Datasets:

tomekkorbak

/

pii-pile-chunk3-1400000-1450000

like 0

[ "In vitro assessment of the effectiveness of powder disinfectant (Stalosan F) against Lawsonia intracellularis using two different assays.", "\nThe objective of this study was to determine the in vitro efficacy of Stalosan F, a mixed chemical and heavy metal disinfectant, against two strains of Lawsonia intracellularis using both a modified tissue culture and a direct count method. ", "For testing as a powder, 1g, 0.5g, or 0.25g of Stalosan F was applied to bacterial solutions spread into sterile dishes. ", "For use as an aqueous suspension, Stalosan F was prepared to final concentrations of 1%, 4%, 8%, 16%, and 32%. ", "In both applications, L. intracellularis was exposed to Stalosan F for 0.5h, 1h, 2h, and 4h. ", "The results showed that both strains were similar in their susceptibilities to Stalosan F. The modified tissue culture assay showed no detectable L. intracellularis in cell culture after exposure to all levels of Stalosan F powder for 0.5h. ", "Furthermore, the number of viable bacteria was markedly reduced in the aqueous concentration of 4% and no L. intracellularis was detected at concentrations of > or =8% for 0.5h. ", "Using the direct count method, detection of live bacteria was less than 1% after exposure to the powder for 0.5h. ", "After exposure to the aqueous form, the number of viable bacteria killed was over 99% in concentrations of > or =16% compared to controls. ", "Our results indicate that Stalosan F in both powder and suspension forms is able to inactivate over 99% of L. intracellularis after 30min of exposure. ", "Furthermore, both laboratory methods can be used to determine the effect of disinfectants on L. intracellularis viability." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.014598540145985401, 0.004132231404958678, 0, 0.009009009009009009, 0, 0.004149377593360996, 0, 0, 0, 0.013245033112582781, 0.00819672131147541 ]

[ "One form of powertrain transmissions utilizes a multiple clutch system to transmit torque from an input source, such as an engine or motor, to a gear box or other gear shifting mechanism, which in turn transfers torque and rotational speed to a drivetrain. ", "Such multi-clutch systems may be used in manual, an assisted manual or automatic transmissions. ", "One type of multi-clutch system is a dual clutch transmission such as those used in automotive applications. ", "Dual clutch transmissions typically are provided with a single torque input from the engine that is transferred by the clutch to one of a pair of shafts out of the clutch to the transmission gear box.", "\nThe torque input is transferred to the output shafts through a pair of selectively engageable, compressible sets of clutch friction elements, such as stacks of clutch disks. ", "One example of such a dual clutch system has a first and a second clutch friction element or clutch stack, and, where disk stacks are used, each stack has a set of driving disks and a set of driven disks. ", "The driving disks are operatively connected to the torque input, and the driven disks are operatively connected to one of the output shafts. ", "In the gear box, the output shafts provide torque to different gear sets, providing different gear ratios to the drivetrain.", "\nIn such a system, one of the clutch stack/output shafts can provide torque to the even numbered gear ratios in the transmission and the other shaft can provide torque to the odd numbered gear ratios and a reverse gear. ", "Other multi-clutch systems typically provide a similar arrangement of multiple clutch friction elements providing torque transfer to preselected output shafts/gear ratio combinations.", "\nBy selectively operating the clutch friction elements, the operator or operating system can frictionally engage the driving elements and the driven elements to transmit torque to preselected gear ratios. ", "The amount of torque transfer will depend on the degree to which the driving and driven friction elements are engaged, the engine speed and other related factors. ", "Because one set of friction elements is engaged while the other set(s) is inactive, additional gear ratios may be selected in the transmission and engaged to the output shaft(s) connected to the inactive clutch friction elements. ", "The gear shift is accomplished by disengaging the active set of friction elements and activating the selected inactive set that is already engaged with a new gear. ", "Thus, the time required to shift to the new, pre-selected gear ratio can be reduced, clutch engagement and disengagement interruptions can be reduced, and a smoother gear shift can be accomplished.", "\nIn “wet” clutch systems, a consistent flow of an oil, transmission fluid or other lubricating fluid, also is maintained through the clutch. ", "The lubricating fluid flows through supply channels and through the clutch friction elements providing lubrication to the friction elements, seals and other moving parts. ", "This fluid flow reduces friction wear on the friction elements and further serves an important role in cooling the clutch and the friction elements.", "\nMany multi-clutch systems position the sets of friction elements, e.g. clutch disk stacks, radially with respect to each other. ", "In other systems, the sets of clutch friction elements are positioned parallel to each other along the principal axis of rotation of the clutch mechanism. ", "Other arrangements also may be used depending on the number of sets of clutch friction elements, space concerns, efficiency concerns, etc.", "\nIn many multi-clutch systems, the clutch output shafts are concentrically arranged with respect to each other. ", "One example of such an arrangement in a dual clutch system uses a first inner clutch output shaft connected to one of the clutch disk stacks and positioned within a hollow second, outer clutch output shaft, that is connected to the other clutch disk stack. ", "The selective activation of either the first or the second clutch stacks allows for the torque input from, for example, an engine drive shaft to one of the inner or outer output shafts.", "\nIn such a system, each clutch stack can be hydraulically activated by radially extending annular pistons. ", "The pistons often extend from a location proximate a clutch support to the outer clutch plates of each of their clutch stacks. ", "The pistons together with an annular cylinder and/or inner walls of the clutch define a pressure chamber for each piston. ", "When a flow of fluid (typically transmission oil) is applied to the pressure chamber and thus to one of the pistons, the piston contacts the clutch stack with a force sufficient to compress and frictionally engage the discs of the clutch stack. ", "In such systems, accordingly, when one stack is engaged the other is inactive, and shifts are discrete events made as quickly as possible\nA microprocessor controller frequently is used to operate the clutch systems, and alone or in co-ordination with one or more other controllers such as those directing the selection of specific gear ratios in the transmission, engine controllers, etc. ", "For example, a microprocessor controller may be used to direct the application of pressure to the disk stacks, the supply of cooling and lubrication fluids to the disk stacks, and the shifting of gears in the gearbox, etc.", "\nThe overall performance of a transmission often is evaluated in several respects. ", "Some factors involve objective measurements, such as torque transfer efficiency, shift time, the clutch and/or gear endurance and durability, shift efficiency and duration, potential fuel savings, etc. ", "Other factors are more subjective, such as shift noise, shift busyness (i.e. number of shifts for a given time period/condition), shift timing, shift stiffness, etc. ", "In manual transmissions, many of these considerations are subject to the operator's direct control. ", "In automatic transmissions and partially automatic transmissions factors such as shift timing, shift busyness, etc. ", "are subject to the controller system, the gear ratios, and other mechanical or electromechanical systems in the transmission.", "\nThe balancing of these factors often results in compromises necessary to satisfy specific design criteria, cost considerations and criteria unrelated to the function and operation of the transmission. ", "For example, automatic transmissions can require a relatively broad range of gear ratios to provide adequate load bearing capacity at a vehicle start up using a first or second gear, and to provide high speed travel capabilities at a fourth, fifth or sixth gear.", "\nStandard manual transmissions, and some semi-manual transmissions, with a comparable range of gear ratios often require undesirable, rapid shifting at relatively low vehicle speeds, particularly when the vehicle is launched from a stop or near launch speeds. ", "This undesirable “shiftiness” also can be present in dual clutch transmissions with such a range of gear ratios. ", "Such undesirable “shiftiness,” in addition, can occur where a manual transmission is replaced by a dual clutch automated transmission or other automated transmissions.", "\nAccordingly, in many multi-clutch systems, the gear ratios necessary under heavy load conditions, such as towing a trailer, are unnecessary under no-load conditions, but nevertheless are used to satisfy the operational demands for the transmission. ", "For example, when the vehicle is launching, or starting from rest, the high ratio first gear often is needed only for a brief time, normally for seconds, and then the transmission typically is shifted to the next, higher gear ratios. ", "A similar shifting occurs when a vehicle under load (e.g. from cargo or towing a trailer) is traveling at a very slow speed and rapid acceleration is required.", "\nSuch conditions can produce an undesirable “busy” shifting routine, particularly if the transmission controller senses changing loads or speeds requiring shifting repeatedly between a first gear to a second or higher gear. ", "The resulting noise and vibrations induced due to such shifting operations is undesirable for many applications.", "\nOne approach to addressing this issue has been to use a higher gear (and lower gear ratio) for vehicle start up or launch conditions, and for similar conditions requiring greater torque transfer to a drive train. ", "This approach, however, is unsuitable for many applications, particularly those where the drive train load conditions and torque needs are variable, and where the vehicle/drive train loads may cause engine stalling or damage at those gear ratios.", "\nThe operating inefficiencies that result from the use of gear ratios that are not well matched to specific driving conditions, i.e. high gear ratios in first or second gears, also can result in undesirable losses in fuel economy, transmission and/or powertrain durability, etc. ", "For example, at start up and thereafter, unnecessarily high gear ratios will result in use of excessive engine speeds to achieve desired rates of speed or speed increases. ", "Similarly, the use of gear ratios that are too low for a particular load and vehicle condition will result in engine inefficiencies causing a reduction in fuel efficiencies and potential engine damage." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "dnl Process this file with autoconf to produce a configure script.", "\ndnl\ndnl Copyright 2018-2020 Japanese TeX Development Community <issue@texjp.org>\ndnl\ndnl This file is free software; the copyright holder\ndnl gives unlimited permission to copy and/or distribute it,\ndnl with or without modifications, as long as this notice is preserved.", "\ndnl\nAC_INIT([dviout-util (TeX Live)], [20200501], [tex-k@tug.org])\nAC_PREREQ([2.65])\nAC_CONFIG_SRCDIR([dvispc.c])\nAC_CONFIG_AUX_DIR([../../build-aux])\nAC_CONFIG_MACRO_DIR([../../m4])\n\ndnl Common code for all programs using libkpathsea.", "\nKPSE_COMMON([dviout-util])\n\nAC_CONFIG_HEADERS([config.h])\n\nm4_include([../../version.ac])[] dnl define tex_live_version\nAC_DEFINE([TL_VERSION], [\"TeX Live tex_live_version()\"],\n [Define to the current TeX Live version string.])", "\n\nKPSE_KPATHSEA_FLAGS\nKPSE_PTEXENC_FLAGS\n\nAC_CONFIG_FILES([Makefile])\n\nAC_OUTPUT\n" ]

{ "pile_set_name": "Github" }

[ 0, 0.007220216606498195, 0.00847457627118644, 0.004219409282700422, 0.012345679012345678 ]

[ "Princess Antonia of Luxembourg\n\nPrincess Antonia of Luxembourg (Antoinette Roberte Sophie Wilhelmine; 7 October 1899 – 31 July 1954) was a member of the Luxembourgish House of Nassau-Weilburg and the last Crown Princess of Bavaria as the wife of Crown Prince Rupprecht.", "\n\nFamily\n\nBorn at Schloss Hohenburg, at Lenggries in Upper Bavaria, Antonia was the fourth daughter of Guillaume IV, Grand Duke of Luxembourg, who reigned between 1905 and 1912, and Marie Anne, a princess of the Portuguese House of Braganza.", "\n\nShe was the younger sister of two successive grand duchesses: Marie-Adélaïde and Charlotte. ", " In the family she was called \"Toni\".", "\n\nMarriage and children\nAntonia became the second wife of Rupprecht, Crown Prince of Bavaria. ", " The two were engaged on 26 August 1918. ", " At the time, Rupprecht was Generalfeldmarschall in the Imperial German army, and had successfully commanded the German Sixth Army at the Battle of Lorraine. ", " \n\nThis led to criticism of the close ties between the Luxembourgian Grand Ducal Family and the royalty of the German Empire at a time when Luxembourg was occupied by Germany. ", "This added to the pressure already on Grand Duchess Marie-Adélaïde, who was forced to abdicate on 10 January 1919. ", "Despite the abdication of her elder sister, and the overthrow of the Kingdom of Bavaria in favour of a republic, the two were married on 7 April 1921 at Schloss Hohenburg.", "\n\nAntonia and Rupprecht had six children, through whom they have further descendants:\nPrince Heinrich Franz Wilhelm of Bavaria (28 March 1922–14 February 1958) he married Anne Marie de Lustrac on 31 July 1951.", "\nPrincess Irmingard Marie Josefa of Bavaria (29 May 1923–23 October 2010) she married Prince Ludwig of Bavaria on 20 July 1950. ", "They have three children, five grandchildren and four great-grandchildren.", "\nPrincess Editha Marie Gabrielle Anna of Bavaria (16 September 1924 – 4 May 2013) married Tito Tomasso Maria Brunetti on 12 November 1946. ", "They had three daughters, five grandchildren and four great-grandchildren. ", "She remarried Professor Gustav Christian Schimert on 29 December 1959. ", "They have three sons and six grandchildren.", "\nSerena Giovanna Brunetti (22 December 1947) married Vanni Pozzolini on 17 April 1971. ", "They have one son and one grandson. ", "She remarried Vieri Fiori in 1987. ", "They have one daughter and one granddaughter. ", "\nGiorgio Pozzolini (26 July 1972) he has an illegitimate son:\nCostantino Pozzolini (2010) \nBeatrice Fiori (11 April 1979) she has an illegitimate daughter:\nIsabella \nCarlotta Hilda Brunetti (10 June 1949) married Count Michael von Bucquoy de Longueval on 29 April 1972. ", "They have two children and two granddaughters:\nCount Nicholas von Bucquoy de Longueval (23 August 1976)\nCountess Flora von Buquoy, de Longueval (11 May 1979) married Axel Luis (Sito) Roever on 12 June 2010. ", "They have two daughters.", "\nAntonia Hilda Brunetti (10 June 1952) married Erich Franz George Winibald Graf von Waldburg zu Zeil und Trauchburg on 4 June 1982. ", "They have one daughter. ", "She remarried Cornelius Wiedemann on 15 April 1997. ", "\nCountess Maria Sophie Eleonore Editha Walburga von Waldburg zu Zeil und Trauchburg (2 May 1984)\nAndreas Heinrich Rupprecht Marius Schimert (26 May 1961) married Dorothee Gauer on 10 July 1993. ", "They have two sons:\nMaximilian Schimert (4 September 1993 – 18 June 1994)\nFerdinand Schimert (12 December 1996)\nChristian Philipp Gabriel Johannes Schimert (18 March 1963) married Leena Nehru on 23 November 1994. ", "They have three children.", "\nPhilipp Schimert (1 November 1996)\nSerena Schimert (23 March 1998)\nMaya Schimert (17 October 2000)\nConstantin Maximilian Ludwig Karl Schimert (30 May 1968) married Karina Frowein in 2011 and they have one daughter. ", "\nMarie-José Schimert (*2010)\nPrincess Hilda Hildegard Marie Gabriele of Bavaria (24 March 1926 – 5 May 2002) married Juan Bradstock Edgart Lockett de Loayza on 12 February 1949. ", "They had four children and four grandchildren:\nJuan Bradstock Christopher Henry Anthony Rupprecht Lockett de Baviera (10 April 1950) married Martha Katharina Herdt on 22 April 1991\nJuan Bradstock Miguel Maria Alexander Lockett von Wittelsbach (3 May 1953) he has two illegitimate sons by Elfriede Seidel:\nDavid Seidel (1977) \nRoman Seidel (1979)\nHenry Maria Alexander Lockett von Wittelsbach (11 April 1958)\nMarie Isabel Lockett von Wittelsbach (5 July 1960) married Jacob Rudolf von Saldern on 16 June 1986. ", "They have two daughters:\nCharlotte Juanita Akazie Nerina von Saldern (19 September 1986)\nHilaria Renata Hilda Giula von Saldern (17 December 1987)\nPrincess Gabriele Adelgunde Marie Theresia Antonia of Bavaria (10 May 1927 – 19 April 2019) married Karl Emmanuel Herzog von Croÿ, later 14th Duke of Croÿ on 17 June 1953. ", "They have three children and ten grandchildren:\nPrincess Marie-Thérèse of Croÿ (29 March 1954) married Count Stephan de Waldersdorff on 5 July 2002. ", "She has an illegitimate daughter:\nLaura Gabrielle Irmingard of Croÿ (25 March 1986)\nPrince Rudolf Carl Rupprecht of Croÿ, later 15th Duke of Croÿ (8 July 1955) married Alexandra Maria Margit Olga Serafimovna Miloradovich on 23 October 1987. ", "They have six children:\nPrince Carl Philipp Emanuel Rudolph Zdenko Seraphim Maria of Croÿ (18 August 1989)\nPrincess Xenia Maria Alexandra Antonia Agnes Gabrielle Camilla of Croÿ (26 December 1990)\nPrince Marc Emanuel Carl Rudolph Zdenko Seraphim Maria of Croÿ (6 April 1992)\nPrince Heinrich Carl Rupprecht Rudolph Zdenko Seraphim Maria of Croÿ (9 December 1993)\nPrince Alexander Carl Rudolf Rudolph Zdenko Seraphim Maria of Croÿ (9 March 1995)\nPrincess Anastasia of Croÿ (12 January 1998)\nPrince Stefan Clemens Philipp of Croÿ (17 May 1959) married Beatrice du Chastel de la Howarderie, Comtesse du Chastel de la Howarderie on 25 August 1990. ", "They have three children:\nPrincess Camile of Croÿ (6 February 1988)\nPrincess Charlotte Regine Gabrielle Sophie of Croÿ (22 December 1992)\nPrince Lionel Carl Francois Eric of Croÿ (3 January 1996)\nPrincess Sophie Marie Therese of Bavaria (born 1935) married Jean, 12th Duke of Arenberg on 18 January 1955. ", "They have five children, eleven grandchildren and one great-granddaughter:\nLeopold, 13th Duke of Arenberg (20 February 1956) married Countess Isabel-Juliana zu Stolberg-Stolberg on 30 June 1995. ", "They have three children: \nPrincess Natasha Sophie Gaspara Maria Annunziata of Arenberg (21 December 1996) \nPrince Philippe-Léopold of Arenberg (20 May 1999)\nPrince Alexandre of Arenberg (2 November 2001)\nPrince Karl-Ludwig Felix Melchior of Arenberg (13 March 1957) married Fiammetta de Frescobaldi on 26 November 1988. ", "They have two children:\nPrincess Anne-Helene Sophie Vittoria Laura Gaspara of Arenberg (7 November 1989)\nPrince Evrard Guillaume Englebert Jean Melchoir Prinz of Arenberg (18 January 1996)\nPrincess Marie Gabriele of Arenberg (2 June 1958) married Gilles Morel de Boncourt-Humeroeuille on 28 January 1984. ", "They have four children and a granddaughter:\nMaïté de Boncourt-Humeroeuille (23 December 1984) married François Stoffels d'Hautefort on 22 September 2012\nZita Stoffels d'Hautefort (2013)\nThaïs Stoffels d'Hautefort (2015)\nEmmanuel Stoffels d'Hautefort (2017)\nCharlotte de Boncourt-Humeroeuille (2 February 1987) married Baron Wilhelm von Stotzingen on 27 July 2013\nAntoine de Boncourt-Humeroeuille (13 February 1990)\nLouis de Boncourt-Humeroeuille (18 July 1996)\nPrince Heinrich Antoine Marie of Arenberg (20 May 1961) married Marie-Thérèse de Spoelberch on 12 January 2001. ", "They have three children.", "\nPrince Etienne Albert Marie Melchoir of Arenberg (11 December 1967) married Adrienne Keller, daughter of Pierre Keller and Claire-Jeanne de Senarclens, on 17 September 1994. ", "They have two daughters:\nPrincess Amélie Claire Sophie Gaspara of Arenberg (9 June 2000)\nPrincess Larissa Lydia Louise Melchiora of Arenberg (18 March 2002)\n\nLater life\nAs opponents of the Nazi regime, Antonia and Rupprecht were forced into exile in Italy in 1939. ", " From there, they moved to Hungary. ", " When Germany occupied Hungary in October 1944, Antonia and her children were captured, while Rupprecht, still in Italy, evaded arrest. ", " They were imprisoned at Sachsenhausen. ", " In early April 1945, they were moved to Dachau concentration camp. ", "Although liberated that same month, the imprisonment greatly impaired Antonia's health; the ordeal led to her vow never to return to German soil, and she died nine years later, at Lenzerheide, Switzerland.", "\n\nTitles and honours\nTitles\n7 October 1899 – 7 April 1921: Her Grand Ducal Highness Princess Antonia of Luxembourg\n7 April 1921 - 18 October 1921: Her Royal Highness The Crown Princess of Bavaria\n18 October 1921 - 31 July 1954: Her Royal Highness Crown Princess Antonia of Bavaria, Princess of Luxembourg\n\nNational\n : Knight Grand Cross of the Order of the Gold Lion of the House of Nassau\n : Grand Cross of the Order of Adolphe of Nassau\n Bavaria: Dame Grand Cross of the Military Merit Order\n Bavaria: Grand Mistress of the Order of Theresa\n Bavaria: Grand Mistress of the Order of Saint Elizabeth\n\nForeign\n : Dame of the Order of the Starry Cross\n Germany/Prussia: Dame of the Order of Louise\n\nAncestry\n\nFootnotes\n\nBibliography\n Schlim, Jean Louis. ", "Antonia von Luxemburg: Bayerns letzte Kronprinzessin. ", "München: LangenMüller, 2006. .", "\n \n\nCategory:1899 births\nCategory:1954 deaths\nCategory:People from Bad Tölz-Wolfratshausen\nCategory:House of Nassau-Weilburg\nCategory:House of Wittelsbach\nCategory:Luxembourgian royalty\nCategory:Bavarian princesses\nCategory:Dames of the Order of Theresa\nCategory:Luxembourgian women in World War I\nCategory:Luxembourgian people imprisoned abroad\nCategory:Sachsenhausen concentration camp survivors\nCategory:Dachau concentration camp survivors\nCategory:German expatriates in Hungary" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.011152416356877323, 0.012448132780082987, 0.02127659574468085, 0, 0.02127659574468085, 0, 0.0189873417721519, 0.005681818181818182, 0, 0, 0.014354066985645933, 0.015625, 0, 0.02158273381294964, 0, 0.014084507042253521, 0, 0.022988505747126436, 0, 0.02857142857142857, 0, 0.018518518518518517, 0.014492753623188406, 0, 0.030303030303030304, 0, 0.019230769230769232, 0.020618556701030927, 0.02336448598130841, 0, 0.027777777777777776, 0.02247191011235955, 0.023575638506876228, 0.0125, 0.013422818791946308, 0.024896265560165973, 0.02021772939346812, 0.029508196721311476, 0.010256410256410256, 0.028037383177570093, 0.022950819672131147, 0.017421602787456445, 0, 0.03428571428571429, 0.01509433962264151, 0, 0.007352941176470588, 0.025, 0, 0, 0.011904761904761904, 0.037037037037037035, 0.03333333333333333, 0.006237006237006237 ]

[ "NEW DELHI: India is eagerly awaiting the launch of Reliance Jio’s 4G connection, which promises to offer average internet speed of 49Mbps on the go. ", "This is over 12 times faster than the current average of 4Mbps on the country’s 3G networks. ", "In theory, Reliance Jio’s 4G network will offer maximum speed of 112Mbps.", "Download speed of 49Mbps may seem astounding for those in India, but the country will still lag far behind the leaders in the global internet race.", "South Korea, widely acknowledged as the most ‘connected’ nation in the world, already has the highest broadband internet speed of 53.3Mbps and average speed of 13.3Mbps, according to Akamai.", "On mobile networks, South Korea's telecom operator SK Telecom claimed in November that it has achieved maximum internet download speed of 225Mbps on its LTE-Advanced (LTE-A) network. ", "LTE-A is a new technology that allows 50% faster data download over mobile networks.", "The speed of up to 225Mbps has been achieved for a demo, though the actual download speed of the network has not yet been announced. ", "The commercial rollout of its service will happen in the second half of 2014, around the same time when Reliance rolls out its 4G network. ", "Even if 225Mbps is taken as the promised maximum speed and not actual speed, it will be twice as fast as Reliance's peak of 112Mbps.", "SK Telecom has said that it is waiting for smartphone chips that can support such high download speeds to arrive in the market. ", "Qualcomm’s Snapdragon 800 chipset, the most powerful in the world, support maximum actual download speed of 150Mbps.", "The South Korean telecom operator also plans to offer download speed of 300Mbps on mobile connections, though it has not given a time frame for this. ", "UK's EE has also reportedly achieved 300Mbps download speed, but has not announced plans for the commercial rollout yet.", "When Reliance finally rolls out its 4G network expected by around mid-2014, its highest speed of 112Mbps will also be nearly one-third slower than that of UK-based service provider EE’s highest download speed of 300Mbps, the maximum internet speed on a mobile network in the world right now. ", "EE promises average speed of 25-30Mbps across the UK, with speeds as high as 60Mbps in certain cities.", "According to latest data compiled by analytics website Speedtest.net, the US town of Ephrata, Washington DC, enjoys average internet speed of 85.54Mbps. ", "However, the national average internet speed of the US is 18.5Mbps only. ", "On mobile networks, the maximum speed inthe country is 58.25Mbps (AT&T 4G), according to data by PCMag.", "Google Fiber, the internet titan’s pilot broadband internet project, promises maximum speed of 1Gbps (gigabits per second; 1gigabit = 1024 megabits) in the US. ", "However, actual speed delivered in Kansas City under this project is 49.86Mbps, the second highest in US, according to Speedtest.net data.", "In Hong Kong too, the peak speed is 65.1Mbps (the highest in the world) and average speed users get is 10.8Mbps. ", "The average 4G mobile download speed, however, in the country is 20Mbps.", "Akamai’s data dates back to the July-September quarter, and it is likely that the internet speeds would increase by the time Reliance’s network rolls out.", "Another operator offering 4G broadband in India is Bharti Airtel. ", "The company's network is currently available in cities like Pune, Kolkataand Bangalore, but it is not available on mobile phones. ", "Airtel 4G offers average download speed of 40Mbps via USB dongles, with the theoretical highest speed claimed to be 100Mbps.", "It is, therefore, obvious that India’s fastest consumer internet networks will not stand anywhere close to those in the developed markets and will even remain far behind upcoming networks in terms of pure download speeds.", "Also, the 3G flop show in India, where only 107 million users (out of an estimated 919 million) use 3G internet on mobile devices, does not bode too well for Reliance’s soon-to-be-rolled-out 4G internet. ", "High pricing and poor connectivity due to patchy networks has been one of the biggest stumbling blocks for 3G adoption in India. ", "Thus, Reliance would not only have to maintain a reliable network for its 4G users, but will have to also keep the prices low to promote mass adoption.", "With India’s burgeoning smartphone market, a number of consumers are likely to spend on high-speed internet on mobile devices for a better user experience, especially since video viewing is expected to be the next big data consumption medium in the country.", "However, India can still catch up with the leaders in the internet speed race. ", "The government is working with Israel to develop 5G internet networks, which offer speed of 10Gbps. ", "This technology is still in development across the world, with several companies claiming that it will be ready by 2020." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.006711409395973154, 0, 0.0136986301369863, 0, 0.005263157894736842, 0.01092896174863388, 0.011904761904761904, 0, 0.007194244604316547, 0.007575757575757576, 0.0078125, 0.008620689655172414, 0, 0, 0.00684931506849315, 0, 0.013071895424836602, 0, 0.009708737864077669, 0.00625, 0.007246376811594203, 0, 0, 0.012987012987012988, 0.015151515151515152, 0.015384615384615385, 0.008064516129032258, 0, 0.004901960784313725, 0, 0.006622516556291391, 0, 0, 0, 0 ]

[ "The South Dakota Advisory Committee to the commission is hosting a panel discussion on Friday, March 24, in Aberdeen, according to a press release. ", "Tribal officials are among those expected to testify at the first of three sessions on the issue.", "\n\n\"The briefing topics will include the value of the use of body-worn cameras in law enforcement, and minority policing that impacts Native Americans and immigrant communities,\" a notice that was published in the Federal Register on Tuesday reads." ]

{ "pile_set_name": "Pile-CC" }

[ 0.006756756756756757, 0.010309278350515464, 0.004048582995951417 ]

[ "1. ", "Field of the Invention\nThe present invention relates to a composite writing implement provided with a pencil lead feeder, a ballpoint refill and a stylus in a coaxial arrangement or two ballpoint refills and a stylus in a coaxial arrangement.", "\n2. ", "Description of the Related Art\nThere have been composite writing implements of this type provided with at least two writing elements, such as a pencil lead feeder and a stylus pen, or a ballpoint refill and a stylus. ", "In the conventional composite writing implement provided with at least two writing elements, such as a pencil lead feeder and a stylus, or a ballpoint refill and a stylus, the two writing elements are placed side by side in a barrel and are projected alternately from the barrel. ", "Thus, the conventional composite writing implement inevitably needs many parts and has a complicated mechanism, and the barrel has a big diameter. ", "Consequently, it has been difficult to provide a reliable composite writing implement of such conventional construction having a small diameter and easy to operate.", "\nAccordingly, it is an object of the present invention to provide a reliable composite writing implement provided with three coaxially arranged writing elements, including a comparatively small number of parts and easy to operate.", "\nAnother object of the present invention is to provide a very useful composite writing implement provided with a pencil lead feeder, a ballpoint refill and a stylus, in which the stylus can be used as a cap for covering the ballpoint refill and as a pencil lead feeder operating member without impeding its intrinsic function, and can be put on a barrel cap to use both the ballpoint refill and the stylus of the composite writing implement.", "\nAccording to a first aspect of the present invention, a composite writing implement includes: a barrel, a pencil lead feeder unit axially slidably placed in the barrel, a ballpoint refill unit disposed behind and coaxially with the pencil lead feeder unit in the barrel, an interlocking means for interlocking the pencil lead feeder unit and the ballpoint refill unit, and a cap, provided with a stylus tip, for covering a ballpoint tip of the ballpoint refill.", "\nAccording to a second aspect of the present invention, a composite writing implement includes a barrel provided with a detachable barrel cap, a first ballpoint refill placed in the barrel, a second ballpoint refill disposed behind the first ballpoint refill in the barrel, a ballpoint refill case placed in the barrel and holding the second ballpoint refill therein, an interlocking means for interlocking the first ballpoint refill and the ballpoint refill case holding the second ballpoint refill, and a stylus serving also as a cap for covering a tip of the second ballpoint refill and an operating member for turning the ballpoint refill case holding the second ballpoint refill therein to make the tip of the first ballpoint refill project from the barrel." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "1. ", "Field of the Invention\nThe present invention relates generally to a wireless communication device, and more particularly, to a Near Field Communication (NFC) device.", "\n2. ", "Description of the Related Art\nAn NFC scheme is a type of Radio Frequency IDentification (RFID) technology and may use a frequency (e.g., 13.56 MHz) of a high frequency band and transmit data at a distance with low power. ", "An example of an NFC scheme has been standardized in International Organization for Standardization/International Electrotechnical Commission (ISO/IEC) 18092. ", "An NFC scheme performs short distance radio communication using various frequency signals, e.g., 125, 135, and 900 kHz, in addition to the 13.56 MHz.", "\nAccordingly, an NFC device may have such advantages of communicating or being compatible with existing information devices, including portable wireless terminals and notebook computers through exchanges of address books, game and MP3 files. ", "Further, an NFC device using a predetermined frequency band is already in use for public transportation and mobile phone payment.", "\nA mobile phone embedded with NFC chips is still in an early distribution stage, although NFC technology is expected to be widely adopted in mobile terminals, such as portable wireless terminals, in the near future." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0.006060606060606061, 0, 0.009009009009009009, 0.018867924528301886, 0.006711409395973154, 0.004132231404958678, 0.007751937984496124, 0.009302325581395349 ]

[ "It Dies Today\n\nIt Dies Today (sometimes abbreviated \"IDT\") is an American metalcore band that formed in Buffalo, New York during September 2001 (around the time surrounding 9/11). ", "The band achieved popular success in 2004 with the release of their debut album, The Caitiff Choir. ", "After frontman Nicholas Brooks departed in 2006, just after the release of the band's sophomore effort Sirens, It Dies Today released Lividity in 2009 before going on an indefinite hiatus in 2010.. The band reunited briefly for a show in 2012.", "\n\nHistory\n\nFormation, EPs and The Caitiff Choir (20012004)\nIt Dies Today was formed in August 2001 in Buffalo, New York and was originally composed of vocalist Nicholas Brooks, guitarist Chris Cappelli, and guitarist Steve Lemke (who now plays bass). ", "During their formation, most of the band members were only 16 years old. ", "Their initial release was a three-track demo titled Let the Angels Whisper Your Name, recorded in late 2001. ", "The following year, It Dies Today released an EP titled Forever Scorned, which led to the band touring the U.S. with artists such as Between the Buried and Me and Alexisonfire.", "\n\nIn 2003, Lemke switched to bass as guitarist Mike Hatalak joined. ", "Prior to joining It Dies Today, Hatalak played in bands called Short of Breath, Plain of Ashes, and Stricture. ", " The group eventually signed with Trustkill Records, home to hardcore heavyweights such as Throwdown, Eighteen Visions, and Bleeding Through.", "\n\nFall 2004 brought about the release of the band's debut full-length The Caitiff Choir. ", "The album sold over 25,000 copies within four months and allowed the band to sell out two national headlining tours with support from Twelve Tribes, Anterrabae, Trivium and others. ", "Alternative Press named them a \"Band To Know\" in 2005. ", "The album has sold 90,000 copies to date.", "\n\nIn 2005, It Dies Today went on a series of whirlwind tours including tours supporting Bleeding Through, Walls of Jericho, All That Remains, and Throwdown, as well as appearing on the PETA-sponsored \"Compassion Over Fashion\" tour with Most Precious Blood and Remembering Never. ", "The group also supported metal bands such as God Forbid, Machine Head and The Haunted, as well as securing a spot on the coveted Ozzfest second-stage in the summer of 2005. ", "The following summer, the band was scheduled to take part in the Van's Warped Tour but had to cancel due to a vocal injury sustained by Brooks.", "\n\nSirens and departure of Nicholas Brooks (20062007)\n\nIt Dies Today spent 2006 writing and recording their follow-up album with producers Gggarth and Ben Kaplan. ", "Co-producing were vocalist Nick Brooks and guitarist Mike Hatalak, who owns DWS Studios in Niagara Falls, New York.", "\n\nOn October 17, 2006, It Dies Today released Sirens, which was followed by a U.S. tour. ", "A song from the album, \"Sacred Heart (Sacre Coeur)\" was featured in the 2009 film Jennifer's Body, while another song, \"Sixth of June\", was featured on the Resident Evil: Extinction. ", "On January 17, 2007 it was announced that Brooks had left the band and that his replacement would be Jason Wood, whom they met while on tour with Still Remains. ", "Before joining It Dies Today, Jason, a Grand Rapids, Michigan native, was the vocalist for the metal outfits Kamilla and The Orphan. ", "Later that year, the band played Warped Tour alongside Still Remains, Throwdown, Poison the Well, As I Lay Dying, and Parkway Drive, among others.", "\n\nLividity and hiatus (20072010)\n\nIt Dies Today spent the latter half of 2007 working on their third album, breaking in early 2008 for a small tour before getting back to work for the remainder of the year. ", "After several delays in recording, as well as push-backs by Trustkill Records, the new album Lividity was released on September 15, 2009.", "\n\nOn August 13, 2009, it was announced that the band would be playing at Australia's Soundwave Festival in 2010. ", "The band then played at the Mountain Metal Mayhem Festival in Berlin, NH on August 14, 2010 with Within The Ruins, Bloodlined Calligraphy, Threat Signal, Thy Will Be Done, Unearth, and local support. ", "In September 2010, former vocalist Nick Brooks and current It Dies Today guitarist Mike Hatalak formed a new hardcore band called The March. ", "They have since recorded and posted demos on the band's MySpace page.", "\n\nRumors of a break-up began to spread due the lack of updates, but in December 2010 drummer Nicholas Mirusso posted on the band's Facebook account, \"We are currently on an indefinite hiatus. ", "No promising news to give at the moment, other than we've all been submerged into the \"real\" world.\" ", "Their Facebook account also uploaded two unreleased tracks entitled “Pee Wee…Listen To Reason” and a cover of Alice In Chains' “Them Bones” in October 2011.", "\n\nTemporary reunion (2012present)\n\nOn November 23, 2011 the band announced a reunion show with original vocalist Nicholas Brooks. ", "Days after the performance on January 28, 2012, guitarist Mike Hatalak publicly stated that It Dies Today was no longer a band, but less than a month later, the statement would be retracted when the band stated that their new EP would be out on December 12, 2012. ", "Someone from the band said, \"Yes, patience, please. ", "We are no longer in our early twenties living at our parents' house. ", "We have jobs, responsibilities, and new families we've created. ", "We're not bound by a label, so true fans will appreciate the time we're investing in this.\" ", "However, the planned EP never came to fruition.", "\n\nOn January 19, 2014, a video featuring a new recording, presumably by Mike Hatalak, was posted on the band's Facebook page. ", "The full demo of the recording, titled \"Son of Dawn, Brilliant Star\", was later released on Lambgoat.com on April 29, 2014, with the band also announcing a set of shows in September to celebrate the 10 year anniversary of the release of The Caitiff Choir on the same day. ", "This is the first track to feature Nicholas Brooks since the release of Sirens eight years prior, marking a return to the original lineup for the band. ", "In response to his return, Brooks commented, \"I honestly could not be happier to have the opportunity to not only play shows with these dudes again but to write and record a new album with them as well.\" ", "However, on February 13, 2015, Nicholas Brooks announced that due to a \"severe case of writer's block and family life\", the potential album effort had been postponed indefinitely.", "\n\nMembers\nCurrent\nNicholas Brooks – lead vocals (2001–2007, 2012–present)\nChris Cappelli – guitars (2001–present)\nSteve Lemke – bass guitar, backing vocals (2003–present), guitars (2001–2003)\nMike Hatalak – guitars (2003–present)\nNick Mirusso – drums, percussion (2002–present)\n\nFormer\nJason Wood – lead vocals (2007–2012)\nSeth Thompson – bass(2001-2003)\nJoe Cuonze – drums (2001)\nSteven Sanchez – bass (2003)\nAaron Adkins – guitar (2001)\n\nTouring\nTony Lorenzo – guitars (2004)\n\nDiscography\n\nStudio albums\n 2004: The Caitiff Choir (re-released in 2006)\n 2006: Sirens\n 2009: Lividity\n\nEPs and Demos\n 2001: Let the Angels Whisper Your Name\n 2002: Forever Scorned (re-released in 2006)\n\nCompilations\n 2005: Masters of Horror Soundtrack\n 2006: The Best Of Taste Of Chaos\n 2006: Headbanger's Ball: The Revenge\n 2006: A Santa Cause: It's a Punk Rock Christmas\n 2007: Resident Evil: Extinction Soundtrack\n 2009: Saw VI Soundtrack\n 2009: Soundwave 2010\n\nReferences\n\nCategory:American metalcore musical groups\nCategory:Heavy metal musical groups from New York (state)\nCategory:Musical groups established in 2001" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0, 0.01, 0.00411522633744856, 0.01195219123505976, 0, 0, 0.011363636363636364, 0.014705882352941176, 0.018018018018018018, 0.028368794326241134, 0, 0.0055248618784530384, 0, 0, 0.0035842293906810036, 0.011560693641618497, 0.006993006993006993, 0.024691358024691357, 0.034782608695652174, 0, 0.01639344262295082, 0.012422360248447204, 0.007518796992481203, 0.0136986301369863, 0.004830917874396135, 0.0072992700729927005, 0, 0.025, 0.014184397163120567, 0, 0.005208333333333333, 0, 0.00641025641025641, 0.007692307692307693, 0.007575757575757576, 0, 0, 0, 0, 0.02127659574468085, 0.007936507936507936, 0.003676470588235294, 0.006578947368421052, 0.004901960784313725, 0.00558659217877095, 0.013599274705349048 ]

[ "AN HONEST ACCOUNT OF THE TRIALS AND TRIUMPHS OF A TWENTY- SOMETHING CITY KID\n\nSO AFRAID TO FAIL THAT YOU CAN’T EVEN START\n\nI haven’t been blogging much recently. ", "I’ve been trying to unpack the reasons for that because it is something that brings me great joy and I’d like to continue doing it. ", "One of the perpetual themes in my life is a crippling fear of failure. ", "This fear rears it’s ugly head in the most unwanted places and leaves me feeling like I can’t even start something because what if it sucks and everyone hates it, and everyone thinks I’m stupid, and I think I’m stupid, and why did I even think I could do this anyway?", "\n\nThe funny thing about this thought process is you usually have to suck before you can be good at something. ", "You also do in fact have to do something in order to become good at it.", "\n\nPeople often ask: “if you could do anything in the world, what would it be?” ", "If I could do anything in the world, I would be a singer-songwriter. ", "I’ve dreamt about it for decades (all 2.8 of them). ", "Do you want to know what I do about that dream? ", "Nothing. ", "I don’t write songs, I don’t practice guitar or any instrument regularly, I don’t even sing all that often. ", "I’m intensely afraid that if I wholeheartedly pursued this dream, I would be terrible at it. ", "And what’s more heartbreaking than being terrible at something you love?", "\n\n6 thoughts on “SO AFRAID TO FAIL THAT YOU CAN’T EVEN START”\n\nEMMA! ", "You have no idea how much this resonates with me. ", "Mark Manson, the writer of “The subtle art of not giving a f*ck” wrote that he once had a similar thought to you. ", "He wanted to be a guitarist really bad, but never did anything about it. ", "He said I wanted to be at the top of the mountain, but not climb it. ", "And then he realized that he didn’t really want to be a guitarist because he didn’t want to do the work of it, so he found something he DID want to work on. ", "Reading this passage from him helped me a lot when I was feeling stuck like this because I realized, my fear of failing at performing or acting was actually a smaller fear than the fear of feeling I may I missed out because I didn’t do the work. ", "And work is exactly that, work. ", "It’s progressive, and forward moving, even when it feels like it’s not.", "\nThat’s my two sense. ", "If it’s something you love, love the work of it too. ", "Xx\n\nEMMA! ", "I would have bought your album YESTERDAY!!!! ", "The little taste you gave us of your singing really resonated within me. ", "It is honest pure and refreshing. ", "You truly have an ethereal unique quality. ", "Please share your gifts with us!", "\n\nYes yes yes. ", "I think about this constantly. ", "And lately I have been realizing that while there are also other reasons I am afraid to start, the fee of failure is a huge one, and I have been convincing myself that there are too many other big reasons why I don’t attempt to try anything. ", "But yes, you have to start somewhere, and FAR more often than not, the beginning will feel like failure after failure. ", "But the cool thing is that you don’t even have to look at it that way, since failure is more or less necessary at the beginning– without it, you might not get anywhere. ", "I try to think of it as a learning curve or trial and error instead of failing. ", "It feels more doable that way." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0, 0.00909090909090909, 0.014084507042253521, 0, 0, 0, 0, 0, 0, 0.010752688172043012, 0, 0.014492753623188406, 0, 0.008771929824561403, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "1. ", "The High Contracting Parties shall, also in peacetime, endeavour, with the assistance of the national Red Cross (Red Crescent, Red Lion and Sun) Societies, to train qualified personnel to facilitate the application of the Conventions and of this Protocol, and in particular the activities of the Protecting Powers.", "\n\n2. ", "The recruitment and training of such personnel are within domestic jurisdiction.", "\n\n3. ", "The International Committee of the Red Cross shall hold at the disposal of the High Contracting Parties the lists of persons so trained which the High Contracting Parties may have established and may have transmitted to it for that purpose.", "\n\n4. ", "The conditions governing the employment of such personnel outside the national territory shall, in each case, be the subject of special agreements between the Parties concerned." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0.01592356687898089, 0, 0, 0, 0.004166666666666667, 0, 0 ]

[ "Share this...\n\n\n\nRecords in the Northeast: Not only is record-cold weather gripping the Northeast USA, with wind chills as low as 50°F below zero and New York City hitting a new low, but also cold is spreading across Great Britain. ", "The cold is also expected to sweep across Europe by early this week. ", "Spring is nowhere in sight and people are growing weary of winter.", "\n\nThe Daily Mail here reports that temperatures in Scotland fell to as low as -14°C this morning, the lowest recording in Britain in four years. ", "Temperatures expected to fall to -15°C later in the week.", "\n\nTaipei coldest temperature in 44 years\n\nUnusual cold has also gripped Southeast Asia, especially Taiwan. ", "German Bild here reports of “85 deaths in record cold in East Asia“. ", "The German online daily writes that the temperature fell to just 4°C in the capital city of Taipei Sunday morning. ", "Southeast Asia has been gripped by severe cold over weeks.", "\n\nHeaviest snowfall in 32 years\n\nAccording to the weather service it was the lowest reading in 44 years. ", "Bild also reports that over 80,000 visitors were stranded on the southern resort island of Jeju due to the “heaviest snowfall in 32 years“.", "\n\n9000 domesticated animals freeze in Vietnam\n\nTwo weeks ago the Austrian heute.at/news reported here of bitter cold gripping Vietnam, freezing to death some 9000 in total cows, pigs, sheep and horses in what they write as the “roughest cold wave in almost 40 years“.", "\n\nAlso the Austrian online kleinezeitung.at reports that winter has reached its zenith as temperatures dip down to -50°C in Siberia and meters of snow pile up in Japan." ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0, 0, 0.017543859649122806, 0, 0, 0, 0, 0, 0.007194244604316547, 0, 0 ]

[ "Q:\n\nDo the dwarves grow weary of Middle-earth\n\nThis answer suggests that, like the Eldar, the Dwarves grow weary of Middle-earth. ", "I had never considered that notion before. ", "The passage is:\n\nAlso, the Noldor's purpose was to prevent the decay of time which only affected the dwarves and eldar.", "\n\nOr perhaps I'm simply misinterpreting that wording and it was intending to say something else. ", "\nAnyway, is there any support for this idea in canon -- for any interpretation? ", "How does the \"decay of time\" affect the dwarves?", "\nAs far as I know, except for Gimli, none of the Dwarves are permitted to travel to the West -- at least prior to death -- no matter how weary they might be.", "\n\nA:\n\nI think there's evidence on this. ", "From the Appendices:\n\nWe have heard tell that Legolas took Gimli Glóin's son with him because of their great friendship, greater than any that has been between Elf and Dwarf. ", "If this is true, then it is strange indeed: that a Dwarf should be willing to leave Middle-earth for any love, or that the Eldar should receive him, or that the Lords of the West should permit it. ", "But it is said that Gimli went also out of desire to see again the beauty of Galadriel; and it may be that she, being mighty among the Eldar, obtained this grace for him. ", "More cannot be said of this matter.", "\n\nI think that \"then it is strange indeed: that a Dwarf should be willing to leave Middle-earth for any love\" makes it clear that Dwarves do not weary of Middle Earth, at least not in the way that Elves do.", "\nAs far as I can see, Dwarves are pretty much like Men in their ageing. (", "Though greed is the besetting failing of Dwarves, while fear of death is that of Men, so Dwarves may approach old age with greater serenity than Men.)", "\n\nA:\n\nThe Dwarves are decaying because they reproduce slowly.", "\nWhile Mark Olson does an excellent job at proving the Dwarves aren't \"fading\" he doesn't quite look at the text that inspired the question, so lets look at that closer.", "\nThe quote says the Noldor were preventing the decay of time that \"only affected the Dwarves and the Eldar\". ", "While there is a mistake in this sentiment1, it's not that the Dwarves are decaying. ", "The decay of the Dwarves has nothing to do with their power or interest in Middle-earth fading, but to do with the low reproduction rates and general lack of women in Dwarven populations. ", "This caused the decay of the Dwarves in the later ages, they also became more secluded which is \"why\" we don't see them today.", "\n\nDís was the daughter of Thráin II. ", "She is the only dwarf-woman named in these histories. ", "It was said by Gimli that there are few dwarf-women, probably no more than a third of the whole people.", "\nThe Lord of the Rings - Appendix A, III: Durin's Folk\n\nThe number of dwarf-men that marry is actually less than one-third. ", "For not all the women take husbands: some desire none; some desire one that they cannot get, and so will have no other. ", "As for the men, very many also do not desire marriage, being engrossed in their crafts.", "\nibid.", "\n\nOn top of the lack of Dwarven women, the population of Dwarves rarely rose quickly, this was because it was rare to see a Dwarf-woman bear up to 4 children. ", "This low replacement ratio combined with the low amount of females marrying makes population growth and only happened in peace time in the recorded histories.", "\n\nIt is then said that Dwarves marry late, seldom before they are ninety or more,18 that they have few children (so many as four being rare)\nHistory of Middle-earth - Volume XII: People's of Middle-earth, IX: The Making of Appendix A, (iv) Durin's Folk\n\nYou are right, Dwarves weren't permitted to sail the Straight-Road to Valinor. ", "They were mortal and it is unclear what happens to them upon death. ", "They believed they go to the Halls of Mandos to be cared for by Aule, but whether this is true is unclear.", "\n1 It wasn't only the Eldar that faded but all Elves, while this is just a naming convention, the Eldar were only those that had seen the light of the two trees, the Calaquendi.", "\n\nA:\n\nNo, I don't believe there is any support in cannon for the idea that Dwarves grow weary of Middle-earth in the way that Elves do. ", "If that is what WOPR meant in the answer that you linked to, I think that was a mistake. ", "\nThis answer to a question about Gimli's age provides evidence that the Dwarves we know the most about lived for about 250 years. ", "Durin the Deathless was an exception and probably lived much longer as described in this answer.", "\nAll kinds of people are subject to weariness, but even though Dwarves live long lives, their lifespan does not approach the age of the Elves who were born in the first age.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0.008403361344537815, 0, 0, 0, 0.006369426751592357, 0, 0.022857142857142857, 0.01015228426395939, 0.011695906432748537, 0, 0.0048543689320388345, 0, 0, 0, 0.005917159763313609, 0, 0, 0, 0, 0, 0, 0.009708737864077669, 0.008064516129032258, 0, 0, 0, 0.006289308176100629, 0, 0, 0, 0.009433962264150943, 0.01694915254237288, 0, 0, 0.007692307692307693, 0.010416666666666666, 0, 0 ]

[ "Pain Wars: A New Hope.", "\nNociceptin opioid peptide receptor agonists interact with mu-opioid receptor agonists for pain relief. ", "A new study by Ding et al. (", "2018) examines a bifunctional nociceptin- and mu-opioid receptor agonist, AT-121, that provides analgesia without physiological side effects or abuse liability, offering a promising new hope toward better analgesics." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0.03571428571428571, 0 ]

