for a 50% reduction in the absorbance.", "\n\n#### Wound healing assay\n\nThe wound healing assay was used to determine the cell migration ability. ", "After cells formed a monolayer in 6-well plates, cells were washed with PBS and then cultured in RPMI-1640 medium with 1% FBS overnight. ", "Then the wound assay was performed. ", "A straight scratch was made gently through the cell monolayer using a 10-µl pipette tip. ", "Detached cells were washed away with PBS, and then fresh RPMI-1640 medium with 10% FBS was added. ", "The cells were imaged at 0 and 24 h after wounding using a light microscope (CKX41; Olympus, magnification, ×100).", "\n\n#### Transwell assays\n\nFor the migration assay, 800 µl medium supplemented with 10% FBS was added to the lower well, and 4×10^4^ cells in 200 µl medium supplemented with 1% FBS were seeded into the upper chamber of a Transwell insert. ", "The cells were incubated for 24 h at 37°C in 5% CO~2~. For the invasion assay, the inserts were coated with a Matrigel matrix (BD Science), which was diluted in serum-free medium and incubated at 37°C for 2 h before cell plating. ", "In both assays, the cells were then imaged under a light microscope (IX73; Olympus). ", "The detailed cell numbers in each field were counted via ImageJ software (National Institutes of Health). ", "Three independent experiments were performed.", "\n\n#### Plasmid construction and dual-luciferase reporter assay\n\nTo construct a plasmid containing the *AXL* 3′-UTR (3′ untranslated region) fused to the 3′ end of a luciferase reporter, a 221-bp fragment containing the predicted miR-625-3p target site (positions 905--911) was inserted into the psiCHECK-2 dual-luciferase vector (Promega). ", "The potential binding sites were predicted by TargetScan (<http://www.targetscan.org/>). ", "The psiCHECK-2-*AXL*−3′-UTR wild-type and mutated fragments were synthesized and subcloned directly (Genewiz). ", "Cells were plated in a 24-well plate overnight and then co-transfected with the wild-type or mutated plasmid, control pRL-TK plasmid and with either miR-625-3p mimics or miR-NC using Lipofectamine 2000 (Life Technologies; Thermo Fisher Scientific, Inc.). ", "Then, the cells were harvested, and luciferase activities were evaluated using a Dual-Luciferase Reporter Assay Kit (Promega). ", "Each experiment was performed in triplicate.", "\n\n#### RNA isolation and RT-qPCR\n\nTrizol reagent was used to extract RNA (Takara). ", "In our study, we extracted RNA from HCC827 and HCC827GR cells to detect miR-625-3p and *AXL* mRNA expression to verify the sequencing results. ", "After transfection of the HCC827GR cells with miR-NC and miR-625-3p, RNA was extracted to examine miR-625-3p and *AXL* expression to confirm whether miR-625-3p was upregulated and *AXL* was downregulated in the cells. ", "We also extracted RNA from HCC827GR cells transfected with si-NC and si-*AXL* to confirm whether *AXL* was downregulated.", "\n\nReverse transcription was performed using reverse transcriptase M-MLV (Takara) according to the manufacturer\\'s protocol. ", "miR-625-3p and U6-specific cDNA were synthesized using gene-specific primers designed and synthesized by Guangzhou RiboBio Co. (cat. ", "no. ", "MQPS0001992-1-100 and MQPS0001992-1-100). ", "Reverse transcription polymerase chain reaction (RT-qPCR) was performed using SYBR Premix ExTaq™ (Takara) according to the manufacturer\\'s instructions. ", "The primer sequences for RT-qPCR of *AXL* and GAPDH were as follows: *AXL* sense, 5′-GGTGGCTGTGAAGACGATGA-3′ and antisense, 5′-CTCAGATACTCCATGCCA-3′; GAPDH sense, 5′-TGCACCACCAACTGCTTAGC-3′ and antisense, 5′-GGCATGGACTGTGGTCATGG-3′. The PCR programme was as follows: 50°C for 2 min; 95°C for 10 min; and 45 cycles of 95°C for 15 sec and 60°C for 1 min. ", "The expression values of *AXL* and miR-625-3p were normalized to the values of the internal controls GAPDH and U6, respectively. ", "Relative expression was calculated using the 2^−ΔΔCt^ method ([@b28-or-44-01-0185]).", "\n\n#### Western blot analysis\n\nIn the present study, HCC827, HCC827GR, HCC82GR cell lines transfected with miR-625-3p, si-*AXL* or negative control were proceeded to extract proteins to identify the changes in the SMAD pathway and EMT-related signaling. ", "Generally, the cells were harvested and lysed on ice for 30 min in RIPA lysis buffer (cat. ", "no. ", "9806, Cell Signaling Technology, Inc.) to extract protein fractions. ", "The lysates were collected by high-speed centrifugation at 11,000 × g for 15 min at 4°C. ", "Lysates were subjected to western blot analysis as previously described ([@b29-or-44-01-0185]). ", "The antibodies used in our study included anti-vimentin (RV202, dilution 1:1,000, cat. ", "no. ", "550513, BD Biosciences), anti-pAXL (Y779, dilution 1:1,000, cat. ", "no. ", "AF2228, R&D Systems), and anti-AXL (C89E7, dilution 1:1,000, cat. ", "no. ", "8661), anti-Smad3 (C67H9, dilution 1:1,000, cat. ", "no. ", "9523), anti-pSmad3 (Ser423/425, dilution 1:1,000, cat. ", "no. ", "9520), anti-ZEB1 (D80D3, dilution 1:1,000, cat. ", "no. ", "3396), anti-Snail (C15D3, dilution 1:1,000, cat. ", "no. ", "3895s), anti-MMP2 (D8N9Y, dilution 1:1,000, cat. ", "no. ", "13132), and anti-MMP9 (603H, dilution 1:1,000, cat. ", "no. ", "13667), anti-N-cadherin (D4R1H, dilution 1:1,000, cat. ", "no. ", "13116) and anti-E-cadherin (4A2, dilution 1:1,000, cat. ", "no. ", "14472) (all from Cell Signaling Technology, Inc.), In addition, anti-β-actin (13E5, dilution 1:1,000, cat. ", "no. ", "4970S) and anti-mouse (dilution 1:2,000, cat. ", "no. ", "7076S) or anti-rabbit (dilution 1:2,000, cat. ", "no. ", "7074S) constituted the secondary antibodies and were also purchased from Cell Signaling Technology, Inc.\n\n#### Statistical analysis\n\nGraphPad Prism 5.02 (GraphPad Software, Inc.) and SPSS 16.0 software (SPSS, Inc.) were used to perform the statistical analysis. ", "Significant differences between two groups were assessed by a non-paired Student\\'s t-test. ", "Significant differences between three groups were analyzed using one-way ANOVA followed by Dunnett\\'s post-hoc test. ", "All statistical tests were two-tailed, and statistical significance was defined as P\\<0.05.", "\n\nResults\n=======\n\n### EMT features are detected in HCC827 gefitinib-resistant (HCC827GR) cells without the EGFR T790M mutation\n\nFirst, we established a gefitinib-resistant subline from the parental HCC827 and PC9 cells harboring EGFR-activating mutations. ", "As shown in [Fig. ", "1A and B](#f1-or-44-01-0185){ref-type=\"fig\"}, the gefitinib-resistant sublines HCC827GR (IC~50~: 0.07 µM vs. 23.64 µM) and PC9GR (IC~50~: 2.06 µM vs. 28.45 µM ) manifested significant resistance to gefitinib. ", "The T790M mutation and *MET* gene amplification are the most clearly defined mechanisms underlying acquired resistance to gefitinib. ", "Therefore, we profiled DNA from the cell lines and analyzed the gene status using a capture-based targeted sequencing panel that included the *EGFR* and *MET* genes ([Table SI](#SD1-or-44-01-0185){ref-type=\"supplementary-material\"}). ", "The results revealed that PC9GR cells acquired a secondary T790M mutation compared with HCC827GR cells, and *MET* gene amplification was not detected ([Table SII](#SD1-or-44-01-0185){ref-type=\"supplementary-material\"}). ", "Growing evidence has shown that in addition to the T790M mutation and *MET* amplification, EMT plays an important role in acquired resistance to EGFR-TKIs. ", "EMT is an important process during malignant cancer progression, accompanied by upregulation of N-cadherin and vimentin and downregulation of E-cadherin ([@b30-or-44-01-0185]). ", "Furthermore, wound healing and Transwell assays were performed, and the results showed that HCC827GR cells contained high migratory and invasive ability compared with HCC827 cells ([Fig. ", "1C and D](#f1-or-44-01-0185){ref-type=\"fig\"}). ", "Moreover, western blot analysis revealed decreased protein levels of E-cadherin and increased protein levels of N-cadherin and vimentin in the HCC827GR cells ([Fig. ", "1E](#f1-or-44-01-0185){ref-type=\"fig\"}).", "\n\n### miR-625-3p is decreased in HCC827GR cells, and overexpression of miR-625-3p attenuates gefitinib resistance via regulation of EMT phenotypes\n\nMicroRNAs can regulate multiple signaling cascades via transcriptional silencing effects. ", "First, microRNA library construction and RNA sequencing were performed. ", "We found 16 upregulated microRNAs and 27 downregulated microRNAs in HCC827GR cells when compared to the parental cells \\[[Fig. ", "2A](#f2-or-44-01-0185){ref-type=\"fig\"}, \\>1.5-fold change, false discovery rate (FDR) \\<0.05, P\\<0.05\\]. ", "To verify the results above, we performed RT-qPCR analysis and found that miR-625-3p expression was significantly reduced in HCC827GR cells compared with HCC827 cells ([Fig. ", "2B](#f2-or-44-01-0185){ref-type=\"fig\"}, P\\<0.001). ", "In addition, data showed similar downregulated miR-625-3p expression in PC9GR cells when compared to PC9 cells ([Fig. ", "S1A](#SD1-or-44-01-0185){ref-type=\"supplementary-material\"}).", "\n\nAs microRNA interventions can attenuate EGFR-TKI-resistant phenotypes, we next verified whether miR-625-3p overexpression could reverse the acquired resistance to EGFR-TKI. ", "HCC827GR cells were transfected with miR-625-3p mimics ([Fig. ", "3A](#f3-or-44-01-0185){ref-type=\"fig\"}). ", "As shown in [Fig. ", "3B](#f3-or-44-01-0185){ref-type=\"fig\"}, our results demonstrated that overexpression of miR-625-3p could partly reverse gefitinib resistance in the HCC827GR cells. ", "In addition, the IC~50~ value declined to 12.26 µM after miR-625-3p transfection. ", "Considering the findings that EMT is a mechanism of acquired resistance to EGFR-TKI, wound healing and Transwell assays were performed. ", "The results showed that overexpression of miR-625-3p inhibited the migratory and invasive ability of the HCC827GR cells ([Fig. ", "3C and D](#f3-or-44-01-0185){ref-type=\"fig\"}). ", "Moreover, western blot analysis showed increased E-cadherin expression and decreased N-cadherin and vimentin expression after miR-625-3p overexpression ([Fig. ", "3E](#f3-or-44-01-0185){ref-type=\"fig\"}).", "\n\n### AXL is upregulated in EGFR-TKI-resistant lung cancer cell lines and is a direct target of miR-625-3p\n\nIt is well accepted that microRNAs execute their function by attenuating the stability and translation of downstream target genes. ", "The miRanda and RNAhybrid databases were used to predict the potential mRNAs targeted by miR-625-3p. ", "Among all mRNAs presented in [Fig. ", "4A](#f4-or-44-01-0185){ref-type=\"fig\"}, *AXL* has been shown to be associated with EMT and drug resistance ([@b31-or-44-01-0185],[@b32-or-44-01-0185]). ", "Therefore, we focused on *AXL* as a new post-transcriptional mechanism of miR-625-3p. ", "RNA sequencing showed that *AXL* was upregulated in the HCC827GR cells ([Fig. ", "4B](#f4-or-44-01-0185){ref-type=\"fig\"}). ", "Additionally, upregulated *AXL* expression was also found in HCC827 erlotinib-resistant cells based on the data extracted from the public datasets GSE38121 and GSE71587 ([Fig. ", "4C and D](#f4-or-44-01-0185){ref-type=\"fig\"}). ", "To validate that *AXL* is a direct target of miR-625-3p, the *AXL* wild-type (WT) 3′-UTR (containing the miR-625-3p binding sequence) and the *AXL* MUT 3′-UTR were constructed ([Fig. ", "5A](#f5-or-44-01-0185){ref-type=\"fig\"}). ", "The dual-luciferase reporter assay conducted in 293T cells showed that miR-625-3p significantly inhibited the luciferase activity in cells transfected with the wild-type *AXL* 3′-UTR but did not in cells transfected with the mutant construct ([Fig. ", "5B](#f5-or-44-01-0185){ref-type=\"fig\"}). ", "Moreover, we also performed the luciferase assay in HCC827 and HCC827GR cells and got similar results ([Fig. ", "S2](#SD1-or-44-01-0185){ref-type=\"supplementary-material\"}). ", "In addition, we found that *AXL* expression was downregulated in the HCC827GR cells at both the mRNA and protein levels after transfection with miR-625-3p mimics ([Fig. ", "5C and D](#f5-or-44-01-0185){ref-type=\"fig\"}). ", "Collectively, our data showed that *AXL* is a target of miR-625-3p in NSCLC cells.", "\n\n### AXL knockdown attenuates gefitinib resistance in HCC827GR cells by reversing EMT phenotypes\n\nThe role of *AXL*-mediated EMT and drug resistance has been documented in many types of cancers, especially lung cancer. ", "First, we performed RT-qPCR analysis to confirm the results from RNA sequencing and found that the *AXL* level was significantly increased in HCC827GR cells compared with that noted in the HCC827 cells ([Fig. ", "6A](#f6-or-44-01-0185){ref-type=\"fig\"}, P\\<0.01). ", "In contrary, PC9GR cells were found to contain lower *AXL* mRNA expression when compared to PC9 cells ([Fig. ", "S1B](#SD1-or-44-01-0185){ref-type=\"supplementary-material\"}). ", "Next, we inhibited *AXL* using specific small interfering RNA (siRNA) and found that knockdown of *AXL* enhanced gefitinib sensitivity in the HCC827GR cells. ", "Similarly, the IC~50~ value decreased to 18.02 µM after *AXL* knockdown ([Fig. ", "6B and C](#f6-or-44-01-0185){ref-type=\"fig\"}). ", "To investigate whether knockdown of *AXL* enhanced gefitinib sensitivity by reversing EMT, wound healing and Transwell assays were performed. ", "The results showed that *AXL* knockdown significantly inhibited the migratory and invasive ability of HCC827GR cells ([Fig. ", "6D and E](#f6-or-44-01-0185){ref-type=\"fig\"}). ", "Western blot analysis demonstrated increased protein levels of E-cadherin and decreased protein levels of N-cadherin and vimentin in the HCC827GR cells following *AXL* knockdown ([Fig. ", "6F](#f6-or-44-01-0185){ref-type=\"fig\"}).", "\n\n### miR-625-3p/AXL axis contributes to gefitinib resistance via the SMAD pathway\n\nFrom previous results we know that overexpression of miR-625-3p or knockdown of *AXL* can attenuate gefitinib resistance by reversing the EMT phenotype. ", "However, the underlying mechanism remains unclear. ", "Given that the transforming growth factor (TGF)-β1 signaling pathway can contribute to the EMT phenotype in the progression of various cancers ([@b33-or-44-01-0185],[@b34-or-44-01-0185]), and that Smad3 functions as a canonical downstream player involved in the TGF-β1 signaling pathway ([@b35-or-44-01-0185],[@b36-or-44-01-0185]), we hypothesized that Smad3 may participate in *AXL*-mediated acquired resistance to gefitinib. ", "As shown in [Fig. ", "7A](#f7-or-44-01-0185){ref-type=\"fig\"}, western blot analysis demonstrated that the expression level of phosphorylated Smad3 was increased in the HCC827GR cell line compared to that found in the HCC827 cells. ", "In addition, the expression of the transcription factors Snail and ZEB1 was increased in the HCC827GR cells. ", "MMP family members, such as MMP2 and MMP9, showed similar upregulated tendencies. ", "Moreover, knockdown of *AXL* and overexpression of miR-635-3p decreased the protein levels of p-Smad3, ZEB1, Snail, MMP2 and MMP9 in the HCC827GR cells. ", "All these changes confirmed that the TGF-β1/Smad3 pathway was indeed involved in the miR-625-3p/*AXL* axis-mediated gefitinib resistance ([Fig. ", "7A](#f7-or-44-01-0185){ref-type=\"fig\"}).", "\n\nDiscussion\n==========\n\nRecently, the identification of epidermal growth factor receptor (*EGFR*) mutations as oncogenic drivers has launched the era of precision medicine in the treatment of non-small cell lung cancer (NSCLC). ", "A majority of patients who carry *EGFR*-sensitive mutations, such as exon 19 deletions (del 19) and exon 21 L858R substitutions, have benefited from the clinical application of gefitinib ([@b37-or-44-01-0185],[@b38-or-44-01-0185]). ", "However, some patients eventually develop acquired drug resistance during treatment, and thus, the efficacy is limited. ", "It has been reported that the T790M mutation accounts for more than 50% of the cases of known acquired resistance. ", "However, the mechanism for acquired resistance in the remaining patients without the T790M mutation still needs to be explored. ", "After profiling DNA from cell lines using a capture-based targeted sequencing panel, we found that PC9GR cells contained the T790M mutation compared to HCC827GR cells. ", "Therefore, in the next step, we mainly focused on the mechanism of resistance to gefitinib in the HCC827GR cell line.", "\n\nMicroRNAs are important regulators in tumor development and progression. ", "A vast variety of evidence also indicates that microRNAs can participate in the acquired resistance to epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs). ", "It has been reported that microRNA-147 overexpression can induce colon cancer cells to undergo a mesenchymal-to-epithelial transition phenotype to reverse gefitinib resistance ([@b39-or-44-01-0185]). ", "In NSCLC, miR-124 modulates gefitinib resistance through *SNAI2* and *STAT3*, providing a therapeutic strategy for reversing acquired gefitinib resistance in patients ([@b40-or-44-01-0185]). ", "Our microarray data showed that miR-625-3p was significantly downregulated in HCC827GR cells compared to HCC827 cells, implying that miR-625-5p may play an important role in the development of resistance to EGFR-TKIs.", "\n\nImportantly, we found that overexpression of miR-625-3p decreased the IC~50~ value in HCC827GR cells and thus partly reversed gefitinib resistance. ", "The EMT process has been demonstrated to contribute to acquired resistance to gefitinib. ", "Consequently, next we mainly focused on whether overexpression of miR-625-5p could induce mesenchymal-to-epithelial transition to reverse gefitinib resistance. ", "The Transwell and wound healing assays both showed that overexpression of miR-625-3p inhibited the migratory and invasive ability of HCC827GR cells. ", "Western blot assays further revealed increased expression of E-cadherin and decreased expression of N-cadherin and vimentin in HCC827GR cells transfected with miR-625-3p. ", "All of these findings confirmed that miR-625-3p overexpression indeed induced NSCLC cells to undergo mesenchymal-to-epithelial transition to reverse gefitinib resistance.", "\n\nAfter integrating the data obtained from Targetscan analysis, we were surprised to find that AXL receptor tyrosine kinase (*AXL*) was among the potential targets of miR-625-3p. ", "It is known that *AXL* is associated with EMT and TKI resistance. ", "We found higher *AXL* expression in HCC827GR cells based on RNA sequencing analysis. ", "Analysis of data from public databases also demonstrated that *AXL* is highly expressed in both HCC827GR and HCC827 erlotinib-resistant (HCC827ER) cells. ", "Dual-luciferase reporter assays were performed to prove that *AXL* is a direct target of miR-625-3p. ", "After knockdown of *AXL* expression, the IC~50~ value was decreased, and the migratory and invasive ability were decreased in HCC827GR cells. ", "Western blot analysis showed similar results that the expression of E-cadherin was increased. ", "Moreover, the expression of N-cadherin and vimentin were decreased, implying that the cells had acquired a mesenchymal-to-epithelial transition phenotype. ", "We should not ignore the fact that miR-625-3p and AXL mRNA expression were all showed to be downregulated in PC9GR cells when compared to the PC9 cells, indicating that the miR-625-3p/*AXL* axis may be responsible for the mechanism underlying non-T790M mutation. ", "However the hypothesis needs to be further explored.", "\n\nTumor growth factor-β1 (TGF-β1)-induced epithelial to mesenchymal transition (EMT) is recognized to contribute to the reduction in drug sensitivity and acquisition of resistance to EGFR-TKIs ([@b41-or-44-01-0185]). ", "Among all downstream signaling molecules, the Smad pathway is a major transducer in response to TGF-β1 stimulation. ", "Western blot analysis showed that the expression level of phosphorylated Smad3 was upregulated in the HCC827GR cells. ", "The expression level of p-Smad3 was downregulated after transfection with miR-625-3p or si-*AXL*. ", "In addition to the change in EMT features, ZEB1, Snail, MMP2 and MMP9 levels were also altered. ", "Collectively, these data indicate that the miR-625-3p/*AXL* axis contributes to gefitinib resistance via the SMAD pathway in NSCLC cells.", "\n\nHowever, the present study also consisted of various limitations. ", "We did not co-transfect the AXL plasmid and miR-625-3p mimics to assess gefitinib resistance and EMT phenotypes. ", "This rescue experiment can be regarded as another evidence of the miR-625-3p/*AXL* axis. ", "In addition, when we performed the wound healing assay, cells were starved before we scratched the cellular layer. ", "However in various research studies, to prevent cells from proliferating, cells were cultured in serum-free medium or in medium with lower concentrations of FBS after the scratch was made ([@b42-or-44-01-0185],[@b43-or-44-01-0185]). ", "Thus, we can repeat the wound healing assay under the latter condition to ensure the accuracy of the results in the future.", "\n\nIn conclusion, this is the first report showing that miR-625-3p overexpression reversed TGF-β1-induced EMT and enhanced gefitinib sensitivity by directly targeting *AXL* in lung cancer cells ([Fig. ", "7B](#f7-or-44-01-0185){ref-type=\"fig\"}). ", "The miR-625-3p/*AXL* axis was identified as a mechanism for the development of drug resistance in HCC827GR cells without the T790M mutation. ", "Our data may provide therapeutic approaches to increase drug sensitivity and combat resistance to EGFR-TKIs. ", "However, further studies are needed to clarify the underlying mechanism of the miR-625-3p/*AXL* axis and TGF-β1-induced EMT in NSCLC.", "\n\nSupplementary Material\n======================\n\n###### Supporting Data\n\nNot applicable.", "\n\nFunding\n=======\n\nThis work was supported by grants from the Jiangsu Provincial Medical Youth Talent (no. ", "QNRC2016746), the Postgraduate Research and Practice Innovation Program of Jiangsu Province (no. ", "KYCX18_2525), the Suzhou Key Laboratory for Respiratory Medicine (no. ", "SZS201617), the Clinical Medical Center of Suzhou (no. ", "Szzx201502), the Jiangsu Provincial Key Medical Discipline (no. ", "ZDXKB2016007), and the National Natural Science Foundation of China (no. ", "81702870).", "\n\nAvailability of data and materials\n==================================\n\nThe datasets used during the present study are available from the corresponding author upon reasonable request.", "\n\nAuthors\\' contributions\n=======================\n\nAll authors contributed to this article substantially. ", "WD, LS, and TL performed the experiments. ", "JZ and YZe were responsible for the literature research and collected the cell line data. ", "YZh and XW analysed the data. ", "ZL and JAH contributed to the design of this study and draft of the manuscript. ", "All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.", "\n\nEthics approval and consent to participate\n==========================================\n\nNot applicable.", "\n\nPatient consent for publication\n===============================\n\nNot applicable.", "\n\nCompeting interests\n===================\n\nThe authors declare that they have no competing interests.", "\n\nNSCLC\n\n: non-small cell lung cancer\n\nTGF-β1\n\n: transforming growth factor-β1\n\nHCC827GR\n\n: HCC827 gefitinib resistant\n\nEGFR-TKIs\n\n: epidermal growth factor receptor-tyrosine kinase inhibitors\n\nEMT\n\n: epithelial to mesenchymal transition\n\n{#f1-or-44-01-0185}\n\n{#f2-or-44-01-0185}\n\n{#f3-or-44-01-0185}\n\n{#f4-or-44-01-0185}\n\n{#f5-or-44-01-0185}\n\n{#f6-or-44-01-0185}\n\n{#f7-or-44-01-0185}\n\n[^1]: Contributed equally\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.00005478851632697786, 0.00002564891761567662, 0.000074360499702558, 0.0001417233560090703, 0.0000400576830636116, 0, 0.000048225308641975306, 0.00027041644131963225, 0.00009512485136741974, 0.0001893700290367378, 0.000051226009152380304, 0.000042165626581211, 0.00005907372400756144, 0.00003472222222222222, 0, 0.000012939288856684438, 0.000024451073402122352, 0.000022675736961451248, 0.00007911079466793244, 0, 0.000048902146804244705, 0.00013660269107301415, 0, 0, 0, 0, 0.00013660269107301415, 0.000042718612499466016, 0.00004622781065088758, 0.00004691311690748733, 0.00006126850308793256, 0.00003302946228035408, 0, 0, 0.00010412328196584755, 0.00003121001217190475, 0, 0, 0.00017928215425436553, 0, 0, 0, 0.00004565376186997809, 0.00009425959091337542, 0, 0.00009245562130177516, 0.00011317338162064282, 0.000297441998810232, 0.00008899964400142399, 0.00004247276433986706, 0, 0, 0.000027868608799048752, 0.0000369210775047259, 0.000012140489747356409, 0.0000637091465098006, 0.00002532895986626309, 0.0001321964439156587, 0.0002118494456606172, 0.00008195512137553476, 0.00005482215692294198, 0, 0.00008734387282732115, 0, 0, 0, 0, 0.00003881309553843467, 0, 0.00006009254251547383, 0, 0.000053279343598486864, 0, 0, 0.00010412328196584755, 0.00007694675284702985, 0, 0.000056710775047258974, 0.00013840830449826988, 0.00008899964400142399, 0, 0.000008650519031141868, 0.0002524933720489837, 0.00008116224332440549, 0.00003075740099961553, 0.000124000248000496, 0, 0.0005806357961968356, 0.000048902146804244705, 0.000042083999663328004, 0.00013660269107301415, 0, 0.00011306461642828876, 0, 0.0005668934240362812, 0, 0.00004012551260342351, 0.00012018508503094766, 0.0001417233560090703, 0.000031245606086644065, 0, 0, 0.00021003990758244068, 0, 0.00010850694444444444, 0, 0, 0.0002366863905325444, 0, 0.0004591368227731864, 0, 0, 0, 0, 0, 0, 0, 0.0004164931278633902, 0, 0.0004164931278633902, 0, 0, 0, 0, 0, 0, 0, 0.00008734387282732115, 0, 0, 0, 0, 0, 0.00005827166249053085, 0, 0.00014610271020527432, 0.00012075836251660429, 0.000015140274644582053, 0.0030864197530864196, 0.00009157299512373801, 0.00005653230821414438, 0.00001826283877565929, 0.000020661157024793387, 0.00008218277449046679, 0.00006383861597880558, 0.000028596757127741712, 0, 0.000036730945821854914, 0, 0.0000176541204717181, 0.00019290123456790122, 0, 0.00027210884353741496, 0.00003302946228035408, 0, 0.00007181844297615628, 0.0002687449610319807, 0.00003265306122448979, 0.0002601456815816857, 0, 0.0030864197530864196, 0, 0.000148720999405116, 0.00010813148788927336, 0.000062000124000248, 0, 0.00003955539733396622, 0, 0.00003501339262267817, 0.0000980296049406921, 0.0008163265306122448, 0.00017313019390581717, 0.00013520822065981613, 0.0004930966469428008, 0.000594883997620464, 0.00006456611570247934, 0, 0.00005972110245155126, 0, 0.000016128772116578765, 0, 0.00008416799932665601, 0, 0.00003501277966457757, 0, 0.000297441998810232, 0.00004132231404958677, 0.000045786497561869004, 0.0004, 0.00008416799932665601, 0, 0.00012017304919083481, 0.0003204614645088928, 0, 0.00009918666931164451, 0.00006503642039542143, 0.0004526935264825713, 0.000029218407596785978, 0, 0.00005341024408481547, 0, 0.00003290754624881396, 0.0030864197530864196, 0, 0, 0, 0.000042718612499466016, 0.000048225308641975306, 0, 0.000019069049026525047, 0.000018579072532699166, 0, 0, 0, 0, 0, 0, 0, 0.000025, 0.00008223458786765713, 0, 0.000044444444444444447, 0.00012624668602449185, 0, 0.00004504301608035674, 0, 0.00003460207612456747, 0.00003121001217190475, 0.0004591368227731864, 0.00027681660899653976, 0.000042165626581211, 0.0000980296049406921, 0.00009918666931164451, 0, 0, 0.000014457343607685523, 0, 0.0000637091465098006, 0.00014863258026159333, 0, 0, 0.00010850694444444444, 0.00010655868719697373, 0, 0.00015662933667475918, 0, 0, 0.000036839875481220875, 0, 0.0001, 0, 0, 0, 0.00016959692464243314, 0.00012913223140495868, 0.00008734387282732115, 0.00010628122010840684, 0.0006122448979591836, 0.0006611570247933884, 0.000244140625, 0.00018765246762994932, 0, 0, 0, 0.0011337868480725624, 0, 0.0011111111111111111, 0.00015625, 0, 0, 0, 0, 0.000031745527848764306, 0.00018765246762994932, 0, 0, 0, 0, 0.00011080332409972299, 0.00013840830449826988, 0, 0.00021626297577854672, 0, 0, 0, 0.00011814744801512288, 0, 0, 0, 0, 0.00006009254251547383, 0.0004081632653061224, 0.00008573388203017832, 0.00038446751249519417, 0.0003652300949598247, 0.00022160664819944597, 0.00009245562130177516, 0.00010412328196584755, 0, 0.00048069219676333925, 0.000625, 0.000028596757127741712, 0.00003228305785123967, 0.00009070294784580499, 0, 0.000186000372000744, 0.0001512287334593573, 0.00018261504747991235, 0.00027681660899653976, 0.00012075836251660429, 0, 0.0001602307322544464, 0.0000591715976331361, 0.00038580246913580245, 0.00013364963747535834, 0.00013840830449826988, 0.00004917307282532085, 0, 0.000038580246913580246 ]