[ "---\nabstract: 'We provide multiple Schramm-Loewner evolutions (SLEs) to describe the scaling limit of multiple interfaces in critical lattice models possessing Lie algebra symmetries. ", "The critical behavior of the models is described by Wess-Zumino-Witten (WZW) models. ", "Introducing a multiple Brownian motion on a Lie group as well as that on the real line, we construct the multiple SLE with additional Lie algebra symmetries. ", "The connection between the resultant SLE and the WZW model can be understood via SLE martingales satisfied by the correlation functions in the WZW model. ", "Due to interactions among SLE traces, these Brownian motions have drift terms which are determined by partition functions for the corresponding WZW model. ", "As a concrete example, we apply the formula to the $\\su$-WZW model. ", "Utilizing the fusion rules in the model, we conjecture that there exists a one-to-one correspondence between the partition functions and the topologically inequivalent configurations of the SLE traces. ", "Furthermore, solving the Knizhnik-Zamolodchikov equation, we exactly compute the probabilities of occurrence for certain configurations (i.e. crossing probabilities) of traces for the triple SLE.'", "\nauthor:\n- |\n Kazumitsu Sakai[^1]\\\n \\\n *Institute of Physics, University of Tokyo,\\\n *Komaba 3-8-1, Meguro-ku, Tokyo 153-8902, Japan\\\n \\\n \\\n **\ntitle: 'Multiple Schramm-Loewner evolutions for conformal field theories with Lie algebra symmetries'\n---\n\nIntroduction\n============\n\nGeometric aspects of critical phenomena are characterized by random fractals such as conformally invariant fluctuations of local order parameters. ", "They have been extensively studied from various different points of view, especially in two dimensions (2D) where the conformal invariance imposes strong constraints on the structure of critical phenomena. ", "Among them, the Schramm-Loewner evolutions (SLEs) [@S1], which directly describe geometric aspects of 2D critical phenomena through simple 1D Brownian motions, have brought a renewed interest in the theory of random fractals (see [@RS; @Wer; @KN; @C1; @Law; @BB1; @Gruz; @Smir] for reviews).", "\n\nThe SLE is a stochastic process defined in the upper half plane $\\mathbb{H}$. Its evolution is described by the ordinary differential equation $$d g_t(z)=\\frac{2 dt}{g_t(z)-x_t}, \\quad g_0(z)=z\\in \\mathbb{H},\n\\label{chordal}$$ where $x_t=\\sqrt{\\kappa} \\xi_t$ is a Brownian motion on $\\mathbb{R}$, starting at the origin (i.e. $x_0=0$), and its expectation value and variance are given by $\\mathbf{E}[d x_t]=0$ and $\\mathbf{E}[dx_t dx_t]=\\kappa dt$, respectively. ", "Here $\\kappa>0$ is a diffusion coefficient which essentially characterizes the SLE process. ", "The SLE has a solution up to the explosion time $\\tau_z$, i.e. the first time when $g_t(z)$ hits the singularity $x_t$. Let $K_t=\\overline{\\{z\\in \\mathbb{H}| \\tau_z<t \\}}$ be the hull at time $t$ (see Fig.", " \\[hull\\] for a schematic view). ", "Then $K_t$ ($t\\ge 0$) is an increasing family of hulls: $K_s \\subset K_t$ for $s<t$. Moreover $g_t(z)$ with $g_t(z)=z+O(1)$ at $z\\to\\infty$ (hydrodynamic normalization) is the unique conformal map uniformizing the complement of the hull $K_t$ in the upper half plane $\\mathbb{H}$: $g_t(z): \\mathbb{H}\\setminus K_t \\to \\mathbb{H}$ (see Fig.", " \\[uniform\\]). ", "The image $x_t$ by $g_t^{-1}(x_t)$ defines the tip $\\gamma_t$ of the growing random curve. ", "More precisely, it is expressed as $\\gamma_t=\\lim_{\\epsilon\\to +0} g_t^{-1}(x_t+i\\epsilon)$.\n\n![", "Schematic view of a SLE trace ($\\gamma_t$ denotes the tip of the trace) (a) and its hull $K_t$ (b).[]{data-label=\"hull\"}](hull.eps){width=\"85.00000%\"}\n\nThe connection between the SLE and conformal field theory (CFT) is well understood [@BB2; @BB3; @FW1; @FW2; @BB4; @BB5; @BB6; @BBK; @C1; @BB1]. ", "Specifically, it can be accomplished by noticing that CFT correlation functions $$\\mathcal{M}_t=\\frac{\\bra \\psi(\\infty) \\mathcal{O} \\psi(\\gamma_t)\\ket}\n{\\bra \\psi(\\infty) \\psi(\\gamma_t) \\ket}\n\\label{correlation}$$ are SLE martingales: $d \\mathcal{M}_t/dt=0$, where $\\psi(\\gamma_t)$ and $\\psi(\\infty)$ are boundary condition changing (bcc) operators with conformal weights $h$, which are inserted at the points $z=\\gamma_t$ and $z=\\infty$, respectively (see [@BB1; @BBK] or next section for details). ", "Thus one can find the SLE corresponds to the minimal conformal field theory $\\mathcal{M}(p,p')$ ($p$, $p'$ are coprime integers satisfying the condition $p>p'\\ge 2$) where the central charge and the conformal weights of the primary fields are, respectively, given by [@BPZ; @FMS] $$c=1-6\\frac{(p-p')^2}{p p'}, \\quad h_{r,s}=\\frac{(p r-p's)^2-(p-p')^2}{4p p'}.$$ Then the diffusion constant $\\kappa$ and the conformal weight $h$ of the boundary field $\\psi$ are, respectively, expressed as $$c=\\frac{(3\\kappa-8)(6-\\kappa)}{2\\kappa}, \\quad\nh=\\frac{6-\\kappa}{2\\kappa}=\n\\begin{cases}\nh_{2,1} &\\text{ for $\\kappa=4p'/p\\le 4$} \\\\\nh_{1,2} &\\text{ for $\\kappa=4p/p'> 4$} \n\\end{cases}.", "\n\\label{minimal}$$ Namely the boundary field $\\psi$ is degenerate at level two, i.e. possesses a null field at level two.", "\n\nAn extension to the SLE connecting with conformal field theories with Lie algebra symmetries (i.e. WZW models [@N; @W; @KZ]) has been achieved by adding the extra Brownian motion $\\exp(\\sum_a t^a d \\theta_t^a(z))$ on a (semisimple) group manifold $G$ associated with a Lie algebra $\\g$, where $t^a$’s ($a=1,\\dots,\\dim \\g$) stand for any representation of the Lie algebra generators [@BGLW; @ABI] (see [@R1] for a very different approach). ", "The evolution of this additional stochastic process $\\theta^a_t(z)$ is defined as $$d\\theta^a_t(z)=\\frac{\\sqrt{\\tau}d \\vartheta_t^a}{z-x_t}, \\qquad\n\\mathbf{E}[d\\vartheta_t^a]=0,\\,\\, \\mathbf{E}[d\\vartheta_t^a d\\vartheta_t^b]=\\delta^{ab} dt \n \\,\\,\\,(\\vartheta_t^a\\in \\mathbb{R}).", "\n\\label{lie}$$ The combination of and defines a fractal curve living on the Lie group $G$ manifold. ", "The SLE martingale $d \\mathcal{M}_t/dt=0$, which should be satisfied by the CFT correlation function (note that the bcc operators and the operator $\\mathcal{O}$ take their values on $G$), determines the relation of the SLE defined by and with the corresponding WZW model. ", "Some extensions to the SLE with other additional symmetries have also been done in [@R2; @R3; @NR; @Sant; @Naza1; @Naza2].", "\n\n![", "Uniformizing map $g_t$: $\\mathbb{H}\\setminus K_t\\to \\mathbb{H}$ and its inverse. []{", "data-label=\"uniform\"}](uniform.eps){width=\"85.00000%\"}\n\nIn this paper we generalize the SLE for the system containing multiple random interfaces which possess additional Lie algebra symmetries, according to the theory developed in [@BBK]. ", "Assuming that each SLE interface grows under an independent martingale in the infinitesimal time interval, we extend together with to the case for the system with multiple interfaces. ", "The evolution (cf. ", "for the single case) characterizing the geometric aspect of the interfaces is described by a multiple Brownian motion on the real line, while the evolution (cf. ", "for the single case) expressing the algebraic aspect is described by a multiple Brownian motion on the Lie group $G$. Both the Brownian motions, however, have drift terms describing the interaction among the SLE traces. ", "Taking into account the SLE martingale, one finds that these drift terms are determined by the partition function in the corresponding WZW model. ", "Moreover this partition function characterizes the configuration of the SLE traces. ", "As an example, we apply our formula to the SLE for the $\\su$-WZW models. ", "Utilizing the fusion rules for $\\su$, we conjecture that there is a one-to-one correspondence between the partition functions and the topologically inequivalent configurations of the SLE traces. ", "Further, we exactly compute the probabilities of occurrence for certain configurations of traces (that correspond to crossing probabilities) for the triple SLE, which can be obtained by solving the Knizhnik-Zamolodchikov (KZ) equation [@KZ].", "\n\nThe paper is organized as follows. ", "In the subsequent section, we describe some basic notions required in this paper. ", "In section 3, the multiple SLE for conformal field theory with Lie algebra symmetries is formulated. ", "The drift terms of the driving Brownian motions are explicitly determined in section 4. ", "A concrete application of the formula to the SLE for the $\\su$-WZW model is given in section 5.", "\n\nPreliminaries\n=============\n\nIn this section, we describe several theoretical foundations required in subsequent sections. ", "In the former part of this section, we introduce SLE martingales from the point of view of statistical mechanics (see [@BB1] for details). ", "SLE martingales are given by CFT correlation functions involving bcc operators, and hence they become a key to decipher the relation between SLE and CFT. ", "In the latter part, general properties of correlation functions are explained in the case of the WZW model.", "\n\nSLE martingales and conformal correlators\n-----------------------------------------\n\nTo formulate the SLEs correctly describing the behavior of 2D interfaces in critical systems, one must construct SLE martingales in terms of the corresponding statistical systems defined on $\\mathbb{H}$. Let $\\bra \\mathcal{O} \\ket$ be the thermal average of an observable $\\mathcal{O}$ defined in $\\mathbb{H}$, and $\\bra \\mathcal{O} \\ket|_{\\{\\gamma_t\\}}$ be the thermal average under a given shape of configuration of (multiple) interfaces, where $\\{\\gamma_t\\}$ denotes the shape of configuration with its occurrence probability $\\mathbf{P}[{\\{\\gamma_t\\}}]$. Then the thermal average $\\bra \\mathcal{O} \\ket$ must be given by $$\\bra \\mathcal{O}\\ket=\\mathbf{E}[\\bra \\mathcal{O} \\ket|_{\\{\\gamma_t\\}}]\n=\\sum_{\\{\\gamma_t\\}} \\mathbf{P}[\\{\\gamma_t\\}]\\bra \\mathcal{O}\\ket|_{\\{\\gamma_t\\}},$$ where the average $\\mathbf{E}[\\cdots]$ should be taken over all the possible configurations. ", "The conditional expectation value $\\bra \\mathcal{O} \\ket|_{\\{\\gamma_t\\}}$ is thus time independent (i.e. conserved in mean), and therefore it is a martingale. ", "Here and in what follows, we denote it by $\\mathcal{M}_t$.\n\nAt the critical point where the conformal invariance is expected in the system, the above observable can be described in terms of the CFT correlation functions. ", "For the situation where the number of the interfaces under consideration is $m$, it reads $$\\mathcal{M}_t:=\\bra \\mathcal{O} \\ket|_{\\{\\gamma_t\\}}=\n\\frac{\\bra \\mathcal{O}\\psi_1(w_1)\\cdots\\psi_m(w_m)\\psi_{m+1}(\\infty)\\ket}\n {\\bra \\psi_1(w_1)\\cdots\\psi_m(w_m)\\psi_{m+1}(\\infty)\\ket},\n\\label{correlation2}$$ where $w_j$’s denote the positions of the tips of the interfaces. ", "Note that the CFT correlation functions are defined on the domain $\\mathbb{H}$ removing the hull $K_t$, i.e. $\\mathbb{H}\\setminus K_t$ (see Fig.", " \\[corr\\]). ", "The operators $\\psi_j(w_j)$’s inserted at the positions of the tips denote primary bcc operators with conformal weights $h$: under a local conformal map $z\\to z'= w(z)$, a primary field $\\psi(z)$ transforms as $\\psi(z)\\to\\psi'(z')$: $$\\psi'(z')=\\left(\\frac{dw(z)}{dz}\\right)^{-h} \\psi(z).", "\n\\label{CC}$$ The denominator in stands for the CFT partition function with a specific boundary condition fixed by the bcc operators $\\psi_j(w_j)$.\n\nApplying the conformal uniformizing map $g_t(z)$ (written with the same symbol as that used for the single SLE ), we obtain $$\\mathcal{M}_t=\n\\frac{\\bra {}^{g_t}\\mathcal{O}\\psi_1(x_{1t})\\cdots\\psi_m(x_{mt})\\psi_{m+1}(\\infty)\\ket}\n {\\bra \\psi_1(x_{1t})\\cdots\\psi_m(x_{mt})\\psi_{m+1}(\\infty)\\ket}.$$ Here $x_{jt}=g_t(w_j)$, and ${}^{g_t}\\mathcal{O}$ is the image of $\\mathcal{O}$ by the map $g_t$. Note that the Jacobians coming from the conformal map on $\\psi_j$ have been canceled in the numerators and the denominators[^2]. ", "Now SLE martingales $\\mathcal{M}_t$ are expressed as the CFT correlation functions on $\\overline{\\mathbb{H}}$, where the bcc operators $\\psi_j(x_j)$ are inserted at the points $x_j\\in\\mathbb{R}$ (see Fig.", " \\[corr\\]). ", "To proceed further, let us consider the case when the operator $\\mathcal{O}$ is a product of an arbitrary number of primary fields $\\mathcal{O}=\\prod_{j=1}^n\\phi_j(z_j,\\zb_j)$ at positions $(z_j,\\zb_j)$ and with conformal weights $(h_j,\\hb_j)$. By construction, the uniformizing map $g_t(z)$ can be analytically extended to the lower half plane: $g_t(\\zb)=\\bar{g_t}(z)$. Then, the doubling trick can be applied to the CFT correlation functions. ", "The result reads $$\\mathcal{M}_t=\n\\prod_{j=1}^{2n}\\left( \\frac{\\der y_{jt}}{\\der z_j} \\right)^{h_j}\n\\frac{\\bra\\prod_{j=1}^{2n} \\phi_j(y_{jt}) \\psi_1(x_{1t})\\cdots\\psi_m(x_{mt}) \n\\psi_{m+1}(\\infty)\\ket}\n{\\bra\\psi_1(x_{1t})\\cdots\\psi_m(x_{mt}) \\psi_{m+1}(\\infty)\\ket }, \n\\label{martingale}$$ where we denote that $y_{jt}=g_t(z_j)$; $\\phi_{j+n}=\\bar{\\phi}_{j}$; $z_{j+n}=\\zb_j=z_j^{\\ast}$; $y_{j+n t}=\\bar{y}_{jt}=y_{jt}^{\\ast}$, $h_{j+n}=\\hb_{j}$ for $1\\le j \\le n$. Here $\\phi_j(y_{jt})$ ($\\bar{\\phi}_{j}(y_{jt})$) stands for the holomorphic (antiholomorphic) part of the field $\\phi_j(y_{jt},\\bar{y}_{jt})$.\n\nIn this paper, we analyze the SLE martingales for the system that possesses additional Lie algebra symmetries. ", "Namely we construct the multiple SLE for the WZW models which are one of the most fundamental CFTs with extra Lie algebra symmetries. ", "In this case, the primary fields constructing the SLE martingale possess internal degrees of freedom, such as “spin\".", "\n\n![", "CFT correlation functions on $\\mathbb{H}\\setminus\\mathbb{K}$ (a). ", "It can be transformed to the one defined on $\\overline{\\mathbb{H}}$ by the uniformizing map $g_t(z)$ (b).[]{data-label=\"corr\"}](correlation.eps){width=\"85.00000%\"}\n\nWZW models and correlation functions\n------------------------------------\n\nLet us introduce several properties for correlation functions of WZW primary fields to analyze the SLE martingales . ", "The WZW model is a CFT described by a field $g(z,\\zb)$ taking values in a group manifold $G$ associated with a Lie algebra $\\g$ [@FMS; @N; @W; @KZ]. ", "The model is invariant under $$g(z,\\zb)\\to\\Omega(z)g(z,\\zb)\\bar{\\Omega}^{-1}(\\zb),\n\\label{GG}$$ where $\\Omega$ and $\\bar{\\Omega}(\\zb)$ denote arbitrary matrices valued in $G$. This invariance gives rise to Noether currents $J(z)=-k \\der_z g g^{-1}$ and $\\bar{J}(\\zb)=k g^{-1}\\der_{\\zb} g$, which can be written as $$J(z)=\\sum_{a=1}^{\\dim\\g} J^a(z) t^a,\\quad\n\\bar{J}(\\zb)=\\sum_{a=1}^{\\dim\\g} \\bar{J}^a(\\zb) t^a,$$ where $t^a$’s stand for any matrix representation of the generator of $\\g$, with commutation relations $[t^a,t^b]=\\sum_c i f^{ab}_{\\,\\,\\,\\,\\,\\,c} t^c$. The parameter $k$ is a positive integer referred to as the level. ", "Hereafter we only consider the holomorphic components, as if there were no boundary (cf. ) [", "@C2]. ", "Let $\\bra X \\ket$ be a correlator of $G$-valued fields. ", "Then the infinitesimal transformation $\\Omega(z)=1+\\omega(z)$ leads to the Ward identity $$\\delta_\\omega \\bra X \\ket=-\\frac{1}{2\\pi i}\\oint dz \\sum_{a=1}^{\\dim\\g} \\omega^a(z) \n\\bra J^a(z) X\\ket.", "\n\\label{ward-alg}$$\n\nOn the other hand, conformal aspects of the WZW model are described by the stress energy tensor $T(z)$: $$T(z)=\\frac{1}{2(k+h^{\\vee})}\\sum_{a=1}^{\\dim \\g}\n:J^a(z) J^a(z):,\n\\label{sugawara}$$ where $h^{\\vee}$ denotes the dual Coxeter number of $\\g$. Note that $:\\,\\,:$ means the “normal ordering\" defined as $$:A(z)B(z):=\\frac{1}{2\\pi i}\\oint_{z}\\frac{dw}{w-z} A(w)B(z).$$ The infinitesimal conformal transformation $z\\to z'=z+\\epsilon(z)$ leads to the Ward identity $$\\delta_\\epsilon\\bra X \\ket=-\\frac{1}{2\\pi i}\\oint dz \\epsilon(z)\\bra T(z) X\\ket.", "\n\\label{ward-geo}$$ This geometric part of the Ward identity together with the algebraic part are a key ingredient in analyzing the SLE martingale.", "\n\nThe current $J^a(z)$ and the stress energy tensor $T(z)$ can be expanded in terms of the modes $J^a_n$ and $L_n$, respectively. ", "Namely $$J^a(z)=\\sum_{n\\in \\mathbb{Z}} J_n^a z^{-n-1}, \\quad\nT(z)=\\sum_{n\\in \\mathbb{Z}} L_n z^{-n-2},\n\\label{mode}$$ where $J_n^a$ and $L_n$ denote, respectively, the generators[^3] of the affine Lie algebra $\\hat{\\g}$ with level $k$, and the generators of the Virasoro algebra: $$\\begin{aligned}\n&[J^a_n, J^b_m]=\\sum_c i f^{ab}_{\\,\\,\\,\\,\\,\\,c} J^c_{n+m}+k n \\delta^{a,b}\\delta_{n+m,0},\n \\nn \\\\\n&[L_n,J_m^a]=-m J_{n+m}^a, \\nn \\\\\n& [L_n,L_m]=(n-m)L_{n+m}+\\frac{c}{12}(n^3-n)\\delta_{n+m,0}.", "\n\\label{Vir}\\end{aligned}$$ The central charge $c$ of the Virasoro algebra is then given by $$c=\\frac{k \\dim \\g}{k+h^{\\vee}}.", "\n\\label{central}$$ By construction , the Virasoro generators are not independent of the affine generators: $$L_n=\\frac{1}{2(k+h^{\\vee})}\\sum_{a=1}^{\\dim\\g}\\sum_{m\\in \\mathbb{Z}}\n :J_m^a J_{n-m}^a:,\n\\label{L-J}$$ where the normal ordering $:\\,\\,:$ means that the operator with larger index $n$ is placed at the rightmost position. ", "The primary fields in the WZW model are defined as the fields transforming covariantly with respect to the $G(z)$ transformation : $\\delta_\\omega g=\\omega g$. Together with the conformal covariance (see ), these properties can be expressed in terms of the operator product expansions (OPE) via the Ward identities and : $$T(z)\\psi_{\\lambda}(w)=\\frac{h_\\lambda \\psi_\\lambda(w)}{(z-w)^2}+\n \\frac{\\der_w \\psi_\\lambda(w)}{z-w}+\\text{reg.}, ", "\\quad \nJ^a(z) \\psi_{\\lambda}(w)=\\frac{-t_\\lambda^a \\psi_\\lambda(w)}{z-w}+\\text{reg.},", "\n\\label{OPE}$$ where the field $\\psi_\\lam(z)$ takes values in the representation specified by the highest weight $\\lambda$, and $t_\\lambda^a$ is the generator $t^a$ in that representation. ", "Furthermore utilizing the field-state correspondence, i.e. $|\\psi_\\lambda\\ket:=\\lim_{z\\to0}\\psi_\\lambda(z)|0\\ket$, we can translate these properties into $$\\begin{aligned}\n{2}\n& L_0 |\\psi_\\lambda\\ket=h_\\lambda |\\psi_\\lambda\\ket, \\quad && L_n|\\psi_\\lambda\\ket=0 \n\\,\\,\\,(n>0), \\nn \\\\\n&J_0^a |\\psi_\\lambda\\ket=-t_\\lambda^a |\\psi_\\lambda\\ket, \\quad && \nJ_n^a |\\psi_\\lambda\\ket=0 \\,\\,\\, (n>0).", "\n\\label{FS}\\end{aligned}$$ Insertion of the relation into the l.h.s. ", "of the first equation in the above yields $$L_0|\\psi_\\lambda\\ket=\\frac{1}{2(k+h^{\\vee})}\\sum_{a=1}^{\\dim \\g}\n J_0^a J_0^a|\\psi_\\lambda\\ket=\n\\frac{1}{2(k+h^{\\vee})}\\sum_{a=1}^{\\dim\\g} t_\\lam^a t_\\lam^a|\\psi_\\lambda\\ket\n=\\frac{(\\lam,\\lam+2\\rho)}{2(k+h^{\\vee})}|\\psi_\\lambda\\ket.", "\n\\label{primary}$$ In the last equality we used the explicit form of the eigenvalue of the quadratic Casimir. ", "The quantity $\\rho$ denotes the Weyl vector, i.e. the sum of the fundamental weights $\\rho=\\sum_{i=1}^r \\Lambda_i$, where $r$ is the rank of $\\g$. Comparing the r.h.s. ", "in the first equation in with the above, we find $$h_\\lam=\\frac{(\\lam,\\lam+2\\rho)}{2(k+h^{\\vee})}.", "\n\\label{wt}$$\n\nSince the Virasoro generators are expressed in terms of affine generators as , the other arbitrary states are of the form $J_{-l_1}^a J_{-l_2}^b \\cdots |\\psi_\\lambda\\ket$ with $l_1, l_2\\dots$ positive integers. ", "Let $(L_{-l}\\psi_\\lambda)(z)$ and $(J_{-l}^a \\psi_\\lam)(z)$ be the descendent fields corresponding to the states $L_{-l}|\\psi_\\lam\\ket$ and $J_{-l}^a |\\psi_\\lam\\ket$, respectively. ", "Combining the OPE and the mode expansions , one finds that the correlation functions $\\bra (L_{-l}\\psi_\\lam)(z) X\\ket$ and $\\bra (J_{-l}^a \\psi_\\lam)(z) X\\ket$, where $X=\\prod_{i=1}^m \\psi_{\\lam_i}(z_i)$, satisfy the following equations: $$\\begin{aligned}\n{2}\n&\\bra (L_{-l}\\psi_\\lam)(z) X\\ket=\\mathcal{L}_{-l} \\bra \\psi_\\lam(z) X \\ket,\n\\quad &&\\mathcal{L}_{-l}=\\sum_{j=1}^m \\left[\\frac{(l-1)h_{\\lam_j}}{(z_j-z)^l}\n-\\frac{\\der_{z_j}}{(z_j-z)^{l-1}}\\right], \\nn \\\\\n&\\bra (J_{-l}^a \\psi_\\lam)(z) X\\ket=\\mathcal{J}_{-l}^a\\bra \\psi_\\lam(z) X \\ket,\n\\quad && \\mathcal{J}_{-l}^a=\\sum_{j=1}^m \\frac{t_{\\lam_j}^a}{(z_j-z)^l}.", "\n\\label{LJ-op}\\end{aligned}$$ Note that the global $G$-invariance requires $\\delta_\\omega \\bra \\psi_\\lam(z) X \\ket=0$. Using the Ward identity with constant $\\omega$ and the OPE , we obtain a relation satisfied by the correlation function: $$\\sum_{a=1}^{\\dim\\g}\\left(t_\\lam^a+\\sum_{j=1}^m t_{\\lam_j}^a\\right)\n\\bra \\psi_\\lam(z) X \\ket=0.", "\n\\label{global}$$ This constraint together with the global conformal invariance (or equivalently $SL(2,\\mathbb{C})$-invariance) fix the structure of the two- and three-points correlation functions.", "\n\nTo close this section, let us derive a crucial equation called Knizhnik-Zamolodchikov (KZ) equation [@KZ] satisfied by the correlation functions of the WZW primary fields. ", "The constraint stems from the fact that the Virasoro generators are not independent of the affine generators as in . ", "For $n=-1$, we have $L_{-1}=\\sum_{a=1}^{\\dim\\g} J_{-1}^a J_0^a/(k+h^{\\vee})$. Then a null state $|\\chi\\ket=0$ is given by $$|\\chi\\ket=\\left(L_{-1}+\\frac{1}{k+h^{\\vee}}\\sum_{a=1}^{\\dim\\g} t_\\lam^a \nJ_{-1}^a\\right) |\\psi_\\lam\\ket=0,$$ where we used the property in . ", "Using the field-state correspondence and inserting the property into the correlation functions $\\bra \\chi(z) X\\ket$, one obtains the KZ equation: $$\\left(\\der_{z}-\\frac{1}{k+h^{\\vee}}\\sum_{a=1}^{\\dim\\g}\n\\sum_{j=1}^m\\frac{t_\\lam^a t_{\\lam_j}^a}{z-z_j}\\right)\n\\bra \\chi(z) X\\ket=0.", "\n\\label{kz}$$ Here we used the translation invariance $(\\der_z +\\sum_{j=1}^m \\der_{z_j}) \\bra \\chi(z) X\\ket=0$, which can be easily verified from and the OPE by setting $\\epsilon(z)=\\epsilon$.\n\nMultiple SLEs for WZW models\n============================\n\nNow we generalize the SLE and for the system containing multiple random interfaces with additional Lie algebra symmetries. ", "In the infinitesimal time interval, we expect that each SLE interface grows under an independent martingale. ", "Let us discuss the case where the number of the interfaces is $m$. Then the uniformizing map $g_t(z)$ with the hydrodynamic normalization may be of the form [@BBK] (see also [@C3; @Dub; @Gra; @KL] for other approaches). ", "$$dg_t(z)=\\sum_{\\alpha=1}^m \\frac{2 dq_\\alpha}{g_t(z)-x_{\\alpha t}}, \\quad g_0(z)=z,\n\\label{geo-SLE}$$ where $dq_\\alpha$’s mean infinitesimal time intervals satisfying the condition $\\sum_{\\alpha=1}^m dq_\\alpha=dt$. The random processes $x_\\alpha$ ($1\\le\\alpha\\le m$), which play a role as driving forces for the growth of interfaces, should be written as the Itô stochastic differential equations: $$dx_{\\alpha t}=\\sqrt{\\kappa}d\\xi_{\\alpha t}+d F_{\\alpha t},\n\\label{geo-driving}$$ where $\\xi_{\\alpha t}$ is an $\\mathbb{R}^m$-valued Brownian motion whose expectation value and variance are, respectively, given by $$\\mathbf{E}[d {\\xi}_{\\alpha t}]=0, \\quad\n\\mathbf{E}[d\\xi_{\\alpha t} d\\xi_{\\beta t}]=\\delta_{\\alpha\\beta}dq_\\alpha.", "\n\\label{br1}$$ Namely $dq_\\alpha$ prescribes the growth rate of each interface. ", "The quantity $d F_{\\alpha t}$ denotes a drift term proportional to $d q_\\alpha$, which comes from interactions among interfaces, and will be determined later by the SLE martingale. ", "To extend to evolutions with Lie algebra symmetries, we define a stochastic process $\\exp[\\sum_a d\\theta_t^a(z) t^a]$ ($a=1,\\dots,\\dim\\g$) living on a Lie group manifold $G(z)$, where $\\theta^a_t(z)$ is written as $$d\\theta^a_t(z)=\\sum_{\\alpha=1}^m\\frac{dp^a_{\\alpha t}}{z-x_{\\alpha t}}, \n\\quad \\theta^a_0(z)=0\n\\label{alg-SLE}$$ with $$dp_{\\alpha t}^a=\\sqrt{\\tau} d\\vartheta_{\\alpha t}^a+dG_{\\alpha t}^a .", "\n\\label{alg-driving}$$ Here $\\vartheta_{\\alpha t}^a$ is an $\\mathbb{R}^{m \\dim\\g}$-valued Brownian motion with $$\\mathbf{E}[d\\vartheta^a_{\\alpha t} ]=0, \\quad\n\\mathbf{E}[d\\vartheta^a_{\\alpha t} d\\vartheta_{\\beta t}^b]=\n\\delta^{ab}\\delta_{\\alpha\\beta}dq_\\alpha,\n\\label{br2}$$ and $dG_{\\alpha t}^a$ stands for a drift term proportional to $dq_\\alpha$, which will also be determined later. ", "For $z=x_{\\beta t}$, we must define $$d\\theta_t^a(x_{\\beta t})=\\sum_{\\substack{\\alpha=1\\\\ \\alpha\\ne\\beta}}^m\n\\frac{dp^a_{\\alpha t}}{x_{\\beta t}-x_{\\alpha t}}.$$\n\nThe growth of interfaces with affine Lie algebra symmetries is described by both the geometric and the algebraic components.", "\n\nDrift terms and SLE martingales\n===============================\n\nThe remaining problem is to determine the drift terms appearing in the driving forces and in the Brownian motion . ", "To achieve it, we must evaluate the variation of the SLE martingale $\\mathcal{M}_t$ involving WZW primary fields. ", "For the WZW models, the SLE martingale is written as $$\\mathcal{M}_t=\n\\prod_{j=1}^{2n}\\left( \\frac{\\der y_{jt}}{\\der z_j} \\right)^{h_{\\mu_j}}\n\\frac{\\bra\\prod_{j=1}^{2n} \\phi_{\\mu_j}(y_{jt}) \\psi_{\\lam_1}(x_{1t})\\cdots\n\\psi_{\\lam_m}(x_{mt}) \\psi_{\\lam_{m+1}}(\\infty)\\ket}\n{\\bra\\psi_{\\lam_1}(x_{1t})\\cdots\\psi_{\\lam_m}(x_{mt}) \\psi_{\\lam_{m+1}}(\\infty)\\ket },\n\\label{mart-SLE}$$ where $y_{jt}=g_t(z_j)$ and $x_{\\alpha t}=g_t(w_\\alpha)$ (see section 2.1 for details). ", "Note that the primary fields $\\phi_{\\mu_j}$ and $\\psi_{\\lam_\\alpha}$ constructing the correlation function take values in the representation specified by the highest weights $\\mu_j$ and $\\lam_\\alpha$, respectively.", "\n\nThe drift terms are determined by the condition which makes $\\mathcal{M}_t$ to be a martingale. ", "To simplify the notations we sometimes omit the index $t$, $\\lam$ and $\\mu$ (e.g. $x_{\\alpha t}=x_\\alpha$, $\\theta_t^a=\\theta^a$, $\\psi_{\\lam_\\alpha}(x_\\alpha)=\n\\psi_\\alpha(x_\\alpha)$, $h_{\\lam_j}=h_j$, etc.), ", "if there is no ambiguity. ", "Let $Z_t$, $Z_t^\\phi$ and $J_t^\\phi$ be the denominator, numerator and Jacobian factor of , respectively. ", "First we explicitly compute $dJ_t^\\phi$. A simple manipulation leads to $$\\der_{q_\\alpha}\\left( \\frac{\\der y}{\\der z} \\right)^{h}=\nh \\left( \\frac{\\der y}{\\der z} \\right)^{h-1}\n\\der z\\left(\\frac{\\der y}{\\der q_\\alpha}\\right) \n=\nh\\left( \\frac{\\der y}{\\der z} \\right)^{h}\\der y\n\\left(\\frac{\\der y}{\\der q_\\alpha}\\right) \n=-\\left( \\frac{\\der y}{\\der z} \\right)^{h}\n\\frac{2h}{(y-x_\\alpha)^2},\n\\label{jacob}$$ where in the last equality, we applied the geometric component of the SLE . ", "Thus we obtain the variation of the Jacobian factor: $$d J_t^\\phi=-J_t^\\phi\\sum_{\\alpha=1}^m\n\\sum_{j=1}^{2n}\n\\frac{2h_j}{(y_j-x_\\alpha)^2} dq_\\alpha.", "\n\\label{der-Jacobi}$$\n\nNext we shall calculate $d (J_t^\\phi Z_t^\\phi)$. The Itô derivative of the bulk fields $\\phi(y)$ is given by $$\\begin{aligned}\nd \\phi(y)&=\\frac{\\der \\phi(y)}{\\der y}\\sum_{\\alpha=1}^m\\frac{\\der y}{\\der q_\\alpha} \ndq_\\alpha+\\sum_{a=1}^{\\dim\\g} t^a d\\theta^a(y)\n \\phi(y)\n+\\frac{1}{2}\\sum_{a=1}^{\\dim\\g} t^a d\\theta^a(y) \n \\sum_{b=1}^{\\dim\\g} t^b d\\theta^b(y)\n \\phi(y) \\nn \\\\\n&=\\sum_{\\alpha=1}^m\\left[ \\frac{2dq_\\alpha\\der_y}{y-x_\\alpha}+\n \\sum_{a=1}^{\\dim\\g}\n \\frac{dp_\\alpha^a t^a}{y-x_\\alpha}+\n \\frac{\\tau}{2}\\sum_{a=1}^{\\dim\\g}\n \\frac{dq_\\alpha t^a t^a}{(y-x_\\alpha)^2}\n\\right]\\phi(y).\\end{aligned}$$ Here we applied to the first term, and to the second and third terms. ", "For the third term we also used the property . ", "Similarly, for the boundary fields $\\psi_{\\alpha}(x_\\alpha)$, we obtain $$\\begin{aligned}\nd\\psi_{\\alpha}(x_\\alpha)&=\n\\left[dq_\\alpha\\frac{\\kappa}{2}\\der_{x_\\alpha}^2+dx_\\alpha\\der_{x_\\alpha} \n+\\sum_{a=1}^{\\dim\\g} t^a d\\theta^a(x_\\alpha)\n+\\frac{1}{2}\\sum_{a=1}^{\\dim\\g} t^a d\\theta^a(x_\\alpha) \n \\sum_{b=1}^{\\dim\\g} t^b d\\theta^b(x_\\alpha)\n\\right]\n \\phi_{\\alpha}(x_\\alpha) \n\\nn \\\\\n&=\\left[dq_\\alpha\\frac{\\kappa}{2}\\der_{x_\\alpha}^2+\nd x_\\alpha \\der_{x_\\alpha}\n+ \\sum_{a=1}^{\\dim\\g}\\sum_{\\substack{\\beta=1\\\\ \\beta\\ne\\alpha}}^m\n \\left(\\frac{dp_\\beta^a t_{\\alpha}^a}{x_\\alpha-x_\\beta}+\n \\frac{\\tau}{2}\n \\frac{dq_\\beta t_\\alpha^at_\\alpha^a}{(x_\\alpha-x_\\beta)^2}\\right)\n\\right]\\psi_{\\alpha}(x_\\alpha).\\end{aligned}$$ The above two relations together with give the form of $d(J_t^\\phi Z_t^\\phi)$. Explicitly it reads $$\\begin{aligned}\n\\frac{d(J_t^\\phi Z_t^\\phi)}{J_t^\\phi}=&\n\\sum_{\\alpha=1}^m dq_\\alpha\\left(\n\\frac{\\kappa}{2}\\mathcal{L}_{\\alpha,-1}^2-2\\mathcal{L}_{\\alpha,-2}+\n\\frac{\\tau}{2}\\sum_{a=1}^{\\dim\\g}\\J_{\\alpha,-1}^a\\J_{\\alpha,-1}^a\n\\right) Z_t^\\phi\\nn \\\\\n&\n+\\sum_{\\alpha=1}^m \\left(\n2\\widetilde{\\mathcal{L}}_{\\alpha,-2} dq_\\alpha\n+\\mathcal{L}_{\\alpha,-1} dx_\\alpha\n+\\sum_{a=1}^{\\dim\\g}\\J_{\\alpha,-1}^a dp_\\alpha^a \\right) Z_t^\\phi,\n\\label{num}\\end{aligned}$$ where we define $$\\begin{aligned}\n&\\mathcal{L}_{\\alpha,-l}=\\sum_{j=1}^n \n\\left(\n\\frac{(l-1)h_j}{(y_j-x_\\alpha)^l}-\\frac{\\der_{y_j}}{(y_j-x_\\alpha)^{l-1}}\n\\right)+\n\\sum_{\\substack{\\beta=1\\\\\\beta\\ne\\alpha}}^m\n\\left(\n\\frac{(l-1)h_\\beta}{(x_\\beta-x_\\alpha)^l}-\\frac{\\der_{x_\\beta}}{(x_\\beta-x_\\alpha)^{l-1}}\n\\right), \\nn \\\\\n&\\J_{\\alpha,-l}^{a}=\\sum_{j=1}^n\\frac{t_{\\lam_j}^a}{(y_j-x_\\alpha)^l}\n+\\sum_{\\substack{\\beta=1\\\\\\beta\\ne\\alpha}}^m\n\\frac{t_{\\lam_\\beta}^a}{(x_\\beta-x_\\alpha)^l},\n\\label{LJ-op2}\\end{aligned}$$ and $\\widetilde{\\mathcal{L}}$ (resp. ", "$\\widetilde{\\J}$) is given by subtracting the first sum depending on $y_j$ from the r.h.s. ", "of the first (resp. ", "second) equation in . ", "Note that the operator $\\mathcal{L}$ (resp. ", "$\\J$) characteristically appears in the correlation functions between a descendent field $(L_{-l} \\psi_{\\lam_\\alpha})(x_\\alpha)$ (resp. ", "$(J_{-l} \\psi_{\\lam_\\alpha})(x_\\alpha)$) and some composite primary field (see ). ", "To derive , we have also applied the identity $\\der_{x_\\alpha} Z_t^\\phi=\\mathcal{L}_{\\alpha,-1}Z_t^\\phi$, which comes from the translation invariance of the correlation functions (see the explanation below ).", "\n\nIn completely the same manner, $d Z_t$ can also be evaluated: $$\\begin{aligned}\ndZ_t=&\n\\sum_{\\alpha=1}^m dq_\\alpha\\left(\n\\frac{\\kappa}{2}\\widetilde{\\mathcal{L}}_{\\alpha,-1}^2-2\\widetilde{\\mathcal{L}}_{\\alpha,-2}+\n\\frac{\\tau}{2}\\sum_{a=1}^{\\dim\\g}\\widetilde{\\J}_{\\alpha,-1}^a\n \\widetilde{\\J}_{\\alpha,-1}^a\n\\right) Z_t\\nn \\\\\n&\n+\\sum_{\\alpha=1}^m \\left(\n2\\widetilde{\\mathcal{L}}_{\\alpha,-2} dq_\\alpha\n+\\widetilde{\\mathcal{L}}_{\\alpha,-1} dx_\\alpha\n+\\sum_{a=1}^{\\dim\\g}\\widetilde{\\J}_{\\alpha,-1}^a dp_\\alpha^a \\right) Z_t,\n\\label{den}\\end{aligned}$$\n\nBy construction, we must set $h_{\\lam_\\alpha}=h$ ($1\\le \\alpha\\le m$) for the conformal weights of the bcc operators. ", "Furthermore, due to the constraint between the conformal weight $h_\\lambda$ and the representation $\\lambda$ , all the bcc operators $\\psi_{\\lam_\\alpha}(x_\\alpha)$ except for $\\psi_{\\lam_{m+1}}(\\infty)$ must take values in the representation specified by $\\lam$, or its conjugate $\\lam^{\\ast}$ (note that $h_\\lam=h_{\\lam^{\\ast}}$ holds). ", "The conformal weight $h_{\\lam_{m+1}}$ for the bcc operator inserted at $\\infty$ is determined by fusion rules. ", "Thanks to this restriction, we can determine, in principle, the relation of the parameters $\\kappa$, $\\tau$ and the weight $h_\\lam$ of the bcc operators by considering the case that there is only a single interface ($m=1$) as in [@BGLW; @ABI]. ", "We see this in the next subsection.", "\n\nSingle case ($m=1$)\n-------------------\n\nFor the single SLE (set $\\alpha=1$ and $m=1$), one sees $d Z_t=0$ due to the translation invariance of the two-point correlation functions (it can also be obtained directly from by setting $m=1$). ", "Therefore the SLE martingale gives a constraint to the correlation function $Z_t^\\phi$, i.e. $\\mathbf{E}[d(J_t^\\phi Z_t^\\phi)]=0$. From the relation and the definitions and , one easily see that this restriction leads to $dF_1=0$, $dG_1^a=0$ and $$\\left(\n\\frac{\\kappa}{2}\\mathcal{L}_{\\alpha,-1}^2-2 \\mathcal{L}_{\\alpha,-2}\n+\\frac{\\tau}{2}\n\\sum_{a=1}^{\\dim\\g}\\J_{\\alpha,-1}^{a}\\J_{\\alpha,-1}^{a}\\right)Z_t^\\phi=0 \n\\quad (\\alpha=1).", "\n\\label{l2}$$\n\nNamely any drift terms do not show up in the driving forces and , as expected. ", "Moreover the constraint indicates that the bcc operators must have null states at level 2. ", "Namely $\\mathcal{M}_t$ is a martingale if and only if the bcc operators have the following null states at level 2: $$0=|\\chi\\ket:=\\left(\\frac{\\kappa}{2}L_{-1}^2-2 L_{-2}+\\frac{\\tau}{2} \\sum_{a=1}^{\\dim \\g}\nJ_{-1}^a J_{-1}^a\\right)|\\psi_{\\lam_1}\\ket.", "\n\\label{l2-null}$$ Here $L_n$ and $J_n^a$ are, respectively, the Virasoro and affine generators . ", "This is equivalent to the conditions $J_1^b |\\chi\\ket=0$ and $J_2^b|\\chi\\ket=0$, which respectively lead to $$\\left[\n(\\tau k-\\tau h^{\\vee}-2)J_{-1}^b+\\kappa J_0^b L_{-1}+i\\tau \n\\sum_{a,c}f^{ab}_{\\,\\,\\,\\,\\,\\,c}J_0^a J_{-1}^c\\right]|\\psi_{\\lam_1}\\ket=0,\n\\quad\n(\\kappa +\\tau h^{\\vee}-4)J_0^b|\\psi_{\\lam_1}\\ket=0.", "\n\\label{ns-condition}$$ This necessary and sufficient condition is rather involved. ", "For some simple cases (e.g. $\\su$), however, we can directly solve the above equations by acting the generator $J_1^d$. (Note that more elegant procedure utilizing the KZ-equation has been developed in [@ABI].)", "\n\nFor later convenience, here we explicitly write down the results for the $\\su$-WZW model. ", "The central charge $c$ and the conformal weight $h_{\\lam_1}$ of the bcc operator $\\psi_{\\lam_1}(x_1)$ in the spin-$j/2$ representation are, respectively, written as $$c=\\frac{3k}{k+2}, \\qquad h_{\\lam_1}=h_{j \\Lambda}=\\frac{j(j+2)}{4(k+2)},\n\\label{weight}$$ where $\\Lambda$ denotes the fundamental weight, and we used $h^{\\vee}=2$. From the direct evaluation of for $\\su$ case, one finds that the conditions in are valid only for the case that the bcc operator carries spin-1/2 ($j=1$) [@ABI]. ", "Then [@BGLW; @ABI] $$\\kappa=\\frac{4(k+2)}{k+3}, \\qquad \n\\tau=\\frac{2}{k+3} \\quad (k\\ge 2).", "\n\\label{kappa}$$ For $k=1$, $\\kappa$ and $\\tau$ can not be specified, and only the relation $\\kappa+2\\tau=4$ is imposed. ", "This case, however, corresponds to a $c=1$ CFT (cf. ), ", "and therefore we shall set $\\kappa=4$.\n\nMultiple case ($m>1$)\n---------------------\n\nNow we identified the bcc operators $\\psi_{\\lam_j}(z_j)$. Namely they have null states at level 2 and must satisfy the condition . ", "Utilizing the field-state correspondence, one finds that the first sums in and vanish. ", "Thus the drift term of the Itô derivative of the CFT correlation function $$d\\mathcal{M}_t=d\\left(\\frac{J_t^\\phi Z_t^\\phi}{Z_t}\\right)\n=\\frac{d(J_t^\\phi Z_t^\\phi)}{Z_t}-\\frac{J_t^\\phi Z_t^\\phi dZ_t}{Z_t^2}\n-\\frac{d(J_t^\\phi Z_t^\\phi )dZ_t}{Z_t^2}+\n\\frac{J_t^\\phi Z_t^\\phi (dZ_t)^2}{Z_t^3}$$ is explicitly given by $$\\begin{aligned}\n\\mathbf{E}[d\\mathcal{M}_t]=&J_t^\\phi \\sum_{\\alpha=1}^m\\left(dF_\\alpha -\n\\kappa dq_\\alpha \\der_{x_\\alpha}\\log Z_t\n-2\\sum_{\\substack{\\beta=1\\\\\\beta\\ne \\alpha}}^m\n\\frac{dq_\\beta }{x_\\alpha-x_\\beta}\n\\right)\\der_{x_\\alpha}\\left(\\frac{Z_t^\\phi}{Z_t}\\right) \\nn \\\\\n&\\qquad+\n\\frac{J_t^\\phi}{Z_t}\n\\sum_{\\alpha=1}^m\\sum_{a=1}^{\\dim\\g}\n\\left[\n\\left(dG_\\alpha^a-\n\\frac{\\tau dq_\\alpha}{Z_t}\\widetilde{J}^{a}_{\\alpha,-1}Z_t\n\\right)\\left(J_{\\alpha,-1}^a Z_t^\\phi-\n\\frac{Z_t^\\phi\\widetilde{\\J}_{\\alpha,-1}^a}{Z_t}Z_t\\right)\n\\right],\\end{aligned}$$ where we substituted the relations and . ", "By recalling that $\\mathcal{M}_t$ is the SLE martingale, the above quantity must be zero. ", "Thus one finds the drift terms $d F_\\alpha$ and $dG_{\\alpha}^a$ are described by the partition function $Z_t$: $$\\begin{aligned}\n&dF_\\alpha =\\kappa dq_\\alpha \\der_{x_\\alpha} \\log Z_t+\n2\\sum_{\\substack{\\beta=1\\\\\\beta\\ne \\alpha}}^m\n\\frac{dq_\\beta }{x_\\alpha-x_\\beta}, \\quad\ndG_\\alpha^a =\\frac{\\tau}{Z_t}\\sum_{\\substack{\\beta=1\\\\\\beta\\ne\\alpha}}^m\n\\frac{t_{\\lam_\\beta}^a Z_t}{x_\\beta-x_\\alpha}dq_\\alpha.\\end{aligned}$$\n\nMain claim\n----------\n\nTo summarize, we have constructed the multiple SLEs for $\\hat{\\mathfrak{g}}_k$-WZW models: $$\\begin{aligned}\n{2}\n&dg_t(z)=\\sum_{\\alpha=1}^m \\frac{2 dq_\\alpha}{g_t(z)-x_{\\alpha t}},&\\qquad&\nd x_{\\alpha t}=\\sqrt{\\kappa}d\\xi_{\\alpha t}+dF_{\\alpha t} \\nn \\\\\n& d\\theta_t^a(z)=\\sum_{\\alpha=1}^m\\frac{dp^a_{\\alpha t}}{z-x_{\\alpha t}},\n&& dp_{\\alpha t}^a=\\sqrt{\\tau} d\\vartheta_{\\alpha t}^a+dG_{\\alpha t}^a \n\\quad (1\\le a\\le\\dim(\\g)).", "\n\\label{sle-sum}\\end{aligned}$$ The drift terms $d F_{\\alpha t}$ and $dG_{\\alpha t}^a$ are given by $$\\begin{aligned}\n&dF_{\\alpha t} =\\kappa dq_\\alpha \\der_{x_{\\alpha t}} \\log Z_t+\n2\\sum_{\\substack{\\beta=1\\\\\\beta\\ne \\alpha}}^m\n\\frac{dq_\\beta }{x_{\\alpha t}-x_{\\beta t}}, \\quad\ndG_{\\alpha t}^a =\\frac{\\tau}{Z_t}\\sum_{\\substack{\\beta=1\\\\\\beta\\ne\\alpha}}^m\n\\frac{t_{\\lam_\\beta}^a Z_t}{x_{\\beta t}-x_{\\alpha t}}dq_\\alpha,\n\\label{driving-sum}\\end{aligned}$$ where $\\xi_{\\alpha t}$ (resp. ", "$\\vartheta_{\\alpha t}^a$) is the $\\mathbb{R}^m$ (resp. ", "$\\mathbb{R}^{m \\dim\\g}$)-valued Brownian motion whose expectation value and variance are given by $$\\begin{aligned}\n{2}\n&\\mathbf{E}[d \\xi_{\\alpha t}]=0, \\quad &&\n\\mathbf{E}[d\\xi_{\\alpha t} d\\xi_{\\beta t}]=\\delta_{\\alpha\\beta}dq_\\alpha, \\nn \\\\\n&\\mathbf{E}[d\\vartheta^a_{\\alpha t} ]=0, \\quad &&\n\\mathbf{E}[d\\vartheta^a_{\\alpha t} d\\vartheta_{\\beta t}^b]=\n\\delta^{ab}\\delta_{\\alpha\\beta}dq_\\alpha.\\end{aligned}$$ $Z_t$ is a partition function involving the bcc operators: $$Z_t=\n\\bra\\psi_{\\lam_1}(x_{1t})\\cdots\\psi_{\\lam_m}(x_{mt}) \n\\psi_{\\lam_{m+1}}(\\infty)\\ket,\n\\label{CFT-cor}$$ where all the bcc operators $\\psi_{\\lam_\\alpha}(x_\\alpha)$ except for $\\psi_{\\lam_{m+1}}(\\infty)$ must take values in representations specified by $\\lam$, or its conjugate $\\lam^{\\ast}$. The conformal weight $h_{\\lam_{m+1}}$ for the bcc operator inserted at $\\infty$ is determined by fusion rules (see next section for example). ", "The structure of the partition function is described by both the global $G$-invariance (cf. ), ", "and the KZ-equation (cf. ) ", "$$\\sum_{a=1}^{\\dim\\g} \\sum_{\\alpha=1}^{m+1} t_{\\lam_\\alpha}^a Z_t=0,\n\\quad\n\\left(\\der_{z_\\alpha}-\\frac{1}{k+h^{\\vee}}\n\\sum_{a=1}^{\\dim\\g}\n\\sum_{\\substack{\\beta=1\\\\\\beta\\ne\\alpha}}^{m}\n\\frac{t_{\\lam_\\alpha}^a t_{\\lam_\\beta}^a}{z_\\alpha-z_\\beta}\\right)\nZ_t=0.", "\n\\label{global2}$$\n\nMultiple SLEs for $\\su$-WZW models\n==================================\n\nAs a concrete application of our formula, let us consider multiple SLEs for the $\\su$-WZW model where the bcc operators carry spin-1/2, and discuss topologies for the SLE traces.", "\n\nFor the $\\su$ case, the fusion rules of the primary fields are similar to those in the minimal CFTs. ", "Therefore it is natural to extend the argument [@BBK] (see also [@Gra; @KL]) describing the geometric configurations of the SLE traces in minimal CFTs to the $\\widehat{\\mathfrak{su}}(2)_k$-WZW model. ", "Thus we make the following conjecture.", "\n\n\\[conj-config\\] There exists a one-to-one correspondence between topologically inequivalent configurations of $\\su$ multiple SLE traces and the independent solutions of the KZ-equation satisfied by the partition functions.", "\n\nWe describe this conjecture more specifically. ", "Let $x_\\alpha$ ($1\\le\\alpha\\le m$) be the positions where the $m$ SLE traces start to grow, and be ordered as $x_1<\\cdots<x_m<\\infty$. Consider the case that the traces eventually form $m-n$ disjoint curves in $\\mathbb{H}$ so that each point $x_\\alpha$ is an end point of exactly one curve and $\\infty$ is an end point of exactly $m-2n\\ge 0$ curves. ", "Namely $n$ disjoint curves form arches (more precisely $n$ pairs of growing curves hit each other’s tips and consequently form $n$ arches) and other $m-2n$ curves converge toward the point at $\\infty$ (see Fig.", " \\[config\\] for $m=4$ and $n=2$). ", "Then the number of topologically inequivalent configurations are given by $$c_{m,n}=\\binom{m}{n}-\\binom{m}{n-1}.$$ This is nothing but a Kostka number appearing as the coefficient of the irreducible decomposition for the $m$ tensor product of the $\\mathfrak{su}(2)$ fundamental representation $L_{\\Lambda}^{\\otimes m}$ into $L_{(m-2n)\\Lambda}$ ($L_{j \\Lambda}$ denotes the integral representation with the highest weight $j \\Lambda$, where $j\\in \\mathbb{Z}_{\\ge 0}$ and $\\Lambda$ is the fundamental weight of $\\mathfrak{su}(2)$): $$L_\\Lambda^{\\otimes m}=\\bigoplus_{n=0}^{\\lfloor m/2 \\rfloor} \nc_{m,n}L_{(m-2n)\\Lambda},\n\\label{su2}$$ where $\\lfloor x \\rfloor$ denotes the integer part of $x$.\n\nNow we mention that the relation between the geometric configurations and the CFT partition functions $Z$ (hereafter we omit the index $t$ to simplify the notation). ", "To this end, we consider the fusions of the $\\su$ primary fields: $$\\psi_{j_1 \\Lambda} \\otimes \\psi_{j_2 \\Lambda}=\n\\bigoplus_{\\substack{j_3=|j_1-j_2|\\\\ \n j_1+j_2+j_3\\equiv 0 \\mod 2}}^{\\min(j_1+j_2,2k-j_1-j_2)}\n \\psi_{j_3 \\Lambda},\n\\label{fusion}$$ where $\\psi_{j \\Lambda}$ stands for the $\\su$ bcc primary field taking values in the integral representation $L_{j \\Lambda}$. For sufficiently large $k$, the above rules reduce to the decomposition . ", "Applying the fusion procedures to the bcc operators $\\psi_{\\lam_\\alpha}$ ($1\\le\\alpha\\le m$) recursively, one can reduce $Z$ to a two point function involving the fusion operator and the bcc operator at $\\infty$. Thus, for the non-vanishing partition functions, the conformal weight $h_{\\lam_{m+1}}$ of the bcc operator $\\psi_{\\lam_{m+1}}(\\infty)$ must be equivalent to that of the fusion operator. ", "Fig.", " \\[fusion-fig\\] shows the possible conformal weight $h_{\\lam_{m+1}}$ up to $m=4$. Due to the fusion procedures , for sufficiently large $k$, one finds that the number of the paths from the left to $h_{(m-2n)\\Lambda}$ corresponds to the number of topologically distinct configurations for the SLE traces, i.e. $c_{m,n}$. For generic $k$, the number of paths is, in general, constrained by the fusion rules, which affects the structure of the partition functions, and therefore the realization of the geometric configurations.", "\n\n![", "Configurations for $m=4$ and $n=2$. There are two ($c_{4,2}=\\binom{4}{2}-\\binom{4}{1}=2$) topologically inequivalent configurations.[]{data-label=\"config\"}](config.eps){width=\"70.00000%\"}\n\nFor instance, the configuration where all the curves eventually converge toward $\\infty$ (i.e. no arches) corresponds to the path to the weight $h_{\\lam_{m+1}}=h_{m \\Lambda}$. By a standard argument for the CFT correlation functions, one obtains the corresponding partition function $Z$: $$Z=\n \\prod_{j<k}^m (x_j-x_k)^{\\frac{1}{2(k+2)}} \\quad \\text{ for $m \\le k$}.$$ One can easily check that this partition function satisfies the KZ-equation . ", "The factorized correlation function with the same exponents $1/(2(k+2))$ does not exist for $m> k$, indicating that the no-arch configuration is allowed only when $m \\le k$.\n\nDouble SLEs\n-----------\n\nAccording to the argument in [@BBK], we confirm our conjecture by considering the simplest case ($m=2$), where only two SLE traces exist in the upper half plane $\\mathbb{H}$. To analyze specifically, let us write down the partition function $Z$. Up to a constant factor, it is given by $$Z=\\bra \\psi_{\\lam_3}(\\infty) \\psi_\\Lambda(x_1) \\psi_{\\Lambda}(x_2)\\ket\n=\\lim_{x\\to\\infty} x^{2h_{\\lam_3}}\n\\bra \\psi_{\\lam_3}(x) \\psi_\\Lambda(x_1) \\psi_{\\Lambda}(x_2)\\ket=\n(x_1-x_2)^\\Delta,$$ where the exponent is $\\Delta=h_{\\lam_3}-2h_\\Lambda$. The fusion rules (see also Fig.", " \\[fusion-fig\\]) indicate that $h_{\\lam_3}=h_{2\\Lambda}$ ($k>1$) or $h_{\\lam_3}=0$ ($k\\ge 1$). ", "Then using the relation , one arrives at $\\Delta=1/(2(k+2))$ ($k>1$) or $\\Delta=-3/(2(k+2))$ ($k\\ge 1$). ", "Correspondingly the partition functions are $$Z_0=(x_1-x_2)^{-\\frac{3}{2(k+2)}} \\quad (k\\ge1), \n\\quad Z_2=(x_1-x_2)^{\\frac{1}{2(k+2)}} \\quad (k> 1).$$ By inserting them into and , the driving processes $dx_{1t}$ and $dx_{2t}$ characterizing the geometric aspects of the SLE traces become: $$\\begin{aligned}\n dx_{1t}=\\sqrt{a_1 \\kappa }dB_{1 t}+\\frac{2a_2+\\kappa\\Delta a_1}{x_{1t}-x_{2t}} dt, \\quad\n dx_{2t}=\\sqrt{a_2 \\kappa }dB_{2 t}+\\frac{2a_1+\\kappa\\Delta a_2}{x_{2t}-x_{1t}} dt,\\end{aligned}$$ where we normalized the variances by $dq_{\\alpha t}=a_\\alpha dt$ so that $d \\xi_{\\alpha_t}=\\sqrt{a_\\alpha }dB_{\\alpha t}$ with two independent standard Brownian motions: $\\mathbf{E}[d B_{\\alpha_t}]=0$ and $\\mathbf{E}[dB_{\\alpha_t} dB_{\\beta t}]=\\delta_{\\alpha \\beta} dt$. These driving processes with the SLE describe two curves emerging from two points $x_1=x_{1,0}$ and $x_{2,0}$. Setting $y_{s}=x_{1t}-x_{2t}$ and rescaling the time by $ds=\\kappa(a_1+a_2)dt$, we reduce the processes to the following Bessel process: $$dy_s=d B_s+\\frac{\\Delta+2/\\kappa}{y_s}ds$$ with the effective dimension $d_{\\rm eff}=2 \\Delta+4/\\kappa+1$. Substitution of the exponent $\\Delta$ and $\\kappa$ yields $$d_{\\rm eff}=\\begin{cases}\n 1 & \\text{ ($k=1$)} \\\\\n \\frac{2(k+1)}{k+2} &\\text{ ($k>1$)} \n \\end{cases}\n\\quad \\text{for $h_{\\lam_3}=0$}, \\quad\nd_{\\rm eff}=2+\\frac{2}{k+2} \\quad(k>1)\n\\quad \\text{for $h_{\\lam_3}=h_{2\\Lambda}$}.$$ Recalling that the Bessel process is recurrent (resp. ", "not recurrent) if $d_{\\rm eff}<2$ (resp. ", "$d_{\\rm eff}>2$) (see [@Law], for example), we conclude that the driving processes $x_{\\alpha t}$ hit each other with probability 1 for $h_{\\lam_3}=0$ and never hit for $h_{\\lam_3}=h_{2\\Lambda}$. The hit of the driving processes means the hit of the tips of the SLE traces, and hence the case for $h_{\\lam_3}=0$ describes a single curve (i.e. single arch) whose end points are $x_1$ and $x_2$, while the case for $h_{\\lam_3}\n=h_{2 \\Lambda}$ describes two curves converging to the point at $\\infty$. The above observation agrees with Conjecture \\[conj-config\\].", "\n\n![", "The fusion rules of the bcc operator $\\psi_{\\Lambda}$. The primary fields with weight $h_{\\lambda \\Lambda}$ for $\\lambda>k$ do not exist due to the fusion rules. ", "For instance, for $k=2$, the primary fields in the shadow area vanish.[]{data-label=\"fusion-fig\"}](fusion.eps){width=\"40.00000%\"}\n\nTriple SLEs and arch (crossing) probabilities\n---------------------------------------------\n\nLet us discuss a more non-trivial example: the triple SLEs ($m=3$). ", "The geometric properties are characterized by the partition function: $$Z=\\bra \\psi_{\\lam_4}(x_4)\n\\psi_{\\lam_3}(x_3)\\psi_{\\lam_2}(x_2)\\psi_{\\lam_1}(x_1) \\ket,$$ where $x_4=\\infty$ and by construction the bcc operators $\\psi_{\\lam_j}$ ($1\\le j\\le m$) take values in the fundamental representation $L_\\Lambda$. From the fusion rules (see also Fig.", " \\[fusion-fig\\]), the conformal weight $h_{\\lam_4}$ of the bcc operator $\\psi_{\\lam_4}(\\infty)$ inserted at $\\infty$ is $h_{\\lam_4}=h_{3\\Lambda}$ ($k\\ge 3$) or $h_{\\lam_4}=h_{\\Lambda}$ ($k\\ge 1$). ", "When the level takes its value in the range $k\\ge 3$ and $h_{\\lambda_4}=h_{3\\Lambda}$, there exists the factorized partition function with the same exponents $1/(2(k+2))$: $$Z=\\left[(x_2-x_1)(x_3-x_1)(x_3-x_2)\\right]^{\\frac{1}{2(k+2)}} \\quad (k \\ge 3).$$ According to Conjecture \\[conj-config\\], we expect that this partition function describes three curves converging toward $\\infty$.\n\n![", "Configurations for $m=3$ and $n=1$. There are two ($c_{3,1}=\\binom{3}{1}-\\binom{3}{0}=2$) topologically inequivalent configurations. ", "These configurations are described by the partition function involving the 4 bcc operators with the same conformal weights $h_\\Lambda$. The configuration in the left (resp. ", "right) panel is characterized by the partition function $Z_{\\rm C_1}$ (resp. ", "$Z_{\\rm C_2}$). []{", "data-label=\"config2\"}](config2.eps){width=\"70.00000%\"}\n\nThe case for $h_{\\lam_4}=h_{\\Lambda}$ is more interesting, because two topologically inequivalent configurations do exist (see Fig.", " \\[config2\\]). ", "By conformal mapping $f(z)=(z-x_1)(x_3-x_4)/((z-x_4)(x_3-x_1))$, the four points $x_j$ are transformed to the points $x_1\\to0$, $x_2\\to x$, $x_3\\to 1$ and $x_4\\to\\infty$, where $x=f(x_2)$. Thus the partition function $Z$ can be expressed as $$Z=((x_2-x_4)(x_1-x_3))^{-2 h_\\Lambda}Z(x), \\quad\nZ(x)=\\bra \\psi_\\Lambda(\\infty) \\psi_\\Lambda(1) \\psi_\\Lambda(x) \\psi_\\Lambda(0) \\ket.", "\n\\label{Z}$$ The correlation function $Z(x)$ can be calculated by solving the KZ-equation [@KZ; @FMS]. ", "Its explicit form reads $$Z(x)=Z_{\\rm C_1}(x)+Z_{\\rm C_2}(x)$$ with $$\\begin{aligned}\nZ_{{\\rm C_1}}(x)=F_1^{(-)}+\\frac{1-c_-}{c_+} F_1^{(+)}, \\quad\nZ_{{\\rm C_2}}(x)=F_2^{(-)}+\\frac{1-c_-}{c_+} F_2^{(+)},\n\\label{part}\\end{aligned}$$ where $F_j^{(\\pm)}$’s are expressed by the hypergeometric function ${}_2F_1$: $$\\begin{aligned}\n&F_1^{(-)}=x^{-2 h_\\Lambda}(1-x)^{h_{2\\Lambda}-2h_{\\Lambda}}\n{}_2F_1\\left(\\frac{1}{k+2},\\frac{-1}{k+2};\\frac{k}{k+2};x\\right), \\nn \\\\\n&F_1^{(+)}=x^{h_{2\\Lambda}-2h_\\Lambda}(1-x)^{h_{2\\Lambda}-2h_{\\Lambda}}\n{}_2F_1\\left(\\frac{1}{k+2},\\frac{3}{k+2};\\frac{k+4}{k+2};x\\right), \\nn \\\\\n&F_2^{(-)}=\\frac{1}{k} x^{1-2 h_\\Lambda}(1-x)^{h_{2\\Lambda}-2h_{\\Lambda}}\n{}_2F_1\\left(\\frac{k+3}{k+2},\\frac{k+1}{k+2};2\\frac{k+1}{k+2};x\\right), \\nn \\\\\n&F_2^{(+)}=-2 x^{h_{2\\Lambda}-2h_\\Lambda}(1-x)^{h_{2\\Lambda}-2h_{\\Lambda}}\n{}_2F_1\\left(\\frac{1}{k+2},\\frac{3}{k+2};\\frac{2}{k+2};x\\right), \\end{aligned}$$ and the coefficients $c_\\pm$ are respectively, given by $$c_-=2\\frac{\\Gamma(2/(k+2))\\Gamma(-2/(k+2))}{\\Gamma(1/(k+2))\\Gamma(-1/(k+2))}, \\quad\nc_+=-2 \\frac{\\Gamma^2(2/(k+2))}{\\Gamma(3/(k+2))\\Gamma(1/(k+2))}.$$ Note that $Z_{\\rm C_1}(x)$ and $Z_{\\rm C_2}(x)$ satisfy the relation $Z_{\\rm C_1}(x)=Z_{\\rm C_2}(1-x)$. For $k=1$, $c_-=1$ holds[^4], and then the partition functions reduce to simple forms $$Z_{{\\rm C_1}}(x)=x^{-1/2}(1-x)^{1/2}, \\quad Z_{{\\rm C_2}}(x)=x^{1/2}(1-x)^{-1/2}.$$ For generic $k$, the behaviors of the partition functions close to the position $x=0$ and $x=1$ are described as $$Z_{{\\rm C}_1}(x)\\sim \\begin{cases}\n x^{-2h_\\Lambda} & \\text{ $x\\to0$} \\\\\n (1-x)^{h_{2\\Lambda}-2h_\\Lambda} &\\text{ $x\\to 1$}\n \\end{cases},\n\\quad\nZ_{{\\rm C}_2}(x)\\sim \\begin{cases}\n x^{h_{2\\Lambda}-2h_\\Lambda} & \\text{ $x\\to0$} \\\\\n (1-x)^{-2h_\\Lambda} &\\text{ $x\\to 1$}\n \\end{cases}.$$ Thus the fusion rules and Conjecture \\[conj-config\\] imply that $Z_{\\rm C_1}$ describes two curves connecting the points $[0x]$ and $[1\\infty]$ (configuration ${\\rm C_1}$; see the left panel in Fig \\[config2\\]) while $Z_{{\\rm C_2}}$ corresponds to the configuration $[\\infty 0]$ and $[x1]$ (configuration ${\\rm C_2}$; see the right panel in Fig \\[config2\\]).", "\n\n![", "Arch configurations in a domain $\\mathcal{D}$ obtained by applying a conformal transformations $u(z)$ to the configurations in Fig.", " \\[config2\\] ($u_j$ denotes $u_j=u(x_j)$). ", "The probability of the occurrence of the configuration (a) (resp. (", "b)) is exactly the same as that of the occurrence of the configuration (a) (resp. (", "b)) in Fig.", " \\[config2\\].[]{data-label=\"crossing-fig\"}](crossing.eps){width=\"85.00000%\"}\n\nUtilizing the partition functions , we can exactly compute the probability $\\mathbf{P}[{\\rm C_1}]$ (resp. ", "$\\mathbf{P}[{\\rm C_2}]$) of the occurrence of the configuration ${\\rm C_1}$ (resp. ", "${\\rm C_2}$) with the initial condition that the three curves emerging from the point $x_1=0$, $x_2=x$, $x_3=1$ by $$\\mathbf{P}[{\\rm C_1}]=\\frac{Z_{\\rm C_1}(x)}{Z_{\\rm C_1}(x)+Z_{\\rm C_2}(x)}, \\quad\n\\mathbf{P}[{\\rm C_2}]=\\frac{Z_{\\rm C_2}(x)}{Z_{\\rm C_1}(x)+Z_{\\rm C_2}(x)}.$$ (See [@BBK; @Koz] for similar formulas for minimal CFTs.) ", "Since the measure is conformally invariant, the probabilities in arbitrary (simply connected) domain $\\mathcal{D}$ can be easily reproduced by use of $Z(x)$ and the conformal map $u(z)$ mapping $\\mathbb{H}$ to $\\mathcal{D}$. More explicitly, the probability $\\mathbf{P}[{\\rm C}_1]$ (resp. ", "$\\mathbf{P}[{\\rm C}_2]$) is exactly the same as that of the occurrence of the configuration with two curves joining the boundary points $[u_1 u_2]$ and $[u_3 u_4]$ (resp. ", "$[u_1 u_4]$ and $[u_2 u_3]$) on $\\der \\mathcal{D}$ (see Fig.", " \\[crossing-fig\\]) (note that $u_j$ stands for $u_j=u(x_j)$ $(1\\le j \\le 4$)). ", "In this sense, the arch probabilities can be interpreted as crossing probabilities of the interfaces. ", "For $k=1$, the formula becomes very simple: $$\\mathbf{P}[{\\rm C_1}]=1-x \\quad (k=1).$$ In Fig.", " \\[arch-fig\\], the arch probabilities $\\mathbf{P}[{\\rm C_1}]$ are depicted for several values of $k$. As shown in Fig.", " \\[arch-fig\\], the $x$-dependence of the arch probabilities close to $1/2$ in the wide range of $x$, as increasing $k$.\n\n![", "The crossing probabilities $\\mathbf{P}[{\\rm C}_1]$ for various level $k$.[]{data-label=\"arch-fig\"}](arch.eps){width=\"70.00000%\"}\n\nAcknowledgment {#acknowledgment .unnumbered}\n==============\n\nThe present work was partially supported by Grants-in-Aid for Young Scientists (B) No. ", "21740285 and for Scientific Research (C) No. ", "24540393 from Japan Society for the Promotion of Science.", "\n\nO. Schramm, Isr. ", "J. Math. [**", "118**]{} (2000) 221. ", "\\[arXiv:math/9904022v2\\]. ", "S. Rohde and O. Schramm, Ann. ", "Math. [**", "161**]{} (2005) 879. ", "\\[arXiv:math/0106036v4\\]. ", "W. Werner, [*Random planar curves and Schramm-Loewner evolutions*]{}, in [*Lectures on probability theory and statistics*]{}, Lecture Notes in Mathematics vol. ", "1840, pp 107-195, Springer, Berlin, 2004. ", "\\[arXiv:math/0303354v1\\]. ", "W. Kager and B. Nienhuis, J. Stat. ", "Phys. [**", "115**]{} (2004) 1149. ", "\\[arXiv:math-ph/0312056v3\\]. ", "J. Cardy, Ann. ", "Phys. [**", "318**]{} (2005) 81. ", "\\[arXiv:cond-mat/0503313v2 \\]. ", "G.F. Lawler,[*Conformally invariant processes in the plane*]{}, Mathematical Surveys and Monographs, vol. ", "114, American Mathematical Society, Providence, RI, 2005. ", "M. Bauer and D. Bernard, Phys. ", "Rep. [**432**]{} (2006) 115. ", "\\[arXiv:math-ph/0602049v1\\]. ", "I.A. Gruzberg, J. Phys. ", "A: Math. ", "Gen. [**39**]{} (2006) 12601. ", "\\[arXiv:math-ph/0607046v2\\]. ", "S. Smirnov, Proc. ", "Int. ", "Congr. ", "Math. [**", "2**]{} (2006) 1421. ", "\\[arXiv:0708.0032v1\\]. ", "M. Bauer and D. Bernard, Phys. ", "Lett. ", "B [**543**]{} (2002) 135. ", "\\[arXiv:math-ph/0206028v3\\]. ", "M. Bauer and D. Bernard, Comm. ", "Math. ", "Phys. [**", "239**]{} (2003) 493. ", "\\[arXiv:hep-th/0210015v3\\]. ", "R. Friedrich and W. Werner, C.R. Acad. ", "Sci. ", "Paris, Ser. ", "I Math. [**", "335**]{} (2002) 947. ", "\\[arXiv:math/0209382v2\\]. ", "R. Friedrich and W. Werner, Comm. ", "Math. ", "Phys. [**", "243**]{} (2003) 105. ", "\\[arXiv:math-ph/0301018v3\\]. ", "M. Bauer and D. Bernard, Phys. ", "Lett. ", "B [**557**]{} (2003) 309. ", "\\[arXiv:hep-th/0301064v2\\]. ", "M. Bauer and D. Bernard, Ann. ", "Henri. ", "Poincaré [**5**]{} (2004) 289. ", "\\[arXiv:math-ph/0305061v1\\]. ", "M. Bauer and D. Bernard, Phys. ", "Lett. ", "B [**583**]{} (2004) 324. ", "\\[arXiv:math-ph/0310032v1\\]. ", "M. Bauer, D. Bernard, K. Kytölä, J. Stat. ", "Phys. [**", "120**]{} (2005) 1125. ", "\\[arXiv:math-ph/0503024v2\\]. ", "A.A. Belavin, A.M. Polyakov, A.B. Zamolodchikov, Nucl. ", "Phys. ", "B [**241**]{} (1984) 333. ", "P. Di Francesco, P. Mathieu, and D. Sénéchal, [*Conformal Field Theory*]{}, Springer, New York, 1997. ", "S.P. Novikov, Usp. ", "Mat. ", "Nauk [**37**]{} (1982) 3. ", "E. Witten, Comm. ", "Math. ", "Phys. [**", "92**]{} (1984) 455. ", "V.G. Knizhnik and A.B. Zamolodchikov, Nucl. ", "Phys. ", "B [**247**]{} (1984) 83. ", "E. Bettelheim, I.A. Gruzberg, A.W.W. Ludwig and P. Wiegmann, Phys. ", "Rev. Lett [**95**]{} (2005) 251601. ", "\\[arXiv:hep-th/0503013v3\\]. ", "A. Alekseev, A. Bytsko and K. Izyurov, Lett. ", "Math. ", "Phys. [**", "97**]{} (2011) 243. ", "\\[arXiv:1012.3113v2\\]. ", "J. Rasmussen, Afr. ", "J. Math. ", "Phys. [**", "4**]{} (2007) 1. ", "\\[arXiv:hep-th/0409026v2\\]. ", "J. Rasmussen, Lett. ", "Math. ", "Phys. [**", "68**]{} (2004) 41. ", "\\[arXiv:math-ph/0312010v1\\]. ", "J. Rasmussen, J. Stat. ", "Mech. (", "2004) P09007. ", "\\[arXiv:math-ph/0408011v2\\]. ", "J. Nagi and J. Rasmussen, Nucl. ", "Phys. ", "B [**704**]{} (2005) 475. ", "\\[arXiv:math-ph/0407049v1\\]. ", "R. Santachiara, Nucl. ", "Phys. ", "B [**793**]{} (2008) 396. ", "\\[arXiv:0705.2749v2\\]. ", "A. Nazarov, JETP Lett. [**", "96**]{} (2012) 93-96. ", "\\[arXiv:1205.6104v1\\]. ", "A. Nazarov, J. Phys: Conf. ", "Ser. [**", "343**]{} (2012) 012085. ", "\\[arXiv:1112.4354v1\\]. ", "J. Cardy, Nucl. ", "Phys. ", "B [**240**]{} (1984) 514. ", "J. Cardy, J. Phys. ", "A: Math. ", "Gen. [**36**]{} (2003) L379. ", "\\[arXiv:math-ph/0301039v49\\]. ", "J. Dubédat, Comm. ", "Pure Appl. ", "Math. [**", "60**]{} (2007) 1792. ", "\\[arXiv:math/0411299v4\\]. ", "K. Graham, J. Stat. ", "Mech. (", "2007) P03008. ", "\\[arXiv:math-ph/0511060v1\\]. ", "M.J. Kozdron and G.F. Lawler, Fields Inst. ", "Comm. [**", "50**]{} (2007) 199. ", "\\[arXiv:math/0605159v2\\]. ", "M.J. Kozdron, J. Phys. ", "A: Math. ", "Gen. [**42**]{} (2009) 265003. ", "\\[arXiv:0905.2430v1\\].", "\n\n[^1]: E-mail: sakai@gokutan.c.u-tokyo.ac.jp\n\n[^2]: The identity $\\bra \\Phi'_1(z'_1)\\cdots \\Phi'_n(z'_n) \\ket=\n \\bra \\Phi_1(z'_1)\\cdots \\Phi_n(z'_n) \\ket$ holds for a global conformal map $z\\to z'=f(z)$, where the field $\\Phi_j(z_j)$ transforms as $\\Phi_j(z_j)\\to\\Phi_j'(z_j')$ [@FMS].", "\n\n[^3]: Here we use the orthonormal basis in terms of the Killing form: $K(J_n^a,J_m^b)=\\delta_{n+m,0}\\delta^{a,b}$. In that case, the structure constants can be written as $f^{ab}_{\\,\\,\\,\\,\\,\\,c}=f_{abc}$, where $f_{abc}$ is antisymmetric in all three indices.", "\n\n[^4]: Thus the second terms in vanish. ", "In fact, this is a consequence that primary fields with weight $h_{2\\Lambda}$ do not exist for $k=1$.\n" ]

{ "pile_set_name": "ArXiv" }

[ 0.005434782608695652, 0, 0.006329113924050633, 0.01948051948051948, 0.0064516129032258064, 0, 0.0049504950495049506, 0.01020408163265306, 0.008968609865470852, 0.0048543689320388345, 0.03436426116838488, 0.004301075268817204, 0.010869565217391304, 0.00975609756097561, 0, 0.0029498525073746312, 0, 0, 0, 0.0472972972972973, 0.01, 0.008875739644970414, 0, 0.013605442176870748, 0.0035971223021582736, 0, 0.011029411764705883, 0.05737704918032787, 0, 0, 0.012552301255230125, 0.005434782608695652, 0, 0, 0.004545454545454545, 0.00684931506849315, 0.011904761904761904, 0.0136986301369863, 0.005128205128205128, 0.012448132780082987, 0, 0, 0.009900990099009901, 0, 0.010526315789473684, 0, 0.014388489208633094, 0.025974025974025976, 0.009345794392523364, 0.004153686396677051, 0, 0.004524886877828055, 0, 0.013888888888888888, 0, 0.003472222222222222, 0.0014771048744460858, 0.014705882352941176, 0, 0.0044943820224719105, 0.004166666666666667, 0.014925373134328358, 0.008547008547008548, 0, 0, 0.0028011204481792717, 0.020134228187919462, 0, 0, 0.16666666666666666, 0, 0.015463917525773196, 0.005272407732864675, 0.013605442176870748, 0, 0.009881422924901186, 0.008, 0.006060606060606061, 0.009111617312072893, 0, 0, 0.010282776349614395, 0, 0, 0.00909090909090909, 0, 0, 0.004424778761061947, 0.0055248618784530384, 0.013008130081300813, 0.008928571428571428, 0, 0.011494252873563218, 0.008547008547008548, 0.0037735849056603774, 0.010752688172043012, 0.010638297872340425, 0.009174311926605505, 0.022727272727272728, 0.00411522633744856, 0, 0.0055248618784530384, 0, 0.007751937984496124, 0.0034965034965034965, 0.005494505494505495, 0.008771929824561403, 0.008602150537634409, 0, 0, 0, 0, 0, 0.008316008316008316, 0, 0.007863695937090432, 0, 0.004859611231101512, 0, 0, 0, 0, 0, 0, 0, 0.004491017964071856, 0.0029585798816568047, 0, 0.00819672131147541, 0, 0.004166666666666667, 0.004651162790697674, 0, 0, 0, 0.01020408163265306, 0.006472491909385114, 0, 0.004761904761904762, 0, 0.002028397565922921, 0.022222222222222223, 0.008264462809917356, 0, 0, 0, 0.005512679162072767, 0.011111111111111112, 0.00461361014994233, 0.002070393374741201, 0.01818181818181818, 0.005506607929515419, 0, 0, 0.0038910505836575876, 0.0037174721189591076, 0, 0.02, 0, 0.004464285714285714, 0, 0.002857142857142857, 0.004761904761904762, 0, 0.0034924330616996507, 0.008695652173913044, 0, 0.25, 0.0019083969465648854, 0, 0.0031496062992125984, 0.005235602094240838, 0, 0, 0.0033400133600534404, 0, 0.007142857142857143, 0, 0, 0, 0.002898550724637681, 0, 0.002570694087403599, 0, 0, 0, 0, 0.0106951871657754, 0, 0.007978723404255319, 0.019417475728155338, 0.006343452650657001, 0, 0.007633587786259542, 0, 0, 0, 0.09090909090909091, 0, 0.012048192771084338, 0.01791044776119403, 0, 0, 0.016666666666666666, 0, 0, 0.010638297872340425, 0.00847457627118644, 0, 0.0035971223021582736, 0.022222222222222223, 0.017543859649122806, 0.10526315789473684, 0.08333333333333333, 0, 0, 0.06666666666666667, 0, 0, 0, 0.0125, 0, 0, 0.08571428571428572, 0, 0, 0, 0.13333333333333333, 0, 0, 0, 0.02830188679245283, 0.017241379310344827, 0.06451612903225806, 0, 0, 0.08333333333333333, 0, 0, 0, 0.05555555555555555, 0, 0, 0, 0, 0, 0.06451612903225806, 0.16666666666666666, 0, 0, 0.06451612903225806, 0, 0, 0, 0, 0.07692307692307693, 0, 0, 0, 0, 0, 0.058823529411764705, 0, 0, 0, 0, 0.06451612903225806, 0.16666666666666666, 0, 0, 0.06666666666666667, 0, 0, 0, 0.06451612903225806, 0.16666666666666666, 0, 0, 0.09523809523809523, 0, 0, 0, 0.05454545454545454, 0, 0, 0.029411764705882353, 0.05263157894736842, 0, 0, 0.058823529411764705, 0, 0, 0, 0.045454545454545456, 0, 0, 0.05970149253731343, 0.027777777777777776, 0, 0.08888888888888889, 0, 0, 0, 0, 0.10526315789473684, 0.1111111111111111, 0, 0, 0, 0.1, 0, 0, 0, 0, 0.08695652173913043, 0, 0, 0, 0.0625, 0, 0, 0, 0.045454545454545456, 0, 0, 0, 0.038461538461538464, 0, 0.043478260869565216, 0, 0, 0.041666666666666664, 0, 0.0625, 0, 0, 0.10526315789473684, 0, 0, 0, 0.05555555555555555, 0, 0, 0, 0, 0.1, 0, 0, 0, 0.06976744186046512, 0, 0, 0, 0.08695652173913043, 0, 0, 0.045454545454545456, 0.006896551724137931, 0.0038314176245210726, 0, 0 ]

[ "Q:\n\nnode Async push loop\n\nI have a async function I want to execute for i in a range. ", "I tried this :\nvar async = require('async');\n\nfunction main(a, b){\n\n var funcs = [];\n\n for(var i=a; i<=b; i++){\n var txt = \"func \"+i;\n\n funcs.push(function(callback){\n console.log(i);\n console.log(txt);\n callback(null, null);\n });\n }\n\n async.parallelLimit(funcs, 10, function(){\n console.log(\"done\");\n });\n\n}\n\nmain(1,5);\n\nand the output is :\n6\nfunc 5\n6\nfunc 5\n6\nfunc 5\n6\nfunc 5\n6\nfunc 5\ndone\n\nwhy i have not \"func 6\" ??? ", "and btw I want 1 2 3 4 5 ...\nThanks\n\nA:\n\nYour functions will be executed after loop is done. ", "So after loop i will be equal 6, and txt will be equal func 5. ", "Put content of your loop into closure to fix it:\nfor(var i=a; i<=b; i++){\n (function(i) {\n var txt = \"func \"+i;\n\n funcs.push(function(callback){\n console.log(i);\n console.log(txt);\n callback(null, null);\n });\n })(i);\n}\n\nPS In ECMAScript 6 (upcoming specification of JavaScript) there are let variables which resolve this problem.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0.004024144869215292, 0, 0, 0.007712082262210797, 0 ]

[ "Colorado Moves to Make Marijuana Edibles Safer After Man’s Death, Consumption by Kids\n\nOn March 10, a college student from Wyoming bought four marijuana cookies for herself and her three friends at the 16th Street Mall in Denver.", "\n\nLate into the night, restless and exhibiting erratic behavior, 19-year-old Levy Thamba leapt over the fourth-floor railing of a Holiday Inn into the lobby. ", "He was pronounced dead at 3:51 a.m. Thamba’s tragic death highlighted the deceptive nature of THC-infused foods: They affect the human body later in time after ingestion than smoked bud.", "\n\nThe case is not the only disturbing episode connected to marijuana edibles since Colorado opened up the market for legal recreational marijuana eight months ago. ", "Some children have gotten their hands on edibles, and landed in the emergency room, while one man who allegedly killed his wife—and faces a first-degree murder charge—was said to have eaten pot candy beforehand. ", "The incidents have prompted changes in marijuana policies that are intended to make edibles safer to consume, keep them away from minors, and educate Coloradans and visitors on the differences between marijuana food and pot that you smoke.", "\n\nEating an edible is not like taking a shot of whiskey or smoking marijuana, said Ron Kammerzell, senior director of enforcement with the Colorado Department of Revenue. “", "You need to give yourself enough time to make sure you are feeling the effects of marijuana before you consume additional edibles,” he said in a phone interview.", "\n\nWhile the effects of smoked bud are rather immediate, edibles are deceptive because it can take hours to feel anything from the THC, the psychoactive ingredient in marijuana. ", "Thamba, a native of Africa who was on spring break from Northwest College in Powell, Wyoming, may not have known that.", "\n\nBessie Gondwe, one of his college friends with whom he was staying at the Holiday Inn, told Denver police she had purchased the cookies and it was the first time she believed Thamba had ingested marijuana. ", "During a search of the hotel room, police found wrappers with labels that identified the marijuana products as “Sweet Grass Kitchen, lemon poppy seed cookie.” ", "Gondwe and another friend staying in the room with Thamba told authorities the college students had begun eating the cookies around midnight. ", "Each of the four cookies contained 65 milligrams (mg) of THC, or the equivalent of 6.5 servings; an employee at the marijuana store advised the students that they should split the cookie into six pieces and eat one piece at a time, according to the police report.", "\n\nBut Thamba revealed he wasn’t feeling anything from the marijuana cookie so he ate the rest of the edible all at once, Gondwe told police. ", "Later in the night, the police report detailed, Thamba exhibited strange behaviour—screaming, speaking in French, apologizing for criminal behaviour that he had not committed, smashing fixtures and finally jumping off the balcony.", "\n\nThamba’s autopsy report said the cause of death was the result of “multiple injuries due to a fall from a height” and listed “marijuana intoxication” as “a significant contributing factor.” ", "The college friends weren’t aware that Thamba had consumed any alcohol or other drugs, and other than detecting THC in his system, the blood results revealed no other “positive findings of toxicological significance.”", "\n\nLimiting THC in Each Edible\n\nIn the wake of his death, Colorado regulators have adopted rules that are designed to encourage marijuana edible companies to make pot treats that contain no more than 10 mg of THC. ", "Under emergency rules that were adopted on August 1, if a marijuana edible is more than 10 mg and up to 100 mg, “you have to score it or demark it in such a way that it is intuitively obvious to the consumer how to break off a serving size of that edible,” said Kammerzell of the Colorado Department of Revenue.", "\n\nState regulators also gave marijuana edible makers an incentive to make products containing no more than 10 mg. ", "If they do so, their products will be tested for potency fewer times than other edibles. ", "Even before the emergency rule was adopted, a number of manufacturers had moved toward individual serving sizes of 10 mg, Kammerzell said.", "\n\n“There is no lethal dose for marijuana other than maybe a 500-pound brick of it falling on your head, but we don’t want people to have a bad experience or get to the point where they are not functional,” said Andy Williams, president of Medicine Man, a marijuana dispensary in Denver.", "\n\nAs part of a responsible vendor training program modeled after one administered by the state’s liquor enforcement division, it is expected that marijuana establishments will educate consumers on the differences between eating an edible and smoking marijuana.", "\n\nWilliams and the owner of a recreational marijuana dispensary north of Boulder said their employees, or budtenders as they are affectionately known, already warn customers about edibles – “We take the extra step at the counter to really educate people on how to use them safely, how to get familiar with the effect of edibles,” said Dylan Donaldson of Karing Kind, who estimated edibles constitute 30 to 40 percent of sales on an average day. “", "It is quite different. ", "It’s a whole other beast.”", "\n\nProtecting Kids from Inadvertent Consumption\n\nThat beast has sickened some kids in Colorado. ", "Since recreational marijuana was legalized on Jan. 1, “Children’s [Hospital] Colorado has treated 13 children, six of whom became critically ill from edible marijuana,” said Natalie Goldstein, a spokeswoman with the hospital, in an email last month.", "\n\nIn a May interview with the Denver Post, Michael DiStefano, the medical director of the hospital’s emergency department, said a number of children who accidentally ingested marijuana had been admitted for sedation or agitation and one child suffered breathing problems that required a respirator.", "\n\nEarlier this year, a 10-year-old boy in Greeley, Colorado admitted to selling marijuana to other students on the playground while another child came to school with a THC-infused candy bar, according to CBS4. ", "The kids reportedly obtained the pot from home where it was purchased by their grandparents.", "\n\nEdibles today hardly are limited to the marijuana brownies of the 1990s. ", "Other than the THC, the treats are the same ones kids savor at home and school: cookies, gummy bears, Lollipops.", "\n\n“In Colorado, there is almost no limit to what marijuana can be put into whether that is infused or baked or sprayed,” said Rachel O’Bryan of Smart Colorado, an organization that is dedicating to protecting Colorado youth and advocates for policies that limit early marijuana consumption. ", "Said state Rep. Frank McNulty: “Many of these marijuana edibles look just like kids’ snacks.”", "\n\nThe Colorado Marijuana Enforcement Division requires that a seal be placed on packaging of marijuana products, but “that doesn’t mean anything to most kids or parents,” said McNulty, a Republican who represents Highlands Ranch, a suburb south of Denver.", "\n\nColorado lawmakers have moved to solve the problem. ", "House Bill 1366, signed in May by Gov. John Hickenlooper, required that Colorado’s state licensing authority convene a stakeholder group to discuss recommendations on how to make edibles clearly identifiable.", "\n\nMembers of the working group include a wide range of interests from law enforcement representatives and a school resource officer to a marijuana baker and testing facility owner. ", "An initial meeting was held on Aug. 1, and a second meeting is scheduled for Sept. 11 in Denver. ", "Rules will be adopted no later than January 2016.", "\n\n“It’s going to be a challenging topic for sure,” Kammerzell said. ", "But the edibles rule, once implemented, could save Colorado kids from unnecessary trips to the ER." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0.006329113924050633, 0.010752688172043012, 0, 0, 0, 0.011627906976744186, 0, 0.005649717514124294, 0.00847457627118644, 0.009615384615384616, 0, 0.014084507042253521, 0.0038022813688212928, 0.0070921985815602835, 0, 0, 0.009216589861751152, 0.004694835680751174, 0.006430868167202572, 0, 0, 0.007246376811594203, 0.006993006993006993, 0, 0.006726457399103139, 0, 0, 0.010526315789473684, 0.004016064257028112, 0.006711409395973154, 0.004761904761904762, 0, 0, 0.017857142857142856, 0.003436426116838488, 0.010752688172043012, 0.011764705882352941, 0, 0.014423076923076924, 0.0055248618784530384, 0, 0, 0.014705882352941176, 0.01020408163265306 ]

[ "Child Sexual Abuse Perpetrators: What Forensic Nurses Need to Know.", "\nChild sexual abuse is a problem of epidemic proportions resulting in lifelong physical and mental health consequences for victims. ", "Most child sexual abuse victims never disclose and do not receive needed treatment. ", "Clearly, pediatric healthcare providers must understand the dynamics of child sexual abuse to better identify and protect potential victims. ", "Forensic nurses are at the forefront of caring for victims of sexual abuse and are strong voices in the education of parents, community members, and other healthcare professionals regarding sexual abuse. ", "Forensic nurses with a deeper understanding of child sexual abuse perpetrators will be better able to educate the public and advocate for children at risk for sexual abuse. ", "In this article, specific types of child sexual abuse perpetration will be explored, and implications for forensic nursing will be discussed." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0, 0, 0 ]

[ "Bible believers are beside themselves about the prospect that marriage norms and laws are changing, but let me tell you a secret about Bible believers that I know because I was one. ", "Most don’t actually read their Bibles.", "\n\nIf they did, they would know that the biblical model of sex and marriage has little to do with the one they so loudly defend. ", "Sex in the Bible includes rape, incest, master-slave sexual relations, captive virgins, and more. ", "Of course, just because a story is told in the Bible doesn’t mean it is intended as a model for moral behavior. ", "Does God forbid or command the behavior? ", "Is it punished or rewarded? ", "In the New Testament stories, does Jesus change the rules or leave them alone? ", "By these criteria, the Bible not only describes many forms of sexual relationships (including sexually coercive relationships), it gives them the divine thumbs up.", "\n\nNot One Man, One Woman\n\nThe God of the Bible explicitly endorses polygamy and sexual slavery and coerced marriage of young virgins along with monogamy. ", "In fact, he endorses all three to the point of providing detailed regulations. ", "Based on stories of sex and marriage that God rewards and appears to approve one might add incest to the mix of sexual contact that receives divine sanction.", "\n\nNew Testament Endorses Old Testament\n\nNowhere does the Bible say, “Don’t have sex with someone who doesn’t want to have sex with you.” ", "Consent, in the Bible, is not a thing. ", "Furthermore, none of the norms that are endorsed and regulated in the Old Testament law – polygamy, sexual slavery, coerced marriage of young girls—are revised, reversed, or condemned by Jesus. ", "In fact, the writer of Matthew puts these words in the mouth of Jesus:\n\nDo not think that I have come to abolish the Law or the Prophets; I have not come to abolish them but to fulfill them. ", "I tell you the truth, until heaven and earth disappear, not the smallest letter, not the least stroke or a pen, will by any means disappear from the Law [the Old Testament] until everything is accomplished. (", "Matthew 5:17-18)\n\nThe Law of which Jesus speaks is the Law of Moses, or the Torah, and anyone who claims the Bible as the perfect word of an omniscient, omnipotent, omnibenevolent God should have the decency to read the Torah carefully—and then keep going.", "\n\nPolygamy. ", "Polygamy is a norm in the Old Testament and accepted in the New Testament. ", "Biblicalpolygamy.com has pages dedicated to 40 biblical figures, each of whom had multiple wives. ", "The list includes patriarchs like Abraham and Isaac. ", "King David, the first king of Israel may have limited himself to eight wives, but his son Solomon, reputed to be the wisest man who ever lived had 700 wives and 300 concubines! (", "1 Kings 11)\n\nSex Slaves. ", "Concubines are sex slaves, and the Bible gives instructions on acquisition of several types of sex slaves, although the line between biblical marriage and sexual slavery is blurry. ", "A Hebrew man might, for example, sell his daughter to another Hebrew, who then has certain obligations to her once she is used. ", "For example, he can’t then sell her to a foreigner. ", "Alternately a man might see a virgin war captive that he wants for himself.", "\n\nWar Booty. ", "In the book of Numbers (31:18) God’s servant commands the Israelites to kill all of the used Midianite women who have been captured in war, and all of the boy children, but to keep all of the virgin girls for themselves. ", "The Law of Moses spells out a purification ritual to prepare a captive virgin for life as a concubine. ", "It requires her owner to shave her head and trim her nails and give her a month to mourn her parents before the first sex act (Deuteronomy 21:10-14). ", "A Hebrew girl who is raped can be sold to her rapist for 50 shekels, or about $580 (Deuteronomy 22:28-29). ", "He must then keep her as one of his wives for as long as she lives.", "\n\nBrother’s Wife. ", "A man might acquire multiple wives whether he wanted them or not if his brother died. ", "In fact, if a brother dies with no children, it becomes a duty to impregnate his wife. ", "In the book of Genesis, Onan is struck dead by God because he fails to fulfill this duty – preferring to spill his seed on the ground rather than providing offspring for his brother (Genesis 38:8-10). ", "A New Testament story shows that the tradition has survived. ", "Jesus is a rabbi, and a group of scholars called Sadducees try to test his knowledge of Hebrew Law by asking him this question:\n\nTeacher,” they said, “Moses told us that if a man dies without having children, his brother must marry the widow and raise up offspring for him. ", "Now there were seven brothers among us. ", "The first one married and died, and since he had no children, he left his wife to his brother. ", "The same thing happened to the second and third brother, right on down to the seventh. ", "Finally, the woman died. ", "Now then, at the resurrection, whose wife will she be of the seven, since all of them were married to her?” (", "Matthew 22:24-28).", "\n\nJesus is too clever for them and points out that in Heaven, that place of perfect bliss, there is no marriage.", "\n\nHaving a brother act as a sperm donor isn’t the only biblical solution to lack of offspring. ", "The patriarch Abraham is married to his half-sister Sarah, but the two are childless for the first 75 years or so of their marriage. ", "Frustrated, Sarah finally says, “The LORD has kept me from having children. ", "Go, sleep with my slave; perhaps I can build a family through her.” ", "Her slave, Hagar, becomes pregnant, and then later Sarah does too and the story gets complicated (Genesis 16). ", "But that doesn’t stop Abraham’s grandson Jacob from participating in a competition, in which his two wives repeatedly send in their slaves to get pregnant by him, each trying to get more sons than the other (Genesis 30:1-22).", "\n\nBible Believers or Simply Change-Averse?", "\n\nThese stories might be irrelevant to the question of biblical marriage were it not that Bible believers keep telling us that God punishes people when he dislikes their sexual behavior. ", "He disliked the behavior of New Orleans gays so much, according to Pat Robertson, that he sent a hurricane to drown the whole city – kind of like Noah’s flood. ", "And yet, according to the Bible story, both Abraham and Jacob were particularly beloved and blessed by God.", "\n\nThe point is that marriage has changed tremendously since the Iron Age when the Bible was written. ", "For centuries, concubines and polygamy were debated by Christian leaders – accepted by some and rejected by others. ", "The nuclear family model so prized by America’s fundamentalist Christians emerged from the interplay between Christianity and European cultures including the monogamous tradition of the Roman Empire. ", "As humanity’s moral consciousness has evolved, coerced sex has become less acceptable even within marriage while intertribal and interracial marriage has grown in acceptance. ", "Today even devout Bible believers oppose sexual slavery. ", "Marriage, increasingly, is a commitment of love, freely given. ", "Gay marriage is simply a part of this broader conversation, and opposition on the part of Bible believers has little to do with biblical monogamy.", "\n\nSince many Christians haven’t read the whole Bible, most “Bible believers” are not, as they like to claim, actually Bible believers. ", "Biblical literalists, even those who think themselves “nondenominational,” almost all follow some theological tradition that tells them which parts of the Bible to follow and how. ", "Granted, sometimes even decent people do get sucked into a sort of text worship that I call bibliolatry, and Bible worship can make a person’s moral priorities as archaic and cruel as those of the Iron Age tribesmen who wrote the texts. (", "I once listened, horrified, while a sweet, elderly pair of Jehovah’s Witnesses rationalized the Old Testament slaughter of children with the same words Nazis used to justify the slaughter of Jewish babies.)", "\n\nBut many who call themselves Bible believers are simply, congenitally conservative – meaning change-resistant. ", "What really concerns them is protecting the status quo, an ancient hierarchy with privileged majority-culture straight males at the top, which they justify by invoking ancient texts. ", "Freedom to marry will expand, as will other rights related to sexuality, reproduction, and family formation; and these Bible believers will adapt to these changes as they have others: reluctantly, slowly and with angry protests, but in the end accepting the new normal, and perhaps even insisting that it was God’s will all along.", "\n\n————-\n\nMore from the Bible at Awaypoint:\n\nMandrakes and Dove Blood: Biblical Healthcare Anyone?", "\n\nIf the Bible Were Law, Would You Qualify For the Death Penalty?", "\n\nWhat the Bible Says About Rape and Rape Babies\n\nWoman’s Hanging and Burning of Dog Biblical\n\nValerie Tarico is a psychologist and writer in Seattle, Washington and the founder of Wisdom Commons. ", "She is the author of “Trusting Doubt: A Former Evangelical Looks at Old Beliefs in a New Light” and “Deas and Other Imaginings.” ", "Her articles can be found at Awaypoint.Wordpress.com." ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.005235602094240838, 0, 0.01171875, 0, 0.02666666666666667, 0.01020408163265306, 0.03773584905660377, 0, 0, 0, 0, 0, 0, 0, 0.004524886877828055, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.015037593984962405, 0.013157894736842105, 0, 0.018018018018018018, 0, 0, 0, 0.0125, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0048543689320388345, 0, 0, 0, 0, 0, 0.02030456852791878, 0.007751937984496124, 0.018867924528301886 ]

[ "Q:\n\nHow to make a button pattern?", "\n\nI'm trying to make a little puzzle game in HTML5 and I'm having trouble figuring out how to make a puzzle. ", "In the puzzle you have to click the squares in a certain order to beat it. ", "I don't know how to make it to where you have to click the buttons in order and if you don't you'll lose. ", "\n<!", "DOCTYPE html>\n<html>\n <head>\n <title>Room Two</title>\n <link rel=\"stylesheet\" type=\"text/css\" href=\"youtubeGame.css\">\n\n <link rel=\"stylesheet\" type=\"text/css\" href=\"https://fonts.googleapis.com/css?family=Tangerine|Inconsolata|Droid+Sans|Oxygen|Ubuntu|Coming+Soon\">\n </head>\n <body>\n <div id=\"content\">\n <h1 id=\"roomNum\">Room 2</h1>\n <p id=\"roomInfo\">Once again the door seems to magically close behind \nyou.<br /> Unlike the stone floor from the previous room, this one is divided up \ninto wooden slabs.<br /> You press your foot onto a slab. ", "It slides down, and an \narrrow shoots from the roof.<br /> You barely get out of the way but somehow you \ndodge it. ", "You tell yourself to watch your step...</p>\n\n <p id=\"step\"></p>\n\n <p id=\"step2\"></p>\n\n <div class=\"menu-container\" id=\"puzzle\">\n <div class=\"button-container\">\n <a href=\"#\" class=\"button\" onclick=\"wrongStep()\">1</a>\n <a href=\"#\" class=\"button\" onclick=\"correctStep6()\">2</a>\n <a href=\"#\" class=\"button\" onclick=\"correctStep7()\">3</a>\n <a href=\"#\" class=\"button\" onclick=\"wrongStep()\">4</a>\n <a href=\"#\" class=\"button\" onclick=\"correctStep5()\">5</a>\n <a href=\"#\" class=\"button\" onclick=\"correctStep4()\">6</a>\n <a href=\"#\" class=\"button\" onclick=\"correctStep1()\">7</a>\n <a href=\"#\" class=\"button\" onclick=\"correctStep2()\">8</a>\n <a href=\"#\" class=\"button\" onclick=\"correctStep3()\">9</a>\n </div>\n </div>\n </div>\n\n <br><br>\n\n <div id=\"death\">\n <a href=\"youtubeGame.html\">Try Again?</a>\n </div>\n\n <a href=\"roomThree.html\" id=\"nextRoom\">Next Room</a>\n\n <script type=\"text/javascript\">\n\n document.getElementById(\"death\").style.display = \"none\";\n\n document.getElementById(\"nextRoom\").style.display = \"none\";\n\n function correctStep1() {\n return true; \n }\n function correctStep2() {\n return true;\n }\n\n function correctStep3() {\n return true;\n }\n\n function correctStep4() {\n return true;\n }\n\n function correctStep5() {\n return true;\n }\n\n function correctStep6() {\n return true;\n }\n\n function correctStep7() {\n return true;\n }\n\n function wrongStep() {\n document.getElementById(\"content\").style.display = \"none;\"\n\n document.getElementById(\"puzzle\").style.display = \"none\";\n\n document.getElementById(\"death\").style.display = \"block\";\n\n document.getElementById(\"roomNum\").innerHTML = \"You Have \nDied\";\n\n document.getElementById(\"roomInfo\").style.display = \"none\";\n }\n\n </script>\n </body>\n</html>\n\nPlease help me fix this\n\nA:\n\nA very simple way would be to save the correct order in an array and if the user clicks, increment a clickcounter and check if the clicked button is at this position in the array:\nvar state = {\n clickedButtons:[]\n};\nvar correctClickSettings = {\n order:[7,8,9,6,5,2,3],\n resetOn:7 // order has 7 elements, so the user have to click 7 buttons, after that it will be checked and the clicked buttons will be resolved or rejected\n};\n// called from every button that can be clicked to solve the game\nfunction onClick(evt) {\n evt = evt || window.event;\n var sourceButtonText = this.innerText;\n state.clickedButtons.push(sourceButtonText);\n if(state.clickedButtons.length >= correctClickSettings.resetOn) {\n var distanceBetweenArrays = state.clickedButtons.reduce((cur,val,idx)=>cur+Math.abs(val-correctClickSettings.order[idx]),0);\n if(distanceBetweenArrays > 0) {\n wrongStep();\n state.clickedButtons = [];\n } else {\n alert('This was right!');", "\n }\n }\n}\n\nThis solution has one problem: Everybody with a little bit of understanding for javascript can open the webpage and read out the solution. ", "So if you want to do it a little better (not so easaly cheatable) you have to use another solution:\nYou can use a hash instead of an array of button clicks as correct order:\nfunction simpleHash(currentHash, idx, sourceButtonText) {\n currentHash = currentHash*137+parseInt(sourceButtonText,10);\n}\n\nNow simply calculate the correct solution value: 46672273550408 (in your case)\nNow with every button click calculate the next hash and compare it after 7 steps with the solution.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0.009174311926605505, 0, 0, 0, 0.0016366612111292963, 0, 0.0032943995208146153, 0, 0, 0 ]

[ "The present invention relates to methods or devices for encoding structured documents, particularly XML documents, in which a bit stream is generated from a structured document as a function of a schema, and a method or device for decoding, in which a structured document is generated from a bit stream as a function of a schema.", "\nIn the context of the work on the MPEG-7 standard, a method for binary encoding of XML data was developed which is referred to as the BiM method in the following and which is known, for example, from the publication ISO/IEC FDIS 15938-1:2001(E), “Information Technology—Multimedia Content Description Interface—Part 1: Systems.” ", "This method uses XML schema definitions which are available at the encoder and the decoder, such as the MPEG-7 schema, in order to generate the codes for the individual data elements of the XML description. ", "A precondition for this method is that the same schema definitions are available at least in part to the encoder and the decoder. ", "This can be ensured, for example, if a standardized XML schema is permanently installed in the decoder. ", "Moreover, the possibility exists of transferring the schema to the decoder separately or in addition to the actual document. ", "The transmission of the schema from the encoder to the decoder can be carried out in textual form, where standard text compression, such as ZIP, can be applied.", "\nThe present invention is directed toward specifying methods or devices in such a way that the transmission of the schema is carried out particularly efficiently and the dataset transmitted and the computing performance at the decoder, which is needed for generating the code tables from the schema, is reduced. ", "Moreover, the consistency of a schema which has not been transmitted in full should be ensured." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0.0030303030303030303, 0, 0, 0, 0, 0, 0, 0 ]

[ "Video: How an arts-loving schoolgirl so beautiful she was mistaken for Brigitte Bardot ended her life as the tragic first Mrs Reggie Kray\n\nTom, who plays Reggie and Ronnie, in the new Kray biopic can be seen proposing to Frances Shea, played by Emily Browning at a South East London location." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.02054794520547945 ]

[ "<?", "xml version=\"1.0\" encoding=\"utf-8\"?", ">\r\n<xsd:schema\n\ttargetNamespace=\"http://schemas.openxmlformats.org/officeDocument/2006/custom-properties\"\n\txmlns=\"http://schemas.openxmlformats.org/officeDocument/2006/custom-properties\"\n\txmlns:xsd=\"http://www.w3.org/2001/XMLSchema\"\n\txmlns:vt=\"http://schemas.openxmlformats.org/officeDocument/2006/docPropsVTypes\"\n\tblockDefault=\"#all\" elementFormDefault=\"qualified\"\r\n\txmlns:jaxb=\"http://java.sun.com/xml/ns/jaxb\"\r\n\txmlns:xjc=\"http://java.sun.com/xml/ns/jaxb/xjc\" jaxb:version=\"2.1\">\r\n\t\n\t<!-- ", "\n\t****************************************************************\n\t*** ***\n\t*** customProperties ***\n\t*** ***\n\t****************************************************************\n\t\n\t::::::::::::::\n\tdocProps/custom.xml\n\t::::::::::::::\n\t\n\t<?", "xml version=\"1.0\" encoding=\"UTF-8\"?", ">\n\t\n\t<Properties xmlns=\"http://schemas.openxmlformats.org/officeDocument/2006/custom-properties\" xmlns:vt=\"http://schemas.openxmlformats.org/officeDocument/2006/docPropsVTypes\">\n\t<property fmtid=\"{D5CDD505-2E9C-101B-9397-08002B2CF9AE}\" pid=\"2\" name=\"transformSequenceNumber\">\n\t<vt:lpwstr>5</vt:lpwstr>\n\t</property>\n\t<property fmtid=\"{D5CDD505-2E9C-101B-9397-08002B2CF9AE}\" pid=\"3\" name=\"Grouping\">\n\t<vt:lpwstr>EachBlock</vt:lpwstr>\n\t</property>\n\t<property fmtid=\"{D5CDD505-2E9C-101B-9397-08002B2CF9AE}\" pid=\"4\" name=\"CheckinMessageEnabled\">\n\t<vt:lpwstr>false</vt:lpwstr>\n\t</property>\n\t</Properties>\r\n\t\t\r\n\t\t\t\r\n To generate the classes from /src/main/resources$ \t\r\n\t\t\r\n\t sh ~/jaxb/jaxb-ri-20070917/bin/xjc.sh THIS.xsd -d ../java/ -no-header -target 2.0\r\n\t\t\n\t\n\t-->\n\t\n\t<xsd:import\n\t\tnamespace=\"http://schemas.openxmlformats.org/officeDocument/2006/docPropsVTypes\"\n\t\tschemaLocation=\"shared-documentPropertiesVariantTypes.xsd\"/>\n\t\r\n\t<xsd:annotation>\r\n\t\t<xsd:appinfo>\r\n\t\t\t<xsd:appinfo>\r\n\t\t\t\t<jaxb:globalBindings>\r\n\t\t\t\t</jaxb:globalBindings>\r\n\t\t\t</xsd:appinfo>\r\n\t\t\t<jaxb:schemaBindings>\r\n\t\t\t\t<!-- ", "can be overridden on the command line with -p -->\r\n\t\t\t\t<!-- ", "A schema scope covers all the schema elements in the\r\n\t\t\t\t*target namespace* of a schema. ", " [JAXB 2.1 Spec 7.4.1]\r\n\t\t\t\t\r\n\t\t\t\tSince all the relevant bits of wordml are in a\r\n\t\t\t\tsingle namespace, this means we can't put for\r\n\t\t\t\texample the table elements in a table package. --", ">\r\n\t\t\t\t<jaxb:package name=\"org.docx4j.docProps.custom\"/>\r\n\t\t\t</jaxb:schemaBindings>\r\n\t\t</xsd:appinfo>\r\n\t</xsd:annotation>\r\n\t\r\n\t\n\t<xsd:element name=\"Properties\">\n\t\t<xsd:annotation>\n\t\t\t<xsd:documentation>Custom File Properties</xsd:documentation>\n\t\t</xsd:annotation>\n\t\t<xsd:complexType>\n\t\t\t<xsd:sequence>\n\t\t\t\t<xsd:element name=\"property\" minOccurs=\"0\" maxOccurs=\"unbounded\">\n\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t<xsd:documentation>Custom File\n\t\t\t\t\t\t\tProperty</xsd:documentation>\n\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t<xsd:complexType>\n\t\t\t\t\t\t<xsd:choice minOccurs=\"1\" maxOccurs=\"1\">\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:vector\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>\n\t\t\t\t\t\t\t\t\t\tVector</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:array\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>Array</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:blob\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>Binary\n\t\t\t\t\t\t\t\t\t\tBlob</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:oblob\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>Binary Blob\n\t\t\t\t\t\t\t\t\t\tObject</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:empty\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>Empty</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:null\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>Null</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:i1\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>1-Byte Signed\n\t\t\t\t\t\t\t\t\t\tInteger</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:i2\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>2-Byte Signed\n\t\t\t\t\t\t\t\t\t\tInteger</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:i4\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>4-Byte Signed\n\t\t\t\t\t\t\t\t\t\tInteger</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:i8\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>8-Byte Signed\n\t\t\t\t\t\t\t\t\t\tInteger</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:int\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>\n\t\t\t\t\t\t\t\t\t\tInteger</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:ui1\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>1-Byte Unsigned\n\t\t\t\t\t\t\t\t\t\tInteger</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:ui2\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>2-Byte Unsigned\n\t\t\t\t\t\t\t\t\t\tInteger</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:ui4\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>4-Byte Unsigned\n\t\t\t\t\t\t\t\t\t\tInteger</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:ui8\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>8-Byte Unsigned\n\t\t\t\t\t\t\t\t\t\tInteger</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:uint\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>Unsigned\n\t\t\t\t\t\t\t\t\t\tInteger</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:r4\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>4-Byte Real\n\t\t\t\t\t\t\t\t\t\tNumber</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:r8\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>8-Byte Real\n\t\t\t\t\t\t\t\t\t\tNumber</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:decimal\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>\n\t\t\t\t\t\t\t\t\t\tDecimal</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:lpstr\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>LPSTR</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:lpwstr\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>\n\t\t\t\t\t\t\t\t\t\tLPWSTR</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:bstr\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>Basic\n\t\t\t\t\t\t\t\t\t\tString</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:date\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>Date and\n\t\t\t\t\t\t\t\t\t\tTime</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:filetime\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>File\n\t\t\t\t\t\t\t\t\t\tTime</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:bool\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>\n\t\t\t\t\t\t\t\t\t\tBoolean</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:cy\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>\n\t\t\t\t\t\t\t\t\t\tCurrency</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:error\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>Error Status\n\t\t\t\t\t\t\t\t\t\tCode</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:stream\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>Binary\n\t\t\t\t\t\t\t\t\t\tStream</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:ostream\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>Binary Stream\n\t\t\t\t\t\t\t\t\t\tObject</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:storage\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>Binary\n\t\t\t\t\t\t\t\t\t\tStorage</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:ostorage\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>Binary Storage\n\t\t\t\t\t\t\t\t\t\tObject</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:vstream\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>Binary Versioned\n\t\t\t\t\t\t\t\t\t\tStream</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:clsid\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>Class\n\t\t\t\t\t\t\t\t\t\tID</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t\t<xsd:element ref=\"vt:cf\">\n\t\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t\t<xsd:documentation>Clipboard\n\t\t\t\t\t\t\t\t\t\tData</xsd:documentation>\n\t\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t\t</xsd:element>\n\t\t\t\t\t\t</xsd:choice>\n\t\t\t\t\t\t<xsd:attribute name=\"fmtid\" use=\"required\"\n\t\t\t\t\t\t\ttype=\"vt:ST_Clsid\">\n\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t<xsd:documentation>Format ID</xsd:documentation>\n\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t</xsd:attribute>\n\t\t\t\t\t\t<xsd:attribute name=\"pid\" use=\"required\" type=\"xsd:int\">\n\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t<xsd:documentation>Property\n\t\t\t\t\t\t\t\t\tID</xsd:documentation>\n\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t</xsd:attribute>\n\t\t\t\t\t\t<xsd:attribute name=\"name\" use=\"optional\"\n\t\t\t\t\t\t\ttype=\"xsd:string\">\n\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t<xsd:documentation>Custom File Property\n\t\t\t\t\t\t\t\t\tName</xsd:documentation>\n\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t</xsd:attribute>\n\t\t\t\t\t\t<xsd:attribute name=\"linkTarget\" use=\"optional\"\n\t\t\t\t\t\t\ttype=\"xsd:string\">\n\t\t\t\t\t\t\t<xsd:annotation>\n\t\t\t\t\t\t\t\t<xsd:documentation>Bookmark Link\n\t\t\t\t\t\t\t\t\tTarget</xsd:documentation>\n\t\t\t\t\t\t\t</xsd:annotation>\n\t\t\t\t\t\t</xsd:attribute>\n\t\t\t\t\t</xsd:complexType>\n\t\t\t\t</xsd:element>\n\t\t\t</xsd:sequence>\n\t\t</xsd:complexType>\n\t</xsd:element>\n</xsd:schema>" ]

{ "pile_set_name": "Github" }

[ 0, 0.02857142857142857, 0.012195121951219513, 0, 0.02857142857142857, 0.0027472527472527475, 0, 0, 0, 0.0003899142188718482 ]

[ "/*\n * Copyright (c) 2011 LinkedIn, Inc\n * \n * Licensed under the Apache License, Version 2.0 (the \"License\"); you may not\n * use this file except in compliance with the License. ", "You may obtain a copy of\n * the License at\n * \n * http://www.apache.org/licenses/LICENSE-2.0\n * \n * Unless required by applicable law or agreed to in writing, software\n * distributed under the License is distributed on an \"AS IS\" BASIS, WITHOUT\n * WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. ", "See the\n * License for the specific language governing permissions and limitations under\n * the License.", "\n */\n\npackage cleo.search.bootstrap;\n\nimport java.util.", "ArrayList;\nimport java.util.", "Collections;\nimport java.util.", "Comparator;\nimport java.util.", "List;\n\nimport cleo.search.connection.", "ConnectionFilter;\nimport cleo.search.store.", "ArrayStoreWeights;\nimport cleo.search.util.", "ConnectionStrengthHandler;\nimport cleo.search.util.", "Weight;\nimport cleo.search.util.", "Weights;\n\n/**\n * WeightedConnectionsStoreConnectionStrengthHandler\n * \n * @author jwu\n * @since 06/13, 2011\n */\npublic class WeightedConnectionsStoreConnectionStrengthHandler implements ConnectionStrengthHandler {\n private final ArrayStoreWeights weightedConnectionsStore;\n private final ConnectionFilter connectionFilter;\n private final long timestamp;\n \n public WeightedConnectionsStoreConnectionStrengthHandler(ArrayStoreWeights weightedConnectionsStore, ConnectionFilter connectionFilter, long timestamp) {\n this.weightedConnectionsStore = weightedConnectionsStore;\n this.connectionFilter = connectionFilter;\n this.timestamp = timestamp;\n }\n \n public final ArrayStoreWeights getWeightedConnectionsStore() {\n return weightedConnectionsStore;\n }\n \n public final ConnectionFilter getConnectionFilter() {\n return connectionFilter;\n }\n \n @Override\n public void handle(int source, int[] connections, int[] strengths) throws Exception {\n if(source >= 0) {\n int[][] weightData = null;\n if(weightedConnectionsStore.hasIndex(source)) {\n weightData = weightedConnectionsStore.getWeightData(source);\n }\n \n int[][] newWeightData = new int[][]{connections, strengths};\n \n try {\n List<Weight> weightList = merge(source, weightData, newWeightData);\n weightedConnectionsStore.setWeightData(source, weightList, timestamp);\n } catch (Exception e) {\n e.printStackTrace();\n }\n }\n }\n \n static Comparator<Weight> weightCmpDsc = new Comparator<Weight>() {\n @Override\n public int compare(Weight w0, Weight w1) {\n return w1.elementWeight - w0.elementWeight;\n }\n };\n \n protected List<Weight> merge(int source, int[][] oldWeightData, int[][] newWeightData) {\n ArrayList<Weight> oldList = new ArrayList<Weight>();\n ArrayList<Weight> newList = new ArrayList<Weight>();\n \n if(oldWeightData !", "= null) {\n int[] elemIds = oldWeightData[ArrayStoreWeights.", "ELEMID_SUBARRAY_INDEX];\n int[] weights = oldWeightData[ArrayStoreWeights.", "WEIGHT_SUBARRAY_INDEX];\n for(int i = 0, cnt = elemIds.length; i < cnt; i++) {\n if(connectionFilter.accept(source, elemIds[i], true)) {\n oldList.add(new Weight(elemIds[i], weights[i]));\n }\n }\n }\n \n if(newWeightData !", "= null) {\n int[] elemIds = newWeightData[ArrayStoreWeights.", "ELEMID_SUBARRAY_INDEX];\n int[] weights = newWeightData[ArrayStoreWeights.", "WEIGHT_SUBARRAY_INDEX];\n for(int i = 0, cnt = elemIds.length; i < cnt; i++) {\n if(connectionFilter.accept(source, elemIds[i], true)) {\n newList.add(new Weight(elemIds[i], weights[i]));\n }\n }\n }\n \n List<Weight> list = Weights.merge(oldList, newList);\n Collections.sort(list, weightCmpDsc);\n return list;\n }\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.016853932584269662, 0.009584664536741214, 0.009615384615384616, 0, 0.03571428571428571, 0.03333333333333333, 0, 0, 0.023255813953488372, 0, 0.0196078431372549, 0.03125, 0.004199475065616798, 0, 0, 0, 0, 0, 0.0028011204481792717 ]

[ "//* This file is part of the MOOSE framework\n//* https://www.mooseframework.org\n//*\n//* All rights reserved, see COPYRIGHT for full restrictions\n//* https://github.com/idaholab/moose/blob/master/COPYRIGHT\n//*\n//* Licensed under LGPL 2.1, please see LICENSE for details\n//* https://www.gnu.org/licenses/lgpl-2.1.html\n\n#include \"Kernel.h\"\n\n// MOOSE includes\n#include \"Assembly.h\"\n#include \"MooseVariableFE.h\"\n#include \"MooseVariableScalar.h\"\n#include \"SubProblem.h\"\n#include \"NonlinearSystem.h\"\n\n#include \"libmesh/threads.h\"\n#include \"libmesh/quadrature.h\"\n\ndefineLegacyParams(Kernel);\n\nInputParameters\nKernel::validParams()\n{\n InputParameters params = KernelBase::validParams();\n params.registerBase(\"Kernel\");\n return params;\n}\n\nKernel::Kernel(const InputParameters & parameters)\n : KernelBase(parameters),\n MooseVariableInterface<Real>(this,\n false,\n \"variable\",\n Moose::VarKindType::VAR_NONLINEAR,\n Moose::VarFieldType::VAR_FIELD_STANDARD),\n _var(*mooseVariable()),\n _test(_var.phi()),\n _grad_test(_var.gradPhi()),\n _phi(_assembly.phi(_var)),\n _grad_phi(_assembly.gradPhi(_var)),\n _u(_is_implicit ? _", "var.sln() : _var.slnOld()),\n _grad_u(_is_implicit ? _", "var.gradSln() : _var.gradSlnOld())\n{\n addMooseVariableDependency(mooseVariable());\n _save_in.resize(_save_in_strings.size());\n _diag_save_in.resize(_diag_save_in_strings.size());\n\n for (unsigned int i = 0; i < _save_in_strings.size(); i++)\n {\n MooseVariable * var = &_subproblem.getStandardVariable(_tid, _save_in_strings[i]);\n\n if (_fe_problem.getNonlinearSystemBase().hasVariable(_save_in_strings[i]))\n paramError(\"save_in\", \"cannot use solution variable as save-in variable\");\n\n if (var->feType() !", "= _var.feType())\n paramError(\n \"save_in\",\n \"saved-in auxiliary variable is incompatible with the object's nonlinear variable: \",\n moose::internal::incompatVarMsg(*var, _var));\n\n _save_in[i] = var;\n var->sys().addVariableToZeroOnResidual(_save_in_strings[i]);\n addMooseVariableDependency(var);\n }\n\n _has_save_in = _save_in.size() > 0;\n\n for (unsigned int i = 0; i < _diag_save_in_strings.size(); i++)\n {\n MooseVariable * var = &_subproblem.getStandardVariable(_tid, _diag_save_in_strings[i]);\n\n if (_fe_problem.getNonlinearSystemBase().hasVariable(_diag_save_in_strings[i]))\n paramError(\"diag_save_in\", \"cannot use solution variable as diag save-in variable\");\n\n if (var->feType() !", "= _var.feType())\n paramError(\n \"diag_save_in\",\n \"saved-in auxiliary variable is incompatible with the object's nonlinear variable: \",\n moose::internal::incompatVarMsg(*var, _var));\n\n _diag_save_in[i] = var;\n var->sys().addVariableToZeroOnJacobian(_diag_save_in_strings[i]);\n addMooseVariableDependency(var);\n }\n\n _has_diag_save_in = _diag_save_in.size() > 0;\n}\n\nvoid\nKernel::computeResidual()\n{\n prepareVectorTag(_assembly, _var.number());\n\n precalculateResidual();\n for (_i = 0; _i < _test.size(); _i++)\n for (_qp = 0; _qp < _qrule->n_points(); _qp++)\n _local_re(_i) += _JxW[_qp] * _coord[_qp] * computeQpResidual();\n\n accumulateTaggedLocalResidual();\n\n if (_has_save_in)\n {\n Threads::spin_mutex::scoped_lock lock(Threads::spin_mtx);\n for (const auto & var : _save_in)\n var->sys().solution().add_vector(_local_re, var->dofIndices());\n }\n}\n\nvoid\nKernel::computeJacobian()\n{\n prepareMatrixTag(_assembly, _var.number(), _var.number());\n\n precalculateJacobian();\n for (_i = 0; _i < _test.size(); _i++)\n for (_j = 0; _j < _phi.size(); _j++)\n for (_qp = 0; _qp < _qrule->n_points(); _qp++)\n _local_ke(_i, _j) += _JxW[_qp] * _coord[_qp] * computeQpJacobian();\n\n accumulateTaggedLocalMatrix();\n\n if (_has_diag_save_in && !_", "sys.computingScalingJacobian())\n {\n DenseVector<Number> diag = _assembly.getJacobianDiagonal(_local_ke);\n Threads::spin_mutex::scoped_lock lock(Threads::spin_mtx);\n for (const auto & var : _diag_save_in)\n var->sys().solution().add_vector(diag, var->dofIndices());\n }\n}\n\nvoid\nKernel::computeOffDiagJacobian(MooseVariableFEBase & jvar)\n{\n auto jvar_num = jvar.number();\n if (jvar_num == _var.number())\n computeJacobian();\n else\n {\n prepareMatrixTag(_assembly, _var.number(), jvar_num);\n\n // This (undisplaced) jvar could potentially yield the wrong phi size if this object is acting\n // on the displaced mesh\n auto phi_size = _sys.getVariable(_tid, jvar.number()).dofIndices().size();\n mooseAssert(\n phi_size * jvar.count() == _local_ke.n(),\n \"The size of the phi container does not match the number of local Jacobian columns\");\n\n if (_local_ke.m() !", "= _test.size())\n return;\n\n precalculateOffDiagJacobian(jvar_num);\n if (jvar.count() == 1)\n {\n for (_i = 0; _i < _test.size(); _i++)\n for (_j = 0; _j < phi_size; _j++)\n for (_qp = 0; _qp < _qrule->n_points(); _qp++)\n _local_ke(_i, _j) += _JxW[_qp] * _coord[_qp] * computeQpOffDiagJacobian(jvar_num);\n }\n else\n {\n unsigned int n = phi_size;\n for (_i = 0; _i < _test.size(); _i++)\n for (_j = 0; _j < n; _j++)\n for (_qp = 0; _qp < _qrule->n_points(); _qp++)\n {\n RealEigenVector v =\n _JxW[_qp] * _coord[_qp] *\n computeQpOffDiagJacobianArray(static_cast<ArrayMooseVariable &>(jvar));\n for (unsigned int k = 0; k < v.size(); ++k)\n _local_ke(_i, _j + k * n) += v(k);\n }\n }\n\n accumulateTaggedLocalMatrix();\n }\n}\n\nvoid\nKernel::computeOffDiagJacobian(unsigned int jvar)\n{\n mooseDeprecated(\"The computeOffDiagJacobian method signature has changed. ", "Developers, please \"\n \"pass in a MooseVariableFEBase reference instead of the variable number\");\n if (jvar == _var.number())\n computeJacobian();\n else\n {\n prepareMatrixTag(_assembly, _var.number(), jvar);\n\n precalculateOffDiagJacobian(jvar);\n for (_i = 0; _i < _test.size(); _i++)\n for (_j = 0; _j < _phi.size(); _j++)\n for (_qp = 0; _qp < _qrule->n_points(); _qp++)\n _local_ke(_i, _j) += _JxW[_qp] * _coord[_qp] * computeQpOffDiagJacobian(jvar);\n\n accumulateTaggedLocalMatrix();\n }\n}\n\nvoid\nKernel::computeOffDiagJacobianScalar(unsigned int jvar)\n{\n MooseVariableScalar & jv = _sys.getScalarVariable(_tid, jvar);\n prepareMatrixTag(_assembly, _var.number(), jvar);\n\n for (_i = 0; _i < _test.size(); _i++)\n for (_j = 0; _j < jv.order(); _j++)\n for (_qp = 0; _qp < _qrule->n_points(); _qp++)\n _local_ke(_i, _j) += _JxW[_qp] * _coord[_qp] * computeQpOffDiagJacobian(jvar);\n\n accumulateTaggedLocalMatrix();\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.007171314741035857, 0.017857142857142856, 0.0019230769230769232, 0, 0.0030651340996168583, 0.008859357696566999, 0.00496031746031746, 0.003061224489795918 ]

[ "Tower of Mirian\n\nTower of Mirian () is a tower built by the King of Georgia Mirian III in the 4th century.", "\n\nFamous Georgian monk Gabriel during his last years lived in the tower of King Mirian.", "\n\nSee also \n City of Mtskheta\n Starets\n Monasticism\n Hesychasm\n Eastern Orthodox Church\n List of Christian mystics\n Thaumaturgy\n\nCategory:Towers in Georgia (country)" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0, 0.022988505747126436, 0 ]

[ "A Navajo Nation lawmaker has been convicted in a rare jury trial of funneling nearly $34,000 to his children from a tribal discretionary fund meant for Navajos facing extreme financial hardship.", "\n\nThree men and three women spent less than three hours deliberating Wednesday in Window Rock before finding Mel Begay guilty on 10 criminal counts. ", "He faces the loss of his legislative seat, jail time and fines.", "\n\nBegay’s attorney, Jeffrey Rasmussen, said late Wednesday that he doesn’t believe Begay got a fair trial and will appeal the conviction to the Navajo Nation Supreme Court after the May 17 sentencing.", "\n\n“We expect it will be overturned on appeal, but still it was disappointing,” he said.", "\n\nBegay’s trial was the first of two in a yearslong investigation of lawmakers’ spending from the now-defunct discretionary fund. ", "About two dozen other current and former lawmakers have resolved their criminal or ethics cases through plea agreements with prosecutors.", "\n\nProsecutors outlined a series of requests from Begay’s children to jurors during the trial that started last week, including $1,800 in three payments for a band trip that largely was paid for by his daughter’s school and summer tuition that didn’t exist. ", "They said Begay and his children never disclosed their relationship.", "\n\nTribal law prohibits nepotism, and prosecutors say Begay attested to following the laws when he approved the requests.", "\n\nRasmussen said the discretionary fund program was poorly designed and lawmakers weren’t trained on what was permitted. ", "Begay’s family was struggling to pay for education expenses at a private school and felt they were eligible for assistance, Rasmussen said.", "\n\nAccording to court documents, Begay’s daughters also asked for help with heating and utility bills, rental payments and car parts, sometimes posing as voters from Coyote Canyon, New Mexico. ", "Prosecutors say the girls were minors at the time.", "\n\nProsecutors said Begay’s conviction demonstrates that the tribe will hold elected officials accountable for misusing tribal funds.", "\n\n“The entire Navajo Nation owes the jury its heartfelt thanks for its service,” the prosecution said in a statement." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.005154639175257732, 0.006711409395973154, 0, 0.015, 0, 0, 0, 0.0038910505836575876, 0.014705882352941176, 0.008333333333333333, 0.008264462809917356, 0.007194244604316547, 0.005208333333333333, 0, 0.007575757575757576, 0.008547008547008548 ]

[ "...and the groom gets to have an early bath before Sunday's nuptials (Image: The FA via Getty Images)\n\n“He has come back to the club, because year after year he has been sent away [on loan] by managers. ", "The manager has showed big faith in him this year and he has been excellent, so [we're] just trying to pick him up.", "\n\n“Naturally he is down and the poor fella has got his wedding tomorrow as well. ", "But he’s been excellent all season, so no-one’s to blame." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0 ]

[ "Guangzhou, China - ZWSOFT, a leading supplier of 2D and 3D CAD/CAM solutions to the AEC and MCAD industries, announced today that it donated 25 licenses of ZW3D 2012 to Riga Technical University in Latvia.", "\nZW3D will be used for teaching and training students who study material technology and CAD CAM product design.", "\n\nZWSOFT constantly strives to help enrich students’ education, whether through donating licenses to schools like Riga Technical University, or through the new ZW3D student edition, which is available to all qualified students. ", "With these programs, ZWSOFT hopes to help students learn and gain an understanding of\nCAD CAM software, which will prepare them for the future.", "\n\nFor more than ten years, Riga Technical University has prepared students in Latvia for careers in many different fields of product design. ", "At the end of 2011, RTU began renovating their architecture and design building in order to meet their increasing needs. ", "The building will be finished at the end of 2012, when it will be fully equipped with the latest technologies.", "\n\nZW3D was selected as one of the CAD/CAM solutions for teaching. ", "The company provided 25 licenses and they are now being used by students in the university’s Faculty of Materials Science and Applied Chemistry, Institute of Textile Materials Technology and Design.", "\n\nZWSOFT’s Latvian Partner,\nZWCAD Baltic Distributor Centre, facilitated this donation, and is providing support to the university. ", "Riga Technical University stated, “We want to teach our design study program students the latest CAD/CAM technology, so they would become high qualified personnel and leaders in international and local companies after graduating from our university.”", "\n\nRTU is an accredited, internationally recognized European level university offering high-class academic and professional study programmes. ", "Founded in 1862, Riga Technical University is now comprised of 8 faculties ranging from design, architecture and urban planning to mechanical engineering.", "\nwww.rtu.lv/en.", "\n\nAbout ZW3D\n\nZW3D is cost-effective\nCAD software integrated with CAM for 3D modeling, mold design, and machining, which takes engineers from concept to finished product in one easy-to-use, single collaborative environment. ", "It integrates product design, sheet metal, reverse engineering, product assembly, mold development and machining in one package. ", "Free trial of ZW3D is available from\nwww.zwsoft.com." ]

{ "pile_set_name": "Pile-CC" }

[ 0.01951219512195122, 0, 0.0043859649122807015, 0.006993006993006993, 0.0070921985815602835, 0.008264462809917356, 0, 0.030303030303030304, 0.005050505050505051, 0.007575757575757576, 0.008, 0, 0.006493506493506494, 0.06666666666666667, 0.004464285714285714, 0, 0.019230769230769232 ]

[ "South Park is at it again with its hilarious parodies of modern day pop culture. ", "The target this time? ", "The record-breaking Battle Royale title from Epic Games: Fortnite.", "\n\n“Butters, I need help,” began the statement from Cartman that started it all. “", "My mom says if I flunk another math test she’s going to ground me from playing Fortnite!”", "\n\nSo what about that statement is mocking? ", "Well, it depends on perspective but it seems to be a very sneaky jab by Trey Parker and Matt Stone that Fortnite is made for kids, whereas the big topic of battle royale centers around games like Call of Duty: Black Ops 4 Blackout and PlayerUnknown's Battlegrounds being a more 'mature' online experience.", "\n\nWe also know that the creators of the show love to mock pretty much anything and everything under the Pop Culture sun. ", "Nothing is off limits, and nothing is safe, and with Fortnite continuing to break records left and right while dominating mainstream media, it would make sense that the shooter make it into the show eventually.", "\n\nEpic Games recently revealed their player count for the month of August with an impressive 78.3 million gamers fighting for that Victory Royale. ", "That's just one month of game time - that's insane!", "\n\nIn their recent post about the Fall Skirmish, the studio had this to say about their continued success and how they plan to be better:\n\n\"Beginning in October, we’re opening up inclusive competition, where everybody can play and compete. ", "To make that possible we’ve had to harden and scale our systems and infrastructure. ", "For example, August was Fortnite’s biggest month yet, with 78.3 million of you showing up to play. ", "This exposed weak points and allowed us to make targeted improvements to critical systems, such as stats and servers. ", "The Summer Skirmish also, as you all probably noticed, highlighted problems with performance and spectating, which we’ve been working on ever since. ", "We’re excited about kicking off the new competition system and we’ll have details dropping in the weeks ahead.\"", "\n\nFortnite is now available for Xbox One, PlayStation 4, Nintendo Switch, PC, iOS, and select Android players. ", "To check out what else is new in the wonderful world of Fortnite, you can check out our previous coverage here revealing all of the new items, LTMs, and more!" ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0.015151515151515152, 0, 0, 0, 0.013114754098360656, 0, 0, 0.006802721088435374, 0, 0, 0, 0.010101010101010102, 0, 0.006711409395973154, 0, 0.018018018018018018, 0.006329113924050633 ]

[ "In the latest major shake-up at the Los Angeles Times, Executive Editor and Publisher Davan Maharaj and his second-in-command Marc Duvoisin were abruptly fired Monday, according to the Los Angeles Times.", "\n\nThe newspaper's parent company, Tronc, has installed Chicago Sun-Times editor and publisher Jim Kirk as interim editor of the L.A. Times. ", "The newspaper's publisher will be Ross Levinsohn, who has no experience in newspapers but worked at Fox and Yahoo.", "\n\nTwo other top editors were also fired Monday morning, the newspaper reported: Deputy Managing Editor for Digital Megan Garvey and Assistant Managing Editor of Investigations Matt Doig.", "\n\nMaharaj had spent his entire career with the Times, beginning as an intern in 1989 and later rising to several reporter and editor roles. ", "He was named Editor in Chief in 2011 and publisher this past May.\n\nA 28-year veteran of the Times, Maharaj had been promoted repeatedly during several ownership and leadership changes. ", "The newspaper has seen declines in revenues with the shift to online publishing, which dramatically reduced readership throughout the newspaper industry.", "\n\nIn the years before Maharaj took over as Editor in Chief, the L.A. Times cut 40 percent of its editorial staff in an attempt to remain profitable. ", "Several previous editors and publishers left the newspaper over the deep cost cutting measures.", "\n\nThere have been repeated rumors over the years that Tribune, which bought the newspaper in 2000, would sell the Los Angeles Times to competing newspaper chain Gannett or to private investors. ", "Instead, Tribune held onto the Times and restructured its publishing operation, forming a new company, Tronc Inc., in 2016.", "\n\nDespite the restructuring, Tronc, too, has suffered losses in ad revenue and print subscriptions.", "\n\nIn his most recent earnings call in July, Tronc’s CEO Justin Dearborn told investors that the company's advertising revenue for Q2 dropped 15 percent over the same period, but that circulation revenue increased by 2 percent – most of that growth came from digital-only subscribers to the L.A. Times.", "\n\nThe firings were not a surprise to news industry analysts who have seen the same newsroom leaders continue in place over repeated changes in ownership and corporate management, said Gabriel Kahn, a professor at the USC Annenberg School of Journalism. ", "He co-directs the media economics and entrepreneurship program.", "\n\n“The newsroom staff needs to be re-energized and feel that there is some type of long term plan in terms of what they're doing,” Kahn said. ", "He and others have noted that the company had announced, but not acted on, plans to increase reporting on entertainment from foreign bureaus.", "\n\n“The results that Tronc, the parent company, has posted recently have been lackluster at a moment, strangely, when other big American news publishers have shown signs of life boosting digital revenue and subscriber revenue,” Kahn said. ", "Those are \"two areas where Tronc has been pretty flat.”", "\n\nOne of the clear areas of improvement is the digital arena, Kahn said.", "\n\n“There’s nowhere to go but up. ", "That’s the truth of it. ", "There’s plenty to innovate in terms of the digital experience,” he said.", "\n\nFor two weeks, the online forum Reddit has had a thread airing reader rants about intrusive pop-up ads at latimes.com.", "\n\nWith Maharaj at the helm, the Times won the Pulitzer Prizes for its breaking news coverage of the San Bernardino shooting in 2016 and several awards for its investigation on oxycodone painkillers.", "\n\nA key criticism of Maharaj and his top editors was that major articles could be delayed for months without reasons that were apparent to the reporters, said Ed Liebowitz, a reporter who wrote the Los Angeles Magazine story titled, “What’s the Matter with the L.A. Times?” ", "His central example was about delays in the Times publishing a story about the drug industry’s role in the opioid addition crisis. ", "Liebowiz interviewed more than 50 current and former Times staffers.", "\n\n“The composite portrait they painted was of a leader who was very feckless and domineering and insecure and at the same time anyone who would suppress stories often for no reason,” Liebowitz said.", "\n\nHe was hopeful new management might remove a publishing bottleneck.", "\n\n“This is a paper that is really worth supporting and I know a lot of people have been very disappointed with it,” he said. “", "It's been contracting in terms of pages. ", "And it certainly is a lot more expensive than it used to be.”", "\n\nThis story has been updated." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.019704433497536946, 0.02857142857142857, 0.02631578947368421, 0.010752688172043012, 0.007142857142857143, 0.010810810810810811, 0, 0.013422818791946308, 0, 0.015463917525773196, 0.024390243902439025, 0.010101010101010102, 0.009966777408637873, 0.007905138339920948, 0, 0.007042253521126761, 0, 0.008403361344537815, 0.01818181818181818, 0.013888888888888888, 0, 0, 0, 0.008333333333333333, 0.005050505050505051, 0.010948905109489052, 0.007633587786259542, 0.014705882352941176, 0.005050505050505051, 0, 0, 0, 0, 0 ]

[ "defmodule ShopixWeb.", "StringHelpers do\n import Phoenix.", "HTML\n\n def to_json(data) do\n data\n |> Jason.encode!()", "\n |> raw\n end\n\n def options_reject_nil(options) do\n options\n |> Enum.reject(&is_nil(elem(&1, 1)))\n end\n\n def truncate(text, opts \\\\ []) do\n max_length = opts[:max_length] || 50\n omission = opts[:omission] || \"...\"\n\n cond do\n not String.valid?(text) ->\n text\n\n String.length(text) < max_length ->\n text\n\n true ->\n length_with_omission = max_length - String.length(omission)\n\n \"#{String.slice(text, 0, length_with_omission)}#{omission}\"\n end\n end\nend\n" ]

{ "pile_set_name": "Github" }

[ 0.05, 0, 0, 0 ]

[ "View above the Confluence\n\nOverlooking the confluence of Coyote Gulch and the Escalante River. ", "Steven's Arch is seen on opposite wall. ", "This is the view before going through Crack-in-the-Wall. ", "Head down the sandslide to the left of the Navajo Sandstone formation in the middle. ", "Coyote Gulch is 700 feet down from the top of the sandslide." ]

{ "pile_set_name": "Pile-CC" }

[ 0.021052631578947368, 0.05, 0, 0, 0.016666666666666666 ]

[ "//\n// Align.swift\n// Cartography\n//\n// Created by Robert Böhnke on 17/02/15.", "\n// Copyright (c) 2015 Robert Böhnke. ", "All rights reserved.", "\n//\n\n#if os(iOS) || os(tvOS)\nimport UIKit\n#else\nimport AppKit\n#endif\n\nprivate func makeEqual<P: RelativeEquality>(_ attribute: (LayoutProxy) -> P, first: LayoutProxy, rest: [LayoutProxy]) -> [NSLayoutConstraint] {\n return rest.reduce([]) { acc, current in\n current.view.car_translatesAutoresizingMaskIntoConstraints = false\n\n return acc + [ attribute(first) == attribute(current) ]\n }\n}\n\n/// Aligns multiple views by their top edge.", "\n///\n/// All views passed to this function will have\n/// their `translatesAutoresizingMaskIntoConstraints` properties set to `false`.", "\n///\n/// - returns: An array of `NSLayoutConstraint` instances.", "\n///\n@discardableResult public func align(top first: LayoutProxy, _ rest: LayoutProxy...) -> [NSLayoutConstraint] {\n return makeEqual({ $0.top }, first: first, rest: rest)\n}\n\n/// Aligns multiple views by their right edge.", "\n///\n/// All views passed to this function will have\n/// their `translatesAutoresizingMaskIntoConstraints` properties set to `false`.", "\n///\n/// - returns: An array of `NSLayoutConstraint` instances.", "\n///\n@discardableResult public func align(right first: LayoutProxy, _ rest: LayoutProxy...) -> [NSLayoutConstraint] {\n return makeEqual({ $0.right }, first: first, rest: rest)\n}\n\n/// Aligns multiple views by their bottom edge.", "\n///\n/// All views passed to this function will have\n/// their `translatesAutoresizingMaskIntoConstraints` properties set to `false`.", "\n///\n/// - returns: An array of `NSLayoutConstraint` instances.", "\n///\n@discardableResult public func align(bottom first: LayoutProxy, _ rest: LayoutProxy...) -> [NSLayoutConstraint] {\n return makeEqual({ $0.bottom }, first: first, rest: rest)\n}\n\n/// Aligns multiple views by their left edge.", "\n///\n/// All views passed to this function will have\n/// their `translatesAutoresizingMaskIntoConstraints` properties set to `false`.", "\n///\n/// - returns: An array of `NSLayoutConstraint` instances.", "\n///\n@discardableResult public func align(left first: LayoutProxy, _ rest: LayoutProxy...) -> [NSLayoutConstraint] {\n return makeEqual({ $0.left }, first: first, rest: rest)\n}\n\n/// Aligns multiple views by their leading edge.", "\n///\n/// All views passed to this function will have\n/// their `translatesAutoresizingMaskIntoConstraints` properties set to `false`.", "\n///\n/// - returns: An array of `NSLayoutConstraint` instances.", "\n///\n@discardableResult public func align(leading first: LayoutProxy, _ rest: LayoutProxy...) -> [NSLayoutConstraint] {\n return makeEqual({ $0.leading }, first: first, rest: rest)\n}\n\n/// Aligns multiple vies by their trailing edge.", "\n///\n/// All views passed to this function will have\n/// their `translatesAutoresizingMaskIntoConstraints` properties set to `false`.", "\n///\n/// - returns: An array of `NSLayoutConstraint` instances.", "\n///\n@discardableResult public func align(trailing first: LayoutProxy, _ rest: LayoutProxy...) -> [NSLayoutConstraint] {\n return makeEqual({ $0.trailing }, first: first, rest: rest)\n}\n\n/// Aligns multiple views by their horizontal center.", "\n///\n/// All views passed to this function will have\n/// their `translatesAutoresizingMaskIntoConstraints` properties set to `false`.", "\n///\n/// - returns: An array of `NSLayoutConstraint` instances.", "\n///\n@discardableResult public func align(centerX first: LayoutProxy, _ rest: LayoutProxy...) -> [NSLayoutConstraint] {\n return makeEqual({ $0.centerX }, first: first, rest: rest)\n}\n\n/// Aligns multiple views by their vertical center.", "\n///\n/// All views passed to this function will have\n/// their `translatesAutoresizingMaskIntoConstraints` properties set to `false`.", "\n///\n/// - returns: An array of `NSLayoutConstraint` instances.", "\n///\n@discardableResult public func align(centerY first: LayoutProxy, _ rest: LayoutProxy...) -> [NSLayoutConstraint] {\n return makeEqual({ $0.centerY }, first: first, rest: rest)\n}\n\n/// Aligns multiple views by their baseline.", "\n///\n/// All views passed to this function will have\n/// their `translatesAutoresizingMaskIntoConstraints` properties set to `false`.", "\n///\n/// - returns: An array of `NSLayoutConstraint` instances.", "\n///\n@discardableResult public func align(baseline first: LayoutProxy, _ rest: LayoutProxy...) -> [NSLayoutConstraint] {\n return makeEqual({ $0.baseline }, first: first, rest: rest)\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.012658227848101266, 0.02564102564102564, 0, 0.011061946902654867, 0, 0, 0.008928571428571428, 0, 0, 0.008733624454148471, 0, 0, 0.008733624454148471, 0, 0, 0.008771929824561403, 0, 0, 0.008547008547008548, 0, 0, 0.008298755186721992, 0, 0, 0.008438818565400843, 0, 0, 0.008695652173913044, 0, 0, 0.0053475935828877 ]

[ "#!", "/usr/bin/env bash\n\n##############################################################################\n##\n## Gradle start up script for UN*X\n##\n##############################################################################\n\n# Add default JVM options here. ", "You can also use JAVA_OPTS and GRADLE_OPTS to pass JVM options to this script.", "\nDEFAULT_JVM_OPTS=\"\"\n\nAPP_NAME=\"Gradle\"\nAPP_BASE_NAME=`basename \"$0\"`\n\n# Use the maximum available, or set MAX_FD !", "= -1 to use that value.", "\nMAX_FD=\"maximum\"\n\nwarn ( ) {\n echo \"$*\"\n}\n\ndie ( ) {\n echo\n echo \"$*\"\n echo\n exit 1\n}\n\n# OS specific support (must be 'true' or 'false').", "\ncygwin=false\nmsys=false\ndarwin=false\ncase \"`uname`\" in\n CYGWIN* )\n cygwin=true\n ;;\n Darwin* )\n darwin=true\n ;;\n MINGW* )\n msys=true\n ;;\nesac\n\n# For Cygwin, ensure paths are in UNIX format before anything is touched.", "\nif $cygwin ; then\n [ -n \"$JAVA_HOME\" ] && JAVA_HOME=`cygpath --unix \"$JAVA_HOME\"`\nfi\n\n# Attempt to set APP_HOME\n# Resolve links: $0 may be a link\nPRG=\"$0\"\n# Need this for relative symlinks.", "\nwhile [ -h \"$PRG\" ] ; do\n ls=`ls -ld \"$PRG\"`\n link=`expr \"$ls\" : '.*-> \\(.*\\)$'`\n if expr \"$link\" : '/.*' > /dev/null; then\n PRG=\"$link\"\n else\n PRG=`dirname \"$PRG\"`\"/$link\"\n fi\ndone\nSAVED=\"`pwd`\"\ncd \"`dirname \\\"$PRG\\\"`/\" >&-\nAPP_HOME=\"`pwd -P`\"\ncd \"$SAVED\" >&-\n\nCLASSPATH=$APP_HOME/gradle/wrapper/gradle-wrapper.jar\n\n# Determine the Java command to use to start the JVM.", "\nif [ -n \"$JAVA_HOME\" ] ; then\n if [ -x \"$JAVA_HOME/jre/sh/java\" ] ; then\n # IBM's JDK on AIX uses strange locations for the executables\n JAVACMD=\"$JAVA_HOME/jre/sh/java\"\n else\n JAVACMD=\"$JAVA_HOME/bin/java\"\n fi\n if [ ! ", "-x \"$JAVACMD\" ] ; then\n die \"ERROR: JAVA_HOME is set to an invalid directory: $JAVA_HOME\n\nPlease set the JAVA_HOME variable in your environment to match the\nlocation of your Java installation.\"", "\n fi\nelse\n JAVACMD=\"java\"\n which java >/dev/null 2>&1 || die \"ERROR: JAVA_HOME is not set and no 'java' command could be found in your PATH.", "\n\nPlease set the JAVA_HOME variable in your environment to match the\nlocation of your Java installation.\"", "\nfi\n\n# Increase the maximum file descriptors if we can.", "\nif [ \"$cygwin\" = \"false\" -a \"$darwin\" = \"false\" ] ; then\n MAX_FD_LIMIT=`ulimit -H -n`\n if [ $? ", "-eq 0 ] ; then\n if [ \"$MAX_FD\" = \"maximum\" -o \"$MAX_FD\" = \"max\" ] ; then\n MAX_FD=\"$MAX_FD_LIMIT\"\n fi\n ulimit -n $MAX_FD\n if [ $? ", "-ne 0 ] ; then\n warn \"Could not set maximum file descriptor limit: $MAX_FD\"\n fi\n else\n warn \"Could not query maximum file descriptor limit: $MAX_FD_LIMIT\"\n fi\nfi\n\n# For Darwin, add options to specify how the application appears in the dock\nif $darwin; then\n GRADLE_OPTS=\"$GRADLE_OPTS \\\"-Xdock:name=$APP_NAME\\\" \\\"-Xdock:icon=$APP_HOME/media/gradle.icns\\\"\"\nfi\n\n# For Cygwin, switch paths to Windows format before running java\nif $cygwin ; then\n APP_HOME=`cygpath --path --mixed \"$APP_HOME\"`\n CLASSPATH=`cygpath --path --mixed \"$CLASSPATH\"`\n\n # We build the pattern for arguments to be converted via cygpath\n ROOTDIRSRAW=`find -L / -maxdepth 1 -mindepth 1 -type d 2>/dev/null`\n SEP=\"\"\n for dir in $ROOTDIRSRAW ; do\n ROOTDIRS=\"$ROOTDIRS$SEP$dir\"\n SEP=\"|\"\n done\n OURCYGPATTERN=\"(^($ROOTDIRS))\"\n # Add a user-defined pattern to the cygpath arguments\n if [ \"$GRADLE_CYGPATTERN\" !", "= \"\" ] ; then\n OURCYGPATTERN=\"$OURCYGPATTERN|($GRADLE_CYGPATTERN)\"\n fi\n # Now convert the arguments - kludge to limit ourselves to /bin/sh\n i=0\n for arg in \"$@\" ; do\n CHECK=`echo \"$arg\"|egrep -c \"$OURCYGPATTERN\" -`\n CHECK2=`echo \"$arg\"|egrep -c \"^-\"` ### Determine if an option\n\n if [ $CHECK -ne 0 ] && [ $CHECK2 -eq 0 ] ; then ### Added a condition\n eval `echo args$i`=`cygpath --path --ignore --mixed \"$arg\"`\n else\n eval `echo args$i`=\"\\\"$arg\\\"\"\n fi\n i=$((i+1))\n done\n case $i in\n (0) set -- ;;\n (1) set -- \"$args0\" ;;\n (2) set -- \"$args0\" \"$args1\" ;;\n (3) set -- \"$args0\" \"$args1\" \"$args2\" ;;\n (4) set -- \"$args0\" \"$args1\" \"$args2\" \"$args3\" ;;\n (5) set -- \"$args0\" \"$args1\" \"$args2\" \"$args3\" \"$args4\" ;;\n (6) set -- \"$args0\" \"$args1\" \"$args2\" \"$args3\" \"$args4\" \"$args5\" ;;\n (7) set -- \"$args0\" \"$args1\" \"$args2\" \"$args3\" \"$args4\" \"$args5\" \"$args6\" ;;\n (8) set -- \"$args0\" \"$args1\" \"$args2\" \"$args3\" \"$args4\" \"$args5\" \"$args6\" \"$args7\" ;;\n (9) set -- \"$args0\" \"$args1\" \"$args2\" \"$args3\" \"$args4\" \"$args5\" \"$args6\" \"$args7\" \"$args8\" ;;\n esac\nfi\n\n# Split up the JVM_OPTS And GRADLE_OPTS values into an array, following the shell quoting and substitution rules\nfunction splitJvmOpts() {\n JVM_OPTS=(\"$@\")\n}\neval splitJvmOpts $DEFAULT_JVM_OPTS $JAVA_OPTS $GRADLE_OPTS\nJVM_OPTS[${#JVM_OPTS[*]}]=\"-Dorg.gradle.appname=$APP_BASE_NAME\"\n\nexec \"$JAVACMD\" \"${JVM_OPTS[@]}\" -classpath \"$CLASSPATH\" org.gradle.wrapper.", "GradleWrapperMain \"$@\"\n" ]

{ "pile_set_name": "Github" }

[ 0, 0.007936507936507936, 0, 0.008695652173913044, 0.043478260869565216, 0, 0.016877637130801686, 0.0051813471502590676, 0.005, 0.007905138339920948, 0.005, 0.006711409395973154, 0.009523809523809525, 0, 0, 0, 0.004210526315789474, 0, 0 ]

[ "Facebook 0 Pinterest 0 LinkedIn Email Reddit 5 Messenger Twitter\n\nIt is officially summer in St. Louis, and now that it has stopped raining, I can actually kick off summer with some backyard grilling. ", "My backyard is not huge or luxurious, but rather small and kind of comfy. ", "I have an older model Weber Genesis Silver hand-me-down grill, which is rusted through in some spots, but not where it counts. ", "It still grills like a champ. ", "And, I love grilling. ", "I especially like it when I remember to unlock the basement door so I can have quick access to my beer fridge. ", "Because frankly just as much as beer and food go together, so does beer and the actual act of grilling. ", "And the beer you choose can depend on the meat you’re cooking and the day you’re cooking it. ", "Sometimes you want something to guzzle, sometimes you want a sipper. ", "Do you want sweet, bitter, strong, light? ", "The answers are the fun part. ", "So, no matter what I have on the grill on a particular night, I believe there is a perfect St. Louis beer to enjoy while you’re cooking it. ", "Here are some of my favorite beers to enjoy while out grilling. ", "Modern Brewing | Modern Man Lager (4.2 ABV) This is a beer that I first had at Craft Beer Cellar in Clayton and wrote on Untappd, “Nice lager. ", "Could be a beer of summer for sure,” and it is. ", "Refreshing, swiggable, crisp and clean. ", "Everything you want with a lager, and pretty much goes with any meat you can think of. ", "This is summer, I’m all in on New England Style IPAs, and this summer St. Louis breweries are making me smile. ", "Because my beer fridge is stacked with NEIPAs, I’ve given quite a few of them a go. ", "Voodoo Ranger Juicy Haze IPA | New Belgium Brewing | 7.5% | 42 IBU\n\nNew Belgium does many things right, and this is one of them. ", "I’m all about the balance, and this one of that regularly defines it. ", "With this beer, you get a burst of citrus, that just times out perfectly with the hops. ", "You’ll get the lemon, orange, guava and pineapple notes, which is then smoothed out nicely at the end with sort of creamy caramelly thing going on.", "\n\nCitrus Wheat | Old Bakery Brewing Company | 4.7% ABV | 20 IBU\n\nOld Bakery Beer’s Citrus Wheat is an unfiltered American Wheat beer, brewed with lemon peel, orange peel, coriander, and chamomile. ", "By no means a heavy beer at 4.7 ABV, this is a sessionable choice that is interesting and unique. ", "You could enjoy a few of these, extra cold while standing over the grill.", "\n\nThis is a great spring and summer beer. ", "My recommendation is to pick up a few cans and make them a staple in your beer fridge this year. ", "This will be a good one have around for the backyard, watching the Cardinals or after mowing the lawn.", "\n\nContact High Juiced | 4 Hands Brewing Co. | 5.5% ABV\n\nIf I ever create a summer beer hall of fame, this beer will among the first beers inducted. ", "The second variant of the popular Pale Wheat Ale, this one has become an instant St. Louis summer classic. ", "The new variant is JUICED up with tangerine juice and zest, giving it a big citrusy aroma and crisp hop.", "\n\nEasy Jack | Firestone Walker Brewing Company | 4% ABV | 47 IBU\n\nThis really is a nice and easy beer to drink at the grill. ", "A tad bit on the hoppy side, but not by much. ", "Firestone Walker is another brewery, that for me, has defined balance in a beer. ", "A session IPA at 4% ABV, you can enjoy a few of these while you clock through till the next meat turn on the grill. ", "You’ll get all the juicy citrus, but this time backed up by plenty of malt.", "\n\nOld Fashioned Lemonade IPA | Evil Twin Brewing | 7 % ABV | 70 IBU\n\nI remember when I first had this beer at the Craft Beer Cellar in Clayton, that this would be a good grilling beer, and I was right. ", "A bit hoppier than the others on my list, but even at 70 IBUs, this beer really does not drink like an IPA. ", "Evil Twin is a special brewery. ", "They know balance in beer as well. ", "This one is deceivingly well balanced with sweet and sour notes." ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.006993006993006993, 0, 0, 0, 0, 0, 0.015503875968992248, 0, 0, 0, 0.01015228426395939, 0.02040816326530612, 0, 0, 0, 0.00980392156862745, 0.013513513513513514, 0, 0.009615384615384616, 0.024, 0, 0.012345679012345678, 0.008620689655172414, 0, 0, 0.009259259259259259, 0.03125, 0, 0 ]

[ "Battle of the Saints\n\nBattle of the Saints may refer to:\n\n Battle of the Saintes, a sea battle during the American War of Independence\n Battle of the Saints (cricket), a cricket contest in Sri Lanka" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.010101010101010102 ]

[ "Keswick Film Festival\n\nThe Keswick Film Festival is an annual festival held in Keswick, Cumbria, England, since 2000. ", "It was organised by the Keswick Film Club in association with Theatre by the Lake. ", "Festival Focus refers to it as 'Cumbria's principal general film fest'.", "\n\nThe festival includes the Osprey Short Film Awards, which recognise short films from local filmmakers. ", "In 2014, the festival ran from 27 February until 2 March. ", "In 2014, John Hurt was in attendance.", "\n\nOsprey Short Film Awards \n\nThe Osprey Short Film Awards are part of the Keswick Film Festival and aim to 'celebrate local film making' by showing short films from local filmmakers. ", "The winners from both the Under 19 and Open categories are awarded Osprey Awards. ", "News and Star called it 'an opportunity for great directors to showcase their work'. ", "In 2014, the Osprey Short Film Awards took place on 1 March. ", "The winners were Animals, directed by Matthew Edwards, in the Under 19 category and Little Chamonix, directed by Dom Bush, in the Open category.", "\n\nReferences\n\nExternal links\nOfficial website\n\nCategory:Festivals in Cumbria\nCategory:Keswick, Cumbria\nCategory:Film festivals in England" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.00847457627118644, 0.024096385542168676, 0.014084507042253521, 0, 0, 0.02702702702702703, 0, 0.012195121951219513, 0.011764705882352941, 0, 0.020833333333333332, 0.0072992700729927005 ]

[ "By Michael Hurley, CBS Boston\n\nBOSTON (CBS) — Not that there was much doubt, but it seems as though Cowboys owner Jerry Jones did not closely follow the two-year saga of nonsense known as DeflateGate.", "\n\nJones, speaking to the media after his team’s Week 1 victory on Sunday night, broke his temporary stretch of silence on the ongoing battle between the NFL and his star running back, Ezekiel Elliott, over domestic violence allegations.", "\n\nIn both cases — the frivolous case of PSI and inflation needles, and the much more serious accusations of domestic violence — the public at large remains unaware of the cold, hard truth. ", "We can read the lengthy report compiled by Ted Wells on Tom Brady, or we can read the gross details of the Elliott police report, but the point is we don’t know.", "\n\nExcept for Jones. ", "He claims to know, and in speaking with reporters, he clarified why Brady deserved his four-game suspension but Elliott does not deserve his six-game suspension.", "\n\nIn comments shared by Yahoo’s Dan Wetzel (that didn’t seem to make it into the video on the Cowboys’ official website), Jones weighed in.", "\n\n“Well, [DeflateGate] was about whether or not the player had misrepresented to the commissioner. ", "We’ve got rules that if you don’t tell the truth to the commissioner, then you can get sanctioned. ", "Those are rules,” Jones said. “", "That’s not the case here. ", "Zeke gave him everything … everything he had to have here. ", "So these are different issues.”", "\n\nWell, not really.", "\n\nWhen Brady was suspended by the NFL, the reasoning was that the league believed it was “more probable than not” that Brady was “at least generally aware” of a ball deflation scheme which wasn’t proven to have happened. ", "While Brady did initially refuse to hand over his cell phone to investigators, those investigators were in possession of all of his communications with any potentially involved parties. ", "Also, as former NFl commissioner Paul Tagliabue stated clearly in overrulling the punishments Goodell had enforced on Saints players for the so-called “Bountygate” scandal, “There is no evidence of a record of past suspensions based purely on obstructing a League investigation.”", "\n\nEssentially, prior to Brady, the precedent stated that it didn’t matter how little or how much a player cooperated with a league investigation. ", "Ultimately, punishment would be determined based on evidence.", "\n\n(UPDATE: According to Deadspin, the NFL asked Elliott to turn over his phone information, but he only “provided ‘redacted, incomplete’ records.” ", "That’s not quite the “everything” that Jones suggested.)", "\n\nIn the Brady case, the evidence was lacking, so the cell phone became the primary target of the league to win the battle of public opinion when Goodell issued his ruling to uphold his own decision. ", "It was successful, and it still has Jones convinced that Goodell did anything but “an outstanding job” when he was violating several tenets of fairness in going after another team’s player.", "\n\nBut now that it’s Jones’ player who is being subjected to Goodell’s tactics, he has found a problem.", "\n\nJones now just wants things to be fair.", "\n\n“Why should it surprise us when we adjudicate, or the equivalent to adjudicate, over a privilege that we’ve got in our relationship with players, and we don’t do it in a fair way? ", "Why should it surprise anybody if we get slapped?” ", "Jones said Sunday night. “", "It doesn’t surprise me. ", "You’ve got to be fair.”", "\n\nWithout relitigating the trivial football fight, it was not fair when Goodell ruled to keep Brady and the NFLPA dark with regard to Jeff Pash’s shadow role as “editor” of the Wells report. ", "It was likewise unfair that the firm hired to serve as “independent” investigators provided their investigative notes to one side (the NFL) but not the other (the NFLPA) and then served as the NFL’s counsel at the appeal hearing. ", "Then there was the matter of Goodell claiming impartiality as an arbitrator, even though the decision to suspend the player was his own decision in the first place.", "\n\nRobert Katzmann, the Chief Judge of the Second Circuit Court of Appeals, explained his interpretation of the breach of fairness in his dissent to the ruling to uphold Goodell’s decision.", "\n\n“The lack of any meaningful explanation in the Commissioner’s final written decision convinces me that the Commissioner was doling out his own brand of industrial justice,” Katzmann wrote.", "\n\nKatzmann ended his dissent succinctly: “It is ironic that a process designed to ensure fairness to all players has been used unfairly against one player.”", "\n\nLong story short, Brady won in a district court and ultimately lost in a court of appeals, but at no point was the “fairness” of Goodell affirmed. ", "The case against Brady was slanted from the start. ", "Elliott’s case appears to be moving along the same track. (", "If you care to learn more details about the unfairness currently at play, Wetzel perfectly tackled that matter on Friday.)", "\n\nWithout oversimplifying a complex issue, the NFL’s investigator recommended that Elliott not face a suspension. ", "Her suggestions were ignored, and the NFL sought to silence her comments by not including her in the meeting in which Lisa Friel recommended the six-game suspension. ", "The fact that Friel is openly a die-hard fan of the New York Giants and saw no issue with Giants kicker Josh Brown getting just a one-game suspension last year is a part of the story that — sad as it may sound — cannot be ignored. ", "The fact that the NFL scrambled to issue a six-game suspension to Brown three days ago (nearly a full year since his final NFL game played) shows just how poorly the NFL has bungled the current situation with Elliott.", "\n\nJones is right to have his doubts … though subtly threatening the job status of the NFL’s head of investigation in matters related to domestic violence was without a doubt over the line. ", "And it’s difficult to feel sympathy for someone who allowed the wool to be placed over his eyes as he gleefully watched the NFL’s best team squirm in the midst of an unwinnable fight with the NFL.", "\n\n“I’m a big supporter of [Goodell],” Jones stated in the spring of 2015. “", "I know one of his best qualities is fairness.”", "\n\nGoodell was not being fair then. ", "He is not being fair now. ", "Had Jones been more interested in the matter from January 2015 through September 2016 instead of giving employment to Greg Hardy and trying to paint the accused domestic abuser as a victim, none of this would be surprising to him.", "\n\nYou can email Michael Hurley or find him on Twitter @michaelFhurley." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.025, 0.00847457627118644, 0.005291005291005291, 0.018633540372670808, 0, 0.012422360248447204, 0.02158273381294964, 0, 0, 0.03225806451612903, 0, 0.01694915254237288, 0, 0, 0.013574660633484163, 0.005376344086021506, 0.014336917562724014, 0.00684931506849315, 0, 0.02040816326530612, 0.017857142857142856, 0.01, 0.010582010582010581, 0.00980392156862745, 0, 0, 0, 0, 0, 0, 0.02617801047120419, 0.013043478260869565, 0.006097560975609756, 0.015957446808510637, 0.005263157894736842, 0.00641025641025641, 0.013422818791946308, 0.0196078431372549, 0, 0.00819672131147541, 0.017543859649122806, 0.012048192771084338, 0.017316017316017316, 0.02304147465437788, 0.005291005291005291, 0.01020408163265306, 0.02666666666666667, 0, 0.02857142857142857, 0, 0.004347826086956522, 0.02857142857142857 ]

[ "Image: Heikki Saukkomaa / Lehtikuva\n\nThe Trade Union Pro, which represents private sector workers, and the aviation workers union IAU are threatening to strike on February 17 – if a collective bargaining agreement with the firm Airpro is not reached by that date.", "\n\nTUI and Tjäreborg outsource their cabin personnel, security workers and ground staff from Airpro, which is owned outright by Finavia, Finland's state-owned airport maintenance firm. ", "Norwegian uses ground services provided by the company.", "\n\nIf an agreement is not reached by February 17, security workers plan to strike between 2 and 6 pm that day. ", "Other travel services would be affected between the hours of 3 to 7 pm, and airport hall services would be affected between 4 to 7 pm.", "\n\nIf the strike takes place, Airpro cabin crew on TUI and Tjäreborg would strike for 23 hours – starting at midnight Sunday, February 19 until 11 pm the next day.", "\n\nUnions: Wages too low\n\nOne of the chief disputes between the parties concerns workers salaries. ", "According to the head of the Trade Union Pro, Else-Mai Kirvesniemi, Airpro pays its workers too little.", "\n\n\"Wages and working conditions for both cabin and ground crews have remained well below industry standards,\" Kirvesniemi said.", "\n\nAirpro flight attendants earn about 1,500 euros per month, which is about half of the normal wage in the industry, according to Kirvesniemi.", "\n\nShe says that Trade Union Pro and the IAU have tried to reach agreements independently with Airpro, but says that's not possible as long as Finavia continues its practice of paying low wages.", "\n\nAirpro operates under agreements between the public sector union JHL, the Federation of Salaried Employees Pardia and the service sector union Palta.", "\n\nKirvesniemi apologised on behalf of the unions to affected travellers during the holiday in advance of the possible strike.", "\n\nEDIT-This story originally stated that Norwegian uses cabin crew from Airpro. ", "That's incorrect, the airline has its own cabin crew but will be affected by industrial action involving ground maintenance crews and airport staff." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0076045627376425855, 0.021739130434782608, 0, 0, 0, 0.018518518518518517, 0, 0.019417475728155338, 0.007874015748031496, 0.007042253521126761, 0.02072538860103627, 0.019867549668874173, 0, 0.0125, 0 ]