[ "I am numb to everything except the tears that burn my cheeks.", "The anxiety pierces my head and the deafening pressure builds in my ears, I need release!But my granite limbs will not move. ", "They are as heavy as my heart.", "My mind spins with suffocating thoughts. ", "It is almost to much effort breathe.", "A small light within me wants to believe in hope, but I don't dare start.", "For the onset of reality will only leave me with further to fallSo instead, I lock my mind and pretend that all is right.", "As the dreamer inside me screams from within my tormented mind,I will pretend that I am all right and ignore the deafening lull Of white noise now within.", "Fate can be a cruel teacher even more so To the unwilling scholar.", "I should continue fighting I knowBut I can't any more today. ", "For now I must rest.", "Peace and stillness will silence the crying that can no longer Be controlled." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Special issue commentary: the changing face of inflammation in the brain.", "\nThe study of inflammation in the brain has been extended to include a wide range of conditions, but there remains plenty of argument over semantics and the precise definition of what constitutes inflammation in these pathologies. ", "In this special issue, we sought to highlight the diversity of what is considered to be inflammation in the brain, and we have accepted that the presence of microglia cells with altered morphology remains a useful starting point. ", "However, it is clear that whatever is the molecular expression profile that accompanies an activated microglial cell, it is not static and it is influenced by factors both intrinsic and extrinsic to the brain. ", "This article is part of a Special Issue entitled 'Neuroinflammation in neurodegeneration and neurodysfunction'." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0 ]

[ "John McDonnell has told BBC Breakfast that not calling for a general election now is about \"putting the country before party interest\".", "\n\nHe said that dealing with Boris Johnson \"is like someone dealing with a two or three year old having a tantrum\"." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.00010973936899862826, 0.00007694675284702985 ]

[ "#include \"../PrjFSKext/KauthHandlerTestable.hpp\"\n#include \"../PrjFSKext/VirtualizationRoots.hpp\"\n#include \"../PrjFSKext/PrjFSProviderUserClient.hpp\"\n#include \"../PrjFSKext/VirtualizationRootsTestable.hpp\"\n#include \"../PrjFSKext/VnodeCachePrivate.hpp\"\n#include \"../PrjFSKext/VnodeCacheTestable.hpp\"\n#include \"../PrjFSKext/PerformanceTracing.hpp\"\n#include \"../PrjFSKext/public/Message.h\"\n#include \"../PrjFSKext/ProviderMessaging.hpp\"\n#include \"../PrjFSKext/public/PrjFSXattrs.h\"\n#include \"../PrjFSKext/kernel-header-wrappers/kauth.h\"\n#import \"KextAssertIntegration.h\"\n#import <sys/stat.h>\n#include \"KextMockUtilities.hpp\"\n#include \"MockVnodeAndMount.hpp\"\n#include \"MockProc.hpp\"\n#include \"ProviderMessagingMock.hpp\"\n#include \"VnodeCacheEntriesWrapper.hpp\"\n#include <tuple>\n\nusing std::make_tuple;\nusing std::shared_ptr;\nusing std::vector;\nusing std::string;\nusing std::extent;\nusing KextMock::_;\n\n// Darwin version of running kernel\nint version_major = PrjFSDarwinMajorVersion::MacOS10_14_Mojave;\n\nstatic const pid_t RunningMockProcessPID = 501;\n\nclass PrjFSProviderUserClient\n{\n};\n\nstatic void SetPrjFSFileXattrData(const shared_ptr<vnode>& vnode)\n{\n PrjFSFileXAttrData rootXattr = {};\n vector<uint8_t> rootXattrData(sizeof(rootXattr), 0x00);\n memcpy(rootXattrData.data(), &rootXattr, rootXattrData.size());\n vnode->xattrs.insert(make_pair(PrjFSFileXAttrName, rootXattrData));\n}\n\nstatic void TestForDarwinVersionRange(int versionMin, int versionMax, void(^testBlock)(void))\n{\n const int savedVersion = version_major;\n for (int version = versionMin; version <= versionMax; ++version)\n {\n version_major = version;\n testBlock();\n }\n version_major = savedVersion;\n}\n\nstatic void TestForAllSupportedDarwinVersions(void(^testBlock)(void))\n{\n TestForDarwinVersionRange(PrjFSDarwinMajorVersion::MacOS10_13_HighSierra, PrjFSDarwinMajorVersion::MacOS10_15_Catalina, testBlock);\n}\n\n@interface HandleVnodeOperationTests : PFSKextTestCase\n@end\n\n@implementation HandleVnodeOperationTests\n{\n vfs_context_t context;\n string repoPath;\n string filePath;\n string dirPath;\n VirtualizationRootHandle dummyRepoHandle;\n PrjFSProviderUserClient dummyClient;\n pid_t dummyClientPid;\n shared_ptr<mount> testMount;\n shared_ptr<vnode> repoRootVnode;\n shared_ptr<vnode> testFileVnode;\n shared_ptr<vnode> testDirVnode;\n VnodeCacheEntriesWrapper cacheWrapper;\n}\n\n- (void) setUp\n{\n [super setUp];\n \n kern_return_t initResult = VirtualizationRoots_Init();\n XCTAssertEqual(initResult, KERN_SUCCESS);\n context = vfs_context_create(NULL);\n dummyClientPid = 100;\n\n cacheWrapper.", "AllocateCache();\n\n // Create Vnode Tree\n repoPath = \"/Users/test/code/Repo\";\n filePath = \"/Users/test/code/Repo/file\";\n dirPath = \"/Users/test/code/Repo/dir\";\n testMount = mount::Create();\n repoRootVnode = testMount->CreateVnodeTree(repoPath, VDIR);\n testFileVnode = testMount->CreateVnodeTree(filePath);\n testDirVnode = testMount->CreateVnodeTree(dirPath, VDIR);\n\n // Register provider for the repository path (Simulate a mount)\n VirtualizationRootResult result = VirtualizationRoot_RegisterProviderForPath(&dummyClient, dummyClientPid, repoPath.c_str());\n XCTAssertEqual(result.error, 0);\n self->dummyRepoHandle = result.root;\n\n MockProcess_AddContext(context, RunningMockProcessPID /*pid*/);\n MockProcess_SetSelfInfo(RunningMockProcessPID, \"Test\");\n MockProcess_AddProcess(RunningMockProcessPID, 1 /*credentialId*/, 1 /*ppid*/, \"test\" /*name*/);\n \n ProvidermessageMock_ResetResultCount();\n ProviderMessageMock_SetDefaultRequestResult(true);\n ProviderMessageMock_SetSecondRequestResult(true);\n}\n\n- (void) tearDown\n{\n if (VirtualizationRoot_GetActiveProvider(self->dummyRepoHandle).isOnline)\n {\n ActiveProvider_Disconnect(self->dummyRepoHandle, &self->dummyClient);\n }\n\n testMount.reset();\n repoRootVnode.reset();\n testFileVnode.reset();\n testDirVnode.reset();\n cacheWrapper.", "FreeCache();\n \n VirtualizationRoots_Cleanup();\n CleanupPendingRenames();\n vfs_context_rele(context);\n MockVnodes_CheckAndClear();\n MockCalls::Clear();\n MockProcess_Reset();\n\n [super tearDown];\n}\n\n- (void) removeAllVirtualizationRoots\n{\n if (VirtualizationRoot_GetActiveProvider(self->dummyRepoHandle).isOnline)\n {\n ActiveProvider_Disconnect(self->dummyRepoHandle, &self->dummyClient);\n }\n \n VirtualizationRoots_Cleanup();\n VirtualizationRoots_Init();\n}\n\n- (void) testEmptyFileHydrates {\n testFileVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n SetPrjFSFileXattrData(testFileVnode);\n \n kauth_action_t actions[] =\n {\n KAUTH_VNODE_READ_ATTRIBUTES,\n KAUTH_VNODE_WRITE_ATTRIBUTES,\n KAUTH_VNODE_READ_EXTATTRIBUTES,\n KAUTH_VNODE_WRITE_EXTATTRIBUTES,\n KAUTH_VNODE_READ_DATA,\n KAUTH_VNODE_WRITE_DATA,\n KAUTH_VNODE_EXECUTE,\n KAUTH_VNODE_APPEND_DATA,\n };\n const int actionCount = std::extent<decltype(actions)>::value;\n\n for (int i = 0; i < actionCount; i++)\n {\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n actions[i],\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n XCTAssertTrue(\n MockCalls::DidCallFunction(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n _,\n MessageType_KtoU_HydrateFile,\n testFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr));\n MockCalls::Clear();\n }\n}\n\n- (void) testFileDeleteHydratesOnlyWhenNecessary\n{\n testFileVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n SetPrjFSFileXattrData(testFileVnode);\n \n TestForAllSupportedDarwinVersions(^{\n InitPendingRenames();\n XCTAssertEqual(\n KAUTH_RESULT_DEFER,\n HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_DELETE,\n reinterpret_cast<uintptr_t>(self->context),\n reinterpret_cast<uintptr_t>(self->testFileVnode.get()),\n 0,\n 0));\n bool didHydrate =\n MockCalls::DidCallFunction(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n _,\n MessageType_KtoU_HydrateFile,\n self->testFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr);\n\n // On High Sierra, any delete causes hydration as it might be due to a rename:\n if (version_major <= PrjFSDarwinMajorVersion::MacOS10_13_HighSierra)\n {\n XCTAssertTrue(didHydrate);\n }\n else\n {\n // On Mojave+, no hydration on non-rename delete:\n XCTAssertFalse(didHydrate);\n }\n \n MockCalls::Clear();\n CleanupPendingRenames();\n });\n}\n\n- (void) testVnodeAccessCausesNoEvent {\n testFileVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n SetPrjFSFileXattrData(testFileVnode);\n \n const int actionCount = 9;\n kauth_action_t actions[actionCount] =\n {\n KAUTH_VNODE_READ_ATTRIBUTES | KAUTH_VNODE_ACCESS,\n KAUTH_VNODE_WRITE_ATTRIBUTES | KAUTH_VNODE_ACCESS,\n KAUTH_VNODE_READ_EXTATTRIBUTES | KAUTH_VNODE_ACCESS,\n KAUTH_VNODE_WRITE_EXTATTRIBUTES | KAUTH_VNODE_ACCESS,\n KAUTH_VNODE_READ_DATA | KAUTH_VNODE_ACCESS,\n KAUTH_VNODE_WRITE_DATA | KAUTH_VNODE_ACCESS,\n KAUTH_VNODE_EXECUTE | KAUTH_VNODE_ACCESS,\n KAUTH_VNODE_DELETE | KAUTH_VNODE_ACCESS,\n KAUTH_VNODE_APPEND_DATA | KAUTH_VNODE_ACCESS,\n };\n \n for (int i = 0; i < actionCount; i++)\n {\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n actions[i],\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n XCTAssertFalse(MockCalls::DidCallFunction(ProviderMessaging_TrySendRequestAndWaitForResponse));\n MockCalls::Clear();\n }\n}\n\n\n- (void) testNonEmptyFileDoesNotHydrate {\n testFileVnode->attrValues.va_flags = FileFlags_IsInVirtualizationRoot;\n \n const int actionCount = 9;\n kauth_action_t actions[actionCount] =\n {\n KAUTH_VNODE_READ_ATTRIBUTES,\n KAUTH_VNODE_WRITE_ATTRIBUTES,\n KAUTH_VNODE_READ_EXTATTRIBUTES,\n KAUTH_VNODE_WRITE_EXTATTRIBUTES,\n KAUTH_VNODE_READ_DATA,\n KAUTH_VNODE_WRITE_DATA,\n KAUTH_VNODE_EXECUTE,\n KAUTH_VNODE_DELETE,\n KAUTH_VNODE_APPEND_DATA,\n };\n \n for (int i = 0; i < actionCount; i++)\n {\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n actions[i],\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n XCTAssertFalse(\n MockCalls::DidCallFunction(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n _,\n MessageType_KtoU_HydrateFile,\n testFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n nullptr));\n MockCalls::Clear();\n }\n}\n\n- (void) testNonEmptyFileWithPrjFSFileXAttrNameDoesNotHydrate {\n testFileVnode->attrValues.va_flags = FileFlags_IsInVirtualizationRoot;\n SetPrjFSFileXattrData(testFileVnode);\n \n const int actionCount = 9;\n kauth_action_t actions[actionCount] =\n {\n KAUTH_VNODE_READ_ATTRIBUTES,\n KAUTH_VNODE_WRITE_ATTRIBUTES,\n KAUTH_VNODE_READ_EXTATTRIBUTES,\n KAUTH_VNODE_WRITE_EXTATTRIBUTES,\n KAUTH_VNODE_READ_DATA,\n KAUTH_VNODE_WRITE_DATA,\n KAUTH_VNODE_EXECUTE,\n KAUTH_VNODE_DELETE,\n KAUTH_VNODE_APPEND_DATA,\n };\n \n for (int i = 0; i < actionCount; i++)\n {\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n actions[i],\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n XCTAssertFalse(\n MockCalls::DidCallFunction(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n _,\n MessageType_KtoU_HydrateFile,\n testFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n nullptr));\n MockCalls::Clear();\n }\n}\n\n- (void) testEventsThatShouldNotHydrate {\n testFileVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n \n const int actionCount = 4;\n kauth_action_t actions[actionCount] =\n {\n KAUTH_VNODE_DELETE_CHILD,\n KAUTH_VNODE_READ_SECURITY,\n KAUTH_VNODE_WRITE_SECURITY,\n KAUTH_VNODE_TAKE_OWNERSHIP\n };\n \n for (int i = 0; i < actionCount; i++)\n {\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n actions[i],\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n XCTAssertFalse(\n MockCalls::DidCallFunction(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n _,\n MessageType_KtoU_HydrateFile,\n testFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n nullptr));\n MockCalls::Clear();\n }\n}\n\n- (void) testHydrationOnDeleteWhenRenamingFile {\n testFileVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n\n // Hydration on delete only occurs if deletion is caused by rename\n string renamedFilePath = filePath + \"_renamed\";\n HandleFileOpOperation(\n nullptr, // credential\n nullptr, /* idata, unused */\n KAUTH_FILEOP_WILL_RENAME,\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n reinterpret_cast<uintptr_t>(filePath.c_str()),\n reinterpret_cast<uintptr_t>(renamedFilePath.c_str()),\n 0); // unused\n\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_DELETE,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n XCTAssertTrue(MockCalls::DidCallFunctionsInOrder(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n make_tuple(\n _,\n MessageType_KtoU_HydrateFile,\n testFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr),\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n make_tuple(\n _,\n MessageType_KtoU_NotifyFilePreDeleteFromRename,\n testFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr))\n );\n XCTAssertTrue(MockCalls::CallCount(ProviderMessaging_TrySendRequestAndWaitForResponse) == 2);\n}\n\n- (void) testDeleteFileNonRenamed\n{\n testFileVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n\n InitPendingRenames();\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_DELETE,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n XCTAssertTrue(MockCalls::DidCallFunction(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n _,\n MessageType_KtoU_NotifyFilePreDelete,\n testFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr));\n \n // Should not hydrate if delete is not caused by rename\n XCTAssertFalse(MockCalls::DidCallFunction(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n _,\n MessageType_KtoU_HydrateFile,\n _,\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr));\n CleanupPendingRenames();\n}\n\n- (void) testConcurrentRenameOperationRecording\n{\n InitPendingRenames();\n self->testFileVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n\n string otherFilePath = repoPath + \"/otherFile\";\n shared_ptr<vnode> otherTestFileVnode = testMount->CreateVnodeTree(otherFilePath);\n otherTestFileVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n\n string renamedFilePath = filePath + \"_renamed\";\n string renamedOtherFilePath = otherFilePath + \"_renamed\";\n\n MockProcess_SetCurrentThreadIndex(0);\n HandleFileOpOperation(\n nullptr, // credential\n nullptr, /* idata, unused */\n KAUTH_FILEOP_WILL_RENAME,\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n reinterpret_cast<uintptr_t>(filePath.c_str()),\n reinterpret_cast<uintptr_t>(renamedFilePath.c_str()),\n 0); // unused\n\n MockProcess_SetCurrentThreadIndex(1);\n HandleFileOpOperation(\n nullptr, // credential\n nullptr, /* idata, unused */\n KAUTH_FILEOP_WILL_RENAME,\n reinterpret_cast<uintptr_t>(otherTestFileVnode.get()),\n reinterpret_cast<uintptr_t>(otherFilePath.c_str()),\n reinterpret_cast<uintptr_t>(renamedOtherFilePath.c_str()),\n 0); // unused\n\n MockProcess_SetCurrentThreadIndex(0);\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_DELETE,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n\n MockProcess_SetCurrentThreadIndex(1);\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_DELETE,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(otherTestFileVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n\n XCTAssertTrue(MockCalls::DidCallFunctionsInOrder(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n make_tuple(\n _,\n MessageType_KtoU_HydrateFile,\n testFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr),\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n make_tuple(\n _,\n MessageType_KtoU_NotifyFilePreDeleteFromRename,\n testFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr),\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n make_tuple(\n _,\n MessageType_KtoU_HydrateFile,\n otherTestFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr),\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n make_tuple(\n _,\n MessageType_KtoU_NotifyFilePreDeleteFromRename,\n otherTestFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr))\n );\n XCTAssertTrue(MockCalls::CallCount(ProviderMessaging_TrySendRequestAndWaitForResponse) == 4);\n CleanupPendingRenames();\n}\n\n\n- (void) testHydrationOnDeleteWhenRenamingDirectory\n{\n testDirVnode->attrValues.va_flags = FileFlags_IsInVirtualizationRoot;\n\n // Hydration on delete only occurs if deletion is caused by rename\n string renamedDirPath = self->dirPath + \"_renamed\";\n HandleFileOpOperation(\n nullptr, // credential\n nullptr, /* idata, unused */\n KAUTH_FILEOP_WILL_RENAME,\n reinterpret_cast<uintptr_t>(self->testDirVnode.get()),\n reinterpret_cast<uintptr_t>(self->dirPath.c_str()),\n reinterpret_cast<uintptr_t>(renamedDirPath.c_str()),\n 0); // unused\n\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_DELETE,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testDirVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n XCTAssertTrue(MockCalls::DidCallFunctionsInOrder(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n make_tuple(\n _,\n MessageType_KtoU_RecursivelyEnumerateDirectory,\n testDirVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr),\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n make_tuple(\n _,\n MessageType_KtoU_NotifyDirectoryPreDelete,\n testDirVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr))\n );\n XCTAssertTrue(MockCalls::CallCount(ProviderMessaging_TrySendRequestAndWaitForResponse) == 2);\n}\n\n- (void) testDeleteDirNonRenamed\n{\n testDirVnode->attrValues.va_flags = FileFlags_IsInVirtualizationRoot;\n\n TestForAllSupportedDarwinVersions(^{\n InitPendingRenames();\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_DELETE,\n reinterpret_cast<uintptr_t>(self->context),\n reinterpret_cast<uintptr_t>(self->testDirVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n XCTAssertTrue(MockCalls::DidCallFunction(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n _,\n MessageType_KtoU_NotifyDirectoryPreDelete,\n self->testDirVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr));\n\n // Should not enumerate if delete is not caused by rename, except on High Sierra\n bool didEnumerate = MockCalls::DidCallFunction(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n _,\n MessageType_KtoU_RecursivelyEnumerateDirectory,\n self->testDirVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr);\n if (version_major <= PrjFSDarwinMajorVersion::MacOS10_13_HighSierra)\n {\n XCTAssertTrue(didEnumerate);\n }\n else\n {\n XCTAssertFalse(didEnumerate);\n }\n \n MockCalls::Clear();\n CleanupPendingRenames();\n });\n}\n\n- (void) testEmptyDirectoryEnumerates {\n testDirVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n const int actionCount = 5;\n kauth_action_t actions[actionCount] =\n {\n KAUTH_VNODE_LIST_DIRECTORY,\n KAUTH_VNODE_SEARCH,\n KAUTH_VNODE_READ_SECURITY,\n KAUTH_VNODE_READ_ATTRIBUTES,\n KAUTH_VNODE_READ_EXTATTRIBUTES\n };\n \n for (int i = 0; i < actionCount; i++)\n {\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n actions[i],\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testDirVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n XCTAssertTrue(\n MockCalls::DidCallFunction(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n _,\n MessageType_KtoU_EnumerateDirectory,\n testDirVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr));\n MockCalls::Clear();\n }\n}\n\n- (void) testEventsThatShouldNotDirectoryEnumerates {\n testDirVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n const int actionCount = 9;\n kauth_action_t actions[actionCount] =\n {\n KAUTH_VNODE_WRITE_DATA,\n KAUTH_VNODE_ADD_FILE,\n KAUTH_VNODE_APPEND_DATA,\n KAUTH_VNODE_ADD_SUBDIRECTORY,\n KAUTH_VNODE_DELETE_CHILD,\n KAUTH_VNODE_WRITE_ATTRIBUTES,\n KAUTH_VNODE_WRITE_EXTATTRIBUTES,\n KAUTH_VNODE_WRITE_SECURITY,\n KAUTH_VNODE_TAKE_OWNERSHIP\n };\n\n for (int i = 0; i < actionCount; i++)\n {\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n actions[i],\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testDirVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n XCTAssertFalse(\n MockCalls::DidCallFunction(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n _,\n MessageType_KtoU_EnumerateDirectory,\n testDirVnode.get(),\n _,\n _,\n _,\n _,\n _,\n nullptr));\n MockCalls::Clear();\n }\n}\n\n- (void) testNonEmptyDirectoryDoesNotEnumerate {\n testDirVnode->attrValues.va_flags = FileFlags_IsInVirtualizationRoot;\n const int actionCount = 5;\n kauth_action_t actions[actionCount] =\n {\n KAUTH_VNODE_LIST_DIRECTORY,\n KAUTH_VNODE_SEARCH,\n KAUTH_VNODE_READ_SECURITY,\n KAUTH_VNODE_READ_ATTRIBUTES,\n KAUTH_VNODE_READ_EXTATTRIBUTES\n };\n \n for (int i = 0; i < actionCount; i++)\n {\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n actions[i],\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testDirVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n XCTAssertFalse(MockCalls::DidCallFunction(ProviderMessaging_TrySendRequestAndWaitForResponse));\n }\n}\n \n-(void) testWriteFile {\n // If we have FileXattrData attribute we should trigger MessageType_KtoU_NotifyFilePreConvertToFull to remove it\n testFileVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n SetPrjFSFileXattrData(testFileVnode);\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_WRITE_DATA,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n XCTAssertTrue(MockCalls::DidCallFunctionsInOrder(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n make_tuple(\n _,\n MessageType_KtoU_HydrateFile,\n testFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr),\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n make_tuple(\n _,\n MessageType_KtoU_NotifyFilePreConvertToFull,\n testFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr))\n );\n XCTAssertTrue(MockCalls::CallCount(ProviderMessaging_TrySendRequestAndWaitForResponse) == 2);\n}\n\n-(void) testWriteFileHydrated {\n testFileVnode->attrValues.va_flags = FileFlags_IsInVirtualizationRoot;\n // If we have FileXattrData attribute we should trigger MessageType_KtoU_NotifyFilePreConvertToFull to remove it\n SetPrjFSFileXattrData(testFileVnode);\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_WRITE_DATA,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n XCTAssertFalse(\n MockCalls::DidCallFunction(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n _,\n MessageType_KtoU_HydrateFile,\n testFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr));\n XCTAssertTrue(\n MockCalls::DidCallFunction(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n _,\n MessageType_KtoU_NotifyFilePreConvertToFull,\n testFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr));\n XCTAssertTrue(MockCalls::CallCount(ProviderMessaging_TrySendRequestAndWaitForResponse) == 1);\n}\n\n-(void) testWriteFileHydratedOfflineRoot\n{\n testFileVnode->attrValues.va_flags = FileFlags_IsInVirtualizationRoot;\n SetPrjFSFileXattrData(testFileVnode);\n ActiveProvider_Disconnect(self->dummyRepoHandle, &self->dummyClient);\n \n XCTAssertEqual(\n KAUTH_RESULT_DENY,\n HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_WRITE_DATA,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0));\n XCTAssertFalse(\n MockCalls::DidCallFunction(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n _,\n _,\n testFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr));\n}\n\n-(void) testWriteFlaggedNonRepoFile\n{\n string testFilePath = \"/Users/test/code/otherproject/file\";\n shared_ptr<vnode> testFile = testMount->CreateVnodeTree(testFilePath);\n testFile->attrValues.va_flags = FileFlags_IsInVirtualizationRoot;\n XCTAssertEqual(\n KAUTH_RESULT_DEFER,\n HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_WRITE_DATA,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFile.get()),\n 0,\n 0));\n XCTAssertFalse(\n MockCalls::DidCallFunction(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n _,\n _,\n testFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr));\n}\n\n-(void) testWriteFileFull {\n testFileVnode->attrValues.va_flags = FileFlags_IsInVirtualizationRoot;\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_WRITE_DATA,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n XCTAssertFalse(MockCalls::DidCallFunction(ProviderMessaging_TrySendRequestAndWaitForResponse));\n}\n\n- (void) testEventsAreIgnored {\n testFileVnode->attrValues.va_flags = FileFlags_IsInVirtualizationRoot | FileFlags_IsEmpty;\n const int actionCount = 3;\n kauth_action_t actions[actionCount] =\n {\n KAUTH_VNODE_WRITE_SECURITY,\n KAUTH_VNODE_TAKE_OWNERSHIP,\n KAUTH_VNODE_ACCESS\n };\n \n for (int i = 0; i < actionCount; i++)\n {\n // Verify for File node\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n actions[i],\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n XCTAssertFalse(\n MockCalls::DidCallFunction(ProviderMessaging_TrySendRequestAndWaitForResponse));\n MockCalls::Clear();\n\n // Verify for Directory node\n HandleVnodeOperation(\n nullptr,\n nullptr,\n actions[i],\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testDirVnode.get()),\n 0,\n 0);\n XCTAssertFalse(MockCalls::DidCallFunction(ProviderMessaging_TrySendRequestAndWaitForResponse));\n MockCalls::Clear();\n }\n}\n\n- (void) testDeleteWithNoVirtualizationRoot {\n [self removeAllVirtualizationRoots];\n testFileVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_DELETE,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n\n XCTAssertFalse(MockCalls::DidCallFunction(ProviderMessaging_TrySendRequestAndWaitForResponse));\n}\n\n- (void) testDeleteWhenRequestFails {\n ProviderMessageMock_SetDefaultRequestResult(false);\n testFileVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_DELETE,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DENY);\n\n XCTAssertTrue(MockCalls::CallCount(ProviderMessaging_TrySendRequestAndWaitForResponse) == 1);\n}\n\n- (void) testDeleteDirectoryWithDisappearingVirtualizationRoot {\n ProviderMessageMock_SetRequestSideEffect(\n [&]()\n {\n ActiveProvider_Disconnect(self->dummyRepoHandle, &self->dummyClient);\n });\n testDirVnode->attrValues.va_flags = FileFlags_IsInVirtualizationRoot;\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_DELETE,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testDirVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n\n XCTAssertTrue(MockCalls::CallCount(ProviderMessaging_TrySendRequestAndWaitForResponse) == 1);\n}\n\n// When the first call to getVirtualizationRoot fails, ensure no more calls are made\n- (void) testRenameDirectoryWhenFirstRequestFails {\n ProviderMessageMock_SetDefaultRequestResult(false);\n testDirVnode->attrValues.va_flags = FileFlags_IsInVirtualizationRoot;\n\n string renamedDirPath = self->dirPath + \"_renamed\";\n HandleFileOpOperation(\n nullptr, // credential\n nullptr, /* idata, unused */\n KAUTH_FILEOP_WILL_RENAME,\n reinterpret_cast<uintptr_t>(self->testDirVnode.get()),\n reinterpret_cast<uintptr_t>(self->dirPath.c_str()),\n reinterpret_cast<uintptr_t>(renamedDirPath.c_str()),\n 0); // unused\n\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_DELETE,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testDirVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DENY);\n\n XCTAssertTrue(MockCalls::CallCount(ProviderMessaging_TrySendRequestAndWaitForResponse) == 1);\n}\n\n- (void) testDeleteDirectoryForRenameWhenSecondRequestFails {\n ProviderMessageMock_SetSecondRequestResult(false);\n \n // Hydration on delete only occurs if deletion is caused by rename\n string renamedDirPath = self->dirPath + \"_renamed\";\n HandleFileOpOperation(\n nullptr, // credential\n nullptr, /* idata, unused */\n KAUTH_FILEOP_WILL_RENAME,\n reinterpret_cast<uintptr_t>(self->testDirVnode.get()),\n reinterpret_cast<uintptr_t>(self->dirPath.c_str()),\n reinterpret_cast<uintptr_t>(renamedDirPath.c_str()),\n 0); // unused\n\n testDirVnode->attrValues.va_flags = FileFlags_IsInVirtualizationRoot;\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_DELETE,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testDirVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DENY);\n\n XCTAssertTrue(MockCalls::CallCount(ProviderMessaging_TrySendRequestAndWaitForResponse) == 2);\n}\n\n- (void) testRenameDirectoryWithNoVirtualizationRoot {\n [self removeAllVirtualizationRoots];\n testDirVnode->attrValues.va_flags = FileFlags_IsInVirtualizationRoot;\n \n string renamedDirPath = self->dirPath + \"_renamed\";\n HandleFileOpOperation(\n nullptr, // credential\n nullptr, // idata, unused\n KAUTH_FILEOP_WILL_RENAME,\n reinterpret_cast<uintptr_t>(self->testDirVnode.get()),\n reinterpret_cast<uintptr_t>(self->dirPath.c_str()),\n reinterpret_cast<uintptr_t>(renamedDirPath.c_str()),\n 0); // unused\n\n XCTAssertEqual(\n KAUTH_RESULT_DEFER,\n HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_DELETE,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testDirVnode.get()),\n 0,\n 0));\n\n XCTAssertFalse(MockCalls::DidCallFunction(ProviderMessaging_TrySendRequestAndWaitForResponse));\n}\n\n- (void) testReadAttributesDirectoryWithNoVirtualizationRoot {\n [self removeAllVirtualizationRoots];\n testDirVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_READ_ATTRIBUTES,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testDirVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n\n XCTAssertFalse(MockCalls::DidCallFunction(ProviderMessaging_TrySendRequestAndWaitForResponse));\n}\n\n- (void) testReadAttributesDirectoryWhenRequestFails {\n ProviderMessageMock_SetDefaultRequestResult(false);\n testDirVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_READ_ATTRIBUTES,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testDirVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DENY);\n\n XCTAssertTrue(MockCalls::CallCount(ProviderMessaging_TrySendRequestAndWaitForResponse) == 1);\n}\n\n- (void) testReadAttributesWithNoVirtualizationRoot {\n [self removeAllVirtualizationRoots];\n testFileVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_READ_ATTRIBUTES,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n\n XCTAssertFalse(MockCalls::DidCallFunction(ProviderMessaging_TrySendRequestAndWaitForResponse));\n}\n\n- (void) testReadAttributesWhenRequestFails {\n ProviderMessageMock_SetDefaultRequestResult(false);\n testFileVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_READ_ATTRIBUTES,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DENY);\n\n XCTAssertTrue(MockCalls::CallCount(ProviderMessaging_TrySendRequestAndWaitForResponse) == 1);\n}\n\n- (void) testWriteWithDisappearingVirtualizationRoot {\n // Tests provider disappearing between hydration and attempting to convert to full.", "\n \n // Start with empty file…\n testFileVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n SetPrjFSFileXattrData(self->testFileVnode);\n \n // First message to provider marks the file as hydrated and also disconnects the providers\n ProviderMessageMock_SetRequestSideEffect(\n [&]()\n {\n ActiveProvider_Disconnect(self->dummyRepoHandle, &self->dummyClient);\n // mark as hydrated\n testFileVnode->attrValues.va_flags &= ~FileFlags_IsEmpty;\n });\n \n // File should become hydrated but write access should be denied due to failure to convert to full.", "\n XCTAssertEqual(\n KAUTH_RESULT_DENY,\n HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_WRITE_DATA,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0));\n\n XCTAssertTrue(MockCalls::CallCount(ProviderMessaging_TrySendRequestAndWaitForResponse) == 1);\n}\n\n- (void) testWriteWhenSecondRequestFails {\n ProviderMessageMock_SetSecondRequestResult(false);\n SetPrjFSFileXattrData(testFileVnode);\n testFileVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_WRITE_DATA,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DENY);\n\n XCTAssertTrue(MockCalls::CallCount(ProviderMessaging_TrySendRequestAndWaitForResponse) == 2);\n}\n\n- (void) testWriteDataToForkedPath {\n // By setting namedStream, HandleVnodeOperation with treat testFileVnode as a named fork\n testFileVnode->namedStream = true;\n testFileVnode->GetParentVnode()->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n SetPrjFSFileXattrData(testFileVnode);\n testFileVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n\n XCTAssertTrue(HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_WRITE_DATA,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0) == KAUTH_RESULT_DEFER);\n\n XCTAssertTrue(MockCalls::CallCount(ProviderMessaging_TrySendRequestAndWaitForResponse) == 0);\n}\n\n- (void) testIneligibleFilesystemType\n{\n shared_ptr<mount> testMountNone = mount::Create(\"msdos\", fsid_t{}, 0);\n shared_ptr<vnode> testVnodeNone = testMountNone->CreateVnodeTree(\"/Volumes/USBSTICK\", VDIR);\n \n XCTAssertEqual(\n KAUTH_RESULT_DEFER,\n HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_ADD_FILE,\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testVnodeNone.get()),\n 0,\n 0));\n XCTAssertFalse(MockCalls::DidCallFunction(ProviderMessaging_TrySendRequestAndWaitForResponse));\n}\n\n- (void) testOfflineRootDeniesAccessToEmptyFile\n{\n testFileVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n SetPrjFSFileXattrData(testFileVnode);\n\n ActiveProvider_Disconnect(self->dummyRepoHandle, &self->dummyClient);\n\n kauth_action_t actions[] =\n {\n KAUTH_VNODE_WRITE_ATTRIBUTES,\n KAUTH_VNODE_WRITE_EXTATTRIBUTES,\n KAUTH_VNODE_WRITE_DATA,\n KAUTH_VNODE_APPEND_DATA,\n KAUTH_VNODE_READ_DATA,\n KAUTH_VNODE_READ_ATTRIBUTES,\n KAUTH_VNODE_EXECUTE,\n KAUTH_VNODE_READ_EXTATTRIBUTES,\n };\n const size_t actionCount = extent<decltype(actions)>::value;\n \n for (size_t i = 0; i < actionCount; i++)\n {\n XCTAssertEqual(\n KAUTH_RESULT_DENY,\n HandleVnodeOperation(\n nullptr,\n nullptr,\n actions[i],\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0));\n XCTAssertFalse(\n MockCalls::DidCallFunction(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n _,\n MessageType_KtoU_HydrateFile,\n testFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr));\n MockCalls::Clear();\n }\n}\n\n- (void) testOfflineRootDeniesFileAndDirectoryCreation\n{\n self->testDirVnode->attrValues.va_flags = FileFlags_IsInVirtualizationRoot;\n SetPrjFSFileXattrData(self->testDirVnode);\n\n ActiveProvider_Disconnect(self->dummyRepoHandle, &self->dummyClient);\n\n kauth_action_t actions[] =\n {\n KAUTH_VNODE_ADD_SUBDIRECTORY,\n KAUTH_VNODE_ADD_FILE\n };\n const size_t actionCount = extent<decltype(actions)>::value;\n \n for (size_t i = 0; i < actionCount; i++)\n {\n XCTAssertEqual(\n KAUTH_RESULT_DENY,\n HandleVnodeOperation(\n nullptr,\n nullptr,\n actions[i],\n reinterpret_cast<uintptr_t>(self->context),\n reinterpret_cast<uintptr_t>(self->testDirVnode.get()),\n 0,\n 0));\n XCTAssertFalse(\n MockCalls::DidCallFunction(\n ProviderMessaging_TrySendRequestAndWaitForResponse));\n MockCalls::Clear();\n }\n}\n\n\n- (void) testOfflineRootDeniesRename\n{\n // Where we can detect renames (Mojave and newer), file/directory renames\n // should be prevented when the provider is offline. ", "On High Sierra we have\n // to let them happen as we can't distinguish them from file deletions\n // before it's already happened.", "\n\n ActiveProvider_Disconnect(self->dummyRepoHandle, &self->dummyClient);\n\n // Check the behaviour works for both empty and full files, and empty files are not hydrated.", "\n vector<uint32_t> vnode_flags { FileFlags_IsInVirtualizationRoot, FileFlags_IsInVirtualizationRoot | FileFlags_IsEmpty };\n \n std::for_each(vnode_flags.begin(), vnode_flags.end(),\n [self](uint32_t flags)\n {\n testFileVnode->attrValues.va_flags = flags;\n\n TestForAllSupportedDarwinVersions(^{\n InitPendingRenames();\n\n if (version_major >= PrjFSDarwinMajorVersion::MacOS10_14_Mojave)\n {\n string renamedFilePath = self->filePath + \"_renamed\";\n HandleFileOpOperation(\n nullptr, // credential\n nullptr, /* idata, unused */\n KAUTH_FILEOP_WILL_RENAME,\n reinterpret_cast<uintptr_t>(self->testFileVnode.get()),\n reinterpret_cast<uintptr_t>(self->filePath.c_str()),\n reinterpret_cast<uintptr_t>(renamedFilePath.c_str()),\n 0); // unused\n }\n\n int deleteAuthResult =\n HandleVnodeOperation(\n nullptr,\n nullptr,\n KAUTH_VNODE_DELETE,\n reinterpret_cast<uintptr_t>(self->context),\n reinterpret_cast<uintptr_t>(self->testFileVnode.get()),\n 0,\n 0);\n\n if (version_major <= PrjFSDarwinMajorVersion::MacOS10_13_HighSierra)\n {\n XCTAssertEqual(deleteAuthResult, KAUTH_RESULT_DEFER);\n }\n else\n {\n // On Mojave+, renames should be blocked:\n XCTAssertEqual(deleteAuthResult, KAUTH_RESULT_DENY, \"flags = 0x%x\", flags);\n }\n\n XCTAssertFalse(\n MockCalls::DidCallFunction(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n _,\n MessageType_KtoU_HydrateFile,\n self->testFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr));\n\n MockCalls::Clear();\n CleanupPendingRenames();\n });\n });\n}\n\n- (void) testOfflineRootAllowsRegisteredProcessAccessToEmptyFile\n{\n testFileVnode->attrValues.va_flags = FileFlags_IsEmpty | FileFlags_IsInVirtualizationRoot;\n SetPrjFSFileXattrData(testFileVnode);\n\n ActiveProvider_Disconnect(self->dummyRepoHandle, &self->dummyClient);\n\n XCTAssertTrue(VirtualizationRoots_AddOfflineIOProcess(RunningMockProcessPID));\n\n kauth_action_t actions[] =\n {\n KAUTH_VNODE_READ_ATTRIBUTES,\n KAUTH_VNODE_WRITE_ATTRIBUTES,\n KAUTH_VNODE_READ_EXTATTRIBUTES,\n KAUTH_VNODE_WRITE_EXTATTRIBUTES,\n KAUTH_VNODE_READ_DATA,\n KAUTH_VNODE_WRITE_DATA,\n KAUTH_VNODE_EXECUTE,\n KAUTH_VNODE_DELETE,\n KAUTH_VNODE_APPEND_DATA,\n };\n const size_t actionCount = extent<decltype(actions)>::value;\n \n for (size_t i = 0; i < actionCount; i++)\n {\n XCTAssertEqual(\n KAUTH_RESULT_DEFER,\n HandleVnodeOperation(\n nullptr,\n nullptr,\n actions[i],\n reinterpret_cast<uintptr_t>(context),\n reinterpret_cast<uintptr_t>(testFileVnode.get()),\n 0,\n 0));\n XCTAssertFalse(\n MockCalls::DidCallFunction(\n ProviderMessaging_TrySendRequestAndWaitForResponse,\n _,\n MessageType_KtoU_HydrateFile,\n testFileVnode.get(),\n _,\n _,\n _,\n _,\n _,\n _,\n nullptr));\n MockCalls::Clear();\n }\n\n VirtualizationRoots_RemoveOfflineIOProcess(RunningMockProcessPID);\n}\n\n@end\n" ]