[ "This is an archived article and the information in the article may be outdated. ", "Please look at the time stamp on the story to see when it was last updated.", "\n\nSAN DIEGO — A 23-year-old man is fighting for his life after a grisly incident in the Midway District, authorities said Monday.", "\n\nRyan Bowers allegedly cut his throat with a knife and pulled out a different knife from his jacket pocket once officers arrived at the scene, said San Diego Police Lieutenant Anthony Dupree.", "\n\nDispatchers received a 911 call around 9:45 p.m. Thursday from a person reporting that they managed to get a knife away from Bowers after he used the weapon to cut his throat at a residence in the 3100 block of Cauby Street, Lt. ", "Dupree said.", "\n\nOfficers responded to the location and family member of Bowers let them into the apartment and led them to a back bedroom, Dupree said. ", "When officers approached the man in the bedroom he allegedly pulled out a knife from his jacket pocket and raised it up toward officers.", "\n\nThe officers then drew their weapons and ordered the man to back up, but the man continued to advance on the officers with the knife pointed at them, the lieutenant said.", "\n\nOne of the officers then fired his weapon at the man, striking him at least once in the upper body, Dupree said.", "\n\nOfficers at the scene gave medical aid until paramedics arrived.", "\n\nBowers was transported to a local hospital with life-threatening injuries.", "\n\nHomicide detectives are investigating the officer-involved shooting.", "\n\n32.749501 -117.20892" ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0, 0.010416666666666666, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Introduction\n============\n\nSince the 1970's, broilers have substantially improved in growth rate, breast-meat yield and efficiency of feed conversion ([@B11]). ", "Feed conversion ratio (FCR), calculated as the ratio of feed consumed to weight gained, is a widely used performance measure, representing how efficiently the feed is utilized and converted into body mass ([@B44]). ", "The extraction of energy and nutrients from feed requires interplay between the biochemical functions provided by the chicken and the intestinal microbiota ([@B46]). ", "The chicken gut harbors a very diverse microbiota that for many years has been kept stable by the use of sub-therapeutic dosages of antimicrobial growth promoters (AGPs) in the feed. ", "The ban on the use of AGPs in the EU has resulted in an increase of intestinal health problems in broiler flocks and thus reduced profitability for poultry farmers. ", "A disease that has emerged after the AGP ban is necrotic enteritis (NE), caused by *Clostridium perfringens*.", "\n\nPrebiotics, probiotics, essential oils, plant extracts, and organic acids have been proposed as potential alternatives to antibiotics ([@B3]). ", "Probiotics or direct-fed microbials (DFM) are live microorganisms that, when administered in adequate amounts, confer a health benefit on the host ([@B23]). ", "This beneficial effect can be achieved indirectly by improving the properties of the indigenous microbiota, resulting in the protection from enteric pathogen infections ([@B18]). ", "Most probiotic strains that are used in livestock are members of the bacterial genera *Bacillus*, *Enterococcus*, *Lactobacillus* or the yeast genus *Saccharomyces.* ", "They are predominantly used to improve performance parameters, including market-aged body weight and FCR ([@B19]). ", "Probiotics display multiple modes of action, including modification of gut pH via secretion of short chain fatty acids (SCFA), inhibition of the proliferation and colonization of pathogens and control of enteric diseases ([@B50]). ", "In feed supplementation of the SCFA butyrate, which is an important end-product of anaerobic bacterial fermentation of carbohydrates, has been shown to decrease pro-inflammatory cytokine expression in broiler challenge models and to induce expression of antimicrobial host defense components in the gut ([@B48]; [@B55]). ", "Moreover, it stimulates proliferation, differentiation and function of mucosal epithelial cells and immune cells. ", "Butyrate mediated beneficial effects on growth and intestinal integrity have been demonstrated in piglets ([@B27]; [@B29]) and broiler chickens ([@B1]; [@B35]; [@B2]; [@B39]). ", "In all these studies, butyric acid was added to the feed ([@B22]). ", "A valuable alternative strategy would consist of stimulation of *in situ* production of butyrate through administration of a selected bacterium or substrates that are converted to butyrate.", "\n\nThe objectives of the present study were to assess the effect of dietary supplementation of *Butyricicoccus pullicaecorum*, a butyrate-producing chicken isolate, on animal performance, on the intestinal microbiota composition and on the resistance against *C. perfringens* induced NE.", "\n\nMaterials and Methods {#s1}\n=====================\n\nStrains\n-------\n\n*Butyricicoccus pullicaecorum* strain 25-3^T^ (LMG 24109), isolated from the caecal content of a chicken ([@B15]), member of *Clostridium* cluster IV and shown to produce 15.3 mM butyrate under lab conditions, was grown overnight at 37°C in M2GSC medium at pH6 ([@B34]) in an anaerobic (84% N~2~, 8% CO~2~, and 8% H~2~) workstation (Ruskinn Technology, Bridgend, UK). ", "After centrifugation (6400 × *g*, 37°C, 15 min) of the bacterial culture, the pellet was resuspended and lyophilized in lyoprotectant consisting of 750 ml horse serum and 250 ml distilled water supplemented with 7.5% sucrose (Sigma--Aldrich, St Louis, MO, USA), 0.63% nutrient broth (Sigma--Aldrich, St Louis, MO, USA) and 1 mg/ml cysteine HCl. ", "The number of surviving cells after freeze drying was counted using the agar plate count method and expressed as cfu/g lyophilized powder.", "\n\n*Clostridium perfringens* strain 56, originally isolated from the intestine of a chicken with severe necrotic gut lesions, was used to induce NE in the *in vivo* broiler model. ", "This strain has been characterized as a NetB toxin positive type A strain (no β2 or enterotoxin genes) and a producer of moderate amounts of alpha toxin *in vitro* ([@B20]). ", "Before inoculation of the chickens, the bacteria were cultured in brain heart infusion broth (Oxoid, Basingstoke, UK) for 24 h at 37°C in the anaerobic cabinet.", "\n\nPerformance Trial\n-----------------\n\nA total of 504 1-day-old (252 males and 252 females) Ross 308 broiler chicks obtained from a commercial hatchery were weighed and randomly allocated to one of two treatment groups. ", "Each treatment group consisted of three replicates with 42 male and three replicates with 42 female chickens per pen. ", "There was no significant difference in body weight between the two groups at the start of the trial. ", "The birds were raised on concrete floor covered with wood shavings. ", "Temperature was maintained at 33°C for the 1st week and then gradually reduced at a rate of 3°C per week to a final temperature of 22°C. ", "The lighting schedule provided 18 h of light per day and proper ventilation was ensured by means of exhaust fans. ", "The animals had *ad libitum* access to water and feed in a mash form that was formulated for a starter (days 1--13), grower (days 14--26), and finisher (days 27--40) period. ", "Lyophilized probiotic bacteria were mixed thoroughly in a small amount of feed (1 kg). ", "The resultant mixture was then mixed with the rest of the feed in a mechanical blender until a thorough and consistent mixture was obtained containing 10^9^ cfu *B. pullicaecorum*/kg feed. ", "All birds were given the same basal diet. ", "The treatment was as follows: basal diet without addition (control) and basal diet containing 10^9^ cfu *B. pullicaecorum*/kg feed.", "\n\n### Growth Performance, Feed Conversion Ratio, and Sample Collection\n\nAll chickens were weighed individually on d 14, 26, and 40. ", "In addition, feed consumption for each pen between weighing was determined by measuring leftovers of the feed on the same days as the birds were weighed. ", "FCR was calculated.", "\n\nOn days 26 and 40, three chickens per pen were randomly selected and euthanized by an intravenous overdose of sodium pentobarbital 20% (Kela, Hoogstraten, Belgium). ", "The ileal and cecal content was collected yielding 18 digesta samples per treatment and time point. ", "The samples were preserved at -80°C until 100 mg was weighed and subjected to total DNA extraction using hexadecyltrimethylammonium bromide (CTAB) based on the protocol described by [@B5]. ", "Isolated DNA was used as template for further analyses.", "\n\n### Library Construction and Sequencing of the V4 Region of 16S Ribosomal DNA\n\nThe V4 region of the bacterial 16S rRNA gene was amplified using PCR primers 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′) together with flanking molecular identifier (MID) and Illumina sequencing adapter as described by [@B28]. ", "PCR amplification was performed in a 50 μl reaction volume containing 25 μl 2X Taq Master Mix (Thermo Scientific, Aalst, Belgium), 0.2 μM of each forward and reverse primer and 20 ng DNA template. ", "The reaction conditions consisted of an initial 94°C for 3 min, followed by 35 cycles at 94°C for 45 s, 50°C for 60 s and 72°C for 90 s, as well as a final extension at 72°C for 10 min. ", "Next, amplified products with an expected band size of 300--350 bp were checked by 2% agarose gel electrophoresis and ethidium bromide staining. ", "Amplicons were purified using the MoBio UltraClean PCR Clean-Up kit (Mo Bio, Carlsbad, CA, USA) according to the manufacturer's instructions. ", "Libraries purified from agarose gel electrophoresis were applied for sequencing using Illumina MiSeq sequencer and MiSeq v2 sequencing kit to produce 250 bp pair-end reads. ", "The raw fastq sequences were merged using FLASH software ([@B32]) and quality-filtered using the FASTX-toolkit^[1](#fn01){ref-type=\"fn\"}^ Chimeras were removed using UCHIME v6.0.307 ([@B14]) and each sample was downsampled to 10,000 reads using random selection of reads. ", "The taxonomy of the reads was determined using RDP classifier ([@B52]), and species-level OTUs (taxonomical bins of sequences with \\>97% similarities) were clustered *de novo* using USEARCH v6.0 ([@B13]). ", "All taxonomy tables were created using Perl scripts for the follow-up analysis. ", "Statistical analysis of alpha-diversity and beta-diversity were carried out using Vegan package ([@B12]) in R.\n\n### Real-Time PCR Quantification of *Campylobacter* spp.", "\n\nMembers of the genus *Campylobacter* were quantified using the CFX384 Bio-Rad detection system (Bio-Rad, Nazareth-Eke, Belgium). ", "Amplification and detection were carried out in a 384-well plate using 2X SensiMix^TM^ SYBR No-ROX mix (Bioline, Nazareth-Eke, Belgium). ", "Each reaction was done in triplicate in a 12 μl total reaction mixture using 2 μl of appropriate dilutions of the DNA sample and 0.5 μM final qPCR primer concentration (**Table [1](#T1){ref-type=\"table\"}**). ", "The reaction conditions used were 1 cycle at 95°C for 10 min, followed by 40 cycles at 90°C for 30 s and 60°C for 45 s. A stepwise increase of the temperature from 65 to 95°C was added and melting curve data were analyzed to confirm specificity of the reaction. ", "For construction of the standard curve, a 812 bp long PCR product was generated using standard PCR primers listed in **Table [1](#T1){ref-type=\"table\"}** and genomic DNA from *Campylobacter jejuni.* ", "After purification (Invitek, Berlin, Germany) and determination of the DNA concentration with a Nanodrop ND 1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA), the volume of the linear dsDNA standard was adjusted to 10^8^ copies/μl assuming an average molecular weight of 660 per nucleotide pair. ", "This stock solution was serially diluted to obtain a standard series from 10^8^ to 1 copies/μl with each step differing by 10-fold. ", "The copy numbers of samples were determined by reading off the standard series with the cycle threshold (*C*~t~) values of the samples. ", "Gene copy numbers were expressed as log~10~ values per gram wet weight of intestinal content.", "\n\n###### \n\nSequence of used primers.", "\n\n Target Forward primer Reverse primer Analysis Reference\n ----------------------------------------- ---------------------- ---------------------- -------------- ------------\n 16S rRNA gene from *Campylobacter* spp. ", " CATTGTAGCACGTGTGTC GGATGACACTTTTCGGAGC Standard PCR This study\n nt^∗^ 380--398 nt 1191--1174 \n GCGTAGGCGGATTATCAAGT CGGATTTTACCCCTACACCA qPCR [@B8]\n nt 526--545 nt 628--647 \n \n\n∗\n\nnt = nucleotide sequences are presented from 5′ to 3′ and their position in the 16S rRNA gene is given based on the sequences of\n\nCampylobacter jejuni\n\nNCTC 11351.", "\n\nNecrotic Enteritis Trials\n-------------------------\n\nRoss 308 broiler chickens were obtained as 1-day-old chicks from a commercial hatchery and reared in cages with a density of 30 birds/m^2^ on wood shavings. ", "All cages were separated by solid walls to prevent contact between birds from different treatment groups. ", "Four trials were performed. ", "For each experiment the chickens were randomly allocated into groups of 30 birds. ", "A 23 h/1h light/darkness program was applied. ", "The chickens received drinking water and feed *ad libitum*. ", "The feed was based on wheat/rye as described by [@B21] with soybean meal as protein source. ", "A one and twofold dose of Poulvac Bursa Plus (Zoetis, Zaventem, Belgium) was given in the drinking water on days 4 and 9, respectively, to all groups. ", "On day 11, all birds were orally inoculated with a 10-fold dose of Hipracox (Hipra, Girona, Spain) and on day 16 they received a 10-fold dose of Paracox-8^TM^ (Schering-Plough Animal Health, Brussels, Belgium). ", "Both vaccines were diluted in water and each chicken received 1ml orally. ", "From day 17 onwards, the soybean in the feed was replaced by fishmeal (30%) as the protein source. ", "All chickens were orally challenged (three times a day) on days 18, 19, 20, and 21 with 1 ml of a fresh broth culture containing 5 × 10^8^ cfu *C. perfringens* per milliliter. ", "On day 22 all birds were euthanized by an intravenous overdose of sodium pentobarbital 20% (Kela, Hoogstraten, Belgium). ", "Necrotic lesions in the small intestine (duodenum to ileum) were scored as described by [@B24]. ", "Briefly, the scoring was as follows: 0 = no gross lesions; 1 = congested intestinal mucosa; 2 = small focal necrosis or ulceration (1--5 foci); 3 = focal necrosis or ulceration (6--15 foci); 4 = focal necrosis or ulceration (16 or more foci); 5 = patches of necrosis 2--3 cm long; 6 = diffuse necrosis typical of field cases. ", "Birds with lesions score of two or more were classified as NE-positives.", "\n\nIn the first trial, from day 1 onwards, lyophilized *B. pullicaecorum* bacteria were mixed in the feed of two groups at a concentration of 10^9^ cfu per kg, while the control group received unsupplemented feed. ", "The second, third, and fourth trial both comprised two groups with one group receiving feed supplemented with 10^9^ cfu lyophilized *B. pullicaecorum* per kg and one control group. ", "All the bird experiments were carried out according to the recommendations of, and following approval by the Ethical Committee of the Faculty of Veterinary Medicine, Ghent University (EC2009/098, EC2010/099, EC2012/101, EC2014/50).", "\n\nStatistical Analysis\n--------------------\n\nThe data for body weight and FCR were statistically analyzed with GraphPad Prism version 5.0 (GraphPad, La Jolla, CA, USA) using a non-parametric unpaired *t*-test. ", "A one-tailed Wilcoxon test for each genus was applied to test for differences in relative abundancy. ", "A non-parametric Mann--Whitney *U* test was performed to compare the mean number *Campylobacter* bacteria as measured with qPCR in the treated and untreated group. ", "The data from the NE trials were analyzed using one-tailed Wilcoxon signed-rank tests. ", "In all cases, a probability level of *p* ≤ 0.05 was considered statistically significant.", "\n\nResults\n=======\n\nPerformance Trial\n-----------------\n\n### Daily Weight Gain, Growth Performance, and FCR\n\nThe effects of dietary supplementation with *B. pullicaecorum* on animal performance of all broilers and for both sexes separately during different periods are shown in **Table [2](#T2){ref-type=\"table\"}.**", "\n\n###### \n\nThe effect of *Butyricicoccus pullicaecorum* supplementation on the growth performance of the chickens.", "\n\n Body weight (g)^a^ Feed conversion ratio^a^ \n -------- ----------- -------------------- -------------------------- -------------- --------------- --------------- ---------------\n Male Ctrl 497.1 ± 4.5 1405 ± 14.3 2949 ± 31.8 1.125 ± 0.013 1.422 ± 0.059 1.629 ± 0.024\n Bp 484.5 ± 4.8 1328 ± 11.2 2789 ± 23.6 1.103 ± 0.006 1.310 ± 0.046 1.521 ± 0.011\n *P*-value 0.0573 **\\<0.0001** **\\<0.0001** 0.1935 0.2043 **0.0148**\n Female Ctrl 466.1 ± 4.7 1250 ± 10.0 2575 ± 23.8 1.111 ± 0.011 1.384 ± 0.008 1.635 ± 0.017\n Bp 463.0 ± 3.9 1268 ± 9.3 2564 ± 18.6 1.100 ± 0.004 1.295 ± 0.002 1.516 ± 0.001\n *P*-value 0.6107 0.1980 0.7061 0.4129 **0.0005** **0.0120**\n All Ctrl 481.6 ± 3.4 1328 ± 10.2 2762 ± 23.8 1.118 ± 0.008 1.403 ± 0.028 1.632 ± 0.013\n Bp 473.6 ± 3.2 1298 ± 7.5 2675 ± 16.7 1.102 ± 0.003 1.302 ± 0.021 1.518 ± 0.011\n *P*-value 0.0860 **0.0155** **0.0025** 0.0936 **0.0157** **\\<0.0001**\n \n\nBody weight and feed conversion ratio (FCR) were measured at three time intervals.", "\n\na\n\nValues are the mean of three replicates of 42 chickens ± standard error of the mean. ", "Ctrl: feed without probiotic supplementation, Bp: feed supplemented with 10\n\n9\n\ncfu\n\nB. pullicaecorum\n\nper kg feed. ", "Bolded values are the ones that are significantly different.", "\n\nThe male birds fed the *B. pullicaecorum* supplemented diet had a lower (*p* \\< 0.05) body weight on days 26 and 40 than the male birds in the control group. ", "Supplementation of the probiotic had no significant effect on the body weight of the females at the three different time points. ", "Significant differences between treatments were noted in the FCR. ", "The FCR for *B. pullicaecorum* treated females was significantly lower during grower (1.295 ± 0.002 vs. 1.384 ± 0.008) and finisher (1.516 ± 0.001 vs. 1.635 ± 0.017) period than for the control group. ", "A significantly lower FCR for the *B. pullicaecorum* treated male birds (1.521 ± 0.011 vs. 1.629 ± 0.024) was observed only during the finisher period.", "\n\n### Characterization of Microbial Communities\n\nAfter quality trimming, a total of 745,182 and 980,262 sequencing reads were obtained from the ileal and caecal samples, respectively. ", "Rarefaction of all samples to 10,000 reads resulted in the identification of a total of 7490 and 4996 OTUs in the ileum and caecum, respectively. *", "Firmicutes*, *Bacteroidetes*, and *Proteobacteria* were the most abundant bacterial phyla in the ileal and caecal samples, regardless age or group. ", "Overall, major separation was observed between the microbiome from different sampling sites (ileum vs. caecum, 21.5% variation, *p* = 0.001); minor differences were noted between samples taken at different time points (26 days vs. 40 days, 6.9% variation, *p* = 0.001). ", "Neither gender nor administration of *B. pullicaecorum* had a significant impact on microbial community differences (both \\<1% variation, *p* \\> 0.05). ", "On both days 26 and 40 the proportions of a number of genera representing at least 1% of sequences were altered significantly in the *Butyricicoccus* treated group compared with the control group. ", "On day 26, significantly higher proportions of *Bacteroides*, *Butyricicoccus*, *Parabacteroides*, *Parasutterella*, and unclassified *Veillonellaceae* were detected in the ileum of the probiotic group as compared to control chickens (**Figure [1A](#F1){ref-type=\"fig\"}**). ", "The numbers of *Lactobacillus* and *Aquabacterium* spp. ", "were significantly higher in the ileum of the treated chickens on day 40, while the abundances of *Enterococcus*, *Escherichia/Shigella*, *Desulfovibrio*, *Barnesiella*, and unclassified *Enterobacteriaceae* were significantly lower in the ileum compared to the control animals (**Figure [1B](#F1){ref-type=\"fig\"}**). ", "Differences in the caecum on day 26 were observed for *Parabacteroides* (**Figure [1C](#F1){ref-type=\"fig\"}**) and on day 40 for *Parasutterella* and *Ruminococcus*, with each genus being significantly more abundant in the animals that received *Butyricicoccus*. ", "Numbers of unclassified *Bdellovibrionaceae*, unclassified *Halobacteroidaceae*, and *Campylobacter* were significantly lower in treated vs. control chickens (**Figure [1D](#F1){ref-type=\"fig\"}**).", "\n\n{#F1}\n\n### Quantification of *Campylobacter* spp.", "\n\nTo confirm the decrease in abundance of *Campylobacter* in the caeca of chickens fed a *B. pullicaecorum* supplemented feed, as measured by pyrosequencing, we quantified the number of this human enteropathogen in the chicken intestinal microbiota by qPCR. ", "We found that the average number of bacteria belonging to the genus *Campylobacter* on day 40 was significantly (*p* = 0.0169) lower (5.27 ± 0.46 vs. 6.74 ± 0.19 in log number of 16S rRNA gene copy number/g caecal content) in the caeca of chickens that were administered *B. pullicaecorum* supplemented feed compared to control animals (**Figure [2](#F2){ref-type=\"fig\"}**).", "\n\n![**", "Quantification using qPCR of *Campylobacter* bacteria in caecal content from nine male (![](", "fmicb-07-01416-i001.jpg)) and nine female (![](", "fmicb-07-01416-i002.jpg)) *B. pullicaecorum* treated and nine male (![](", "fmicb-07-01416-i003.jpg)) and nine female (![](", "fmicb-07-01416-i004.jpg)) untreated chickens on day 26 **(A)** and day 40 **(B)**.** ", "Bacterial density is expressed as log~10~ copy number of 16S rRNA genes of *Campylobacter* per g of caecal content. ", "^∗^*p* = 0.0169.](fmicb-07-01416-g002){#F2}\n\nNecrotic Enteritis Trials\n-------------------------\n\n**Table [3](#T3){ref-type=\"table\"}** shows the percentage of birds with necrotic lesions in their small intestine in all trials. ", "The NE challenge was effective in inducing gross lesions, presented as multiple necrotic foci in the duodenum and jejunum. ", "No marked clinical signs or mortality were seen during the experiments. ", "The percentage of birds presenting lesions in the infected untreated control group varied between 14.8 and 56.6. ", "When the results of all trials were combined and evaluated for statistical differences, supplementation of *B. pullicaecorum* resulted in a significant (*p* = 0.0313) reduction in the number of birds developing necrotic lesions in comparison with the untreated control group.", "\n\n###### \n\nPercentage of chickens with macroscopic necrotic enteritis (NE) lesions (lesion score ≥2) per trial after challenge with *Clostridium perfringens*.", "\n\n Percentage animals with necrotic lesions \n --- ------------------------------------------ ---------------\n 1 56.6 40.0 and 39.3\n 2 36.0 7.69\n 3 53.6 25\n 4 14.8 3.6\n \n\nCtrl: feed without probiotic supplementation,\n\nB. pullicaecorum\n\n: feed supplemented with 10\n\n9\n\ncfu\n\nB. pullicaecorum\n\nper kg feed.", "\n\nDiscussion\n==========\n\nRecently, 16S rRNA gene-based pyrosequencing analysis identified the *Ruminococcaceae* family, harboring a range of highly oxygen-sensitive butyrate-producing species, to be associated with desirable productivity outcomes since they were found highly abundant in the caecal ([@B45]) and fecal ([@B42]) microbiota of chickens with low FCR. ", "In our study supplementation of *B. pullicaecorum*, a member of the *Ruminococcaceae* family, resulted in a significantly lower body weight which was compensated by a significantly lower FCR. ", "Rapid growth and heavy body weight of broilers often results in metabolic diseases such as ascites and sudden death syndrome. ", "Also skeletal disorders resulting in immobility of the birds are often observed ([@B6]). ", "Therefore, slowing down body weight gain may be advantageous. ", "This can only be of practical relevance when the improvement in feed conversion outweighs the reduced body weight in terms of economic benefit.", "\n\nThe subclinical form of *C. perfringens* associated- NE can adversely affects growth rate, feed conversion, and flock uniformity ([@B31]) resulting in serious economic losses on the poultry industry ([@B49]). ", "In addition to the etiological agent *C. perfringens*, predisposing factors such as *Eimeria*-induced mucosal damage and diets containing high levels of proteins are required to elicit the clinical signs and lesions of NE in poultry ([@B17]). ", "Those predisposing factors are hypothesized to change the gastrointestinal microbiota, providing a disrupted intestinal ecosystem in which *C. perfringens* can proliferate and cause disease ([@B53]). ", "Pyrosequencing of 16S rRNA amplicons showed that the predominant families *Ruminococcaceae* and *Lachnospiraceae*, linked with gut health through butyrate production ([@B4]) were the most affected bacterial phylotypes by the predisposing treatments for NE ([@B37]; [@B47]; [@B53]). [", "@B30] showed that birds previously fed butyrate were better in withstanding the stress of coccidial challenge ([@B30]). ", "Moreover butyrate was shown to induce synthesis of a subset of host defense peptides (cathelicidins) in jejunal and caecal explants from chicken origin, with immunomodulatory properties and a natural broad antimicrobial spectrum important as first line of defense ([@B48]). ", "This butyrate-induced mechanism of innate host defense may account for the suppressive effect on potential pathogenic and performance-related species as observed in the present performance trial. ", "Because butyrate-producing bacteria are depleted in the gut of chickens with NE, and butyrate has anti-inflammatory and epithelial barrier-strengthening effects ([@B38]; [@B51]), administrating a strain such as *B. pullicaecorum* can restore the unbalanced microbiota composition and the butyrate production and thus counteract NE.", "\n\n*B. pullicaecorum* treatment resulted in a depletion of sequences related to the genera *Enterococcus, Escherichia/Shigella, Barnesiella, Desulfovibrio*, and *Campylobacter*. ", "All, except for *Enterococcus*, are Gram negative organisms and thus the primary source for endotoxin, also referred to as lipopolysaccharide (LPS), able to stimulate localized or systemic inflammation resulting in attenuated growth performance ([@B33]). ", "Depending on the strain, enterococci are considered probiotic (such as *Enterococcus faecalis*; [@B9]) or pathogenic organisms (such as *E. cecorum*). ", "The latter may adversely affect performance, as it is associated with arthritis, osteomyelitis, and femoral head necrosis ([@B43]). *", "Campylobacter* is considered the most common bacterial cause of human gastroenteritis and poultry has often been implicated as source ([@B41]). ", "Intestinal colonization of *Campylobacter* in chickens causes a negative effect on growth performance ([@B10]) but, more importantly, plays an important role in carcass contamination at slaughter. ", "In the present study, *B. pullicaecorum* supplementation was associated with a 1.47 log reduction of *Campylobacter* at slaughter age. ", "It has been calculated that a reduction of 2 log units would reduce the public health risk by more than 90% ([@B16]).", "\n\nSequences related to the genera *Lactobacillus* and *Bacteroides* were enriched in the gut of chickens treated with *B. pullicaecorum*. ", "Lactobacilli have been shown to beneficially affect performance in broilers ([@B36]) by inducing immunomodulation and protection of the intestinal barrier via antagonistic activities against pathogens ([@B25]; [@B7]). ", "Although Gram-negative, and thus a source of endotoxin, organisms belonging to the genus *Bacteroides* are thought to play an important role in the development of the immune system, gut homeostasis and metabolism in humans ([@B40]). ", "In infants, a low *Bacteroides* signature is associated with a decreased microbial diversity ([@B54]) that has been associated with decreased intestinal health in general. ", "In the chicken, as in other species, members of the *Bacteroides* genus are involved in hydrolyzing polysaccharides from plant fibers ([@B26]). ", "As such, they may contribute to the improved feed conversion.", "\n\nConclusion\n==========\n\nThe continuous feeding of *B. pullicaecorum* suppressed the growth of undesirable microorganisms in the gut, prevented NE and improved the feed conversion in broilers. ", "Considering the relatively small quantities of *Butyricicoccus* that were added to the feed and the relatively low abundance of the strain in the intestine, the beneficial effect of performance of *Butyricicoccus* probiotic supplementation most probably is not only due to the direct effect of its butyrate production but also due to its modulating effects on the microbiome.", "\n\nAuthor Contributions\n====================\n\nFVI, RD, and FH designed the study, VE and AVP conducted the animal trials. ", "VE performed the qPCR analysis and JW, MJ, GF, and JR carried out bioinformatics analysis of the data. ", "VE drafted the manuscript. ", "All authors edited the manuscript and approved the final version of the manuscript.", "\n\nConflict of Interest Statement\n==============================\n\nThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.", "\n\nThe reviewer LB and handling Editor declared their shared affiliation, and the handling Editor states that the process nevertheless met the standards of a fair and objective review.", "\n\n**Funding.** ", "This work was supported by the Institute of Science and Technology, Flanders (IWT), under contract no SBO-100016. ", "MJ is postdoctoral fellow of the Research Foundation - Flanders (FWO).", "\n\nThe authors want to thank the Ph.D. students from the Department of Pathology, Bacteriology and Avian Diseases who assisted in the sampling during the *in vivo* trial and Leen Rymenans from KU Leuven for preparing the sequencing library.", "\n\n<http://hannonlab.cshl.edu/fastx_toolkit/.>\n\n[^1]: Edited by: *Zhongtang Yu, Ohio State University, USA*\n\n[^2]: Reviewed by: *Esperanza Martinez-Romero, National Autonomous University of Mexico, Mexico; Lisa Bielke, Ohio State University, USA*\n\n[^3]: This article was submitted to Microbial Symbioses, a section of the journal Frontiers in Microbiology\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.00625, 0.009302325581395349, 0.006024096385542169, 0, 0.006060606060606061, 0, 0.006896551724137931, 0.012738853503184714, 0.00558659217877095, 0, 0.017391304347826087, 0.008658008658008658, 0.009345794392523364, 0, 0.03409090909090909, 0.014925373134328358, 0, 0, 0.0136986301369863, 0, 0, 0, 0.011494252873563218, 0.0125, 0.004545454545454545, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.022727272727272728, 0, 0.05263157894736842, 0, 0, 0.005291005291005291, 0, 0.011940298507462687, 0.01015228426395939, 0, 0, 0.007042253521126761, 0.011560693641618497, 0.01838235294117647, 0.014634146341463415, 0, 0.011904761904761904, 0, 0.0072992700729927005, 0, 0, 0.010050251256281407, 0.009554140127388535, 0, 0, 0, 0, 0, 0.0014925373134328358, 0.0047169811320754715, 0, 0, 0, 0, 0, 0.010869565217391304, 0.006622516556291391, 0.009478672985781991, 0, 0, 0, 0, 0.010416666666666666, 0, 0, 0, 0, 0.017316017316017316, 0.014285714285714285, 0.009900990099009901, 0.006097560975609756, 0.011494252873563218, 0, 0.006369426751592357, 0, 0.003663003663003663, 0, 0, 0, 0, 0, 0.015151515151515152, 0, 0.013245033112582781, 0.005434782608695652, 0, 0, 0, 0, 0, 0, 0, 0.006289308176100629, 0, 0, 0, 0.002583979328165375, 0, 0, 0, 0, 0, 0, 0.02127659574468085, 0, 0.02127659574468085, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.008241758241758242, 0.005208333333333333, 0, 0.011235955056179775, 0, 0, 0.009478672985781991, 0.00411522633744856, 0.005, 0.014134275618374558, 0.016666666666666666, 0.0036496350364963502, 0, 0.006042296072507553, 0.01694915254237288, 0.00784313725490196, 0.006622516556291391, 0.007518796992481203, 0.006944444444444444, 0.01015228426395939, 0, 0.008547008547008548, 0, 0.01834862385321101, 0.004291845493562232, 0.005813953488372093, 0.006944444444444444, 0, 0, 0, 0.03305785123966942, 0.019417475728155338, 0, 0, 0, 0.00546448087431694, 0, 0.017543859649122806, 0.02857142857142857, 0.0041841004184100415, 0.022535211267605635 ]

[ "/*\n * Copyright (c) 2018 THL A29 Limited, a Tencent company. ", "All Rights Reserved.", "\n *\n * Licensed under the Apache License, Version 2.0 (the \"License\");\n * you may not use this file except in compliance with the License.", "\n * You may obtain a copy of the License at\n *\n * http://www.apache.org/licenses/LICENSE-2.0\n *\n * Unless required by applicable law or agreed to in writing,\n * software distributed under the License is distributed on an\n * \"AS IS\" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY\n * KIND, either express or implied. ", " See the License for the\n * specific language governing permissions and limitations\n * under the License.", "\n */\n\nnamespace TencentCloud.", "Mongodb.", "V20190725.Models\n{\n using Newtonsoft.", "Json;\n using System.", "Collections.", "Generic;\n using TencentCloud.", "Common;\n\n public class InquirePriceCreateDBInstancesRequest : AbstractModel\n {\n \n /// <summary>\n /// 实例所属区域名称，格式如：ap-guangzhou-2\n /// </summary>\n [JsonProperty(\"Zone\")]\n public string Zone{ get; set; }\n\n /// <summary>\n /// 每个副本集内节点个数，当前副本集节点数固定为3，分片从节点数可选，具体参照查询云数据库的售卖规格返回参数\n /// </summary>\n [JsonProperty(\"NodeNum\")]\n public long? ", "NodeNum{ get; set; }\n\n /// <summary>\n /// 实例内存大小，单位：GB\n /// </summary>\n [JsonProperty(\"Memory\")]\n public long? ", "Memory{ get; set; }\n\n /// <summary>\n /// 实例硬盘大小，单位：GB\n /// </summary>\n [JsonProperty(\"Volume\")]\n public long? ", "Volume{ get; set; }\n\n /// <summary>\n /// 版本号，具体支持的售卖版本请参照查询云数据库的售卖规格（DescribeSpecInfo）返回结果。参数与版本对应关系是MONGO_3_WT：MongoDB 3.2 WiredTiger存储引擎版本，MONGO_3_ROCKS：MongoDB 3.2 RocksDB存储引擎版本，MONGO_36_WT：MongoDB 3.6 WiredTiger存储引擎版本，MONGO_40_WT：MongoDB 4.0 WiredTiger存储引擎版本\n /// </summary>\n [JsonProperty(\"MongoVersion\")]\n public string MongoVersion{ get; set; }\n\n /// <summary>\n /// 机器类型，HIO：高IO型；HIO10G：高IO万兆型；STDS5：标准型\n /// </summary>\n [JsonProperty(\"MachineCode\")]\n public string MachineCode{ get; set; }\n\n /// <summary>\n /// 实例数量, 最小值1，最大值为10\n /// </summary>\n [JsonProperty(\"GoodsNum\")]\n public long? ", "GoodsNum{ get; set; }\n\n /// <summary>\n /// 实例时长，单位：月，可选值包括[1,2,3,4,5,6,7,8,9,10,11,12,24,36]\n /// </summary>\n [JsonProperty(\"Period\")]\n public long? ", "Period{ get; set; }\n\n /// <summary>\n /// 实例类型，REPLSET-副本集，SHARD-分片集群，STANDALONE-单节点\n /// </summary>\n [JsonProperty(\"ClusterType\")]\n public string ClusterType{ get; set; }\n\n /// <summary>\n /// 副本集个数，创建副本集实例时，该参数必须设置为1；创建分片实例时，具体参照查询云数据库的售卖规格返回参数；若为单节点实例，该参数设置为0\n /// </summary>\n [JsonProperty(\"ReplicateSetNum\")]\n public long? ", "ReplicateSetNum{ get; set; }\n\n\n /// <summary>\n /// For internal usage only. ", "DO NOT USE IT.", "\n /// </summary>\n internal override void ToMap(Dictionary<string, string> map, string prefix)\n {\n this.", "SetParamSimple(map, prefix + \"Zone\", this.", "Zone);\n this.", "SetParamSimple(map, prefix + \"NodeNum\", this.", "NodeNum);\n this.", "SetParamSimple(map, prefix + \"Memory\", this.", "Memory);\n this.", "SetParamSimple(map, prefix + \"Volume\", this.", "Volume);\n this.", "SetParamSimple(map, prefix + \"MongoVersion\", this.", "MongoVersion);\n this.", "SetParamSimple(map, prefix + \"MachineCode\", this.", "MachineCode);\n this.", "SetParamSimple(map, prefix + \"GoodsNum\", this.", "GoodsNum);\n this.", "SetParamSimple(map, prefix + \"Period\", this.", "Period);\n this.", "SetParamSimple(map, prefix + \"ClusterType\", this.", "ClusterType);\n this.", "SetParamSimple(map, prefix + \"ReplicateSetNum\", this.", "ReplicateSetNum);\n }\n }\n}\n\n" ]

{ "pile_set_name": "Github" }

[ 0.03278688524590164, 0, 0.014492753623188406, 0.009404388714733543, 0.009523809523809525, 0.034482758620689655, 0.125, 0.025, 0.08695652173913043, 0, 0.0625, 0.002403846153846154, 0.0136986301369863, 0, 0.004285714285714286, 0.005434782608695652, 0.005050505050505051, 0, 0, 0, 0, 0, 0, 0.037037037037037035, 0, 0, 0, 0, 0, 0, 0, 0.03225806451612903, 0.021739130434782608, 0.03571428571428571, 0, 0, 0.02040816326530612, 0.03225806451612903, 0, 0 ]

[ "\n75 Wyo. ", "305 (1956)\n295 P.2d 985\nIn the matter of the Estate of JOHN K. HARTT, Deceased, CLARENCE A. BRIMMER and ROBERT BIBLE, Executors of the Estate of JOHN K. HARTT, Deceased; CLARENCE A. BRIMMER and ROBERT BIBLE, as designated Trustees under the Last Will and Testament of JOHN K. HARTT, Deceased; and MARJORIE HIGLEY, Appellants,\nvs.\nPEARL HARTT, PEARL HOLMQUIST, MARIE HARRISON, FRANCES LOUISE MITCHELL, CATHERINE KEFFELER and DOROTHY OKEY, Respondents. ", "PEARL HARTT, Plaintiff and Respondent,\nvs.\nCLARENCE A. BRIMMER and ROBERT BIBLE, Executors of the Estate of JOHN K. HARTT, Deceased; CLARENCE A. BRIMMER and ROBERT BIBLE, as designated Trustees under the Last Will and Testament of JOHN K. HARTT, Deceased, Defendants and Appellants, PEARL HOLMQUIST, MARIE HARRISON, FRANCES LOUISE MITCHELL, CATHERINE KEFFELER and DOROTHY OKEY, Defendants and Respondents, and\nMARJORIE HIGLEY, Defendant and Appellant.", "\nNos. ", "2684 and 2685.", "\nSupreme Court of Wyoming.", "\nApril 10, 1956.", "\n*312 For the appellants Brimmer and Bible, as executors, in each case, the causes were submitted upon the brief of Clarence A. Brimmer, Jr., of Rawlins, Wyoming, and Lathrop & Lathrop of Cheyenne, Wyoming, and oral argument by Mr. Carleton A. Lathrop and Mr. Clarence A. Brimmer, Jr.\nFor the appellant Marjorie Higley in each case, the causes were submitted upon the brief of Smith & Nicholas of Lander, Wyoming, and oral argument by Mr. W.A. Smith.", "\nFor the respondents in each case, the causes were submitted upon the brief of Pence & Millett of Laramie, Wyoming; Senior & Senior of Salt Lake City, Utah; and Johnson & Miles of Rawlins, Wyoming; and oral argument by Mr. Alfred M. Pence and Mr. George J. Millett.", "\n\nOPINION\nBLUME, Chief Justice.", "\nJohn K. Hartt of about 78 years of age, hereinafter named generally as the testator, made his last will and testament on March 14, 1951. ", "We shall set out only the essential parts involved in this case. ", "In paragraph 3 he provided:\n\"I give, devise and bequeath all of my property, real, personal and mixed, whereof I may die seized or possessed, wheresoever situate and of whatsoever kind, after the payment of all of my just debts, expenses of administration and the family allowance, as follows, to-wit:\"\nHe then devised certain real estate consisting of the home in Rawlins and an adjoining tract of land to his wife, Pearl Hartt of about the age of 72 or more, and he devised other real estate to his six daughters, namely, Pearl Holmquist, Marie Harrison, Marjorie Higley, Frances Louise Mitchell, Katherine Keffeler, and Dorothy Hartt.", "\n*326 In paragraph 4 of his will, he provided:\n\"All of the rest, residue and remainder of my estate, being all of the balance of my said estate, to Clarence A. Brimmer and Robert Bible, all of the City of Rawlins, County of Carbon, State of Wyoming, to have and to hold the same, they, their heirs and assigns, in trust — nevertheless, for the uses and purposes, with the powers and in the manner hereinafter mentioned, namely, to-wit:\n\"(a) I hereby authorize, empower and direct the said trustees above named, and their survivors and successors, to adjust and settle all accounts and transactions relating to my business or investments; to leave my said estate, real, personal and mixed, invested as it then is at the time of my decease, or, should they deem it for the best interests of my estate, to lease, mortgage, sell or dispose of any or all of said estate, real, personal or mixed, whatsoever or wheresoever, either by public or private sale, for the best prices that can be obtained for the same, and by proper deed or deeds, mortgage or mortgages, conveyances or assurances in the law, to be duly executed, acknowledged and perfected by them, to grant, convey and assure the same to the purchaser or purchasers thereof; to invest the proceeds thereof in stocks or bonds or put the same out on interest at good security, or invest in such other manner as they may deem best, and they shall not be liable for any shrinkage in value by reason of the exercise of the discretion thereby reposed in them.", "\n\"(b) I do further authorize, empower and direct the said trustees and their survivors and successors to appropriate the net annual income of my said trust estate to the support of my wife during her lifetime; said monies to be appropriated for that purpose from time to time at regular intervals;\n\"(c) And I do further authorize, empower and direct the said trustees above named, and the survivors and successors of the said trustees, in case they shall deem it expedient and necessary, to appropriate the whole or any part of the principal of my said estate, real, personal or mixed, to the maintenance and support of my said wife.\"", "\n*327 He further provided that upon the death of his wife, if she should survive him, the income from the estate then remaining should be paid over to his six daughters in equal shares and that the principal of the estate then remaining should be paid over to these six daughters after the expiration of eight years. ", "In paragraph 8 of his will, Mr. Hartt provided as follows:\n\"I do nominate, constitute and appoint Robert Bible and Clarence A. Brimmer, to be the executors of this my Last Will and Testament, reposing full confidence in their integrity and ability to perform the trusts thus committed to them. ", "I do further direct that the said executors complete their administration of the said estate as soon as possible, in order that it may vest in them as trustees as aforesaid, by due process of law.\"", "\nRobert Bible, named as one of the executors in the will above mentioned, has been admitted to practice law in this state but in the main he is a banker and president of the First National Bank at Rawlins, Wyoming. ", "Clarence A. Brimmer is an attorney at law, having practiced for approximately forty years. ", "The pleadings and testimony in this case show: \"That for many years prior to the death of John K. Hartt, Clarence A. Brimmer as his attorney and Robert Bible as his financial adviser, consulted with and advised the testator in practically all of his legal and financial problems and assisted him in the determination of policy and management of the Cow Creek and Pioneer Sheep Companies as well as other interests of the decedent and devoted all the time necessary for such purpose.\" ", "It is further shown by the testimony that both Bible and Brimmer had large experience in connection with livestock companies. ", "The personal property left by the deceased was valued at more than $800,000 and consisted mainly of the controlling stock in three sheep companies, namely, Yellowstone Sheep *328 Company, Cow Creek Sheep Company and Pioneer Sheep Company.", "\nJohn K. Hartt died on July 14, 1952. ", "His funeral was held on July 16, 1952, after which a meeting was held at the home of the testator and his widow, Pearl Hartt. ", "There were present at that time the widow and five of the daughters of the testator as well as Robert Bible and Clarence A. Brimmer. ", "The will of the testator was read and Robert Bible gave a synopsis of the property which was left by the testator. ", "The will was duly admitted to probate in the district court of Carbon county, Wyoming, on August 14, 1952, and Bible and Brimmer were duly appointed as executors. ", "All of the beneficiaries of the will were apparently satisfied with the will of the testator for approximately a year. ", "But in the fall of 1953 after consultation with counsel, Pearl Hartt commenced an action in equity to permit her to dissent from the will of testator, although at that time the statutory period permitting her to dissent had expired. ", "Mrs. Hartt and five of her daughters also commenced an action to remove the executors appointed in the will. ", "Mrs. Hartt also set out another cause of action in which she claimed she was entitled to her statutory share of the estate, that is to say one-half thereof as well as that provided in the will. ", "These causes of action were consolidated by the court for trial and we shall consider them together in the order named. ", "All these causes or proceedings have been argued in great detail and extensively by counsel on both sides. ", "We have for instance before us one of the briefs in connection with two of these cases on the part of counsel for Mrs. Hartt and her daughters consisting of 300 closely printed pages and citing us to approximately 300 authorities. ", "In view of the minute and extensive briefs in the case, we feel compelled, much against our will, to make our opinion in these cases somewhat exhaustive, following the footsteps *329 of counsel in these cases. ", "We must apologize for the length of the opinion but the questions involved are new and important.", "\n\nI. Right of Widow To Dissent From Will After Statutory Time.", "\nThe action in equity heretofore mentioned to permit the widow to dissent from the will was brought by Pearl Hartt, widow of testator, on November 4, 1953. ", "She alleged in substance that she did not know of her right to elect to take against the will of the deceased; that she did not know the extent and value of the estate; that she was ignorant of the impact of Federal taxes on the estate; that she was not advised of her rights by the executors of the estate in whom the testator and plaintiff had reposed trust and confidence, nor was she advised of her rights by any one else. ", "All of the daughters of testator and Pearl Hartt, except Marjorie Higley, filed their answer admitting the allegations of the petition, and consented to the court granting the relief prayed. ", "Marjorie Higley, a daughter, and the executors answered and in substance denied the right of the widow to dissent from the will after the expiration of the time fixed by statute. ", "For convenience, Pearl Hartt and the daughters joining her in her petition will frequently be referred to as respondents.", "\nThe court, by decree dated July 16, 1954, granted the widow the right to elect to take against the will, which she did on July 20, 1954. ", "From the decree Marjorie Higley and the executors have appealed.", "\nThe statute,] 6-301 W.C.S. 1945, so far as applicable here, reads as follows:\n\"Any person of full age and sound mind, may dispose by will of all his property except what is sufficient to pay his debts, or what is allowed by law to husband *330 and family or wife and family; provided, however, that in case any married person shall hereafter by will deprive his or her husband or wife of over one-half of his or her property remaining after the payment of his or her debts, it shall be optional with the surviving spouse after the death of the testator or testatrix to accept the condition of such will or one-half of the estate, real and personal, of the deceased spouse. ", "Such option shall be signified by an instrument in writing, signed by the surviving spouse and acknowledged before some officer authorized by the laws of this state to take acknowledgments, and filed in the office of the clerk of the district court in which such will is admitted to probate within six (6) months after the probate thereof. ", "In default of the filing of such instrument duly executed and acknowledged as aforesaid within said period of six (6) months, the will shall govern and control in the distribution of the testator's estate * * *.\"", "\nThe question before us is as to whether or not Mrs. Hartt, the widow, has a right to elect not to take under the will, when she did not do so within six months after the probate of the will, and have relief in an action in equity. ", "The case is one of first impression in this court, and is, on account of future cases, of utmost importance. ", "It is stated in Annotation, 81 A.L.R. 757, that the authorities on the question are in conflict, without pointing out the reasons for conflict. ", "The decisive decisions on the point, pro and con, are absolutely irreconcilable, although we have diligently sought some ground on which they could be reconciled. ", "The reasons for the irreconcilability will be pointed out later. ", "There are but few points on which the courts are generally agreed, namely, when fraud and the like appear by reason of which the widow has been silent, relief may be granted, for fraud vitiates everything. ", "No fraud or the like appears in the case at bar. ", "So, too, the courts hold that if the widow wants to change her mind during the period fixed in the statutes, she may do so. ", "See cases cited in In re Zweig's Will, *331 145 Misc. ", "839, 261 N.Y.S. 400, 419. ", "There also may be very exceptional circumstances under which the time fixed by statute is not controlling. ", "Mann v. Peoples-Liberty Bank & Trust Co., Ky., 256 S.W.2d 489. ", "Counsel for respondents think that we have in principle decided in favor of their contention in Merrill v. District Court of Fifth Judicial Dist., ", "73 Wyo. ", "58, 272 P.2d 597. ", "We there relieved a party from default in a procedural matter and stated that courts have inherent power to relieve parties from default, which, of course, is true in so far as procedural matters are concerned. ", "But that case involves a substantive, a property right, and a method of acquiring property, and the case has no bearing herein. ", "A number of other cases, cited by counsel for respondents, are not in point herein. ", "Thus New Mexico and Oklahoma have no statute fixing the time in which an election must be made. ", "In re Woolley's Estate, 96 Vt. ", "60, 117 A. 370, and Hathaway v. Hathaway, 44 Vt. ", "658, are not in point for the reason that the statute expressly authorized the court to extend the time without apparently fixing any limit to that time. ", "That appears to be true also in the case of Town of Raymond v. Goodrich, 80 N.H. 215, 116 A. 38. ", "See Revised Statutes, New Hampshire, 1942, p. 1542,] 14. ", "The Kansas and Ohio cases cited may be distinguished by reason of the fact that there the probate court is required to explain to the widow her right of election against the will. ", "Porter v. Spring, 250 Mass. 83, 145 N.E. 52, is distinguishable because there the surviving spouse filed an election both under and against the will by mistake. ", "Primeau v. Primeau, 317 Mo. 828, 297 S.W. 382, too, is distinguishable because it involves the election by an insane person. ", "Nor does Waggoner v. Waggoner, 111 Va. 325, 68 S.E. 990, 992, 30 L.R.A. (N.S.) 644, from which counsel quote at length, support the position that the widow in this case should be permitted to now elect against the *332 will. ", "In that case the husband undertook to devise property to the widow which belonged to her, and for that reason the court held that the statute limiting the time in which she might elect was not applicable. ", "See comment on that case in 2 Pomeroy's Equity Jurisdiction, § 513a, p. 447, n. 4. ", "So the statement in Waggoner v. Waggoner, supra, that the rule of ignorance of the law excuses no one is not applicable \"to the mistakes of persons as to their own private rights and interests\" can be held to be applicable only as to the facts in that case, and cannot be held to state a universal rule. ", "Smart v. Waterhouse, Tenn., 10 Yerg. ", "94, is based on fraud. ", "Other cases cited by counsel for respondents are explainable by reason of their particular facts. ", "We need not comment on all of them. ", "In some instances courts do not seem to have been consistent throughout. ", "Take for instance In re McCutcheon's Estate, 283 Pa. 157, 128 A. 843. ", "We have not been able to reconcile some of the statements contained in that case with a later decision from that jurisdiction cited hereafter.", "\nThere are, however, left a number of cases which hold, or the excerpts from which state, that an election by a widow is not binding unless made with knowledge of her legal rights. ", "See for instance Dick v. Taylor, 124 Kan. 646, 261 P. 579; Hanson v. Clark, 246 Ill. App. ", "496; In re Donovan's Estate, 409 Ill. 195, 98 N.E.2d 757, 29 A.L.R.2d 215; Tolley v. Poteet, 62 W. Va. 231, 57 S.E. 811; Merchants Nat. ", "Bank v. Hubbard, 222 Ala. 518, 133 So. ", "723, 74 A.L.R. 646. ", "These cases are irreconcilable with the cases cited by appellants that a widow is not allowed to change her mind after the expiration of the time fixed by statute. ", "The reason for the difference is clear. ", "The former class still adhere to the common law rule of election. ", "For illustration of that see 28 C.J.S. 1098. ", "The latter class of cases do not adhere to the rule holding that the statute is mandatory *333 and that equity follows the law. ", "Thus we are compelled to make a choice.", "\nThe rule of the latter class of cases seems to have two sources. ", "In the first place we have the general rule that mandatory statutes must be obeyed and that the courts have no right to make a law contrary to that prescribed by the legislature. ", "In the second place the beginning at least of considering statutes mandatory in cases such as before us is clearly found in the fact that such statutes were enacted for the express purpose of remedying the evils of the law of election in such cases under the common law. ", "That has been somewhat obscured in later years, although some reference to it is found in the case of In re Stitzer's Estate, 103 Colo. 529, 87 P.2d 745, 120 A.L.R. 1266. ", "The earlier cases are clear on the subject. ", "Stephens v. Gibbes, 14 Fla. 331, 357, 358, discusses the common law at some length. ", "It points out that at common law no election was necessary except in certain cases; again that there was no limit of time in which an election by a widow was necessary to be made. ", "The court states that anyone who knows anything about the history of election in such cases knows the mischief that existed at common law, and that the enactment of statutes by the legislature on the subject \"originated in the desire and necessity for curing the evils incident to the common law rules upon these subjects.\" ", "The case was brought to have dower assigned. ", "It points out the statute providing that the widow was bound to take under the will unless she made an election to the contrary within the time specified. ", "The court states among other things:\n\"Under this statute, it is impossible that the practice prevailing in a court of equity upon the subject of election can obtain. ", "If the effect of the failure to dissent is in law an election to take the will, that is an end of the matter, because a court of equity except upon the ground of fraud, or some other like ground, cannot give a construction which will defeat the plain result of the *334 statute. ", "And if the effect of the law is not such an election, it has no effect at all, as the whole matter is left just as it was before.\"", "\nThe reasoning of the case is flawless. ", "From a logical standpoint at least it is impossible to disagree with it. ", "And because the law makes an election in such case, other cases in which the widow makes an affirmative election one way or the other are probably distinguishable, since in the latter cases the common law rule could probably be more readily applied. ", "No case, however, has discussed that feature. ", "So we speak with some diffidence on this point. ", "But it might well be said that if the law makes the election, what power has the court to permit a different one to be made?", "\nCollins v. Carman, 5 Md. 503, 530, 531, 532, discusses a like statutory provision in the light of the common law. ", "That case was an action in equity to elect against the will, after the expiration of the statutory time, on behalf of a widow who was insane, presenting if any fact could, an equitable reason for allowing the renunciation of the will. ", "But the court would not allow it. ", "The court states among other things:\n\"Every valid devise or bequest is, therefore, made an effectual bar, unless it be removed by a renunciation. ", "And until that is made the bar remains. ", "The law admits of no excuse for a failure to renounce. ", "If she makes no election within the time prescribed, the law makes it, without stopping to enquire why or for what reason she made none. (", "Italics supplied.) * * *\"", "\n\"The law clearly gives to the husband the power by his will to bar, or extinguish the common law rights of his widow, unless she thinks proper to quit all claim to the property conferred upon her by the will. ", "And to effect the husband's object the wife need not declare her assent; if however, she desires to defeat it, she must manifest her intention to do so, by an express dissent. ", "And such dissent is an act, which by the very terms of the law, must precede her becoming entitled to or vested with, those rights which she might have claimed *335 but for the will; for the act declares, she shall be barred of those rights, if she does not renounce and quit claim to the devises and bequests, and make her election to take in lieu thereof her dower, or legal share of the estate. ", "It is this election which vests in her the right of dower or legal share, in lieu of what the will had given (See 2 Devereux's Eq.", "Rep.,344). ", "Whether from design, neglect, or from other cause, the widow fails to make such renunciation, the result is the same. * * *\"", "\n\"To acquire such rights in opposition to the will, the law makes the renunciation a necessary act. ", "The non-performance of this act, is therefore, not a forfeiture of existing rights, but prevents the acquisition of those rights, which, by its performance, might be secured. * * *\"", "\n\"When the law directs an act to be done, or a condition to be preformed for the purpose of conferring a right, that right cannot be acquired if the act is left undone, or the condition is not performed. ", "And if no exception is made in favor of insane persons, courts of justice have no more power to decree to them the allowance of such rights, because of their mental incapacity to comply with the requisites of the law, than they have to decree in favor of sane persons failing to comply. ", "If the law makes no exception the courts can make none, whether they be courts of law or equity; for where the construction of a statute is before them, the rules of construction are the same in both courts.\"", "\nThe case was cited with approval in Bish v. Bish, 181 Md. 621, 31 A.2d 348, 350.", "\nIn McDaniel v. Douglas, Tenn., 6 Humph 220, 230, the court also considered the common law rule of election. ", "It held that in the absence of fraud the widow was bound by the provisions of the will. ", "The court aptly stated:\n\"The case bears no analogy to some of the cases of election at common law; that is said to be a `gentle nursing mother,' but the statute is stern and inflexible and exacts obedience. ", "The statute has existed for more than sixty years; and there has been no case in North Carolina or Tennessee, which sanctions the principle of *336 construction in this instance contended for. ", "To yield to the present application, would be a virtual repeal and abrogation of the statute. ", "It is better that a few widows should be permitted to choose ignorantly and injudiciously, and to their loss, than that we should have no rule.\"", "\nThe common law rule of election was also considered in Craven v. Craven, 17 N.C. 338, 344, 345, 347, in which it appears that a statute similar to ours was passed. ", "The court stated among other things:\n\"Where the language of a statute is free from ambiguity, there is much hazard of misconstruction by departing from it in search of the supposed policy of the Legislature. ", "If however we are to suppose that the Legislature intended to establish a more general and precise rule of election, than that which theretofore prevailed, when a demand of dower by a widow conflicted with the will of her husband, this supposition will conduct us to the same result as is indicated by the literal construction of the statute. * * *\"", "\n\"The Legislature substituted a new rule, more absolute and universal. * * * ", "And to remove all dispute as to the fact of her election, they declared her to have elected to take under the will, unless her refusal so to take was manifested within a prescribed time, by a solemn dissent in open court. * * *\"", "\n\"The law has defined the time, and prescribed the mode when and how, this fact can be certainly known. ", "The most obvious considerations of public policy forbid, without the clearest warrant, judicial exposition which will have a tendency to defeat this great purpose of the law.\"", "\nThus the reason for the adoption of statutes such as ours on the subject before us is clear, and pulls strongly to have us arrive at the same result in this case. ", "And that is even more true when we come to consider other authorities. ", "2 Pomeroy's Equity Jurisprudence, 5th Ed., ", "the standard book on equity, is in accord with the rules laid down. ", "The author in section 512, etc., ", "discusses the comon law rules, similar to those asserted to be the rules by counsel for respondent. ", "But the author *337 expressly states in § 511 that these rules govern in the absence of a statute on the subject, limiting the time in which an election must be made. ", "In § 513a, the author states as follows:\n\"These purely equitable rules, at least so far as they affect widows electing between testamentary benefits and dower, have been greatly modified by legislation in this country. ", "In very many of the states statutes have been passed which prescribe definite periods of time within which the right of election between dower and a provision made by will must be exercised. ", "Courts generally have held that legislative acts of this character are simply statutes of limitation fixing a definite time after which an election, if filed, cannot be considered. ", "If dissent is not indicated within the prescribed time and in the manner required by law, the widow is conclusively presumed to have elected to take under the will, no matter how hard the decision in a particular case may seem to be. ", "This is so except in cases of fraud, and perhaps under some other exceptional circumstances.\"", "\nAnd in § 519c, the author, though also citing cases to the contrary, states:\n\"Ordinarily, in the absence of a showing of fraud, and where no laches appears, a widow's petition to revoke an election between the provisions of her husband's will and her statutory rights must be presented within the period within which she is required to signify her election.\"", "\nFollowing the line of reasoning of the foregoing authorities, the Colorado Supreme Court in In re Sheely's Estate, 102 Colo. 194, 78 P.2d 378, 379, held that failure to renounce the will within the time fixed by statute, namely six months, is conclusive of her duty to take under the will and the statute is mandatory. ", "Counsel for respondents think that the case is not in point because that statute provided \"The failure to make and file such election within said period of six months shall be conclusive evidence of the consent of the surviving wife or husband to the provisions of such *338 will.\" ", "We think our statute means exactly the same as the Colorado statute. ", "This appears more clearly when we consider other cases. ", "In Indiana the statute provides that the widow takes under the will \"unless she shall make her election to retain her rights in the husband's estate given to her under the laws of the state of Indiana, which election shall be made in the manner hereinafter provided.\" ", "It may be noted that this statute is not nearly as explicit as our own, yet the construction put upon it is the same as on the Colorado statute. ", "In Haas v. Haas, 121 Ind. App. ", "335, 96 N.E.2d 116, 119, the court said:\n\"These statutes have been construed to mean that in all cases where there is a will, the widow is conclusively bound by it unless she renounces its provisions and elects to take under the law in the manner pointed out in the statute. ", "Fosher v. Gilliams, Executor, 1889, 120 Ind. 172, 22 N.E. 118, Collins v. Collins, 1891, 126 Ind. 559, 25 N.E. 704, 28 N.E. 190.) ", "To put it another way, on the death of a husband who made testamentary provisions for his wife, the failure of the surviving widow to make her election to take under the law instead of the will within six months after the probate thereof raises a conclusive presumption that she has accepted the provisions made for her in the will. ", "Easterday, v. Easterday, 1938, 105 Ind. App. ", "80, 10 N.E.2d 764.\"", "\nIn Tennessee the statute provides:\n\"A widow may dissent from her husband's will:\n\"(1) Where a satisfactory provision in real or personal estate is not made for her; in which case, she shall signify her dissent in open court, within one year after the probate of the will.\"", "\nIt may be noted that this statute, too, is not as explicit as ours, but the same construction is put upon it as upon the Colorado statute. ", "In McGinness v. Chambers, 156 Tenn. 404, 1 S.W.,2d 1015, 82 A.L.R. 1492, 1493, 1494, the court stated among other things, after referring to the statute, and quoting from another case:\n*339 \"`In looking at the language of the Code, it will be seen that it involves the idea necessarily that the widow is prima facie bound by the will of her husband, but that a privilege is conferred on her by which she may avoid its provisions as to herself, and she may dissent from it. ", "She is not required to assent to the will, but the will is binding and conclusive on her as to its dispositions, unless she shall signify her dissent in open court within one year after the probate of the will. ", "In other words, the will is a perfected act, vesting rights and fixing title as to the widow, which may be defeated and rendered nugatory, so far as she is concerned, by dissent, signified in open court within the twelve months after probate of the will. ", "These principles have been repeatedly held by this court, and such is the plain meaning of the statute. ", "It is even held, and conclusively settled as the law, that if the widow fails to dissent within the time allowed by law, it will be presumed conclusively that the provisions are satisfactory to her, and she having thus, by failure to dissent from the will, elected to take under it, can not be allowed to share in the estate of which her husband died intestate, and can only receive the property given to her by the will.' ", "Waterbury v. Netherland, 53 Tenn. (6 Heisk.) ", "512.\"", "\nAnd in the late case of Pinkerton v. Truman, 196 Tenn. 448, 268 S.W.2d 347, 350, the same court, after citing the statute, stated as follows:\n\"It is settled law in this state that `if the widow fails to dissent within the time allowed by law, it will be presumed conclusively that the provisions are satisfactory to her, and she having thus, by failure to dissent from the will, elected to take under it, can not be allowed to share in the estate of which her husband died intestate, and can only receive the property given to her by the will.' ", "Wrenne v. American Nat. ", "Bank, 183 Tenn. 247, 256, 191 S.W.2d 547, 551, opinion by Mr. Justice Gailor. ", "The opinion goes on to say, `This has been the law in Tennessee from very early times, as is evident from many reported cases', citing cases. ", "The first reported case is that of Malone v. Majors, 27 Tenn. 577, decided in 1847, opinion by Mr. Justice Turley.\"", "\nIn other cases, the courts have held that a statute like ours fixing the time in which a surviving spouse *340 must dissent from the will has been held to be a statute of limitation, and it is said that a court of equity may not give relief from such a statute no matter what hardship may be created, unless, perhaps, it be by reason of fraud or the like. ", "In re Zweig's Will, 145 Misc. ", "839, 261 N.Y.S. 400. ", "Thus the Colorado Supreme Court which, as noted, held the failure to elect to be conclusive on the rights of the widow, in the later case of In re Stitzer's Estate, 103 Colo. 529, 87 P.2d 745, 120 A.L.R. 1266, designates the statute as a statute of limitation. ", "Other cases to the same effect are Schweer v. Schweer, Mo. App., ", "86 S.W.2d 969; Ludington v. Patton, 111 Wis. 208, 86 N.W. 571; In re Zweig's Will, 145 Misc. ", "839, 261 N.Y.S. 400; Akin v. Kellogg, 119 N.Y. 441, 23 N.E. 1046. ", "Thus it is said in Palmer v. Voorhis, N.Y., 35 Barb. ", "479, 483:\n\"The devisees and grantees of the husband are under no obligation to give the widow notice of the provisions made for her by the will, and to require her to make her election. ", "This is not the purport of the statute. ", "It imposes no such duty on them as a condition of exonerating their lands from the burden of her claim. ", "She is presumed to know, as well as any one else, when the death of her husband occurs, and although she may not become apprised of the contents and provisions of his will within the period of a year after his death, she is bound to know that if she omits for that space of time to enter upon the lands, or commence proceedings for the recovery or assignment of her dower, her claim will be barred if there is a will with a pecuniary or other provision made for her in lieu thereof. ", "In this respect the statute operates as a limitation of her right of action; so that if the conditions upon which it applies actually exists, unless she commences her action within the time limited, the right to recover is barred as effectually as it would be, in the absence of a testamentary provision, by the omission to commence her action within the twenty years mentioned in the 18th section of the act.\"", "\nNumerous cases announce the rule that under a statute similar to ours, the surviving spouse must dissent *341 from the provisions of the will within the time fixed by statute, excepting cases involving fraud or the like. ", "Thus it is said in First Nat. ", "Exchange Bank of Roanoke v. Hughson, 194 Va. 736, 74 S.E.2d 797, 804:\n\"This paramount right to share in the estate under and as allowed by statute must be exercised within a year of the time of admission of the will to probate to become effective. ", "That limitation, however, merely restricts the time in which the right may be availed of and does not lessen its certainty, Yet within the year the widow or widower must elect to take by the will or against it, and election to take under the statute forfeits all rights enjoyed and provisions made for him or her in the will. ", "Mitchell v. Johnson, 1835, 6 Leigh 461; Kinnaird, Ex'r. ", "v. Williams' Adm'r. ", "8 Leigh 400; Findley's Ex'r. ", "v. Findley, 11 Grat. ", "434, 52 Vr. ", "434; and Nelson's Adm'r. ", "v. Kownslar's Ex'r., ", "79 Va. 468.\"", "\nIn Stearns v. Stearns, 103 Conn. 213, 130 A. 112, 116, the court stated:\n\"The statute is too plain to require construction. ", "The will did give to the husband a portion of the estate of testatrix. ", "The husband made no election in writing as to whether he would accept or reject the provisions of the will in lieu of his statutory share as husband of the testatrix. ", "The terms of this statute are explicit, and however unfortunate the result, the facts of record bring the case exactly within the statute and require us to hold that the husband `shall be taken to have accepted the provisions of the will, and shall be barred of said statutory share.'\"", "\nIn re Daub's Estate, 305 Pa. 446, 157 A. 908, 911, 81 A.L.R. 735, the court stated:\n\"No matter how hard the decision in a particular case may seem to be, if a widow does not make her election within the statutory period, the courts, because of that act, must declare that she is deemed to have made an election to take under the will, for this `statute here fixes the time as definitely as does that relating to taking appeals, and both are mandatory. * * * ", "In view of the positive provisions of the statute we are not persuaded that relief could be granted ex gratia.' ", "In re *342 Minnich's Estate or Sherwood's Estate, 288 Pa. 354, 358, 136 A. 236, 237. * * *\"", "\n\"A different conclusion will, of course, be reached in cases where actual fraud has been committed to obtain the widow's election, and no laches appears, for fraud vitiates everything it touches.\"", "\nAnd the court further held that a misrepresentation of one executor without intent to defraud is no ground for permitting a widow her election to take under the will. ", "Similar in effect, aside from the cases already cited, are: Hamilton Nat. ", "Bank v. Haynes, 180 Tenn. 247, 174 S.W.2d 39; Bunker v. Murray, 182 Mass. 335, 65 N.E. 420; Morgan v. Christian, 142 Ky. 14, 133 S.W. 982; Landers v. Landers, 151 Ky. 206, 151 S.W. 386; McGlaughlin v. McGlaughlin's Legatees, 43 W. Va. 226; 27 S.E. 378; In re Broad's Estate, 325 Pa. 541, 190 A. 872; In re Zweig's Will, 145 Misc. ", "839, 261 N.Y.S. 400; In re Goldstein's Estate, 176 Misc. ", "366, 27 N.Y.S.2d 288; In re Paskievitz' Estate, 184 Misc. ", "320, 55 N.Y.S. 2d 595; In re Brown's Estate, 69 N.Y.S.2d 864.", "\nIn 173 A.L.R. 999, we find an annotation dealing with extension of time in which to accept or renounce the provisions of a will. ", "Numerous cases are cited. ", "The fundamental principle involved in all, or most of these cases is the same as the principle involved in the case at bar, and substantially all the cases cited and quoted hold that when the surviving spouse fails to elect within the time fixed by statute, she must take under the provisions in the will of a testator.", "\nNotwithstanding this great array of authorities, in which the courts have considered the statutory provisions to be mandatory, counsel for respondents contend that we should follow the common law rule of election, in which time is not considered to be of the essence, and that equity will give relief. ", "We have already seen that Stephens v. Gibbes, 14 Fla. 331, and Collins v. Carman, 5 Md. 503, followed by another Maryland case, *343 hold the contrary. ", "Perhaps the leading case on the subject before us, because of the comprehensive discussion of all the phases on this subject, is In re Zweig's Will, 145 Misc. ", "839, 261 N.Y.S. 400. ", "Counsel for respondents say that the case is distinguishable because the probate court of New York has no equitable jurisdiction. ", "But it has jurisdiction, by statute, to extend the time within a limited period, which itself seems to be equitable in its nature. ", "Further the court expressly considers the subject of whether or not a court of equity can give relief after the expiration of the time fixed by statute, and states that courts of equity are powerless to vary the direct mandate of legislative enactments as are courts of law, and that this has been determined on innumerable occasions. ", "The court cites many cases. ", "In re Freer's Estate, 353 Pa. 351, 45 A.2d 47, 49, the court states:\n\"Since the will of the decedent was probated in Franklin County and no appeal from this probate was taken it follows that if the surviving husband wished to elect to take against his wife's will, it was incumbent upon him to manifest this election by a writing signed by him and duly acknowledged and delivered to the executors of the estate within one year after letters testamentary were issued. ", "His failure to do so is legally deemed an election to take under the will. ", "Courts have no power to extend the one year statutory limitation. ", "In re Broad's Estate, 325 Pa. 541, 190 A. 872.\"", "\nIn Moise v. Moise's Ex'r, 302 Ky. 843, 196 S.W.2d 607, 608, the syllabus is as follows:\n\"A chancery court has no power to grant testator's widow additional time to determine whether to renounce will after expiration of statutory period for renunciation thereof, unless application for extension of time is made within time prescribed by statute for such election.\"", "\nAnd in that case the court also stated:\n\"But no case has been called to our attention where, the twelve month period having expired, the Court approved the allowance of additional time to determine *344 whether or not to renounce. ", "On the other hand, the reasoning contained in the opinion of McGinnins v. McGinnis' Ex'r, et al., ", "300 Ky. 759, 190 S.W.2d 323, which we feel constrained to follow, forces us to the conclusion that the Court is without authority to grant additional time for renunciation, unless requested to do so before the expiration of the time prescribed by Statute * * *. ", "A widow's failure to renounce the will within the statutory period of time is tantamount to a formal declaration that she has elected to take under the will, and is as solemn and binding upon her as a renunciation would have been, if made. ", "It seems to us that, if the Court is without power to permit the withdrawal of a renunciation after the period for renouncing has expired, it likewise is without power to grant additional time to determine whether or not to renounce, unless application be made therefor within the time prescribed by Statute for the election.", "\n\"In other cases wherein Statutes limit the time in which acts may be done, we have held that the Court may not extend such time, unless application therefor shall have been made before expiration of the time allowed by Statutes.\"", "\nIn Shelton v. Sears, 187 Mass. 455, 73 N.E. 666, 668, the court stated in part as follows:\n\"It is suggested that she may have relief in equity against the operation of the statute, on the ground of accident or mistake in not earlier asserting her claim, and that she should be allowed by amendment to change her writ of dower into a bill in equity. ", "But the form of procedure cannot change the result. ", "Not only is no fraud or concealment shown, but she knew of the contents of the will and of its admission to probate, and at the time was acting under legal advice. ", "Motherway v. Wall, 168 Mass. 333, 338, 47 N.E. 135. ", "The only excuse offered for her inaction is that she was ignorant of the law, but this is not sufficient in equity, any more than at law, to overcome the express limitation fixed by statute within which she must act or be forever barred. ", "Upham v. Wyman, 7 Allen, 499, 502; Currier v. Studley, 159 Mass. 17, 33 N.E. 709.\"", "\nIn Allen v. Hartnett, 116 Mo. 278, 22 S.W. 717, 719, the court under a statute similar to ours stated in part:\n*345 \"This right is purely statutory. ", "It did not exist at common law. ", "Then, to entitle the widow to its benefits, she must bring herself within its provisions. ", "Equity can afford her no relief. ", "Admitting all the evidence introduced in her behalf to be true, then she did not comply with the statute. ", "That she intended to do so there can be no question. ", "It devolved upon her to see that her election was not only duly and timely executed, but that it was also filed in the office of the judge of the probate court of St. Charles county within 12 months after the granting of letters of administration on her deceased husband's estate. * * * ", "Such instruments are not filed, however, until deposited in the proper office, and the far-reaching arm of a court of equity, however willing it may be to do so, is not long enough to furnish relief in case of the defective execution of a statutory power, or dispense with any of the formalities required thereby for its execution. ", "Houx v. County of Bates, 61 Mo. 391; Moreau v. Detchemendy 18 Mo. 522. ", "When the statute specifically prescribes the manner in which a certain thing shall be done, it is strictly construed. ", "Hyde v. Goldsby, 25 Mo. App. ", "29, and authorities cited.\"", "\nThe case was expressly approved, quoting part of what is quoted above, in Wash v. Wash, 189 Mo. 352, 87 S.W. 993. ", "In Akin v. Kellogg, 119 N.Y. 441, 23 N.E. 1046, 1047, 1048, the court stated:\n\"I think, even if we assume the truth of these charges of her complaint, that her right to relief in equity is most doubtful. ", "She does not ask for relief against some positive act of her commission, procured by the fraud of another. ", "She asks for it because, through reliance upon the statements of others, she remained inactive, and thus suffered the period of time to expire within which she should have been diligent to ascertain and to secure her rights. ", "Now, equity does not interfere to grant relief when one has failed in diligence, or in the performance of an obvious and imperative duty imposed by law. ", "It does not rise above the common law and the statute. ", "Its office is not to relieve against a hardship, merely as such; nor should its interference be moved by mere opinion in the judge. ", "I do not think the equitable powers of a court can be properly invoked to interfere with the established rules of law. * * * *", "346 This being, then, a statute of limitation upon the widow's right to enforce her claim to dower, the policy of the law in such a case, as in all cases involving the operation of such a statute upon a person's rights or demands, forbids the granting of relief against its provisions. ", "The statute has acted, and the right has gone. ", "Nor is this the ordinary case of election, where knowledge is necessary in order to make it validly; and hence, where there was a mistake of facts, or a misconception as to rights, relief in equity is allowable. ", "Here the statute does not offer or create the election. ", "That existed already. ", "The office of the statute was to impose a limitation of time upon the exercise of the power to elect, and to bar any subsequent exercise of it. * * * ", "She was bound to know that the law compelled her to make her election as to whether she would abide by the will or not within a year. ", "Ignorance of that law is no excuse.\"", "\nIn Ludington v. Patton, 111 Wis. 208, 86 N.W. 571, 578, the court stated among other things:\n\"No further discussion of this subject seems necessary. ", "The decisions cited to our atttention in the briefs of counsel for appellant, to sustain the theory that a court of equity has power to relieve a widow from the effect of an election or failure to elect to take the provision made for her by law instead of the one made for her by her husband's will, because of mere ignorance or mistake on her part, cannot be followed. ", "They are out of harmony with the doctrine of this and most courts.\"", "\nWe think we are constrained to hold that our statute hereinbefore quoted is mandatory, and that Mrs. Hartt had no right to dissent from the will after the expiration of six months mentioned in the statute. ", "However, in order to show that the result of applying the statute is not nearly as drastic at least as applied to this case as counsel for respondents would have us believe, we shall, as briefly as possible, examine some of the facts that appear in the record and some of the law applicable in that connection. ", "And we must remember that equity is not always at odds with the law. ", "We have no doubt that when the legislature enacted § 6-301 W.C.S. 1945, it *347 thought that it was treading in the path of equity. ", "We cannot say that is not true. ", "Courts have no exclusive claim to that path.", "\nThe evidence in the case at bar shows that Mrs. Hartt, the widow, was present when the will of the testator was executed, so that she must have had at least a general idea what the will contained. ", "The will was read with the widow present, after the death of testator. ", "At that time Mr. Bible read to the widow and most of the daughters from a statement containing substantially an inventory of the estate. ", "He valued the estate at slightly more than the sum at which it was subsequently valued in the inventory filed in the case. ", "The will was admitted to probate. ", "No objections on the part of the widow were heard until the summer of 1953, when Bible bought some stock in the sheep companies from Mrs. Hartt's brother and part of which was distributed to Marjorie Higley, one of the daughters, and to her husband. ", "Mrs. Hartt did not like Marjorie's husband. ", "She testified that she was angry when she found that Mr. and Mrs. Higley got hold of some of the stock. ", "Thereafter she consulted Mr. Senior of Salt Lake City. ", "Soon thereafter we find such a barrage of lawsuits in connection with this estate as finds few parallels in the law books. ", "Two of these have already been decided by this court. ", "See Hartt v. Brimmer, 74 Wyo. ", "338, 287 P.2d 638 and 74 Wyo. ", "356, 287 P.2d 645.", "\nMrs. Hartt testified that she did not know that she had the right to dissent from the will. ", "As already stated, she was present at the time the will was executed. ", "For more than two years from that time she had the opportunity to investigate her rights. ", "She alleges that she relied on Bible and Brimmer. ", "She talked with the former nearly every week after July 1952 until she left Rawlins. ", "She did not manifest any sign that she was in the executors should have advised her of her rights. ", "It any way dissatisfied with the will. ", "She contends that *348 is stated in 90 C.J.S. 225 that: \"By accepting the trust, a trustee (executors are trustees) becomes bound to administer it, or to execute it, in accordance with the provisions of the trust instrument and the intent of the settlor.\" ", "In determining his duty, the intention of the testator is of controlling importance. ", "Robinson v. Elston Bank & Trust Co., 113 Ind. App. ", "633, 48 N.E.2d 181, 49 N.E.2d 348. ", "Hence the first and primary duty of the executors in this case was to see that the intent of the testator was carried out. ", "It was not their duty, in fact it would have been a violation of their duty, to do anything that would nullify the provisions of the will. ", "True the executors had no right to defraud the widow or by chicanery induce her not to dissent from the will. ", "But no fraud or chicanery is shown herein. ", "The court in Stephens v. Gibbes, 14 Fla. 331, 356, stated:\n\"Neither the executors, the other devisees or legatees, nor the creditors, are in any legal sense under an obligation to give the widow notice of the provisions of the will. ", "The law presumes her knowledge of the will and its contents as well as her knowledge of her right of dower and its nature, and she is bound to know that if she omits for the space of one year to signify her dissent, she cannot claim dower.\"", "\nThat, of course, applies as well to her right to take under the statute of descent and distribution. ", "In Ludington v. Patton, 111 Wis. 208, 86 N.W. 571, 579, the court laying down the same rule stated:\n\"The contention of respondents' counsel that the executors of the estate of Gov. Ludington had a legal and equitable right, if they saw fit, to remain passive for the year subsequent to the admission of the will to probate, conscious that by so doing the appellant, through her ignorance, would lose her widow\"s rights under the law, and that they and the Ludington children would be greatly enriched by such loss, must be sustained.", "\n\"The foregoing conclusion goes as far in sustaining the contention of counsel for respondents, that the trial court erred in deciding that Patton and Van Schaick breached their duty to appellant in failing to inform *349 her or put her in the way of informing herself as to what was the best course to pursue as regards her husband's estate, and in dealing with her to her disadvantage, as any of the authorities upon which they rely.\"", "\nSee also Akin v. Kellogg, 119 N.Y. 441, 23 N.E. 1046, from which we have heretofore quoted; 2 Bancroft's Probate Practice, 2d Ed., § ", "278; Zottarelli v. Pacific States Savings & Loan Co., 94 Cal. ", "App.2d 480, 211 P.2d 23; Reiner v. Fidelity Union Trust Co., 126 N.J. Eq. ", "78, 8 A.2d 175; Annotation, 39 A.L.R. 329.", "\nUnder the provisions of § 6-301 W.C.S. 1945, a widow to whom less than half of the estate of a testator has been left has the right to choose to take one-half of the estate, provided that she so chooses within six months after the probate of the will, and presumably takes the one-half by absolute title. ", "Mrs. Hartt did not file her dissent from the will within the time fixed by statute, but waited for over 14 months in which to petition the court for permission to file her dissent. ", "In such a situation a principle of equity enters the case, assuming that she had any right to dissent from the will at that time. ", "The basic thought underlying the cases which hold that a widow may change her mind after the expiration of the time fixed by statute is that the widow had been treated unfairly, and that an injustice should be remedied. ", "In other words she seeks equity. ", "Now counsel for the respondents go upon the theory that the widow has not been treated equitably and fairly unless she receives the one-half of the property by absolute title. ", "But is that assumption justified? ", "We are now in a court of equity. ", "We have found no case in which this question has been discussed. ", "Neither have we found any cases in which a will disposes of substantially a million dollars in the manner in which it was done in the case at bar. ", "So we have an entirely new question before us, and we must dispose of it as *350 a court of equity should, again assuming that the widow has any right at all at this time to change her mind. ", "The widow in this case was left the entire income of the property left in trust, together with the right to consume all of the corpus, if necessary. ", "And the question before us is: Is that an unfair and unjust will, so far as the widow is concerned? ", "Even at first glance, let alone after long deliberation which we have given the point, we think the unqualified answer must be in the negative, unless it be in connection with Federal taxes against the estate, which we shall mention later. ", "We presume that when equity intervenes to permit a widow to dissent from a will after the expiration of the statutory time, the fundamental purpose is not so much to give her a certain additional number of dollars or a certain amount of property, but to give her an additional amount of protection so that she may live in greater ease and in greater comfort in her old age. ", "We know of no more effective way to protect a widow of rather advanced age and of rather limited business experience, as is true in the case of Mrs. Hartt, than to give her the whole of the income of a comparatively large estate, plus the corpus, if necessary. ", "It is difficult to perceive why a court of equity should interfere with the provisions of a will of that kind. ", "Trusts are well known. ", "Provisions for a widow through a trust are frequent and it is in fact a common method in connection with large estates. ", "The testator knew his wife, her strength and her weakness, whether or not she would be unduly influenced by one or more of her daughters and thus perhaps fritter away her property and possibly ultimately leave her penniless. ", "It is rather hazardous for a court to substitute its judgment as of greater wisdom than that of the testator who had known his wife for fifty years. ", "There is testimony in the record that she could, if she received one-half of the property, give each of her six daughters *351 the sum of three thousand dollars each year. ", "That but accentuates what we have said. ", "The welfare of the daughters is wholly irrevelant on the question before us. ", "The testator, if of sound mind and not under undue influence, had the right or privilege to do with his property as he wished so far as the daughters are concerned. ", "And no question of testamentary incapacity enters into this case. ", "Five of these daughters are dissatisfied because the principal of the estate, left after the death of the widow, goes to them only after the expiration of 8 years after the widow's death. ", "All of the daughters are mature women, the youngest being above thirty years of age, so in view of that fact the provision is rather unusual. ", "But the court has no power to eliminate it, unless, perchance by and with the consent of all interested parties. ", "We might add as an explanation of this provision that the testator perhaps wanted to provide for his daughters after middle or old age when their or their husband's earning capacity had decreased. ", "If so, the provision was perhaps wise, rather than unwise.", "\nW.P. Farthing, an attorney, who has given special attention to Federal taxation, testified that if the widow would elect to take against the will, there would be an immediate saving of Federa lestate taxes of about $135,000; that if she died immediately, her estate would then be required to pay about $102,000, making a saving of only about $33,000; that if she lived out her expectancy of life, made no gifts, and saved about $5,000 per annum, her estate would then pay from about $119,000 to about $151,000. ", "This witness did not know whether the Bureau of Internal Revenue would recognize an election made after the statutory time had elapsed, thus leaving the question whether there would be any tax saving altogether problematical.", "\n*352 We can readily understand the anxiety of the trial court in this connection, feeling as all of us do the onerous burden of Federal taxation, hoping that the $135,000 might in the first instance be saved the estate, and doubtless figuring that a bird in hand is worth two in the bush. ", "It is not improbable that this fact, more than anything else caused it to enter the judgment permitting the widow to dissent from the will, as well as removing the executors, feeling that they were responsible for not saving this sum at this time. ", "It might be suggested that this amount of $135,000 might well have been taken by the widow and advantageously invested in an annuity. ", "There is, however, a flaw in that suggestion. ", "If she dissented from the will she could not take that sum from the estate, but would have to take it out of her one-half. ", "She could not have taken it out of the share of the children. ", "We, too, should be glad to have the foregoing sum saved, if it could be done consistent with the wishes of the testator. ", "The contention that the executors should have informed the widow of the effect of the Federal estate taxes is not well taken, as we have already seen. ", "They did not have the duty to advise her to do any act which would nullify the will. ", "And the contentions of the respondents, if sustained, would result in that. ", "The trouble in this whole matter is that the respondents try to shift the burden of not saving the foregoing sum at the present time on the wrong shoulders — on those of the executors. ", "The testator is no longer here to defend himself, so respondents try to find a scapegoat. ", "The responsibility in this connection rests solely and exclusively on the shoulders of the testator, and on those of no one else. ", "Appellants offered to prove that the testator consulted an expert on taxation before or at the time when he executed his will. ", "The court refused to permit that testimony. ", "That is not important. ", "Testator was as tax-conscious as every business man is. ", "He is presumed *353 to have known the law. ", "In fact we may well assume, without violating any legal rule, that he, with his business acumen, fully informed himself of the amount necessary to pay Federal taxes and deliberately made his will in the face of that fact. ", "He had a legal right to do so. ", "Should or can a court of equity say that he did not have that right? ", "Moreover, we may well revert to the question asked before: Can a court of equity, under the facts confronting us, say that the widow was treated unfairly and unjustly, and substitute its judgment for that of the testator? ", "We think we should give the same answer which we gave before. ", "Who, in this uncertain world, is so wise as to be able to look into the future and say that the provisions made by the testator were unwise?", "\nWe do not pretend to be seers, but, if this state keeps on being developed as it has in the past, it is not unlikely that we may have in the future numerous men with considerable wealth who may want to provide for their widows in a like or similar manner as the testator did in this case despite the laws on taxation, and for the reason, as already indicated, such method i sone of the most effective methods for the protection an dwelfare of a widow of advanced years and of limited business experience, when the amount involved is not small. ", "It hardly behooves our courts to deter them from so doing by not guarding such wills against untimely dissent, or cause them to go to other states with more liberal rights of testation.", "\nCounsel for respondents want us to consider the statement of K.N. Llewellyn in 46 Columbia Law Review, p. 167, to the effect that a decision should make sense in simple terms of life and justice. ", "The trouble in this case is that respondents and their counsel look at equity and justice from too narrow a standpoint. ", "Not a single voice is raised in testator's behalf by any *354 member of his family except that of his daughter Marjorie Higley. ", "The others consider this case from their own standpoint alone, ignoring the wishes of the testator. ", "We recall but one sentence in the voluminous briefs of their counsel which makes any reference to the testator's wishes. ", "Practically speaking, they take the position — which they would disavow — that the wishes of the testator must be disregarded if they conflict with the wishes of those upon whom he bestowed his bounty. ", "We do not, of course, blame them. ", "Everything in their view must be determined in favor of the living; the testator is in his grave; his wishes are no longer of importance. ", "We, along with at least many of the courts, think that is too narrow a view; that the testator's wishes must be carried out, if within the bounds of law, as they are in the case at bar. ", "After all, it is his property with which we are dealing. ", "He accumulated it; he could have given it away in his lifetime and left his widow practically penniless; he could have disposed of it in his will as he desired, if not contrary to law, as it is not in this case. ", "It is, and for many centuries has been, a common thought in our economic system, that to execute a last will and testament is the most solemn and sacred act of a man's life. ", "It is not our province to make light of that. ", "It would not be becoming of us to give men and women to understand that as soon as they are lowered in the grave, those upon whom they have bestowed their bounty may engage in a scramble over the property at will. ", "To say that would, we think, be poor public policy, contrary to the interests of society and should not be encouraged.", "\n\nII. ", "Removal Of The Executors.", "\nPearl Hartt, widow of John K. Hartt, deceased, together with five out of six of her daughters who were also daughters of the deceased, filed their petition in the matter of the probate of the estate of the deceased, *355 asking in substance that Robert Bible and Clarence A. Brimmer, appointed as executors under the will of deceased, be removed, and that they should not be appointed as trustees under the will although named herein as such, for the following reasons: (1) The personal interest of the executors conflict with and are adverse to their official duties as such executors and trustees. (", "2) There are hostile feelings between the executors and petitioners which will or are likely to interfere with the orderly and proper management of the estate and trust. (", "3) The executors have neglected to comply with mandatory duties imposed on them by statute. ", "Reference to the particulars of these objections, or at least those worthy to be mentioned, will be made in the discussion which follows:\nThe court granted the prayer of the petitioners, removed the executors as being incompetent to administer the estate and directed them to turn the property of the estate over to a special administrator. ", "The executors and Marjorie Higley, one of the daughters of testator, have appealed to this court. ", "The plaintiffs will be referred to as respondents. ", "The term appellants includes the executors and Marjorie Higley.", "\nBefore proceeding further we should, we think, refer to some general principles which have been enunciated by the courts in this connection. ", "It is stated that an order of removal is harsh and severe; that it is serious, that it is drastic. ", "In re Bell's Estate, 135 Cal. ", "194, 67 P. 123; Pyle v. Pyle, 137 App.", "Div. ", "568, 122 N.Y.S. 256. ", "In re Bailey's Estate, 306 Pa. 334, 159 A. 549, 551, the court stated:\n\"It is a serious matter to dismiss trustees appointed by will; much more should be shown by those who wish them dismissed than would be the case where the trustees are appointed by the court. ", "Perry on Trusts (6th Ed.) ", "276, says: `The power of removal of trustees appointed by a deed or will ought to be exercised sparingly *356 by the courts. ", "There must be a clear necessity for interference to save the trust property. ", "Mere error or even breach of trust may not be sufficient; there must be such misconduct as to show want of capacity or of fidelity putting the trust in jeopardy.'\"", "\nIrregularities not directly harmful in managing the estate will be overlooked. ", "In re Gerbereux' Will, 148 Misc. ", "461, 266 N.Y.S. 134. ", "If the court can readily remedy a matter of complaint, no removal will be ordered. ", "Massey v. Stout, 4 Del. Ch. ", "274; 2 Bancroft's Probate Practice, 2d Ed., ", "184; Wilson v. Smoot, 186 Ky. 194, 216 S.W. 129. ", "In 90 C.J.S. 193, 194, relating to trusts, it is stated: \"In order to warrant removal, there must be such gross negligence or misconduct as to evidence a want either of capacity or fidelity, putting the trust in jeopardy.\" ", "The misconduct must be willful. ", "Massey v. Stout, supra. ", "See also 33 C.J.S. 1037. ", "In Smith v. Heyward, 115 S.C. 145, 105 S.E. 275, 282, the court stated:\n\"The courts have ever been reluctant to take the management of an estate from those to whom it has been confided by the testator, for to that extent the intention expressed in his will would be defeated. ", "No doubt, the courts have the power to do it in a proper case. ", "But for obvious reasons it is a power which should be exercised with great caution, and not at all, unless it is made to appear to be necessary for the protection of the estate, to prevent loss or injury to it from misappropriation, maladministration or fraud.", "\n\"In Stairley v. Rabe, McM. Eq. ", "22, the court said:\n\"`The rule certainly is that the administration will not be taken from an executor without strong reasons, \"because,\" says Lord Erskin in Middleton v. Dodswell, 18 Ves. ", "268, \"it is for the testator, not the court, to say in whom the trust for administration of his effects shall be reposed.\"'\"", "\nIn Shelton v. McHaney, 343 Mo. 119, 119 S.W.2d 951, 954, 960, the court stated in part:\n\"A trustee will not `be removed for every violation of duty, or even breach of trust, if the fund is in no *357 danger of being lost. * * * ", "There must be a clear necessity for interference to save the trust property. ", "Mere error, or even breach of trust, may not be sufficient; there must be such misconduct as to show a want of capacity or of fidelity, putting the trust in jeopardy.' ", "1 Perry on Trusts, 7th Ed., § ", "276, notes 93, 94. * * * ", "Defendants are testamentary trustees, named by the testator. ", "`The court will less readily remove a trustee named by the settlor than a trustee appointed by the court or by a third person who is by the terms of the trust authorized to appoint a trustee. ", "The court will not ordinarily remove a trustee named by the settlor upon a ground existing at the time of his appointment and known to the settlor and in spite of which the settlor appointed him, although the court would not have appointed him trustee.' ", "1 Restatement of the Law of Trusts, p. 280, § 107(a),f.", "\n\n* * * *\n\"We are dealing with trustees appointed by the creator of the trust after personally securing their consent to serve. ", "The trust estate was created after mature deliberation and the trustees are men which whom the trustor had been associated in business and in whose business ability he had confidence. ", "The cestuis take under testator's will. ", "They may not escape the conditions there imposed or avoid testator's preference of trustees to administer his estate without just and sufficient cause. ", "Testator's desires, as well as the desires of the cestuis, are to be considered.\"", "\nIn petition of Commonwealth-Atlantic Nat. ", "Bank, 249 Mass. 440, 144 N.E. 443, 447, the court stated in part:\n\"Nomination of a person to act as his executor by one making his will imports signal trust and confidence in the particular person so named. ", "Such nominations with respect to natural persons as matter of common knowledge are inserted in a will because the one executing the will reposes special reliance upon the individual integrity, sagacity, capacity, good faith, friendliness and sympathy with testamentary wishes on the part of the specified person.\"", "\nIn re Chadbourne's Estate, 15 Cal. ", "App. ", "363, 114 P. 1012, 1013, the court stated:\n*358 \"In the first place, it should be and is the policy of the law to give effect, as far as it can be legally done, to the expressed will of the deceased. ", "The nomination of the executor is evidence of the confidence reposed in him by the testator, and the deliberate purpose and desire thus solemnly expressed as to the administration should not be thwarted, unless the plain provisions of the law or the interests of justice demand it.\"", "\nIn Wilson v. Smoot, 186 Ky. 194, 216 S.W. 129, the rule here involved is stated distinctly in a syllabus of the Kentucky Reports as follows:\n\"Trusts — Trustee Under Will — Removal. ", "— A trustee appointed under a will will not be removed from his trust except upon the clearest testimony showing his incompetence or incapacity to act as trustee, or his intentional or grossly negligent management of the trust property, and where the only derelictions with which he is charged or attempted to be proven is that he failed to make settlement in the manner and at the times required by law, and failed to manage the property so as to realize the greatest possible profit, he will not be removed, especially when his appointment was made in the will of his wife who directed that he manage and control the property according to his judgment, and in which she expressed utmost confidence.\" ", "A good discussion of the general principles involved is found in Massey v. Stout, 4 Del. Ch. ", "274, 275. ", "We quote some of the syllabi:\n\"The power of the Court to remove trustees appointed by deed or will, is exercised very sparingly, the principle being maintained that there must be clear necessity for its interference, in order to secure the trust fund against loss or misapplication.", "\n\"The Court will not remove a trustee appointed by deed or will, for error or misjudgment in some special transactions, or even for a breach of trust. ", "There must be such gross negligence or misconduct as to evidence a want either of capacity or fidelity, putting the trust in jeopardy.", "\n\"Where the trust is not put in jeopardy, the remedy against a trustee for a breach of trust is to charge him *359 for the consequences of his acts; or he may be enjoined from any improper act meditated, but not executed.\"", "\nThroughout their brief counsel for respondents rely to a great extent upon the rule that we have no authority to reverse the judgment of the court below unless we find there was a clear abuse of discretion. ", "There are a great many authorities differing in their view as to what abuse of discretion means. ", "It is stated in Swall v. Anderson, Cal. ", "App., ", "140 P.2d 196, syllabus 7, that: \"An `abuse of judicial discretion' means merely that reviewing court would have decided differently under the same circumstances.\" ", "To the same effect is Borger v. Mineral Wells Clay Products Co., Tex.", "Civ.", "App., ", "80 S.W.2d 333, 334. ", "In Puterman v. Puterman, 69 Wyo. ", "89, 205 P.2d 815, 822, we stated:\n\"Many courts in defining the words `abuse of discretion' as opposed to the words `sound discretion' have used substantially the language employed in the case of Detroit Fidelity & Surety Co. v. Foster, 170 S.C. 121, 169 S.E. 871, 881, as follows: `The term \"abuse of discretion\" does not mean any reflection upon the presiding judge, and does not carry with it an implication of conduct deserving censure, but is strictly a legal term indicating that the appellate court is of the opinion that under the circumstances the trial judge committed error of law in the exercise of his discretion.\"", "\nTo the same effect is Brown v. Beck, 64 Ariz. 299, 169 P.2d 855. ", "True the term has been, even by this court, used in a different sense. ", "And it is said in many cases that the trial court has a wide discretion, and will not be reversed even though reasonable minds may differ regarding the facts. ", "However the discretion of removing executors and trustees has been circumscribed by rules. ", "We cannot shirk our duty to examine the facts, and if, in the light of the circumscribing rules, we are clearly of the opinion that the facts do not warrant the removal, we should, in a case like the one at bar, say *360 so, and not take the easy way out by saying that the removal was in the discretion of the court.", "\n\nA. Violation of Statutes.", "\nIt is claimed by the respondents that the executors should be removed because they did not comply with certain provisions of the statutes. ", "We cannot, of course, encourage violation of specific provisions of the statutes, but whether or not failure of strict compliance therewith is sufficient ground for removing the executors is another matter. ", "The statute, § 6-1301 W.C.S. 1945, provides that an inventory shall be filed within a reasonable time after the appointment of the executor or administrator. ", "In this case the executors filed an inventory on April 17, 1953, about eight months after the will was admitted to probate. ", "A statement, substantially an inventory, was submitted to the beneficiaries under the will, or most of them, on July 16, 1952, after the funeral of the deceased testator. ", "So a statement, substantially an inventory, was embodied in the petition to have the will admitted to probate. ", "Furthermore, the testimony shows that an action for damages involving a claim for some $170,000 was pending just prior to the time the inventory was filed, making it somewhat difficult to file a minute inventory before that time. ", "We think the foregoing contention is without merit. ", "See Clancy v. McElroy, 30 Wash, 567, 70 P. 1095; Willoughby v. Willoughby, 203 Ala. 138, 82 So. ", "168; In re Graber's Estate, 111 Cal. ", "432, 44 P. 165; 21 Am.", "Jur. ", "450.", "\nSection 6-2010 W.C.S. 1945, provides that executors and administrators must file their accounts six months after their appointment. ", "It does not appear that any request for an accounting was made, nor does it appear that any harm resulted because of the failure of the executors in this case. ", "So the objection in this connection is unsubstantial, and not a cause for removal. ", "In *361 re Johnson's Estate, 178 Or. ", "214, 164 P.2d 886; In re Stewart's Estate, 145 Or. ", "460, 28 P.2d 642, 91 A.L.R. 818. ", "It is probably not a mere conjecture when we say that if the failure herein mentioned is cause for removal of the executors, half of the executors and administrators in this state should be removed. ", "The contention made herein may serve as a warning in the future.", "\nSection 6-1007 W.C.S. 1945, provides that if two or more persons are appointed executors or administrators a separate bond must be required from each. ", "Note the italicized words. ", "The failure in this case, if it was a failure, was the failure of the clerk of court who approved the one bond, signed by a surety company, filed by the executors herein. ", "The bond is a joint and several bond and there is some doubt that there was a violation of the statute. ", "The statute was passed in the days when surety companies were not known. ", "In any event the statutes make ample provisions for additional bonds. §§ ", "6-1009 to 6-1012. ", "So far no one has made application for any such additional bond, except indirectly in this collateral action.", "\nObjection is also made that the executors did not invest the amount of money on hand, which was the sum of $120,000, and a larger amount subsequently. ", "The executors say they accumulated that sum to be prepared to pay the federal estate taxes in the amount of over $200,000. ", "That would seem to be a sufficient excuse. ", "Furthermore Robert Bible testified that if the executors had invested the amount of money on hand in Government bonds, they would have lost money. ", "Anyone at all familiar with the erratic market in Government bonds in 1953 and 1954 knows that to be true or at least probable.", "\nThe amount of money mentioned above was kept on deposit in the First National Bank of Rawlins, Wyoming, *362 of which Robert Bible and Clarence Brimmer are officers. ", "It is the contention that this amount of money should have been given preferred status in the bank. ", "Perhaps that would have been wise. ", "However, it is not shown that the bank is not fully solvent. ", "Furthermore, if any loss had occurred by reason of the deposit in the First National Bank, Bible and Brimmer would have been liable on their bond which was for over a million dollars and was a much better protection than if the money had been given a preferred status in the bank.", "\nIn conclusion we think the foregoing objections are so unsubstantial that they give no cause for the removal of the executors in this case.", "\n\nB. Hostilities.", "\nCounsel contend the executors herein should be removed because of the hostility existing between them and the respondents. ", "It is held the hostility must be of such a character as to prevent proper management of the estate. ", "33 C.J.S. 1033. ", "Hostility to the will is no ground for removing trustees. ", "90 C.J.S. 189. ", "The same rule should prevail in the case of executors. ", "Mere friction is not grounds for removing trustees. ", "Restatement of Trusts, § 107; 54 Am.", "Jur. ", "112.", "\nCounsel for respondents refer to the fact that Bible made Mrs. Hartt angry because he let her son-in-law have some of the stock in some of the sheep companies involved herein. ", "Bible bought the stock from Spragg, the brother of Mrs. Hartt, and distributed that stock to his co-executor and Charles Higley, Mrs. Hartt's son-in-law. ", "Mrs. Hartt testified this made her angry, in view of the fact that she did not like Higley and furthermore indicated that the estate should have had an opportunity to buy this stock. ", "The stock cost $300 and $200 a share. ", "In the first place she should have been glad that those working for the companies should *363 want to buy the stock in order to give them an incentive to work for the interest of the companies, the stock of which was controlled by the estate. ", "That is the rule followed by many or most corporations. ", "No reason existed for her becoming angry. ", "Mrs. Hartt testified that she got over her anger in a few days until she later thought about it. ", "We cannot imagine what revived her anger unless it was that later she decided to try and nullify the will and kept up her anger for the purpose of having some grounds for removal of the executors herein. ", "Even that is not understandable in view of the fact that she then wanted to liquidate the sheep companies. ", "In short we find no merit in the contention that these matters were any legitimate cause for hostility and hence for removing the executors.", "\nAnother matter mentioned by counsel for respondents as grounds for hostility is that Bible kept the key to the deposit box in the bank which had been rented in the name of the testator and Mrs. Hartt. ", "But the latter had a whole year and more to ask for this key but she never asked for it until she was evidently advised that she could claim all of the contents of the box which contained the bulk of the property belonging to the estate. ", "See Hartt v. Brimmer, Wyo., ", "287 P.2d 638. ", "Had it not been for the stamped statement on the agreement to hire the box — made, as mentioned in the foregoing case, mainly for the protection of the bank — Bible and Brimmer would have been entitled to the key to the box as representatives of the testator as much so as Mrs. Hartt. ", "We are somewhat surprised that this matter should even be mentioned by counsel for the respondents as a cause of hostility and hence for the removal of the executors.", "\nPearl Holmquist, daughter of Mrs. Hartt, testified that she did not agree with the way her father wrote *364 his will. ", "Her chief complaint was making them wait eight years, which she said was wrong. ", "Mrs. Mitchell, another daughter, testified that she felt her father's will was not fair to the family, particularly in having the daughters wait eight years after Mrs. Hartt's death before they could get the principal of the estate. ", "Dorothy Okey, another daughter, testified to the same effect. ", "Mrs. Hartt, herself, testified she wanted the will disrupted because then she could make some gifts to her daughters. ", "This clearly shows the main hostility was to the will itself, which, as we see it, is no ground for removing the excutors. ", "90 C.J.S. 189. ", "The hostility against the latter in the main accordingly was because they wanted to uphold the provisions of the will. ", "The most effective method of disrupting the will was to get rid of the main defenders of the will and one cannot help but wonder if one of the reasons for instituting the action here considered was to get rid of these defenders or cause them to desist from the opposition to the main purpose mentioned. ", "In any event, counsel for respondents in their brief assert as grounds of hostility towards the executors that they failed to advise the widow of her rights of dissenting from the will. ", "We have heretofore considered that, ruling against that contention. ", "We might add that counsel say the executors should have advised respondents that the trust would be accelerated by the widow dissenting from the will. ", "We think we are not far wrong in saying there is probably not a single lawyer in the state who, not having had special occasion to look up the matter, knows anything about the rule, but counsel, in order to have the defenders of the will removed, point an accusing finger of guilt at them in this connection. ", "We think they protest too much.", "\nIt is further claimed that it was the duty of the executors to inform Mrs. Hartt and the respondents *365 of the rights of the widow and of other matters because of the fact that they relied on the executors and trusted them. ", "It may be noted that most of the reliance was on Robert Bible, who, while knowing some legal lore, is in the main a banker. ", "Respondents paid little or no attention to Clarence Brimmer, whose profession is that of a lawyer. ", "The daughters are apparently all college-bred and highly intelligent, so we may fairly infer that their mother, too, was intelligent. ", "They all admitted that when they asked either of the executors anything, the information for which they asked was promptly supplied, and that when they asked the executors to do anything which was in their power, it was done. ", "To hold that college-bred women or women of reasonable intelligence can blindly rely and depend on another without making any effort whatever to find out things for themselves is not too safe a rule to lay down for the conduct of men and women. ", "In 1 Restatement of the Law of Trusts, § 173d, it is stated: \"Ordinarily the trustee is not under a duty to the beneficiary to furnish information to him in the absence of a request for such information.\" ", "It would seem a similar rule should apply to executors, unless, perhaps, under exceptional circumstances. ", "It ought not to be too easy to trump up as an afterthought a charge that some information should have been furnished, when the records in the case would easily have furnished such information.", "\nIt is further claimed that the executors did not have the privilege or right to resist Mrs. Hartt's dissent from the will, and that because of such conduct hostility exists. ", "That doubtless is true, and we could readily agree that if the executors had no right to resist the attempts of Mrs. Hartt to dissent from the will after the expiration of the time fixed by statute, then there would be sufficient grounds for the removal of the executors. ", "It is contended in this connection that *366 the executors are not authorized to employ counsel except in connection with a contest of the will, presumably inferring that they have no right to oppose a dissent of the widow from the will, and it is claimed that such dissent merely involves the distribution of the estate and nothing more. ", "Counsel cite no cases in point. ", "The same matter is involved in the contention later mentioned that the executors have no appealable interest. ", "This matter seems to be the main ground, aside from salaries hereinafter mentioned, for the removal of the executors herein. ", "The point here involved is of vital importance. ", "In Yeager v. Yeager, 155 Kan. 734, 129 P.2d 242, 243, the court said: \"Our forthright decisions, * * * have held that any action whose plain and essential purpose is to get rid of a will — to effect a result contrary to the obvious intent of the testator — is an action `to contest' the will.\" ", "In Willson v. Whitehead, 181 Va. 960, 27 S.E.2d 213, it was held that trustees must defend all suits against them with respect to the subject of the trust. ", "In Tuttle v. Union Bank and Trust Co., 112 Mont. 568, 119 P.2d 884, 139 A.L.R. 127, the court held it is the duty of a trustee reasonably to defend any suit which will affect the trust estate, regardless of whether the trustee has any personal pecuniary interest in the outcome thereof. ", "In Republic Nat. ", "Bank & Trust Co. v. Bruce, 130 Tex. ", "136, 105 S.W.2d 882, the court held it is the absolute and positive duty imposed on a trustee to defend the life of the trust whenever it is assailed. ", "In re Riviere's Estate, 8 Cal. ", "App. ", "773, 98 P. 46, the court stated that the confidence reposed in an executor would be abused and he would prove recreant to his trust even in the face of contests, if he did not diligently endeavor to carry out the wishes of the testator. ", "In re Logan's Estate, 171 Cal. ", "357, 153 P. 388, 390, the court stated: \"When a will is admitted to probate it is the duty of the executor to defend and uphold the will against any *367 subsequent attack for its revocation made upon it, * * * and this duty primarily rests upon the executor, and not upon the legatees or devisees.\" ", "It is accordingly quite clear that hostility engendered in that manner cannot be a cause for removal of the executors unless we are willing to hold that the executors have no duty as mentioned in the foregoing authorities.", "\n\nC. Conflicting Interests.", "\nIt is contended that there exists such a conflict of interests between the executors and respondents as to require the removal of the executors. ", "It is undoubtedly the rule that a trustee must not place himself in a position where his interest may conflict with his duty, and that he cannot place himself in a position where he gains any individual advantage except what the law gives him. ", "In re Jones' Will, 124 N.Y.S.2d 672, 679, and cases cited. ", "We shall deal with this point more fully later. ", "The question is in what respect the interests of the executors conflict with their duties and what interest the law gives them. ", "One of these conflicts is claimed to exist because respondents wanted to have the sheep companies liquidated and the proceeds invested in a different form, and Bible did not agree. ", "There is something ironic in this claim. ", "Just three months before this action was instituted Mrs. Hartt thought so highly of these companies that she became angry because a few shares of stock came into the hands of Bible and Brimmer and her son-in-law. ", "In three months, she changed her mind, on the advice of counsel who, just as the members of this court, know probably less than half as much on the subject as did Robert Bible with his large experience. ", "We do not say counsel were wrong. ", "It is not at all improbable they were right, provided that no precipitate action is taken to bring about the result, since no ready buyers may be found. ", "Precipitate action might be disastrous to the *368 estate. ", "That Bible did not agree to liquidation is no cause at all for the removal of the executors. ", "The will gives them the right to keep the sheep companies going. ", "In any event whether the sheep companies should be liquidated or not, or whether the shares of stock therein should be sold should not be determined in this collateral action. ", "It should be determined in an orderly way pursuant to a petition to the court, and an order made after hearing competent and disinterested witnesses. ", "There is no cause to believe, so far as we can see, that the executors would disobey an order of the court duly made, and would not use all efforts to liquidate the companies if that is deemed advisable.", "\nAside from the matter of salaries which we shall discuss later, we fail to perceive any conflict of interests other than those which in the nature of things arises when respondents want to invalidate the will as nearly as possible and when the executors want to uphold the provisions of the will. ", "It is this combination — one side wants to destroy and the other side wants to preserve — which distinguishes the case before us from all other cases cited by respondents and which to a more or less extent affects every contention made herein by respondents. ", "It is quite clear that a conflict arising under such conditions cannot be a conflict that gives rise to the right of removal of the executors. ", "True, executors and trustees receive fees, generally proportionate to the amount and to the duties involved. ", "Should the will be nullified to the extent wanted by respondents, the fees as trustees would be less than if the will stands as written. ", "So we come back to the same question several times mentioned as to whether the will should stand or not.", "\n\nD. Salaries.", "\nOne of the main questions arises herein in connection with salaries which the executors voted themselves *369 in three sheep companies which were controlled by the testator. ", "The Yellowstone Sheep Company has 6000 shares of stock of which the estate of John K. Hartt owns 3148 shares, or 52.46% of the total shares. ", "It owns 17,000 acres of deeded land, and had an allotment, presumably under the Taylor Grazing Act, of 3 1/2 townships, and operates in the main in Fremont county, Wyoming. ", "It ran about 1800 head of cattle and about 7000 to 8000 head of sheep. ", "The Cow Creek and Pioneer companies were run together and in the main, it appears in Carbon county in this state. ", "Each had 600 shares of stock. ", "The estate of John K. Hartt, deceased, owns 363 shares or 60.5% of the total shares of the Cow Creek Sheep Company and 313 shares or 52.1% of the total shares in the Pioneer Sheep Company. ", "These companies own about 50,000 acres of deeded land and hold about 44,000 acres of leased land and ran 21,000 to 22,000 head of sheep. ", "The volume of business done by these companies is not shown, but it must have been large. ", "It is admitted in the pleadings that Hartt during his lifetime drew a salary of $6,000 as president of the Yellowstone Sheep Company; $4,000 as president of the Cow Creek Sheep Company and $1,500 as an officer of the Pioneer Sheep Company. ", "It is also admitted that Robert Bible was, during the testator's lifetime, secretary-treasurer of the Yellowstone Sheep Company at a salary of $2,400 and treasurer of the Pioneer Sheep Company at a salary of $1,000. ", "It also appears that Clarence A. Brimmer was for many years counselor and advisor of the testator and of the sheep companies. ", "There is testimony that he was connected with part of the sheep companies as an officer. ", "But that is not clear. ", "The total salaries drawn by the testator during his lifetime and others in the sheep companies were $18,600. ", "After the death of the testator, the executors voted themselves a salary as president, the same salaries which the testator *370 had drawn as such officer. ", "The total salaries voted to themselves, to one Walter E. Cosgriff, as assistant secretary, and to C.A. Brimmer, Jr., as assistant secretary and assistant treasurer, were $21,400 or $2,800 more than the salaries paid during the testator's lifetime, a difference probably very small compared with the volume of business done. ", "The difference lies mainly in the salary voted to C.A. Brimmer, Jr., of $900, as assistant secretary, and salaries voted to C.A. Brimmer as vice president, when no such salraies had been paid previously. ", "There is testimony that Mrs. Hartt was informed of the salaries, but she denied it. ", "The executors owned a few shares of stock in these sheep companies. ", "That seems to have no bearing in this case except that they contributed their proportionate share to their own salaries. ", "It must be borne in mind that so far as the estate is concerned, it contributed only a little over one half of the total salaries paid, and it would, of course, be just that the minority stockholders should contribute their proper share. ", "There is no testimony in the record that the salaries paid to the executors herein were excessive. ", "The only testimony in the record is to the contrary.", "\nRespondents claim that under the foregoing facts the court was justified in removing the executors and trustees, and that we have no right to interfere with the court's discretion. ", "They rely on the general rule that executors and trustees must not place themselves i na position of conflict of interests, and they especially cite the cases of In re Hirsch's Estate, 116 App.", "Div. ", "367, 101 N.Y.S. 893; Pyle v. Pyle, 137 App.", "Div. ", "568, 122 N.Y.S. 256, affirmed 199 N.Y. 538, 92 N.E. 1099; In re Kirkman's Estate, 143 Misc.", "Rep. 342, 256 N.Y.S. 495; In re Grossman's Estate, 157 Misc. ", "164, 283 N.Y.S. 323. ", "The facts in these cases were, of course, different from the facts in this case, and we cannot take the space to analyze them. ", "It is true that excerpts *371 contained in these cases indicate that removal of executors in the case at bar was justified. ", "It may be that some appellate courts would sustain the action of the trial court herein even under the facts in this case, although we doubt it. ", "The sound rule undoubtedly is that whether or not there is cause for removal depends on the facts and circumstances in each case. ", "In re Goldner's Will, 115 N.Y.S.2d 104; In re Keyston's Estate, 102 Cal. ", "App.2d 223, 227 P.2d 17, 21; In re Brown's Estate, 22 Cal. ", "App.2d 480, 71 P.2d 345. ", "It was held in In re Berri, 130 Misc.", "Rep. 527, 224 N.Y.S. 466, 472, 473, that the acceptance of salary by a trustee in a corporation, the stock of which was held by the estate, did not of itself justify the trustee's removal. ", "In that case, it was objected that the executor should not have allowed himself to be elected as a salaried president of the corporation. ", "The court pointed out that some one had to be elected, and stated among other things:\n\"While it is true that ordinarily the commissions allowed by law are deemed to be full compensation for the performance of services as a trustee, this is not an inflexible rule. ", "Where a trustee renders services outside of his duties as trustee, he is entitled to fair compensation for the services rendered to the estate. ", "It was so held in the case of Lent v. Howard, 89 N.Y. 169, and in Russell v. Hilton, 37 Misc. ", "Rep. 642, 76 N.Y.S. 233. ", "In the latter case the opinion was written by Mr. Justice Scott, and it was then stated that, if the executor in that case had not devoted his time to the duties for which it was sought to compensate him, it would have been necessary to have employed some one else to perform them, and the compensation of the person so employed would have been a legitimate charge against the estate.\"", "\nIn reGerbereaux' Will, 148 Misc. ", "461, 266 N.Y.S. 134, 145, the same objection was made. ", "The court held that the internal management of a corporation by a director whose responsibility as executor or testamentary *372 trustee to estate possessing stock therein in questioned, ma ybe scanned to determine whether the acts resulted in depreciation of the stock of the estate, and if they willfully abuse their trust, they will be held liable to the estate. ", "The court stated further:\n\"I do not believe such pay for services rendered as officers of the corporation, upon the volume of business transacted, amounts to a misuse or spoliation and waste of corporate property, nor do I believe that it diminished the value of the stock held by the trust. ", "It did not amount to a devastavit to create such a personal interest in them as to conflict with their duties as trustees. ", "The facts are entirely dissimilar to those in Matter of Auditore's Will, (249 N.Y. 335, 164 N.E. 242) and Matter of Kirkman's Estate, 143 Misc. ", "342, 256 N.Y.S. 495.\"", "\nIn re Goldner's Will, 115 N.Y.S. 104, 106, 107, a trustee, a woman, had worked for the corporation in which the estate had some stock, receiving a salary. ", "After becoming a trustee, she continued the same work and received the same salary. ", "The court stated:\n\"The Special Guardian contends that the roles of the respondent as trustee and as employee of the corporation are in such conflict that she must relinquish either the trusteeship or the Secretaryship. ", "A fiduciary relationship requires the administration of the trust in the sole interest of the beneficiaries and that the trustee refrain from placing himself in a position where his personal interests will conflict with those of the cestuis que trust. ", "This guiding principle does not necessarily prohibit, however, individual participation by a fiduciary in all transactions in which the trust estate also has an interest. ", "It frequently happens, as in the instant case, that the trustee is an officer or director of a corporation in which the trust estate holds a stock interest. ", "Whether the trustee is accountable to the trust for any salary which he may receive or that his acts constitute a proper basis for removal depends upon the circumstances in each case. ", "Moreover, the rule that commissions allowed by law are deemed to be full compensation for the performance of services by a fiduciary is *373 not an inflexible one. ", "Matter of Berri, 130 Misc. ", "527, 224 N.Y.S. 466. ", "An examination of the authorities shows ample precedent to sustain the continuance of the dual roles occupied by the respondent trustee. ", "Matter of Berri, supra; Matter of Gerbereaux, 148 Misc. ", "461, 266 N.Y.S. 134.\"", "\nWe shall not quote from other cases involving the same principle, although, of course, under different facts a similar result was reached in In re Brown's Estate, 22 Cal. ", "App.2d 480, 71 P.2d 345; In re Keyston's Estate, 102 Cal. ", "App.2d 223, 227 P.2d 17; Shirk v. Walker, 298 Mass. 251, 10 N.E.2d 192, 125 A.L.R. 620; In re Meyrowitz' Estate, 108 N.Y.S.2d 275; In re Block's Will, 60 N.Y.S.2d 639.", "\nRespondents admit that some person or persons were to be elected to serve as officers of the corporation. ", "But counsel say it was not necessary for Bible and Brimmer to elect themselves or to vote themselves a salary after being elected. ", "There may be some doubt as to how far that is true, in view of the fact that the estate held a controlling interest and it was the duty of the executors to protect it. ", "But if we concede the statement of respondents to be correct, that does not get us far. ", "It simply leaves us at a dead end. ", "Counsel do not point out a better course which should have been pursued. ", "Should the executors have elected someone else at the same, at a larger, or at a lesser salary? ", "Counsel are silent. ", "The burden of proof of facts which would warrant the removal of the executors and trustees was on respondents. ", "We do not know that there was a single individaul who was competent, available and willing to take these official positions, or at what salary. ", "So far as the record shows, Bible and Brimmer were the only parties competent, available and willing to serve in the capacity above mentioned. ", "Counsel for respondents state in their brief (p. 207): \"We are not unmindful of the fact that John K. Hartt *374 named C.A. Brimmer and Robert Bible as Trustees, and that perhaps in doing so the testator knew that control of the three sheep companies would be vested in them.\" ", "We think the word \"perhaps\" in the foregoing statement should be stricken. ", "The companies were close corporations. ", "Not too many persons are available and willing to assume the duties performed by the testator during his lifetime. ", "Bible and Brimmer, as the testimony shows, had a great deal of experience in connection with sheep companies. ", "The testator directed that his executors could continue to keep the sheep companies running. ", "Bible and Brimmer were for many years his trusted and tried friends, associates, counselors and advisors. ", "He even trusted Bible to the extent of loaning him $37,000. ", "It is, we think, almost a certainty that the testator expected Bible and Brimmer to occupy the chief official positions in the companies. ", "And that the testator expected, as anyone else would expect, that they should have some compensation in some form is an equal certainty, if we are any judge of human conduct at all. ", "We hardly think a court should disregard these certainties, or near-certainties. ", "The only question then left is in what form and in what amount the compensation should be made. ", "That matter is in the control of the court. ", "It can fix and determine and adjust the matter easily and so protect the beneficiaries. ", "In this case a final accounting is yet to be made and a hearing thereon had. ", "The executors have requested the court to take the salaries paid them into consideration in fixing their fees in the final accounting. ", "That they made the request after the action herein was filed makes no difference. ", "It follows as a matter of law that the court not only would but should take these salaries into consideration when their fees are fixed and determined. ", "There is no indication that when it is done, respondents will be harmed in any way. ", "As we have seen the removal *375 of an executor or trustee is harsh and severe; it is serious; it is a drastic action; it should not be done unless clearly necessary; if the court can adjust the disputed matters, the removal should not be made; an executor or trustee should not be removed except for gross and willful misconduct. ", "If these rules are of any value at all, if they are worth more than the paper on which they are written, then, clearly, the facts in this case do not justify the removal of the executors in this case for the sole reason that they received salaries as above mentioned. ", "Indeed it seems that even respondents do not claim that that fact alone would justify the removal, but that it was justified for that reason in connection with other factors heretofore discussed. ", "These factors, as we have seen form no basis for the removal, and the combination is no stronger than its weakest link. ", "The whole matter of salaries, if that was in fact a matter of serious objection by respondents, could have been easily adjusted by the very simple method of respondents filing their objections thereto, and asking the court to pass upon them, instead of taking the drastic method pursued in this case. ", "Let us go a little further. ", "Suppose the president of a bank holds control of the stock in a bank and draws a salary of $6,000 per annum. ", "He dies and leaves the stock in trust to his son, also connected with the bank, to pay the income from the stock to the banker's widow, etc., ", "similar to the provisions in the case at bar. ", "The son uses the stock to vote himself in as president at an equal salary to that of his father. ", "Is there anyone or any court that would say the son, on that account, was guilty of gross or willful misconduct warranting his removal from his position in the bank? ", "We think not. ", "Substitute for the son, the tried and trusted friends, counselors and advisors of the testator, who might be closer to him than a son would be, should a different result be reached? ", "We doubt it. ", "While at times conflicting *376 interests alone justify the removal of executors, we must be able to say under the facts herein that they were guilty of gross and willful misconduct to justify their removal. ", "Their honesty and integrity is not questioned either by respondents or the trial court. ", "Much as we would like to defer to the judgment of the trial court, we have, after searching our conscience for many days, been unable to characterize their conduct as willful and gross misconduct. ", "To say Brimmer and Bible are incompetent to manage the estate is, in view of their experience, simply not true. ", "Counsel say the term incompetent means unsuitable. ", "But, aside from the matter of salaries which we have already discussed, the only possible reason for that would be because they insisted on upholding the testator's wishes. ", "That, as we have seen, is not a legitimate reason for removing them. ", "To hold that it is, would simply mean that we would encourage casting aside a testator's will. ", "That we think would be against public policy and we are not prepared to violate that policy, even if the feelings of respondents are left in an unfortunately unhappy state. ", "We regret that, of course, as much as respondents, but is it comparatively unimportant when measured by the importance of upholding the principle involved.", "\nWe cannot, however, dismiss this subject without further consideration. ", "It is elementary law, we think, that an executor or trustee, acting in a fiduciary capacity, cannot be permitted to fix and determine his own compensation. ", "At common law he was not entitled to any at all. ", "In re Popp, 107 N.Y.S. 277; 90 C.J.S. 719. ", "A will may contain provisions in connection therewith, or a statute may fix it, but aside from such provisions the compensation must be fixed by the court, or at least pursuant to the consent of the beneficiaries under the will. ", "34 C.J.S. § 856, pp. ", "1011, 1012; 2 Bancroft's Probate Practice, 2dEd., § ", "423; 90 C.J.S. § 396, p. 719; 4 Schouler on Wills, Executors and Administrators, *377 6th Ed., & ", "3029. ", "It is not absolutely necessary that the compensation, even if extra compensation, be fixed before actual payment. ", "Schouler, supra. ", "As we have seen the court may approve the compensation after payment, but in a case such as before us, it is far safer to consult the court beforehand, rather than hope for a subsequent approval, and in the meantime face the demand for removal. ", "It seldom happens, at least in this state, that an executor does or may occupy a dual role, and the executors in this case evidently did not realize that the rule above mentioned applies when the executor receives a salary from a corporation in which the estate holds stock. ", "But careful consideration or reading the cases on the subject discloses that it should apply in such a case. ", "The corporate entity is not so distinct but that the court may inquire into the compensation of an executor who controls the corporation by virtue of the stock held by the estate in the corporation. ", "In re Gerbereux' Will, 148 Misc. ", "461, 266 N.Y.S. 134. ", "In the case of In re Flood's Estate, 230 N.Y.S. 774, 777, a woman, before being appointed executrix received an allowance of $75 per month for the care of the decedent while living. ", "When she became executrix, she became a party to raising the compensation to $100. ", "The court, reducing the compensation, stated:\n\"Any attempt to enlarge the amount originally fixed should have been the subject of an application to this court. ", "Section 212, Surrogate's Court Act. ", "The payment of additional compensation for individual services rendered by an executor or trustee is discouraged to the greatest degree by the courts. ", "Where extraordinary personal services outside of the trust duties are rendered, compensation has sometimes been allowed, but the right to payment and the amount thereof have always been the subject of the strictest judicial scrutiny. ", "This rule has been based upon the adversity of interest in the same person between his capacity as trustee an dhis capacity as a paid employee. *", "378 The temptation to exact excessive or unauthorized pay is too great to permit the representative to fix his or her own compensation. ", "In his comprehensive opinion in Matter of Popp, 123 App.", "Div.2, 107 N.Y.S. 277, Justice Gaynor reviewed the authorities applicable to this question. ", "He pointed out the importance of the rule of strict scrutiny in the allowance of extra compensation and the intolerable abuses which would arise if not properly controlled.\"", "\nThe court in Mangels v. Safe Deposit & Trust Co., 167 Md. 290, 173 A. 191, 197, 198, discusses the principle here involved fully, citing many authorities and holding that it is a most salutary principle that a trustee, or one acting in a fiduciary capacity, is not permitted to place himself in such a position that his own and the interest of the beneficiary come in conflict. ", "In that case, Mr. Tippett, as trustee, controlled 50% of the stock in a corporation and drew a salary with the consent of the one who controlled the other 50%. ", "The court in concluding its discussion stated as follows:\n\"The question in this case is: Does the record show a state of facts which violates this firmly established doctrine? ", "It is fair and just to say that this record is barren of evidence showing bad motive, or any willful purpose to deplete or injure the trust estate. ", "But Mr. Tippett has placed himself in a position which, if occupie dby one acutuated by evil, selfish, or malignant purposes, could result in personal profit at the expense of the beneficiary. ", "By virtue of the stock belonging to the estate, and held by himself and his cotrustee, he is elected a director of the corporation. ", "It is apparent that the management of the corporation is within the control of two directors, Mr. Herold representing one half of the stock, and Mr. Tippett the other half; and it is true that his position as secretary at a salary of $50 a week is dependent upon his directorship, growing out of the trustee-ownership of the stock. ", "It is no concern whether or not the services rendered be fully worth the salary received. ", "It still remains true that that personal benefit to him is derived by virtue of his trusteeship. ", "There can be no question that the net *379 return to the estate is lessened by one-half of the amount of the salary received by Mr. Tippett as secretary; and he is in a situation, as trustee, to use such position for personal gain at the expense of the estate. ", "We find no evidence in this recrod which indicates that his services as secretary have been overpaid, or that any other person occupying that position would not be entitled to and receive as much or more salary. ", "But, as stated, this can have no influence upon the application of the principle here invoked. ", "He might as easily have demanded and received a very much larger salary, in return for voting an unreasonable salary to Mr. Herold, the president and treasurer; and it is apparent that his self-interest and the interest of the estate which he represents as trustee may conflict, to the detriment of the estate. ", "We desire to make it clear that we find no evil intention, purpose, or design on the part of Mr. Tippett; but the facts show a case governed by the principle laid down by the authorities, and, if that is to be maintained in its full force and integrity, we feel compelled to apply it to the present facts.", "\n\n* * * *\n\"Our conclusion upon the whole case is that there is no violation of this principle in a trustee holding stock in a corporation, preventing him from becoming a director therein, but that he should not become a salaried officer or employee of the corporation that the record does not call for or warrant a removal of Mr. Tippett as trustee, but that the appellant is entitled to an accounting of the salary received by Mr. Tippett as secretary of the corporation from the time he was first so appointed, and the payment of one-half of such an amount so found to the appellant, without interest.\"", "\nAt first blush we thought the rule of that case might well be applied in the case at bar. ", "However, we do not know the amount of business done by the sheep companies or the financial condition of the corporations which should be taken into consideration, as to what, if any salaries, should be paid. ", "We do not know whether or not the compensation fixed by statute for the executors in this case is disproportionately small as compared *380 with the amount of time spent and labor done by the executors in this case. ", "So we have concluded that the whole matter should be left in the hands of the trial court. ", "It may take into consideration in settling the matter the salary paid to C.A. Brimmer, Jr., as assistant secretary of the sheep companies and should take into consideration the amounts paid Bible and Brimmer during the testator's lifetime.", "\nWe are not satisfied with the broad statement in the foregoing case that a trustee should never become a salaried officer in a corporation in which the trust has stock, especially when the corporation is controlled by the stock held in trust. ", "Several of the cases already cited indicate that that should not be a general rule. ", "It might be true in some cases. ", "But the corporations here involved are sheep companies demanding large attention and the evidence in this case indicates that both of the executors have had large experience with livestock companies, and unless more competent men than they can be found and at lesser salary, the rule for the foregoing case should not apply, although as heretofore indicated, whatever salaries they receive should be fixed and determined by the court, and not be left to the trustees' discretion. ", "The court can thus fully protect the estate and the trust. ", "As shown before, the undoubted intention of the testator was that Bible and Brimmer should have control of the sheep companies and that they should be compensated in some form.", "\n\nIII. ", "Right To Appeal.", "\nIt is contended herein that the order allowing the widow to elect after the statutory time is not a reviewable order. ", "It is provided by § 6-2710 W.C.S. 1945 that the provisions of the code of civil procedure shall apply to matters in probate. ", "It is said in In re Barrett's *381 Estate, 22 Wyo. ", "281, 138 P. 865, 141 P. 95, 97, that \"a party has the same right to appeal from a judgment or final order of the district court in probate matters as in civil actions * * * unless as to a particular matter he is deprived of that right by some express provision of the statute.\" ", "There is no such express provision as relating to the matters herein involved. ", "We have then express statutory authority that the matters herein involved may be appealed, provided that they constitute a final order affecting a substantial right according to the provisions of § 3-5301 W.C.S. 1945, and this statutory authority is just as explicit as counsel say exists, for instance, under the California Statute. ", "Respondents claim that the widow's election to take against the will merely affects the distribution of the estate in which the executors and trustees are not interested. ", "Counsel for the appellants claim that the widow's election after the statutory time is equivalent to a contest of a will, and respondents agree that a judgment in a contest is appealable. ", "We think we must agree with counsel for appellants. ", "We have heretofore quoted from Yeager v. Yeager, 155 Kan. 734, 129 P.2d 242, 243, that \"any action whose plain and essential purpose is to get rid of the will, — to effect a result contrary to the obvious intent of the testator — is an action `to contest' the will.\" ", "While the facts involved in that case were different from those in this case, the principle stated clearly is sound and correct. ", "In 6 A.L.R.2d 152, the annotation states:\n\"Where the order or judgment affects or threatens the very existence, validity, or continuance of the trust, or prevents the trustee from discharging his duties under the trust, or threatens to defeat the purpose of the trust, or depletes the trust fund by allowance of unreasonable or unfound claims against it, the trustee, though having no personal interest in the litigation, is not a disinterested party. ", "In such case he, in his fiduciary or representative capacity, is aggrieved by the *382 judgment or order, and may appeal therefrom, whether the litigation is between the beneficiaries themselves or between the trust and third parties.\"", "\nThe principle stated should apply even while the estate is still in the hands of the executor. ", "To hold that the trial court may, in disregard of our statute, permit a widow to dissent from the will almost at any time, and make that court the court of final resort in such cases, without right of appeal to this court, would, we think, be a rather startling rule. ", "Mrs. Hartt did not raise the point in the trial court that the executors had no right to contest her petition to dissent from the will after the statutory time. ", "Furthermore we have held that it was not only the privilege and right of executors to resist her petition, but that it was their duty to do so, and thus protect the will and wishes of the testator. ", "If that is true in the trial court, it would seem to follow as a matter of law that it is equally true in the appellate court. ", "See Annotation, 6 A.L.R. 147. ", "Such election by the widow, after the time provided by statute involves, it is true, a final distribution of the estate, but it involves much more than that, namely the validity and the effect of the will. ", "The fact that no objection would have been available, if the widow had elected to dissent from the will within the time required by statute, is beside the point. ", "When that time has expired then, says the statute, the will is in effect as written, and the testator, through his representatives, has the right to have the will upheld, and should not be bound by the action of the trial court as a court of final resort.", "\nIt is also contended that the order of removal of the appellants as executors and trustees is not appealable, for the reason that their interest is not such as affects them adversely. ", "A partial annotation on the subject is contained in 140 A.L.R. 808 and a more complete annotation in 37 A.L.R.2d 751. ", "These annotations show an irreconcilable conflict in the authorities on *383 substantially every point argued by the respective counsel herein. ", "Looking over the subject generally, it would seem that we are meeting a lot of technical procedural matters. ", "We had thought that we were living in an era in which technical procedural matters are not favored. ", "But perhaps we are wrong. ", "There are conflicting authorities, for instance, on whether an appeal, assuming that it is allowable, should be made in a fiduciary capacity or an individual. ", "Annotation, 37 A.L.R.2d 795. ", "It is quite clear that Bible and Brimmer are adversely affected both in their fiduciary capacity and in their individual capacity, and the adverse effect would seem to be alike, or at least similar. ", "Indiana, holding that the appeal must be in the individual capacity, yet holds that when the name of the individual is followed by guardian, executor, etc., ", "that is merely descriptive personae. ", "Sibley v. Lewis, 117 Ind. 655, 75 N.E.2d 420; Weiland v. Scheuch, 123 Ind. 633, 109 N.E.2d 618. ", "Again we meet with the question as to whether or not the appeal, especially if a stay is directed, as in the case at bar, suspends the judgment of removal. § ", "12, Annotation, 37 A.L.R.2d 800. ", "The authorities are in hopeless conflict, some cases holding that the order of removal made by the trial court is not vacated by the appeal. ", "That would seem to be in accord with the general rule stated in 4 C.J.S. 1150. ", "Yet in 4 C.J.S. 1096, it is held that the order of the trial court is suspended, and that would be particularly true when, as in the case at bar, an order for a stay is, and must be granted in accordance with the provisions of § 3-5310 W.C.S. 1945. ", "It was granted in the case at bar. ", "See in that connection State ex rel Huber v. Tazwell, 132 Or. ", "122, 283 P. 745. ", "So far as the actual appeal is concerned there seems to be little difference, whether the order stays in effect or whether it is merely suspended, although there might be a difference in connection with collateral matters, for instance, *384 whether the court was authorized to appoint a special administrator in this case.", "\nIn some of the cases a distinction is made between the removal of an executor and administrator. ", "See State ex rel Huber v. Tazwell, supra. ", "In Hartford Nat. ", "Bank & Trust Co. v. Malcolm-Smith, 129 Conn. 67, 26 A.2d 234, 140 A.L.R. 805, 807, the court, speaking of the removal of a trustee stated in part that he must have a pecuniary interest in the appeal. \"", "A grievance to his feelings of propriety or sense of justice is not such a grievance as gives him a right of appeal.\" ", "The annotator at page 808, 140 A.L.R., on the contrary states:\n\"There would seem to be reasonable ground for the view that the act of a decedent in designating a particular person as executor or trustee, when duly assented to and when made effectual by judicial appointment, becomes the foundation of a peculiar obligation personally to administer the will or trust and to maintain the right to do so in the courts, and that consequently the interest of the appointed person in so doing should not be regarded as purely sentimental. ", "Surely, the concern of the decedent in designating the trusted person to act with reference to property matters could not be described as nonpecuniary.\"", "\nThat statement is, we think, sound, and meets with the approval of this court.", "\nNumerous cases hold that an order removing an executor or other fiduciary may be appealed. ", "See Annotation, 37 A.L.R.2d § 7, p. 770. ", "So too, it is held in many cases that a fiduciary has the right to appeal. ", "Annotation, 37 A.L.R.2d § 10, p. 792. ", "We need mention only a few. ", "In Monroe v. Winn, 16 Wash.2d 497, 133 P.2d 952, it was held that testamentry trustees have such an interest in the subject matter of litigation as entitled them to appeal from an order for their removal. ", "In State ex rel Huber v. Tazkell, 132 Or. ", "122, *385 283 P. 745, 746, the court stated, citing many Oregon cases:\n\"The general rule applicable to the right of an executor or administrator to appeal from a decree revoking letters testamentary or of administration is that ordinarily such an appeal will lie. ", "See 23 C.J. p. 1107. ", "In this state the right of a removed executor or administrator to appeal is well settled. * * * ", "Under these authorities, relator's right to appeal from the decree revoking her appointment as executrix is clear.\" ", "In re Bellows' Estate, 60 Vt. ", "224, 14 A. 697, 699, the court stated:\n\"Had the executor, Sowles, the right to an appeal? ", "The executor of a will is the creation of the testator. ", "The probate court has no power to appointment. ", "The testator alone has this right. ", "The dominion of the property after the testator's death is given the executor. ", "Sabine v. Rounds, 50 Vt. ", "74. ", "We think the executor has such a right to the property of the estate conferred upon him by the will as gives him the right of an appeal. ", "He has, unless unfit, the legal right to administer the estate. ", "What the rule may be in case of an administrator simply, or one c.t.a., ", "we are not called upon to decide. ", "There was error in dismissing the appeal.\"", "\nIn Bancroft's Probate Practice, 2d Ed., ", "p. 235, the author states that: \"An executor has a clear right to have reviewed proceedings removing him from office.\" ", "Counsel for respondents state that the authorities on which the author relies are not in point. ", "Even if that is true, when an author who has given the subject careful consideration, his opinion is not without some value.", "\nIn Hecht v. Carey 13 Wyo. ", "154, 78 P. 705, this court reviewed an order removing an executor, and reversed the trial court's order removing him. ", "Counsel for respondents say that the case is not in point because the direct question herein was not involved or raised. ", "That is true, and yet the practice established in that *386 case, which was in 1904, is to be taken into consideration. ", "In re Barrett's Estate, 22 Wyo. ", "281, 138 P. 865, 141 P. 95, involved an appeal from an order appointing an administrator. ", "The court holding that the supreme court has a right to review the order on appeal cited Hecht v. Carey, supra, thus coming very close at least in holding that an executor may appeal from an order removing him. ", "In any event the practice established in Hecht v. Carey, supra, has been approved in many other cases, and we do not feel called on to depart from it in this case.", "\nAs may be noted, the trial court found that Bible and Brimmer were incompetent to administer the estate of the testator as executors and trustees. ", "The removal as trustees could not be made at that time, since the trustees had not yet entered upon their duties as such. ", "So respondents argue that in so far as the order removing Bible and Brimmer as trustees is concerned it is not a final order, and so not appealable. ", "Technically they may be right. ", "But what is the court to do when the proper time comes in the face of its findings? ", "Would it feel itself bound by the finding above mentioned? ", "For us to say nothing about it would leave the matter in a strange and perplexing situation. ", "We think that we should cut the Gordian knot and should hold, as we do hold, that the finding above mentioned is null and void and of no effect.", "\nWe might add, briefly, that we see no reason why the right of appeal should not also apply to Marjorie Higley. ", "While she stated half heartedly that she did not care whether her mother elected to take under the will, she also stated that she felt her mother would be better off, if she took under the will. ", "She is interested in having the will stand as written. ", "Furthermore she has as much right to ask to have the estate administered by those in whom she has confidence, as her *387 sisters have the right to ask that it be administered by some one else. ", "The right should be reciprocal and is, we think, substantial. ", "It might, depending on the circumstances, be the most effective way to protect her interests. ", "At least the contrary cannot be shown. § ", "6-1211 W.C.S. 1945, provides that when a petition for a removal is filed, the executors may demur or answer, and respondents think that this section does not permit Marjorie Higley to also demur or answer. ", "That statute does not forbid her to also appear, and as stated she should have a right reciprocal to that of her sisters.", "\n\nIV. ", "Right To Take Under and Against Will.", "\nIn one of the causes of action in connection with the suit in equity, the court was asked that the widow be permitted to take her share under the statute of descent and distribution and also to take under the will. ", "The court ruled to the contrary. ", "That was correct. ", "The claims are inconsistent, and there is no merit in that cause of action. ", "Bayes v. Howes, 113 Ky. 465, 68 S.W. 449; Landers v. Landers, 151 Ky. 206, 151 S.W. 386, 390; Schweer v. Schweer, Mo. App., ", "86 S.W.2d 969, 974; In re Zweig's Will, 145 Misc. ", "839, 261 N.Y.S. 400, 408; Akin v. Kellogg, 119 N.Y. 441, 23 N.E. 1046, 1047; In re McCutcheon's Estate, 283 Pa. 157, 128 A. 843, 845, and cases cited; West v. West, 105 Kan. 523, 185 P. 4. ", "Moreover we have already held the widow can only take under the will.", "\nThe judgment of the court denying the right of Mrs. Hartt to take a distributive share under the statute and also take under the will is affirmed. ", "The judgment permitting the widow to dissent from the will after the statutory time fixed is reversed, and the right to so dissent is denied and her election made after the statutory period is declared void. ", "The judgment of the court removing the executors herein is *388 reversed with direction to reinstate Bible and Brimmer as executors and trustees, with all the rights and duties pertaining to such office under the will of testator, including the right to act as directors of the sheep companies, and make all orders to effectuate what is here stated, and with the following additional directions: The court should determine what amount of salary, in fairness and justice, should be allowed to Bible and Brimmer as salaried officers of the sheep companies here involved, adding that amount, if any, to the statutory fees allowed them for their services as executors, taking into consideration what we have heretofore stated. ", "To these sums should be added any amounts fixed by the court as compensation for any extraordinary services they or their attorneys have been called upon to perform in connection with this estate. ", "If there have been amounts already received by the executors, either as salaries of officers of the sheep companies, as executors or otherwise, such amounts will of course be applied against the amounts to be determined as above and such adjustments made as may be necessary. ", "The court should also fix their salaries, if any, for acting as salaried officials of the sheep companies in the future. ", "The court should make any and all other orders that may be deemed fair, just and necessary within the spirit of what we have herein said.", "\nThe executors may think this order leaves their compensation within the mercy of the trial judge. ", "But that is more or less true in every case where the trial court fixes and must fix the compensation. ", "Moreover we have the fullest confidence in the trial judge that, after reading this opinion and after causing such testimony to be produced as may be deemed necessary, and particularly testimony, if possible, of disinterested witnesses, he will make such orders which are fair and just and within the spirit of what we have said.", "\n*389 The costs taxed on this appeal and incurred by the executors in this court must be repaid to them out of the estate of testator. ", "Willson v. Whitehead, 181 Va. 960, 27 S.E.2d 213, and cases cited. ", "No costs, however, will be taxed for the briefs.", "\nAffirmed in part.", "\nReversed in part.", "\nHARNSBERGER, J., concurs.", "\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0, 0.03325942350332594, 0.026607538802660754, 0.16666666666666666, 0, 0, 0, 0.02, 0.01509433962264151, 0.03225806451612903, 0.007246376811594203, 0, 0.01098901098901099, 0.0013253810470510272, 0, 0, 0.01020408163265306, 0, 0.009302325581395349, 0.01098901098901099, 0.010330578512396695, 0.007936507936507936, 0.012605042016806723, 0.02631578947368421, 0.007936507936507936, 0.015037593984962405, 0.008695652173913044, 0.006134969325153374, 0, 0.004291845493562232, 0.009174311926605505, 0.005154639175257732, 0, 0, 0.004329004329004329, 0, 0, 0, 0.00641025641025641, 0, 0.010471204188481676, 0.00558659217877095, 0.008264462809917356, 0, 0.015625, 0, 0, 0, 0.004310344827586207, 0, 0, 0, 0, 0, 0.02040816326530612, 0, 0, 0, 0, 0.031746031746031744, 0.013605442176870748, 0, 0, 0, 0, 0, 0, 0.03225806451612903, 0.02040816326530612, 0, 0.010309278350515464, 0, 0, 0.006211180124223602, 0.008, 0.0044444444444444444, 0, 0.012048192771084338, 0.003289473684210526, 0, 0, 0, 0, 0, 0.014285714285714285, 0, 0, 0.03333333333333333, 0.022058823529411766, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.011904761904761904, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.008695652173913044, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007692307692307693, 0.09090909090909091, 0, 0, 0, 0, 0, 0, 0, 0.009174311926605505, 0, 0, 0, 0, 0, 0, 0.004807692307692308, 0.0028653295128939827, 0.012987012987012988, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.003125, 0, 0, 0, 0, 0, 0.06451612903225806, 0, 0.03076923076923077, 0, 0.022222222222222223, 0, 0, 0, 0.006342494714587738, 0, 0, 0, 0, 0.022222222222222223, 0, 0.0018315018315018315, 0.041666666666666664, 0.01282051282051282, 0, 0.008695652173913044, 0, 0.03333333333333333, 0, 0.0038314176245210726, 0.015384615384615385, 0.03225806451612903, 0.015151515151515152, 0.018867924528301886, 0, 0, 0, 0, 0, 0, 0.03333333333333333, 0.008064516129032258, 0, 0.03571428571428571, 0.05, 0.034482758620689655, 0.047619047619047616, 0, 0.04, 0.047619047619047616, 0, 0.008, 0, 0, 0, 0.002178649237472767, 0, 0.02197802197802198, 0, 0, 0.013513513513513514, 0.02727272727272727, 0, 0.034482758620689655, 0.03278688524590164, 0, 0, 0, 0, 0.006578947368421052, 0.006289308176100629, 0, 0, 0, 0, 0, 0.0021413276231263384, 0, 0, 0.02127659574468085, 0.005479452054794521, 0.004310344827586207, 0.02040816326530612, 0.003816793893129771, 0, 0.003076923076923077, 0.008695652173913044, 0.005714285714285714, 0, 0, 0.019230769230769232, 0, 0.024390243902439025, 0.006666666666666667, 0, 0, 0, 0, 0, 0, 0, 0.028169014084507043, 0, 0.06896551724137931, 0, 0.008695652173913044, 0.004901960784313725, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.013333333333333334, 0, 0, 0.004830917874396135, 0, 0, 0, 0, 0, 0.005050505050505051, 0, 0.0072992700729927005, 0, 0, 0.008, 0.045454545454545456, 0.009615384615384616, 0.01818181818181818, 0, 0, 0, 0, 0, 0.010752688172043012, 0, 0, 0, 0, 0, 0, 0, 0, 0.0392156862745098, 0, 0, 0, 0, 0, 0, 0, 0, 0.0075046904315197, 0.0022935779816513763, 0.014925373134328358, 0.016129032258064516, 0.02702702702702703, 0.023809523809523808, 0, 0.0055248618784530384, 0, 0, 0, 0, 0, 0, 0, 0.006802721088435374, 0, 0, 0, 0, 0, 0.0038314176245210726, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.001953125, 0.0044444444444444444, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.005076142131979695, 0, 0.0078125, 0, 0, 0, 0, 0, 0.005376344086021506, 0, 0, 0, 0, 0.004672897196261682, 0, 0, 0.04, 0.006644518272425249, 0, 0, 0, 0.01020408163265306, 0, 0.015873015873015872, 0, 0, 0.03333333333333333, 0.02631578947368421, 0, 0.047619047619047616, 0.0038022813688212928, 0, 0, 0, 0, 0, 0, 0.047619047619047616, 0, 0.07142857142857142, 0.022727272727272728, 0.02040816326530612, 0, 0, 0.041666666666666664, 0, 0, 0, 0, 0, 0.005291005291005291, 0, 0.004366812227074236, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.023255813953488372, 0, 0, 0.027777777777777776, 0, 0, 0, 0.01098901098901099, 0, 0.021505376344086023, 0, 0.0035460992907801418, 0.006622516556291391, 0, 0, 0, 0, 0.025, 0, 0, 0.028985507246376812, 0, 0, 0, 0, 0.004792332268370607, 0.015151515151515152, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.010416666666666666, 0.02702702702702703, 0, 0, 0, 0, 0, 0, 0.02702702702702703, 0.0196078431372549, 0, 0, 0, 0, 0, 0, 0, 0, 0.0136986301369863, 0, 0, 0, 0, 0, 0.006802721088435374, 0, 0.011976047904191617, 0, 0, 0, 0.007142857142857143, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.005649717514124294, 0.025974025974025976, 0.01092896174863388, 0, 0, 0, 0, 0.010309278350515464, 0, 0, 0, 0.0049504950495049506, 0, 0, 0, 0.007017543859649123, 0, 0.016666666666666666, 0, 0.008583690987124463, 0.016129032258064516, 0.00847457627118644, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.004405286343612335, 0.008064516129032258, 0.010101010101010102, 0, 0, 0, 0, 0, 0, 0.005714285714285714, 0.003676470588235294, 0, 0, 0, 0, 0, 0, 0.00641025641025641, 0.003484320557491289, 0, 0.027777777777777776, 0, 0, 0, 0, 0.03225806451612903, 0, 0, 0, 0, 0, 0.01694915254237288, 0, 0, 0, 0, 0.009389671361502348, 0.0049261083743842365, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.014184397163120567, 0, 0, 0.017543859649122806, 0, 0.015873015873015872, 0, 0, 0.016666666666666666, 0.013888888888888888, 0.007936507936507936, 0, 0, 0, 0, 0.009259259259259259, 0.00980392156862745, 0.011904761904761904, 0, 0, 0, 0, 0, 0, 0.0051813471502590676, 0, 0.023255813953488372, 0, 0.03296703296703297, 0.03278688524590164, 0, 0, 0, 0, 0, 0.0273972602739726, 0.01694915254237288, 0, 0.02702702702702703, 0.010582010582010581, 0, 0, 0, 0.02127659574468085, 0.04, 0.0025974025974025974, 0.029411764705882353, 0.01818181818181818, 0.00273224043715847, 0, 0, 0.013888888888888888, 0, 0.00641025641025641, 0, 0.0045662100456621, 0, 0, 0, 0, 0, 0, 0.047619047619047616, 0, 0, 0.047619047619047616, 0.005813953488372093, 0.017241379310344827, 0.017964071856287425, 0, 0.007633587786259542, 0, 0, 0, 0, 0, 0, 0, 0, 0.006993006993006993, 0.010830324909747292, 0, 0, 0, 0.00909090909090909, 0, 0.009433962264150943, 0, 0.007246376811594203, 0.005494505494505495, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.021739130434782608, 0, 0, 0, 0, 0, 0, 0, 0, 0.008928571428571428, 0, 0, 0, 0, 0, 0, 0, 0, 0.02040816326530612, 0.023255813953488372, 0, 0.047619047619047616, 0.019230769230769232, 0.030927835051546393, 0, 0, 0.058823529411764705, 0, 0, 0, 0, 0, 0.047619047619047616, 0.01098901098901099, 0, 0, 0.027777777777777776, 0, 0, 0, 0, 0, 0.010869565217391304, 0, 0.002638522427440633, 0.00625, 0, 0, 0.0051813471502590676, 0, 0.006024096385542169, 0, 0, 0.0038314176245210726, 0, 0, 0.003215434083601286, 0.003278688524590164, 0.0033112582781456954, 0.01098901098901099, 0, 0, 0, 0.012552301255230125, 0, 0, 0, 0, 0, 0.005681818181818182, 0, 0, 0, 0, 0.0196078431372549, 0, 0, 0.0029940119760479044, 0, 0, 0, 0.003745318352059925, 0, 0, 0, 0, 0, 0.006211180124223602, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.005025125628140704, 0, 0, 0.020833333333333332, 0, 0.030303030303030304, 0, 0, 0, 0.02857142857142857, 0.03225806451612903, 0, 0, 0, 0.047619047619047616, 0.058823529411764705, 0.009950248756218905, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.023809523809523808, 0, 0, 0, 0, 0.03333333333333333, 0.011111111111111112, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.04878048780487805, 0, 0, 0, 0.037037037037037035, 0, 0, 0, 0.03125, 0, 0.014218009478672985, 0.012269938650306749, 0.006756756756756757, 0, 0.006711409395973154, 0, 0, 0, 0, 0, 0.008928571428571428, 0, 0, 0, 0, 0, 0, 0.0048543689320388345, 0, 0, 0, 0, 0, 0, 0, 0.024193548387096774, 0.02, 0.010582010582010581, 0, 0.006756756756756757, 0, 0.0027662517289073307, 0, 0, 0, 0, 0, 0, 0, 0, 0.014925373134328358, 0, 0, 0, 0.038461538461538464, 0 ]