{ "pile_set_name": "Github" }

[ 0.0000018652433425160697, 0.000004299928621184888, 7.536166899311129e-8, 0.000002345166260562043, 7.95538745998639e-7, 0, 0.00003302946228035408, 8.377342304908452e-7 ]

[ "Weekly Updates and News\n\nHappy Friday (and you get a break for 2 weeks)! ", "What a FUN week! ", "Thank you to ALL of you for helping make this week magical for the kids! ", "We truly enjoyed trying to catch our leprechaun, and the traps were so creative! ", "The kids took such pride in sharing them with their classmates! ", "I hope you all did not mind the rainbow treats I sent home on Thursday. ", "I tried to do something small =) Our first pep rally was today. ", "The kinders LOVED it along with the rest of the students! ", "We want to continue to build our community and make sure ALL of the kids have fun together! ", "We took our mid-module assessment in math today on measurement. ", "I was happy to end with that before the break, and the kids shined! ", "If you are interested in some extra work over the break, it would be awesome to have your child work with adding different combinations up to ten. ", "Examples: 2 and 3 make 5, 4 and 3 make 7, 8 and 2 make 10. ", "Please use this language as this is the language we will be using in class. ", "We will be concentrating on these skills heavily when we return.", "The spelling test was exciting and successful today. ", "It made them feel like big kids they said =)Thank you so much for helping your child with the spelling homework. ", "Soon, it will become automatic for them. ", "Everyone is catching on to our new writing unit on opinion writing. ", "I am hoping to have something to show the week we get back from break. ", "Please continue to read with your child over the break. ", "They all are amazing readers, and I don't want them to lose steam. ", "Thank you for helping make this the BEST year! ", "I hope you all enjoy the break and get a little extra time with your child. ", "I am super excited to hold my babies more! ", "If you need me for anything, you can reach me on my cell phone. ", "I cannot promise I will be checking emails often =) See you all in two weeks on April 4th. ", "Happy Easter!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.00018765246762994932, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Chanderi fort\n\nChanderi Fort located at Chanderi in Ashoknagar District of Madhya Pradesh state in India is situated at a distance of 127 km from Shivpuri and 37 km from Lalitpur and about 45 km from Esagarh and 38 km from Mungoali It is located on a hill southwest of the Betwa River. ", " Chanderi is surrounded by hills, lakes and forests and there are several monuments of the Bundela Rajputs and Malwa sultans. ", "Chanderi finds mention in Mahabharata. ", "Shishupal was the king of Mahabharata period.", "\n\nChanderi is located strategically on the borders of Malwa and Bundelkhand. ", "History of Chanderi goes back to the 11th century, when it was dominated by the trade routes of Central India and was proximate to the arterial route to the ancient ports of Gujarat as well as to Malwa, Mewar, Central India and the Deccan. ", "Consequently, Chanderi became an important military outpost.", "\n\nChanderi Fort, a vast Mughal fort, dominates the skyline of the lovely old town of Chanderi. ", "The main gate of the fort is known as the \"Khooni Darwaza\". ", "Chanderi fort is situated on a hill 71 meter above the town. ", "The fortification walls were constructed mainly by the Muslim rulers of Chanderi. ", "To the southwest of the fort there is a curious gateway called katti-ghatti made through a hill side.", "\n\nHistory\n\nChanderi is mentioned by the Persian scholar Alberuni in 1030. ", "Ghiyas ud din Balban captured the city in 1251 for Nasiruddin Mahmud, Sultan of Delhi. ", "Sultan Mahmud Khilji of Malwa captured the city in 1438 after a siege of several months. ", "In 1520 Rana Sangha of Mewar captured the city, and gave it to Medini Rai, a rebellious minister of Sultan Mahmud II of Malwa. ", "The Mughal Emperor Babur captured the city from Medini Rai, and in 1540 it was captured by Sher Shah Suri, and added to the governorship of Shujaat Khan. ", "The Mughal Emperor Akbar made the city a sarkar in the subah of Malwa. ", "The Bundela Rajputs captured the city in 1586, and it was held by Ram Sab, a son of Raja Madhukar of Orchha. ", "In 1680 Devi Singh Bundela was made governor of the city, and Chanderi remained in the hands of his family until it was annexed in 1811 by Jean Baptiste Filose for the Maratha ruler Daulat Rao Sindhia of Gwalior. ", "The city was transferred to the British in 1844. ", "The British lost control of the city during the Revolt of 1857, and the city was recaptured by Sir Hugh Rose on February 14, 1858. ", "Richard Harte Keatinge was awarded the Victoria Cross for leading this assault. ", "The city was transferred back to the Sindhias of Gwalior in 1861, and became part of Isagarh District of Gwalior state. ", "After India's independence in 1947, Gwalior became part of the new state of Madhya Bharat, which was merged into Madhya Pradesh on November 1, 1956.", "\n\nReferences\nHunter, William Wilson, James Sutherland Cotton, Sir Richard Burn, William Stevenson Meyer, eds. (", "1909). ", "Imperial Gazetteer of India, vol. ", "9. ", "Oxford, Clarendon Press.", "\n\nCategory:Forts in Madhya Pradesh\nCategory:Ashoknagar district" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.00003642146924206923, 0.00012597631645250691, 0.0006574621959237343, 0.0004938271604938272, 0.000168662506324844, 0, 0.0002777777777777778, 0.00011080332409972299, 0, 0.0002687449610319807, 0, 0, 0.00018261504747991235, 0.0001321178491214163, 0, 0.000186000372000744, 0.00012649687974363298, 0, 0.00016833599865331202, 0.00008816592827701735, 0, 0, 0.0003125, 0, 0.00009130752373995617, 0.0004058112166220274, 0, 0.0008650519031141869, 0, 0.001736111111111111, 0.00025195263290501383 ]

[ "#pragma once\n\n#include <optional.h>\n\n#include <initializer_list>\n#include <memory>\n#include <string>\n#include <vector>\n\n// TODO:\n// - rename indexer.h to clang_indexer.h and pull out non-clang specific code\n// like IndexFile\n// - rename this file to indexer.h\n\nstruct Config;\nstruct IndexFile;\nstruct FileContents;\nstruct FileConsumerSharedState;\n\n// Abstracts away the actual indexing process. ", "Each IIndexer instance is\n// per-thread and constructing an instance may be extremely expensive (ie,\n// acquire a lock) and should be done as rarely as possible.", "\nstruct IIndexer {\n struct TestEntry {\n std::string path;\n int num_indexes = 0;\n\n TestEntry(const std::string& path, int num_indexes);\n };\n\n static std::unique_ptr<IIndexer> MakeClangIndexer();\n static std::unique_ptr<IIndexer> MakeTestIndexer(\n std::initializer_list<TestEntry> entries);\n\n virtual ~IIndexer() = default;\n virtual optional<std::vector<std::unique_ptr<IndexFile>>> Index(\n FileConsumerSharedState* file_consumer_shared,\n std::string file,\n const std::vector<std::string>& args,\n const std::vector<FileContents>& file_contents) = 0;\n};\n" ]

{ "pile_set_name": "Github" }

[ 0.00003125, 0, 0 ]

[ "Q:\n\nCSS first-child absolutely not working\n\nI have these html elements:\n\n.form-group:first-child {\r\n display: none;\r\n}\r\n\r\n#form-group:first-child {\r\n display: none;\r\n}\r\n\r\n#my-form #form-group:first-child {\r\n display: none;\r\n}\r\n\r\n#my-form .form-group:first-child {\r\n display: none;\r\n}\n<form id=\"my-form\">\r\n <div class=\"form-group\" id=\"form-group\">first</div>\r\n <div class=\"form-group\" id=\"form-group\">second</div>\r\n <div class=\"form-group\" id=\"form-group\"></div>\r\n <div class=\"form-group\" id=\"form-group\"></div>\r\n <div class=\"form-group\" id=\"form-group\"></div>\r\n <div class=\"form-group\" id=\"form-group\"></div>\r\n <div class=\"form-group\" id=\"form-group\"></div>\r\n <div class=\"form-group\" id=\"form-group\"></div>\r\n <div class=\"form-group\" id=\"form-group\"></div>\r\n <div class=\"form-group\" id=\"form-group\"></div>\r\n</form>\n\nAnd none of these work, what am I doing wrong?", "\n\nA:\n\nFirstly, ID's should be unique but \n#my-form .form-group:first-child {\n\ndisplay: none;\n}\n\n..will work regardless\n\n#my-form .form-group:first-child {\r\n display: none;\r\n}\n<form id=\"my-form\">\r\n <div class=\"form-group\" id=\"form-group\">1</div>\r\n <div class=\"form-group\" id=\"form-group\">2</div>\r\n <div class=\"form-group\" id=\"form-group\">3</div>\r\n <div class=\"form-group\" id=\"form-group\">4</div>\r\n <div class=\"form-group\" id=\"form-group\">5</div>\r\n <div class=\"form-group\" id=\"form-group\">6</div>\r\n <div class=\"form-group\" id=\"form-group\">7</div>\r\n <div class=\"form-group\" id=\"form-group\">8</div>\r\n <div class=\"form-group\" id=\"form-group\">9</div>\r\n <div class=\"form-group\" id=\"form-group\">10</div>\r\n</form>\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.000011755102040816326, 0.000007780753916150705 ]

[ "Q:\n\npretty url setting in codeigniter\n\nI have the url with controller 'package',function 'tour_package' and parameter '1'. ", "\nhttp://www.mysite.in/package/tour_packages/1\nHere the parameter is set as the id. I need to change it with corresponding url string\nhttp://www.mysite.in/package/tour_packages/American\nand another example like:\nhttp://www.mysite.in/package/tour_packages/2\nto\nhttp://www.mysite.in/package/tour_packages/African\nHow to accomplish this?", "\n\nA:\n\nFirst of I would change the url link to use url_title() (url helper). ", "If you create the query using the text value of the ID from what I presume is a database call this will give you something like \n(For example, if the record for id 1 is name=\"America\");\necho 'http://www.mysite.in/package/tour-packages/'.url_title($name);\n\nWould give;\nhttp://www.mysite.in/package/tour-packages/American\n\nIf you then add this extended router class it will automatically reformat dashes to underscores for you.", "\n<?", "php if (! ", "defined('BASEPATH')) exit('No direct script access allowed');\nclass MY_Router extends CI_Router {\n\n function set_class($class) {\n $this->class = str_replace('-', '_', $class);\n }\n\n function set_method($method) {\n $this->method = str_replace('-', '_', $method);\n }\n\n function _validate_request($segments) {\n // Does the requested controller exist in the root folder?", "\n if (file_exists(APPPATH.'controllers/'.str_replace('-', '_', $segments[0]).EXT)) {\n return $segments;\n }\n // Is the controller in a sub-folder?", "\n if (is_dir(APPPATH.'controllers/'.$segments[0])) { \n // Set the directory and remove it from the segment array\n $this->set_directory($segments[0]);\n $segments = array_slice($segments, 1);\n\n if (count($segments) > 0) {\n // Does the requested controller exist in the sub-folder?", "\n if ( ! ", "file_exists(APPPATH.'controllers/'.$this->fetch_directory().str_replace('-', '_', $segments[0]).EXT)) {\n show_404($this->fetch_directory().$segments[0]);\n }\n } else {\n $this->set_class($this->default_controller);\n $this->set_method('index');\n\n // Does the default controller exist in the sub-folder?", "\n if ( ! ", "file_exists(APPPATH.'controllers/'.$this->fetch_directory().$this->default_controller.", "EXT)) {\n $this->directory = '';\n return array();\n }\n\n }\n\n return $segments;\n }\n\n // Can't find the requested controller...\n show_404($segments[0]);\n }\n}\n\nThen you can add an entry in the routes file (in config); something like;\n$route['package/tour_package/(:any)'] = \"package/lookup_by_name/$1\";\n\nYou then need to create a method in the package controller called lookup_by_name($name).", "\nThis method needs to do a sql query to your database where you get the id from the name value. ", "You can then continue to load a view or do whatever you want.", "\nE.g\npublic function lookup_by_id($name) {\n // sql to get id from database record\n\n // load the view?", "\n $this->view($id);\n}\n\npublic function view($id) {\n // sql to load full record from id\n $this->load->view('foo', $data);\n}\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0.00003607210814418022, 0, 0.00001107266435986159, 0, 0, 0, 0, 0, 0, 0.000006608468091011822, 0, 0, 0.000004251248804336274, 0, 0, 0, 0 ]

[ "Alternative intronic promoters in development and disease.", "\nApproximately 20,000 mammalian genes are estimated to encode between 250 thousand and 1 million different proteins. ", "This enormous diversity of the mammalian proteome is caused by the ability of a single-gene locus to encode multiple protein isoforms. ", "Protein isoforms encoded by one gene locus can be functionally distinct, and they can even have antagonistic functions. ", "One of the mechanisms involved in creating this proteome complexity is alternative promoter usage. ", "Alternative intronic promoters are located downstream from their canonical counterparts and drive the expression of alternative RNA isoforms that lack upstream exons. ", "These upstream exons can encode some important functional domains, and proteins encoded by alternative mRNA isoforms can be thus functionally distinct from the full-length protein encoded by canonical mRNA isoforms. ", "Since any misbalance of functionally distinct protein isoforms is likely to have detrimental consequences for the cell and the whole organism, their expression must be precisely regulated. ", "Misregulation of alternative intronic promoters is frequently associated with various developmental defects and diseases including cancer, and it is becoming increasingly clear that this phenomenon deserves more attention." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0, 0.0000358564308508731, 0, 0, 0 ]

[ "The present invention relates to coplanar waveguides, and more specifically, to universal flip-chip crossover systems and methods for removal of spurious microwave modes in coplanar waveguides.", "\nCoplanar waveguide (CPW) layouts are becoming commonplace in superconducting qubit quantum computing designs. ", "Superconducting CPW resonators can be made with high quality factors (Q), in excess of 100,000 or more. ", "Furthermore, the large ground planes help confine the electromagnetic mode in a relevant region of interest.", "\nA typical CPW resonator includes a center conductor of defined length and two adjacent ground planes. ", "Simple single CPW resonator structures include either one or two ports, as well as two large continuous ground planes. ", "The resonator is addressed via capacitive coupling to the ports via CPW microwave feedlines. ", "Depending on half-wave or quarter-wave configuration, determined by how the center conductor is terminated (i.e., open or short), the cavity and its relevant modes are predictable. ", "However, microwave electromagnetic (EM) simulations reveal the presence of other spurious on-chip modes, including differential slotline modes, which can travel along the large ground planes. ", "For multiple CPW resonators on the same chip, more and more such parasitic EM modes are present since each CPW resonator contributes additional ground planes that are not well connected and therefore are not isopotential at different frequencies. ", "For most applications, especially those involving superconducting circuits, the presence of such modes is detrimental to the operation and measurement of the superconducting circuits.", "\nConventional techniques for removing unwanted modes involve the use of wire-bond straps, using an aluminum bond wire to attach from one piece of ground plane onto the other, spanning across the center conductor. ", "Often just a few well-placed bonds can greatly mitigate the presence of these modes. ", "However, this is only a trivial solution for simple designs such as those for a single CPW cavity. ", "For more complicated structures wire bonds are not feasible, often due to space constraints and repeatability concerns.", "\nAnother method to deal with parasitic modes uses microfabricated shorting straps connecting the ground planes together, thereby performing the same role as the previously mentioned wirebonds but avoiding the tedious manual wirebonding step. ", "These straps are fabricated with additional photolithography steps. ", "One of the drawbacks of this method is that a dielectric is required for the crossover in order to prevent shorting to the center conductor. ", "For superconducting circuits at low temperature and low power, most dielectrics have a relatively large dielectric loss tangent and thus could reduce the resonator quality factor and/or qubit performance. ", "In addition, it is difficult to create such a crossover which is adequately spaced from the center conductor so that the resonant properties of the CPW are not affected.", "\nOther techniques exist as well but are even less feasible given the current state-of-the-art. ", "One possibility involves through-vias placed into the substrate. ", "The top ground plane is directly tied to a bottom ground plane. ", "Sufficiently closely spaced through-vias then help tie all ground structures together. ", "However, although the steps are well known to make through-vias, the extra processing steps may be prohibitively time consuming and could also be impossible for substrates such as sapphire, commonly used in superconducting circuits. ", "Similarly, embedded stripline designs involve a multi-layer process that could degrade the device performance." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0.00008116224332440549, 0, 0, 0, 0, 0.00011562030292519367, 0, 0.00002712673611111111, 0.000032782048550213904, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00003501277966457757, 0, 0, 0, 0, 0, 0 ]

[ "Adrien Broner, the supposedly brash and careless but actually cheerful and confident lightweight champ, dispatched Gavin Rees last night in Atlantic City to improve his undefeated record to 26-0. ", "It wasn't the cakewalk some were expecting, though it would eventually come to an end by TKO in the fifth round after the Welshman lost his ability to defend himself.", "\n\nRees's nickname is \"The Rock,\" and Broner's most lethal punch of the night—this fourth-round knockdown—sank Rees like one. ", "To his credit, Rees got back up; the match didn't last much longer, though, and Broner's uppercut is an example of why Hamilton said in November that the Cincinnatian is unbeatable.", "\n\nThis is a Deadspin Video, in which strange sports moments are slowed down to ridiculous speeds and matched with indie music. ", "This video features \"Go-Getter\" by KO & The Knockouts. ", "See previous episodes here." ]

{ "pile_set_name": "Pile-CC" }

[ 0.00005206164098292378, 0.00007257947452460445, 0.000064, 0.00006104819755196727, 0.000062000124000248, 0.0003305785123966942, 0 ]

[ "Q:\n\nDingit.tv process running in Safari, using 1GB memory and 15% cpu\n\nThere's a process running in Safari (9.0.3) which is killing performance on my MBA. ", "It's called dingit.tv and it's using between 1-2 GB RAM. ", "As far as I know I've never been to this site. ", "If I kill the process it just reappears immediately.", "\nIt seems like a virus to me. ", "Anyone else seen this or know how to get rid of it?", "\n\nA:\n\nYou can try running Dingit's uninstaller here:\nhttp://kb.dingit.tv/article/114-how-do-i-uninstall-the-dingit-infinitehd-plugin\nOn OSX 10.10.5 when I browsed to the site the following appeared in the Activity Monitor:\nhttp://www.dingit.tv \n\nand it's actually just a window that's open in Safari and Safari will keep reopening it each time you kill it. ", "The easy way to bring it onto the screen is to use the Merge All Windows option in Safari's Window menu and then close it.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.00008324661810613944, 0, 0, 0, 0, 0, 0.00003923137882604022, 0.00006718624025799517, 0 ]

[ "Change Log\n==========\n\nmetar-1.7.0 (15 January 2019)\n-----------------------------\n\nThis release is a bug fix and enhancement release with no known API breakages. ", "The highlights include:\n\n- [#77](https://github.com/python-metar/python-metar/issues/77) Support was added for I-group (ice accretion), see new `Metar` attributes `ice_accretion_1hr`, `ice_accretion_3hr`, and `ice_accretion_6hr`.", "\n- [#70](https://github.com/python-metar/python-metar/issues/70) Code tests were migrated to pytest.", "\n- [#64](https://github.com/python-metar/python-metar/issues/64) Cloud type `AC` is now supported.", "\n- A number of pull requests were merged that improved the PEP8 and code style. ", "The project's LICENSE was also clarifed as BSD.", "\n\n\nmetar-1.6.0 (20 August 2018)\n----------------------------\n\nThe development of the `python-metar` library has been moved to a [Github Organization](https://github.com/python-metar) with the kind approval of Tom Pollard. ", " A few volunteers including @phobson and @akrherz look to maintain this library doing forward. ", " The best way to submit bug reports is through Github.", "\n\nThe 1.6.0 release is the first made by our new organization and signifies an effort to fix bugs and improve the API. ", " Here are some of the highlights with this release.", "\n\n - The `Metar` constructor now supports a `strict` parameter (see #51 and #36). ", "When `strict=False`, the parsing of METARs will not raise exceptions for parsing failures nor unparsed groups.", "\n - Python 3.6 is formally supported and actively tested against.", "\n - `print` statements were replaced by standard library loggers.", "\n - In the case of a METAR that contains sea-level pressure (SLP) and not altimeter, the METAR object attribute `press` is left unset. (", "see #38)\n - METAR precipitation and snow reports can be of `Trace` value. (", "see #34)\n - It is now possible to override some class attributes (see #37)\n - Add support for METAR 4/ group (snow depth) (see #31)\n - Add method to show recent weather as string (see #21)\n - A few sundry code fixes, cleanups, and improvements to automated testing\n\n\nmetar-1.5 (18 December 2017)\n---------------------------\n\nPython-metar v1.5 includes updated documentation and a few minor bug fixes.", "\nThe old sourceforge site is no longer being updated, and so the only authoritative\nsource repository is the GitHub repo. ", " To clone the project from there, use\n\n git clone https://github.com/python-metar/python-metar.git\n\n\n\nmetar-1.4 (2 May 2009)\n---------------------------\nPython-metar v1.4 incorporates a handful of bug fixes and enhancements\nmade over the last couple of years. ", " Notably, Toby White contributed code to \nlet the parser recognize and ignore trend forecasts and runway-state groups.", "\n\nStarting with this release, new releases will be made available through my \nsourceforge project, at http://python-metar.sourceforge.net/. I've also \nconverted my code repository from CVS to Git, and made public copies of the \nGit repository available on Sourceforge and on Github. ", "To clone the \nrepository, you can use either\n\n git clone git://python-metar.git.sourceforge.net/gitroot/python-metar\nor\n git clone git://github.com/tomp/python-metar.git\n\n\n - Merged Toby White's changes for parsing (and ignoring) runway state groups\n and trend forecasts. (", "Thanks!)", "\n\n - Report the peak wind and wind shift times, if included in the remarks.", "\n (Requested by Daryl Herzmann.)", "\n\n - Changed the date-handling code to avoid automatic month/year adjustment\n if the month or year are specified explicitly. ", " \n (Thanks to Scott McKuen for reporting this.)", "\n\n - Only allow single-digit numerator in fractional visibility values, to avoid\n confusion with following temp/dewpt group.", "\n (Reported by Franco Fiorese, Francesco Spada, and David Gregory.)", "\n\n - Fixed the misuse of str() function and string() methods in a couple of spots.", "\n (Reported by David Gregory and others.)", "\n\n - Added tests for the visibility, trend, and runway state parsers.", "\n\n - Added tests to verify that automatic month/year adjustment of the observation \n date were being done correctly.", "\n\n - Updated links to METAR resources in the README\n\n\nmetar 1.3 (1 August 2006)\n---------\n\n - The datatype classes now have __str__ methods, so you can user the \n generic str() function to get their string representation.", "\n\n - 'MMM' is now accepted to represent missing data in the wind group.", "\n\n - Fixed bugs in the handling of wind observations reported in KMH and MPH.", "\n (Thanks to Erik Bryer for reporting the MPH problem.)", "\n\n - '/' placeholders for missing data in the weather group are handled better now.", "\n\n - Added tests for KMH and MPH conversions to the test_speed.py script.", "\n\n - Added tests for wind-group parsing to the test_metar.py script.", "\n\n - Accept \"11/2\" as equivalent to \"1 1/2\" in the visibility group.", "\n\n - Fixed a bug that prevented the error handler in get_report.py from reporting\n the error message :-) (Thanks to Erik Bryer for reporting this.)", "\n\n\nmetar 1.2 (6 February 2005)\n---------\n\n - Save the 1-, 3-, 6- and 24-hr preciptation values as Metar attributes.", "\n\n - Save the 6- and 24-hour max and min temperatures as Metar attributes.", "\n\n - Save the peak wind speed and direction as Metar attributes.", "\n\n - Save the sea-level pressure as a Metar attribute. ", " The sea-level\n pressure is treated as the station pressure, as well, if no station\n pressure is otherwise reported.", "\n\n - Added a peak_wind() method, to report peak wind data.", "\n\n - 'QNH' and 'SLP' pressure groups are now accepted. ", " 'INS' at the end of\n a pressure group is recognized, as well.", "\n\n - A group of four digits is accepted as a pressure group, now.", "\n\n - Present-weather and cloud-cover lines are only written in the textual\n output if observations of those phenomena were reported.", "\n\n - The character 'O' is treated as a zero in the cloud-height, visibility\n and wind fields.", "\n\n - 'CORR' (in the modification field) is interpretted as 'COR'\n\n - 'NIL' and 'FINO' (in the modification field) are interpretted as 'NO DATA'\n\n - 'K', 'T' and 'LT' are all interpretted as 'KT'.", "\n\n - 'SCK' is interpretted as 'SKC'\n\n - 'MM' is now accepted as a placeholder in the 'temp' and 'dewpoint' groups.", "\n\n - An 'integrity' field ('+' or-) has been created.", "\n\n - 'RVRNO' groups are ignored, now.", "\n\n - '0VC' is treated as 'OVC'.", "\n\n - A pressure group consisting of just four digits with no leading 'A' or\n 'Q' is accepted now. ", " The units are assumed to be inches if the value\n is greater than 2500.", "\n\n - An 'O' in a cloud height field is treated as a '0'.", "\n\n - Modified to handle \"MIFZFG\".", "\n\n - Moved regexp matching out of the _parse* methods and into the `__init__`\n method. ", " This lets me avoid unnecessary method calls and removes a bunch\n of previously duplicated code. ", " It gives a 10-15% speedup. ", " The ability to \n ignore trend groups has been temporarily lost as a result of this change.", "\n\n - The date parsing code will assume we're in the previous month if the day\n is greater than today's date.", "\n\n - Rearranged the VISIBILITY_RE regexp to fix a parsing bug, which had\n caused \"1 1/2SM\" to be parsed as two groups.", "\n\n - Modified SKY_RE regexp to accept two to four digits in the cloud height,\n and to treat 'O' as '0', if found in the height.", "\n\n - Fixed a bug (a typo) in the vertical visibility handling code. ", " This was\n reported by Joseph Sheedy.", "\n\n - Fixed a bug in reporting maximum visibility when there was no direction\n for the maximum visibility.", "\n\n - Changed the way the visibility group was parsed to allow better\n handling of units. ", " '9999U' and '7000M' are now accepted.", "\n\n - Added support for sky group of the form '///030///', indicating cloud\n height without coverage or type info.", "\n\n - Support \"KTS\" as an alternative to \"KT\".", "\n - Support \"XX\" as a placeholder for a missing temperature or dewpoint.", "\n(These are violations of the spec, but are sometimes used, anyway.)", "\n\nmetar 1.1 (28 January 2005)\n---------\n\nNo notes available for this release.", "\n\nmetar 1.0 (16 August 2004)\n---------\n\nNo notes available for this release.", "\n" ]

{ "pile_set_name": "Github" }

[ 0.000037637848620572846, 0.000038138098053050095, 0.0001, 0.00010412328196584755, 0, 0.0009053870529651426, 0.00006087168249330412, 0.00022160664819944597, 0, 0.0000706164818868724, 0, 0, 0, 0, 0, 0.00005406574394463668, 0, 0.00000625, 0.00006718624025799517, 0.000014457343607685523, 0, 0.00004959333465582226, 0, 0, 0, 0.0008650519031141869, 0, 0.0004164931278633902, 0, 0.000630119722747322, 0, 0.0005408328826392645, 0, 0, 0.000020108990729755272, 0, 0.000168662506324844, 0.0006155740227762388, 0, 0.00037530493525989863, 0, 0, 0.000044444444444444447, 0, 0.00018261504747991235, 0.000244140625, 0.0003305785123966942, 0, 0, 0, 0, 0, 0, 0, 0.00007889546351084813, 0.0001538935056940597, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0006574621959237343, 0, 0, 0, 0, 0.0004938271604938272, 0, 0, 0, 0, 0 ]

[ "miércoles, 26 de abril de 2017\n\nApril 25, 2017 (Wichita Falls, Texas) – Carter\nAviation Technologies, LLC (Carter) has teamed\nup with Mooney International Corporation\n(Mooney) to explore developing a vertical takeoff\nand landing (VTOL) aircraft in support of the Uber\nElevate initiative.", "\n\nThe companies announced this\npartnership at this week’s Uber Elevate Summit\nduring their respective presentations. ", "The aircraft\nwill be a 4-6 seat air taxi for the intra city market,\nutilizing Carter’s patented Slowed Rotor\nCompound (SR/C™) technology for efficient\nhover and efficient cruise at 175 mph, and\nbenefitting from Mooney’s extensive general\naviation experience.", "\n\nUber has defined several challenging requirements for this project – requirements that Carter and Mooney are\nconfident they can meet. ", "The aircraft must be powered by all electric propulsion, be much more quiet than\nexisting conventional VTOL aircraft, be capable of fully autonomous flight (although Uber expects to have a\npilot onboard for the first several years of operation), cruise efficiently at ~175 mph, and above all else, be\nextremely safe.", "\n\nSR/C technology uniquely addresses these requirements. ", "The low disc loaded single main rotor can operate\nat low tip speeds in hover to reduce takeoff and landing noise, and be slowed in cruise to reduce cruise noise\nand allow for high speed efficiency on par with a fixed wing aircraft. ", "And with the high inertia rotor always\nturning, it can operate in effect as a built in parachute, but one that can be ‘deployed’ at any altitude or any\nairspeed, and one which allows for directional control all the way down to the ground.", "\n\n“We’re excited to be working with Mooney,” stated Jay Carter, Jr., Founder and CEO of Carter Aviation.", "\n“They’re a tremendous company with a prestigious history of high performance aircraft. ", "In fact, I used to own a\nMooney M20. ", "They bring a lot of engineering expertise and a lot of experience in developing a product to\nmarket and getting it certified. ", "I’m looking forward to this partnership, and can’t wait to see what we can\nachieve.”", "\n\nFor more information on Uber Elevate, please visit Uber Elevate or the Uber Elevate Summit page.", "\nFor information about Mooney, please visit their website, Mooney International.", "\nAbout Carter Aviation Technologies, LLC.", "\nCarter Aviation is a Wichita Falls, Texas based aerospace research and development firm that has developed\nand demonstrated its Slowed-Rotor/Compound (SR/C™) Technology. ", "More information is available at\nwww.CarterCopters.com. ", "To discuss any of the foregoing or schedule a visit to Carter Aviation’s facilities,\nplease contact Jeff Lewis at Jeff.Lewis@CarterAero.com." ]

{ "pile_set_name": "Pile-CC" }

[ 0.00007284293848413846, 0.00007305135510263716, 0.00004506940688660537, 0.00010813148788927336, 0.0000200288415318058, 0, 0, 0, 0.00036982248520710064, 0, 0, 0, 0, 0.00031236984589754266, 0.0003125, 0.001189767995240928, 0.00006839711364180432, 0.00031887755102040814, 0.0001020408163265306 ]

[ "Mermaid Party Favor Bags set of 12\n\nProduct Info\n\nNeed to spruce up your party favors for your guests to thank them for coming!", "\n\nWhat you GET with this listing:\n1. ", "12 clear bags (4-3/4\" x 6\")\n2. ", "12 printed labels as shown with your wording\n3. ", "shipped within 72 hours after you proof the labels and payment clears\n\nOnce you receive the products, all you have to do is fill your bags and then staple the labels onto the bags. ", "Comes folded and ready to assemble.", "\n\n********************************************************************************************************\nNOTE: If you prefer this as a printable PDF file, email me for a custom listing, cost is $6.50 and there are 2 labels to a sheet. ", "I can change the mermaid to have brown, blonde or red hair if you like, just make a note in the buyer note section of your checkout.", "\n*******************************************************************************************************\nThanks for shopping with My Little World Party Shoppe!" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0, 0, 0, 0.000017803414694938486, 0, 0.00003955539733396622 ]

[ "First, we’ve retired the DOOM season pass and are making all of the multiplayer DLC content available to all players. ", "That’s three multiplayer DLC packs, which include nine of our best maps, three additional guns, three additional playable demons, new equipment, armor sets and more. ", "That’s on top of the modes and features, like bot support, that players have been enjoying since late last year.", "\n\nAlso with update 6.66, you’ll find a new rune system, a revised progression system, and enhanced kill notifications:\n\nRevised Progression System – The revised progression system will alter when and how players unlock additional guns, demons, equipment, and all of the player and weapon customization options. ", "Instead of relying on the random distribution of unlocks, items now unlock through specific leveling requirements or through in-game challenges that the player can complete. ", "For example, if there’s a specific helmet you want right now, you can work towards unlocking it by focusing your play style on the requirement.", "\n\nNew Rune System – The all-new Runes replace the Hack Module system. ", "Like Hack Modules, Runes enhance player abilities, but can be persistently equipped, which was not possible with the previous system.", "\n\nEnhanced Kill Notifications – The death screen is getting an overhaul as well, now calling out how you were killed, not just who killed you. ", "The new death screen will list out the combination of players, weapon types and damage inflicted.", "\n\nOn top of that, all players’ multiplayer levels have been reset back to 0, but “veteran players will have the option to reset their unlock progression and experience the new progression system fresh, or retain all of their existing guns, equipment, demons and customization options that they’ve acquired or purchased while unlocking some of the new items in the revised progression system.”", "\n\nIf you’ve played Doom’s multiplayer since the game launched in May 2016, you’ll receive a special veteran status badge.", "\n\nInterested in trying out Doom for free? ", "A Free Weekend will kick off on Thursday, July 27 at 9am PT/12pm ET on PS4. ", "It will let you play the first two levels of the campaign and give you unlimited access to multiplayer and SnapMap.", "\n\nDuring the Free Weekend, which ends on July 30 at 9pm PT, digital copies of Doom will be discounted to $14.99 USD/£11.99. ", "Should you purchase Doom during the Free Weekend, all of your progress will carry over.", "\n\n2016 PS4 Games You Overlooked\n\nAction Henk\n\nAction Henk takes the time trial fun of Trials, but replaces motorcycles with an out-of-shape action hero. ", "Perfect for speedrunners, this platformer’s addictive nature will have players repeatedly playing stages in order to shave precious seconds off of their time. ", "It’s a blast, and really opens up once the grappling hook is introduced.", "\n\nAssault Android Cactus\n\nThis year’s best twin-stick shooter wasn’t a hyped release like Alienation, as indie standout Assault Android Cactusstole the show. ", "This highly challenging title features co-op fun, and is best played with friends, but can also be completed solo. ", "A colorful cast of characters, each with their own abilities, helps the game stay fresh from beginning to end.", "\n\nCarnival Games VR\n\nIt’s easy to dismiss Carnival Games VR. ", "After all, the series didn’t have a great reputation on the Wii, but it delivers good fun on PlayStation VR. ", "It doesn’t provide a ton of depth as it instead opts to provide plenty of light-hearted fun, but sometimes that is exactly what is needed.", "\n\nGrand Kingdom\n\nRole-playing games are looking to shine in 2017, but 2016 had quite a few good ones as well. ", "One of which was Monochrome Corporation’s Grand Kingdom, a turn-based title where positioning is key.", "It also has a unique focus on multiplayer, which is rarely explored in the genre. ", "It’s also available on Vita, if you prefer to play on the go.", "\n\nOxenfree\n\nNight School Studio’s Oxenfree was one of the year’s best surprises. ", "Composed of former Telltale staff, the studio managed to implement some of the most impressive interactive dialogue that has been seen in gaming. ", "Oxenfree isn’t just a technical feat, though, as it also tells a spooky story that will leave you thinking after the credits roll.", "\n\nSalt and Sanctuary\n\nIf Dark Souls III didn’t leave you fully satisfied, then you should give Ska Studios’ Salt and Sanctuary a try. ", "This 2D take on FromSoftware’s Souls series provides a highly rewarding experience. ", "It even features local multiplayer, in case you want to go on a journey with a friend.", "\n\nSoft Body\n\nZeke Virant’s Soft Body is one of the coolest games released in 2016. ", "The inventive action game has the player controlling two characters at once (a ghost and soft body). ", "The game starts off simple, but after a few levels the game’s iterative design starts to shine. ", "Mechanics build upon each other, and it becomes a highly difficult & beautiful game. ", "It’s a must-play for people looking for something new or are fans of bullet hell titles.", "\n\nTharsis\n\nTharsis is basically Yahtzee set in space, except a bad dice roll might result in the deaths of your entire spaceship crew. ", "This game is all about management and making difficult decisions, as players have to manage stress levels after a ship gets critically damaged. ", "Only talented players will be able to survive, and the game deals with some brilliant themes.", "\n\nValley\n\nCanadian developer Blue Isle Studios has improved a lot since they released Slender: The Arrival. ", "Their second major release, Valley, is a first-person adventure game that has players using a “L.E.A.F. suit” to jump through the air. ", "It looks gorgeous, and has an interesting story to discover.", "\n\nVideoball\n\nVideoball is a game filled with much more depth than immediately meets the eye. ", "Underneath its minimalistic aesthetic hides a highly complex, yet easy to pick-up, competitive multiplayer title. ", "A mixture between air hockey and soccer, the game is some of the best fun players can have with friends, both online or locally.", "\n\nPlayConn is a revolutionary new wireless power solution for gaming consoles and portable gaming devices. ", "Our patented connector allows you to keep your system charged up without the hassle of wires or docks." ]

{ "pile_set_name": "Pile-CC" }

[ 0.00007181844297615628, 0.000036289737262302225, 0, 0, 0, 0, 0, 0.00005653230821414438, 0, 0, 0, 0, 0.0005668934240362812, 0.00034626038781163435, 0.00007561436672967865, 0.00006503642039542143, 0.0001321178491214163, 0, 0, 0, 0.0000400576830636116, 0, 0, 0.0002687449610319807, 0, 0, 0, 0.0000980296049406921, 0, 0.0002687449610319807, 0, 0.00004691311690748733, 0, 0.00011138338159946535, 0.0001417233560090703, 0, 0, 0, 0, 0, 0, 0.00005486968449931413, 0, 0, 0.00017146776406035664, 0, 0, 0, 0, 0, 0.00008734387282732115, 0 ]

[ "Q:\n\nJavascript function plays correctly old site but not new\n\nI recently moved my companies website to one of our unused web servers in order to update the Joomla backend from 1.5.26 to the latest Joomla 2.5. ", "We couldn't go to 3.x because of modules.", "I used SP Upgrade, and everything migrated brilliantly once I had my new theme and current modules installed.", "\nWe have a customized default theme and an assigned theme to the home page. ", "Within the assigned theme (assigned to the home menu) directory, index.php has a script above the header. ", "I will post this code below. ", "\nThe old site can be found at the following link and when you first go to the site, you will see the video play.", "\ncpmchurchministries.com/old\nThe new site can be found at the following link and when you first go to the site, you will see only an image.", "\ncpmchurchministries.com/new\nThe code is the same for both sites, index.php:\n<head>\n <jdoc:include type=\"head\" />\n <link rel=\"stylesheet\" href=\"<?php echo $this->baseurl ?", ">/templates/<?php echo $this->template ?", ">/css/template.css\" type=\"text/css\"/>\n <script type=\"text/javascript\" src=\"<?php echo $this->baseurl ?", ">/templates/<?php echo $this->template ?", ">/swf/swfobject.js\"></script>\n <script type=\"text/javascript\">\n swfobject.embedSWF(\"<?php echo $this->baseurl ?", ">/templates/chosenpeople/swf/cpm_logo.swf\", \"flash_logo\", \"245\", \"162\", \"7\");\n window.addEvent('domready', function() {\n if($('default_header')) {\n if(Cookie.get(\"cpm_movie\") !", "= \"full\") {\n full_movie();\n } else {\n small_movie();\n }\n }\n });\n\n function small_movie() {\n $('default_header').removeClass('full_movie');\n $('default_header').addClass('small_movie');\n swfobject.embedSWF(\"<?php echo $this->baseurl ?", ">/templates/cphome/swf/header_home.swf\", \"flash_header\", \"696\", \"157\", \"7\");\n }\n\n function full_movie() {\n $('default_header').removeClass('small_movie');\n $('default_header').addClass('full_movie');\n Cookie.set(\"cpm_movie\", \"full\", {duration: 365});\n swfobject.embedSWF(\"<?php echo $this->baseurl ?", ">/templates/cphome/swf/video_header.swf\", \"flash_header\", \"696\", \"400\", \"7\");\n }\n</script>\n<?", "php if ($editmode) echo '<link rel=\"stylesheet\" href=\"'.$this->baseurl.", "'/templates/system/css/general.css\" type=\"text/css\" />'.", "\"\\n\"; ?", ">\n\nHas anyone run into a similar issue? ", "Is it possible to get any help?", "\nThank you. . .", "\n\nA:\n\nThe newer version of Joomla that you are using uses a newer version of the MooTools library so you need to make the following two function changes to the code:\n\nOLD\nwindow.addEvent('domready', function() {\n if($('default_header')) {\n if(Cookie.get(\"cpm_movie\") !", "= \"full\") {\n full_movie();\n } else {\n small_movie();\n }\n }\n});\n\nfunction small_movie() {\n $('default_header').removeClass('full_movie');\n $('default_header').addClass('small_movie');\n swfobject.embedSWF(\"/new/templates/cphome/swf/header_home.swf\", \"flash_header\", \"696\", \"157\", \"7\");\n}\n\nfunction full_movie() {\n $('default_header').removeClass('small_movie');\n $('default_header').addClass('full_movie');\n Cookie.set(\"cpm_movie\", \"full\", {duration: 365});\n swfobject.embedSWF(\"/new/templates/cphome/swf/video_header.swf\", \"flash_header\", \"696\", \"400\", \"7\");\n}\n\nNEW\nwindow.addEvent('domready', function() { \n if($('default_header')) {\n if(Cookie.read(\"cpm_movie\") !", "= \"full\") {\n full_movie();\n } else {\n small_movie();\n }\n }\n });\n\nfunction small_movie() {\n $('default_header').removeClass('full_movie');\n $('default_header').addClass('small_movie');\n swfobject.embedSWF(\"/new/templates/cphome/swf/header_home.swf\", \"flash_header\", \"696\", \"157\", \"7\");\n}\nfunction full_movie() {\n $('default_header').removeClass('small_movie');\n $('default_header').addClass('full_movie');\n Cookie.write(\"cpm_movie\", \"full\", {duration: 365});\n swfobject.embedSWF(\"/new/templates/cphome/swf/video_header.swf\", \"flash_header\", \"696\", \"400\", \"7\");\n}\n\nEDIT for easy copy paste\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.000022893248780934502, 0, 0.00008416799932665601, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.000025878577713368875, 0, 0 ]

[ "Transoral robotic surgery: The radiation oncologist's perspective.", "\nTransoral Robotic Surgery (TORS) is a fascinating new technology allowing for excellent functional outcomes after resection of head and neck tumors that previously required morbid surgical approaches for access. ", "With a new technology, however, come new questions as to optimal patient selection and its impact on adjuvant therapy considerations. ", "Here we review the issues most pertinent to a radiation oncologist adapting to the use of TORS. ", "Patient selection, indications for adjuvant radiotherapy, radiation dose and target volumes are discussed. ", "Finally, ongoing clinical trials and future directions are considered." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0002295684113865932, 0, 0, 0, 0, 0 ]

[ "Biography\n\nNeurophysiological mechanisms underlying neurodegenerative disorders.", "\nOur primary research interests are directed toward understanding the mechanisms underlying neuronal dysfunction in the basal ganglia and cortex in neurodegenerative disorders. ", "The research consists of a multidisciplinary approach combining neurophysiological, morphological and molecular techniques. ", "This research has evolved into several major projects: 1) Examining the physiological changes in mutant mouse models of Huntington's disease, 2) Assessment of neuromodulation in the striatum as in pertains to Parkinson's disease and assessment of new gentic mouse models of Parkinson's disease and 3) Examining cellular cortical electrophysiological and morphological abnormalities occurring in children suffering from intractable pediatric epilepsy.", "\nThe first area of research involves using mutant murine models of Huntington's disease to understand how this neurological disorder physiologically affects cellular function. ", "We study different types of mouse models, each with a unique part of the human Huntington's disease gene inserted into the mouse genome. ", "We examine physiological function and morphological changes in striatal and cortical neurons, the two primary areas affected in Huntington's disease.", "\nThe studies on neuromodulation have concentrated on examining interactions among receptor subtypes in the striatum and othe nuclei of the basal ganglia as well as new genetic models of Parkinson's disease. ", "These studies emanate from our initial observations that the direction of dopamine modulation of electrophysiological responses induced by activation of excitatory amino acid receptors is dependent upon the subtypes of excitatory amino acid and dopamine receptors activated. ", "This observation could explain many of the inconsistencies in the literature concerning the modulatory role of dopamine in the striatum and other nuclei. ", "One of the goals of these studies is to learn the rules that guide dopaminergic modulation, to identify their mechanisms and to examine how this modulation is altered in models of Parkinson's disease to help design rational therapies for this disorder.", "\nThe third area examines alterations in development of electrophysiological properties of human neocortical neurons. ", "Pathological neocortical tissue is obtained from children suffering from pediatric epilepsy and undergoing surgery to alleviate intractable seizures. ", "These experiments study \"abnormal-appearing\" neurons and they have shown that a population of neurons with altered voltage-dependent intrinsic currents and in some cases altered ligand-gated currents occurs." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0.000004938271604938272, 0.00003228305785123967, 0.000053279343598486864, 0.00004504301608035674, 0, 0, 0, 0, 0, 0, 0 ]

[ "PH marks 400 years since the arrival of Our Lady of Mount Carmel image\n\non: May 04, 2018\n\nA replica of the original image of Our Lady of Mount Carmel de San Sebastian at the top of the main retablo of Basilica Minore de San Sebastian. ", "CBCPNews\n\nCBCPNews\n\nMay 3, 2018\n\nManila, Philippines\n\nMarian devotees are expected to gather at Manila’s Quirino Grandstand on Friday, May 4, for the “Salubong and Traslacion”, a re-living of the arrival of the image of Our Lady of Mt. Carmel from Mexico to the Philippines 400 years ago.", "\n\nThe gathering will start with a fluvial procession at 5am and will be followed with a Mass to presided over by Archbishop Romulo Valles, president of the Catholic Bishops’ Conference of the Philippines.", "\n\nThe traslacion, which includes a procession of the image, will start at 8am to San Sebastian Basilica, passing by Quiapo Church, where the revered Black Nazarene image will be brought out for the traditional “Dungaw”.", "\n\nThe image will then be made available for public veneration upon its arrival at the country’s iconic and only all-steel church at around 8am.", "\n\nValles said the event is an opportunity for the faithful to pray together for the welfare of the country at a time when it is facing several challenges.", "\n\n“We urgently need to seek Our Mother’s intercession to protect the Philippines against natural calamities, the ongoing attacks on the sanctity of life and of the family, and other serious difficulties that our nation faces,” Valles said.", "\n\nAlong with missionaries from the Order of Augustinian Recollects, the image arrived in Manila in 1618, which also began the Brown Scapular devotion in the Philippines that lives on today.", "\n\nInitially housed at the San Juan de Bautista de Bagumbayan Church at the Luneta, the image was enthroned at the first San Sebastian Church in Quiapo when it opened its doors in 1621.", "\n\nCanonically crowned in 1991 by the late Cardinal Jaime Sin under the authority of Saint John Paul II, Our Lady of Mount Carmel remains the Queen of San Sebastian Basilica — and of Quiapo.", "\n\nDevotees, particularly in Quiapo, Our Lady of Mt. Carmel is a key figure in the annual Black Nazareno feast, where she appears during the Dungaw, awaiting the passing in procession of the image of the black Jesus.", "\n\nCapping the whole day event will be a 6pm Mass and the re-enthronement of the image of Our Lady of Mount Carmel at the basilica.", "\n\nCardinal Luis Antonio Tagle earlier said that with the normal conditions, those taking part in the occasion will be able to receive a plenary indulgence or the remission of temporal punishment due to sins as approved by the Vatican.", "\n\nIn order to obtain a plenary indulgence, Catholics must make a sacramental confession, receive Holy Communion, have complete detachment from sin, and pray for the Pope’s intentions." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0.00004805843906189927, 0.00002085027418110548, 0, 0.000042165626581211, 0.000017506696311339085, 0.000055989473978891965, 0.00002953686200378072, 0.000027994736989445982, 0.000043266630611141155, 0, 0.00001826283877565929, 0.00002986055122577563 ]

[ "Q:\n\nMySQL Cross Table Constraint\n\nI have three tables, table A has a unique primary key that is auto-incremented, and the other two (table B and C) have primary keys that have a foreign key constraint that ties them to the first tables primary key.", "\nI want to make a constraint that maintains that for all rows in the second and third tables they cannot contain any duplicate, and for all records in table A there is a matching record in B or C.\nSo basically a record of type A can be a type B or C and must be one of B or C.\nIs there away to make this constraint without triggers in MySQL? ", "or are triggers necessary?", "\nThanks for any help.", "\n\nA:\n\nYou can use a \"type\" table:\nCREATE TABLE Type\n ( type_code CHAR(1) NOT NULL\n , PRIMARY KEY (type_code)\n ) ;\n\nwith exactly 2 rows (as many as the different subtype tables you need:\nINSERT INTO Type (type_code)\nVALUES ('B'), ('C') ;\n\nThe supertype table (that includes a column that references \"Type\"):\nCREATE TABLE A\n ( a_id INT NOT NULL AUTO_INCREMENT\n , type_code CHAR(1) NOT NULL\n , PRIMARY KEY (a_id)\n , UNIQUE KEY (type_code, a_id)\n , FOREIGN KEY (type_code)\n REFERENCES Type (type_code)\n ) ;\n\nThe subtype tables (that are now referencing the combination of A's Primary key and type_code:\nCREATE TABLE B\n ( a_id INT NOT NULL\n , type_code CHAR(1) NOT NULL DEFAULT 'B'\n , PRIMARY KEY (type_code, a_id)\n , FOREIGN KEY (type_code, a_id)\n REFERENCES A (type_code, a_id)\n , CHECK (type_code = 'B')\n ) ;\n\nCREATE TABLE C\n ( a_id INT NOT NULL\n , type_code CHAR(1) NOT NULL DEFAULT 'C'\n , PRIMARY KEY (type_code, a_id)\n , FOREIGN KEY (type_code, a_id)\n REFERENCES A (type_code, a_id)\n , CHECK (type_code = 'C')\n ) ;\n\nThe above would work fine, if only MySQL had implemeneted CHECK constraints. ", "But it hasn't. ", "So, to be absolutely sure that all your specifications are enforced, and not 'B' type data is inserted in C table, you'll have to add 2 more \"type\" tables (and remove the useless in MySQL CHECK constraints):\nCREATE TABLE TypeB\n ( type_code CHAR(1) NOT NULL\n , PRIMARY KEY (type_code)\n ) ;\n\nCREATE TABLE TypeC\n ( type_code CHAR(1) NOT NULL\n , PRIMARY KEY (type_code)\n ) ;\n\nwith exactly 1 rows each:\nINSERT INTO TypeB (type_code)\nVALUES ('B') ;\n\nINSERT INTO TypeC (type_code)\nVALUES ('C') ;\n\nand the additional FKs:\nALTER TABLE B\n ADD FOREIGN KEY (type_code)\n REFERENCES TypeB (type_code) ;\n\nALTER TABLE C\n ADD FOREIGN KEY (type_code)\n REFERENCES TypeC (type_code) ;\n\nWith these constraints, every row of table A, will be either of type B or C and it will be in the respective table (B or C) and never in both.", "\nIf you also want to ensure that they will be in exactly one table (and never in neither B nor C), that should be taken care when inserting in A (all insertions should be done with a transaction that enforces that requirement).", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.000016259105098855357, 0, 0, 0, 0.000011747200250606939, 0, 0.0000029599635332492706, 0, 0 ]