[ "40 F.3d 385\nU.S.v.", "Henry*\nNO. ", "94-10484\nUnited States Court of Appeals,Fifth Circuit.", "\nNov 09, 1994\nAppeal From: N.D.Tex., ", "No. ", "2:94-CR-0002\n\n1\nDISMISSED.", "\n\n\n\n*\n Fed.", "R.App.", "P. 34(a); 5th Cir.", "R. 34.2\n\n\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0, 0, 0.037037037037037035, 0, 0, 0, 0, 0.16666666666666666, 0, 0.1 ]

[ "Q:\n\nvba calculate days between dates in two cells, only return a value if both cells have a date\n\nI have the below code to calculate days between dates in two cells, but it returns an error value if column X has no date. ", " I want the code to only return a value if there is a date in column X, but I don't know how to do that. ", " I am new to VBA. ", " Thanks in advance for any help you can give.", "\nSub CalcDays()\nDim LastRow As Long\nDim wb As Workbook: Set wb = ThisWorkbook\nDim ws As Worksheet\nSet ws = wb.", "Sheets(\"Sheet2\")\n\nLastRow = Cells.", "Find(\"*\", SearchOrder:=xlByRows, SearchDirection:=xlPrevious).Row\n\nWith Range(\"AA2:AA\" & LastRow)\n [AA:AA] = [X:X-Z:Z]\nEnd With\n\nEnd Sub\n\nA:\n\nYou could do something like:\n[AA:AA] = [if(X:X=\"\", \"\", if(Z:Z=\"\", \"\", X:X-Z:Z))]\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0.05555555555555555, 0, 0.02727272727272727, 0.029411764705882353, 0.00881057268722467 ]

[ "NORWAY\n\nTHE TRIBUTE (SANDNES NORWAY)\n\nSANDNES ROCKEKLUBB “TRIBUTE” has a main goal to find new bands and give them a stage to play on, we work on a voluntary basis and have approximately 55 shows a year with mostly bands in the metal/hard rock family. ", "We are very pleased to be part of the M2TM and tying bonds over to the UK.", "\n\nMANCHESTER\n\nREBELLION\n\nRebellion Manchester is a 500 capacity live-music venue located in the heart of Manchester City Centre. ", "There are pool tables, many seated areas, a large beer garden and two bar areas, all creating a spacious and welcoming atmosphere for all visitors.", "\n22nd January 2017 – Launch Party and free BBQ\nRepresentatives from 48 qualifying bands will be present in order to select their position in the 12 Heats. ", "Please see the attached spreadsheet for dates and layout of the Heats to Finals. ", "These positions will be chosen at random out of a ‘hat’ and immediately placed onto the Heats Board which will be present in the venue throughout the competition in order to advertise accordingly. ", "Live music performances will feature throughout the Launch Party in order to showcase the venue’s high quality tech specifications. ", "A free BBQ will be available to all, served in the sheltered area of the Beer Garden.", "\nAfter the Launch Party, following Sundays will be a series of 12 Heats, 4 Quarter Finals, 2 Semi Finals and 1 Final. ", "Dates are listed on the spreadsheet. ", "Throughout the competition it is our duty and pleasure to advertise via all available online and physical platforms, whilst keeping artists informed in a professional manner. ", "We are determined for this to be a series of fun and entertaining events, culminating in the party of the decade!", "\n\nWOLVERHAMPTON\n\nTHE GIFFARD ARMS\n\nFor many people a visit to the pub is a diversion into their third dimension - the first being at home and the second the workplace - and this unique pub in particular lives up to its third dimension / twilight zone reputation.", "\nOn this site we endeavour to give a little of the relaxed and friendly ( if a little bizarre ) feeling we strive for in the pub itself, where you can meet up and talk with friends, where there is always something going on & where the pressures of everyday life slip away over a cold drink and a good conversation\nIf you`ve not already paid us a visit, then come and join us soon & take a sip from the devils cup.", "\n\nBRISTOL\n\nTHE EXCHANGE\n\nExchange is a versatile 250 capacity live music and club space, situated in the heart of Bristol’s city centre. ", "After hosting the semi-finals last year they‘ve joined forces with 2015 winners Mortishead and they will now be the hosts of M2TM, Bristol region, in 2017. ", "Together they are committed in helping Bloodstock find the best from the Bristol/Southwest region to grace the Newblood Stage.", "\n\nBIRMINGHAM\n\nTHE ROADHOUSE\n\nThe roadhouse venue in Birmingham is an independent 250 capacity live music venue and hosts all types of live music events from acoustic nights to heavy metal all dayers, from unsigned local bands to touring national and international acts. ", "The events are intimate to fans and professional to the artist with house sound and light technicians and backstage facilities for headline acts. ", "The roadhouse Birmingham is now in it’s 6th year of hosting the Birmingham heats for the metal to the masses competition – all of which have been awesome shows with an electric atmosphere and camaraderie! ", "2012: Birmingham death-metallers Kataleptic were overall winners 2013: winners gehtika stormed the final to a sell out crowd 2014: both Eradikator and Aceldama secured slots at bloodstock at the 2014 final! ", "2015: both burden of the noose and the Mighty Wraith were chosen to perform on the hollowed grounds at Bloodstock. ", "2016: Face of Ruin and Valous both smashed it … so we will see the roadhouse host the competition for the 6th time and it is gearing up to be even better than before! ", "Apply now for your band to take part in the Birmingham heats for metal to the masses at the roadhouse Birmingham.", "\n\nBOURNEMOUTH\n\nTHE ANVIL\n\nThe Anvil is Bournemouth's premier rock bar and venue and hosts a wide variety of genres all year round. ", "With a backbar of over 100 spirits, a rock jukebox, friendly atmosphere and an ever growing reputation for live music by hosting national and international touring bands.", "\n\nSELBY\n\nTHE VENUE\n\nThe Venue is on the site of the old Greens furniture shop on Ousegate in the historical market town of Selby. ", "Right opposite the river Ouse this vast space has been converted into a 300 capacity live venue with the addition of local band rehearsal rooms. ", "It has a state of the art PA, lighting rig, DJ booth and A/V equipment and is perfectly positioned to host the very best specialist club events and functions pre and post gigs.", "\nTo enquire about hiring the venue or booking a gig email us at info@venueselby.co.uk\n\nLINCOLNSHIRE\n\nCAFE INDIEPENDANT\n\nLizard King Promotions is honoured to be asked back to represent Lincolnshire for M2TM for a 2nd year in a row with Cafe INDIEpendant.", "\nCafé INDIEpendent... Coffee and Music House... Art and Gigs Venue.", "\n\nOXFORD\n\nTHE BULLINGDON\n\nThe Bullingdon is in the heart of the student living district of Oxford. ", "Being a medium capacity venue (300) it attracts many genres of bands including rock and metal. ", "It’s a well known venue in Oxford. ", "Celebrating over 20 years of Gigs, Clubs and live performance - showcasing Local, National and International touring acts - and some of the scenes leading DJ's\n\nLONDON\n\nNAMBUCCA / THE SCALA\n\nThis will be Monsta’s 6th successful year for M2TM.", "\nLast year we made Nambucca in Holloway (a metal friendly venue) our new home.", "\nM2TM LDN now has a firm reputation for embracing the Metal 2 The Masses initiative as well as cementing the relationship of London’s metal family – bands and fans alike, uncovering the best of the Capitals New Blood.", "\n\nHITCHIN\n\nCLUB 85\n\nDedicated 300 capacity live music venue.", "\n24’ x 13’x 3’ stage.", "\nFull decent PA, lights, bar, merch area, small dressing room.", "\nLimited Parking available.", "\nDisabled access but no wheelchair friendly toilet facilities.", "\nAge limit 16+ but younger patrons can be signed in at the door if accompanied by a grown up.", "\nClub 85 has been the local home for live metal for the past 20 years, and has seen many bands grow that have grown up on our stage.", "\n\nNOTTINGHAM\n\nTHE MAZE\n\nThe maze has in recent years become somewhat of a legendary venue. ", "Mixing a host of underground club nights and alternative band nights, it has become a linchpin in the ever growing music community of Nottingham city.", "\nA strong supporter of local bands, The Maze hosts regular gigs for local musicians and has had some of the UK’s finest talents grace it’s stage. ", "Bands such as Evil Scarecrow, Lawnmower deth, Black Tongue, Black Spiders, The Algorithm have passed through the venue.", "\n\nMERSEYSIDE\n\nEBGB’S\n\nA new bar and club is rocking Liverpool down to its very core and there’s nothing you can do to stop it!", "\nEBGB’s Basement has been known for crazy late nights for longer than most of you people have been alive. ", "Refreshingly unique, wonderfully insane and undeniably spectacular, EBGB’s is the club you’ve always wanted but never dared to go!", "\n\nBURNLEY\n\nSANCTUARY\n\nSanctuary Rock Bar has been THE alternative venue in Burnley for 11 years. ", "Established in 2005 out of a passion for live music, Sanctuary provides a pub, club, live music venue and all round safe haven for the alternative community. ", "Building on the success of two previous years, we are proud to be associated with Bloodstock and Metal to the Masses again in 2017.", "\n\nDEVON & CORNWALL\n\nLIVEWIRE\n\nLivewire is a small 250 capacity venues situated on the banks of the river tamar. ", "Livewire is a UK Charity giving young people opportunities around music, the venue however is of high quality and has as well as hosting many local young bands has also hosted The Damned, Funeral For a Friend, Phil Campbell (Motorhead) and many more. ", "The venue has an impressive back line.", "\n\nCARDIFF\n\nFUEL\n\nFounded in 2006, Fuel has gone from strength to strength and continues to set the standard for Rock Clubs.", "\nNow in its new full-time home at Fuel Rock Club on Womanby Street, it has continued to attract the craziest rockers in Cardiff and south Wales, as well as the cream of touring bands.", "\nAlthough Fuel has been home to the Metal 2 The Masses – South Wales initiative for a few years now, 2016 saw the venue take over the running of the competition with local Death Metalers “Agrona” being victorious.", "\nFuel is now poised and ready to kick off the biggest South Wales M2TM platform to date, with a shed load of new talent waiting to give it what they’ve got!", "\n\nCOVENTRY\n\nTHE ARCHES\n\nFATangel and Fargo Events, in association with The Underground Ascending presents Metal 2 The Masses at Arches Venue Coventry.", "\nArches venue is the city’s leading live music venue, a 350 capacity venue who regularly host events from the best of the best from the UK underground metal scene.", "\nArches Venue is Coventry’s home of metal. ", "Where better to host Metal 2 The Masses.", "\n\nCARLISLE\n\nTHE BRICKYARD\n\nThe Brickyard is Carlisle's premier and only full time live music venue and has hosted some of the biggest names in music past and present.", "\nFormally known as The Richmond Hall, or The Richmond Memorial Hall, the venue itself is over 100 years old and has been a key figure in the Carlisle music scene. ", "The Richmond Hall was built as Saint Mary’s Parish Rooms, named in honour of the late Canon Thomas Richmond of Canon Carlisle Cathedral.", "\nAfter a long absence, The Richmond Hall was renovated and it's doors opened on new year's eve 2002 to the new name of The Brickyard. ", "Ideally situated between Newcaste and Glasgow, The Brickyard is a 350 capacity venue.", "\n\nINVERNESS\n\nMAD HATTERS\n\nLocated on the 1st floor of Hootananny, Inverness’ only rock and metal club, Mad Hatter’s, hosts M2TM 2017 North of Scotland final. ", "Situated in the city centre Mad Hatter’s hold 80 – 90 people and has purpose built PA and lighting systems.", "\n2016 saw the first year of Inverness’ M2TM involvement with blistering success! ", "Highland band Seed of Sorrow playing to a full house, secured their slot at The New Blood stage with brutal passion. ", "After 2016’s success Inverness’ metal scene is poised waiting for round two!", "\n\nBELFAST\n\nVOODOO\n\nThis will be the 3rd year the Voodoo has hosted some of the heats, semi-finals and final of the M2M competition. ", "The venue is one of the cornerstones of live metal events in Belfast, having played host to a wealth of local talent, as well as bands such as Diamond Head, Raging Speedhorn, Aura Noir, Exhumed, Negura Bunget and a whole host of others! ", "It’s ideal for touring bands and local shows alike and has successfully celebrated its 5th birthday in 2016\n\nSWINDON\n\nTHE VICTORIA\n\nThe Victoria is one of Swindons oldest and busiest venues I'm town. ", "Having always hosted a variety of live music it's an ideal venue to host Metal 2 The Masses. ", "We had a great showing last year for all 4 heats and a PACKED final show to send off Heriot to BOA2016!", "\n\nBRIGHTON\n\nGREEN DOOR STORE\n\nBack for a 4th year in Brighton Jackhammer Promotions and The Green Door Store bring the M2TM to you, after 3 incredibly successful events where the best of Brighton has competed. ", "Tucked away under Brighton train station is where you can find us.", "\n\nLEICESTER\n\nTHE FIREBUG / THE DE MONTFORT HALL\n\nLeicestershire's premier rock/metal venue is proud to see the Metal 2 the Masses return again in 2017, with a 400 capacity bar and 150 capacity venue above we have already seen some major acts come to play , Katatonia , Raging Speedhorn amongst others have all graced our stage And that's until we get to the final, held once again at the legendary DeMontfort Hall a 2,400-capacity venue with its own legacy.", "\n\nGLASGOW\n\nIVORY BLACKS\n\nIvory Blacks is a 300 Capacity Live music Venue in the city centre of Glasgow, we have hosted the Scottish/ Glasgow heats and final of Bloodstock Metal 2 the masses since 2008,If your band is from Scotland and interested in competing in the heats of M2TM217Glasgow please send an email with the heading “m2tm2017entry” to ivoryblacksglasgow@googlemail.com or contact the facebook page https://www.facebook.com/m2tmscotland\n\nNEWCASTLE\n\nTRILLIANS\n\nTrillians Rock Bar is a genuine iconic venue for rock and metal fans. ", "The “Wall of Fame” listing some of the fantastic bands who’ve played there over the years. ", "The bar had had some well-documented rocky times, but the current ownership team of long-serving sound guy Dave Hills and long-term regular Barbara Blair have restored glory and pride to the establishment. ", "Focusing on many amazing up and coming bands, along with the odd touring icon (Jizzy Pearl one of many acts to play there at his request) there’s a real buzz that’s got the rock crowd excited again.", "\nIn 2016, the M2TM Heats were held in Trillians and this attracted a good mixture of regulars and people there to cheer their favourites which led to many a good night. ", "We’re pleased to be running the full run there this time so fans can see the full journey under one roof." ]

{ "pile_set_name": "Pile-CC" }

[ 0.015873015873015872, 0, 0, 0, 0.012903225806451613, 0, 0.005076142131979695, 0.007575757575757576, 0.011764705882352941, 0.00847457627118644, 0, 0, 0, 0, 0, 0.0072992700729927005, 0.00641025641025641, 0.015873015873015872, 0, 0, 0, 0.004830917874396135, 0.008695652173913044, 0, 0, 0.007633587786259542, 0, 0.023076923076923078, 0, 0, 0.011811023622047244, 0.029850746268656716, 0.010101010101010102, 0, 0, 0.01652892561983471, 0.01282051282051282, 0.004608294930875576, 0, 0, 0, 0, 0, 0, 0, 0, 0.006666666666666667, 0, 0.025210084033613446, 0, 0, 0.007692307692307693, 0.010309278350515464, 0, 0.015267175572519083, 0, 0.00796812749003984, 0, 0.008130081300813009, 0.00546448087431694, 0.009389671361502348, 0, 0.013333333333333334, 0, 0.046511627906976744, 0.025, 0.012048192771084338, 0.006134969325153374, 0.029411764705882353, 0, 0.03529411764705882, 0.012658227848101266, 0, 0, 0, 0, 0.007575757575757576, 0.016877637130801686, 0.005, 0.010752688172043012, 0.009708737864077669, 0.004761904761904762, 0.015151515151515152, 0.002188183807439825, 0.011090573012939002, 0, 0.009708737864077669, 0.005050505050505051, 0, 0 ]

[ "Q:\n\nDrupal 7: How can I display nodes of specific author in a taxonomy term?", "\n\nI've a question about taxonomy terms. ", "\nIn my organization I've actors that work for me and, for each actor I created a taxonomy term containing some information, such as bio, an image etc.", "\nEach actor can create content of type \"post\". ", "I want display all contents of a specific actor in his own term.", "\nSo, if in actors vocabulary there are \"alan\", \"jack\" and \"Lucy\", whan an user reaches alan term, he can see all posts created by Alan, and so on.", "\nFor security I don't want the actors select terms when create posts.", "\nI hope you can understand my question.", "\n\nA:\n\nI probably wouldn't have used a taxonomy term to store that info, but that's not a big deal. ", "\nIt sounds like you want a block containing the information in the taxonomy term to appear on a user's post. ", "\nYou need an entity reference connecting a user/author with the appropriate taxonomy term.", "\nCreate View that is based on the taxonomy vocabulary. ", "Use a \"contextual reference\" starting with the post's node id in the URL to a relationship to the author of the post to another relationship to the taxonomy term using the entity reference.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0, 0.02054794520547945, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Slideshow ( 3 images )\n\nRIO DE JANEIRO (Reuters) - Brazil’s leading presidential candidate Jair Bolsonaro said on Thursday that if elected in the Oct. 28 runoff ballot, he would name banker Paulo Guedes as economy minister to oversee a “super ministry” combining the current finance, planning and development portfolios.", "\n\nSpeaking to journalists after meeting with members of his Social Liberal Party, the far-right politician said he would appoint retired army general Augusto Heleno Pereira as defense minister, and congressman Onyx Lorenzoni as chief of staff. ", "He also said that conservative agriculture leader Nabhan Garcia would not be the eventual head of another ministry combining the current agriculture and environment ministries." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.009375, 0.012295081967213115, 0.005681818181818182 ]

[ "Q:\n\nChange text into a button doesn't work\n\nI write the next code:\n<span id=\"post\">search by id</span>\n\n$(\"#post\").click(function () {\n var input = $(\"<input type='text' id='input_find_by_id'><button type='button' id='button_search_by_id'>Click Me!</button>\");\n $(this).replaceWith(input);\n setTimeout(function() {change();},1250);\n});\n\nfunction change() {\n var input = $(\"<span id='post'><u>search by id</u></span>\");\n $(\"#input_find_by_id\").replaceWith(input);\n $(\"#button_search_by_id\").remove();\n //input.select();\n}\n\nhttp://jsfiddle.net/alonshmiel/APjyy/2/\nwhen I press \"search by id\", it is changed into a button and then, after 1 moment, it returns to be \"search by id\".", "\nBut when I try to press it again, nothing is happen. ", "why don't I get again the button?", "\n\nA:\n\nWhen you replace the original span with another content, you effectively remove the element from the DOM - along with any events attached to it. ", " When you then add your span again (in change function), it's a newly created element, which doesn't have any event handlers attached to it - you would need to attached the event handler again.", "\nThe alternative to solve this would be to use jQuery on function to attach \"live\" event handlers:\n$(document).on('click', '#post', function () {\n ...\n});\n\nIn addition, since you're only calling one function with no arguments in your setTimeout, you can simplify it to\nsetTimeout(change, 1250);\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0028653295128939827, 0, 0, 0, 0, 0 ]

[ "Q:\n\nIssue with QCA (Qt C++ Encryption Library) run on windows 7\n\nI am using Qt 4.8.1, MinGW compiler and Qt Creator, all on windows 7. ", "I want to add an encryption/ decryption library to my project. ", "After searching the web for couple days I found QCA. ", "Fortunately I found a pre-built version using the same C++ compiler I am using, and a pre-built version of the needed plugins. ", "\nI followed the instructions to add the QCA library to my project. ", "I used a code like this to encrypt using AES:\nQCA::Initializer init = QCA::Initializer();\n\n//Here where the execution stops\nQCA::SymmetricKey key = QCA::SymmetricKey(16);\n\nQCA::InitializationVector iv = QCA::InitializationVector(16);\n\nQCA::Cipher cipher = QCA::Cipher(QString(\"aes128\"), QCA::Cipher::CBC,\n QCA::Cipher::DefaultPadding, QCA::Encode,\n key, iv);\n\nif (!", "QCA::isSupported(\"aes128-cbc-pkcs7\"))\n{\n qDebug() << \"AES128 is not supported\";\n return;\n}\n\nThe code compiles just fine but when I run the application stops with unknown reason.", "\nI really got tired from this bug, if anybody can help it will be very very very appreciated.", "\n\nA:\n\nFor future programmers that might get stuck on this\nQCA loads the plugins at runtime, so even if it compiles fine, if the plugin is not in a searchable folder, it won't load.", "\nYou can check if that's the problem by calling qDebug() << QCA::supportedFeatures();. ", "If the plugins are not being loaded, you'll get something like:\n(\"random\", \"md5\", \"sha1\", \"keystorelist\")\n\nYou should be able to see the folders QCA is looking up by calling:\nqDebug(\"%s\", QCA::pluginDiagnosticText().toUtf8().constData());\n\nApparently, plugins must be placed in a subdirectory called crypto in the libs root directory.", "\nYou can check for all the paths where Qt looks for libraries using:\nqDebug() << QCoreApplication::instance()->libraryPaths();\n\nThis documentation might have some useful information: http://doc.qt.io/qt-4.8/qpluginloader.html\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.02962962962962963, 0, 0.018867924528301886, 0, 0.014925373134328358, 0.002331002331002331, 0, 0, 0.005555555555555556, 0.011494252873563218, 0.005988023952095809, 0.004405286343612335 ]

[ "The present invention relates generally to implantable medical devices and more particularly to controlling surface properties of implantable biocompatible materials suitable for fabrication of implantable medical devices.", "\nImplantable medical devices are fabricated of materials that are sub-optimal in terms of the biological response they elicit in vivo. ", "Many conventional materials used to fabricate implantable devices, such as titanium, polytetrafluoroethylene, silicone, carbon fiber and polyester, are used because of their strength and physiologically inert characteristics. ", "However, tissue integration onto these materials is typically slow and inadequate. ", "Certain materials, such as silicone and polyester, elicit a significant inflammatory, foreign body response that drives fibrous encapsulation of the synthetic material. ", "The fibrous encapsulation may have significant adverse effects on the implant. ", "Moreover, conventional biomaterials have proved inadequate in eliciting a sufficient healing response necessary for complete device integration into the body. ", "For example, in devices that contact blood, such as stents and vascular grafts, attempts to modify such devices to promote endothelial cell adhesion may have a concomitant effect of making the devices more thrombogenic.", "\nWhen implanted, conventional blood-contacting implantable devices, such as stents, stent-grafts, grafts, valves, shunts and patches, fail to develop a complete endothelial layer, thereby exposing the device material to thrombus formation or smooth muscle cell proliferation, and ultimate failure of the implanted device. ", "It has been recognized that, when implanted into the body, metals are generally considered to have superior biocompatibility than polymers used to fabricate commercially available polymeric grafts.", "\nIn cellular interactions with prosthetic material surfaces, cell adhesion to the material surface is mediated by integrins present on cell membranes that interact with the prosthetic surface. ", "Integrins are the most prominent member of a class of extracellular matrix (ECM) adhesion receptors. ", "Integrins are a large family of heterodimeric transmembrane proteins with different α and β subunits. ", "Integrins are regulated at several levels. ", "Modulation of the affinity of the adhesion receptor for ligand, termed affinity modulation, is a mechanism for activation of platelet aggregation and is believed to underlie activation of leukocyte adhesion. ", "Adhesive strengthening by clustering of adhesion receptors or by cytoskeletal-dependent processes such as cell spreading has been shown to be crucial for strong cellular attachment, control of cell growth and cell motility. ", "Under high shear forces present in flowing blood, leukocytes first tether, then roll along the vessel surface. ", "When a local signal, e.g., a cytokine, is released in their vicinity, the leukocyte arrests, develops a firm adhesion then migrates across the endothelium. ", "Tethering, rolling, arrest and adhesion tightening are all known to result from activation of leukocyte integrins.", "\nOnce adhered to a surface, cell spreading and migration are associated with assembly of focal adhesion junctions. ", "Cell migration entails the coordination of cytoskeletal-mediated process extension, i.e., filopodia and lamellopodia, formation of adhesive contacts at the leading edge of a cell, breaking adhesive contacts, and cytoskeletal retraction at the trailing edge of the cell. ", "Focal adhesions are comprised of integrins as the major adhesion receptors along with associated cytoplasmic plaque proteins. ", "Assembly of focal adhesions is regulated by extracellular ligand binding events and by intracellular signaling events. ", "Ligand binding controls localization of β1- and β3-containing integrins into focal adhesions. ", "The cytoplasmic domains of the β subunits have intrinsic signals for focal adhesion localization, but incorporation of the integrins into focal adhesions is prevented by the α subunits of the heterodimers. ", "Ligand binding, however, relieves this inhibition and allows the subunit cytoplasmic tail signals to recruit the integrin dimmer into the focal adhesion.", "\nAttempts at coating implanted metal devices, such as stents, with proteins that contain the Arg-Gly-Asp (RGD) attachment site have been made with some success. ", "The RGD sequence is the cell attachment site of a large number of adhesive extracellular matrix, blood, and cell surface proteins and many of the known integrins recognize the RGD sequence in their adhesion protein ligands. ", "Integrin-binding activity may also be reproduced by synthetic peptides containing the RGD sequence. ", "However, bare metal implanted materials will not, of course, have native RGD attachment sites. ", "Thus, metal implantable devices, such as stents, have been derivitized with polymers having RGD attachment sites bound to the polymer matrix.", "\nWhen prosthetic materials are implanted, integrin receptors on cell surfaces interact with the prosthetic surface. ", "When cells come into contact with the extracellular matrix, such as a prosthetic surface, their usual response is to extend filopodia, and integrins at the tip of the filopodia bind to the extracellular matrix and initiate the formation of focal adhesions. ", "Actin-rich lamellipodia are generated, often between filopodia, as the cell spreads on the extracellular matrix. ", "Fully developed focal adhesions and associated actin stress fibers ensue. ", "These same evens occur during cell migration as cells extend lamellipodia and form focal adhesions to derive the traction necessary for movement. ", "Giancotti, F. G., et al. ", "Science, 285:13 August 1999, 1028-1032.", "\nThe integrin receptors are specific for certain ligands in vivo. ", "If a specific protein is adsorbed on a prosthetic surface and the ligand exposed, cellular binding to the prosthetic surface may occur by integrin-ligand docking. ", "It has also been observed that proteins bind to metals in a more permanent fashion than they do to polymers, thereby providing a more stable adhesive surface. ", "The conformation of proteins coupled to surfaces of most medical metals and alloys appears to expose greater numbers of ligands and attract endothelial cells having surface integrin clusters to the metal or alloy surface, preferentially over leukocytes.", "\nBecause of their greater adhesive surface profiles, metals are also susceptible to short-term platelet activity and/or thrombogenicity. ", "These deleterious properties may be offset by administration of pharmacologically active antithrombogenic agents in routine use today. ", "Surface thrombogenicity usually disappears 1-3 weeks after initial exposure. ", "Antithrombotic coverage is routinely provided during this period of time for coronary stenting. ", "In non-vascular applications such as musculoskeletal and dental, metals have also greater tissue compatibility than polymers because of similar molecular considerations. ", "The best article to demonstrate the fact that all polymers are inferior to metals is van der Giessen, W J. et al. ", "Marked inflammatory sequelae to implantation of biodegradable and non-biodegradable polymers in porcine coronary arteries, Circulation, 1996:94(7):1690-7.", "\nNormally, endothelial cells (EC) migrate and proliferate to cover denuded areas until confluence is achieved. ", "Migration, quantitatively more important than proliferation, proceeds under normal blood flow roughly at a rate of 25 μm/hr or about 2.5 times the diameter of an EC, which is nominally 10 μm. ", "EC migrate by a rolling motion of the cell membrane, coordinated by a complex system of intracellular filaments attached to clusters of cell membrane integrin receptors, specifically focal contact points. ", "The integrins within the focal contact sites are expressed according to complex signaling mechanisms and eventually couple to specific amino acid sequences in substrate adhesion molecules. ", "An EC has roughly 16-22% of its cell surface represented by integrin clusters. ", "Davies, P. F., Robotewskyi A., Griem M. L. Endothelial cell adhesion in real time. ", "J. Clin. ", "Invest. ", "1993; 91:2640-2652, Davies, P. F., Robotewski, A., Griem, M. L., Qualitiative studies of endothelial cell adhesion, J. Clin. ", "Invest. ", "1994; 93:2031-2038. ", "This is a dynamic process, which involves more than 50% remodeling in 30 minutes. ", "The focal adhesion contacts vary in size and distribution, but 80% of them measure less than 6 μm2, with the majority of them being about 1 μm2, and tend to elongate in the direction of flow and concentrate at leading edges of the cell. ", "Although the process of recognition and signaling to determine specific attachment receptor response to attachment sites is not completely understood, availability of attachment sites will favorably influence attachment and migration. ", "Materials commonly used as medical grafts, such as polymers, do not become covered with EC and therefore do not heal after they are placed in the arteries.", "\nThere have been numerous attempts to increase endothelialization of implanted medical devices such as stents, including covering the stent with a polymeric material (U.S. Pat. ", "No. ", "5,897,911), imparting a diamond-like carbon coating onto the stent (U.S. Pat. ", "No. ", "5,725,573), covalently binding hydrophobic moieties to a heparin molecule (U.S. Pat. ", "No. ", "5,955,588), coating a stent with a layer of blue to black zirconium oxide or zirconium nitride (U.S. Pat. ", "No. ", "5,649,951), coating a stent with a layer of turbostratic carbon (U.S. Pat. ", "No. ", "5,387,247), coating the tissue-contacting surface of a stent with a thin layer of a Group VB metal (U.S. Pat. ", "No. ", "5,607,463), imparting a porous coating of titanium or of a titanium alloy, such as Ti—Nb—Zr alloy, onto the surface of a stent (U.S. Pat. ", "No. ", "5,690,670), coating the stent, under ultrasonic conditions, with a synthetic or biological, active or inactive agent, such as heparin, endothelium derived growth factor, vascular growth factors, silicone, polyurethane, or polytetrafluoroethylene (U.S. Pat. ", "No. ", "5,891,507), coating a stent with a silane compound with vinyl functionality, then forming a graft polymer by polymerization with the vinyl groups of the silane compound (U.S. Pat. ", "No. ", "5,782,908), grafting monomers, oligomers or polymers onto the surface of a stent using infrared radiation, microwave radiation or high voltage polymerization to impart the property of the monomer, oligomer or polymer to the stent (U.S. Pat. ", "No. ", "5,932,299). ", "However, all these approaches do not address the lack of endothelialization of polymer grafts.", "\nOverall rate to reach confluence for the endothelial cells on the blood contact surface of implanted medical device is mainly determined by two factors, the rate of cell movement and rate of cell proliferation, with the first being more important. ", "The rate of cell movement further comprises three interrelated steps. ", "Initially, a cell forms lamellipodia and filopodia that protrude outward. ", "This step involves reassembly of actins in the forefront of lambaepolia. ", "After protrusion of lamellipodia from one or multiple points from the cell membrane, the front end of the lamellipodia will form a close attachment, called focal adhesion point, to the substratum through the interaction of integrin on the cell membrane and extracellular matrix binding site. ", "The final step of cell movement involves the contraction of the posterior end through the action of myosin II. ", "The formation of a focal adhesion point is critical for the cell movement because the protruding lamellipodia will otherwise fold back. ", "Without the tension force from the focal adhesion point, a cell loses the contraction from the posterior end and hence stops moving.", "\nAvailability of attachment sites on the substratum is not only important for the focal adhesion point formation, but also important for propagation. ", "It has been shown that cells are forced to spread, survive better and proliferate faster than cells that are confined to the same amount of surface area (Science 276:1425-1428, 1997). ", "This may explain why spreading of neighbor cells stimulate a cell to proliferate, after cells are lost from epithelium.", "\nThe formation of extracellular matrix (ECM) is, to much extent, determined by the cells within it because molecules which form ECM are secreted by the cells. ", "Subsequently, the structure of the ECM, and hence the distribution of attachment sites on the ECM for the integrin binding, determines the focal adhesion point formation, the critical step in cell movement. ", "Therefore, proper distribution of integrin binding sites on the surface of an implanted medical device substantially determines the speed of reendothelialization from the ends surrounding the device.", "\nThere still remains a need for a medical device that stimulates endothelial proliferation and movement when implanted in order to form an endothelial layer over the medical device. ", "Furthermore, there is a remaining need for a method of fabricating such a medical device." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.009900990099009901, 0, 0, 0, 0, 0, 0.00641025641025641, 0.008771929824561403, 0, 0, 0, 0, 0, 0, 0, 0, 0.008928571428571428, 0.01, 0, 0.0070921985815602835, 0, 0, 0.008849557522123894, 0, 0, 0.08, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.017543859649122806, 0.006493506493506494, 0.009009009009009009, 0.005208333333333333, 0.004878048780487805, 0, 0.012658227848101266, 0.024096385542168676, 0.1111111111111111, 0, 0.032, 0, 0, 0, 0, 0, 0.0064516129032258064, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00909090909090909, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.012578616352201259, 0.00966183574879227, 0, 0, 0 ]

[ "Buying and selling merchandise and services via the Internet has become more widely accepted and more secure in recent years. ", "Aside from established merchants and commercial retailers, individuals have found a marketplace online for shopping or peddling their new or used merchandise as well as seeking or offering a variety of services. ", "Many employers seeking employees and those seeking employment have turned to the Internet for opportunities. ", "Generally speaking, this marketplace can be referred to as an online classifieds listing and many websites specializing in this type of commerce currently exist. ", "Most notably, EBay and Craig's List are two of the more popular sites. ", "However, national sites such as EBay lack the level of personalization that may be more closely associated with some more parochial sites such as Craig's List. ", "For example, EBay has traditionally focused on the ability to hold auctions across the country while Craig's List has currently adopted a message board type of framework that has a more local feel, but limits users to search only a particular metropolitan area. ", "On either site, users are left wanting more. ", "The national site can be too large-scale and intimidating for new or infrequent users. ", "On the contrary, the more local based site may seem too restricted in terms of the scope and ability to attract buyers and sellers.", "\nIn addition to these concerns, many of the current sites tend to either charge relatively high transaction fees or have difficulties in maintaining or increasing traffic to their sites due to other restrictions or limitations associated therewith. ", "High fees make it less desirable for infrequent sellers to take advantage of the online service and frequent sellers worry about decreasing traffic to the site due to the higher prices needed to cover the ever-increasing transaction fees." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0, 0, 0.028169014084507043, 0.0125, 0.007633587786259542, 0, 0, 0, 0, 0 ]

[ "Evans says that he grew up a fan of the California Raisins and Vinton’s Eighties tv holiday special A Claymation Christmas Celebration, but hadn’t considered Vinton’s story until he ran across this story about him.", "\n\n“The nostalgia of Will’s work brought me right back to being a kid and discovering his work for the first time,” Evans told Cartoon Brew. “", "What sold me though is that Will has truly a great story. ", "I don’t want to give away too much of the movie for people that don’t know the story, but I became really excited about the potential for a movie when I realized how much material there is to work with.”", "\n\nEvans pitched Vinton on the idea for the film over coffee in Portland, but Vinton turned him down, saying he wasn’t interested in the idea of a documentary. ", "Over time – and with Evans’ persistence – Vinton warmed to the idea, and eventually gave Evans the rights to produce the film, along with unprecedented access to his personal archives.", "\n\n“It’s been nothing but fantastic working with him,” says Evans. “", "We’ve interviewed him four times, spent time at his home with his family…He’s just such a nice guy and always available when we need him for an interview or just to meet up about the project. ", "He’s really let me and the crew go off and do our thing, but anytime we need something such as an introduction to somebody we’d like to interview, he’s always super helpful.”", "\n\nEvans has already recorded interviews with dozens of Vinton’s associates, friends, and colleagues, among them former Vintoners like Hey Arnold! ", "creator Craig Bartlett, Oscar-winning animator Joan Gratz, Strata-cut animation inventor David Daniels, Rogue One animation supervisor Hal Hickel, and animator Chuck Duke (Isle of Dogs, Frankenweenie, Fantastic Mr. Fox).", "\n\nEvans tells us that there is still a lot of filming left to do, including more interviews and creative scene re-enactments. ", "He will also use archival footage, and plans to produce original stop-motion segments with two new characters – Lodge and Randy – who live inside Vinton’s head and represent the left and right sides of his brain.", "\n\nWill Laika chiefs Travis and Phil Knight participate in the documentary as well? ", "Evans certainly hopes so. “", "We have not connected with them yet,” he says, “but I’m very hopeful to have their participation in the film. ", "I really admire what Travis has done with Laika, and am of course a fan of his work.”", "\n\nEvans is designing the film so that it will interest the widest possible audience, even those who aren’t necessarily familiar with Vinton’s body of work. “", "It’s my goal that we tell a great story and make a great movie, as exciting and entertaining as any film about a guy that’s setting off to achieve an impossible dream,” he says. “", "At its core, that’s really what we have here: a protagonist that sets off to follow his dream, and the accolades and obstacles along the way. ", "I think this story has a really interesting arc to it that will hopefully draw people in outside of just animation fans.”", "\n\nThe project until now has been self-funded. ", "Evans plans to launch a crowdfunding campaign in the near future to help raise additional funding to complete the film. ", "To get updates on the film’s production, stay tuned to the official film website and Facebook page." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.004672897196261682, 0.014184397163120567, 0, 0, 0, 0, 0.014925373134328358, 0, 0, 0.0136986301369863, 0.045454545454545456, 0, 0.009433962264150943, 0.024096385542168676, 0, 0, 0.011764705882352941, 0, 0, 0, 0, 0, 0, 0 ]

[ "Behind Crimson Eyes\n\n0Like\n\nVIDEOS\n\nABOUT\n\nThis artist has no videos.", "\n\nBiography\n\nWhen they first formed in Melbourne in 2004, Behind Crimson Eyes was typical of the Australian emo scene, sometimes jokingly referred to as \"emu,\" but over time, and with lineup changes including the addition of second guitarist Kevin Orr, they began to mature and move closer to a hard rock sound. ", "Singer Josh Stuart added screaming to his vocal tricks, Cameron Gilmour appropriated the double-kick drums of metalcore, and Aaron Schultz's guitar and Garth Buchanan's bass rounded out their sound.", "\n\nCarrying a camera with them from their first gig on, Behind Crimson Eyes -- BCE to their fans -- documented six months of their early career, which they edited down into a DVD released with their debut EP. ", "That EP, 2005's Pavour Nocturnis, was a concept album exploring the theme of night terrors, recorded at the prestigious Sing Sing Recording Studios. ", "A second EP, Prologue: The Art of War/Cherry Blossom Epitaph, followed. ", "Enough radio play, and around 25,000 MySpace friends, showed that they were popular enough to make music full-time, and Stuart dropped out of his engineering degree to dedicate himself to it.", "\n\n2006 saw the release of their first full-length album, A Revelation for Despair, on Roadrunner Records. ", "It reached number 43 in the ARIA album charts. ", "A compilation of songs from their earlier EPs and an unreleased demo, Scream Out Your Name to the Night, followed the same year. ", "~ Jody Macgregor" ]

{ "pile_set_name": "Pile-CC" }

[ 0.014492753623188406, 0.003205128205128205, 0.020202020202020204, 0.009615384615384616, 0.013422818791946308, 0, 0.010471204188481676, 0.009433962264150943, 0, 0.007751937984496124, 0.0625 ]

[ "-3.750566 - -3.747. ", "Round k to 4 decimal places.", "\n-0.0036\nSuppose 484709 - 2764709 = -f. ", "Suppose 13*n + f = 16*n. ", "Round n to the nearest one hundred thousand.", "\n800000\nLet h = -391161 + 391196.9947. ", "Let c = 40.9 + -4.9. ", "Let v = h - c. Round v to three dps.", "\n-0.005\nLet o = -17511559.799564816 - 2568.200374184. ", "Let u = o - -17514152. ", "Let h = u + -24. ", "What is h rounded to five dps?", "\n0.00006\nLet o = 14809246.104257 - 14809259. ", "Let p = o + 13.44548. ", "Let i = -0.55 + p. What is i rounded to five dps?", "\n-0.00026\nLet s(r) = 1630*r. ", "Let m be -5 + 7 + (2/2 - 2). ", "Let q be s(m). ", "What is q rounded to the nearest one hundred?", "\n1600\nLet o = -959.99993148 + 960. ", "Round o to 6 decimal places.", "\n0.000069\nLet o = -922 + 977.7. ", "What is o rounded to zero dps?", "\n56\nLet o = -7.606 + 0.006. ", "Let c = o + 7.72. ", "Round c to two dps.", "\n0.12\nSuppose -4*l + 5*l = 2*x + 1590002, l = -5*x + 1589995. ", "Round l to the nearest one hundred thousand.", "\n1600000\nLet u = -2.31 + 3.87. ", "Round u to 1 decimal place.", "\n1.6\nLet h = -1.3 - 0. ", "Let c = 10.3 + h. Let g = 9.000035 - c. What is g rounded to five dps?", "\n0.00004\nLet i = -5 - 16. ", "Let r = -790.35 - -771. ", "Let s = i - r. What is s rounded to one dp?", "\n-1.7\nLet a = -197851 + 197598.942. ", "Let t = -0.058 - a. Let m = t - 252.0141. ", "Round m to three dps.", "\n-0.014\nLet z = -1691.1 + 1691.64355. ", "Let t = -0.54 + z. Round t to three decimal places.", "\n0.004\nLet k = -107.3 + -33.7. ", "Let u = -141.00163 - k. Round u to 3 decimal places.", "\n-0.002\nLet j = 23 + -24.1. ", "Let o = -1.09999973 - j. Round o to seven decimal places.", "\n0.0000003\nLet o(p) = 2018*p**2 - 3*p - 3. ", "Let i = 5 + 8. ", "Let l be o(i). ", "Round l to the nearest ten thousand.", "\n340000\nLet h = -64.3 - -64.300006066. ", "What is h rounded to seven decimal places?", "\n0.0000061\nLet u = -16 - -8. ", "Let h = -7.998 - u. Let y = h + -0.06. ", "Round y to 2 decimal places.", "\n-0.06\nLet j(l) = 2*l**2 - 5*l + 2. ", "Let z be j(3). ", "Let u(g) = -33999*g**3 + 0*g**2 - z*g**2 + 4*g**2. ", "Let r be u(1). ", "What is r rounded to the nearest 10000?", "\n-30000\nLet v = -0.1189984 + 0.119. ", "What is v rounded to 7 decimal places?", "\n0.0000016\nLet n = 85.48725 + 0.43375. ", "Let t = 119 - 33. ", "Let u = t - n. What is u rounded to 2 dps?", "\n0.08\nLet h = -0.0824 + 0.07474. ", "What is h rounded to 4 dps?", "\n-0.0077\nLet i = 0.006601 - 0.491261. ", "Let j = i + 0.49. ", "Round j to four dps.", "\n0.0053\nLet a = 0.82 + 132.18. ", "Let d = a - 242. ", "Let q = d + 109.000071. ", "What is q rounded to 5 decimal places?", "\n0.00007\nLet f = -32.18 - -32. ", "Let g = -0.179936 - f. What is g rounded to 5 dps?", "\n0.00006\nLet m = 7 + 3. ", "Let q = 9.99954 - m. What is q rounded to 4 decimal places?", "\n-0.0005\nLet d = -341.3 + -44.7. ", "Let g = d - -328.6. ", "Round g to the nearest 10.", "\n-60\nLet k(d) = 40219*d - 5. ", "Let b be k(-5). ", "What is b rounded to the nearest ten thousand?", "\n-200000\nLet z(j) = 33482*j + 108. ", "Let i be z(6). ", "Round i to the nearest one hundred thousand.", "\n200000\nLet o = -1.43 + -0.47. ", "Let a = 5.7 - o. Let j = -7.599914 + a. Round j to 5 dps.", "\n0.00009\nLet j(i) = i**2 - 3*i + 7. ", "Let s be j(4). ", "Let f = s - 9. ", "Suppose -f*n + 0*n = -30200000. ", "What is n rounded to the nearest one million?", "\n15000000\nLet f = 6719637.999768 + -6719679. ", "Let a = 41 + f. Round a to five decimal places.", "\n-0.00023\nLet q = -446.4 + 462.235. ", "Round q to zero dps.", "\n16\nLet k(r) = 7*r**3 - 7*r**2 - 7. ", "Let c be k(-6). ", "Let y be (c - 2)/(-3) + 4. ", "Suppose 50093 = 5*u - z + y, -4*z = -8. ", "Round u to the nearest 1000.", "\n10000\nLet o be (-1)/(2*3/18). ", "Let k be (-9 - o)*1/(-3). ", "Suppose 0 = k*u + 3*s - 2*s + 5198, 4*s - 2608 = u. What is u rounded to the nearest one thousand?", "\n-3000\nLet u = -80.3 + 80.3000002018. ", "What is u rounded to 7 decimal places?", "\n0.0000002\nLet k(y) = -2*y - 10. ", "Let c be k(-8). ", "Let q be (c/(-3) - 2) + 6. ", "Let v(r) = 23*r**2 - 2*r - 1. ", "Let z be v(q). ", "Round z to the nearest 10.", "\n90\nLet r = -140 + 139.5503. ", "Round r to one dp.", "\n-0.4\nLet o be (-21 - -6)*4/(-50)*10. ", "Suppose 0 = -o*j + 7*j + 27050000. ", "What is j rounded to the nearest one million?", "\n5000000\nLet z(l) = -62*l**3 - 9*l**2 + 9*l - 38. ", "Let m be z(21). ", "Round m to the nearest 100000.", "\n-600000\nLet c = -16.1 + 16.099998906. ", "Round c to 7 decimal places.", "\n-0.0000011\nSuppose 0 = 5*q + 296825 - 1528240. ", "Suppose 2*b = -y - 98511, q = b - 6*b + 3*y. ", "Let m = -180744 + b. Round m to the nearest one hundred thousand.", "\n-200000\nLet s = -46.7555 + -0.1645. ", "Let x = 60 - 108. ", "Let b = x - s. What is b rounded to one dp?", "\n-1.1\nSuppose b + 25 = 21. ", "Let u = -656 + b. What is u rounded to the nearest 100?", "\n-700\nLet y = 0.794 + 1444.206. ", "Let q = 1426.442 - y. Let h = q + 18.4. ", "Round h to 2 decimal places.", "\n-0.16\nLet f = 3550596 - 3550633.99953. ", "Let l = f + 38. ", "Round l to 4 dps.", "\n0.0005\nSuppose 0*n + 1 = n. Let i be ((-10)/(-4))/(n/2). ", "Suppose 4*c + 4699995 = i*c - 5*r, -5*r = c - 4700005. ", "Round c to the nearest 1000000.", "\n5000000\nLet m = 0.11216 - 0.109. ", "Round m to 3 dps.", "\n0.003\nLet r = 0.014 - 0.0192. ", "Let l = 0.1 - 0.11. ", "Let i = r - l. What is i rounded to three dps?", "\n0.005\nLet l = 1 + -1.037. ", "Let b = l - 0.173. ", "Let g = b + 0.2072. ", "What is g rounded to three dps?", "\n-0.003\nSuppose -43060 = -2*z - 1153404. ", "Let u = 271172 + z. What is u rounded to the nearest ten thousand?", "\n-280000\nLet f be (10/15)/((-1)/(-18)). ", "Suppose 2*i - 8 = -2*u, -f = -3*u - u. Let o(b) = -243000*b. ", "Let h be o(i). ", "What is h rounded to the nearest ten thousand?", "\n-240000\nLet u = -0.091 + -0.019. ", "Let q = 0.11073 + u. What is q rounded to four dps?", "\n0.0007\nLet a = 20.304056 - 20.3. ", "Round a to four dps.", "\n0.0041\nLet f = -2.51 + -68.63. ", "Let w = 140 - 210. ", "Let o = w - f. Round o to one decimal place.", "\n1.1\nSuppose -51996820 - 18523180 = 4*m. ", "What is m rounded to the nearest 1000000?", "\n-18000000\nLet f(z) = -z**2 - 9*z - 7. ", "Let c be f(-8). ", "Let k(i) = -22799*i**3 - i + 1. ", "Let n be k(c). ", "Let u be n/3 - 3/9. ", "Round u to the nearest one thousand.", "\n-8000\nLet a = -14.77 + 15.8. ", "Let f = a - 1.62. ", "What is f rounded to 1 dp?", "\n-0.6\nLet m(s) = s**3 - s - 6. ", "Let l = -60 - -62. ", "Let h be m(l). ", "Round h to the nearest 100.", "\n0\nLet q = -3059055 + 3059067.99947. ", "Let u = -13 + q. What is u rounded to four dps?", "\n-0.0005\nLet z(t) = -57956*t**2 + 51*t - 23. ", "Let a be z(9). ", "Round a to the nearest 1000000.", "\n-5000000\nLet h be 3/1*(0 - (-5 + 4)). ", "Suppose -11649 = -r - 4*n - 31145, 3*n = -h*r - 58497. ", "Round r to the nearest one thousand.", "\n-20000\nLet n = 9 + -8.93. ", "Let z = 4.07 - n. Let i = -3.999978 + z. What is i rounded to 5 decimal places?", "\n0.00002\nSuppose 0 = -22*o + 24*o - 37600. ", "Round o to the nearest one thousand.", "\n19000\nLet o = 76689.74 + -79191. ", "Let d = 2476 + o. Let x = -26 - d. What is x rounded to 1 dp?", "\n-0.7\nSuppose -u - 3*c - 29 = c, -24 = u + 3*c. ", "Let b(i) = 11*i**2 + 1 - 34*i**2 - 5*i + 5*i**2 + 10*i**2 - 138*i**3. ", "Let g be b(u). ", "Round g to the nearest 1000000.", "\n0\nLet o = 0.176 + -0.085. ", "Let s = o - 0.091134. ", "Round s to five dps.", "\n-0.00013\nSuppose 5*s = -2*a - 29, 2*a - 3*a - 3*s = 17. ", "Let v be 0 + a + 1 - 209. ", "Let r = v + 150. ", "What is r rounded to the nearest 100?", "\n-100\nLet g = -72 - -145. ", "Let o = -72.69 + g. Let m = o - 1.39. ", "Round m to one dp.", "\n-1.1\nLet r = 296 + -295.964. ", "What is r rounded to 3 dps?", "\n0.036\nLet t = 3.7256 + 1.07464. ", "Let u = 4.8 - t. What is u rounded to 5 decimal places?", "\n-0.00024\nLet g = 43.97 + -43.970002689. ", "What is g rounded to 6 dps?", "\n-0.000003\nLet w be 4 - (-3)/((-9)/6). ", "Suppose w*d - 3*d - 4*m = 169020, 5*m + 507025 = -3*d. ", "Round d to the nearest ten thousand.", "\n-170000\nLet y = -69.3 + 69.300000391. ", "What is y rounded to seven decimal places?", "\n0.0000004\nLet p = -366 - -614. ", "Let r = p - 243.99. ", "Round r to 0 decimal places.", "\n4\nLet y = -380.0177 - -380. ", "Let h = -0.0176771 - y. Round h to 6 decimal places.", "\n0.000023\nLet z be 2/(6/(-3)) + 4. ", "Let l(m) = -3*m - 3*m + z - 3*m + 16*m - 186*m**2. ", "Let a be l(9). ", "Round a to the nearest 10000.", "\n-20000\nLet z = 27663.1 + -26555. ", "Let f = z + -1170. ", "Round f to the nearest ten.", "\n-60\nLet p be -12 + 968 + 4*1. ", "Let n be ((-56250)/(-27))/((-2)/p). ", "Round n to the nearest one hundred thousand.", "\n-1000000\nLet r = -39.3 + 58. ", "Let c = r - 2.7. ", "Let f = c + -16.0007. ", "What is f rounded to 4 decimal places?", "\n-0.0007\nLet l = -779 + 841.1. ", "Let i = 50 - l. Round i to the nearest integer.", "\n-12\nLet j = 0.0055 + 12.4945. ", "Round j to the nearest integer.", "\n13\nLet o = -9.6 + 22. ", "Let t = o - 12.400000673. ", "Round t to seven dps.", "\n-0.0000007\nLet x(z) = 21319*z**2 - 2*z - 6. ", "Let l be x(-12). ", "Suppose -18690046 = -8*i + l. Round" ]

{ "pile_set_name": "DM Mathematics" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.034482758620689655, 0, 0, 0, 0, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.03225806451612903, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.02564102564102564, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.025, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.05263157894736842, 0, 0, 0, 0.02127659574468085, 0.022222222222222223, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.02857142857142857 ]

[ "Welcome, please sign in\n\nThank you for your interest. ", "Registering allows you to receive information about new products and specials. ", "This information is conveniently stored online so you only have to register with us once.", "\nThank You!" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0 ]

[ "Pillow People\n\nPillow People are rectangular stuffed toys (pillows) with decal faces and stuffed hands & feet attached to their bodies. ", "The line was started in 1986 by Penny Ekstein-Lieberman and was produced by Spring Industries (and later PCE Marketing). ", "The toys were popular during the late 1980s and generated $120 million in sales during the 80's and 90's. ", "The line featured an array of different characters such as animals and people. ", "Besides the 'people' of the line, there are also pillow pets—such as cats and dogs. ", "Additional merchandise included bed sheets imprinted with Pillow People characters, figurines and books. ", "There was also a Christmas TV special made as well.", "\n\nCharacters\nSome of the original Pillow People characters included:\n Mr. Sandman\n Pillow Fighter\n Punky Pillow\n Mr. Thunderclap\n Sweet Dreams\n Rock-a-bye Baby\n Big Footsteps\n Squeaky Door\n Window Rattler\n\nIn culture\nThe Pillow Person \"Window Rattler\" can be seen on multiple episodes of the 1980s TV show Full House, as D.J. Tanner's favorite stuffed animal.", "\n\nSteve gives D.J. a Pillow Person in Episode 10, Season 2 of Fuller House.", "\n\nReferences\n\nExternal links \n Toy website about Pillow People line\n\nCategory:1980s toys\nCategory:Products introduced in 1986\nCategory:Stuffed toys" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0, 0.01652892561983471, 0, 0, 0, 0, 0, 0.011142061281337047, 0.013333333333333334, 0.006802721088435374 ]