[ "Multifactor efficiency in data envelopment analysis with an application to urban hospitals.", "\nA perennial difficulty in measuring hospital efficiency, and one with important policy implications, is how to compare teaching versus non-teaching hospitals. ", "This problem reflects a broader methodological concern in Data Envelopment Analysis (DEA), which is the comparison of specialist and non-specialist Decision-Making Units (DMUs). ", "This paper presents a new performance measure in DEA, termed multifactor efficiency, which represents an average partial factor productivity index summed over all output-input ratios. ", "We apply this technique to measure the performance of 27 large, urban hospitals, including 13 teaching hospitals. ", "These results were reviewed and validated by a panel of health care experts, and multifactor efficiency was shown to offer several benefits that enhance and complement existing performance measures in DEA." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0.00006312334301224592, 0.00002953686200378072, 0, 0.000023795359904818562 ]

[ "When we arrived the staff were very friendly even called our room to make sure our room was okay which has never happened to me before. ", "Good restaurant recommendation would be Saona. ", "Great food for a great price!", "\n\nPocket Guide: Valencia\n\nVisiting Valencia\n\nCouples looking to get away will find a romantic atmosphere in Valencia, though all visitors are sure to appreciate the restaurants, shopping, and beaches. ", "Welcoming and culturally rich, this city also attracts visitors with its museums and monuments. ", "Top attractions include City of Arts and Sciences and Oceanografic Aquarium.", "\n\nThere are 187 Valencia hotels\n\nMarch is the most expensive month to travel here, while January tends to be the cheapest\n\nClosest major airport is in Valencia (VLC), 8.6 mi (13.8 km) from the city centre\n\nSightseeing around Valencia\n\nKnown for its museums, while City of Arts and Sciences, Prince Felipe Museum of Sciences, and Queen Sofia Palace of the Arts are some local cultural sights\n\nPopular family attractions include Oceanografic Aquarium, Bioparc Valencia Zoo, and Royal Gardens\n\nIts historic sites and monuments are notable and landmarks to visit include Plaza del Ayuntamiento, Silk Exchange, and Serranos Towers\n\nThe natural beauty of the beach is picturesque, and places to visit include Pinedo Beach, Valencia Botanical Gardens, and El Perellonet Beach\n\nShopping is a highlight of the area, so enjoy some retail therapy at Central Market, Aqua Shopping Center, and Ruzafa Market\n\nEveryone—not just sports fans—will find lots of reasons to cheer at a game or event at Valencia Street Circuit, Plaza de Toros de Valencia, or Mestalla Stadium\n\nGetting around Valencia\n\nWith so many transportation options, seeing Valencia is a breeze. ", "Walk to a nearby metro station like Maritim-Serreria Station, Ayora Station, or Amistat Station. ", "If you're looking to journey outside of the area, take a train from Valencia Fuente San Luis Station, Valencia Cabanyal Station, or Valencia Joaquin Sorolla Station.", "\n\nStaying in Valencia\n\nIn Valencia, you'll find 187 hotels and other accommodation options to choose from, making it easy to plan your perfect holiday retreat at an affordable price:\n\n78 hotels, ranging from GBP 28/night to GBP 195/night\n\n59 apartments, ranging from GBP 29/night to GBP 140/night\n\n5 B&Bs, ranging from GBP 39/night to GBP 77/night\n\n15 hostals, ranging from GBP 35/night to GBP 73/night\n\n9 hostels, ranging from GBP 11/night to GBP 41/night\n\n12 pensions, ranging from GBP 21/night to GBP 66/night\n\n6 residences, ranging from GBP 49/night to GBP 74/night\n\nFor family trips or any other travel plans, you might consider these top-rated, larger hotels:\n\nHotel Las Arenas Balneario Resort, averaging GBP 243.83/night\n\nThe Westin Valencia, averaging GBP 178.19/night\n\nLooking for a romantic getaway, a cosy spot, or a boutique stay? ", "You might like these highly rated smaller hotels or specialty properties:\n\nCaro Hotel, averaging GBP 214.27/night\n\nAd Hoc Monumental Hotel, averaging GBP 85.26/night\n\nCaro Hotel, a 5-star favourite with Expedia travellers, has a 4.8 out of 5 user rating. ", "Also highly rated by guests are Hotel Las Arenas Balneario Resort and Ad Hoc Monumental Hotel.", "\n\nDressing for Valencia\n\nBetween January and March, you can expect average temperatures of 22°C during the day and 5°C at night\n\nFrom April to June, the average during the day is 30°C, while the average at night is 9°C\n\nJuly through September has daytime averages of 32°C with nighttime averages of 16°C\n\nIn October–December, you can expect daytime averages of 28°C and nighttime averages of 5°C\n\nExpedia Partners\n\n*Savings based on all vacation package bookings with Flight + Hotel on Expedia.com from September 2013 through February 2014, as compared to price of the same components booked separately. ", "Savings will vary based on origin/destination, length of trip, stay dates and selected travel supplier(s). ", "Savings not available on all packages.", "\n\nFlight-inclusive holiday packages and Flight-Plus arrangements created on Expedia.co.uk are financially protected by the Civil Aviation Authority (under Expedia, Inc.'s ATOL number 5788). ", "But ATOL protection does not apply to all holiday and travel services listed on this website. ", "Please ask us to confirm what protection may apply to your booking. ", "If you do not receive an ATOL Certificate then your booking will not be ATOL protected. ", "If you do receive an ATOL Certificate but all the parts of your trip are not listed on it, those parts will not be ATOL protected. ", "Please see our general terms and conditions for further details on ATOL or for more information about financial protection and the ATOL Certificate go to: www.atol.org.uk/ATOLCertificate.", "\n\nFor the sale of travel insurance Expedia Inc. is an Appointed Representative of Mondial Assistance (UK) Limited trading as Allianz Global Assistance which is authorised and regulated by the Financial Conduct Authority (FCA). ", "Mondial Assistance (UK) Limited's FCA registration number is 311909. ", "FCA authorisation can be checked at the Financial Services register at www.fsa.gov.uk/register/" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0.0004526935264825713, 0, 0, 0, 0.00017313019390581717, 0.000014416831574985735, 0.0003188436603252205, 0.00007346189164370983, 0.00000140383189955302, 0.00006151480199923106, 0.00022634676324128565, 0.000002741107846147099, 0, 0, 0.000055401662049861494, 0, 0, 0, 0, 0.000028596757127741712, 0.000058219643307652, 0, 0.00022160664819944597 ]

[ "1. ", "Field of the Invention\nThe present invention relates to a manufacturing method of thin film transistor substrate of a liquid crystal display panel, and more particularly, to a manufacturing method of thin film transistor substrate of a liquid crystal display panel which is capable of improving the aperture ratio.", "\n2. ", "Description of the Prior Art\nBecause of the advantages of low radiation, small size, and low power consumption, liquid crystal display panels have been widely applied to various electronic products, such as notebooks, personal digital assistants, flat televisions, and mobile phones. ", "Generally, a liquid crystal display panel includes a thin film transistor substrate, a color filter substrate, and a liquid crystal layer disposed between the thin film transistor substrate and the color filter substrate. ", "Moreover, the thin film transistor substrate has a plurality of pixel areas defined thereon, and a back light module is further disposed on a side of the liquid crystal display panel to provide back light. ", "Accordingly, through controlling the voltage applying to the liquid crystal layer of each pixel area, corresponding gray scale can be obtained for each pixel area to display images. ", "Furthermore, in order to maintain the voltage to the next frame, storage capacitors are usually disposed in each pixel areas of the thin film transistor substrate.", "\nHowever, the material of the storage capacitor is an opaque metal layer. ", "The opaque metal layer would block light, decrease the aperture ratio of each pixel area, and further reduce the brightness of the liquid crystal display panel. ", "On the other hand, decease of the area of each storage capacitor electrodes may increase the aperture ratio of each pixel area, but this would lead to deterioration of display quality, such as generation of image flicker, because the voltage of the liquid crystal layer cannot be maintained to the next frame." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "[ Pomp and Circumstance Playing ]\n>> Good evening everyone. ", "I am Dr. Les Wong,\nPresident of San Francisco State University.", "\nThose of you in academic regalia may remove\nyour caps if you so choose. ", "And also for everyone's\nconvenience we ask that you please turn off\nyour cellphones. ", "Thank you. ", "As President of\nSan Francisco State University it gives me\ngreat pleasure to welcome all of you to our\n2016 Honors Convocation. ", "I am fortunate to\nlead San Francisco State. ", "And I have great\npride in what accomplish at this university.", "\nMore than 100 of our finest accomplishments\nare sitting behind me on the stage this evening.", "\n[ Applause ]\nAll of these students have met the highest\nstandards during their years here, rising\nto the challenges put to them by our outstanding\nfaculty. ", "They have enriched our lives, for\neducation is a distinctly two-way process.", "\nAnd we must trust that we have enriched their\nlives as well. ", "We want our honor students\nto know that their achievements have been\nrecognized, and so we have gathered here this\nevening, at the end of the academic year to\napplaud them for their fine work and to wish\nthem well as they prepare to graduate. ", "We\ntrust that they are leaving with an education\nthat has prepared them to inquire freely,\nto think and analyze independently, and as\nthey have heard from me very, very often to\nown their own mind. ", "And we trust that they\nare leaving with that distinctive feature\nof a San Francisco State education that we\ncherish dearly. ", "The ability to apply their\nknowledge in ways that will better the world\naround them. ", "Representatives of the University\ncommunity are here to join with us in this\nconvocation and you will meet many of them\nas the evening proceeds, but I would like\nto introduce others of them now. ", "So I would\nask that the following individuals please\nstand as I introduce you. ", "Dr. Luoluo Hong,\nVice President for Student Affairs. ", "Dr. Jennifer\nSummit, Dean of Undergraduate Studies. ", "Deborah\nMasters, University Librarian. ", "Lilly Gee,\nPresident of the University Women's Association,\nwhose members are this evening official convocation\ngreeters, and the host of our reception at\nthe Student Center later tonight. ", "Our two\nmarshals, Dr. John-Carlos Perea, Assistant\nProfessor of American Indian studies. ", "And\nWilliam Christmas, Professor of English Language\nand Literature. ", "I would also like to recognize\nour two faculty marshals, Connie Ulasewicz,\nProfessor of Apparel Design and Merchandising\nand Dorothy Tsuruta, Professor of Africana\nStudies.", "\n[ Applause ]\nBusiness and community leaders often ask me\nwhat is the key ingredient to the educational\nmagic that happens at San Francisco State\nand my answer is well-rehearsed, because I\noften say, talent. ", "As this audience knows\nwell, we attract some of the most talented\nstudents in the world, then we introduce these\ntalented students to one of the world's finest\nteaching faculties who have come to San Francisco\nState out of a desire to make a real difference\nin the lives of students. ", "That intersection\nbetween student and faculty talent is what\nmakes magic happen here. ", "To acknowledge that\nrelationship, each year, we ask the Chief\nRepresentative of the Faculty, the Chair of\nthe Academic Senate to address our honorees\nand our guests. ", "Dr. Troi Carleton joined San\nFrancisco State as a faculty member in 1996\nand is a professor of Linguistics in the English\nDepartment. ", "She has led the faculty of San\nFrancisco State this year as chair of the\nAcademic Senate. ", "For two decades, Dr. Carleton\nhas served San Francisco State as a highly\nrespected teacher, and an accomplished scholar.", "\nIn addition to her work as a faculty member,\nshe has been committed to the preservation\nand documentation of endangered languages\naround the world. ", "Dr. Carleton's academic\ncareer has been centered on the notion that\ncommunity members are stakeholders in the\ndocumentation and presentation of their linguistic\ntradition. ", "In the Mountains of Oaxaca, Mexico,\nher work has concentrated on creating and\nbuilding an archive of the community's oral\nhistory in Zapotecan for their municipal museum\nin international digital archives. ", "Student\njoined her to work on the archives for three\nweeks each summer. ", "Dr. Carleton is a first-grade\nteacher and scholar, but she also lends her\ntalents to making the community around her\na better place. ", "In short, she is a great citizen\nof this University. ", "I am now please to present\nDr. Troi Carleton.", "\n[ Applause ]\n>> Thank you President Wong. [", "Speaking in\nforeign language]. ", "Congratulations to all\nof you. ", "It is such an honor to be here to\ncelebrate all of the hard work, perseverance,\nand impressive accomplishments, represented\nby our new graduates here at San Francisco\nState. ", "You are here with your family and your\nfriends because you have not only reached\nthe level of achievement in this institution\nthat merits special recognition, you have\nalso demonstrated high potential for great\nachievements in the future. ", "Your achievements\nin the future, however, go beyond your quantifiable\nGPAs and any salaries that lay ahead. ", "Your\nachievements will be tied to your character\nand your vision of what is a humane and just\nworld. ", "It will tap into your intrinsic qualities\nas human beings and as citizens of our global\nand local community. ", "I'd like to begin with\na story that has nothing to do with convocation,\nor really any of you. ", "But it will tie in hopefully\nas we move forward. ", "So my husband's from Mexico\nCity. ", "We've been married for 19 years, yeah.", "\nAnd for 19 years my in-laws from Mexico City\ncall on birthdays, they call on graduation,\nschool awards ceremonies that they miss, talent\nshow performances they can't attend. ", "Basically\nanything we celebrate, they call. ", "Begin every\nconversation with me on all these occasions\nwith [foreign word]. ", "It's puzzled me for years,\nI didn't turn five why are you congratulating\nme? ", "I didn't graduate from eighth grade, why\nare you congratulating me? ", "I didn't just get\naccepted into college, why are you congratulating\nme? ", "In fact, from my perspective, it never\nreally actually mattered who did what, I was\ngoing to get congratulated for it. ", "That's\ncool. ", "I just chalked it up to something quirky\nthat Mexico City people do when they call\nlong distance. ", "It was fine. ", "Then it dawned\non me at an embarrassingly late stage in the\ngame, my kid didn't just turn five. ", "She was\nnurtured and loved, and supported for five\nyears of her life, and now we were all celebrating\nit together, just as we celebrated graduating\nfrom eighth grade, and just as we celebrated\nher getting into college. ", "In other words,\nshe didn't just happen, people invested in\nher. ", "And not just family. ", "A best friend, a\nmiddle school history teacher. ", "A teenage math\ntutor who lived across the street. ", "A next\ndoor neighbor. ", "It's taken a team of folks\nto get my kid where she is today. ", "And this\ngets at the heart of what we all understand\ncommunity to be. ", "Community means connecting,\nengaging and investing. ", "Community means supporting\none another without the expectation of quid\npro co. So really congratulations, or [foreign\nword] is in fact the appropriate offering\nfor friends, family, teachers, mentors who\nhave been a part of supporting these newly\nminted graduates and the awesome achievements\nthat they have made. ", "We have invested in you,\n2016 San Francisco State graduates, because\nwe believe in you. ", "And we are confident that\nyou will make a difference out there. ", "But\nit's a funny type of investment. ", "It's not\non the we expect direct payback on. ", "Instead\nyou might say we paid it forward. ", "The concept\nof paying it forward actually dates back a\nmillennia. ", "It was first introduced in 317\nBC by the award-winning, great play write\nMenander. ", "Paying it forward describes an event\nwhere the beneficiary of good deed repays\nit to others instead of the original benefactor.", "\nThe ancient concept is simple, but the consequences\ncan be quite profound. ", "When we engage in civility\nand kindness. ", "When we show compassion and\ngenerosity, when we invest in promoting social\njustice and equity without the slightest expectation\nof being repaid directly, we make the world\na better place. ", "That's just a fact. ", "Benjamin\nFranklin was the first to dust off this concept\nin 1784 in a letter to a friend. ", "He wrote\n\"I do not pretend to give such a deed, I only\nlend it to you. ", "When you meet with another\nhonest man in similar distress, you must pay\nme by lending this sum to him and joining\nhim to discharge the debt by like operation\nwhen he shall be able and shall meet with\nanother opportunity. ", "I hope it makes us go\nthrough many hands before it meets with the\nnave that will stop its progress.\" ", "A hundred\nyears later in 1874, Ralph Waldo Emerson picked\nup on this thread and famously wrote, \"In\nthe order of nature we cannot render benefits\nto those from whom we receive them, or only\nseldom, but the benefit we receive must be\nrendered again. ", "Line by line, deed for deed,\ncent for cent to somebody.\" ", "Well then finally\nanother hundred years later, in the 20th century\nanother favorite, Ray Bradbury's book \"Dandelion\nWine\" he wrote \"How do I thank Mr. Jonas,\nhe wondered, for what he's done. ", "How do I\nthank him? ", "How do I pay him back? ", "No way,\nno way at all. ", "You just can't pay. ", "What then?", "\nWhat? ", "Pass it on to someone else, he thought.", "\nPass it on. ", "Keep the chain moving. ", "Look around,\nfind somebody, and pass it on. ", "That's the\nonly way. ", "Throughout life we are all both\nbenefactors and recipients of good deeds,\nsupport, and mentoring. ", "And while I get great\njoy from mentoring my own students, I still,\neven at my age, have my mentors. ", "That's how\nit works. ", "That's how we connect. ", "That's what\nwe mean by tapping into intrinsic qualities\nof humanity and character. ", "It is a simple\nsocial contract. ", "A contract that requires\nfaith, and the goodness of human kind, and\nthe belief that with each good deed, with\neach act of kindness or support, with each\ncivil dialogue that we engage in we are contributing\nto making a humane and just world. ", "There are\nso many ways that we can pay it forward, an\neasy place to start is a simple acts of kindness,\nthe ripple effect caused by these simple acts\ncan be profound. ", "I'd like to conclude with\na story that's very meaningful to me and I\nthink it simplifies both the ripple effect\nof kindness, as well as the profound consequences\nof paying it forward with a story that has\nguided my life. ", "It's about my dad. ", "My dad\nwas an amazing man in my mind. ", "And he was\nlarger than life and he was my hero, no question\nabout it. ", "He was an idealist, he believed\nin the principles of democracy and good citizenship.", "\nHe was a guy who would quote the Federalist\nPapers at the dinner table, which was super\nfun when you were 10. ", "He was opinionated,\nwickedly intelligent, which meant in many\ncases you either loved him or hated him. ", "But\nabove all he was a kind and just man, which\nmade him very wise. ", "He came from a humble\nbackground. ", "His parents were barely literate.", "\nHe grew up in a blue collar neighborhood in\nHayward during the '40s and '50s and early\non he knew what was right and what was wrong\nand had a moral fortitude and courage that\nI've admired my whole life. ", "I've personally\nnever known a man who embodied such generosity\nand an innate sense of social justice. ", "He\nused to always give my sister and me the same\nadvice. ", "One, all honest work is good work.", "\nSo do your best regardless. ", "Two, don't sweat\nthe small stuff, it will kill you. ", "And three,\nalways, always err on the side of kindness\nand generosity. ", "He didn't tell us much about\nhis childhood, but there were a few stories\nthat he shared with us. ", "One time he told us\nabout this kid in high school who he sort\nof took under his wing and befriended. ", "The\nkid was an awkward kid, he was prone to bullying,\nand my dad, as you can imagine, had no patience\nfor bullies whatsoever. ", "And I remember him\ntelling us, you know he was a nice kid. ", "I\ndidn't get it. ", "He'd be off in the corner by\nhimself and so ostracized. ", "So I invited him\nto come and hang out with us. ", "My dad was his\nsort of unofficial body guard and always looking\nout for him. ", "My dad also refused to go to\nhis own high school dances because he said,\nand I'm just saying it euphemistically, he\nsaid they were mean. ", "He used other words.", "\nSo he would date girls from other high schools\nand go to their dances and always get a date\nfor this kid. ", "At any rate, these two graduate\nfrom high school, my dad goes off San Jose\nState to study political science. ", "He doesn't\nreally think about high school and this kid\nagain, he's got his life going on. ", "Now fast\nforward to 1969, it's the height of the Vietnam\nWar. ", "My dad's lottery number comes up for\nthe draft, and he goes in. ", "There are lots\nof long lines that he has to choose from,\nhe gets in one line, and when he finally gets\nup to the front, who's sitting on the other\nside of the table, but this kid that he had\nlooked out for in high school. ", "This kid was\nnow in the Army, and literally in a position\nto decide my dad's fate. ", "He takes one look\nat my dad, immediately recognizes him, smiles,\nthe chat for a moment, and finally the guy\nsays, say Willy? ", "You like to cook right? ", "My\ndad said, sure yeah. ", "And that moment, my dad's\nimmediate future was decided. ", "Instead of sending\nhim to the front line, this kid who my dad\nlooked out for all those years earlier, sent\nmy dad to Kentucky to be a cook in the Reserves\nfor the remainder of the war. ", "Is this the\nripple effect of kindness, or the profound\nconsequence of paying it forward? ", "Who knows\nbut I like to think so. ", "So class of '16 remember\ncommunity is what you make of it and the world\nis yours to improve upon. ", "Go out there, work\nhard, don't sweat the small stuff, err on\nthe side of kindness and generosity, and pay\nit forward [foreign word].", "\n[ Applause ]\n>> Hello, I'm Sue Rosser, the Provost and\nVice President for Academic Affairs. ", "Thank\nyou Senate Chair Carleton for your heartfelt\nremakes on the investment we make as a community\nin the future of our students we celebrate\ntonight. ", "A future we all agree should always\nvalue and promote the importance of kindness\nand generosity. ", "Moreover, thank you for reminding\nall of us about the value of hard, honest\nwork, not sweating the small stuff, and honoring\nthat investment by passing it on to benefit\nothers in the community. ", "Tonight, we're honoring\nstudents for their outstanding achievements\nat San Francisco State University. ", "First,\nwe will honor those students who were inducted\nas members of Phi Beta Kappa. ", "Next, we will\nhonor 107 undergraduate students who are graduating\nin the top one and one-half percent of the\nstudents from their academic colleges. ", "Most\nof them will graduate Magna Cum Laude or Summa\nCum Laude. ", "I'm very impressed. ", "I'm sure you\nare too. ", "The third group, includes 57 undergraduates,\nwho have been selected by their academic departments\nand programs to receive special recognition\nfor excellence in a particular field. ", "The\nfinal group includes 6 students who have been\nsingled out to represent all of the graduating\nseniors in their respective colleges. ", "Each\nof the six colleges, along with the special\nmajor's program, is invited to select one\noutstanding student to represent all the others\nat the Honors Convocation here tonight and\nalso at commencement tomorrow. ", "They are selected\nbecause of their outstanding academic achievements\nand other significant accomplishments that\nyou won't hear about throughout this evening.", "\nThese six students, seated here in the front\nrow, will receive the symbolic investiture\nof the hood at commencement ceremonies tomorrow.", "\nPhi Beta Kappa. ", "This year marks the 40th anniversary\nof the first instillation of our Phi Beta\nKappa Chapter Members at San Francisco State\nUniversity. ", "The President of the University\nChapter is Dr. Masahiko Minami, who is in\nthe audience tonight. ", "Dr. Minami, will you\nplease stand.", "\n[ Applause ]\nOurs is a university that stresses the liberal\narts as the basis for all instruction. ", "Phi\nBeta Kappa, the oldest honorary society in\nthe United States, founded the same year as\nour country, recognizes those students who\nhave successfully demonstrated breadth and\ndepth in the study of the sciences, the humanities,\nand the behavioral and social sciences. ", "The\nNational Society of Phi Beta Kappa established\nOmicron of California at San Francisco State\nUniversity 40 years ago, in 1976. ", "Since then\nonly 912 San Francisco State University students\nhave met the requirement the requirements\nto be elected to Phi Beta Kappa out of a pool\nof more than 182,000 graduating students.", "\nAs you can see it's election process is quite\nrigorous. ", "I am proud to introduce the Phi\nBeta Kappa members who are able to join us\ntonight, who have been initiated into the\nOmicron of California Chapter. ", "I ask that\neach member please stand as I call your name,\nand remain standing until all members are\nnamed. ", "They are Rebecca Blandino, Andy Chan,\nCody Kho, Estevan Francisco Lopez, Kayla Tolentino.", "\nPlease join me in congratulating these students\nfor their outstanding academic achievements.", "\n[ Applause ]\nYou may be seated now. ", "I would now like to\nintroduce the Dean of the College of Business,\nLinda Oubre, who will present the faculty\nrepresentatives and students accorded high\nacademic honors from the College of Business.", "\n>> Thank you Provost Rosser. ", "I would now like\nto introduce the faculty from the College\nof Business. ", "I'd like to remind the audience\nto please hold your applause until all the\nnames are announced. ", "Jean Wong, Accounting,\nI'm sorry please stand. ", "Oh, there you are\nJean, I'm sorry. ", "Robert Saltzman, Decision\nSciences. ", "Zuzana Janko, Economics. ", "Yuli Su,\nFinance. ", "Susan Roe, Hospitality and Tourism\nManagement. ", "David Chao, Information Systems.", "\nRoblyn Simeon, International Business. ", "Antoaneta\nPetkova, Management. ", "And Judi Strebel, Marketing.", "\n[ Applause ]\nThank you. ", "You may now be seated. ", "As I introduce\nthe honor students from the College of Business,\nI would ask that each student please stand\nand remain standing until all of the students\nfrom the category have been presented. ", "Please\nhold your applause until all the students\nhave been called. ", "Students graduated in the\ntop 1.5% for the college of business in order\nof their majors are, in accounting, Hung Suko\n[assumed spelling], Jonathan Lu [assumed spelling],\nJanine Raez [assumed spelling], Johannes Sai\n[assumed spelling]. ", "In Decision Sciences,\nDanh Nguyen a double major in Information\nSystems. ", "In Finance Saja Alhussain, Brielle\nBlack, Phillip Chang, Cody Kho, Randy Lloyd,\nMohammad Naqvi, Nini Tien, and Mark Patrick\nWeller. ", "In Hospitality and Tourism Management\nCarolin Maier. ", "In Information Systems, Bryan\nMcCaffery and Danh Nguyen, again. ", "In Management,\nNhi Truong. ", "And in Marketing Kyle Hunter Clark.", "\nPlease join me in congratulating the honorees.", "\n[ Applause ]\nYou may now be seated. ", "I would now like to\npresent those students who have been selected\nby their departments for special recognition.", "\nJonathan Lu, Accounting. ", "Danh Nguyen, Decisions\nSciences. ", "Estevan Francisco Lopez, Economics.", "\nRandy Lloyd, Finance. ", "Fion Hu, Hospitality\nand Tourism Management. ", "Ron Gwong Wong [assumed\nspelling] Information Systems. ", "Nana Okuyama,\nInternational Business. ", "Michelle Flores Pulido,\nLabor and Employment Studies. ", "Elena Marie\nRoldan, Management. ", "And Olivia Dippon, Marketing.", "\nPlease join me in congratulating them.", "\n[ Applause ]\nYou may now be seated. ", "As Provost Rosser mentioned,\neach of the colleges select one student to\nreceive the hood tonight on behalf of all\nof its graduates. ", "I'm very pleased to introduce\nthis year's hood recipient from the College\nof Business, Danh Nguyen, a double major in\nDecisions Sciences and Information Systems.", "\n[ Applause ]\nMr. Nguyen was born in Saigon, Vietnam where\nhis father was a prisoner of war. ", "He then\nimmigrated to the United States with his family\nas participants in the Orderly Departure Program\nat age 7. ", "Even at that young age, Mr. Nguyen\nwas aware of the large differences between\nthe two cultures and he worked hard to overcome\ndifficulties in school, including the language\nbarrier, bullying, racism, and violence in\norder to fulfill his dream of higher education.", "\nMr. Nguyen considers knowledge and awareness\nto be the keys to success, which he delivers\nas the level of internal happiness the person\nachieves. ", "I'm sorry, which he defines as the\nlevel of internal happiness the person achieves.", "\nConsequently, he volunteers for two non-profit\norganizations in Oakland, the Vietnamese American\nCommunity Center of the East Bay, and the\nWong Vietnamese Language school, where he\nserves as lion dancer, vice principal, English\nas a second language teacher, and counselor.", "\nMr. Nguyen chose to study at San Francisco\nState because the values, courage, like of\na mind, equity, community, and resilience\nclosely align with his own. ", "Over the past\nyear he has helped many of his fellow students\nby serving as a tutor for the challenging\nDecisions Science 412 Operations Management\nCourse. ", "And I have to say, I used to think\nhe lived on the third floor of the business\nbuilding where the tutoring center is. ", "Mr.\nNguyen hopes his education will allow him\nto give back to the community. ", "He chose to\nmajor in Decision Sciences in order to learn\nthe quantitative skills that can support major\nbusiness decisions, which in turn greatly\nimpact stakeholders, locally and abroad. ", "Congratulations,\nDanh, on all you've achieved, we wish you\nall the best in the future.", "\n[ Applause ]\nIt is now my pleasure to introduce Dean Judith\nMunter who will present the faculty representative\nand the student from the Graduate College\nof Education.", "\n>> Thank you very much Dean Oubre. ", "The Graduate\nCollege of Education is the only college at\nSan Francisco State University that is primarily\na graduate school preparing students who already\nhave their Baccalaureate degrees as they become\nprofessional educators and service providers.", "\nThe Graduate College of Education offers one\nundergraduate degree, a Bachelor of Arts in\nCommunicative Disorders, within the Department\nof Special Education. ", "Representing the faculty\nfrom the Graduate College of Education's undergraduate\nprogram tonight is Dr. Betty Yu. ", "Please stand,\nDr. Yu.", "\n[ Applause ]\nThank you. ", "The following students from the\nDepartment of Special Education majoring in\nCommunicative Disorders is among those who\nare graduating with high academic honors.", "\nLisandra Gutierrez, Aimee Paredez. ", "Congratulations.", "\n[ Applause ]\nNow, I would like to present the student who\nhas been selected as our college's department\nhonoree, Shauna Reem [assumed spelling], Special\nEducation.", "\n[ Applause ]\nCongratulations. ", "I am proud to introduce Taylor\nFreeman, the undergraduate hood recipient\nfor the Graduate College of Education.", "\n[ Applause ]\nShe is graduating from the Communicative Disorders\nProgram with a Bachelor of Arts Degree. ", "Ms.\nFreeman exemplifies the very best that her\nfuture profession of speech language pathology\nhas to offer. ", "She has consistently excelled,\nboth in her academics, and in her service\nto the community. ", "As the elected president\nof the San Francisco State University Chapter\nof the National Student Speech, Language,\nHearing Association, Taylor has been a visionary\nleader, and a high effective organizer. ", "Ms.\nFreeman's passion for becoming a speech language\npathologist began when she worked in her grandmother's\nspecial day classroom located in a low socioeconomic\narea along the Sacramento Delta. ", "She watched\nmany specialists come into the classroom,\nbut she was most fascinated by the speech\nlanguage pathologist. ", "She says she did not\nknow it then, but her career choice was blossoming.", "\nDuring her first year, here in our college\nin the Communicative Disorders Program, Ms.\nFreeman was elected to be the President of\nthe National Student Speech Language Hearing\nAssociation. ", "And she has been a truly outstanding\nleader to her peers. ", "Her numerous volunteer\nexperiences have exposed her to people with\ncommunication difficulties and other challenges.", "\nAnd her outstanding performance in the rigorous\ncommunicative disorders courses has trained\nher to be a well-rounded individual and an\noutstanding future clinician. ", "This year alone\nshe has lead weekly mentoring sessions and\ncabinet meetings, planned two highly successful\nconferences, and facilitative two communicative\ndisorders program student orientations. ", "Ms.\nFreeman has been truly essential to the Communicative\nDisorders Program's capacity to provide high\nquality experiences for our students. ", "Even\nso, she has maintained a high grade point\naverage and also developed many professional\nrelationships. ", "We are delighted to know that\nshe will continue her educational journey\nhere at San Francisco State in the Communicative\nDisorder Master's program beginning in fall\nof 2016. ", "Congratulations, Taylor.", "\n[ Applause ]\n[ Applause ]\nI am now please to introduce my colleague\nDean Ken Monteiro, Dean of the College of\nEthnic Studies who will present the faculty\nrepresentatives and honors students from the\nCollege of Ethnic Studies. ", "Dean Monteiro.", "\n>> Thank you Dean Munter. ", "The Department Chairs\nand faculty from the College of Ethnic Studies\nin attendance tonight, Serie McDougal, Africana\nStudies, if you'd stand. ", "Andrew Jolivette,\nAmerican Indian Studies. ", "Eric Pido, Asian\nAmerican Studies. ", "Dorothy Tsuruta, Africana\nStudies. ", "I'd like to thank these very, very\ndedicated faculty.", "\n[ Applause ]\nThank you. ", "The following students from the\nCollege of Ethnic Studies are among those\ngraduating with high honors. ", "Fern Echevarria,\nLatino Latino studies. ", "Please stand. ", "Yeah.", "\nAsian American Studies, David Ka Wai Pan.", "\nIf we could congratulate those two.", "\n[ Applause ]\nThank you. ", "Departmental honors for the College\nof Ethnic Studies go to Richard Leonard Polote,\nAfricana Studies. ", "Lisa Gersher Hurr [assumed\nspelling], Asian American Studies.", "\n[ Applause ]\n[ Applause ]\nAnd Fern Echevarria, Latino Latino studies.", "\n[ Applause ]\nYou may now be seated. ", "It is truly my honor\ntonight to introduce this year's hood recipient\nfor the College of Ethnic Studies, Richard\nLeonard Polote, who is graduating with a Bachelor's\nDegree in Africana Studies.", "\n[ Applause ]\nA decorated US Air Force Veteran, Mr. Richard\nPolote is a dedicated young Africana Studies\nScholar. ", "We would like to recognize Mr. Polote\nin particular for his academic excellence\nand social responsibility. ", "He represents the\nhighest standards of commitment to scholastic\nmerit in Africana Studies, in addition to\nmaintaining excellent grades, Mr. Polote also\nserves as an ambassador between our campus\nand our local community. ", "Among his career\ngoals of teaching middle and high school students\nboth African and African American history.", "\nMr. Polote has dedicated his life to community\nservice. ", "He served as a youth mentor with\nthe Youth Justice Center in San Francisco.", "\nHe's currently a youth development coordinator\nresponsible for planning, coordinating and\ncarrying out educational and mentorship programs.", "\nHe consistently emerges as a group leader,\nand is among the highest scoring students\nin his classes. ", "For instance, in professor\nDawn-Elissa Fischer's Anthropology of Blackness\ncourse, Mr. Polote led a unit focused on linguistic\nresearch and theory. ", "Mr. Polote guided his\npeers through challenging terminology and\ncourse concepts using accessible models and\nmodes of communication. ", "In Professor Serie\nMcDougal's Research Methods class, Mr. Polote\nled his team in conducting an empirical, quantitative\nstudy on the relationships between racial\nidentity and academic achievement. ", "Mr. Polote\nengaged in a range of arts while studying\nat San Francisco State. ", "Notably he was cast\nas a voice actor for Dr. Trevor Getz's animated\nversion of the graphic novel \"Abina and the\nImportant Men.\" ", "Mr. Polote exemplifies the\nfounding philosophies of our discipline as\nwell as those of our university. ", "I want us\nto appreciate Mr. Polote.", "\n[ Applause ]\nI'd like to introduce my colleague, Dean Alvin\nAlverez who will present the faculty representatives\nand honor students for the College of Health\nand Social Sciences.", "\n[ Applause ]\n>> Thank you Dean Montero. ", "The Department\nChairs and faculty representatives here tonight\nfrom the College of Health and Social Sciences,\nand please stand as I call your name, are\nAlison Baroody, Child and Adolescent Development.", "\nConnie Ulasewicz, Consumer and Family Studies,\nDietetics. ", "Jose Ramon Fernandez-Pena, Health\nEducation. ", "Marie Veri, Kinesiology. ", "Elaine\nMussleman School of Nursing. ", "Carlos Davidson,\nPublic Affairs and Civic Engagement. ", "Eric\nRosegard, Chair, Recreation Parks and Tourism.", "\nJerald Shapiro School of Social Work. ", "And\nTrudie Coker, Sociology and Sexuality Studies.", "\nCan you join me in congratulating our colleagues.", "\n[ Applause ]\nThank you. ", "The following students from the\nCollege of Health and Social Sciences are\namong those graduating with high academic\nhonors. ", "In Child and Adolescent Development\nAlyssa Lauren Ross. ", "Please stand. ", "In Nursing,\nHelena Duhavits [assumed spelling]. ", "Also in\nNursing Briana Anne Fineberg. ", "Kathleen McFaul,\nHelen Lorenzen, and Julia Meinhold. ", "In Consumer\nFamily Studies and Dietetics, Kathryn Von\nRomenger [assumed spelling]. ", "Could you join\nme in congratulating these students?", "\n[ Applause ]\nThank you. ", "Our students here tonight who are\ngiven special recognition by their department\nare, and please stand as I call your name.", "\nAlyssa Lauren Ross, Child and Adolescent Development.", "\nColin Wong, Consumer and Family Studies, Dietetics.", "\nKayla Tolentino, Health Education. ", "Lenka Fejt,\nKinesiology. ", "Kathleen McFaul, School of Nursing.", "\nPatrick Su, Recreations Parks and Tourism.", "\nLatonia Williams, Social Work. ", "And Rosela\nDelgado, Sociology and Sexuality Studies.", "\nPlease join me in applauding them.", "\n[ Applause ]\nThank you. ", "I'm both delighted and honored\nto introduce this year's hood recipient for\nthe College of Health and Social Sciences,\nColin Wong. ", "Colin, would you please stand.", "\n[ Applause ]\nColin is a distinguished undergraduate student\nfrom the Consumer Family Studies and Dietetics\nDepartment. ", "He's also double majoring in family\nand consumer sciences and liberal studies,\nand graduating in an amazing three years.", "\nFour years ago, Colin lost his vision. ", "He\nwrote the transition from being able to see\ncompletely to nothing at all was devastating,\nheartbreaking, humbling, and yet a priceless\nlearning opportunity for me to grow as a person.", "\nAt age 17 I had to learn to walk again, learn\nhow to read, learn how to be a new person.", "\nAnd it was hard. ", "I realized I'm not the only\nperson going through life like this, my disability\nis only an obstacle if I made it an obstacle,\nand it gave me a new view on life. ", "Active\nboth on and off campus, he was a peer counselor\nin the SAFE place, which stands for Sexual\nAbuse Free Environment on campus. ", "He worked\nwith guide dogs for the blind for the past\ntwo years, and has spoken to over 120 students\nacross five different public schools about\nguide dogs. ", "As you'll see by his side, his\ngolden lab, named Wednesday, is his sweet\nand constant companion on campus. ", "He's also\nan athletic coach with Kids Enjoy Exercise\nNow, KEEN, a nonprofit organization providing\nopportunities to youth with disabilities to\nfoster independence and self-esteem through\nsports and recreation. ", "Colin's heart's desire\nis to teach children who struggle with their\ndisability. ", "To recognize that it doesn't have\nto stop them from achieving their goals. ", "He\nnot only models this value, but his genuine\ncare, compassion and desire for continued\ngrowth ensures that children encounter this\nmeaningful message as well. ", "After graduation,\nColin will be entering Louisiana Tech, the\ntop program in the country, to pursue a degree\nin industrial and organizational psychology\nwith a concentration in orientation and mobility.", "\nPlease join me in congratulating Colin and\nwishing him the best.", "\n[ Applause ]\nI am now please to introduce my dear colleague,\nSophie Clavier, the Associate Dean of the\nCollege of Liberal and Creative Arts, who\nwill present the faculty representatives and\nhonor students from the college [applause].", "\n>> Thank you Dean Alvarez. ", "I would like first\nto introduce the department chairs and faculty\nmembers representing the academic departments\nand programs for the College of Liberal and\nCreative Arts. ", "And please hold your applause\nuntil they are all standing. ", "And they are\nChristina Ruotolo, in American Studies Program.", "\nMario LaPlante, Art. ", "Joseph McBride, Cinema.", "\nAlexander Pappas, Classics. ", "Christina Sabee,\nCommunication Studies. ", "Shirin Khanmohamadi,\nComparative and World Literature. ", "Roy Conboy,\nCreative Writing. ", "Neil Lindeman, English Language\nand Literature. ", "Eva Sheppard Wolf in History.", "\nCarel Bertram in Humanities. ", "Kim Komenich\nin Journalism. ", "Marianna Ferreira in Liberal\nStudies. ", "Bradley Stirling Hogarth in Music,\nsaw him earlier. ", "James Martel in Political\nScience. ", "Todd Roehrman, Theater and Dance.", "\nAnd Deb Cohler, Women and Gender Studies.", "\nPlease help me thank our dedicated faculty.", "\n[ Applause ]\nAnd be seated. ", "And now those students accorded\nhigh academic honors from the College of Liberal\nand Creative Arts. ", "And let's hold our applause\nuntil they're all standing. ", "In Broadcast and\nElectronic Communication Arts, Julianne Herrera.", "\nIn Cinema, Sara Gonzalez. ", "In Communication\nStudies, Jakob Ohrner [cheering]. ", "In creative\nwriting, Nicholas John Anthony Urbonas and\nAnna Meier. ", "In Design and Industry, Remdell\nQuiambao. ", "In English Language and Literature,\nNina Mollard and Nicole Walker. ", "In Modern\nLanguages and literature, Rebecca Beardsley\nand Daniel Sullivan. ", "In Humanities, Margaret\nAndretich. ", "In International Relations, Noora\nLarson. ", "In Music, Dalton McLaughlin. ", "In Political\nScience, Trinity Faith Orman. ", "In Technical\nand Professional Writing, Jessica Morley.", "\nAnd in Theater and Dance, Liam Blaney and\n[cheering] and Isabella Tui Gadsby-Connick.", "\nPlease join me in congratulating our great\nstudents.", "\n[ Applause ]\nThe following students have been selected\nby their departments and programs to receive\nspecial recognition for excellence in their\nrespective field. ", "Again, kindly withhold your\napplause until I name all the students in\nthat category. ", "And they are, Paige Nichol\nThornton, American Studies Program. ", "Timothy\nCampbell in Anthropology. ", "Lance Kramer, Art.", "\nJulianne Herrera, Broadcast and Electronic\nCommunication Arts. ", "Kevin Lee Hunter in Classics.", "\nAliyah Khadijah Shaheed, Communication Studies.", "\nJessica Mejia, Comparative and World Literature.", "\nMalia Gabriel, Creative Writing. ", "Ricardo Baltazar,\nDesign and Industry. ", "Jessica Morley in English\nLanguage and Literature. ", "Erik Nobel in History.", "\nMargaret Andretich in Humanities. ", "Emma Marie\nChiang in Journalism. ", "Jamie Pannozzo Liberal\nStudies. ", "Delton McLaughlin, Music. ", "Nichole\nChang, Philosophy. ", "Trinity Faith Orman, Political\nScience. ", "Liam Blaney, Theater and Dance. ", "And\nfinally, [inaudible] Women and Gender Studies.", "\n[ Applause ]\nPlease sit down. ", "And now I'm really honored\nand humbled to introduce the undergraduate\nhood recipient for the College of Liberal\nand Creative Arts, Aliyah Khadijah Shaheed.", "\n[ Applause ]\nGraduating today with BA in Communication\nStudies and a minor in African Studies, Aliyah\nKhadijah Shaheed is an impressive and inspiring\nrepresentative of her undergraduate class\nat SFSU. ", "Not only is Aliyah an excellent student,\nbut also she works tirelessly to promote social\njustice by her words and in her deeds. ", "This\npast year, Aliyah joined the debate team for\nthe first time as a novice competitor, and\nyet she and her debate partner competed at\nthe open level throughout the year, and they\ndefeated, you know, Harvard A-tem at a high-profile\nnational tournament.", "\n[ Applause ]\nThey then went on to win first place at the\nDistrict 1 Regional Competition. ", "Aliyah won\nthird place at the National Debate Tournament.", "\nAnd she and her partner have made waves in\nthe debate community by challenging the normative\nframework that controls debate rules in order\nto highlight how those rules reproduce structures\nof power. ", "As such, she really embodies the\nSFSU spirit of true advocacy and she inspires\nmany. ", "She continues to push for people to\nconsider various identities, various standpoints,\nand perspectives, and is considered to be\na fierce, but also a compassionate participant\nin all competitions and discussions. ", "In addition\nto her coursework, Aliyah makes a difference\nin the community, working for the past three\nyears with high school students, in order\nto prepare them to be first-generation college\nstudents. ", "She also recent went with President\nWong to Washington DC to advocate for Project\nRebound, a program that supports former incarcerated\nindividuals in the pursuit of a CSU education\n[applause]. ", "We're very happy to see that Aliyah\nwill start an MA in Communication here at\nSF State in the fall. ", "She aspires to go to\nlaw school and to become a criminal defense\nattorney. ", "And finally, she asked me to mention\nhow much she loves her family and how grateful\nshe is for their support. ", "So I, and we wish\nthem, as well as Aliyah, the very, very best.", "\n[ Applause ]\nAnd now to present the faculty representatives\nand to honor outstanding students from the\nCollege of Science and Engineering and Special\nPrograms, I yield the podium to Dean Keith\nBowman.", "\n[ Applause ]\nThank you Dr. Clavier. ", "So the chairs and the\nfaculty of the College of Science and Engineering\nhere tonight are Carmen Domingo from Biology.", "\nJane Dewitt from Chemistry and Biochemistry.", "\nWilliam Hsu from Computer Science. ", "Mary Leech\nfrom Earth and Climate Sciences. ", "Tom Holton\nfrom Engineering. ", "Barbara Holzman from Geography\nand Environment. ", "David Ellis from Mathematics.", "\nStephen Kane from Physics and Astronomy. ", "And\nMargaret Lynch from Psychology. ", "Please give\nthese faculty your applause.", "\n[ Applause ]\nSo now I have the privilege to recognize students\nreceiving high academic honors from the college\nof Science and Engineering. ", "In Biochemistry,\nAdriana Garcia. ", "Sima Rantisi. ", "In biology,\nMinore Mon and Roxana Aghili. ", "In Biology with\na concentration in cell and molecular biology,\nChristopher Joseph Black. ", "In biology with\na concentration of physiology, Sarah Semaan.", "\nIn Biology with a concentration in zoology,\nShawn Lucas Denarie. ", "In Computer Engineering,\nRoseanne Damasco. ", "In Geology, Claire Christine\nZurkowski. ", "In Mathematics, Justin Fong. ", "In\nPhysics Andy Chan [assumed spelling]. ", "And\nin Psychology, Jennifer Chao, Anna Theresa\nGalloway, and Jackie Ip [assumed spelling].", "\nPlease give these students your applause.", "\n[ Applause ]\nPlease be seated. ", "The following students have\nbeen selected for special recognition as departmental\nhonorees. ", "Rebecca Blandino from Biology. ", "Adriana\nGarcia from Chemistry and Biochemistry, Marisa\nAbril from Computer Science. ", "Roseanne Damasco\nfrom Engineering. ", "Claire Christine Zurkowski\nfrom Geology. ", "Elizabeth Gasoigne from Geography\nand Environment. ", "Justin Fong from Mathematics.", "\nColin Orion Chandler from Physics and Astronomy.", "\nAnd Abby Ardo [assumed spelling], Special\nPrograms, Scientific Knowledge Applies to\nHealing [cheering]. ", "Please give these students\nyour applause.", "\n[ Applause ]\nPlease be seated. ", "So no I have the privilege\nto introduce and make her stand up again,\nAdriana Garcia. ", "She an undergraduate, hood\nrecipient for the College of Science and Engineering.", "\nShe's receiving her Bachelor of Science Degree\nin Biochemistry. ", "She'll receive this degree\nwith the honor of Summa Cum Laude. ", "She's a\nnative of central California. ", "She initially\nstudied graphic design in the Art Institute\nof San Francisco, however, she sought greater\nintellectual challenges, so she enrolled in\nscience courses at the City College of San\nFrancisco. ", "There she excelled in biology and\nchemistry, and she also qualified for participation\nin an NIH Bridges summer internship. ", "A program\njointly operated by the City College of San\nFrancisco, and San Francisco State. ", "She admits\nher first semester of research was intimidating,\nbut she drew upon her inner courage to continue.", "\nInitially she studied embryotic deformities\nin zebra fish that resulted from exposure\nto common drugs, such as Benadryl and Sudafed.", "\nLater, she teamed up with Chemistry professor\nRaymond Esquerra to study the structural interactions\nin binding of nitrates to important proteins,\nsuch as hemoglobin and myoglobin. ", "These studies\nwill help in the design of nitrate-based drugs\nto be used for cardiovascular disease. ", "Her\njourney has taken her from the study of art,\nto the art of applying advanced analytical\ntechniques, such as the application of magnetic\ncircular dichroism to examine biologically\nimportant proteins. ", "She will use these skills,\nand knowledge as she starts her doctoral studies\nthis summer at Stamford University [cheering].", "\nCongratulations Adriana.", "\n[ Applause ]\n>> It is now my pleasure to welcome President\nWong back to the podium for his closing remarks.", "\n[ Applause ]\n>> Wow. ", "Tonight, we have seen what makes this\nsuch an extraordinary university. ", "We are a\npublic heritage university where individuals\nestablish a higher education legacy for their\nfamilies and generations to follow, and where\ndeveloping the skills and talents of our citizens\nbuilds a legacy of success for our state,\nour nation and our world. ", "Our students are\nas talented and as exciting a group as you\nwill find anywhere, and their varied backgrounds,\ncultures and experiences make this a far richer\nuniversity. ", "I see in this honors convocation\nan exceptional opportunity to make a large\nuniversity a little bit smaller and a little\nmore personal. ", "We've heard a handful of individual\nstories tonight as our hood recipients were\nintroduced. ", "If we had the same opportunity\nto learn about each student on this stage,\nwe would be awed by their courage, their intellectual\nbreadth, their accomplishments, and their\nperseverance we would see in all of them.", "\nThis has been an evening of celebration and\nshared delight for the friends and family\nof our students. ", "I hope that you got a glimpse\nof how we make magic happen here at San Francisco\nState. ", "Let me ask you once again to celebrate\nthese outstanding students, soon to be graduates,\nwho have made this such an inspiring evening.", "\n[ Applause ]\nI'm going to make them remain standing for\na bit longer. ", "I had a reason for asking these\nstudent to stand, that reason is you. ", "The\nfriends and relatives, family members, children,\nand parents who are here tonight. ", "As you have\nheard, many of our honor students would not\nhave been successful without your steadfast\nsupport, therefore it seems only appropriate\nfor all of us here on stage, our honor students\nand our faculty seated in the audience to\nsalute you. ", "The families and friends who have\nguided and encouraged these students throughout\nthe years. ", "So will our honorees and faculties\nplease join me in a round of applause for\nour audience.", "\n[ Applause ]\nNow you can sit down. ", "This evening's celebration\ndoes not end with this ceremony. ", "Thanks to\nthe University Women's Association, which\nsponsored our first Honor's Convocation 36\nyears ago, and has participated in every year\nsince, we are all invited to a reception at\nJack Adams Hall at the Caesar Chavez Student\nCenter. ", "I look forward to seeing all of you\nthere. ", "I now ask that our guests remain seated\nuntil our honor students and faculty have\nleft the theater. ", "Students are reminded to\nstop by Knuth Hall to pick up their awards\ncertificate before going to the reception.", "\nOur 2016 Honors Convocation has come to a\nclose. ", "As you, our honored graduates as soon\nas you leave us, know that you go with our\nlove and certainly our confidence. ", "May tonight\nbe just a first taste of joys and honors to\ncome. ", "So will the members of the platform\nparty, the honorees and our university faculty\nplease rise, and will the platform party please\njoin me in exiting the stage.", "\n[ Applause ]\n" ]