[ "/* Applied Micro X-Gene SoC Ethernet Driver\n *\n * Copyright (c) 2014, Applied Micro Circuits Corporation\n * Authors: Iyappan Subramanian <isubramanian@apm.com>\n *\t Ravi Patel <rapatel@apm.com>\n *\t Keyur Chudgar <kchudgar@apm.com>\n *\n * This program is free software; you can redistribute it and/or modify it\n * under the terms of the GNU General Public License as published by the\n * Free Software Foundation; either version 2 of the License, or (at your\n * option) any later version.", "\n *\n * This program is distributed in the hope that it will be useful,\n * but WITHOUT ANY WARRANTY; without even the implied warranty of\n * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. ", "See the\n * GNU General Public License for more details.", "\n *\n * You should have received a copy of the GNU General Public License\n * along with this program. ", " If not, see <http://www.gnu.org/licenses/>.", "\n */\n\n#include \"xgene_enet_main.h\"\n#include \"xgene_enet_hw.h\"\n#include \"xgene_enet_sgmac.h\"\n#include \"xgene_enet_xgmac.h\"\n\n#define RES_ENET_CSR\t0\n#define RES_RING_CSR\t1\n#define RES_RING_CMD\t2\n\nstatic const struct of_device_id xgene_enet_of_match[];\nstatic const struct acpi_device_id xgene_enet_acpi_match[];\n\nstatic void xgene_enet_init_bufpool(struct xgene_enet_desc_ring *buf_pool)\n{\n\tstruct xgene_enet_raw_desc16 *raw_desc;\n\tint i;\n\n\tfor (i = 0; i < buf_pool->slots; i++) {\n\t\traw_desc = &buf_pool->raw_desc16[i];\n\n\t\t/* Hardware expects descriptor in little endian format */\n\t\traw_desc->m0 = cpu_to_le64(i |\n\t\t\t\tSET_VAL(FPQNUM, buf_pool->dst_ring_num) |\n\t\t\t\tSET_VAL(STASH, 3));\n\t}\n}\n\nstatic int xgene_enet_refill_bufpool(struct xgene_enet_desc_ring *buf_pool,\n\t\t\t\t u32 nbuf)\n{\n\tstruct sk_buff *skb;\n\tstruct xgene_enet_raw_desc16 *raw_desc;\n\tstruct xgene_enet_pdata *pdata;\n\tstruct net_device *ndev;\n\tstruct device *dev;\n\tdma_addr_t dma_addr;\n\tu32 tail = buf_pool->tail;\n\tu32 slots = buf_pool->slots - 1;\n\tu16 bufdatalen, len;\n\tint i;\n\n\tndev = buf_pool->ndev;\n\tdev = ndev_to_dev(buf_pool->ndev);\n\tpdata = netdev_priv(ndev);\n\tbufdatalen = BUF_LEN_CODE_2K | (SKB_BUFFER_SIZE & GENMASK(11, 0));\n\tlen = XGENE_ENET_MAX_MTU;\n\n\tfor (i = 0; i < nbuf; i++) {\n\t\traw_desc = &buf_pool->raw_desc16[tail];\n\n\t\tskb = netdev_alloc_skb_ip_align(ndev, len);\n\t\tif (unlikely(!skb))\n\t\t\treturn -ENOMEM;\n\t\tbuf_pool->rx_skb[tail] = skb;\n\n\t\tdma_addr = dma_map_single(dev, skb->data, len, DMA_FROM_DEVICE);\n\t\tif (dma_mapping_error(dev, dma_addr)) {\n\t\t\tnetdev_err(ndev, \"DMA mapping error\\n\");\n\t\t\tdev_kfree_skb_any(skb);\n\t\t\treturn -EINVAL;\n\t\t}\n\n\t\traw_desc->m1 = cpu_to_le64(SET_VAL(DATAADDR, dma_addr) |\n\t\t\t\t\t SET_VAL(BUFDATALEN, bufdatalen) |\n\t\t\t\t\t SET_BIT(COHERENT));\n\t\ttail = (tail + 1) & slots;\n\t}\n\n\tpdata->ring_ops->wr_cmd(buf_pool, nbuf);\n\tbuf_pool->tail = tail;\n\n\treturn 0;\n}\n\nstatic u16 xgene_enet_dst_ring_num(struct xgene_enet_desc_ring *ring)\n{\n\tstruct xgene_enet_pdata *pdata = netdev_priv(ring->ndev);\n\n\treturn ((u16)pdata->rm << 10) | ring->num;\n}\n\nstatic u8 xgene_enet_hdr_len(const void *data)\n{\n\tconst struct ethhdr *eth = data;\n\n\treturn (eth->h_proto == htons(ETH_P_8021Q)) ? ", "VLAN_ETH_HLEN : ETH_HLEN;\n}\n\nstatic void xgene_enet_delete_bufpool(struct xgene_enet_desc_ring *buf_pool)\n{\n\tstruct xgene_enet_pdata *pdata = netdev_priv(buf_pool->ndev);\n\tstruct xgene_enet_raw_desc16 *raw_desc;\n\tu32 slots = buf_pool->slots - 1;\n\tu32 tail = buf_pool->tail;\n\tu32 userinfo;\n\tint i, len;\n\n\tlen = pdata->ring_ops->len(buf_pool);\n\tfor (i = 0; i < len; i++) {\n\t\ttail = (tail - 1) & slots;\n\t\traw_desc = &buf_pool->raw_desc16[tail];\n\n\t\t/* Hardware stores descriptor in little endian format */\n\t\tuserinfo = GET_VAL(USERINFO, le64_to_cpu(raw_desc->m0));\n\t\tdev_kfree_skb_any(buf_pool->rx_skb[userinfo]);\n\t}\n\n\tpdata->ring_ops->wr_cmd(buf_pool, -len);\n\tbuf_pool->tail = tail;\n}\n\nstatic irqreturn_t xgene_enet_rx_irq(const int irq, void *data)\n{\n\tstruct xgene_enet_desc_ring *rx_ring = data;\n\n\tif (napi_schedule_prep(&rx_ring->napi)) {\n\t\tdisable_irq_nosync(irq);\n\t\t__napi_schedule(&rx_ring->napi);\n\t}\n\n\treturn IRQ_HANDLED;\n}\n\nstatic int xgene_enet_tx_completion(struct xgene_enet_desc_ring *cp_ring,\n\t\t\t\t struct xgene_enet_raw_desc *raw_desc)\n{\n\tstruct sk_buff *skb;\n\tstruct device *dev;\n\tskb_frag_t *frag;\n\tdma_addr_t *frag_dma_addr;\n\tu16 skb_index;\n\tu8 status;\n\tint i, ret = 0;\n\n\tskb_index = GET_VAL(USERINFO, le64_to_cpu(raw_desc->m0));\n\tskb = cp_ring->cp_skb[skb_index];\n\tfrag_dma_addr = &cp_ring->frag_dma_addr[skb_index * MAX_SKB_FRAGS];\n\n\tdev = ndev_to_dev(cp_ring->ndev);\n\tdma_unmap_single(dev, GET_VAL(DATAADDR, le64_to_cpu(raw_desc->m1)),\n\t\t\t skb_headlen(skb),\n\t\t\t DMA_TO_DEVICE);\n\n\tfor (i = 0; i < skb_shinfo(skb)->nr_frags; i++) {\n\t\tfrag = &skb_shinfo(skb)->frags[i];\n\t\tdma_unmap_page(dev, frag_dma_addr[i], skb_frag_size(frag),\n\t\t\t DMA_TO_DEVICE);\n\t}\n\n\t/* Checking for error */\n\tstatus = GET_VAL(LERR, le64_to_cpu(raw_desc->m0));\n\tif (unlikely(status > 2)) {\n\t\txgene_enet_parse_error(cp_ring, netdev_priv(cp_ring->ndev),\n\t\t\t\t status);\n\t\tret = -EIO;\n\t}\n\n\tif (likely(skb)) {\n\t\tdev_kfree_skb_any(skb);\n\t} else {\n\t\tnetdev_err(cp_ring->ndev, \"completion skb is NULL\\n\");\n\t\tret = -EIO;\n\t}\n\n\treturn ret;\n}\n\nstatic u64 xgene_enet_work_msg(struct sk_buff *skb)\n{\n\tstruct net_device *ndev = skb->dev;\n\tstruct xgene_enet_pdata *pdata = netdev_priv(ndev);\n\tstruct iphdr *iph;\n\tu8 l3hlen = 0, l4hlen = 0;\n\tu8 ethhdr, proto = 0, csum_enable = 0;\n\tu64 hopinfo = 0;\n\tu32 hdr_len, mss = 0;\n\tu32 i, len, nr_frags;\n\n\tethhdr = xgene_enet_hdr_len(skb->data);\n\n\tif (unlikely(skb->protocol !", "= htons(ETH_P_IP)) &&\n\t unlikely(skb->protocol !", "= htons(ETH_P_8021Q)))\n\t\tgoto out;\n\n\tif (unlikely(!(skb->dev->features & NETIF_F_IP_CSUM)))\n\t\tgoto out;\n\n\tiph = ip_hdr(skb);\n\tif (unlikely(ip_is_fragment(iph)))\n\t\tgoto out;\n\n\tif (likely(iph->protocol == IPPROTO_TCP)) {\n\t\tl4hlen = tcp_hdrlen(skb) >> 2;\n\t\tcsum_enable = 1;\n\t\tproto = TSO_IPPROTO_TCP;\n\t\tif (ndev->features & NETIF_F_TSO) {\n\t\t\thdr_len = ethhdr + ip_hdrlen(skb) + tcp_hdrlen(skb);\n\t\t\tmss = skb_shinfo(skb)->gso_size;\n\n\t\t\tif (skb_is_nonlinear(skb)) {\n\t\t\t\tlen = skb_headlen(skb);\n\t\t\t\tnr_frags = skb_shinfo(skb)->nr_frags;\n\n\t\t\t\tfor (i = 0; i < 2 && i < nr_frags; i++)\n\t\t\t\t\tlen += skb_shinfo(skb)->frags[i].size;\n\n\t\t\t\t/* HW requires header must reside in 3 buffer */\n\t\t\t\tif (unlikely(hdr_len > len)) {\n\t\t\t\t\tif (skb_linearize(skb))\n\t\t\t\t\t\treturn 0;\n\t\t\t\t}\n\t\t\t}\n\n\t\t\tif (!", "mss || ((skb->len - hdr_len) <= mss))\n\t\t\t\tgoto out;\n\n\t\t\tif (mss !", "= pdata->mss) {\n\t\t\t\tpdata->mss = mss;\n\t\t\t\tpdata->mac_ops->set_mss(pdata);\n\t\t\t}\n\t\t\thopinfo |= SET_BIT(ET);\n\t\t}\n\t} else if (iph->protocol == IPPROTO_UDP) {\n\t\tl4hlen = UDP_HDR_SIZE;\n\t\tcsum_enable = 1;\n\t}\nout:\n\tl3hlen = ip_hdrlen(skb) >> 2;\n\thopinfo |= SET_VAL(TCPHDR, l4hlen) |\n\t\t SET_VAL(IPHDR, l3hlen) |\n\t\t SET_VAL(ETHHDR, ethhdr) |\n\t\t SET_VAL(EC, csum_enable) |\n\t\t SET_VAL(IS, proto) |\n\t\t SET_BIT(IC) |\n\t\t SET_BIT(TYPE_ETH_WORK_MESSAGE);\n\n\treturn hopinfo;\n}\n\nstatic u16 xgene_enet_encode_len(u16 len)\n{\n\treturn (len == BUFLEN_16K) ? ", "0 : len;\n}\n\nstatic void xgene_set_addr_len(__le64 *desc, u32 idx, dma_addr_t addr, u32 len)\n{\n\tdesc[idx ^ 1] = cpu_to_le64(SET_VAL(DATAADDR, addr) |\n\t\t\t\t SET_VAL(BUFDATALEN, len));\n}\n\nstatic __le64 *xgene_enet_get_exp_bufs(struct xgene_enet_desc_ring *ring)\n{\n\t__le64 *exp_bufs;\n\n\texp_bufs = &ring->exp_bufs[ring->exp_buf_tail * MAX_EXP_BUFFS];\n\tmemset(exp_bufs, 0, sizeof(__le64) * MAX_EXP_BUFFS);\n\tring->exp_buf_tail = (ring->exp_buf_tail + 1) & ((ring->slots / 2) - 1);\n\n\treturn exp_bufs;\n}\n\nstatic dma_addr_t *xgene_get_frag_dma_array(struct xgene_enet_desc_ring *ring)\n{\n\treturn &ring->cp_ring->frag_dma_addr[ring->tail * MAX_SKB_FRAGS];\n}\n\nstatic int xgene_enet_setup_tx_desc(struct xgene_enet_desc_ring *tx_ring,\n\t\t\t\t struct sk_buff *skb)\n{\n\tstruct device *dev = ndev_to_dev(tx_ring->ndev);\n\tstruct xgene_enet_pdata *pdata = netdev_priv(tx_ring->ndev);\n\tstruct xgene_enet_raw_desc *raw_desc;\n\t__le64 *exp_desc = NULL, *exp_bufs = NULL;\n\tdma_addr_t dma_addr, pbuf_addr, *frag_dma_addr;\n\tskb_frag_t *frag;\n\tu16 tail = tx_ring->tail;\n\tu64 hopinfo;\n\tu32 len, hw_len;\n\tu8 ll = 0, nv = 0, idx = 0;\n\tbool split = false;\n\tu32 size, offset, ell_bytes = 0;\n\tu32 i, fidx, nr_frags, count = 1;\n\n\traw_desc = &tx_ring->raw_desc[tail];\n\ttail = (tail + 1) & (tx_ring->slots - 1);\n\tmemset(raw_desc, 0, sizeof(struct xgene_enet_raw_desc));\n\n\thopinfo = xgene_enet_work_msg(skb);\n\tif (!", "hopinfo)\n\t\treturn -EINVAL;\n\traw_desc->m3 = cpu_to_le64(SET_VAL(HENQNUM, tx_ring->dst_ring_num) |\n\t\t\t\t hopinfo);\n\n\tlen = skb_headlen(skb);\n\thw_len = xgene_enet_encode_len(len);\n\n\tdma_addr = dma_map_single(dev, skb->data, len, DMA_TO_DEVICE);\n\tif (dma_mapping_error(dev, dma_addr)) {\n\t\tnetdev_err(tx_ring->ndev, \"DMA mapping error\\n\");\n\t\treturn -EINVAL;\n\t}\n\n\t/* Hardware expects descriptor in little endian format */\n\traw_desc->m1 = cpu_to_le64(SET_VAL(DATAADDR, dma_addr) |\n\t\t\t\t SET_VAL(BUFDATALEN, hw_len) |\n\t\t\t\t SET_BIT(COHERENT));\n\n\tif (!", "skb_is_nonlinear(skb))\n\t\tgoto out;\n\n\t/* scatter gather */\n\tnv = 1;\n\texp_desc = (void *)&tx_ring->raw_desc[tail];\n\ttail = (tail + 1) & (tx_ring->slots - 1);\n\tmemset(exp_desc, 0, sizeof(struct xgene_enet_raw_desc));\n\n\tnr_frags = skb_shinfo(skb)->nr_frags;\n\tfor (i = nr_frags; i < 4 ; i++)\n\t\texp_desc[i ^ 1] = cpu_to_le64(LAST_BUFFER);\n\n\tfrag_dma_addr = xgene_get_frag_dma_array(tx_ring);\n\n\tfor (i = 0, fidx = 0; split || (fidx < nr_frags); i++) {\n\t\tif (!", "split) {\n\t\t\tfrag = &skb_shinfo(skb)->frags[fidx];\n\t\t\tsize = skb_frag_size(frag);\n\t\t\toffset = 0;\n\n\t\t\tpbuf_addr = skb_frag_dma_map(dev, frag, 0, size,\n\t\t\t\t\t\t DMA_TO_DEVICE);\n\t\t\tif (dma_mapping_error(dev, pbuf_addr))\n\t\t\t\treturn -EINVAL;\n\n\t\t\tfrag_dma_addr[fidx] = pbuf_addr;\n\t\t\tfidx++;\n\n\t\t\tif (size > BUFLEN_16K)\n\t\t\t\tsplit = true;\n\t\t}\n\n\t\tif (size > BUFLEN_16K) {\n\t\t\tlen = BUFLEN_16K;\n\t\t\tsize -= BUFLEN_16K;\n\t\t} else {\n\t\t\tlen = size;\n\t\t\tsplit = false;\n\t\t}\n\n\t\tdma_addr = pbuf_addr + offset;\n\t\thw_len = xgene_enet_encode_len(len);\n\n\t\tswitch (i) {\n\t\tcase 0:\n\t\tcase 1:\n\t\tcase 2:\n\t\t\txgene_set_addr_len(exp_desc, i, dma_addr, hw_len);\n\t\t\tbreak;\n\t\tcase 3:\n\t\t\tif (split || (fidx !", "= nr_frags)) {\n\t\t\t\texp_bufs = xgene_enet_get_exp_bufs(tx_ring);\n\t\t\t\txgene_set_addr_len(exp_bufs, idx, dma_addr,\n\t\t\t\t\t\t hw_len);\n\t\t\t\tidx++;\n\t\t\t\tell_bytes += len;\n\t\t\t} else {\n\t\t\t\txgene_set_addr_len(exp_desc, i, dma_addr,\n\t\t\t\t\t\t hw_len);\n\t\t\t}\n\t\t\tbreak;\n\t\tdefault:\n\t\t\txgene_set_addr_len(exp_bufs, idx, dma_addr, hw_len);\n\t\t\tidx++;\n\t\t\tell_bytes += len;\n\t\t\tbreak;\n\t\t}\n\n\t\tif (split)\n\t\t\toffset += BUFLEN_16K;\n\t}\n\tcount++;\n\n\tif (idx) {\n\t\tll = 1;\n\t\tdma_addr = dma_map_single(dev, exp_bufs,\n\t\t\t\t\t sizeof(u64) * MAX_EXP_BUFFS,\n\t\t\t\t\t DMA_TO_DEVICE);\n\t\tif (dma_mapping_error(dev, dma_addr)) {\n\t\t\tdev_kfree_skb_any(skb);\n\t\t\treturn -EINVAL;\n\t\t}\n\t\ti = ell_bytes >> LL_BYTES_LSB_LEN;\n\t\texp_desc[2] = cpu_to_le64(SET_VAL(DATAADDR, dma_addr) |\n\t\t\t\t\t SET_VAL(LL_BYTES_MSB, i) |\n\t\t\t\t\t SET_VAL(LL_LEN, idx));\n\t\traw_desc->m2 = cpu_to_le64(SET_VAL(LL_BYTES_LSB, ell_bytes));\n\t}\n\nout:\n\traw_desc->m0 = cpu_to_le64(SET_VAL(LL, ll) | SET_VAL(NV, nv) |\n\t\t\t\t SET_VAL(USERINFO, tx_ring->tail));\n\ttx_ring->cp_ring->cp_skb[tx_ring->tail] = skb;\n\tpdata->tx_level += count;\n\ttx_ring->tail = tail;\n\n\treturn count;\n}\n\nstatic netdev_tx_t xgene_enet_start_xmit(struct sk_buff *skb,\n\t\t\t\t\t struct net_device *ndev)\n{\n\tstruct xgene_enet_pdata *pdata = netdev_priv(ndev);\n\tstruct xgene_enet_desc_ring *tx_ring = pdata->tx_ring;\n\tu32 tx_level = pdata->tx_level;\n\tint count;\n\n\tif (tx_level < pdata->txc_level)\n\t\ttx_level += ((typeof(pdata->tx_level))~0U);\n\n\tif ((tx_level - pdata->txc_level) > pdata->tx_qcnt_hi) {\n\t\tnetif_stop_queue(ndev);\n\t\treturn NETDEV_TX_BUSY;\n\t}\n\n\tif (skb_padto(skb, XGENE_MIN_ENET_FRAME_SIZE))\n\t\treturn NETDEV_TX_OK;\n\n\tcount = xgene_enet_setup_tx_desc(tx_ring, skb);\n\tif (count <= 0) {\n\t\tdev_kfree_skb_any(skb);\n\t\treturn NETDEV_TX_OK;\n\t}\n\n\tskb_tx_timestamp(skb);\n\n\tpdata->stats.tx_packets++;\n\tpdata->stats.tx_bytes += skb->len;\n\n\tpdata->ring_ops->wr_cmd(tx_ring, count);\n\treturn NETDEV_TX_OK;\n}\n\nstatic void xgene_enet_skip_csum(struct sk_buff *skb)\n{\n\tstruct iphdr *iph = ip_hdr(skb);\n\n\tif (!", "ip_is_fragment(iph) ||\n\t (iph->protocol !", "= IPPROTO_TCP && iph->protocol !", "= IPPROTO_UDP)) {\n\t\tskb->ip_summed = CHECKSUM_UNNECESSARY;\n\t}\n}\n\nstatic int xgene_enet_rx_frame(struct xgene_enet_desc_ring *rx_ring,\n\t\t\t struct xgene_enet_raw_desc *raw_desc)\n{\n\tstruct net_device *ndev;\n\tstruct xgene_enet_pdata *pdata;\n\tstruct device *dev;\n\tstruct xgene_enet_desc_ring *buf_pool;\n\tu32 datalen, skb_index;\n\tstruct sk_buff *skb;\n\tu8 status;\n\tint ret = 0;\n\n\tndev = rx_ring->ndev;\n\tpdata = netdev_priv(ndev);\n\tdev = ndev_to_dev(rx_ring->ndev);\n\tbuf_pool = rx_ring->buf_pool;\n\n\tdma_unmap_single(dev, GET_VAL(DATAADDR, le64_to_cpu(raw_desc->m1)),\n\t\t\t XGENE_ENET_MAX_MTU, DMA_FROM_DEVICE);\n\tskb_index = GET_VAL(USERINFO, le64_to_cpu(raw_desc->m0));\n\tskb = buf_pool->rx_skb[skb_index];\n\n\t/* checking for error */\n\tstatus = GET_VAL(LERR, le64_to_cpu(raw_desc->m0));\n\tif (unlikely(status > 2)) {\n\t\tdev_kfree_skb_any(skb);\n\t\txgene_enet_parse_error(rx_ring, netdev_priv(rx_ring->ndev),\n\t\t\t\t status);\n\t\tpdata->stats.rx_dropped++;\n\t\tret = -EIO;\n\t\tgoto out;\n\t}\n\n\t/* strip off CRC as HW isn't doing this */\n\tdatalen = GET_VAL(BUFDATALEN, le64_to_cpu(raw_desc->m1));\n\tdatalen = (datalen & DATALEN_MASK) - 4;\n\tprefetch(skb->data - NET_IP_ALIGN);\n\tskb_put(skb, datalen);\n\n\tskb_checksum_none_assert(skb);\n\tskb->protocol = eth_type_trans(skb, ndev);\n\tif (likely((ndev->features & NETIF_F_IP_CSUM) &&\n\t\t skb->protocol == htons(ETH_P_IP))) {\n\t\txgene_enet_skip_csum(skb);\n\t}\n\n\tpdata->stats.rx_packets++;\n\tpdata->stats.rx_bytes += datalen;\n\tnapi_gro_receive(&rx_ring->napi, skb);\nout:\n\tif (--rx_ring->nbufpool == 0) {\n\t\tret = xgene_enet_refill_bufpool(buf_pool, NUM_BUFPOOL);\n\t\trx_ring->nbufpool = NUM_BUFPOOL;\n\t}\n\n\treturn ret;\n}\n\nstatic bool is_rx_desc(struct xgene_enet_raw_desc *raw_desc)\n{\n\treturn GET_VAL(FPQNUM, le64_to_cpu(raw_desc->m0)) ? ", "true : false;\n}\n\nstatic int xgene_enet_process_ring(struct xgene_enet_desc_ring *ring,\n\t\t\t\t int budget)\n{\n\tstruct xgene_enet_pdata *pdata = netdev_priv(ring->ndev);\n\tstruct xgene_enet_raw_desc *raw_desc, *exp_desc;\n\tu16 head = ring->head;\n\tu16 slots = ring->slots - 1;\n\tint ret, desc_count, count = 0, processed = 0;\n\tbool is_completion;\n\n\tdo {\n\t\traw_desc = &ring->raw_desc[head];\n\t\tdesc_count = 0;\n\t\tis_completion = false;\n\t\texp_desc = NULL;\n\t\tif (unlikely(xgene_enet_is_desc_slot_empty(raw_desc)))\n\t\t\tbreak;\n\n\t\t/* read fpqnum field after dataaddr field */\n\t\tdma_rmb();\n\t\tif (GET_BIT(NV, le64_to_cpu(raw_desc->m0))) {\n\t\t\thead = (head + 1) & slots;\n\t\t\texp_desc = &ring->raw_desc[head];\n\n\t\t\tif (unlikely(xgene_enet_is_desc_slot_empty(exp_desc))) {\n\t\t\t\thead = (head - 1) & slots;\n\t\t\t\tbreak;\n\t\t\t}\n\t\t\tdma_rmb();\n\t\t\tcount++;\n\t\t\tdesc_count++;\n\t\t}\n\t\tif (is_rx_desc(raw_desc)) {\n\t\t\tret = xgene_enet_rx_frame(ring, raw_desc);\n\t\t} else {\n\t\t\tret = xgene_enet_tx_completion(ring, raw_desc);\n\t\t\tis_completion = true;\n\t\t}\n\t\txgene_enet_mark_desc_slot_empty(raw_desc);\n\t\tif (exp_desc)\n\t\t\txgene_enet_mark_desc_slot_empty(exp_desc);\n\n\t\thead = (head + 1) & slots;\n\t\tcount++;\n\t\tdesc_count++;\n\t\tprocessed++;\n\t\tif (is_completion)\n\t\t\tpdata->txc_level += desc_count;\n\n\t\tif (ret)\n\t\t\tbreak;\n\t} while (--budget);\n\n\tif (likely(count)) {\n\t\tpdata->ring_ops->wr_cmd(ring, -count);\n\t\tring->head = head;\n\n\t\tif (netif_queue_stopped(ring->ndev))\n\t\t\tnetif_start_queue(ring->ndev);\n\t}\n\n\treturn processed;\n}\n\nstatic int xgene_enet_napi(struct napi_struct *napi, const int budget)\n{\n\tstruct xgene_enet_desc_ring *ring;\n\tint processed;\n\n\tring = container_of(napi, struct xgene_enet_desc_ring, napi);\n\tprocessed = xgene_enet_process_ring(ring, budget);\n\n\tif (processed !", "= budget) {\n\t\tnapi_complete(napi);\n\t\tenable_irq(ring->irq);\n\t}\n\n\treturn processed;\n}\n\nstatic void xgene_enet_timeout(struct net_device *ndev)\n{\n\tstruct xgene_enet_pdata *pdata = netdev_priv(ndev);\n\n\tpdata->mac_ops->reset(pdata);\n}\n\nstatic int xgene_enet_register_irq(struct net_device *ndev)\n{\n\tstruct xgene_enet_pdata *pdata = netdev_priv(ndev);\n\tstruct device *dev = ndev_to_dev(ndev);\n\tstruct xgene_enet_desc_ring *ring;\n\tint ret;\n\n\tring = pdata->rx_ring;\n\tret = devm_request_irq(dev, ring->irq, xgene_enet_rx_irq,\n\t\t\t IRQF_SHARED, ring->irq_name, ring);\n\tif (ret)\n\t\tnetdev_err(ndev, \"Failed to request irq %s\\n\", ring->irq_name);\n\n\tif (pdata->cq_cnt) {\n\t\tring = pdata->tx_ring->cp_ring;\n\t\tret = devm_request_irq(dev, ring->irq, xgene_enet_rx_irq,\n\t\t\t\t IRQF_SHARED, ring->irq_name, ring);\n\t\tif (ret) {\n\t\t\tnetdev_err(ndev, \"Failed to request irq %s\\n\",\n\t\t\t\t ring->irq_name);\n\t\t}\n\t}\n\n\treturn ret;\n}\n\nstatic void xgene_enet_free_irq(struct net_device *ndev)\n{\n\tstruct xgene_enet_pdata *pdata;\n\tstruct device *dev;\n\n\tpdata = netdev_priv(ndev);\n\tdev = ndev_to_dev(ndev);\n\tdevm_free_irq(dev, pdata->rx_ring->irq, pdata->rx_ring);\n\n\tif (pdata->cq_cnt) {\n\t\tdevm_free_irq(dev, pdata->tx_ring->cp_ring->irq,\n\t\t\t pdata->tx_ring->cp_ring);\n\t}\n}\n\nstatic void xgene_enet_napi_enable(struct xgene_enet_pdata *pdata)\n{\n\tstruct napi_struct *napi;\n\n\tnapi = &pdata->rx_ring->napi;\n\tnapi_enable(napi);\n\n\tif (pdata->cq_cnt) {\n\t\tnapi = &pdata->tx_ring->cp_ring->napi;\n\t\tnapi_enable(napi);\n\t}\n}\n\nstatic void xgene_enet_napi_disable(struct xgene_enet_pdata *pdata)\n{\n\tstruct napi_struct *napi;\n\n\tnapi = &pdata->rx_ring->napi;\n\tnapi_disable(napi);\n\n\tif (pdata->cq_cnt) {\n\t\tnapi = &pdata->tx_ring->cp_ring->napi;\n\t\tnapi_disable(napi);\n\t}\n}\n\nstatic int xgene_enet_open(struct net_device *ndev)\n{\n\tstruct xgene_enet_pdata *pdata = netdev_priv(ndev);\n\tstruct xgene_mac_ops *mac_ops = pdata->mac_ops;\n\tint ret;\n\n\tmac_ops->tx_enable(pdata);\n\tmac_ops->rx_enable(pdata);\n\n\txgene_enet_napi_enable(pdata);\n\tret = xgene_enet_register_irq(ndev);\n\tif (ret)\n\t\treturn ret;\n\n\tif (pdata->phy_mode == PHY_INTERFACE_MODE_RGMII)\n\t\tphy_start(pdata->phy_dev);\n\telse\n\t\tschedule_delayed_work(&pdata->link_work, PHY_POLL_LINK_OFF);\n\n\tnetif_start_queue(ndev);\n\n\treturn ret;\n}\n\nstatic int xgene_enet_close(struct net_device *ndev)\n{\n\tstruct xgene_enet_pdata *pdata = netdev_priv(ndev);\n\tstruct xgene_mac_ops *mac_ops = pdata->mac_ops;\n\n\tnetif_stop_queue(ndev);\n\n\tif (pdata->phy_mode == PHY_INTERFACE_MODE_RGMII)\n\t\tphy_stop(pdata->phy_dev);\n\telse\n\t\tcancel_delayed_work_sync(&pdata->link_work);\n\n\tmac_ops->tx_disable(pdata);\n\tmac_ops->rx_disable(pdata);\n\n\txgene_enet_free_irq(ndev);\n\txgene_enet_napi_disable(pdata);\n\txgene_enet_process_ring(pdata->rx_ring, -1);\n\n\treturn 0;\n}\n\nstatic void xgene_enet_delete_ring(struct xgene_enet_desc_ring *ring)\n{\n\tstruct xgene_enet_pdata *pdata;\n\tstruct device *dev;\n\n\tpdata = netdev_priv(ring->ndev);\n\tdev = ndev_to_dev(ring->ndev);\n\n\tpdata->ring_ops->clear(ring);\n\tdma_free_coherent(dev, ring->size, ring->desc_addr, ring->dma);\n}\n\nstatic void xgene_enet_delete_desc_rings(struct xgene_enet_pdata *pdata)\n{\n\tstruct xgene_enet_desc_ring *buf_pool;\n\n\tif (pdata->tx_ring) {\n\t\txgene_enet_delete_ring(pdata->tx_ring);\n\t\tpdata->tx_ring = NULL;\n\t}\n\n\tif (pdata->rx_ring) {\n\t\tbuf_pool = pdata->rx_ring->buf_pool;\n\t\txgene_enet_delete_bufpool(buf_pool);\n\t\txgene_enet_delete_ring(buf_pool);\n\t\txgene_enet_delete_ring(pdata->rx_ring);\n\t\tpdata->rx_ring = NULL;\n\t}\n}\n\nstatic int xgene_enet_get_ring_size(struct device *dev,\n\t\t\t\t enum xgene_enet_ring_cfgsize cfgsize)\n{\n\tint size = -EINVAL;\n\n\tswitch (cfgsize) {\n\tcase RING_CFGSIZE_512B:\n\t\tsize = 0x200;\n\t\tbreak;\n\tcase RING_CFGSIZE_2KB:\n\t\tsize = 0x800;\n\t\tbreak;\n\tcase RING_CFGSIZE_16KB:\n\t\tsize = 0x4000;\n\t\tbreak;\n\tcase RING_CFGSIZE_64KB:\n\t\tsize = 0x10000;\n\t\tbreak;\n\tcase RING_CFGSIZE_512KB:\n\t\tsize = 0x80000;\n\t\tbreak;\n\tdefault:\n\t\tdev_err(dev, \"Unsupported cfg ring size %d\\n\", cfgsize);\n\t\tbreak;\n\t}\n\n\treturn size;\n}\n\nstatic void xgene_enet_free_desc_ring(struct xgene_enet_desc_ring *ring)\n{\n\tstruct xgene_enet_pdata *pdata;\n\tstruct device *dev;\n\n\tif (!", "ring)\n\t\treturn;\n\n\tdev = ndev_to_dev(ring->ndev);\n\tpdata = netdev_priv(ring->ndev);\n\n\tif (ring->desc_addr) {\n\t\tpdata->ring_ops->clear(ring);\n\t\tdma_free_coherent(dev, ring->size, ring->desc_addr, ring->dma);\n\t}\n\tdevm_kfree(dev, ring);\n}\n\nstatic void xgene_enet_free_desc_rings(struct xgene_enet_pdata *pdata)\n{\n\tstruct device *dev = &pdata->pdev->dev;\n\tstruct xgene_enet_desc_ring *ring;\n\n\tring = pdata->tx_ring;\n\tif (ring) {\n\t\tif (ring->cp_ring && ring->cp_ring->cp_skb)\n\t\t\tdevm_kfree(dev, ring->cp_ring->cp_skb);\n\t\tif (ring->cp_ring && pdata->cq_cnt)\n\t\t\txgene_enet_free_desc_ring(ring->cp_ring);\n\t\txgene_enet_free_desc_ring(ring);\n\t}\n\n\tring = pdata->rx_ring;\n\tif (ring) {\n\t\tif (ring->buf_pool) {\n\t\t\tif (ring->buf_pool->rx_skb)\n\t\t\t\tdevm_kfree(dev, ring->buf_pool->rx_skb);\n\t\t\txgene_enet_free_desc_ring(ring->buf_pool);\n\t\t}\n\t\txgene_enet_free_desc_ring(ring);\n\t}\n}\n\nstatic bool is_irq_mbox_required(struct xgene_enet_pdata *pdata,\n\t\t\t\t struct xgene_enet_desc_ring *ring)\n{\n\tif ((pdata->enet_id == XGENE_ENET2) &&\n\t (xgene_enet_ring_owner(ring->id) == RING_OWNER_CPU)) {\n\t\treturn true;\n\t}\n\n\treturn false;\n}\n\nstatic void __iomem *xgene_enet_ring_cmd_base(struct xgene_enet_pdata *pdata,\n\t\t\t\t\t struct xgene_enet_desc_ring *ring)\n{\n\tu8 num_ring_id_shift = pdata->ring_ops->num_ring_id_shift;\n\n\treturn pdata->ring_cmd_addr + (ring->num << num_ring_id_shift);\n}\n\nstatic struct xgene_enet_desc_ring *xgene_enet_create_desc_ring(\n\t\t\tstruct net_device *ndev, u32 ring_num,\n\t\t\tenum xgene_enet_ring_cfgsize cfgsize, u32 ring_id)\n{\n\tstruct xgene_enet_desc_ring *ring;\n\tstruct xgene_enet_pdata *pdata = netdev_priv(ndev);\n\tstruct device *dev = ndev_to_dev(ndev);\n\tint size;\n\n\tsize = xgene_enet_get_ring_size(dev, cfgsize);\n\tif (size < 0)\n\t\treturn NULL;\n\n\tring = devm_kzalloc(dev, sizeof(struct xgene_enet_desc_ring),\n\t\t\t GFP_KERNEL);\n\tif (!", "ring)\n\t\treturn NULL;\n\n\tring->ndev = ndev;\n\tring->num = ring_num;\n\tring->cfgsize = cfgsize;\n\tring->id = ring_id;\n\n\tring->desc_addr = dma_zalloc_coherent(dev, size, &ring->dma,\n\t\t\t\t\t GFP_KERNEL);\n\tif (!", "ring->desc_addr) {\n\t\tdevm_kfree(dev, ring);\n\t\treturn NULL;\n\t}\n\tring->size = size;\n\n\tif (is_irq_mbox_required(pdata, ring)) {\n\t\tring->irq_mbox_addr = dma_zalloc_coherent(dev, INTR_MBOX_SIZE,\n\t\t\t\t&ring->irq_mbox_dma, GFP_KERNEL);\n\t\tif (!", "ring->irq_mbox_addr) {\n\t\t\tdma_free_coherent(dev, size, ring->desc_addr,\n\t\t\t\t\t ring->dma);\n\t\t\tdevm_kfree(dev, ring);\n\t\t\treturn NULL;\n\t\t}\n\t}\n\n\tring->cmd_base = xgene_enet_ring_cmd_base(pdata, ring);\n\tring->cmd = ring->cmd_base + INC_DEC_CMD_ADDR;\n\tring = pdata->ring_ops->setup(ring);\n\tnetdev_dbg(ndev, \"ring info: num=%d size=%d id=%d slots=%d\\n\",\n\t\t ring->num, ring->size, ring->id, ring->slots);\n\n\treturn ring;\n}\n\nstatic u16 xgene_enet_get_ring_id(enum xgene_ring_owner owner, u8 bufnum)\n{\n\treturn (owner << 6) | (bufnum & GENMASK(5, 0));\n}\n\nstatic enum xgene_ring_owner xgene_derive_ring_owner(struct xgene_enet_pdata *p)\n{\n\tenum xgene_ring_owner owner;\n\n\tif (p->enet_id == XGENE_ENET1) {\n\t\tswitch (p->phy_mode) {\n\t\tcase PHY_INTERFACE_MODE_SGMII:\n\t\t\towner = RING_OWNER_ETH0;\n\t\t\tbreak;\n\t\tdefault:\n\t\t\towner = (!", "p->port_id) ? ", "RING_OWNER_ETH0 :\n\t\t\t\t\t\tRING_OWNER_ETH1;\n\t\t\tbreak;\n\t\t}\n\t} else {\n\t\towner = (!", "p->port_id) ? ", "RING_OWNER_ETH0 : RING_OWNER_ETH1;\n\t}\n\n\treturn owner;\n}\n\nstatic int xgene_enet_create_desc_rings(struct net_device *ndev)\n{\n\tstruct xgene_enet_pdata *pdata = netdev_priv(ndev);\n\tstruct device *dev = ndev_to_dev(ndev);\n\tstruct xgene_enet_desc_ring *rx_ring, *tx_ring, *cp_ring;\n\tstruct xgene_enet_desc_ring *buf_pool = NULL;\n\tenum xgene_ring_owner owner;\n\tdma_addr_t dma_exp_bufs;\n\tu8 cpu_bufnum = pdata->cpu_bufnum;\n\tu8 eth_bufnum = pdata->eth_bufnum;\n\tu8 bp_bufnum = pdata->bp_bufnum;\n\tu16 ring_num = pdata->ring_num;\n\tu16 ring_id;\n\tint ret, size;\n\n\t/* allocate rx descriptor ring */\n\towner = xgene_derive_ring_owner(pdata);\n\tring_id = xgene_enet_get_ring_id(RING_OWNER_CPU, cpu_bufnum++);\n\trx_ring = xgene_enet_create_desc_ring(ndev, ring_num++,\n\t\t\t\t\t RING_CFGSIZE_16KB, ring_id);\n\tif (!", "rx_ring) {\n\t\tret = -ENOMEM;\n\t\tgoto err;\n\t}\n\n\t/* allocate buffer pool for receiving packets */\n\towner = xgene_derive_ring_owner(pdata);\n\tring_id = xgene_enet_get_ring_id(owner, bp_bufnum++);\n\tbuf_pool = xgene_enet_create_desc_ring(ndev, ring_num++,\n\t\t\t\t\t RING_CFGSIZE_2KB, ring_id);\n\tif (!", "buf_pool) {\n\t\tret = -ENOMEM;\n\t\tgoto err;\n\t}\n\n\trx_ring->nbufpool = NUM_BUFPOOL;\n\trx_ring->buf_pool = buf_pool;\n\trx_ring->irq = pdata->rx_irq;\n\tif (!", "pdata->cq_cnt) {\n\t\tsnprintf(rx_ring->irq_name, IRQ_ID_SIZE, \"%s-rx-txc\",\n\t\t\t ndev->name);\n\t} else {\n\t\tsnprintf(rx_ring->irq_name, IRQ_ID_SIZE, \"%s-rx\", ndev->name);\n\t}\n\tbuf_pool->rx_skb = devm_kcalloc(dev, buf_pool->slots,\n\t\t\t\t\tsizeof(struct sk_buff *), GFP_KERNEL);\n\tif (!", "buf_pool->rx_skb) {\n\t\tret = -ENOMEM;\n\t\tgoto err;\n\t}\n\n\tbuf_pool->dst_ring_num = xgene_enet_dst_ring_num(buf_pool);\n\trx_ring->buf_pool = buf_pool;\n\tpdata->rx_ring = rx_ring;\n\n\t/* allocate tx descriptor ring */\n\towner = xgene_derive_ring_owner(pdata);\n\tring_id = xgene_enet_get_ring_id(owner, eth_bufnum++);\n\ttx_ring = xgene_enet_create_desc_ring(ndev, ring_num++,\n\t\t\t\t\t RING_CFGSIZE_16KB, ring_id);\n\tif (!", "tx_ring) {\n\t\tret = -ENOMEM;\n\t\tgoto err;\n\t}\n\n\tsize = (tx_ring->slots / 2) * sizeof(__le64) * MAX_EXP_BUFFS;\n\ttx_ring->exp_bufs = dma_zalloc_coherent(dev, size, &dma_exp_bufs,\n\t\t\t\t\t\tGFP_KERNEL);\n\tif (!", "tx_ring->exp_bufs) {\n\t\tret = -ENOMEM;\n\t\tgoto err;\n\t}\n\n\tpdata->tx_ring = tx_ring;\n\n\tif (!", "pdata->cq_cnt) {\n\t\tcp_ring = pdata->rx_ring;\n\t} else {\n\t\t/* allocate tx completion descriptor ring */\n\t\tring_id = xgene_enet_get_ring_id(RING_OWNER_CPU, cpu_bufnum++);\n\t\tcp_ring = xgene_enet_create_desc_ring(ndev, ring_num++,\n\t\t\t\t\t\t RING_CFGSIZE_16KB,\n\t\t\t\t\t\t ring_id);\n\t\tif (!", "cp_ring) {\n\t\t\tret = -ENOMEM;\n\t\t\tgoto err;\n\t\t}\n\t\tcp_ring->irq = pdata->txc_irq;\n\t\tsnprintf(cp_ring->irq_name, IRQ_ID_SIZE, \"%s-txc\", ndev->name);\n\t}\n\n\tcp_ring->cp_skb = devm_kcalloc(dev, tx_ring->slots,\n\t\t\t\t sizeof(struct sk_buff *), GFP_KERNEL);\n\tif (!", "cp_ring->cp_skb) {\n\t\tret = -ENOMEM;\n\t\tgoto err;\n\t}\n\n\tsize = sizeof(dma_addr_t) * MAX_SKB_FRAGS;\n\tcp_ring->frag_dma_addr = devm_kcalloc(dev, tx_ring->slots,\n\t\t\t\t\t size, GFP_KERNEL);\n\tif (!", "cp_ring->frag_dma_addr) {\n\t\tdevm_kfree(dev, cp_ring->cp_skb);\n\t\tret = -ENOMEM;\n\t\tgoto err;\n\t}\n\n\tpdata->tx_ring->cp_ring = cp_ring;\n\tpdata->tx_ring->dst_ring_num = xgene_enet_dst_ring_num(cp_ring);\n\n\tpdata->tx_qcnt_hi = pdata->tx_ring->slots - 128;\n\n\treturn 0;\n\nerr:\n\txgene_enet_free_desc_rings(pdata);\n\treturn ret;\n}\n\nstatic struct rtnl_link_stats64 *xgene_enet_get_stats64(\n\t\t\tstruct net_device *ndev,\n\t\t\tstruct rtnl_link_stats64 *storage)\n{\n\tstruct xgene_enet_pdata *pdata = netdev_priv(ndev);\n\tstruct rtnl_link_stats64 *stats = &pdata->stats;\n\n\tstats->rx_errors += stats->rx_length_errors +\n\t\t\t stats->rx_crc_errors +\n\t\t\t stats->rx_frame_errors +\n\t\t\t stats->rx_fifo_errors;\n\tmemcpy(storage, &pdata->stats, sizeof(struct rtnl_link_stats64));\n\n\treturn storage;\n}\n\nstatic int xgene_enet_set_mac_address(struct net_device *ndev, void *addr)\n{\n\tstruct xgene_enet_pdata *pdata = netdev_priv(ndev);\n\tint ret;\n\n\tret = eth_mac_addr(ndev, addr);\n\tif (ret)\n\t\treturn ret;\n\tpdata->mac_ops->set_mac_addr(pdata);\n\n\treturn ret;\n}\n\nstatic const struct net_device_ops xgene_ndev_ops = {\n\t.ndo_open = xgene_enet_open,\n\t.ndo_stop = xgene_enet_close,\n\t.ndo_start_xmit = xgene_enet_start_xmit,\n\t.ndo_tx_timeout = xgene_enet_timeout,\n\t.ndo_get_stats64 = xgene_enet_get_stats64,\n\t.ndo_change_mtu = eth_change_mtu,\n\t.ndo_set_mac_address = xgene_enet_set_mac_address,\n};\n\n#ifdef CONFIG_ACPI\nstatic int xgene_get_port_id_acpi(struct device *dev,\n\t\t\t\t struct xgene_enet_pdata *pdata)\n{\n\tacpi_status status;\n\tu64 temp;\n\n\tstatus = acpi_evaluate_integer(ACPI_HANDLE(dev), \"_SUN\", NULL, &temp);\n\tif (ACPI_FAILURE(status)) {\n\t\tpdata->port_id = 0;\n\t} else {\n\t\tpdata->port_id = temp;\n\t}\n\n\treturn 0;\n}\n#endif\n\nstatic int xgene_get_port_id_dt(struct device *dev, struct xgene_enet_pdata *pdata)\n{\n\tu32 id = 0;\n\tint ret;\n\n\tret = of_property_read_u32(dev->of_node, \"port-id\", &id);\n\tif (ret) {\n\t\tpdata->port_id = 0;\n\t\tret = 0;\n\t} else {\n\t\tpdata->port_id = id & BIT(0);\n\t}\n\n\treturn ret;\n}\n\nstatic int xgene_get_tx_delay(struct xgene_enet_pdata *pdata)\n{\n\tstruct device *dev = &pdata->pdev->dev;\n\tint delay, ret;\n\n\tret = of_property_read_u32(dev->of_node, \"tx-delay\", &delay);\n\tif (ret) {\n\t\tpdata->tx_delay = 4;\n\t\treturn 0;\n\t}\n\n\tif (delay < 0 || delay > 7) {\n\t\tdev_err(dev, \"Invalid tx-delay specified\\n\");\n\t\treturn -EINVAL;\n\t}\n\n\tpdata->tx_delay = delay;\n\n\treturn 0;\n}\n\nstatic int xgene_get_rx_delay(struct xgene_enet_pdata *pdata)\n{\n\tstruct device *dev = &pdata->pdev->dev;\n\tint delay, ret;\n\n\tret = of_property_read_u32(dev->of_node, \"rx-delay\", &delay);\n\tif (ret) {\n\t\tpdata->rx_delay = 2;\n\t\treturn 0;\n\t}\n\n\tif (delay < 0 || delay > 7) {\n\t\tdev_err(dev, \"Invalid rx-delay specified\\n\");\n\t\treturn -EINVAL;\n\t}\n\n\tpdata->rx_delay = delay;\n\n\treturn 0;\n}\n\nstatic int xgene_enet_get_resources(struct xgene_enet_pdata *pdata)\n{\n\tstruct platform_device *pdev;\n\tstruct net_device *ndev;\n\tstruct device *dev;\n\tstruct resource *res;\n\tvoid __iomem *base_addr;\n\tu32 offset;\n\tint ret = 0;\n\n\tpdev = pdata->pdev;\n\tdev = &pdev->dev;\n\tndev = pdata->ndev;\n\n\tres = platform_get_resource(pdev, IORESOURCE_MEM, RES_ENET_CSR);\n\tif (!", "res) {\n\t\tdev_err(dev, \"Resource enet_csr not defined\\n\");\n\t\treturn -ENODEV;\n\t}\n\tpdata->base_addr = devm_ioremap(dev, res->start, resource_size(res));\n\tif (!", "pdata->base_addr) {\n\t\tdev_err(dev, \"Unable to retrieve ENET Port CSR region\\n\");\n\t\treturn -ENOMEM;\n\t}\n\n\tres = platform_get_resource(pdev, IORESOURCE_MEM, RES_RING_CSR);\n\tif (!", "res) {\n\t\tdev_err(dev, \"Resource ring_csr not defined\\n\");\n\t\treturn -ENODEV;\n\t}\n\tpdata->ring_csr_addr = devm_ioremap(dev, res->start,\n\t\t\t\t\t\t\tresource_size(res));\n\tif (!", "pdata->ring_csr_addr) {\n\t\tdev_err(dev, \"Unable to retrieve ENET Ring CSR region\\n\");\n\t\treturn -ENOMEM;\n\t}\n\n\tres = platform_get_resource(pdev, IORESOURCE_MEM, RES_RING_CMD);\n\tif (!", "res) {\n\t\tdev_err(dev, \"Resource ring_cmd not defined\\n\");\n\t\treturn -ENODEV;\n\t}\n\tpdata->ring_cmd_addr = devm_ioremap(dev, res->start,\n\t\t\t\t\t\t\tresource_size(res));\n\tif (!", "pdata->ring_cmd_addr) {\n\t\tdev_err(dev, \"Unable to retrieve ENET Ring command region\\n\");\n\t\treturn -ENOMEM;\n\t}\n\n\tif (dev->of_node)\n\t\tret = xgene_get_port_id_dt(dev, pdata);\n#ifdef CONFIG_ACPI\n\telse\n\t\tret = xgene_get_port_id_acpi(dev, pdata);\n#endif\n\tif (ret)\n\t\treturn ret;\n\n\tif (!", "device_get_mac_address(dev, ndev->dev_addr, ETH_ALEN))\n\t\teth_hw_addr_random(ndev);\n\n\tmemcpy(ndev->perm_addr, ndev->dev_addr, ndev->addr_len);\n\n\tpdata->phy_mode = device_get_phy_mode(dev);\n\tif (pdata->phy_mode < 0) {\n\t\tdev_err(dev, \"Unable to get phy-connection-type\\n\");\n\t\treturn pdata->phy_mode;\n\t}\n\tif (pdata->phy_mode !", "= PHY_INTERFACE_MODE_RGMII &&\n\t pdata->phy_mode !", "= PHY_INTERFACE_MODE_SGMII &&\n\t pdata->phy_mode !", "= PHY_INTERFACE_MODE_XGMII) {\n\t\tdev_err(dev, \"Incorrect phy-connection-type specified\\n\");\n\t\treturn -ENODEV;\n\t}\n\n\tret = xgene_get_tx_delay(pdata);\n\tif (ret)\n\t\treturn ret;\n\n\tret = xgene_get_rx_delay(pdata);\n\tif (ret)\n\t\treturn ret;\n\n\tret = platform_get_irq(pdev, 0);\n\tif (ret <= 0) {\n\t\tdev_err(dev, \"Unable to get ENET Rx IRQ\\n\");\n\t\tret = ret ? : ", "-ENXIO;\n\t\treturn ret;\n\t}\n\tpdata->rx_irq = ret;\n\n\tif (pdata->phy_mode !", "= PHY_INTERFACE_MODE_RGMII) {\n\t\tret = platform_get_irq(pdev, 1);\n\t\tif (ret <= 0) {\n\t\t\tpdata->cq_cnt = 0;\n\t\t\tdev_info(dev, \"Unable to get Tx completion IRQ,\"\n\t\t\t\t \"using Rx IRQ instead\\n\");\n\t\t} else {\n\t\t\tpdata->cq_cnt = XGENE_MAX_TXC_RINGS;\n\t\t\tpdata->txc_irq = ret;\n\t\t}\n\t}\n\n\tpdata->clk = devm_clk_get(&pdev->dev, NULL);\n\tif (IS_ERR(pdata->clk)) {\n\t\t/* Firmware may have set up the clock already. */", "\n\t\tdev_info(dev, \"clocks have been setup already\\n\");\n\t}\n\n\tif (pdata->phy_mode !", "= PHY_INTERFACE_MODE_XGMII)\n\t\tbase_addr = pdata->base_addr - (pdata->port_id * MAC_OFFSET);\n\telse\n\t\tbase_addr = pdata->base_addr;\n\tpdata->eth_csr_addr = base_addr + BLOCK_ETH_CSR_OFFSET;\n\tpdata->eth_ring_if_addr = base_addr + BLOCK_ETH_RING_IF_OFFSET;\n\tpdata->eth_diag_csr_addr = base_addr + BLOCK_ETH_DIAG_CSR_OFFSET;\n\tif (pdata->phy_mode == PHY_INTERFACE_MODE_RGMII ||\n\t pdata->phy_mode == PHY_INTERFACE_MODE_SGMII) {\n\t\tpdata->mcx_mac_addr = pdata->base_addr + BLOCK_ETH_MAC_OFFSET;\n\t\toffset = (pdata->enet_id == XGENE_ENET1) ?", "\n\t\t\t BLOCK_ETH_MAC_CSR_OFFSET :\n\t\t\t X2_BLOCK_ETH_MAC_CSR_OFFSET;\n\t\tpdata->mcx_mac_csr_addr = base_addr + offset;\n\t} else {\n\t\tpdata->mcx_mac_addr = base_addr + BLOCK_AXG_MAC_OFFSET;\n\t\tpdata->mcx_mac_csr_addr = base_addr + BLOCK_AXG_MAC_CSR_OFFSET;\n\t}\n\tpdata->rx_buff_cnt = NUM_PKT_BUF;\n\n\treturn 0;\n}\n\nstatic int xgene_enet_init_hw(struct xgene_enet_pdata *pdata)\n{\n\tstruct net_device *ndev = pdata->ndev;\n\tstruct xgene_enet_desc_ring *buf_pool;\n\tu16 dst_ring_num;\n\tint ret;\n\n\tret = pdata->port_ops->reset(pdata);\n\tif (ret)\n\t\treturn ret;\n\n\tret = xgene_enet_create_desc_rings(ndev);\n\tif (ret) {\n\t\tnetdev_err(ndev, \"Error in ring configuration\\n\");\n\t\treturn ret;\n\t}\n\n\t/* setup buffer pool */\n\tbuf_pool = pdata->rx_ring->buf_pool;\n\txgene_enet_init_bufpool(buf_pool);\n\tret = xgene_enet_refill_bufpool(buf_pool, pdata->rx_buff_cnt);\n\tif (ret) {\n\t\txgene_enet_delete_desc_rings(pdata);\n\t\treturn ret;\n\t}\n\n\tdst_ring_num = xgene_enet_dst_ring_num(pdata->rx_ring);\n\tpdata->port_ops->cle_bypass(pdata, dst_ring_num, buf_pool->id);\n\tpdata->mac_ops->init(pdata);\n\n\treturn ret;\n}\n\nstatic void xgene_enet_setup_ops(struct xgene_enet_pdata *pdata)\n{\n\tswitch (pdata->phy_mode) {\n\tcase PHY_INTERFACE_MODE_RGMII:\n\t\tpdata->mac_ops = &xgene_gmac_ops;\n\t\tpdata->port_ops = &xgene_gport_ops;\n\t\tpdata->rm = RM3;\n\t\tbreak;\n\tcase PHY_INTERFACE_MODE_SGMII:\n\t\tpdata->mac_ops = &xgene_sgmac_ops;\n\t\tpdata->port_ops = &xgene_sgport_ops;\n\t\tpdata->rm = RM1;\n\t\tbreak;\n\tdefault:\n\t\tpdata->mac_ops = &xgene_xgmac_ops;\n\t\tpdata->port_ops = &xgene_xgport_ops;\n\t\tpdata->rm = RM0;\n\t\tbreak;\n\t}\n\n\tif (pdata->enet_id == XGENE_ENET1) {\n\t\tswitch (pdata->port_id) {\n\t\tcase 0:\n\t\t\tpdata->cpu_bufnum = START_CPU_BUFNUM_0;\n\t\t\tpdata->eth_bufnum = START_ETH_BUFNUM_0;\n\t\t\tpdata->bp_bufnum = START_BP_BUFNUM_0;\n\t\t\tpdata->ring_num = START_RING_NUM_0;\n\t\t\tbreak;\n\t\tcase 1:\n\t\t\tif (pdata->phy_mode == PHY_INTERFACE_MODE_XGMII) {\n\t\t\t\tpdata->cpu_bufnum = XG_START_CPU_BUFNUM_1;\n\t\t\t\tpdata->eth_bufnum = XG_START_ETH_BUFNUM_1;\n\t\t\t\tpdata->bp_bufnum = XG_START_BP_BUFNUM_1;\n\t\t\t\tpdata->ring_num = XG_START_RING_NUM_1;\n\t\t\t} else {\n\t\t\t\tpdata->cpu_bufnum = START_CPU_BUFNUM_1;\n\t\t\t\tpdata->eth_bufnum = START_ETH_BUFNUM_1;\n\t\t\t\tpdata->bp_bufnum = START_BP_BUFNUM_1;\n\t\t\t\tpdata->ring_num = START_RING_NUM_1;\n\t\t\t}\n\t\t\tbreak;\n\t\tdefault:\n\t\t\tbreak;\n\t\t}\n\t\tpdata->ring_ops = &xgene_ring1_ops;\n\t} else {\n\t\tswitch (pdata->port_id) {\n\t\tcase 0:\n\t\t\tpdata->cpu_bufnum = X2_START_CPU_BUFNUM_0;\n\t\t\tpdata->eth_bufnum = X2_START_ETH_BUFNUM_0;\n\t\t\tpdata->bp_bufnum = X2_START_BP_BUFNUM_0;\n\t\t\tpdata->ring_num = X2_START_RING_NUM_0;\n\t\t\tbreak;\n\t\tcase 1:\n\t\t\tpdata->cpu_bufnum = X2_START_CPU_BUFNUM_1;\n\t\t\tpdata->eth_bufnum = X2_START_ETH_BUFNUM_1;\n\t\t\tpdata->bp_bufnum = X2_START_BP_BUFNUM_1;\n\t\t\tpdata->ring_num = X2_START_RING_NUM_1;\n\t\t\tbreak;\n\t\tdefault:\n\t\t\tbreak;\n\t\t}\n\t\tpdata->rm = RM0;\n\t\tpdata->ring_ops = &xgene_ring2_ops;\n\t}\n}\n\nstatic void xgene_enet_napi_add(struct xgene_enet_pdata *pdata)\n{\n\tstruct napi_struct *napi;\n\n\tnapi = &pdata->rx_ring->napi;\n\tnetif_napi_add(pdata->ndev, napi, xgene_enet_napi, NAPI_POLL_WEIGHT);\n\n\tif (pdata->cq_cnt) {\n\t\tnapi = &pdata->tx_ring->cp_ring->napi;\n\t\tnetif_napi_add(pdata->ndev, napi, xgene_enet_napi,\n\t\t\t NAPI_POLL_WEIGHT);\n\t}\n}\n\nstatic void xgene_enet_napi_del(struct xgene_enet_pdata *pdata)\n{\n\tstruct napi_struct *napi;\n\n\tnapi = &pdata->rx_ring->napi;\n\tnetif_napi_del(napi);\n\n\tif (pdata->cq_cnt) {\n\t\tnapi = &pdata->tx_ring->cp_ring->napi;\n\t\tnetif_napi_del(napi);\n\t}\n}\n\nstatic int xgene_enet_probe(struct platform_device *pdev)\n{\n\tstruct net_device *ndev;\n\tstruct xgene_enet_pdata *pdata;\n\tstruct device *dev = &pdev->dev;\n\tstruct xgene_mac_ops *mac_ops;\n\tconst struct of_device_id *of_id;\n\tint ret;\n\n\tndev = alloc_etherdev(sizeof(struct xgene_enet_pdata));\n\tif (!", "ndev)\n\t\treturn -ENOMEM;\n\n\tpdata = netdev_priv(ndev);\n\n\tpdata->pdev = pdev;\n\tpdata->ndev = ndev;\n\tSET_NETDEV_DEV(ndev, dev);\n\tplatform_set_drvdata(pdev, pdata);\n\tndev->netdev_ops = &xgene_ndev_ops;\n\txgene_enet_set_ethtool_ops(ndev);\n\tndev->features |= NETIF_F_IP_CSUM |\n\t\t\t NETIF_F_GSO |\n\t\t\t NETIF_F_GRO |\n\t\t\t NETIF_F_SG;\n\n\tof_id = of_match_device(xgene_enet_of_match, &pdev->dev);\n\tif (of_id) {\n\t\tpdata->enet_id = (enum xgene_enet_id)of_id->data;\n\t}\n#ifdef CONFIG_ACPI\n\telse {\n\t\tconst struct acpi_device_id *acpi_id;\n\n\t\tacpi_id = acpi_match_device(xgene_enet_acpi_match, &pdev->dev);\n\t\tif (acpi_id)\n\t\t\tpdata->enet_id = (enum xgene_enet_id) acpi_id->driver_data;\n\t}\n#endif\n\tif (!", "pdata->enet_id) {\n\t\tfree_netdev(ndev);\n\t\treturn -ENODEV;\n\t}\n\n\tret = xgene_enet_get_resources(pdata);\n\tif (ret)\n\t\tgoto err;\n\n\txgene_enet_setup_ops(pdata);\n\n\tif (pdata->phy_mode == PHY_INTERFACE_MODE_XGMII) {\n\t\tndev->features |= NETIF_F_TSO;\n\t\tpdata->mss = XGENE_ENET_MSS;\n\t}\n\tndev->hw_features = ndev->features;\n\n\tret = dma_coerce_mask_and_coherent(dev, DMA_BIT_MASK(64));\n\tif (ret) {\n\t\tnetdev_err(ndev, \"No usable DMA configuration\\n\");\n\t\tgoto err;\n\t}\n\n\tret = register_netdev(ndev);\n\tif (ret) {\n\t\tnetdev_err(ndev, \"Failed to register netdev\\n\");\n\t\tgoto err;\n\t}\n\n\tret = xgene_enet_init_hw(pdata);\n\tif (ret)\n\t\tgoto err;\n\n\tmac_ops = pdata->mac_ops;\n\tif (pdata->phy_mode == PHY_INTERFACE_MODE_RGMII) {\n\t\tret = xgene_enet_mdio_config(pdata);\n\t\tif (ret)\n\t\t\tgoto err;\n\t} else {\n\t\tINIT_DELAYED_WORK(&pdata->link_work, mac_ops->link_state);\n\t}\n\n\txgene_enet_napi_add(pdata);\n\treturn 0;\nerr:\n\tunregister_netdev(ndev);\n\tfree_netdev(ndev);\n\treturn ret;\n}\n\nstatic int xgene_enet_remove(struct platform_device *pdev)\n{\n\tstruct xgene_enet_pdata *pdata;\n\tstruct xgene_mac_ops *mac_ops;\n\tstruct net_device *ndev;\n\n\tpdata = platform_get_drvdata(pdev);\n\tmac_ops = pdata->mac_ops;\n\tndev = pdata->ndev;\n\n\tmac_ops->rx_disable(pdata);\n\tmac_ops->tx_disable(pdata);\n\n\txgene_enet_napi_del(pdata);\n\tif (pdata->phy_mode == PHY_INTERFACE_MODE_RGMII)\n\t\txgene_enet_mdio_remove(pdata);\n\tunregister_netdev(ndev);\n\txgene_enet_delete_desc_rings(pdata);\n\tpdata->port_ops->shutdown(pdata);\n\tfree_netdev(ndev);\n\n\treturn 0;\n}\n\n#ifdef CONFIG_ACPI\nstatic const struct acpi_device_id xgene_enet_acpi_match[] = {\n\t{ \"APMC0D05\", XGENE_ENET1},\n\t{ \"APMC0D30\", XGENE_ENET1},\n\t{ \"APMC0D31\", XGENE_ENET1},\n\t{ \"APMC0D3F\", XGENE_ENET1},\n\t{ \"APMC0D26\", XGENE_ENET2},\n\t{ \"APMC0D25\", XGENE_ENET2},\n\t{ }\n};\nMODULE_DEVICE_TABLE(acpi, xgene_enet_acpi_match);\n#endif\n\n#ifdef CONFIG_OF\nstatic const struct of_device_id xgene_enet_of_match[] = {\n\t{.compatible = \"apm,xgene-enet\", .data = (void *)XGENE_ENET1},\n\t{.compatible = \"apm,xgene1-sgenet\", .data = (void *)XGENE_ENET1},\n\t{.compatible = \"apm,xgene1-xgenet\", .data = (void *)XGENE_ENET1},\n\t{.compatible = \"apm,xgene2-sgenet\", .data = (void *)XGENE_ENET2},\n\t{.compatible = \"apm,xgene2-xgenet\", .data = (void *)XGENE_ENET2},\n\t{},\n};\n\nMODULE_DEVICE_TABLE(of, xgene_enet_of_match);\n#endif\n\nstatic struct platform_driver xgene_enet_driver = {\n\t.driver = {\n\t\t .name = \"xgene-enet\",\n\t\t .of_match_table = of_match_ptr(xgene_enet_of_match),\n\t\t .acpi_match_table = ACPI_PTR(xgene_enet_acpi_match),\n\t},\n\t.probe = xgene_enet_probe,\n\t.remove = xgene_enet_remove,\n};\n\nmodule_platform_driver(xgene_enet_driver);\n\nMODULE_DESCRIPTION(\"APM X-Gene SoC Ethernet driver\");\nMODULE_VERSION(XGENE_DRV_VERSION);\nMODULE_AUTHOR(\"Iyappan Subramanian <isubramanian@apm.com>\");\nMODULE_AUTHOR(\"Keyur Chudgar <kchudgar@apm.com>\");\nMODULE_LICENSE(\"GPL\");\n" ]

{ "pile_set_name": "Github" }

[ 0.016129032258064516, 0, 0.01818181818181818, 0, 0.022727272727272728, 0.003216911764705882, 0.004168403501458941, 0, 0.007751937984496124, 0.015384615384615385, 0.0055658627087198514, 0.005801305293691081, 0.0018315018315018315, 0.00663716814159292, 0, 0.008076728924785462, 0, 0.03125, 0.005701254275940707, 0.005777007510109763, 0.006350757205666829, 0.004359673024523161, 0.014634146341463415, 0.01276595744680851, 0.004895960832313341, 0, 0.012987012987012988, 0, 0.007556675062972292, 0.02040816326530612, 0.006802721088435374, 0, 0.012254901960784314, 0.010050251256281407, 0.011363636363636364, 0.006993006993006993, 0.007751937984496124, 0.010416666666666666, 0.005844155844155844, 0, 0.011428571428571429, 0, 0.00558659217877095, 0, 0.007168458781362007, 0, 0.019230769230769232, 0, 0.005797101449275362, 0, 0.007556675062972292, 0, 0, 0.0037705359547535685, 0.013215859030837005, 0.006725663716814159 ]

[ "The overall theme of this proposal is the correlation of structural features of Class II molecules with their role in cell surface expression of Ia. The approach chosen is the molecular and functional analysis of Class II mutant B lymphoma cell lines produced by immunoselection on the basis of cell-surface expression or the transfection of in situ mutagenized Class II genes into Ia-negative B lymphoma cells or into non-lymphoid cells. ", "Ia variant cell lines which have structural defects which result in the complete lack of expression of cell surface Ia despite the presence of intracytoplasmic Ia polypeptides will be used to identify sites in the Class II genes key for post-transcriptional and post-translational regulation of Class II gene expression. ", "These cell lines will be analyzed by two dimensional gel electrophoresis, immunoelectronmicroscopy and DNA sequencing of the relevant mutant gene. ", "Site-directed mutagenesis and recombinant DNA technology will be used to produce Class II molecules which have truncated cytoplasmic regions. ", "These tailless mutants will be used to examine the role of the cytoplasmic domain of the Ia in chain-pairing, assembly, transport, association with invariant chain and transmembrane signalling. ", "The role of the invariant chain in cell surface expression of Ia will be examined by the production and analysis of invariant chain molecules with truncated cytoplasmic and transmembrane regions by site directed mutagenesis to determine whether the targeting and transport of Ii affects the transport and expression of Ia. Exon- shuffling experiments between the Ii gene and the Class I Q10 gene will be performed to map the sites on Ii which mediate the contact between Ii and Ia. The central theme of this proposal, therefore, is the identification, by a mutational approach, of structural features of Class II genes including the Ii gene which affect the expression of these proteins at the post-translational level." ]

{ "pile_set_name": "NIH ExPorter" }

[ 0, 0, 0, 0, 0, 0.0013908205841446453 ]

[ "Pilot study analyzing automated ECG screening of hypertrophic cardiomyopathy.", "\nHypertrophic cardiomyopathy (HCM) is one of the leading causes of sudden cardiac death in athletes. ", "However, preparticipation ECG screening has often been criticized for failing to meet cost-effectiveness thresholds, in part because of high false-positive rates and the cost of ECG screening itself. ", "The purpose of this study was to assess the testing characteristics of an automated ECG algorithm designed to screen for HCM in a multi-institutional pediatric cohort. ", "ECGs from patients with HCM aged 12 to 20 years from 3 pediatric institutions were screened for ECG criteria for HCM using a previously described automated computer algorithm developed specifically for HCM ECG screening. ", "The results were compared to a known healthy pediatric cohort. ", "The studies then were read by trained electrophysiologists using standard ECG criteria and compared to the results of automated screening. ", "One hundred twenty-eight ECGs from unique patients with phenotypic HCM were obtained and compared with 256 studies from healthy control patients matched in 2:1 fashion. ", "When presented with the ECGs, the non-voltage-based algorithm resulted in 81.2% sensitivity and 90.7% specificity. ", "A trained electrophysiologist read the same data according to the Seattle Criteria, with 71% sensitivity with 95.7% specificity. ", "The sensitivity of screening as well as the components of the ECG screening itself varied by institution. ", "This pilot study demonstrates a potential for automated ECG screening algorithms to detect HCM with testing characteristics similar to that of a trained electrophysiologist. ", "In addition, there appear to be differences in ECG characteristics between patient populations, which may account for the difficulties in universal screening." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.012987012987012988, 0.009900990099009901, 0.01, 0.011904761904761904, 0.01809954751131222, 0, 0.007194244604316547, 0.005917159763313609, 0, 0.007751937984496124, 0.009433962264150943, 0.011494252873563218, 0.006329113924050633 ]

[ "We’re only two months into 2020, but readers are already going through books. ", "Over on Goodreads, they’ve already put together a list for sci-fi and fantasy readers of the top 10 most popular and most anticipated books for the first quarter of 2020. ", "What have been your favorite books this year and what books are you most excited to read?", "\n\nHouse of Earth and Blood by Sarah J. Maas" ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0.011695906432748537, 0, 0.046511627906976744 ]

[ "Read Ethan Bronner’s story on Jerusalem in the Times:\n\nMr. Netanyahu’s governing coalition… views Jerusalem, west and east, as the undivided, eternal capital of the Jewish people, where it can build where it wants. ", "The Palestinians and their supporters throughout the Arab and Muslim worlds view East Jerusalem as holy and as rightfully under Palestinian sovereignty.", "\n\nHe ignores the fact that international law is unified in the assertion that Jerusalem does not belong to Israel, but puts an Orientalist spin on it: he points out that Arab and Muslim world regard Jerusalem as holy, which of course is not inaccurate but is only part of the story.", "\n\nIf I had time, I could come up with a good analogy. ", "But it’s biased. ", "And you know it’s painful to have to read this. ", "It’s leaving out the fact that the reader’s own government and every government in the world regards the East Jerusalem occupation as violating the law. ", "It’s unbelievable. ", "And I can’t believe the foreign editor or whoever edited this didn’t recognize this.", "\n\nIsn’t that the first thing you learn about when you learn about the settlements? ", "The boilerplate expression should be: Israel claims a right to all of Jerusalem. ", "The rest of the world, including the United States, regards the annexation of Jerusalem as illegal and the settlements as illegal.", "\n\nThis is what the current argument is about, this is what the flap in Washington was about, and Bronner is not pointing out the true facts. ", "The average reader is duped. ", "It just reinforces the idea that there are two mystical groups there, fighting over a holy city.", "\n\nUpdate from sitemaster: Holy smoke, Bronner himself accepted this point, in a letter to Partners for Peace, five years ago when he was a foreign editor:" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.013953488372093023, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0070921985815602835, 0, 0, 0.006493506493506494 ]

[ "City Gets its Due Sex Tax Machine Introduced for Bonn Prostitutes\n\nProstitution is a legal and taxable trade in Germany, but enforcing taxes among sex workers on the street can be problematic. ", "The city of Bonn has come up with a new solution, though. ", "Prostitutes must now pay a nightly tax to automated ticket machines." ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0 ]

[ "\n46 So.3d 32 (2009)\nAL JOSEPH FELDER, SR.", "\nv.\nCITY OF MONTGOMERY POLICE DEP'T ET AL.", "\nNo. ", "2080416.", "\nCourt of Civil Appeals of Alabama.", "\nMarch 26, 2009.", "\n\nDECISION WITHOUT PUBLISHED OPINION\nDismissed for lack of prosecution.", "\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.024390243902439025, 0, 0, 0, 0, 0, 0, 0 ]

[ "Prosecutors get extension in Rita Crundwell case\n\nDIXON — Federal prosecutors have an extra 30 days to respond to former Dixon comptroller Rita Crundwell's appeal of her nearly 20-year prison sentence.", "\n\nDIXON — Federal prosecutors have an extra 30 days to respond to former Dixon comptroller Rita Crundwell's appeal of her nearly 20-year prison sentence.", "\n\nCrundwell appealed the sentence on July 10. ", "The Telegraph in Dixon reports that US Attorney Joseph Pederson requested the extension last week citing a heavy caseload. ", "Crundwell's attorney, Paul Gaziano, did not object.", "\n\nCrundwell was sentenced in February after pleading guilty to stealing nearly $54 million from the northern Illinois city. ", "She is serving her sentence in a Minnesota federal prison. ", "Her release date is March 5, 2030.", "\n\nProsecutors' response to Crundwell's appeal is now due by Sept. 9. ", "Crundwell's attorney has until Sept. 23 for further arguments." ]

{ "pile_set_name": "Pile-CC" }

[ 0.014925373134328358, 0.013071895424836602, 0.021739130434782608, 0.016260162601626018, 0.0392156862745098, 0.008064516129032258, 0, 0, 0.014492753623188406, 0.016129032258064516 ]

[ "<!", "DOCTYPE html>\n<html lang=\"en\">\n <head>\n <title>AnyAsyncAction Protocol Reference</title>\n <link rel=\"stylesheet\" type=\"text/css\" href=\"../css/jazzy.css\" />\n <link rel=\"stylesheet\" type=\"text/css\" href=\"../css/highlight.css\" />\n <meta charset='utf-8'>\n <script src=\"../js/jquery.min.js\" defer></script>\n <script src=\"../js/jazzy.js\" defer></script>\n \n </head>\n <body>\n <a name=\"//apple_ref/swift/Protocol/AnyAsyncAction\" class=\"dashAnchor\"></a>\n <a title=\"AnyAsyncAction Protocol Reference\"></a>\n <header>\n <div class=\"content-wrapper\">\n <p><a href=\"../index.html\">Katana Docs</a> (99% documented)</p>\n <p class=\"header-right\"><a href=\"https://github.com/BendingSpoons/katana-swift\"><img src=\"../img/gh.png\"/>View on GitHub</a></p>\n </div>\n </header>\n <div class=\"content-wrapper\">\n <p id=\"breadcrumbs\">\n <a href=\"../index.html\">Katana Reference</a>\n <img id=\"carat\" src=\"../img/carat.png\" />\n AnyAsyncAction Protocol Reference\n </p>\n </div>\n <div class=\"content-wrapper\">\n <nav class=\"sidebar\">\n <ul class=\"nav-groups\">\n <li class=\"nav-group-name\">\n <a href=\"../Classes.html\">Classes</a>\n <ul class=\"nav-group-tasks\">\n <li class=\"nav-group-task\">\n <a href=\"../Classes/EmptySideEffectDependencyContainer.html\">EmptySideEffectDependencyContainer</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Classes/Node.html\">Node</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Classes/PlasticNode.html\">PlasticNode</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Classes/PlasticView.html\">PlasticView</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Classes/Renderer.html\">Renderer</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Classes/StateMockProvider.html\">StateMockProvider</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Classes/Store.html\">Store</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Classes/ViewsContainer.html\">ViewsContainer</a>\n </li>\n </ul>\n </li>\n <li class=\"nav-group-name\">\n <a href=\"../Enums.html\">Enums</a>\n <ul class=\"nav-group-tasks\">\n <li class=\"nav-group-task\">\n <a href=\"../Enums/AnimationType.html\">AnimationType</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Enums/AsyncActionState.html\">AsyncActionState</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Enums.html#/s:O6Katana9EmptyKeys\">EmptyKeys</a>\n </li>\n </ul>\n </li>\n <li class=\"nav-group-name\">\n <a href=\"../Extensions.html\">Extensions</a>\n <ul class=\"nav-group-tasks\">\n <li class=\"nav-group-task\">\n <a href=\"../Extensions/Array.html\">Array</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Extensions/CGSize.html\">CGSize</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Extensions/UIView.html\">UIView</a>\n </li>\n </ul>\n </li>\n <li class=\"nav-group-name\">\n <a href=\"../Protocols.html\">Protocols</a>\n <ul class=\"nav-group-tasks\">\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/Action.html\">Action</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/ActionWithSideEffect.html\">ActionWithSideEffect</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/AnyAsyncAction.html\">AnyAsyncAction</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/AnyConnectedNodeDescription.html\">AnyConnectedNodeDescription</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/AnyNode.html\">AnyNode</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/AnyNodeDescription.html\">AnyNodeDescription</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/AnyNodeDescriptionProps.html\">AnyNodeDescriptionProps</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/AnyNodeDescriptionWithChildren.html\">AnyNodeDescriptionWithChildren</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/AnyNodeDescriptionWithRefProps.html\">AnyNodeDescriptionWithRefProps</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/AnyPlasticNodeDescription.html\">AnyPlasticNodeDescription</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/AnyPlatformNativeViewWithRef.html\">AnyPlatformNativeViewWithRef</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/AnyStore.html\">AnyStore</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/AsyncAction.html\">AsyncAction</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/Childrenable.html\">Childrenable</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/ConnectedNodeDescription.html\">ConnectedNodeDescription</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/LinkeableAction.html\">LinkeableAction</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/NativeViewRef.html\">NativeViewRef</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/NativeViewWithRef.html\">NativeViewWithRef</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/NodeDescription.html\">NodeDescription</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/NodeDescriptionProps.html\">NodeDescriptionProps</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/NodeDescriptionState.html\">NodeDescriptionState</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/NodeDescriptionWithChildren.html\">NodeDescriptionWithChildren</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols.html#/s:P6Katana22NodeDescriptionWithRef\">NodeDescriptionWithRef</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/NodeDescriptionWithRefProps.html\">NodeDescriptionWithRefProps</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/PlasticNodeDescription.html\">PlasticNodeDescription</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/PlasticReferenceSizeable.html\">PlasticReferenceSizeable</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/PlatformNativeView.html\">PlatformNativeView</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/SideEffectDependencyContainer.html\">SideEffectDependencyContainer</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Protocols/State.html\">State</a>\n </li>\n </ul>\n </li>\n <li class=\"nav-group-name\">\n <a href=\"../Structs.html\">Structs</a>\n <ul class=\"nav-group-tasks\">\n <li class=\"nav-group-task\">\n <a href=\"../Structs/ActionLinker.html\">ActionLinker</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Structs/ActionLinks.html\">ActionLinks</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Structs/Anchor.html\">Anchor</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Structs/Anchor/Kind.html\">– Kind</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Structs/Animation.html\">Animation</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Structs/AnimationContainer.html\">AnimationContainer</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Structs/AnimationOptions.html\">AnimationOptions</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Structs/AnimationProps.html\">AnimationProps</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Structs/ChildrenAnimations.html\">ChildrenAnimations</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Structs/EdgeInsets.html\">EdgeInsets</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Structs/EmptyProps.html\">EmptyProps</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Structs/EmptyState.html\">EmptyState</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Structs/Size.html\">Size</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Structs/Value.html\">Value</a>\n </li>\n </ul>\n </li>\n <li class=\"nav-group-name\">\n <a href=\"../Typealiases.html\">Typealiases</a>\n <ul class=\"nav-group-tasks\">\n <li class=\"nav-group-task\">\n <a href=\"../Typealiases.html#/s:6Katana25AnimationPropsTransformer\">AnimationPropsTransformer</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Typealiases.html#/s:6Katana21AnyRefCallbackClosure\">AnyRefCallbackClosure</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Typealiases.html#/s:6Katana20NodeUpdateCompletion\">NodeUpdateCompletion</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Typealiases.html#/s:6Katana18RefCallbackClosure\">RefCallbackClosure</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Typealiases.html#/s:6Katana13StoreDispatch\">StoreDispatch</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Typealiases.html#/s:6Katana13StoreListener\">StoreListener</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Typealiases.html#/s:6Katana15StoreMiddleware\">StoreMiddleware</a>\n </li>\n <li class=\"nav-group-task\">\n <a href=\"../Typealiases.html#/s:6Katana16StoreUnsubscribe\">StoreUnsubscribe</a>\n </li>\n </ul>\n </li>\n <li class=\"nav-group-name\">\n <a href=\"../Associated Types.html\">Associated Types</a>\n <ul class=\"nav-group-tasks\">\n <li class=\"nav-group-task\">\n <a href=\"../Associated Types.html#/s:P6Katana27NodeDescriptionWithChildren9PropsType\">PropsType</a>\n </li>\n </ul>\n </li>\n </ul>\n </nav>\n <article class=\"main-content\">\n <section>\n <section class=\"section\">\n <h1>AnyAsyncAction</h1>\n <div class=\"declaration\">\n <div class=\"language\">\n <pre class=\"highlight\"><code><span class=\"kd\">public</span> <span class=\"kd\">protocol</span> <span class=\"kt\">AnyAsyncAction</span></code></pre>\n\n </div>\n </div>\n <p>Type Erasure for <code><a href=\"../Protocols/AsyncAction.html\">AsyncAction</a></code></p>\n\n </section>\n <section class=\"section task-group-section\">\n <div class=\"task-group\">\n <ul>\n <li class=\"item\">\n <div>\n <code>\n <a name=\"/s:vP6Katana14AnyAsyncAction5stateOS_16AsyncActionState\"></a>\n <a name=\"//apple_ref/swift/Property/state\" class=\"dashAnchor\"></a>\n <a class=\"token\" href=\"#/s:vP6Katana14AnyAsyncAction5stateOS_16AsyncActionState\">state</a>\n </code>\n </div>\n <div class=\"height-container\">\n <div class=\"pointer-container\"></div>\n <section class=\"section\">\n <div class=\"pointer\"></div>\n <div class=\"abstract\">\n <p>The state of the action</p>\n\n </div>\n <div class=\"declaration\">\n <h4>Declaration</h4>\n <div class=\"language\">\n <p class=\"aside-title\">Swift</p>\n <pre class=\"highlight\"><code><span class=\"k\">var</span> <span class=\"nv\">state</span><span class=\"p\">:</span> <span class=\"kt\"><a href=\"../Enums/AsyncActionState.html\">AsyncActionState</a></span></code></pre>\n\n </div>\n </div>\n <div class=\"slightly-smaller\">\n <a href=\"https://github.com/BendingSpoons/katana-swift/tree/0.8.7/Katana/Store/AsyncAction.swift#L61\">Show on GitHub</a>\n </div>\n </section>\n </div>\n </li>\n </ul>\n </div>\n </section>\n </section>\n <section id=\"footer\">\n <p>&copy; 2017 <a class=\"link\" href=\"http://bendingspoons.com\" target=\"_blank\" rel=\"external\">Bending Spoons Team</a>. ", "All rights reserved. (", "Last updated: 2017-07-18)</p>\n <p>Generated by <a class=\"link\" href=\"https://github.com/realm/jazzy\" target=\"_blank\" rel=\"external\">jazzy ♪♫ v0.7.4</a>, a <a class=\"link\" href=\"http://realm.io\" target=\"_blank\" rel=\"external\">Realm</a> project.</p>\n </section>\n </article>\n </div>\n </body>\n</div>\n</html>\n" ]

{ "pile_set_name": "Github" }

[ 0, 0.0006275712990725891, 0, 0.0121580547112462 ]