{ "pile_set_name": "YoutubeSubtitles" }

[ 0, 0.0005039052658100277, 0, 0, 0, 0.00006103515625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0007119971520113919, 0.0007396449704142013, 0.0013149243918474686, 0.000055989473978891965, 0.00012624668602449185, 0.00021003990758244068, 0.00013520822065981613, 0, 0, 0, 0.00007257947452460445, 0.00011138338159946535, 0.0001234567901234568, 0.00006944444444444444, 0, 0.00003380205516495403, 0, 0, 0.00005653230821414438, 0, 0.0004938271604938272, 0.0005165289256198347, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00003265306122448979, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0001234567901234568, 0, 0, 0, 0.000016128772116578765, 0, 0.000054823058578438094, 0, 0, 0.001890359168241966, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0001451589490492089, 0.000064, 0, 0, 0, 0, 0, 0, 0, 0, 0.00023124060585038734, 0.00008656509695290859, 0, 0, 0.00009425959091337542, 0.0001417233560090703, 0, 0.00025195263290501383, 0, 0, 0, 0, 0.00002204148206925434, 0, 0, 0, 0, 0.00010850694444444444, 0.0008650519031141869, 0, 0, 0, 0.000027994736989445982, 0, 0.00004565376186997809, 0, 0.0006312334301224593, 0, 0, 0.00007730165683217811, 0.0011111111111111111, 0.00019290123456790122, 0, 0.0009053870529651426, 0.0008163265306122448, 0.0015432098765432098, 0.0032, 0.0030864197530864196, 0.0009053870529651426, 0.001953125, 0.00125, 0.003121748178980229, 0.002551020408163265, 0, 0, 0.00002712673611111111, 0, 0.000054323223177908555, 0.000562957402889848, 0.0004591368227731864, 0.0007119971520113919, 0.000732421875, 0.0013717421124828531, 0.0008163265306122448, 0, 0, 0, 0.002958579881656805, 0.0009182736455463728, 0.0016326530612244896, 0.001890359168241966, 0.0014814814814814814, 0.0003305785123966942, 0.0013850415512465374, 0.0003429355281207133, 0.0009765625, 0.0011890606420927466, 0, 0, 0, 0.00011573627560665098, 0.00011562030292519367, 0, 0.000014457343607685523, 0.00004627701420704336, 0, 0.000013417595835178253, 0.000040569597143900364, 0, 0, 0.000168662506324844, 0.000028596757127741712, 0, 0.00010756929255261931, 0.0007716049382716049, 0.000016259105098855357, 0.0001582215893358649, 0.00015662933667475918, 0.0022675736961451248, 0, 0.0000390625, 0.0015432098765432098, 0, 0.000037180249851279, 0, 0.00016232448664881097, 0.00009070294784580499, 0.00017146776406035664, 0, 0.00007352220370551907, 0.00005314061005420342, 0, 0, 0.00011197894795778393, 0, 0, 0, 0, 0.0001005985614405714, 0, 0.00003302946228035408, 0.001736111111111111, 0.000058219643307652, 0.00510204081632653, 0.0013717421124828531, 0.00019837333862328903, 0.0005408328826392645, 0.0008163265306122448, 0.0016326530612244896, 0, 0, 0.00009425959091337542, 0.00125, 0, 0, 0.0011337868480725624, 0, 0, 0.00019223375624759708, 0.0005374899220639614, 0.0004081632653061224, 0, 0.00013705764644609522, 0.00023084025854108956, 0.00008734387282732115, 0.00004132231404958677, 0, 0.0003077870113881194, 0.00017777777777777779, 0, 0, 0.00004565376186997809, 0.0000573921028466483, 0.00005206164098292378, 0.000168662506324844, 0.00006103515625, 0.00009425959091337542, 0.0008163265306122448, 0.000124840048687619, 0.000594883997620464, 0.0000980296049406921, 0.0005745475438092502, 0.0004938271604938272, 0.0032, 0, 0.0006858710562414266, 0.0015378700499807767, 0.0006574621959237343, 0, 0, 0, 0.00006503642039542143, 0.0006377551020408163, 0, 0, 0.0006925207756232687, 0.001067995728017088, 0.0002903178980984178, 0, 0, 0, 0.0006858710562414266, 0.0007396449704142013, 0.0007716049382716049, 0.0016, 0.0008163265306122448, 0.0016224986479177934, 0.001953125, 0.00036982248520710064, 0, 0, 0.0001183431952662722, 0.0011111111111111111, 0.0001388888888888889, 0, 0.000625, 0, 0, 0, 0, 0.0000573921028466483, 0, 0, 0.000022675736961451248, 0.00015625, 0, 0, 0.00004950372515531794, 0.0002366863905325444, 0.00001826283877565929, 0.0012755102040816326, 0.00003419855682090216, 0, 0.0005555555555555556, 0.002066115702479339, 0.001890359168241966, 0.0023781212841854932, 0.000625, 0.0006611570247933884, 0.0022222222222222222, 0.00043402777777777775, 0.0011890606420927466, 0.0011111111111111111, 0.0012755102040816326, 0.0006925207756232687, 0.00036982248520710064, 0.0016326530612244896, 0.0027548209366391185, 0.0005668934240362812, 0, 0, 0.0002, 0, 0.0002366863905325444, 0.0013717421124828531, 0.00038446751249519417, 0.0004455335263978614, 0, 0.00021626297577854672, 0.00035555555555555557, 0.0008163265306122448, 0.0011337868480725624, 0.0011890606420927466, 0.0005408328826392645, 0.0006858710562414266, 0.00040562466197944835, 0, 0, 0, 0.0007558578987150415, 0, 0.0030864197530864196, 0.00048828125, 0.0011890606420927466, 0.00043402777777777775, 0.0012494793835901706, 0.0017301038062283738, 0.0006574621959237343, 0.00038446751249519417, 0.002066115702479339, 0.0008163265306122448, 0.0009182736455463728, 0.0009765625, 0.0014792899408284025, 0.0027434842249657062, 0.000625, 0.0029296875, 0, 0, 0.00012486992715920916, 0.0000980296049406921, 0.00006103515625, 0.000031245606086644065, 0, 0.0006155740227762388, 0, 0, 0, 0.00002475186257765897, 0.00008053907487449328, 0.0001, 0, 0, 0.00025195263290501383, 0.00004950372515531794, 0.0007304601899196494, 0.00021915406530791145, 0.0009876543209876543, 0.0015432098765432098, 0.0010330578512396695, 0.0011890606420927466, 0.0008680555555555555, 0.0011890606420927466, 0.0017006802721088435, 0.0015432098765432098, 0, 0.0000510204081632653, 0.0009182736455463728, 0.00510204081632653, 0.0011337868480725624, 0.00012624668602449185, 0.0002777777777777778, 0.0002295684113865932, 0.001081665765278529, 0.000625, 0.0011890606420927466, 0.000594883997620464, 0.0004938271604938272, 0, 0, 0, 0.0020811654526534857, 0.0005668934240362812, 0.0008163265306122448, 0.001189767995240928, 0.0007689350249903883, 0.0011890606420927466, 0.0008329862557267804, 0.00009070294784580499, 0, 0, 0.00013840830449826988, 0.00015625, 0.0002366863905325444, 0.0002601456815816857, 0, 0.00004901480247034605, 0, 0.0001234567901234568, 0, 0.00011306461642828876, 0.00006104819755196727, 0, 0, 0.00006718624025799517, 0.0016, 0.00008573388203017832, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0000529623614151543, 0, 0, 0.00008264462809917355, 0, 0, 0, 0, 0 ]

[ "Enzymology of mitomycin C metabolic activation in tumour tissue. ", "Characterization of a novel mitochondrial reductase.", "\nIn this study, the enzymology of mitomycin C (MMC) bioactivation in two murine colon adenocarcinomas, MAC 16 and MAC 26, was examined. ", "Subcellular quinone reductase assessment via cytochrome c reduction confirmed a number of active enzymes. ", "MAC 16 exhibited 22-fold greater levels of cytosolic DT-diaphorase than MAC 26, while microsomal NADPH:cytochrome P-450 reductase levels were similar in both tumour types. ", "Metabolism of MMC by subcellular fractions isolated from both MAC 16 and MAC 26 was quantitated by monitoring the formation of the principle metabolite 2,7-diaminomitosene (2,7-DM) via high-performance liquid chromatography (HPLC). ", "In MAC 16 only, activity displaying the properties of cytosolic DT-diaphorase and microsomal NADPH:cytochrome P-450 reductase was detected and confirmed, using the enzyme inhibitors dicoumarol and cytochrome P-450 reductase antiserum, respectively. ", "The highest level of MMC metabolism was associated with the mitochondrial fraction from both tumours and was the sole enzyme activity detected in MAC 26. ", "The greatest mitochondrial drug metabolism was achieved in the presence of NADPH as cofactor and hypoxia (MAC 16-specific activity, 3.67 +/- 0.58 nmol/30 min/mg; MAC 26 specific-activity, 3.87 +/- 0.71 nmol/30 min/mg) and was unaffected by the addition of the inhibitors dicoumarol and cytochrome P-450 reductase antiserum. ", "NADH-dependent mitochondrial activity was only observed in MAC 16 at approximately 4-fold less than that seen with NADPH. ", "MAC 26 homogenate incubations displayed enhanced metabolism under hypoxia, presumably due to the presence of the identified mitochondrial enzyme. ", "MAC 16 homogenates showed no increase in metabolism under hypoxia, suggesting that other enzyme(s) may be predominant. ", "These data indicate the presence of a novel mitochondrial one-electron reductase capable of metabolising MMC in MAC 16 and MAC 26." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0.00010813148788927336, 0, 0.00010140616549486209, 0.00003715814506539833, 0.0000483863163497363, 0.000084331253162422, 0.000028577960676726108, 0.00013437248051599034, 0.00004691311690748733, 0.0000706164818868724, 0.0001775147928994083 ]

[ "A Brooklyn jury has begun deliberating the fate of an East Village man who, 23 years later, was nabbed by DNA evidence for the brutal stabbing death of teen Sunset Park beauty Lissette Torres.", "\n\nEdwin Alcaide, now 54, is accused of stabbing 19-year-old Torres in the face and neck 15 times on New Year’s Day in 1987 and leaving her to die in a Sunset Park parking lot.", "\n\nIn closing arguments Tuesday, prosecutor Nicole Itkin told jurors the week-long trial was a “case of common sense,” pointing to DNA evidence found under three of Torres’ fingernails linking Alcaide to the murder.", "\n\n“She fought back and she grabbed a piece of him under her nails,” Itkin said.", "\n\nAlcaide was said to have had scratches on his face the day of the murder.", "\n\n“What a coincidence, last person seen with her has scratches on his face and his DNA under her fingernails,” the prosecutor said.", "\n\nThe decades-old cold case was cracked in 2010 when DNA evidence was retested and matched to Alcaide, a registered sex offender with a lengthy rap sheet. ", "He was charged with second degree murder in 2012.", "\n\nDefense attorney Jesse Young said Torres, whose drug-dealing boyfriend was pals with Alcaide, was good friends with her accused murderer, and pointed to the possibility of other suspects during the trial.", "\n\n“The three of them together were the Three Musketeers. ", "No motive. ", "No reason for him to harm his friend Lisette,” said Young.", "\n\nAccording to testimony, Torres, was last seen getting into a cab with Alcaide early on New Year’s Day 1987, in hopes of finding her boyfriend who was taken to a local police precinct following a fight. ", "Her bloodied body was found hours later.", "\n\nTorres’ family and friends have kept vigil during the trial, which began last Wednesday." ]

{ "pile_set_name": "Pile-CC" }

[ 0.00002712673611111111, 0.00006530612244897959, 0.00004367193641366058, 0, 0, 0, 0, 0, 0.00007069469318503158, 0.0003077870113881194, 0, 0.00029726516052318666, 0.000024029219530949635, 0, 0 ]

[ "Piano Sonata No. ", "2 (Mozart)\n\nWolfgang Amadeus Mozart's Piano Sonata No. ", "2 in F major, K 280 / 189e, (1774) is a piano sonata in three movements:\n\nAllegro assai\n\nThe first movement of the sonata is in sonata form, and consists of three themes of new material, a development, in which the themes from the exposition are varied and combined, and a recapitulation, in which the exposition is repeated and varied.", "\nThe sonata begins with the first theme of the exposition, which itself begins with a forte arpeggiated chord, followed by three thirds. ", "The theme next contains a series of falling quarter notes over block chords and Alberti bass, rapid sixteenth notes, and falling fifths. ", "The second theme consists of legato triplets in the right hand over octaves in the left. ", "The theme is somewhat chromatic, with frequent accidentals. ", "The third theme is mostly quarter and eighth notes with an irregular accompaniment. ", "The exposition ends with a C major chord. ", "The development and recapitulation follow, varying and combining these themes before restating them, as is normal in sonata form.", "\n\nAdagio\n\nThe second movement of the sonata is an adagio in F minor. ", "It is the only piano sonata by Mozart with a slow movement in a minor key. ", "While not marked as such, the movement is a siciliana. ", "The mood of this movement is mournful and tragic, with the opening somewhat resembling a funeral march. ", "Estonian composer Arvo Pärt's 1992 (rev. ", "2005) piece Mozart's Adagio reimagined the music from this movement in a work for violin, cello and piano.", "\n\nPresto\n\nThe sonata ends with a presto (sonata form) in F major. ", "It is relatively short for a presto, taking between two and three minutes to play.", "\n\nA typical performance takes about 14 minutes.", "\n\nThe work was written down along with other piano sonatas during the visit Mozart paid to Munich for the production of La finta giardiniera from late 1774 to the beginning of the following March.", "\n\nReferences\n\nExternal links\n\nRecording played by Harvard Fellow Seda Röder\n\nPiano Sonata 02\nCategory:Compositions in F major\nCategory:1774 compositions" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0034602076124567475, 0.0006611570247933884, 0.000008857709750566894, 0, 0.000053279343598486864, 0, 0, 0, 0, 0, 0, 0.00017777777777777779, 0, 0, 0.000594883997620464, 0.00008899964400142399, 0, 0, 0, 0.00002603082049146189, 0.000043282548476454294 ]

[ "Berry Hill RFC\n\nBerry Hill Rugby Football Club is a rugby union club located in Coleford, Gloucestershire. ", "The first XV currently plays in Gloucester Premier, an eighth tier league in the English rugby union system. ", "The club also operates two additional senior sides and a junior section.", "\n\nLeague history\nWhen the league system was established in 1987, Berry Hill was placed in South West 2. ", "It was a successful season for the club as not only did they win promotion but Berry Hill also reached the last 16 of the John Player Cup. ", "Four seasons later they were promoted to the national divisions and played in 1992–93 Courage National 4 South. ", "Reorganisation saw the club placed in Courage League Division 5 South for the following season. ", "They played in that division throughout that competition's three year history and were placed back National 4 South for the 1996-97 season. ", "However they were immediately relegated to South West 1 West and played in the South West divisions until relegation from South West 1 West in 2012. ", "Two years later they were relegated again, this time to local rugby.", "\n\nClub honours\nSouth West 2 champions 1987-88\nSouth West 1 champions 1991-92\nSouth West 1 play-off winners 2001-02\nTribute Western Counties North champions 2010–11\nGloucester 1 champions 2017-18\n\nReferences\n\nExternal links\nwww.berryhillrfc.co.uk/\n\nCategory:English rugby union teams\nCategory:Rugby union in Gloucestershire" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0001746877456546423, 0.00016833599865331202, 0, 0.00009245562130177516, 0.00005175715542673775, 0.00007971938775510203, 0.00010850694444444444, 0, 0, 0, 0.000009644689633887581 ]

[ "Bérenkuy\n\nBérenkuy is a village in the Sanaba Department of Banwa Province in western Burkina Faso. ", "As of 2005 it had a population of 435.", "\n\nReferences\n\nCategory:Populated places in the Boucle du Mouhoun Region\nCategory:Banwa Province" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0001, 0, 0 ]

[ "Q:\n\nSearch parent-child relationship until parent meets a condition\n\nMy table looks like this:\nChildPart ParentPart Quantity ChildType\n--------------------------------------------------\na0001 b0001 1 Bought\na0002 b0002 1 Bought\na0003 b0003 1 Bought\na0004 b0004 1 Bought\na0005 x0000 1 Made\nb0001 c0001 1 Phantom\nb0002 c0002 1 Phantom\nb0003 x0000 1 External\nb0004 c0004 1 Phantom\nc0001 d0001 1 Phantom\nc0002 x0000 1 External\nc0004 d0004 1 Phantom\nd0001 x0000 1 Made\ne0004 x0000 1 External\nx0000 x0000 1 Made\n\nThis table encloses a child-parent relationship of 4 elements. ", "To give some extra detail, the ChildType specifies whether the part is bought, made or made by an external entity. ", "I am interested in getting only the bought parts that are related with a parent that are done externally. ", "However, the Phantom status should be ignored because it is a fake part made only to trace a minimal part transformation.", "\nA better illustration of the process of every part is the following:\npart a0001 -> b0001 -> c0001 -> d0001 -> x0000\ntype Bought - Phanto - Phanto - Made - Final Assembly (Made)\n\npart a0002 -> b0002 -> x0002 -> d0000\ntype Bought - Phanto - Extern - Final Assembly (Made)\n\npart a0003 -> b0001 -> x0000 \ntype Bought - Extern - Final Assembly (Made)\n\npart a0004 -> b0004 -> c0004 -> d0004 -> e0004 -> x0000\ntype Bought - Phanto - Phanto - Phanto - Extern - Final Assembly (Made)\n\npart a0005 -> x0000\ntype Bought - Final Assembly (Made)\n\nThe final output I am interested to have is a table that relates the bought parts (a set of parts provided at the beginning) and their parents as long as they are external, and bypassing any Phantom in the middle. ", "\nIf the part reaches a parent that is Made (anything else that is not External or Phantom), then it should return NULL or a flag indicating that this child does not have a Parent made externally.", "\nI mean something like this:\nChildPart ExternalParent\n-----------------------------\na0001 NULL\na0002 d0004 \na0003 c0004 \na0004 b0004 \na0005 NULL\n\nI been trying to use CTEs for this but without any luck yet...\nThis is my code. ", "I intend to pair every child with their top External processed parent and then select the MainChild and ExternalParent columns.", "\n DECLARE @BOM TABLE(\n ChildPart VARCHAR(20)\n ParentPart VARCHAR(20)\n Quantity DEC(9,2)\n ChildType VARCHAR(20)\n )\n INSERT INTO @BOM VALUES\n ('a0001','b0001',1,'Bought')\n ,('a0002','b0002',1,'Bought')\n ,('a0003','b0003',1,'Bought')\n ,('a0004','b0004',1,'Bought')\n ,('a0005','b0005',1,'Made')\n ,('b0001','c0001',1,'Phantom')\n ,('b0002','c0002',1,'Phantom')\n ,('b0003','c0003',1,'External')\n ,('b0004','c0004',1,'Phantom')\n ,('c0001','d0001',1,'Phantom')\n ,('c0002','d0002',1,'External')\n ,('c0004','d0004',1,'Phantom')\n ,('d0001','e0001',1,'Made')\n ,('e0004','f0004',1,'External')\n ;\n DECLARE @partsToLook TABLE (ChildPart VARCHAR (20)\n INSERT INTO @partsToLook VALUES ('a0001'),('a0002'),('a0003'),('a0004'),('a0005')\n\n ----\n ;WITH cte AS \n (\n SELECT \n MainPart = p.ChildPart --This is to track the Main Child part we are looking the parents.", "\n ,ChildPart\n ,ParentPart\n ,Quantity\n ,ChildType\n FROM @BOM b\n INNER JOIN @partsToLook p ON p.ChildPart=b.ChildPart\n\n UNION ALL\n\n SELECT \n MainPart = tb.", "ChildPart\n ,ChildPart\n ,ParentPart\n ,Quantity\n ,ChildType\n FROM cte tb\n INNER JOIN @BOM b ON b.ChildPart=tb.", "ParentPart\n )\n SELECT MainPart,ParentPart FROM cte\n\nA:\n\nYour expected result in the question doesn't quite match the sample data. ", "You'd better fix it to avoid confusion.", "\nI added an explicit StopRecursion flag in the recursive query, which is set when recursion reaches a row that is not a 'Bought', 'Phantom', 'External'. ", "\nThen ROW_NUMBER is used to pick only one row per StartPart and StopRecursion flag is used to determine whether ExternalParent should be set to NULL.", "\nSample data\nDECLARE @BOM TABLE(\n ChildPart VARCHAR(20)\n ,ParentPart VARCHAR(20)\n ,Quantity DEC(9,2)\n ,ChildType VARCHAR(20)\n);\n\nINSERT INTO @BOM (ChildPart,ParentPart,Quantity,ChildType) VALUES\n ('a0001','b0001',1,'Bought')\n,('a0002','b0002',1,'Bought')\n,('a0003','b0003',1,'Bought')\n,('a0004','b0004',1,'Bought')\n,('a0005','b0005',1,'Made')\n,('b0001','c0001',1,'Phantom')\n,('b0002','c0002',1,'Phantom')\n,('b0003','c0003',1,'External')\n,('b0004','c0004',1,'Phantom')\n,('c0001','d0001',1,'Phantom')\n,('c0002','d0002',1,'External')\n,('c0004','d0004',1,'Phantom')\n,('d0001','e0001',1,'Made')\n,('e0004','f0004',1,'External')\n;\n\nDECLARE @partsToLook TABLE (ChildPart VARCHAR (20));\nINSERT INTO @partsToLook (ChildPart) VALUES\n('a0001'),\n('a0002'),\n('a0003'),\n('a0004'),\n('a0005');\n\nQuery\nWITH\nCTE\nAS\n(\n SELECT\n B.ChildPart\n ,B.ParentPart\n ,B.ChildType\n ,1 AS Lvl\n ,B.ChildPart AS StartPart\n ,CASE WHEN B.ChildType NOT IN ('Bought', 'Phantom', 'External') \n THEN 1 ELSE 0 END AS StopRecursion\n FROM\n @BOM AS B\n INNER JOIN @partsToLook AS P ON P.ChildPart = B.ChildPart\n\n UNION ALL\n\n SELECT\n B.ChildPart\n ,B.ParentPart\n ,B.ChildType\n ,CTE.Lvl + 1 AS Lvl\n ,CTE.StartPart\n ,CASE WHEN B.ChildType NOT IN ('Bought', 'Phantom', 'External') \n THEN 1 ELSE 0 END AS StopRecursion\n FROM\n @BOM AS B\n INNER JOIN CTE ON CTE.ParentPart = B.ChildPart\n WHERE\n CTE.StopRecursion = 0\n)\n,CTE_RN\nAS\n(\n SELECT\n StartPart\n ,ParentPart\n ,StopRecursion\n ,ROW_NUMBER() OVER (PARTITION BY StartPart ORDER BY Lvl DESC) AS rn\n FROM CTE\n)\nSELECT\n StartPart AS ChildPart\n ,CASE WHEN StopRecursion = 1 THEN NULL ELSE ParentPart END AS ExternalParent\nFROM CTE_RN\nWHERE rn = 1\nORDER BY ChildPart;\n\nResult\n+-----------+----------------+\n| ChildPart | ExternalParent |\n+-----------+----------------+\n| a0001 | NULL |\n| a0002 | d0002 |\n| a0003 | c0003 |\n| a0004 | d0004 |\n| a0005 | NULL |\n+-----------+----------------+\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.000008790088296436938, 0.00007561436672967865, 0, 0.00006830134553650708, 0.0000017267548577931038, 0.000026298487836949376, 0, 0.000186000372000744, 0.000006775978253627124, 0.00008680555555555555, 0.00021773842357381332, 0.00005406574394463668, 0, 0.000042718612499466016, 0.0001351290482410702, 0.000006871429540790953 ]

[ "Standards of Practice for Home Inspectors – Published by the Oregon C.C.B., this document covers exactly what home inspectors in Oregon are required to inspect, what is optional, and what is not required. ", "This document is included with the Whole House inspection reports.", "\n\nAmerican Institute of Inspectors® Standards of Practice – Published by the American Institute of Inspectors®, this document covers exactly what A.I.I.™ home inspectors are required to inspect, what is optional, and what is not required during Whole House inspections. ", "This document includes a glossary of terms at the end.", "\n\nAmerican Institute of Inspectors® Code of Ethics – Published by the American Institute of Inspectors®, this document discusses the purpose of the association and the standards to which a member shall be held in order to maintain membership in the association.", "\n\nOregon Property Buyer Advisory – Published by the Oregon Real Estate Agency; this document covers a wide range of topics including home inspections, real estate documents and other useful information.", "\n\nOregon Construction Contractors Board (C.C.B.) Home Page – The Construction Contractors Board was created in 1971 as the Builders Board and is responsible for safeguarding the security and property of the citizens of Oregon by preventing and resolving construction contracting problems and by insuring contractors’ compliance with the law.", "\n\nEnergy Trust of Oregon, Inc. Home Energy Solutions – Schedule a FREE Home Energy Review and learn how you can save energy and money and create a more comfortable living environment. ", "Our Energy Advisor will come to your home, recommend energy-saving measures specific to your home and install FREE compact fluorescent light bulbs, faucet aerators and showerheads. ", "Cash incentives for home improvements.", "\n\nEnergy Trust of Oregon, Inc. Multifamily Home Energy Solutions – Take advantage of valuable cash incentives for energy efficient measures installed in your multifamily properties of five units or larger. ", "We also offer assistance with Oregon Department of Energy tax credits, available to any size rental property in Oregon. ", "Properties must be served by Portland General Electric, Pacific Power, NW Natural or Cascade Natural Gas to qualify for Energy Trust cash incentives.", "\n\nAvista Utilities Corporation Residential Energy Efficiency Rebates – Oregon Residential Customer Rebates for natural gas heating equipment, water heaters, chimney dampers, and programmable thermostats. ", "Avista Utilities will provide a free in home inspection to evaluate the cost and benefits associated with weatherizing your home. ", "This free analysis is available to qualified Oregon residential customers who use natural gas as their main source of heat. ", "Some equipment and weatherization measures qualify for Oregon State tax credits.", "\n\nDo I need a permit? – ", "Links to the Oregon Building Codes Division “Permits Protect” website. ", "This webside includes links to permit issues for structural, electrical, plumbing and mechanical repairs. ", "This covers who needs a permit and under what circumstances.", "\n\nKlamath County Clean Air Ordinance – A notice from the Klamath County Environmental Health Department summarizing some new requirements in regards to Woodstoves or Fireplace Inserts effective November 7, 2007.", "\n\nKlamath Falls International Airport – The Klamath Falls Airport offers commercial air service as well as full general aviation services and is home to the Oregon Air National Guard 173rd Fighter Wing.", "\n\nMerle West Medical Center – Merle West Medical Center is a community-owned regional healthcare center serving some 120,000 people in a 10,000-square-mile area in southcentral Oregon and northeastern California.", "\n\nKlamath County Libraries Home Page – The mission of the Klamath County Library is to provide “open and equal access and guidance to information resources, literature, and ideas for all county residents.” ", "The library welcomes everyone in the community to use and enjoy its facilities and services.", "\n\nKlamath City Schools Home Page – Elementary Schools: Conger, Fairview, Mills, Pelican, Roosevelt. ", "Junior High Schools: Ponderosa. ", "High Schools: Mazama, Klamath Union. ", "Klamath Falls City Schools is dedicated to students, families, and community working together to realize individual dignity and potential.", "\n\nTriad School Home Page – The Triad School is open to all students eligible for preschool through 12th grade who meet entry requirements. ", "It is a quality school with a Christian and technical emphasis. ", "Classrooms of the future, highly qualified staff, supportive curriculum and eager students are blended together for a happy and productive educational opportunity.", "\n\nHosanna Christian School Home Page – Hosanna Christian School (Pre K-12th grade) offers quality education and excellent programs. ", "Hosanna Christian School exists to partner with Christian parents, students, and local churches to educate the whole student (spirit, mind and body) integrating Christ as first in all things.", "\n\nTown of Lakeview Home Page – Town profile, town administration information, town planning and permit information, history and other related information.", "\n\nLake County Chamber of Commerce – The Lake County Chamber of Commerce wants to introduce you to this Land of Enchantment where the “Old West” is still alive in atmosphere, charisma, and attitude and a place where neighbors are still neighborly and our children are still considered to be our communities greatest assets.", "\n\nNorth Lake County Chamber of Commerce – North Lake County is a land of diversity and contrasts. ", "North Lake County includes the towns of Fort Rock, Christmas Valley, Silver Lake, Summer Lake and Paisley.", "\n\nSouthern Oregon Vacation Guide – Lakeview – Lake County is a land of stark beauty. ", "It is possible for one to enjoy, all in one day, the broad expanses of desert, sagebrush, and rim rocks; as well as the solitude of our mountain forests and crystal clear lakes and streams.", "\n\nLake County Airport – The Lake County Airport offers instruction, air taxi service, and courtesy cars.", "\n\nLake District Hospital – The mission is to care for our community with respect & compassion through excellence & teamwork.", "\n\nLake County Examiner – The Lake County Examiner was established in 1880, and is one of the oldest currently running weekly newspapers in America.", "\n\nLakeview School District #7 Home Page – Elementary Schools: Fremont-Hay, Union. ", "Junior High School: Daly Middle. ", "High Schools: Lakeview High. ", "Education and community service are valued with an emphasis on community involvement in schools.", "\n\nDrug Lab Cleanup Program Home Page – The Program is responsible for overseeing cleanup of illegal drug labs and licensing drug lab decontamination contractors and workers.", "\n\nLead Poisoning Prevention Program Home Page – Lead poisoning is a significant environmental health problem, yet it is entirely preventable. ", "The Lead Poisoning Prevention Programs were established to respond to concerns about lead and its effect on the health of Oregon’s citizens.", "\n\nOregon Department of Environmental Quality Asbestos Information – Asbestos is a naturally-occurring fibrous mineral that is very strong, heat-resistant and extremely durable. ", "Because of these properties, asbestos has been used to make a wide range of construction materials. ", "There is no known safe level of exposure to asbestos, so contact with any amount of asbestos should be avoided.", "\n\nEnvironmental Toxicology Program Home Page (Household Mold and Mildews) – Mold and mildew are simple, microscopic organisms that can grow virtually anywhere if they have adequate moisture, nutrients and appropriate temperatures. ", "Some molds produce true allergic sensitization and allergic reactions in susceptible people. ", "Some molds produce toxic by-products that could be harmful to skin, and poisonous if ingested or inhaled in quantity." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0.0002295684113865932, 0.0000411522633744856, 0, 0.0000293595220269814, 0.000024507401235173024, 0.000017199714484739553, 0.00002953686200378072, 0.000030524098775983637, 0, 0, 0.00006944444444444444, 0.00018017206432142696, 0, 0.0000591715976331361, 0, 0, 0, 0.00019837333862328903, 0, 0, 0.00002246131039284832, 0.000024507401235173024, 0, 0.00004712979545668771, 0, 0.0001, 0, 0.0007304601899196494, 0.00005250997689561017, 0.00005175715542673775, 0, 0, 0.0001721763085399449, 0.000027411529289219047, 0.000042165626581211, 0.000009644689633887581, 0, 0.00008899964400142399, 0, 0, 0, 0.00006503642039542143, 0, 0, 0.0009182736455463728, 0, 0, 0.000033412409368839586, 0, 0, 0, 0, 0, 0.00001874027848053822, 0, 0 ]

[ "1,4-Dioxane exposure induces kidney damage in mice by perturbing specific renal metabolic pathways: An integrated omics insight into the underlying mechanisms.", "\n1,4-Dioxane (dioxane), an industrial solvent widely detected in environmental and biological matrices, has potential nephrotoxicity. ", "However, the underlying mechanism by which dioxane induces kidney damage remains unclear. ", "In this study, we used an integrated approach, combining kidney transcriptomics and urine metabolomics, to explore the mechanism for the toxic effects of dioxane on the mouse kidney. ", "Transcriptomics profiling showed that exposure to 0.5 mg/L dioxane induced perturbations of multiple signaling pathways in kidneys, such as MAPK and Wnt, although no changes in oxidative stress indicators or anatomical pathology were observed. ", "Exposure to 500 mg/L dioxane significantly disrupted various metabolic pathways, concomitantly with observed renal tissue damage and stimulated oxidant defense system. ", "Urine metabolomic analysis using NMR indicated that exposure to dioxane gradually altered the metabolic profile of urine. ", "Within the full range of altered metabolites, the metabolic pathway containing glycine, serine and threonine was the most significantly altered pathway at the early stage of exposure (3 weeks) in both 0.5 and 500 mg/L dioxane-treated groups. ", "However, with prolonged exposure (9 and 12 weeks), the level of taurine significantly decreased after treatment of 0.5 mg/L dioxane, while exposure to 500 mg/L dioxane significantly increased glutathione levels in urine and decreased arginine metabolism. ", "Furthermore, integrated omics analysis showed that 500 mg/L dioxane exposure induced arginine deficiency by perturbing several genes involved in renal arginine metabolism. ", "Shortage of arginine coupled with increased oxidative stress could lead to renal dysfunction. ", "These findings offer novel insights into the toxicity of dioxane." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0.000016796560064498793, 0, 0.00006718624025799517, 0, 0, 0, 0, 0 ]

[ "034\nSuppose -362829 + 130506 = -7*p. ", "Let u = p + -21739. ", "Round u to the nearest one thousand.", "\n11000\nLet b = -196.66 - -199. ", "Let g = -0.44 + b. Let o = g - 1.82. ", "What is o rounded to one dp?", "\n0.1\nLet l = 103.25 + -0.25. ", "Let z = 864359 - 864461.9951. ", "Let a = l + z. Round a to three dps.", "\n0.005\nLet h = 530.3345574 - -1.1981426. ", "Let s = h + -531. ", "What is s rounded to two decimal places?", "\n0.53\nLet t = -2064.285 + -82.665. ", "What is t rounded to the nearest 100?", "\n-2100\nLet n = 574268634.0000122 - 574268723. ", "Let c = -133 + 44. ", "Let o = c - n. Round o to six decimal places.", "\n-0.000012\nLet l be (-1)/((0 - 3)/66). ", "Suppose -l = 3*x - x. Let y be 2820001/3 - x/(-33). ", "What is y rounded to the nearest 100000?", "\n900000\nLet q be -1*(1/(-2))/((-2)/(-8)). ", "Suppose -q*l = -12*l + 5*l. ", "Suppose 2*b + 0*a - 5*a - 58000000 = 0, 2*a = l. Round b to the nearest 1000000.", "\n29000000\nSuppose 29786798 = 4*w - t, 8*t = w + 10*t - 7446704. ", "What is w rounded to the nearest one million?", "\n7000000\nLet b(n) = 4*n + 27. ", "Let t be b(-8). ", "Let m(u) = u**3 + 6*u**2 + 4*u + 3. ", "Let k be m(t). ", "Suppose 2*d + d = -5*r - 1871, 0 = 4*r - k. Round d to the nearest 100.", "\n-600\nSuppose 80*k - 162*k + 86*k = -10122000. ", "What is k rounded to the nearest 100000?", "\n-2500000\nSuppose 26*n - 132*n = 3338894000. ", "Round n to the nearest one million.", "\n-31000000\nLet o = -1999476 - -1999475.179943. ", "Let s = 79 - 79.82. ", "Let u = o - s. What is u rounded to 5 dps?", "\n-0.00006\nLet n = 2928.87 - 3027. ", "Let u = n + 100. ", "Let p = u - 5.71. ", "Round p to the nearest integer.", "\n-4\nLet u be (11 + -4 + 0)*4/(-14). ", "Let h be u*2/4*306460/22. ", "What is h rounded to the nearest 1000?", "\n-14000\nLet b = 5508.38587 - -91.33313. ", "Let u = 5602 - b. Round u to 1 dp.", "\n2.3\nLet j = -20 + 19.91. ", "Let l = -0.08999517 - j. What is l rounded to 6 decimal places?", "\n0.000005\nLet b(m) be the second derivative of 505*m**3/2 + 40*m**2 + 99*m - 2. ", "Let d be b(-32). ", "What is d rounded to the nearest 10000?", "\n-50000\nLet q = -0.31 + 223.31. ", "Let b = q + -222.999484. ", "What is b rounded to 4 dps?", "\n0.0005\nLet r = 0.1101 - -4.8999. ", "Let z = -5.0553 + r. Round z to two dps.", "\n-0.05\nLet c = -5227.5 - -6132. ", "Round c to the nearest ten.", "\n900\nLet k be (3 - 2)/(4 + (-43224201)/10806051). ", "Suppose -2256983 = 9*d + k. What is d rounded to the nearest one hundred thousand?", "\n-700000\nLet b = 0.0187 + -1.6737. ", "Let l = b + -0.9. ", "Round l to 1 decimal place.", "\n-2.6\nLet g = -18.3685 - -118.9195. ", "Round g to the nearest 10.", "\n100\nLet f = 1.97 + -2.127. ", "Let s = f + 0.15677. ", "What is s rounded to 5 dps?", "\n-0.00023\nLet f = -54086.964809 - -54087. ", "Round f to three decimal places.", "\n0.035\nLet t = 180.999981581 - 181. ", "What is t rounded to six decimal places?", "\n-0.000018\nLet z = -0.06567 + 0.0663506. ", "Round z to 5 decimal places.", "\n0.00068\nLet u = 0.4089 + 1875.5911. ", "Let j = 1875.96697 - u. What is j rounded to 3 decimal places?", "\n-0.033\nLet n = -458 + -26. ", "Let w = n + 744. ", "Let o = w + -260.000133. ", "What is o rounded to 5 decimal places?", "\n-0.00013\nLet t = 87 - 98.7. ", "Let h = 85.9 + -80. ", "Let a = h + t. Round a to zero dps.", "\n-6\nLet n = -143381 - -143239.062. ", "What is n rounded to zero dps?", "\n-142\nLet q = -0.413 - -2268.413. ", "Let j = -2161.7 + q. Let n = j + -110.91. ", "Round n to zero dps.", "\n-5\nSuppose 184*d = 302*d - 9950350. ", "What is d rounded to the nearest one thousand?", "\n84000\nLet y = -0.0022 - -288.0022. ", "Let d = y + -288.0572. ", "Round d to three dps.", "\n-0.057\nLet y = -35.649 + 35.665099. ", "Round y to three dps.", "\n0.016\nLet q(d) = -2*d**2 - 16*d - 4. ", "Let c(h) = -h**2 - 18*h - 1. ", "Let b be c(-21). ", "Let z = b + 53. ", "Let n be q(z). ", "Round n to the nearest 10.", "\n-70\nLet l = -1506452379.00000023 + 1506452365. ", "Let a = -0.04 - 13.96. ", "Let z = a - l. What is z rounded to 7 dps?", "\n0.0000002\nLet b = 3878908646.30998 + -3878870380. ", "Let z = 38266 - b. Let p = -0.31 - z. What is p rounded to five decimal places?", "\n-0.00002\nLet j = 218 + -318. ", "Let d = j - -98. ", "Let u = -2.0107 - d. Round u to two decimal places.", "\n-0.01\nLet g be ((-35377)/(-51))/(1/579). ", "Let k = -12633 + g. Round k to the nearest ten thousand.", "\n390000\nLet o = -12202 - -12202.7129. ", "What is o rounded to two decimal places?", "\n0.71\nSuppose 0 = 4*a + 7*j - 1957068, -a - 18*j + 489272 = -15*j. ", "Round a to the nearest ten thousand.", "\n490000\nLet y = -1.09 - -1.014. ", "Let b = 6.524 - y. Let m = -6 + b. Round m to one dp.", "\n0.6\nLet t = 194.878335 - 189.899. ", "Let w = t - 4.98. ", "Round w to five dps.", "\n-0.00067\nLet g = -171.96 - 1.04. ", "Let i = 174.192 + g. Let l = i + 0.238. ", "What is l rounded to 1 decimal place?", "\n1.4\nLet i = 1027 + -1027.1407. ", "Let d = i + -208.0593. ", "Round d to the nearest 10.", "\n-210\nLet a = -141541377736 - -141541379917.000007528. ", "Let j = a - 2181. ", "Round j to six decimal places.", "\n0.000008\nLet m = 3.317 - 3.3169567. ", "What is m rounded to five dps?", "\n0.00004\nLet h = -67.58 - -70. ", "Let b = -2.41999846 + h. Round b to 7 decimal places.", "\n0.0000015\nLet k = -21623 - -21623.000032185. ", "What is k rounded to seven dps?", "\n0.0000322\nLet t = 491 - 748. ", "Let l = 256.99999881 + t. Round l to 7 decimal places.", "\n-0.0000012\nLet z be ((-4)/(-8))/(1 - (-91703961)/(-91703958)). ", "Let c = 6733993 + z. What is c rounded to the nearest one million?", "\n-9000000\nLet i = 662.8 + -675.033. ", "What is i rounded to the nearest 10?", "\n-10\nLet h = 384.06 - 384.096273. ", "What is h rounded to three decimal places?", "\n-0.036\nLet j(n) = -788*n**3 - 3*n**2 - 8*n + 14. ", "Let q be j(-9). ", "Let z = q - 331295. ", "Round z to the nearest ten thousand.", "\n240000\nLet p = -1976674 + 796274. ", "What is p rounded to the nearest 1000000?", "\n-1000000\nLet a = 65274 - 65273.970247. ", "Round a to three dps.", "\n0.03\nLet r(d) = -519511*d - 46. ", "Let n be r(-6). ", "Let a = n + -1637020. ", "What is a rounded to the nearest one hundred thousand?", "\n1500000\nLet t = 5593 + -5597.58. ", "What is t rounded to 0 decimal places?", "\n-5\nLet o = -1453.007075 - -1453. ", "What is o rounded to 4 dps?", "\n-0.0071\nLet z(g) = -3*g**3 - 19*g**2 - 22*g - 6. ", "Let r be z(-11). ", "What is r rounded to the nearest 1000?", "\n2000\nLet i = 39.8 + -363.8. ", "Let f = -295.1 - i. Let v = -28.900334 + f. What is v rounded to 5 decimal places?", "\n-0.00033\nLet a = -131.6 + -1511.4. ", "Let l = -1730.86 - a. Let h = l - -90. ", "What is h rounded to 1 decimal place?", "\n2.1\nLet p = 1687 - 1686.99999933626. ", "What is p rounded to 7 dps?", "\n0.0000007\nLet r = -446.0074853 - -446.01. ", "What is r rounded to 5 dps?", "\n0.00251\nSuppose 7*i - 3*i + 4*x = 3729180, -2*i = -2*x - 1864610. ", "What is i rounded to the nearest one hundred thousand?", "\n900000\nLet k = 658 - 658. ", "Suppose -z + 5*z = -3*s + 32490020, 3*s + 3*z - 32490015 = k. Round s to the nearest 1000000.", "\n11000000\nLet k = -604.8 + 609.5528. ", "Round k to 1 decimal place.", "\n4.8\nLet h(n) = -1893*n + 6. ", "Let o(p) = 1894*p - 6. ", "Let d be 7 + 20/(-1 + -3). ", "Let a(z) = d*h(z) + 3*o(z). ", "Let b be a(1). ", "Round b to the nearest 1000.", "\n2000\nLet m = 7906.9999989413 + -7907. ", "Round m to 7 dps.", "\n-0.0000011\nLet l = -67177822 + 67177464.99781. ", "Let j = 357 + l. What is j rounded to 4 decimal places?", "\n-0.0022\nLet v(p) be the third derivative of 2*p**5/3 + 13*p**3/6 - 7*p**2. ", "Let t(a) be the first derivative of v(a). ", "Let o be t(5). ", "Round o to the nearest one hundred.", "\n400\nLet d = 350171 - 365400.7. ", "Round d to the nearest 100.", "\n-15200\nLet b be 10 + (-1 + -1)*1. ", "Let d(t) = 118*t**3 - 7*t**2 + 4*t. ", "Let g be d(b). ", "Suppose 35*o - 29*o - g = 0. ", "Round o to the nearest 100000.", "\n0\nLet d = 11.62758 + -11.464. ", "Round d to three decimal places.", "\n0.164\nLet i = -5621.000004774 + 5621. ", "Round i to six decimal places.", "\n-0.000005\nLet m(v) = -2798*v**3 - 12*v**2 - 34*v - 66. ", "Let c be m(-4). ", "Round c to the nearest 1000.", "\n179000\nLet b = -312771021629 + 312771017338.999993958. ", "Let q = 4290 + b. What is q rounded to 6 decimal places?", "\n-0.000006\nLet p = 561 - 594. ", "Let s be -26 - p - 4827*2341. ", "Round s to the nearest one million.", "\n-11000000\nLet h = -198 - -198.537. ", "Let m = -0.28 + h. Let k = m + -0.12. ", "What is k rounded to 2 dps?", "\n0.14\nLet u = 12040.00615 + -12040. ", "What is u rounded to one dp?", "\n0\nLet j = 840902.1186 - 840922.118599604. ", "Let x = j + 20. ", "Round x to seven dps.", "\n0.0000004\nLet c = 2.876 - 2.87142. ", "Round c to 2 decimal places.", "\n0\nLet r = 0.2192390627 + -0.21924. ", "Round r to seven decimal places.", "\n-0.0000009\nLet n = -118 - -50. ", "Let d be 9900*1/(6/n). ", "Round d to the nearest ten thousand.", "\n-110000\nLet u = 37 - 37. ", "Suppose -5*p - p + 9756000 = u. Suppose 0 = 16*x - 10*x + p. Round x to the nearest 10000.", "\n-270000\nLet u be -6*(5 + (-16379961)/(-9))." ]

{ "pile_set_name": "DM Mathematics" }

[ 0, 0, 0, 0, 0, 0, 0, 0.0011111111111111111, 0, 0.000594883997620464, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0007716049382716049, 0, 0, 0, 0, 0, 0, 0, 0, 0.0044444444444444444, 0, 0.00043402777777777775, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0004725897920604915, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0004, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0008650519031141869, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0008163265306122448, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0005408328826392645, 0, 0, 0, 0, 0.0007716049382716049, 0, 0, 0, 0, 0, 0.0001234567901234568, 0.0005165289256198347 ]

[ "Q:\n\nSetting the Starting Position to Begin Regular Expression Searching\n\nI had a previous post where I used a regular expression to pull requirements from an html document. ", "My original assumptions were that a user would enter a set of requirements in their document and that each requirement would be in a single sentence. ", "The regular expression I was using was: (?'", "Requirement'<requirement>.*\\n?.*</requirement>) I've since found out that there are multiple ways authors are entering requirements in their documents. ", "Some are using unordered lists, some are artificially carriage returns/line breaks, etc for formatting. ", "Here is an example:\n<requirement>A Report contains ratings of the following information elements as defined in \n<a href=\"Criteria.html\">Criteria</a>\n\n</span> \n<ul>\n <li><span class=\"style2\">Overall</span></li>\n <li><span class=\"style2\">Technical</span></li>\n <li><span class=\"style2\">Cost</span></li>\n <li><span class=\"style2\">Schedule</span></li>\n <li><span class=\"style2\">Customer/Quality</span></li>\n <li><span class=\"style2\">Supplier</span></li>\n <li><span class=\"style2\">Staffing</span></li>\n <li><span class=\"style2\">Performance</span></li>\n</ul></requirement>\n\n<requirement>\nIf the owner deviates from the criteria used in\n<a href=\"Criteria.html\">Criteria</a>, the specific rationale shall be documented on the \nReport and color coded as Override (e.g., RO equals Red Override, \nYO equals Yellow Override).", "\n</requirement>\n\n <requirement>\n The justification is specifically documented as a “Override” in the Enhanced Report under the Other Tab and Report Comments.", "\n </requirement>\n\n <requirement>\n This comment will be broken down as a Red, Yellow, Green (RYG) Override for each category that is overridden, \n i.e., RYG Cost Override.", "\n </requirement>\n\nI've tried changing the regular expression which will match any requirement with up to 3 lines:\n(?'", "Requirement'<requirement>.*\\s?.*\\s?.*\\s?.*</requirement>)\n\nHowever changing it to the following results in 2 of the requirements to be matched as 1 requirement.", "\n(?'", "Requirement'<requirement>.*\\s?.*\\s?.*\\s?.*\\s?.*</requirement>)\n\nI know I can get the index of a match, so I thought I would create a routine that would use the following to get a starting position:\nDim matchesreq As MatchCollection = Regex.", "Matches(stringReader, \"(?'", "Requirement'<requirement>)\")\nFor Each matchreq As Match In matchesreq\n start_position = matchreq.index\n\nI thought I would then try to pass the index value into a regular expression to find the ending <\\requirement> tag. ", "I could then use both indexes to parse the strings to extract the requirement.", "\nCan it be done and/or are there any thoughts/suggestions?", "\n\nA:\n\nI ended up using a combination of regular expressions and .net string matching.", "\nDim matchesreq As MatchCollection = Regex.", "Matches(stringReader, \"(?'", "Requirement'<requirement>)\") '.*\\n?.*c)\")\n For Each matchreq As Match In matchesreq\n startpos = matchreq.", "Index + 13\n endpos = stringReader.", "IndexOf(\"</requirement>\", startpos)\n reqstring = stringReader.", "Substring(startpos, endpos - startpos)\n reqstring = reqstring.", "Replace(vbCrLf, \" \")\n reqstring = reqstring.", "Replace(vbCr, \" \")\n reqstring = reqstring.", "Replace(vbLf, \" \")\n reqstring = reqstring.", "Replace(vbTab, \" \")\n reqstring = reqstring.", "Replace(\" \", \"\")\n Dim matchesbad As MatchCollection = Regex.", "Matches(reqstring, \"(?'", "baddata'<(?!l).*?", ">)\")\n For Each matchbad As Match In matchesbad\n Dim badgroups As GroupCollection = matchbad.", "Groups\n thebaddata = badgroups(\"baddata\").ToString\n reqstring = reqstring.", "Replace(thebaddata, \"\")\n Next\n matchesbad = Regex.", "Matches(reqstring, \"(?'", "baddata'<.*?", ">)\")\n For Each matchbad As Match In matchesbad\n Dim badgroups As GroupCollection = matchbad.", "Groups\n thebaddata = badgroups(\"baddata\").ToString\n reqstring = reqstring.", "Replace(thebaddata, vbLf)\n Next\n theRequirement = \"\"\"\" & reqstring.", "Trim & \"\"\"\"\n TempStr(0) = themfo\n TempStr(1) = thefunc_org\n TempStr(2) = thedisciplne\n TempStr(3) = oldTopicTitle\n TempStr(4) = theRevision\n TempStr(5) = thePageTitle\n TempStr(6) = theRelDate\n TempStr(7) = theRequirement\n TempNode = New ListViewItem(TempStr)\n lv1.Items.", "Add(TempNode)\n\n Next\n\nThe first thing I do is populate a match group with the starting requirement tag position. ", "I then use the index of that to do an indexof to get the position of the ending tag. ", "I then populate a string with the characters between the starting index and the ending index. ", "I then clean the tags EXCEPT the <li> tags from the string. ", "Lastly a replace the <li> tags with line feeds.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0, 0.0000045951183759932636, 0.000028596757127741712, 0.00001890359168241966, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.000168662506324844, 0, 0, 0, 0, 0, 0, 0, 0.00006298815822625346, 0.00007971938775510203, 0, 0, 0.006944444444444444, 0.00006298815822625346, 0.00007971938775510203, 0.00010628122010840684, 0.000017006802721088435, 0, 0, 0, 0, 0, 0 ]

[ "Products\n\nEvery once in a while I switch the TV channel from Fox to CNBC to see what the liberals are saying. ", "After listening awhile I get a deep sense of hopelessness and foreboding for our country. ", "The most important thing for the left is giving money to people. ", "They are happy to see the growth of food stamps, disability payments, housing subsidies, free healthcare and all the other welfare benefits. ", "They utterly fail to see the damage it is doing to the recipients. ", "Whole cities that once flourished have deteriorated into rotting eyesores populated with shambling hulks of chemically dependent drones. ", "These people are no longer employable. ", "They have become incompetent and helpless and the liberals can’t see that it’s their doing.", "\n\nWorld inventory will continue to shrink until the price increases dramatically. ", "It will be a big silver user, or group of users, who will panic and send the price soaring. ", "Remember, Ford Motor Company and their disaster in stockpiling palladium. ", "Ford panicked when palladium went into shortage, bought inventories which caused the price to soar, then lost big when the price collapsed. ", "My point is that the silver users will panic when the silver shortage becomes apparent. ", "As Ford said at the time, “What people were doing was protecting against a lack of material that would put us out of production.”", "\n\nOnly when the shortage scares them will they attempt to build silver inventories. ", "Then they will do anything to keep their production lines rolling. ", "The users drove palladium, at its peak, up to $1,100 oz. ", "from $60 ten years earlier, or almost 20 times, to keep those production lines running. ", "You do the math – what’s 20 times the price of silver? ", "Big investors and big users can’t buy real silver in size, and the latter are sure to panic, because they collectively hold maybe a week’s worth of silver inventory. ", "This isn’t rocket science. ", "This is a way for the little guy to make a big profit. ", "It’s simple. ", "Buy real silver, put it away and forget about it until commentators won’t stop talking about it on the evening news. ", "This coming silver event has been 60 years in the making. ", "It’s going to be big news. ", "Put silver to work for you and don’t miss out on this mind-boggling story." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0001652892561983471, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00018261504747991235, 0.0000510204081632653, 0, 0.00006009254251547383, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Q:\n\nAndroid Change Widget Background Image\n\nBeen struggling for the past two days to change the background of my widget, based on some if statements (removed right now just want to change the widget background from the class) here is my source below. ", "What's up though, I've changed images before fine such as backgrounds but can not get it to work for my widget thank you. ", "This is my most recent attempt by the way\n//Widget Provider Class\npublic class WidgetProvider extends AppWidgetProvider {\n\n public void onUpdate(Context context, AppWidgetManager appWidgetManager, int[] appWidgetIds) {\n final int N = appWidgetIds.length;\n\n for (int i=0; i<N; i++) {\n int appWidgetId = appWidgetIds[i];\n\n Intent intent = new Intent(context, com.widget.WidgetDialog.class);\n PendingIntent pendingIntent = PendingIntent.getActivity(context, 0, intent, 0);\n\n RemoteViews views = new RemoteViews(context.getPackageName(), R.layout.widget);\n views.setOnClickPendingIntent(R.id.widget, pendingIntent);\n\n appWidgetManager.updateAppWidget(appWidgetId, views);\n views.setImageViewBitmap(R.id.widget, ((BitmapDrawable)context.getResources().getDrawable(R.drawable.widget_background)).getBitmap());\n\n }\n }\n}\n\n//Widget Layout XML\n<?", "xml version=\"1.0\" encoding=\"utf-8\"?", ">\n<LinearLayout xmlns:android=\"http://schemas.android.com/apk/res/android\"\n android:orientation=\"vertical\"\n android:layout_width=\"fill_parent\"\n android:layout_height=\"fill_parent\"\n >\n <Button android:id=\"@+id/widget\"\n android:background=\"#00000000\"\n android:layout_width=\"fill_parent\"\n android:layout_height=\"fill_parent\">\n </Button>\n</LinearLayout>\n\nA:\n\nHere's a trick that you can do: use ImageView for you background, not \"background\" property of you View and set scaleType to \"fitXY\". ", "Like this:\n<?", "xml version=\"1.0\" encoding=\"utf-8\"?", ">\n<FrameLayout xmlns:android=\"http://schemas.android.com/apk/res/android\"\n android:layout_width=\"match_parent\"\n android:layout_height=\"match_parent\"> \n\n<ImageView\n android:id=\"@+id/backgroundImage\"\n android:layout_width=\"match_parent\"\n android:layout_height=\"match_parent\"\n android:src=\"@drawable/some_background\"\n android:scaleType=\"fitXY\"/>\n\n<RelativeLayout\n android:gravity=\"center\"\n android:layout_width=\"match_parent\"\n android:layout_height=\"match_parent\"> \n\n <Button\n android:text=\"some button\"\n android:layout_width=\"wrap_content\"\n android:layout_height=\"wrap_content\"/>\n\n <!-- ", "all your views -->\n\n</RelativeLayout>\n\n</FrameLayout>\n\nNow you can switch your ImageView source during runtime:\n//updating current widget\nAppWidgetManager appWidgetManager = AppWidgetManager.getInstance(context);\nRemoteViews views = new RemoteViews(getPackageName(), R.layout.widget_layout);\n\nviews.setImageViewResource(R.id.backgroundImage, R.drawable.some_other_background);\n\nappWidgetManager.updateAppWidget(widgetId, views);\n\nA:\n\nAnyone got any other ideas? ", "Really would like to get this figured out\nEdit: ended up setting up different layouts currently have 10 different layouts for 2 different widgets inefficient but working more of a hack around really\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0.000005658669081032141, 0.0008163265306122448, 0.000011267351721651343, 0, 0.0008163265306122448, 0.000004442065471602986, 0.00000937013924026911, 0 ]

[ "Q:\n\nGrapefruit-seed extract for disinfection?", "\n\nI was recommended grapefruit-seed extract by several people and did some research. ", "\nIt convinced me to a level I'm willing to try it but there was something that puzzled me:\nA \"Grapeseed-Extract-Guy\" (Robert Franz) does an interview and tells that, in contrast to Germany, in the US and in Brazil, grapefruit-seed extract is successfully used in the hospitals for disinfection:\nhttps://www.youtube.com/watch?v=iD-I_uqJ5Co&t=2s\n(Minute 1:00, in German)\nI looked into it and it seems grapefruit seeds really do have disinfection purposes. ", "But is it correct that it's used in hospitals? ", "And are there sources for that?", "\n\nA:\n\nIn summary, there is no reliable evidence to say that grapefruit-seed extract has any disinfection efficacy. ", "It was found out that some commercial products have been adulterated with artificial disinfectants.", "\nSome sources mention that grapefruit-seed extract has been used in hospitals in the United states; not to prevent/treat skin infections but to disinfect laundry and carpets. ", "\nAccording to Natural Medicines Comprehensive Database, there is insufficient evidence to say that grapefruit-seed extract is effective in prevention or treatment of infections or other skin conditions.", "\nThis review Grapefruit Seed Extract as an Antimicrobial Agent (ReliasMedia, 2009) provides summaries of various studies - I added the links:\n\nResearchers at a German Institute of Pharmacy tested six commercially\n available grapefruit seed extracts.10 Five of the six products showed\n strong antimicrobial activity against a range of bacteria, yeast, and\n other microbes. ", "However, further analysis of these five active samples\n found they contained between 1.25% and 10% benzethonium chloride. ", "The one sample which contained no benzethonium chloride also showed no\n antimicrobial activity. ", "The researchers made their own grapefruit seed\n extract and it had no antimicrobial activity. (", "Pharmazie, 1999)\nOf nine commercial grapefruit seed extract products purchased in the\n United States, seven contained benzethonium chloride (0.3-22%), three\n contained triclosan (0.01-1.13%). (", "Pharmazie, 2007)\nAnother investigation was conducted into grapefruit seed extracts used\n in farming as organic antimicrobial sprays.4 Nine products were\n tested, of which seven contained various synthetic chemicals, most\n commonly benzethonium chloride. (", "Journal of Agricultural and\n Food Chemistry, 2006)\nIn the most recent analysis published, 41 various products were\n purchased in Japan.12 These included food additives, cosmetics,\n dietary supplements, and disinfectant sprays. ", "All but three\n contained one or more synthetic antimicrobials. (", "Shokuhin\n Eiseigaku Zasshi. ", "2008)\n\nAccording to another review: The Adulteration of Commercial “Grapefruit Seed Extract” with Synthetic Antimicrobial and Disinfectant Compounds (American Botanical Council, 2012):\n\nA significant amount, and possibly a majority, of ingredients, dietary\n supplements and/or cosmetics labeled as or containing grapefruit seed\n extract (GFSE) is adulterated, and any observed antimicrobial activity\n is due to synthetic additives, not the grapefruit seed extract itself.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0.000009703273884608667, 0, 0, 0, 0, 0, 0.000024507401235173024, 0.000021333333333333335, 0, 0, 0, 0, 0, 0.00001890359168241966, 0, 0.0011890606420927466, 0.000013352561021203867, 0 ]

[ "Evaluation of oral care to prevent oral mucositis in estrogen receptor-positive metastatic breast cancer patients treated with everolimus (Oral Care-BC): randomized controlled phase III trial.", "\nThis is a randomized, multi-center, open-label, phase III study to evaluate the efficacy of professional oral care in preventing oral mucositis induced by everolimus in postmenopausal estrogen receptor-positive metastatic breast cancer. ", "Patients will be randomized into professional oral care and control groups (1:1 ratio). ", "All patients will receive everolimus with exemestane and will continue everolimus until disease progression. ", "In the professional oral care group, patients will receive teeth surface cleaning, scaling and tongue cleaning before starting everolimus, and will continue to receive professional oral care weekly from oral surgeons throughout the 8 week treatment. ", "In the control group, patients will brush their own teeth and gargle with 0.9% sodium chloride solution or water. ", "The primary endpoint is the incidence of all grades of oral mucositis. ", "Target accrual is 200 patients with a two-sided type I error rate of 5% and 80% power to detect 25% risk reduction." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.00005425347222222222, 0.0000353082409434362, 0, 0, 0, 0, 0, 0 ]

[ "Q:\n\nWP7 - Is it possible to automatically launch the camera capture without a button press?", "\n\nI'm using this code to grab barcodes from the camera:\nhttp://blogs.msdn.com/b/stephe/archive/2011/11/07/wp7-real-time-video-scan-a-barcode-qr-code-in-your-app-using-zxing-lib.aspx\nIt works fine if it is called from a button press, but if you put it in page load nothing happens, I assume this is a security feature?", "\nIs there any way around it?", "\nThanks\n\nA:\n\nAll must be Ok with Loaded event. ", "Maybe you put code inside constructor instead...\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0.00000995133795738837, 0, 0, 0 ]

[ "Q:\n\n\"Number\" divs with the Alphabet using jQuery .each()\n\nI use this to number divs that have the class \"number\":\n$(\"#parent .number\").each(function(i){\n $(this).html((i+1) + \". \");", "\n});\n\nbut how would I use something similar to instead \"number\" as a,b,c,d etc?", "\n\nA:\n\nUse string.fromCharCode:\n$(\"#parent .number\").each(function(i){\n $(this).html(String.fromCharCode(97 + i) + \". \");", "\n});\n\nAlso, if you would like to use capitalized characters, then use 65 instead of 97.", "\n\nA:\n\nYou can create an array of alphabet characters:\nvar alpha = [\"a\",\"b\",\"c\",....];\n\nthen use the index to print them:\n$(\"#parent .number\").each(function(i){\n $(this).html(alpha[i] + \". \");", "\n });\n\nJust so you know, you can use an ordered list to do this using html and css:\nThe html:\n<ol class=\"alpha\">\n <li>text ...</li>\n <li>text ...</li>\n <li>text ...</li>\n <li>text ...</li>\n</ol>\n\nthe css:\nol.alpha li {\n list-style-type:lower-alpha;\n}\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.00002953686200378072, 0, 0, 0, 0, 0.00001423994304022784 ]

[ "1. ", "Field of the Invention\nThis invention is directed to an interface between a flexible shaft and circuit interrupting device and more particularly to such an interface between a linearly moving rod of the flexible shaft and a rotary mechanism which interacts with the handle of the circuit breaker.", "\n2. ", "Description of the Prior Art\nMolded case circuit breakers are well known in the art. ", "Examples of such circuit breakers are disclosed in U.S. Pat. ", "No. ", "4,679,018, for instance. ", "Such circuit breakers are used to protect electrical circuitry from damaged due to an overcurrent condition. ", "Molded case circuit breakers include a pair of separable contacts, which may be operated either manually by way of a handle disposed on the outside of the case or automatically in response to an overcurrent condition.", "\nFor a variety of reasons, such as operator safety, for example, circuit interrupters are often mounted behind a panel cover or behind a door in a cabinet. ", "Typically, in these installations, the handles of the circuit interrupters are not directly accessible without opening the cover or door. ", "In some of these installations a remote handle mechanism is mounted on or near the opposite side or exterior of the panel or door and a mechanical linkage is used to interconnect the remote handle mechanism with the circuit interrupter handle. ", "Examples of such mechanisms can be found in U.S. Pat. ", "No. ", "5,493,084 assigned to the assignee of the present invention entitled \"Door Release for Circuit Interrupter Rotary Handle Mechanism\". ", "In this case there is a relatively ridged linkage between the circuit interrupter handle the remotely mounted handled. ", "Another example maybe found in U.S. Pat. ", "No. ", "5,422,453 which teaches an actuator for displacing the toggle or handle of a circuit interrupter, in particularly this includes a pair of space, abutment surfaces for bearing against the handle along an arcuate path coincident with the motion of the handle. ", "Still a third example may be found in U.S. Pat. ", "No. ", "5,428,196 entitled \"Flexible Shaft Interface for Circuit Interrupter\" also assigned to the same assignee as the present application. ", "Here is taught a interface between an flexible shaft and a circuit interrupting device and more particularly to an interface between a linearly movable rod of the flexible shaft and the handle of the circuit breaker. ", "Reference may also be made to Eaton publication SA12092 July 94-TLG1043 entitled, \"Flex Shaft.", "TM. ", "Flange Mounted Handle Mechanism\". ", "Still another example maybe found in a publication entitled, \"Westinghouse Series C.RTM. ", "M-Frame External Accessories\" 29-120M January, 1995. ", "In the latter three examples a flexible cable is provided between the external handle and the circuit breaker handle. ", "This is advantageous for allowing easy disposal of the circuit breaker on the inside of the cabinet. ", "Since there are no ridged interconnections between the external handle and the circuit breaker handle a broad range of locations is possible inside of the circuit breaker cabinet for placement of the circuit interrupter.", "\nReferring now to the drawings and FIG. ", "1 in particular, a prior art circuit interrupter system of the kind having a circuit interrupter disposed within a cabinet and a remote, exteriorly mounted operating handle with intermediate sheathed drive or two-piece cable is depicted. ", "In particular there is provided a cabinet 10 having a back wall 12 and front wall or door 14. ", "A remote operator handle 16 is provided on the front wall or door 14, which is interconnected by way of a sheathed, flexible cable 18 to a circuit breaker 20 mounted on the back wall 12. ", "A transfer mechanism 22 is provided on the generally flat front face of the circuit breaker or interrupter 20. ", "It includes a fixed base plate 24, which is attached to the front of the breaker 20 and sliding movable part 26, which is interconnected with the inner drive member of the cable 18. ", "The breaker handled is captured in the movable part 26, so that as the operating handle 16 on the front wall is actuated to either open or close the circuit breaker, the drive member of the cable 18 moves the movable part 26 of the transfer mechanism 22 to cause the breaker or circuit interrupter handle 28 to move to open or close the circuit breaker separable main contacts as required.", "\nAlthough the foregoing have many advantages, they do have certain disadvantages. ", "One disadvantage lays in the fact that all of the mechanisms taught for interconnecting a flexible cable between an external handle and the internal handle of the circuit breaker rely upon centrally locating the cable interface on the front of the circuit breaker. ", "Although this has the advantage of placing the longitudinally moving drive member of the cable immediately over the handle so as to reduce lateral torsion, it generally takes up significant cabinet space. ", "It would be advantageous, if a means could be found for mounting a significant portion of the interface on the side of the circuit breaker thus freeing up more space in front of the face of the circuit breaker. ", "But this will eliminate or greatly reduce the effect of sideways torsion on the handle which is usual for such an arrangement." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.000625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "El exactor de la serie juvenil BKN Luis Baeza fue detenido este martes tras ser acusado de robos por sorpresa en el metro de Santiago.", "\n\nEl joven de 21 años ya contaba con más de 35 detenciones anteriores por el mismo delito y operaba principalmente en la Línea 1, además era considerado como uno de los “lanzas” más importantes del lugar.", "\n\nEl hombre fue detenido por la Policía de Investigaciones en la jornada de ayer lunes, mientras intentaba reducir especies que había sustraído desde la estación La Moneda.", "\n\n“Tenía más de 35 detenciones por diversos delitos. ", "Dentro de su actuar se involucraba con las personas en los horarios punta del metro y realizaba ciertas acciones a fin de lograr sustraer diferentes especies. ", "El día de ayer tenía especies de personas extranjeras, inclusive”, afirmó a La Radio el subprefecto de la brigada de robos Gerson Sanhueza.", "\n\nBaeza que se hizo conocido en 2010 cuando interpretó al tierno “Albertito” en la serie de Mega. ", "Aseguró, mientras era llevado por Carabineros, que no se arrepentía de nada porque las víctimas no se daban cuenta de lo que él hacía hasta que llegaban a sus casas." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.00027845845399866335, 0.0000720876585928489, 0.00013520822065981613, 0, 0.00007911079466793244, 0.000207028621706951, 0.00031236984589754266, 0.00011019283746556473 ]

[ "[Transcranial color-coded duplex ultrasound in interventional therapy of cerebral aneurysms. ", "A pilot study].", "\nTo assess the diagnostic potential of transcranial colour-coded duplex sonography in the recognition of residual perfusion of coiled cerebral aneurysms. ", "10 patients (7 female, 3 male) with angiographically verified cerebral aneurysms (basilar artery n = 2, mean size 8.5 mm; supraclinoid internal cerebral artery n = 2, mean size 15.5 mm; posterior communicating artery n = 2, mean size 7 mm; anterior communicating artery n = 2, mean size 4.5 mm) were examined by TCCD using a 2.25 MHz probe immediately following embolisation and 12-24 hours prior to angiographic evaluation. ", "9 patients had a sufficient temporal bone window. ", "Transtemporal localization of the embolised aneurysms was feasible in 7 of the 9 cases. ", "One partially thrombosed aneurysm of the basilar artery (1 mm) and one completely thrombosed aneurysm of the anterior communicating artery could not be visualised. ", "In 7 cases no discrepancies between TCCD and angiography were evident, since rest, perfusion (n = 6) and complete thrombosis were unanimously diagnosed as such. ", "Mean size of the rest perfused lumina was 4.4 mm (minimum 1.5 mm; maximum 8 mm). ", "Platinum coils appeared as hyperechogenic lesions with an echogenicity comparable to the skull. ", "With TCCD residual perfusion of coiled aneurysms was feasible in most cases. ", "The method seems to be specific but not sensitive in the detection of incompletely coiled aneurysms. ", "Limitations are insufficient transtemporal bone windows and inaccessible aneurysm location, especially the anterior communicating artery." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0.000005536332179930795, 0, 0, 0, 0.000038578758535550326, 0, 0, 0.000168662506324844, 0, 0 ]