[ "Free radicals in exhaustive physical exercise: mechanism of production, and protection by antioxidants.", "\nModerate exercise is a healthy practice. ", "However, exhaustive exercise generates free radicals. ", "This can be evidenced by increases in lipid peroxidation, glutathione oxidation, and oxidative protein damage. ", "It is well known that activity of cytosolic enzymes in blood plasma is increased after exhaustive exercise. ", "This may be taken as a sign of damage to muscle cells. ", "The degree of oxidative stress and of muscle damage does not depend on the absolute intensity of exercise but on the degree of exhaustion of the person who performs exercise. ", "Training partially prevents free radical-formation in exhaustive exercise. ", "Treatment with antioxidants such as vitamins C or E protects in part against free radical-mediated damage in exercise. ", "Xanthine oxidase is involved in free-radical formation in exercise in humans and inhibition of this enzyme with allopurinol decreases oxidative stress and muscle damage associated with exhaustive exercise. ", "Knowledge of the mechanism of free-radical formation in exercise is important because it will be useful to prevent oxidative stress and damage associated with exhaustive physical activity." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Introduction {#s1}\n============\n\nAs of the recent improvement in living standard of contemporary man the consumer preference has been changed to health-conscious menu, considered both taste and quality, from existing quantitative aspect, so the consumption demand of high quality meat has shown the tendency of increase. ", "Tenderness is the most importantly considered item in quality evaluation of meat quality by domestic as well as overseas consumers. ", "To improve tenderness there are number of ways such as temperature treatment of carcass, electrical stimulation, suspension method and adding Tenderizer ([@r001]; [@r011]; [@r017]). ", "For adding tenderizer the vegetable proteolytic enzymes, extracted from natural vegetables are widely used as of its safety and handiness ([@r005]).", "\n\nTo apply proteolytic enzyme as a tenderizer mainly tropical fruits, such as papaya (papain), pineapple (bromelain), kiwi (actinidin) and fig (ficin) have been used ([@r003]; [@r013]; [@r015]). ", "Also edible mushrooms have recently been reported as a healthy food and as a source of proteolytic enzymes. ", "Those edible mushrooms used as a meat tenderizer are *Letinus edodes, Agaricus bisporus, Sarcodon aspratus* and so on ([@r004]; [@r016]; [@r029]). *", "Sarcodon aspratus* is an edible mushroom with pileus diameter of 15-20 cm, reseeded in the mountain side of humus soil rich broad-leaved forest in Korea and Japan.", "\n\nIn Korea traditionally it has been used as a single-medicine prescription for stomach-upset caused by meat. ", "Also its various bioactive functions have been come to right by scientific research results ([@r014]; [@r020]; [@r025]). ", "It is a healthy functional food in accordance with healthy food menu, recently the most keen-interest of consumers. ", "As *Sarcodon aspratus* is known by its superior proteolytic effect, in this study, the possibility of its utilization and development as a tenderizer for beef has been appraised.", "\n\nTherefore, we examined the effects of aqueous extract from *Sarcodon aspratus* on tenderization of the bovine *longissimus dorsi* muscles in comparison with commercial proteolytic enzymes. ", "Furthermore, meat quality and muscle protein degradation were examined.", "\n\nMaterials and Methods {#s2}\n=====================\n\nPreparation of samples {#s2a}\n----------------------\n\nThe bovine *longissimus dorsi* muscles were obtained from a selected retail shop. ", "Dried *Sarcodon aspratus* was collected from a retail mushroom market. ", "Kiwi (New Zealand) were obtained retail market, and papain enzyme powder obtained from a standard supplier (76220, Sigma-Aldrich Co., USA). ", "We marinated meat with 2% *Sarcodon aspratus* extract, 2% kiwi extract, and 0.2% papain. ", "Beef chunks (3×3×3 cm^3^) were marinated with distilled water (control), *Sarcodon aspratus* extract (T1), kiwi extract (T2) or papain (T3) for 48 h at 4℃ *longissimus dorsi* muscles. ", "After 48 h chilling, samples were taken to evaluate the meat quality, and for use subsequent analyses.", "\n\nPreparation of enzyme solution {#s2b}\n------------------------------\n\nTo extract crude enzyme from *Sarcodon aspratus*, 3 g of *Sarcodon aspratus* sample was taken, then homogenized with 30 ml of distilled water (6,000 rpm, 12 s; Ace Homogenizer AM-8, Nissei Co., Japan), while fruit flesh was homogenized for kiwi extract, thereafter those have been shaken for 2 h at 25℃. ", "Thereafter those were centrifuged (10,000 *g*, 4℃, 20 min), then separated supernatants were filtrate by Whatman \\#2 (diameter 110 mm) ([@r021]). ", "To use as the final aqueous extract, *Sarcodon aspratus* sample was 2 times, and kiwi extract sample was 1 time filtrated. ", "Also papain sample was dissolved in 2 times distilled water for use.", "\n\nEnzyme activity measure {#s2c}\n-----------------------\n\nThe enzyme activity of 2% of *Sarcodon aspratus* aqueous extract, 2% of kiwi aqueous extract and 0.2% papain solution were measured by [@r009] process. ", "To measure enzyme activity 1mg of extract was mixed with 1 mL of 2 mM CaCl~2~-0.2 M Tris-HCl (pH 7.5), then incubated 60 min at 35℃ and adding 10 mg of 5% (w/v) trichloroacetic acid to stop the reaction. ", "Thereafter it was centrifuged, and the absorbance at 280 nm was measured for the supernatant by spectrophotometer (DU 650, Beckman, USA). ", "After the first absorbance measuring the sample was incubated 60 min at 35℃, and again its absorbance was measured at 280 nm. ", "One unit of caseinolytic activity was defined as the amount of enzyme that caused of 0.1 absorbance units at 280 nm after 60 min incubation at 35℃.", "\n\nMeat quality traits {#s2d}\n-------------------\n\nFor measuring pH of the sample, after taking the sample out of liquid nitrogen and reducing it to powder using a waring blender (HGB150, Christison Ltd., England), 5 g of it were mixed with 20 mL of distilled water and it was homogenized (6,000 rpm, 40 s; Ace Homogenizer AM-8, Nissei Co., Japan). ", "After leaving it alone for five minutes, pH was measured using a portable pH meter (Model 290A, Orion Research Inc., USA).", "\n\nMeat color was measured using a Minolta chromameter (CR-300, Minolta Camera Co., Japan).", "\n\nFor measuring WHC, the experimental method of [@r008] was transformed to use. ", "After grinding 10 g of the sample, which completed precipitation, using a Daunce homogenizer (7727-40, Pyrex, USA) 0.6 M NaCl 15 mL was added and it was homogenized for one minute. ", "Then, it was homogenized again and centrifugation (3,000 *g*, 4℃, 25 min) was applied after leaving it alone for fifteen minutes at a temperature of 4℃. ", "After centrifugation, supernatant\\'s volume was measured. ", "To measure WHC, the value to subtract supernatant\\'s volume from NaCl 15 mL was multiplied by 10.", "\n\nFor measuring cooking loss, after cutting the sample in a certain shape and weight (50±5 g) and putting it into an airproof polypropylene bag, it was put into a water bath with a temperature of 80℃ and it was heated until the core temperature 75℃. ", "After taking the sample out of it, it was cooled in ice slurry and left alone until the temperature 4℃. ", "The surface of the sample, which was taken out of the Polypropylene bag, was dehydrated and its weight was measured. ", "The value was expressed as a percentage (%).", "\n\nThe sample required for measuring shear force was cut in parallel with the muscle fibers (Diameter: 10 to 50 mm). ", "Using an Instron (Series IX, Instron Corp., USA), the shearing cutting test was conducted for measurement. ", "The chart speed was 120 mm/min, the maximum load was 10 kg, the measurement speed was 20 mm, the sample height was 20 mm, and it was measured using an adapter No. ", "4.", "\n\nProtein solubility {#s2e}\n------------------\n\nProtein solubility was utilized as an indicator of protein denaturation ([@r012]). [", "@r028] process was taken to measure protein solubility. ", "The sample, kept in a deep freezer (−80℃) was powdered by using waring blender (HGB150, Christison Ltd., England). ", "For total protein solubility 1 g of sample was mixed with 20 mL of 1.1 M KI/0.1 M potassium phosphate (pH 7.2), and for sarcoplasmic protein solubility 1 g of sample was mixed with 10 mL of 0.025 M potassium phosphate buffer (pH 7.2), then both were homogenized (6,000 rpm, 12 s; Ace Homogenizer AM-8, Nissei Co., Japan). ", "Then those were centrifuged (1,500 *g*, 4℃, 20 min) after 24 h kept at 4℃. ", "Thereafter, at 540 nm of spectrophotometer (DU 650, Beckman, USA), the absorbance of separated supernatant were measured by biuret method ([@r007]). ", "The myofibrillar protein solubility was calculated by the difference between total protein solubility and sarcoplasmic protein solubility\n\nMyofibrillar protein and sarcoplasmic protein extract from muscle {#s2f}\n-----------------------------------------------------------------\n\nTo extract and analyze myofibrillar protein and sarcoplasmic protein the sample of quick-freeze and stored in deep freezer was used. ", "The protein was extracted by [@r026] process and sodium dodecyl sulfate- polyacylamide gel electorphoresis (SDS-PAGE) was carried out to analyze it by using modified [@r018]process. ", "The sample taken out from deep freezer was powdered by using waring blender (HGB150, Christison Ltd., England), and 400 µL homogenization buffer (250 mM sucrose, 100 mM KCl, 5 mM EDTA, 20 mM Tris, pH 6.8) was injected to the sample 100 mg, then homogenized to make solution in the buffer and centrifuged (10,000 *g*, 4℃, 10 min). ", "This supernatant was used for protein analysis. ", "This process was carried out two more times repeatedly. ", "To the settlement generated by the above process, 400 µL of wash buffer (175 mM KCl, 2 mM EDTA, 0.54% Triton X-100, 20 mM Tris, pH 6.8) was injected, then homogenized to make solution in the buffer and centrifuged (10,000 *g*, 4℃, 10 min). ", "Again to the settlement after removing supernatant 400 µL resuspension buffer (150 mM KCl, 20 mM Tris, pH 7.0) was injected, then homogenized to make solution and stored at low temperature condition. ", "As above all the process to extract myofibrillar protein were carried out under low temperature condition (4℃) to keep the sample stability.", "\n\nTo each myofibrillar protein and sarcoplasmic protein sample, each 300 µL of sample buffer (10% β-mercaptoethanol, 4% sodium dodecyl sulfate, 16% 1.0 M pH 6.8 Tris) was injected, the final protein concentration of sample was maintained around 2.00-2.50 µg/µL by biuret method ([@r007]). ", "Samples were homogenized by vortex mixer, then heat treatment, 3 min in the boiling water, was taken.", "\n\nSDS-PAGE analysis of myofibrillar protein {#s2g}\n-----------------------------------------\n\nThe analysis of myofibrillar protein was done by using SDS-PAGE (SE 260, Hoefer Pharmacia Biotech Inc., USA). ", "Gel was consisted by Stacking gel 4%, separating gel 10%. ", "The sample of myofibrillar protein was loaded 10 µg per lane, for running buffer, upper running buffer (0.1 M tris, 0.15 M glycine, 0.15% SDS) and lower running buffer (0.025 M tris, 0.2 M glycine, 0.1% SDS) were separately manufactured by modifying [@r018] process and used.", "\n\nThe operating condition of electrophoresis running was fixed by 4℃ and 40 mA, and 2 h operated ([@r022]). ", "To dye gel 0.05% Coomassie blue R-250 (w/v), 40% methanol and 7% acetic acid we used for 2 h at room temperature, so that to achieve sufficient dying, and 2 times bleaching were made by 40% methanol and 7% acetic acid.", "\n\nTo take gel image photo of myofibrillar protein Kodak DC290 (Eastman Kodak Company, USA) was used, and to analyze gel image Kodak 1D Image Analysis Software (Eastman Kodak Company, USA) was used ([@r010]; [@r023]).", "\n\nSDS-PAGE analysis of sarcoplasmic protein {#s2h}\n-----------------------------------------\n\nTo analyze sarcoplasmic protein SDS-PAGE was used (SE 260, Hoefer Pharmacia Biotech Inc., USA). ", "The construction of Gel was 8% stacking gel and 15% separating gel. ", "10 µg of sarcoplasmic protein sample was injected into each lane. ", "The running condition of electrophoresis and dying gel were identical to those of myofibrillar protein. ", "To analyze sarcoplasmic protein the proportion of 16 bands in one lane from the gel image observed by electrophoresis ([@r023]).", "\n\nStatistical analysis {#s2i}\n--------------------\n\nFor variance analysis General Linear Model (GLM) procedure of SAS (SAS Institute, USA) was used, and to verify significance F-test was used.", "\n\nResults and Discussion {#s3}\n======================\n\nEnzyme activity {#s3a}\n---------------\n\nTo analyze enzyme activity level of *Sarcodon aspratus* extract, kiwi extract and papain, available from market, were used for comparison ([Table 1](#t001){ref-type=\"table\"}). ", "The enzyme activity level of 2% *Sarcodon aspratus* extract was measured as 683.2 unit/mL, the highest, while that of 2% kiwi extract was 0.68 unit/mL and that of 0.2% papain was 146.33 unit/mL.\n\n###### Enzyme activity of *Sarcodon aspratus* extract, kiwi extract, and papain\n\n 2% *Sarcodon aspratus* extract 2% kiwi extract 0.2% papain Level of significance\n --------- -------------------------------- ----------------- ---------------- -----------------------\n Unit/mL 683.2^a^±96.49^1^ 0.68^c^±0.09 146.3^b^±18.10 \\*\\*\\*\n\n^1^Result presented Means±SD.", "\n\nLevel of significance: \\*\\*\\**p*\\<0.001.", "\n\n^a-c^Means with different superscripts within a row are significantly different (*p*\\<0.05).", "\n\nAccording to the study of [@r019] the enzyme activity level of *Sarcodon aspratus* extract was 66 times higher than that of kiwi extract. ", "Also it was proved from the test for this study that enzyme activity level of *Sarcodon aspratus* extract is quite higher than that of kiwi extract as well, and 4.6 times higher than that of 0.2% papain, widely used for the test condition of enzyme activity level.", "\n\nMeat quality traits {#s3b}\n-------------------\n\nTo analyze the influence of vegetable proteolytic enzyme of *Sarcodon aspratus* extract to the quality of meat, the comparison analysis of meat processed with each kiwi extract and papain was carried out ([Table 2](#t002){ref-type=\"table\"}). ", "The influence of vegetable proteolytic enzyme to pH, there was no distinctive difference between sample group processed by *Sarcodon aspratus* extract and other sample groups as well as control group. ", "For lightness (L\\*) there was significant difference (*p*\\<0.05) based on the sample groups, but between *Sarcodon aspratus* group and control group there was no significant difference, and kiwi extract group showed the lowest figure. ", "For redness (a\\*) the sample group of *Sarcodon aspratus* showed the lowest figure (*p*\\<0.01). ", "For yellowness (b\\*) there was no significant difference between sample group of *Sarcodon aspratus* and control group (*p*\\<0.01). ", "As the idiopathic color of *Sarcodon aspratus* has been reflected, it is understood that redness (a\\*) of sample group *Sarcodon aspratus* was the lowest\n\n###### Meat quality traits of the bovine *longissimus dorsi* muscle treated with 2% *Sarcodon aspratus* extract (T1), 2% kiwi extract (T2), and 0.2% papain (T3)\n\n Control T1 T2 T3 Level of significance\n ------------------ ------------------ ------------------ ------------------ ------------------ -----------------------\n Meat pH 5.52 (0.03)^1^ 5.51 (0.03) 5.53 (0.03) 5.45 (0.02) NS\n Lightness (L\\*) 39.13^ab^ (0.75) 40.22^a^ (0.75) 37.36^b^ (0.75) 40.12^a^ (0.67) \\*\n Redness (a\\*) 22.49^a^ (0.81) 18.29^b^ (0.81) 21.09^a^ (0.81) 22.23^a^ (0.72) \\*\\*\n Yellowness (b\\*) 12.55^ab^ (0.34) 11.63^bc^ (0.34) 11.33^c^ (0.34) 12.82^a^ (0.31) \\*\\*\n Cooking loss (%) 37.21^c^ (0.99) 41.13^b^ (0.99) 37.30^c^ (0.99) 50.52^a^ (0.99) \\*\\*\\*\n WHC (%) 22.33^a^ (10.48) 70.00^b^ (10.48) 26.33^a^ (10.48) 62.67^b^ (10.48) \\*\n\n^1^Standard error of least-square means.", "\n\nLevel of significance: NS=not significant, \\**p*\\<0.05, \\*\\**p*\\<0.01, \\*\\*\\**p*\\<0.001.", "\n\n^a-c^Means with different superscripts within a row are significantly different (*p*\\<0.05).", "\n\nAbbreviation: WHC, water holding capacity.", "\n\nThe cooking loss (%) of sample group of *Sarcodon aspratus* was lower than that of control group and sample group of kiwi extract (*p*\\<0.001), and there was no significant difference with sample group of papain. ", "The adding of *Sarcodon aspratus* powder or *Sarcodon aspratus* extracted proteolytic enzyme gave influence to Water holding capacity (WHC) of meat, the WHC of sample group of *Sarcodon aspratus* was higher than that of control group, but similar to that of sample group of papain ([@r002]). ", "WHC of sample group of *Sarcodon aspratus* showed significant difference with control group as well as sample group of kiwi extract (70.00 vs. 22.33 vs. 26.33%, *p*\\<0.05), but showed similar result with sample group of papain (70.00 vs. 62.67%, *p*\\>0.05). ", "This result is similar to the study result of [@r002]. ", "For the Shear force (WBN), a mechanical figure representing tenderness ([Fig. ", "1](#f001){ref-type=\"fig\"}), sample group of *Sarcodon aspratus* was lower than that of sample group of kiwi extract (36.64 vs. 46.20 N, *p*\\<0.05), but no significant difference with sample group of papain (36.64 vs. 43.78 N, *p*\\>0.05), a marketable enzyme, so it was understood that the strong activeness of proteolytic enzyme of *Sarcodon aspratus* gave influence to the tenderness. ", "As the above result of meat quality trait analysis, it is proved that the adding of *Sarcodon aspratus* extract is effective to improve the WHC and tenderness of meat.", "\n\n{#f001}\n\nProtein solubility {#s3c}\n------------------\n\nTo analyze the level of proteolysis of meat, total protein, solubility of sarcoplasmic protein and myofibrillar protein have been measured from the meat processed by proteolytic enzyme and stored 48 h at 4℃ ([Table 3](#t003){ref-type=\"table\"}). ", "Total protein content of control group showed no significant difference with both sample groups of *Sarcodon aspratus* and kiwi extract, but showed significant difference with sample group of papain (*p*\\<0.05). ", "The sarcoplasmic protein solubility of sample groups *Sarcodon aspratus* was not significantly different from that of sample group of papain (56.92 vs. 58.40 mg/mL, *p*\\>0.05), but showed higher figure against control group (56.92 vs. 42.77 mg/mL, *p*\\<0.001). ", "The myofibrillar protein solubility of sample group *Sarcodon aspratus* showed lower figure than that of control group (102.39 vs. 123.15 mg/mL, *p*\\<0.001) and sample group of kiwi extract (117.31 mg/mL). ", "The lower total protein solubility of sample group papain was more related to myofibrillar proteolysis, instead of sarcoplasmic proteolysis, and the sample group of *Sarcodon aspratus* showed similar tendency.", "\n\n###### Protein solubility of the bovine *longissimus dorsi* muscle treated with 2% *Sarcodon aspratus* extract (T1), 2% kiwi extract (T2), and 0.2% papain (T3)\n\n Control T1 T2 T3\n ---------------------------- --------- ---- ---- ----\n Protein solubility (mg/mL) \n\n^1^Standard error of least-square means.", "\n\nLevel of significance: \\**p*\\<0.05, \\*\\*\\**p*\\<0.001.", "\n\n^a-c^Means with different superscripts within a row are significantly different (*p*\\<0.05).", "\n\nAbbreviations: TPS, total protein solubility; SPS, sarcoplasmic protein solubility; MPS, myofibrillar protein solubility.", "\n\nIn this study myofibrillar protein solubility of sample group *Sarcodon aspratus* showed lower figure than that of control group and sample group of kiwi extract, so it was analyzed that the level of proteolysis was higher. ", "When comparing this test result with [Table 2](#t002){ref-type=\"table\"}, it is understood that the proteolytic capability of *Sarcodon aspratus* proteolytic enzyme affected to the myofibrillar proteolysis, and this proteolysis affected the tenderness of meat, so that the figure of shear force was low.", "\n\nSDS-PAGE analysis of myofibrillar protein {#s3d}\n-----------------------------------------\n\nTo closely observe the change of muscle protein, when meat processed by proteolytic enzyme of *Sarcodon aspratus* extract, the SDS-PAGE gel pattern of myofibrillar protein was analyzed ([Fig. ", "2](#f002){ref-type=\"fig\"}). ", "According to the study of [@r001] calpain and cathepsin, it is reported that the proteolytic enzyme in the muscle, gave influence to myofibrillar protein fragmentation, it has co-relation with tenderness, but little influence to the decomposition of myosin and actin. ", "On the other hand, thiol group vegetable proteolytic enzyme, contained in kiwi, papaya, pineapple and etc., ", "gave influence to the decomposition of sarcoplasmic protein, so it is known as effective to improve tenderness ([@r027]). ", "In this study, according to the observation result of MHC (myosin heavy chain) by using SDS-PAGE, it was proved that the decomposition level of sample group *Sarcodon aspratus* relatively higher than that of control group as well as that of sample group kiwi. ", "Comparing with sample group papain, the decomposition level was similar. ", "This result is identical to that of the study result of [@r016]. ", "Like this, the proteolytic enzyme extracted from *Sarcodon aspratus* gave influence to the decomposition of MHC, and this is related to the tenderness of sample group *Sarcodon aspratus*.", "\n\n{#f002}\n\nSDS-PAGE analysis of sarcoplasmic protein {#s3e}\n-----------------------------------------\n\n[Fig. ", "3](#f003){ref-type=\"fig\"} is the SDS-PAGE gel pattern of sarcoplasmic protein, when processing meat by proteolytic enzyme of *Sarcodon aspratus* aqueous extract. ", "According to the analyzing result there were differences among gel pattern of sarcoplasmic protein depending on the processing groups, but there were similar tendency between sample group of *Sarcodon aspratus* and papain at bands 1, 2, 5, 6, 7, 9 and 12 and between sample group of *Sarcodon aspratus* and kiwi at bands 1, 2, and 7. [", "Fig. ", "4](#f004){ref-type=\"fig\"} indicated the sum of protein content, more decreased than control group (1, 5, 6. ", "9) and protein content more increased than control group (2, 7, 8, 12) among band analyzed in this study. ", "For the sum of more decreased bands, sample group of Kiwi was the lowest, but for the sum of more increased bands sample group of *Sarcodon aspratus* and kiwi were relatively higher than other processing groups, so it is understood that the proteolytic effect of *Sarcodon aspratus* and kiwi is high (*p*\\<0.05).", "\n\n{#f003}\n\n{#f004}\n\nSarcoplasmic protein is a water soluble protein, and has no direct relationship with tenderness, but other various proteins are used as an indicating factor of meat quality as well as protein denaturation. ", "Like this the intensity of various Sarcoplasmic protein bands can be used as an indicator of protein denaturation, in this study PH, CK and unknown protein (about 55 and 60 kDa) showed low intensity by the treatment, but F6PK and phosphoglycerate mutase or phosphoglycerate showed high intensity according to the treatment, so it is understood that those are proteins co-related with the level of proteolysis. ", "Especially an unknown band near 45 kDa, the protein not found in previous [@r023]test, was found from *Sarcodon aspratus*, which has high treatment effect of proteolytic enzyme, so it is understood that it has relationship with the level of proteolysis.", "\n\nConclusion {#s4}\n==========\n\nThe treatment by *Sarcodon aspratus* extraction liquid is effective in improvement of meat tenderness, and it is related to the proteolysis, especially decomposition of MHC, so it has high usefulness for meat tendering agent. ", "However the inherent color of *Sarcodon aspratus* aqueous extract may affect to the redness of meat, so it is understood that the refined proteolytic enzyme of *Sarcodon aspratus* aqueous extract, instead of the extraction liquid as it is, is better to improve tenderness of meat without meat color transition.", "\n\nThis research was supported by the 2015 scientific promotion program funded by Jeju National University.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0, 0, 0.02197802197802198, 0.006756756756756757, 0.020512820512820513, 0, 0.02702702702702703, 0, 0, 0.024793388429752067, 0, 0, 0, 0, 0, 0, 0.014285714285714285, 0, 0, 0, 0.005319148936170213, 0.0136986301369863, 0, 0, 0.004761904761904762, 0, 0.014492753623188406, 0, 0, 0.008620689655172414, 0.01639344262295082, 0.011111111111111112, 0.0125, 0.0055248618784530384, 0, 0, 0, 0, 0, 0.008547008547008548, 0, 0, 0.009345794392523364, 0, 0, 0.007575757575757576, 0.017857142857142856, 0.008695652173913044, 0.006211180124223602, 0, 0.020134228187919462, 0, 0.01098901098901099, 0.015151515151515152, 0, 0, 0.016666666666666666, 0.015, 0, 0.006920415224913495, 0, 0.00980392156862745, 0, 0.0036363636363636364, 0.018518518518518517, 0, 0.027777777777777776, 0.005263157894736842, 0, 0, 0, 0.0078125, 0.010416666666666666, 0, 0.0016666666666666668, 0, 0, 0.007142857142857143, 0, 0, 0, 0.00425531914893617, 0, 0, 0, 0.011111111111111112, 0, 0, 0, 0.003424657534246575, 0.003875968992248062, 0.01818181818181818, 0.02564102564102564, 0, 0, 0, 0, 0, 0, 0, 0.0038314176245210726, 0.0048543689320388345, 0, 0.00273224043715847, 0.01818181818181818, 0, 0.016260162601626018, 0.004424778761061947, 0, 0.0034965034965034965, 0, 0.0037313432835820895, 0, 0.00819672131147541, 0.007692307692307693, 0.0136986301369863, 0.015384615384615385, 0.0053475935828877, 0, 0.006944444444444444, 0.012244897959183673, 0, 0, 0, 0, 0, 0.003205128205128205, 0, 0, 0, 0, 0.013793103448275862, 0, 0, 0, 0.0024390243902439024, 0.007905138339920948, 0.0038910505836575876, 0, 0.009433962264150943, 0 ]

[ "NASHVILLE, Tenn. (WKRN) – It starts as an eyesore—the type of home that attracts crime to neighborhoods. ", "But bring in the bulldozers and Troy Shafer shows up.", "\n\n“When you at a project like this, what do you envision? ", "When I look at this, I’m looking past the boarded windows, the Christmas lights, and I’m just thinking, ‘Why was this house designed like this? ", "Why this big? ", "Why these big windows, and why so close to the street?’ ", "And that starts painting the picture for me,” he explained.", "\n\nShafer is part contractor, part historian, part small business owner, and a little bit of a TV host—but mostly an artist.", "\n\n(Photo: WKRN)\n\nAnd when the layers of old homes start being peeled back, the artist and historian step forward.", "\n\n“It’s not really up to me. ", "The history is already here. ", "I just have to uncover it and bring it back,” he told News 2.", "\n\nHe took News 2’s Neil Orne inside the home. ", "Suddenly they’re standing in the original log cabin the 100-year-old home was built around.", "\n\n“I mean, this is 170 years old,” Shafer said.", "\n\nIt almost takes your breath away. ", "This is the original Nashville. ", "This went up about the same time work began on the Tennessee State Capitol.", "\n\n(Photo: WKRN)\n\n“It blew my mind,” Shafer told News 2. “", "We had a hunch some of the things we might find, but it wasn’t until we started uncovering and started realizing, ‘Wow. ", "We are really working in a 17-year-old log cabin a mile from downtown Nashville.”", "\n\nBut in this new Nashville market, it is a challenge on several fronts.", "\n\nSaving history is not for the faint of heart.", "\n\n“When I started Nashville Flipped in, technically, 2008 … the first house I ever renovated was in East Nashville, and I paid $32,000 for it,” Shafer said.", "\n\n“Now that same house, in that same condition, may be $130,000 or $150,000,” he continued.", "\n\nNo longer does Shafer own a bunch of houses waiting to be restored. ", "It’s too expensive.", "\n\n(Photo: WKRN)\n\nIt is a losing race. ", "Properties are being sold, history torn down, and multiple homes go up—Nashville’s tall skinnies—and it’s happening really fast.", "\n\n“The irony is people fall in love with Nashville. ", "A big part of it is the history, and to see these houses torn down to make way for the new people to come in, that’s a scary thought because you can’t rebuild that,” Shafer told News 2.", "\n\nThe real estate boom has Shafer working more outside of the city in areas like Springfield.", "\n\n“There’s these outlying areas—Goodlettsville, Lebanon, Hendersonville. ", "They are kind of closer to what I felt good with several years ago. ", "Not $30,000, $40,000, but you are finding them for $80,000 and $90,000, and there are a lot of buyers. ", "A lot of people want to be in those areas,” he explained.", "\n\nSkyrocketing prices Shafer can work around and his choices for preservation now have to be right every time.", "\n\n(Photo: WKRN)\n\nHis biggest challenge, by far, is help.", "\n\n“But workers, quality workers to get them, that’s challenging. ", "I’m not used to an electrician telling me it will be three to four weeks before they can come finish that. ", "You have inspectors and it makes it so difficult to stick to a timeline because everybody is so busy,” Shafer said.", "\n\nAnd houses like this log cabin project sit, and sit, and history around it disappears.", "\n\nIn it, though, Shafer sees great irony.", "\n\n“The irony of the love of old houses and the love of just history, and that’s what brings people to Nashville and then to make a place for all these new people. ", "What do some people do? ", "Tear down the history.”", "\n\nIt’s truly a race against time, saving the past for future generations." ]

{ "pile_set_name": "Pile-CC" }

[ 0.009523809523809525, 0.018867924528301886, 0, 0, 0, 0, 0, 0.008130081300813009, 0.008849557522123894, 0, 0, 0, 0.021739130434782608, 0, 0.02127659574468085, 0, 0, 0, 0.03508771929824561, 0, 0, 0, 0, 0.01282051282051282, 0, 0.014285714285714285, 0, 0.02631578947368421, 0, 0, 0.005405405405405406, 0, 0, 0, 0, 0, 0.00909090909090909, 0.017857142857142856, 0, 0, 0.008695652173913044, 0, 0.024390243902439025, 0, 0, 0, 0 ]

[ "Some Ohio CareSource independent healthcare providers —including doctors, nurses and dentists — report paycheck delays, turning to social media to vent their frustrations.", "\n\nCindy Braley of Doylestown, Ohio told News 5, in some cases, she's had to wait months to get her paycheck sent to her from CareSource Ohio.", "\n\nBraley said the delays in pay have put her family in a tough financial situation.", "\n\n\"I have gone five months without payment from CareSource,\" said Braley. \"", "I ended up losing my house over that, that's why we're here, this is my mother's house.\"", "\n\nBraley claimed CareSource still owes her $800 in back-pay, and mistakenly sent her five expired checks that were returned for insufficient funds earlier in the year.", "\n\nBraley said CareSource appointed an ombudsman to help her with paycheck issues and said she was told some of the problems were computer related.", "\n\n\"She said there was a glitch in the system, that it was a 69 glitch code,\" said Braley. \"", "It's getting to the point where I'm just ready to give up.\"", "\n\nNews 5 contacted CareSource headquarters in Dayton, Ohio about this case.", "\n\nCareSource said paycheck delays were not caused by computer issues.", "\n\nThe company said it could not comment in individual cases but said it would continue to work with Braley in solving any issues.", "\n\nCareSource issued the following statement in response to our story:" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.005847953216374269, 0.014184397163120567, 0, 0.02666666666666667, 0, 0.005988023952095809, 0.0136986301369863, 0.01098901098901099, 0, 0.013333333333333334, 0.014492753623188406, 0.007751937984496124, 0.014492753623188406 ]

[ "CDH1 (E-cadherin) in testicular germ cell neoplasia: suppressed translation of mRNA in pre-invasive carcinoma in situ but increased protein levels in advanced tumours.", "\nE-cadherin (CDH1) is a transmembrane glycoprotein involved in cellular adhesion. ", "In our recent microarray studies of testicular germ cell tumours (TGCTs) and the common precursor carcinoma in situ (CIS), CDH1 mRNA was highly expressed in CIS and embryonal carcinoma. ", "It has previously been reported that the CDH1 protein is not expressed in CIS. ", "To resolve the discrepancy, we performed a detailed analysis of the expression of CDH1 mRNA and protein in a series of normal and neoplastic testes. ", "High expression of CDH1 mRNA in CIS was confirmed by real-time PCR and in situ hybridisation. ", "At the protein level, however, CDH1 was only detected with one of three tested antibodies, but Western blotting analysis with this antibody showed additional bands, suggesting unspecific staining. ", "The levels of a CDH1 protein fragment in serum samples from 58 patients with TGCTs were analysed by ELISA; we found significantly higher levels in patients with advanced disease (stage II/III) when compared to healthy individuals and patients with stage I TGCT. ", "In conclusion, despite high mRNA levels, the CDH1 protein is not expressed in CIS, suggesting translational suppression of CDH1 protein expression. ", "CDH1 serum levels may be a serological marker for staging of TGCT patients." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0.010752688172043012, 0.012658227848101266, 0, 0.02127659574468085, 0, 0.003816793893129771, 0.006756756756756757, 0 ]

[ "2013 European Diving Championships – Women's 10 metre platform\n\nThe women's 10 metre platform competition at the 2013 European Diving Championships was held on June 19 with a preliminary round and the final.", "\n\nResults\nThe preliminary round was held at 12:00 and the final was held at 17:30.", "\n\nGreen denotes finalists\n\nReferences\n\nCategory:2013 European Diving Championships\nEuro" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0, 0, 0.011494252873563218 ]

[ "STAT (signal transducers and activators of transcription), a transcriptional regulator, is a DNA-binding protein whose activity is regulated by stimulations of various cytokines (IL-6, interferon, etc.) ", "or growth factors (EGF, PDGF, etc.). ", "Upon binding of cytokines to their receptors, JAK (Janus protein tyrosine kinase) kinase is activated to phosphorylate tyrosine in STAT (see e.g., Non Patent Documents 1 and 2). ", "Moreover, upon binding of growth factors to their receptors, tyrosine kinase possessed by the growth factor receptors themselves phosphorylates STAT (see e.g., Non Patent Document 3). ", "The phosphorylated STAT is activated by dimerization via its Src homology 2 (SH2) domain. ", "The activated STAT moves into the nucleus where it specifically recognizes and binds particular DNA sequences in the gene promoter regions to induce the transcriptions of many genes. ", "Specifically, STAT is a mediator essential for signal transduction pathways from cell surface to the nucleus and is deeply involved in cell growth or differentiation, etc.", "\nFor STAT, 6 different members (STAT1, STAT2, STAT3, STAT4, STAT5, and STAT6) and some isoforms (STAT1α, STAT1β, STAT3α, and STAT3β) are known.", "\nOf them, STAT3 is expressed in the majority of cytomas (see e.g., Non Patent Document 4). ", "Its constitutive activation and overexpression are observed in various cancer cells such as breast cancer, lung cancer, prostatic cancer, head and neck cancer, skin cancer, pancreatic cancer, and ovarian cancer cells, and in cancer cells such as myeloma, breast cancer, prostatic cancer, brain tumor, head and neck cancer, melanoma, leukemia lymphoma, and multiple myeloma cells (see e.g., Non Patent Documents 5, 6, and 7). ", "The growth or invasion of these cancer cells is considered to depend on STAT3. ", "Moreover, the abnormal or constitutive expression of STAT3 is also involved in cellular transformation (see e.g., Non Patent Documents 8, 9, and 10). ", "Thus, STAT3 is probably useful as a target molecule for these cancer types. ", "Its inhibitor is therefore expected as an anticancer agent.", "\nIt has been reported that an antisense oligonucleotide complementary to the translation initiation region of STAT3 actually inhibits TGF-α-stimulated cell growth induced by an epidermal growth factor receptor (EGFR) (see e.g., Non Patent Document 11). ", "It has also been reported that inhibition of STAT3 functions (using antisense, RNAi, peptides, or the like) can suppress the growth of cancer cells and induce apoptosis. ", "This suggests that a STAT3 inhibitor can serve as a therapeutic or preventive drug for cancer.", "\nFor example, 6-nitrobenzo[b]thiophene-1,1-dioxide (see e.g., Non Patent Document 12) and a phosphorylated oligopeptide (see e.g., Non Patent Document 13) are known as compounds inhibiting STAT3.", "\nA 3-aminopyrazole derivative represented by the following formula (A):\n(wherein R represents an alkyl group, a cycloalkyl group, or the like, and R1 represents an alkyl group, a heterocyclic group, an aryl group, or the like) [0010] is known as a therapeutic drug for cancer and cell proliferative disorder (see e.g., Patent Document 1). ", "Examples of the aryl group include a phenyl group as well as aromatic heterocyclic groups such as pyridyl and quinolyl.", "\nMoreover, a quinoline derivative represented by, for example, the following formula (B):\nis known to have caspase inhibitory activity (see e.g., Patent Document 2).", "\nFurthermore, a (thiadiazolyl)quinolinecarboxamide derivative represented by, for example, the following formula (C):\nis known to have antimicrobial or antifungal effect (see e.g., Non Patent Document 14)." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.009852216748768473, 0.05405405405405406, 0.016853932584269662, 0.010869565217391304, 0.011111111111111112, 0.00546448087431694, 0.005847953216374269, 0.06293706293706294, 0.02197802197802198, 0.002352941176470588, 0.012658227848101266, 0.013333333333333334, 0.013157894736842105, 0, 0.015810276679841896, 0.0058823529411764705, 0.010638297872340425, 0.015384615384615385, 0, 0, 0, 0.004878048780487805 ]

[ "Stem cell-derived neurons in the development of targeted treatment for schizophrenia and bipolar disorder.", "\nThe recent advent of induced pluripotent stem cells has enabled the study of patient-specific and disease-related neurons in vitro and has facilitated new directions of inquiry into disease mechanisms. ", "With these approaches, we now have the possibility of correlating ex vivo cellular phenotypes with individual patient response to treatment and/or side effects, which makes targeted treatments for schizophrenia and bipolar disorder a distinct prospect in the coming years. ", "Here, we briefly review the current state of stem cell-based models and explore studies that are providing new insights into the disease biology of schizophrenia and bipolar disorder, which are laying the foundations for the development of novel targeted therapies." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0 ]

[ "Methods :\nSubjects were recruited into 4 groups: 1) control eyes without uveitis (n=8), 2) uveitis without a history of CME (n=7), 3) uveitis with a history of CME, but not present at the time of the scan (n=7), and 4) uveitis with active CME at the time of the scan (n=10). ", "Imaging was performed using CIRRUS SSOCT angiography provided by Zeiss Meditec Inc. Volume scans (3mmx3mm) were obtained at 1050nm, 100 kHz, and 100µm delta-λ providing 5µm axial and 14µm lateral resolution. ", "Quantitative flow parameters including Vessel Diameter Index (VDI), Vessel Area Density (VAD), Vessel Skeleton Density (VSD), Vessel Complexity Index (VCI) and Vessel Perimeter Index (VPI) were calculated. ", "Analysis was limited to a region of interest defined by a ring with inner diameter of 1mm and outer diameter of 3mm centered on the fovea. ", "The 3 patient groups were compared by analysis of variance with post hoc t-test comparison and Bonferroni correction for multiple comparisons.", "\n\nResults :\nSignificant differences between the groups were identified for all parameters except for VDI. ", "Subsequent pair-wise comparisons demonstrated significant differences for VAD, VSD, and VPI after Bonferroni correction. ", "There was a trend towards lower values of these three parameters for group3 vs control, group4 vs control, and group3 vs group2 (0.008<p<0.05). ", "Group4 had significantly lower values of VAD, VSD, and VPI compared to group2 (p<0.008). ", "There were no differences found between controls vs group2 or between group3 vs group4.", "\n\nConclusions :\nOur findings suggest that structural changes occur in the perifoveal vasculature in the context of uveitic CME, particularly for parameters of vascular density. ", "These changes are most pronounced in active CME, but still have detectable changes upon CME resolution. ", "More pronounced differences between the disease and control eyes might be found in a larger, more heterogenous group of uveitic eyes. ", "Hypotheses for our findings include measurement error, flow voids, or true vascular dropout/remodeling in the context of uveitic CME. ", "Our SSOCT protocol shows promise for detecting past and present vascular density changes in uveitic CME.", "\n\nThis is an abstract that was submitted for the 2017 ARVO Annual Meeting, held in Baltimore, MD, May 7-11, 2017." ]

{ "pile_set_name": "Pile-CC" }

[ 0.014545454545454545, 0.004807692307692308, 0.043689320388349516, 0, 0.007042253521126761, 0.009433962264150943, 0.03305785123966942, 0, 0.0449438202247191, 0, 0.005649717514124294, 0.009615384615384616, 0, 0.007462686567164179, 0.009615384615384616, 0 ]

[ "Hirshfeld surface analysis of the 1,1'-(ethane-1,2-diyl)dipyridinium dication in two new salts: perchlorate and peroxodisulfate.", "\nIn the title salts, C12H14N2(2+)·2ClO4(-), (I), and C12H14N2(2+)·S2O8(2-), (II), the dication is organized around an inversion centre located at the centre of the -CH2CH2- bridge and the two pyridine segments are anti with respect to one another. ", "The peroxodisulfate anion in (II) also exhibits inversion symmetry. ", "Hirshfeld surface analysis shows closely similar Hirshfeld surface shapes for the dications in the two salts, reflecting similar intermolecular contacts and similar conformations. ", "The two-dimensional fingerprint plots (FPs) are quite asymmetric, due to the presence of more than one component (cation and anion). ", "The most striking of the complementary features for each of the FPs of the dications is the broad green spike in the region d(e) > d(i), without the presence of a corresponding spike in the region d(e) < d(i), reflecting the absence of O···H contacts. ", "Moreover, H···O interactions (51% in the dications of both salts) outnumber other contacts in both crystal structures." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0.004032258064516129, 0.014705882352941176, 0.005555555555555556, 0, 0.003968253968253968, 0 ]

[ "According to Emerging Tech teacher Suzanne Stark, Emerging tech is a class to explore new technologies and become skilled on classes that are already available here at HHS.", "\n“Exploring the Surface is first on the calendar,” Stark said. “", "We tweak settings to make the individual devices more useful...\n\nDespite being a rather disappointing year in other aspects, 2016 was very kind to us in terms of music. ", "In no particular order, here are 10 of the best albums released throughout the last year:\n“The Life of Pablo” Kanye West\nBoasting a star-studded list of features such as Chance the Rap...\n\nThe Eastern Kansas Scholastic Art Awards Exhibition will take place Jan. 27 to March 2.", "\nThe Silver Key Opening session is on Jan. 27 and the Gold Key and Scholarship Closing Reception will be on March 5.", "\nGold Keys are the highest recognition followed by Silver Key and then Honorable Mention.", "\nSenior...\n\nPhotography and cinematography have always been an important part of senior Jacob Alexander’s life. ", "Starting out by simply just recording and taking photos, Alexander now owns his own website where he shares the images he captures.", "\n“My passion for photography and cinematography really began when...\n\nGift shopping can be one of the most stressful and bank-breaking activities in the books, but fear not. ", "The Guidon is here to help you get the quirky gift you need for $20 and under.", "\n1. ", "Game of Phones, $20. ", "This unusual game has you head to head against you friends to see who's the real champion o..." ]

{ "pile_set_name": "Pile-CC" }

[ 0.011627906976744186, 0.015625, 0, 0.0036231884057971015, 0, 0.033707865168539325, 0.008928571428571428, 0.007633587786259542, 0, 0, 0, 0, 0 ]

[ "Q:\n\nObtengo dos valores distintos al convertir un String a SHA1\n\nTengo el siguiente código con el cual estoy probando como encriptar contraseñas con SHA1. ", "He usado código adaptado de dos fuentes distintas pero ambas me traen resultados distintos. ", " \nimport java.io.", "UnsupportedEncodingException;\nimport java.math.", "BigInteger;\nimport java.security.", "MessageDigest;\nimport java.security.", "NoSuchAlgorithmException;\nimport javax.xml.bind.", "DatatypeConverter;\n\npublic class Encriptacion \n{\n\n public static void main(String[] args) throws UnsupportedEncodingException {\n\n String password = \"Lucas\";\n\n try \n {\n //da39a3ee5e6b4b0d3255bfef95601890afd80709\n MessageDigest md = MessageDigest.getInstance(\"SHA1\");\n md.update(password.getBytes(), 0 , password.length());\n System.out.println(new BigInteger(1, md.digest()).toString(16));\n\n //CBEDE02E8C227684972AB1467409D98C0D0D5A5D\n MessageDigest msdDigest = MessageDigest.getInstance(\"SHA1\");\n msdDigest.update(password.getBytes(\"UTF-8\"), 0, password.length());\n password = DatatypeConverter.printHexBinary(msdDigest.digest());\n System.out.println(password);\n\n } \n catch (NoSuchAlgorithmException ex) \n {\n System.out.println(\"ERROR : \");\n ex.printStackTrace(System.out);\n }\n\n }\n\n}\n\nDesconozco cual es el motivo por el cual me trae resultados distintos ni cual es la forma correcta de encriptar una contraseña. ", "\n\nA:\n\nAmbos son métodos correctos y válidos:\nI)\n MessageDigest md = MessageDigest.getInstance(\"SHA1\");\n md.update(password.getBytes(), 0 , password.length());\n System.out.println(new BigInteger(1, md.digest()).toString(16));\n\nII) \n MessageDigest msdDigest = MessageDigest.getInstance(\"SHA1\");\n msdDigest.update(password.getBytes(\"UTF-8\"), 0, password.length());\n password = DatatypeConverter.printHexBinary(msdDigest.digest());\n System.out.println(password);\n\nPuedes usar ambos métodos, ambos son correctos, en el caso de tu pregunta, si se encuentran en el mismo método únicamente asegura que al llamar cada uno debes inicializar tu variable:\npassword = \"Lucas\";\n\nde esta forma obtendrás el resultado deseado.", "\n\nEn cuanto al resultado da39a3ee5e6b4b0d3255bfef95601890afd80709 que estas obteniendo, la razón es que el valor de password es un String vació \"\".", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0064516129032258064, 0, 0, 0, 0, 0.027777777777777776, 0, 0.0027573529411764708, 0.0040595399188092015, 0.013513513513513514, 0 ]

[ "\nUSCA1 Opinion\n\n\t\n\n\n\n\n\r\r\r\r United States Court of Appeals\r United States Court of Appeals\r For the First Circuit\r For the First Circuit\r ____________________\r\r No. ", "94-2283\r\r THEODORE M. BARBOUR,\r\r Plaintiff, Appellant,\r\r v.\r\r DYNAMICS RESEARCH CORPORATION,\r\r Defendant, Appellee.", "\r\r ____________________\r\r APPEAL FROM THE UNITED STATES DISTRICT COURT\r\r FOR THE DISTRICT OF MASSACHUSETTS\r\r [Hon. ", "William G. Young, U.S. District Judge]\r ___________________\r\r ____________________\r\r Before\r\r Torruella, Chief Judge,\r ___________\r Cyr and Stahl, Circuit Judges.", "\r ______________\r\r ____________________\r\r Norman Jackman with whom Martha M. Wishart and Jackman & Roth\r ______________ __________________ _______________\r were on brief for appellant.", "\r Joan Ackerstein with whom Guy P. Tully and Jackson, Lewis,\r ________________ ______________ ________________\r Schnitzler & Krupman were on brief for appellee.", "\r ____________________\r\r\r ____________________\r\r August 15, 1995\r ____________________\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r STAHL, Circuit Judge. ", " Plaintiff Theodore M.\r STAHL, Circuit Judge.", "\r ______________\r\r Barbour sued his former employer, Dynamics Research\r\r Corporation (\"DRC\"), claiming that DRC terminated his\r\r employment to avoid paying disability benefits, in violation\r\r of section 510 of the Employee Retirement Income Security Act\r\r (ERISA), 29 U.S.C. 1140. ", " The district court granted\r\r summary judgment for DRC, and we affirm.", "\r\r I.\r I.\r __\r\r FACTUAL BACKGROUND\r FACTUAL BACKGROUND\r __________________\r\r In July 1985, DRC, an Andover, Massachusetts\r\r company, hired Barbour as a staff engineer. ", " Although Barbour\r\r was performing his job satisfactorily, his supervisor, Earl\r\r Zimmerman, began to complain to Barbour in September 1987\r\r that Barbour's breath smelled of alcohol. ", " Barbour and\r\r Zimmerman discussed Barbour's alcohol problem, and Zimmerman\r\r suggested that Barbour apply for a medical leave of absence. ", "\r\r For employees with a medically certified\r\r disability, DRC provides company-funded short-term disability\r\r benefits. ", " The short-term disability plan provides a disabled\r\r employee with up to 75% of his or her salary. ", " After six\r\r months elapses, an employee who is still disabled must then\r\r apply for long-term disability benefits, which are provided\r\r through a funded insurance program.", "\r\r DRC employees applying for short-term benefits\r\r receive two documents. ", " The first, a Medical Leave of Absence\r\r\r\r -2-\r 2\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r Notice (the \"Disability Notice\") describes the employee's\r\r rights and responsibilities under the program and requires\r\r certain information and an employee signature.1 The second\r\r form, a Physician's Certification of Disability form (the\r\r \"Certification Form\") is to be completed by the employee's\r\r physician and returned to DRC's benefits office. ", " The\r\r Disability Notice states that the employee \r\r must submit a completed Physician's\r Certification of Disability form (or a\r comparable note on physician's\r letterhead). ", " This must be received in\r the benefits office within 10 days of the\r date your leave commences or the date of\r this notice, whichever is later.", "\r \r The ten-day requirement also appears in a memorandum dated\r\r July 1, 1987, from DRC's benefits administrator, Patricia\r\r Nickles, to department managers. ", " The memorandum provides\r\r that\r\r [t]he employee has 10 days from the first\r day out to submit the signed medical\r leave letter and written medical\r certification to the Benefits office. ", " If\r this timeframe is not met, a time card\r will not be processed . . . .", "\r\r On or around December 4, 1987, Barbour went to see\r\r DRC's vice president of human resources, John Wilkinson, to\r\r discuss the process of applying for short-term disability\r\r benefits. ", " During his meeting with Wilkinson, Barbour\r\r received an undated Disability Notice and a Certification\r\r \r ____________________\r\r 1. ", " The record does not indicate when and if this form was\r returned and neither party focuses on this document.", "\r\r -3-\r 3\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r Form. ", " Barbour claims that Wilkinson told him the Disability\r\r Notice was undated in order to give him more time to obtain\r\r certification. ", " On December 7, without any apparent employer\r\r permission, Barbour commenced his absence from work. ", " On this\r\r same day, Barbour brought the Certification Form to the\r\r office of Dr. Kenneth Prescott, a hematologist who had been\r\r treating him for protracted bleeding. ", " Dr. Prescott was on\r\r vacation but his nurse informed Barbour that the doctor would\r\r return on December 16 and would complete the form at that\r\r time.", "\r\r On December 10, Nickles sent a certified letter to\r\r Barbour, stating that unless the Certification Form was\r\r returned to her office by December 18 -- eleven days after\r\r Barbour commenced his leave -- she would assume he had chosen\r\r voluntarily to terminate his employment. ", " This letter was\r\r never received by Barbour as it was incorrectly addressed.", "\r\r Although Nickles told Barbour about the letter during a\r\r December 15 phone conversation, Barbour claims that Nickles\r\r did not specifically tell him that he would be terminated if\r\r the certification was not received by December 18. ", " Barbour\r\r states that Nickles told him that he would be receiving a\r\r form letter but that he should not \"get shook\" and that DRC\r\r \"will work with you but keep in touch.\"", "\r\r On December 16, Dr. Prescott told Barbour that he\r\r was unwilling to sign the Certification Form and that it\r\r\r\r -4-\r 4\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r should be taken to a general practitioner. ", " Because Barbour\r\r was not under the care of a general practitioner at that\r\r time, he experienced difficulty in obtaining an immediate\r\r appointment. ", " Barbour says that he attempted to contact\r\r Wilkinson on December 16 to inform him of the delay, but\r\r claims that Wilkinson failed to return his phone calls.", "\r\r On December 22, Wilkinson called Barbour to ask\r\r about the status of the Certification Form. ", " After learning\r\r that Barbour had yet to set up an appointment with a general\r\r practitioner, Wilkinson suggested that Barbour continue his\r\r efforts at obtaining certification and told him that \"they\r\r would try to jump the hurdles.\" ", " In the meantime, however,\r\r Nickles and Wilkinson decided to begin the termination\r\r process and on December 22 mailed a certified letter to\r\r Barbour stating that his employment was being terminated for\r\r failure to comply with the ten-day deadline. ", " This letter too\r\r was mistakenly sent to the wrong address and was not received\r\r by Barbour until January 10, 1988.", "\r\r On December 30, Barbour finally saw Dr. Lawrence\r\r McCartin, a general practitioner. ", " During the appointment,\r\r Dr. McCartin told Barbour that he was suffering from a number\r\r of alcohol-related disabilities, including hypertension.", "\r\r Barbour asked the doctor to indicate on the Certification\r\r Form that his disability was caused by hypertension as he did\r\r not want alcoholism documented in his personnel file.", "\r\r\r\r -5-\r 5\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r Barbour picked up the completed form from Dr. McCartin's\r\r office on December 31 and delivered it to DRC on January 4,\r\r 1988, the next business day. ", " The form was stamped by Dr.\r\r McCartin and stated that Barbour was disabled \"indefinitely\"\r\r beginning December 18, 1987, due to hypertension.", "\r\r Upon receipt of the Certification Form, DRC\r\r proceeded to review Barbour's disability claim. ", " On January\r\r 7, Nickles called Dr. McCartin's office and learned that Dr.\r\r McCartin had seen Barbour only once, on December 30, two\r\r weeks after Barbour s disability allegedly began. ", " She also\r\r learned that Barbour had missed a follow-up appointment with\r\r Dr. McCartin scheduled for January 7. ", " DRC claims that, based\r\r on these circumstances, along with the fact that Barbour had\r\r not listed alcoholism as the cause of disability, it chose\r\r not to accept the form as a valid certification of disability\r\r and did not reinstate Barbour. ", " Nickles, in informing Barbour\r\r of DRC's decision by letter on January 7, stated:\r\r Unfortunately, I [Nickles] am unable to\r consider your claim for disability\r benefits. ", " As you already know, it was\r your responsibility to submit this\r documentation by December 18, 1987.", "\r Since we did not receive your paperwork\r by this deadline, you were considered to\r have voluntarily terminated your\r employment with DRC retroactive to\r December 4, 1987. ", "\r\r The record indicates that Barbour was the first\r\r employee ever terminated for failure to submit the\r\r Certification Form within ten days and that Certification\r\r\r -6-\r 6\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r Forms of other employees were received by DRC after the\r\r deadline had elapsed (between three and twenty days late).", "\r\r These employees apparently were not terminated or denied\r\r disability benefits. ", " The record also suggests that there\r\r were other instances in which employees turned in\r\r insufficient Certification Forms and it is not disputed that\r\r these employees were allowed to supplement their original\r\r forms, even though the ten-day period had expired. ", "\r\r After Barbour was terminated, he sought no medical\r\r treatment for a period of nine months. ", " In August 1988,\r\r Barbour stopped drinking but continued to suffer from a\r\r number of alcohol-related illnesses. ", " On April 5, 1991, the\r\r Social Security Administration adjudicated Barbour to have\r\r been disabled since December 4, 1987, the approximate date\r\r that his absence from work commenced.", "\r\r In June 1992, Barbour commenced this action in\r\r Massachusetts state court under section 510 of ERISA, 29\r\r U.S.C. 1140, alleging that DRC terminated him in order to\r\r deprive him of disability benefits. ", " DRC subsequently removed\r\r the case to the United States District Court for the District\r\r of Massachusetts. ", " At the close of discovery, both parties\r\r moved for summary judgment. ", " The district court granted DRC's\r\r motion, and Barbour thereafter filed a motion to reconsider.", "\r\r Upon the district court s refusal to reconsider, this appeal\r\r ensued.", "\r\r\r\r -7-\r 7\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r -8-\r 8\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r II.", "\r II.", "\r ___\r\r DISCUSSION\r DISCUSSION\r __________\r\r A. Summary Judgment Standard\r _____________________________\r\r As always, we review a grant of summary judgment de\r __\r\r novo. ", " Like the district court, we view the facts in the\r ____\r\r light most favorable to the non-moving party, drawing all\r\r reasonable inferences in that party's favor. ", " Woods v.\r _____\r\r Friction Materials, Inc., 30 F.3d 255, 259 (1st Cir. ", " 1994).", "\r ________________________\r\r Summary judgment is appropriate when \"the pleadings,\r\r depositions, answers to interrogatories, and admissions on\r\r file, together with the affidavits, if any, show that there\r\r is no genuine issue as to any material fact and that the\r\r moving party is entitled to judgment as a matter of law.\"", "\r\r Fed. ", " R. Civ. ", " P. 56(c). ", " As a prerequisite to summary\r\r judgment, a moving party must demonstrate \"an absence of\r\r evidence to support the non-moving party's case.\" ", " Celotex\r _______\r\r Corp. v. Catrett, 477 U.S. 317, 325 (1986). ", " Once the moving\r _____ _______\r\r party has properly supported its motion for summary judgment,\r\r the burden shifts to the non-moving party, who \"may not rest\r\r on mere allegations or denials of his pleading, but must set\r\r forth specific facts showing there is a genuine issue for\r\r trial.\" ", " Anderson v. Liberty Lobby, Inc., 477 U.S. 242, 256\r ________ ___________________\r\r (1986). ", " \r\r Even in an ERISA case \"where elusive concepts such\r\r as motive or intent are at issue, summary judgment may be\r\r\r\r -9-\r 9\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r appropriate if the nonmoving party rests merely upon\r\r conclusory allegations, improbable inferences, and\r\r unsupported speculation.\" ", " Goldman v. First Nat'l Bank of\r _______ _____________________\r\r Boston, 985 F.2d 1113, 1116 (1st Cir. ", "1993) (quoting Medina-\r ______ _______\r\r Munoz v. R.J. Reynolds Tobacco Co., 896 F.2d 5, 8 (1st Cir.", "\r _____ __________________________\r\r 1990)). ", " Thus, Fed. ", "R. Civ. ", " P. 56(c) \"mandates the entry of\r\r summary judgment . . . ", "upon motion against a party who fails\r\r to make a showing sufficient to establish the existence of an\r\r element essential to that party's case, and on which the\r\r party will bear the burden of proof at trial.\" ", " Celotex, 477\r _______\r\r U.S. at 322.", "\r\r B. Proving an ERISA section 510 Case\r _____________________________________\r\r 1. ", "The Legal Framework\r ______________________\r\r Section 510 of ERISA provides in part:\r\r It shall be unlawful for any person to\r discharge, fine, suspend, expel,\r discipline, or discriminate against a\r participant or beneficiary for exercising\r any right to which he is entitled under\r the provisions of an employee benefit\r plan . . . ", "for the purpose of interfering\r ______________________________\r with the attainment of any right to which\r _________________________________________\r such participant may become entitled\r _________________________________________\r under the plan . . . . ", "\r _______________________\r\r 29 U.S.C. 1140 (emphasis supplied). ", " The ultimate inquiry\r\r in a section 510 case is whether the employment action was\r\r taken with the specific intent of interfering with the\r\r employee's ERISA benefits. ", " Clark v. Coats & Clark, Inc., 990\r _____ ___________________\r\r F.2d 1217, 1222 (11th Cir. ", "1993); Biggins v. Hazen Paper Co.,\r _______ _______________\r\r 953 F.2d 1405, 1417 (1st Cir. ", "1992), vacated and remanded on\r _______ ___ ________ __\r\r\r -10-\r 10\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r other grounds, 113 S. Ct 1701 (1993); McGann v. H & H Music\r _____________ ______ ___________\r\r Co., 946 F.2d 401, 404 (5th Cir. ", "1991). ", " This \"specific\r ___\r\r intent\" requirement derives from the language of the ERISA\r\r statute (\"for the purpose of interfering\") and is necessary\r\r \"to separate the firings which have an incidental, albeit\r\r important, effect on an employee's . . ", " . ", "rights from the\r\r actionable firings, in which the effect of the firing on the\r\r employer's . . . ", "obligation was a motivating factor.\" ", " Dister\r ______\r\r v. Continental Group, Inc., 859 F.2d 1108, 1111 (2d Cir.", "\r ________________________\r\r 1988). ", " Thus, no ERISA cause of action will lie where the\r\r loss of benefits was a mere consequence of, but not a\r\r motivating factor behind, a termination of employment. ", " Id.\r ___\r\r Without such a requirement, every discharged employee could\r\r have a potential claim against his or her employer.", "\r\r In most cases, given that the employer controls the\r\r evidence related to intent, a plaintiff will be unable to\r\r adduce \"smoking gun\" evidence that the employer intended to\r\r interfere with his or her benefits. ", " An employer is unlikely\r\r to document such a motive, and there is rarely \"eyewitness\r\r testimony as to the employer's mental processes.\" ", " Dister,\r ______\r\r 859 F.2d at 1112 (quoting United States Postal Serv. ", "Bd. ", "of\r __________________________________\r\r Governors v. Aikens, 460 U.S. 711, 716 (1983)). ", " Therefore, a\r _________ ______\r\r plaintiff usually must rely on circumstantial evidence to\r\r prove his or her case.", "\r\r\r\r\r\r -11-\r 11\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r Where a plaintiff must resort to such evidence, the\r\r burden-shifting analysis used in Title VII employment\r\r discrimination cases is especially helpful. ", " It \"enables the\r\r trial judge to sift through the evidence in an orderly\r\r fashion to determine the ultimate question in the case--did\r\r the defendant discriminate against the plaintiff.\" ", " Dillon v.\r ______\r\r Voles, 746 F.2d 998, 1003 (3d Cir. ", " 1984). ", " Accordingly, a\r _____\r\r number of circuits have applied the McDonnell Douglas\r __________________\r\r framework to section 510 claims. ", " See, e.g., Humphreys v.\r ___ ____ _________\r\r Bellaire Corp., 966 F.2d 1037 (6th Cir. ", " 1992); Rath v.\r _______________ ____\r\r Selection Research, Inc., 978 F.2d 1087 (8th Cir. ", " 1992);\r _________________________\r\r Conkwright v. Westinghouse Elec. ", " Corp., 933 F.2d 231 (4th\r __________ _________________________\r\r Cir. ", "1990); Dister, 859 F.2d at 1108; Gavalik v. Continental\r ______ _______ ___________\r\r Can Co., 812 F.2d 834 (3d Cir. ", " 1987). ", " The district court\r ________\r\r appropriately employed the framework in this case, and we now\r\r do the same in assessing the propriety of the court's grant\r\r of defendant's motion for summary judgment.", "\r\r a. Prima Facie Case\r ________________\r\r In order to establish a prima facie case under\r\r section 510, a plaintiff must present sufficient evidence\r\r from which the employer's specific intent to interfere with\r\r the plaintiff's benefits can be inferred. ", " Dister, 859 F.2d\r ______\r\r at 1114-15. ", " Thus, a plaintiff must show that he or she (1)\r\r is entitled to ERISA's protection, (2) was qualified for the\r\r position, and (3) was discharged under circumstances that\r\r\r\r -12-\r 12\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r give rise to an inference of discrimination. ", " Id. at 1115.", "\r ___\r\r As in the Title VII context, the plaintiff's burden of proof\r\r at this stage is de minimis. ", " Id. at 1114-15.", "\r __ _______ ___\r\r Applying this standard to the instant case, Barbour\r\r has met his initial burden of producing evidence to support\r\r each of the elements of his prima facie case. ", " First, Barbour\r\r is a member of the protected class under the ERISA statute\r\r because he had the opportunity to attain a right under an\r\r employee benefit plan. ", " Second, Barbour has provided evidence\r\r that he was performing satisfactorily in his job. ", " DRC's\r\r performance evaluations indicate that Barbour met the\r\r characteristics of a \"fully qualified experienced employee.\"", "\r\r Finally, Barbour was attempting to obtain disability\r\r certification when the employment action was taken and\r\r benefits, if granted, would have been paid from defendant's\r\r general funds. ", " As the plaintiff's burden at the prima facie\r\r stage is de minimis, these circumstances are sufficient to\r __ _______\r\r give rise to an inference that DRC terminated Barbour in\r\r order to interfere with his disability benefits. ", " See Dister,\r ___ ______\r\r 859 F.2d at 1114 (plaintiff's discharge four months before\r\r certain pension benefits were due to vest, together with the\r\r substantial cost savings to the employer in denying pension\r\r benefits, were sufficient to raise an inference of specific\r\r intent at the prima facie stage); Zappia v. Nynex\r ______ _____\r\r Information, No. ", "90-11366-Y, 1993 WL 437676, at *3 (D. Mass.\r ___________\r\r\r\r -13-\r 13\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r Oct. 22, 1993) (employee's discharge while receiving\r\r disability benefits gives rise to a presumption of intent at\r\r the prima facie stage). ", "\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r -14-\r 14\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r b. Defendant's Non-Discriminatory Reason\r _____________________________________\r\r Once the plaintiff establishes a prima facie case,\r\r a presumption arises that the defendant acted unlawfully in\r\r denying the plaintiff ERISA benefits. ", " See St. Mary's Honor\r ___ ________________\r\r Ctr. ", "v. Hicks, 113 S. Ct. ", "2742, 2747 (1993) (Title VII). ", " In\r ____ _____\r\r Title VII cases, \"[t]his presumption `places upon the\r\r defendant the burden of producing an explanation to rebut the\r\r prima facie case--i.e., the burden of producing evidence that\r\r the adverse employment actions were taken for a legitimate,\r\r non-discriminatory reason.'\" ", " Udo v. Tomes, No. ", "94-1931, slip\r ___ _____\r\r op. ", "at 7 (1st Cir. ", "Apr. 28, 1995) (quoting Hicks, 113 S. Ct.", "\r _____\r\r at 2747). ", " In the ERISA context, this burden remains the\r\r same. ", " Dister, 859 F.2d at 1115. ", " Thus, the defendant must\r ______\r\r establish a legitimate, \"non-discriminatory\" reason -- i.e.,\r\r one unrelated to the plaintiff's entitlement to ERISA\r\r benefits -- for its actions toward the plaintiff.", "\r\r DRC claims that it terminated Barbour for failing\r\r to report to work or submit any medical certification of\r\r disability within ten days of the commencement of his leave.", "\r\r Although Barbour disputes the veracity of this justification,\r\r it is enough to satisfy DRC's \"relatively light\" burden.", "\r\r Fuentes v. Perskie, 32 F.3d 759, 763 (3d Cir. ", "1994). ", " As the\r _______ _______\r\r Supreme Court stated in Hicks, \"the determination that a\r _____\r\r defendant has met its burden of production (and has thus\r\r rebutted any legal presumption of intentional discrimination)\r\r\r\r -15-\r 15\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r can involve no credibility assessment. ", " For the burden-of-\r\r production determination necessarily precedes the credibility\r ________\r\r assessment stage.\" ", " 113 S. Ct. ", " at 2748 (emphasis in\r\r original).", "\r\r c. Barbour's Evidence of Pretext and Specific\r _______________________________________________\r\r Intent\r ______\r\r Once the defendant has met its burden of\r\r production, the presumption of intent established by the\r\r plaintiff's prima facie case \"drops out of the picture.\"", "\r\r Hicks, 113 S. Ct. ", "at 2749. ", " The burden of production shifts\r _____\r\r back to the plaintiff, who must prove that the defendant\r\r acted with the specific intent of interfering with the\r\r plaintiff's benefits. ", " Id. Thus, in order to survive a\r ___\r\r motion for summary judgment, a plaintiff must introduce\r\r evidence sufficient to support two findings: (1) that the\r\r employer's articulated reason for its employment actions was\r\r a pretext; and (2) that the true reason was to interfere with\r\r the plaintiff's receipt of benefits. ", " See Udo, slip op. ", "at 8\r ___ ___\r\r (citing Smith v. Stratus Computer, Inc., 40 F.3d 11, 16 (1st\r _____ _______________________\r\r Cir. ", "1994), cert. ", "denied, 115 S. Ct. ", "1958 (1995)).", "\r _____ ______\r\r Barbour argues that Hicks precludes summary\r _____\r\r judgment where there is sufficient evidence to conclude that\r\r the defendant's proffered reasons are a pretext. ", " Barbour\r\r contends that under Hicks, where the plaintiff has\r _____\r\r established a prima facie case and has shown that the\r\r\r\r -16-\r 16\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r employer's reasons are not worthy of credence, no additional\r\r proof of intent is required for the trier of fact to infer\r\r that the employer intended to interfere with the employee's\r\r benefits. ", " Barbour bases his argument on the passage in Hicks\r _____\r\r in which the Court stated that \"[t]he factfinder's disbelief\r\r of the reasons put forward by the defendant (particularly if\r\r disbelief is accompanied by a suspicion of mendacity) may,\r\r together with the elements of the prima facie case, suffice\r\r to show intentional discrimination.\" ", " Hicks, 113 S. Ct. ", " at\r _____\r\r 2749. ", " Barbour's argument, however, was foreclosed by our\r\r decision in Woods, in which we interpreted the quoted passage\r _____\r\r from Hicks to make clear \r _____\r\r that the Supreme Court envisioned that\r some cases exist where a prima facie case\r and the disbelief of pretext could\r provide a strong enough inference of\r actual discrimination to permit the\r factfinder to find for the plaintiff.", "\r Conversely, we do not think that the\r Supreme Court meant to say that such a\r finding would always be permissible . . .", "\r . ", " The strength of the prima facie case\r and the significance of the disbelieved\r pretext will vary from case to case\r depending on the circumstances. ", "\r\r Woods, 30 F.3d at 261 n.3. ", " Thus, whether the plaintiff\r\r relies solely on his prima facie case and evidence of pretext\r\r or has additional evidence of specific intent as well, the\r\r plaintiff must always adduce evidence sufficient for a\r ______\r\r rational jury to conclude that the employer's action was\r\r motivated by an intent to interfere with ERISA benefits.", "\r\r\r\r -17-\r 17\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r Because Barbour relies largely on the same evidence to prove\r\r both pretext and specific intent, we now assess the sum of\r\r that evidence and explain why it is insufficient to carry\r\r Barbour's burden.", "\r\r Barbour points to several facts both disputed and\r\r undisputed that he claims could lead a reasonable juror to\r\r infer that DRC's motivation was to interfere with his receipt\r\r of disability benefits. ", " Barbour contends that he was\r\r deliberately led into a situation in which DRC could use a\r\r non-existent rule to terminate him. ", " As evidence of this,\r\r Barbour points to Wilkinson's provision of an undated\r\r Disability Notice on December 4 in order to give him more\r\r time to obtain certification, Nickles's alleged failure to\r\r state specifically that the Certification Form had to be\r\r returned by a particular date,2 and Wilkinson's instruction\r\r to Barbour on December 22 that he should continue with his\r\r efforts to obtain certification despite his difficulties. ", " We\r\r fail to see how a rational jury could conclude from these\r\r facts that DRC deliberately misled Barbour into believing he\r\r could take as much time as he needed to submit the\r\r Certification Form. ", " No reasonable employee would assume that\r\r \r ____________________\r\r 2. ", " DRC disputes this allegation and claims that Nickles told\r Barbour on two occasions that the Certification Form was due\r in the benefits office by December 18. ", " Even Barbour concedes\r that Nickles told him to return the form \"as early as\r possible.\" ", " Because this is a motion for summary judgment,\r however, we will review the facts in the light most favorable\r to Barbour. ", "\r\r -18-\r 18\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r he or she had an unlimited time period in which to justify an\r _________\r\r absence. ", " Here, the Disability Notice Barbour received stated\r\r very clearly that a certification of disability had to be\r\r provided no later than ten days from the date of the form or\r\r the commencement of the leave, whichever was later. ", " Since\r\r the Disability Notice was undated, Barbour had unequivocal\r\r notice that his ten-day period began to run on December 7,\r\r when he voluntarily commenced his leave. ", " That Wilkinson and\r\r Nickles told Barbour to continue with his certification\r\r efforts when it was apparent that he could not comply with\r\r the deadline does not in any way indicate a deliberate plan\r\r to mislead; to the contrary, it demonstrates that they were\r\r still willing to consider his claim. ", " Barbour's own account\r\r of his conversation with Wilkinson on December 22 indicates\r\r that Wilkinson essentially told Barbour that DRC would see\r\r what it could do although he made no promises.3\r\r \r ____________________\r\r 3. ", " With respect to our dissenting brother, his\r characterization of this conversation is but one in a series\r of skewed presentations of the evidence that, taken together,\r he argues would permit a rational jury to conclude that DRC\r managers conspired to \"induce\" Barbour to take medical leave\r and \"lull\" him into believing there would be no consequences\r for failing to return the medical forms on time. ", " First, the\r dissent suggests that DRC had approved a \"medical disability\r leave\" when Barbour voluntarily began his absence from work\r on December 7. ", " Infra at 24. ", " Although DRC provided Barbour\r _____\r with the proper forms, the record contains no support for the\r inference that Barbour's absence beginning on that day was\r approved or induced by DRC. ", " Our brother finds further\r support for his conspiracy theory in the fact that on\r December 22, Barbour was \"told [by Wilkinson] to continue to\r ____ __ ________ __\r seek medical certification.\" ", " Infra at 26. ", " Barbour's own\r ____ _______ _____________ _____\r notes, however, state that Wilkinson actually told him that\r\r -19-\r 19\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r \r ____________________\r\r he should \"keep going with the Dr. certificate and they would\r ___ ____ _____\r try to jump hurdles,\" and that \"we will see if we can salvage\r ___ __ ____ _______\r this thing.\" ", " Wilkinson's choice of words belies Barbour's\r assertion that DRC soft-pedaled the trouble he was in. ", " The\r assertion is further belied by Barbour's own notes of his\r conversation with Nickles on December 15, in which he\r recorded that Nickles told him that he should not \"get shook\"\r by the form letter she had sent him, and by Barbour's\r December 18 message for Nickles in which he told her that he\r did not want to terminate. ", " See infra at 25. ", " Why should\r ___ _____\r Barbour \"get shook\" at all by a form letter unless he knew it\r contained some kind of ominous warning? ", " And, if Barbour had\r no idea that he was flirting with termination on December 18,\r __ ____\r why did he leave a message for Nickles stating that he did\r \"not want to terminate\"? ", " The particular inferences the\r dissent would permit the jury to draw from this (and other)\r evidence -- that DRC lured an unwary Barbour into a\r bureaucratic trap -- are patently unreasonable on this\r record.", "\r Similarly misleading is the dissent's suggestion\r that DRC's misaddressing of the December 10 letter to\r Barbour, and, in the dissent's underlined language, the fact\r that Nickles \"did [not] ask for Barbour's correct mailing\r ___ ___ ___ ___ _________ _______ _______\r address\" when she spoke to him on December 15, were evidence\r _______\r of nefarious doings. ", " Infra at 24 n.1, 25. ", " The December 10\r _____\r letter was addressed to Barbour at \"P.O. Box 215, 88 Rogers.\"", "\r He had apparently stopped using the postal box; the street\r address, however, was correct. ", " One cannot rationally infer\r __________\r from this that Nickles intended that Barbour would not\r ________\r receive the letter; the fact that Nickles put both addresses\r ____\r on the envelopes -- with at least a reasonable probability\r that the postal service would direct the envelope to the\r correct address -- is mighty strong evidence of mistake and\r not deliberation. ", " That Nickles failed to ask for Barbour's\r correct mailing address, simply in light of the fact that a\r letter sent a few day earlier had not arrived yet, is of even\r less evidentiary value; it proves absolutely nothing. ", "\r To cite a final example of the dissent's\r indefensible inference-drawing, we are at a loss to\r understand what possible weight is added to Barbour's case by\r the statements of Wilkinson's secretary to Barbour on\r December 31. ", " Infra at 26. ", " The dissent cites this as a\r _____\r \"vicarious admission,\" but of what? ", " Even assuming that the\r secretary's statements concerned matters within the scope of\r her employment, what permissible negative inference could a\r rational jury draw from the fact that DRC \"evinced its\r readiness to receive the medical form\" even after Barbour had\r been formally terminated? ", " Whatever inferential leap our\r\r -20-\r 20\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r Barbour also argues that the fact that the penalty\r\r of termination for failure to comply with the ten-day\r\r deadline is not stated in any of DRC's written policies is\r\r evidence that DRC fabricated the \"policy\" in order to\r\r interfere with his benefits. ", " In support of this argument,\r\r Barbour directs us to the undisputed fact that he was the\r\r first employee ever terminated by DRC for failing to comply\r\r with the deadline. ", " In addition, Barbour presents\r\r Certification Forms of other employees submitted after the\r\r deadline had elapsed and there is no evidence indicating that\r\r these employees were terminated or denied disability benefits\r\r for their late submissions. ", "\r\r Even viewing the facts in the light most favorable\r\r to Barbour, we agree with the district court that at most\r\r these facts show that DRC may have acted inconsistently in\r\r its application of the policy regarding employees who turned\r\r in their Certification Forms late. ", " Such evidence, standing\r\r alone, is insufficient to demonstrate intent unless the\r\r inconsistent application is linked with a motivation to\r\r deprive the employee of benefits. ", " See, e.g., Fong v.\r ___ ____ ____\r\r\r \r ____________________\r\r brother is making here escapes us.", "\r Contrary to the dissent's characterization of our\r holding, we do not mean to imply that the total assemblage of\r evidence compels a particular conclusion; rather, we hold\r _______\r that the conclusion that Barbour would have a rational jury\r ________\r draw -- namely, that DRC set Barbour up to apply for medical\r leave so that it could fire him, and then lied about it -- is\r impermissible based on this evidence. ", "\r\r -21-\r 21\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r American Airlines, Inc., 626 F.2d 759, 762 (9th Cir. ", "1980);\r _______________________\r\r Teumer v. General Motors Corp., 840 F. Supp. ", "538, 548-50\r ______ _____________________\r\r (N.D. Ill. 1993) (holding that in an action under section 510\r\r of ERISA, the plaintiff cannot show pretext simply by\r\r demonstrating that the defendant applied its recall policy in\r\r an inconsistent manner, but must adduce facts that allow the\r\r court to infer that the defendant had the specific intent of\r\r interfering with plaintiff's benefits), aff'd, 34 F.3d 542\r _____\r\r (7th Cir. ", "1994).", "\r\r Here, we do not believe that specific intent can be\r\r inferred from the fact that Barbour was the first employee\r\r ever terminated for missing the ten-day deadline. ", " The\r\r Disability Notice clearly states that an employee must\r ____\r\r provide medical certification within ten days; as we stated\r\r above, no reasonable employee would assume that he or she had\r\r an unlimited time in which to provide it. ", " The summary\r\r judgment record indicates that DRC's decision not to\r\r terminate other employees who submitted Certification Forms\r\r late were based on extenuating circumstances absent from this\r\r case. ", " For example, DRC had previously extended the deadline\r\r when an employee's physician contacted DRC and advised it\r\r that he or she would be unable to complete the form within\r\r the specified time period. ", " Similarly, extensions were also\r\r granted where an employee was hospitalized and unable to\r\r complete the form in a timely manner.", "\r\r\r\r -22-\r 22\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r In this case, DRC was never contacted by a\r\r physician regarding Barbour's illness, and Barbour was not\r\r hospitalized. ", " Having received the Disability Notice clearly\r\r notifying him of the ten-day deadline, Barbour then failed to\r\r obtain an appointment with a physician willing to sign the\r\r form until December 30. ", " While the delay in obtaining a\r\r doctor's signature may not have been entirely his fault, it\r\r was Barbour's choice to begin his absence on December 7,\r _________\r\r without any assurance that he would obtain certification of\r\r disability within ten days. ", " By December 22, DRC had not\r\r received any certification of disability and Barbour had\r\r informed Wilkinson that no future doctor's appointment had\r\r been arranged. ", " It was this circumstance that caused DRC to\r\r mail the December 22 termination letter to Barbour. ", " An\r\r employer need not remain idle indefinitely while an employee\r\r is absent without excuse. ", " While DRC may have chosen not to\r\r discharge other employees for missing the certification\r\r deadline, Barbour's case does not present similar extenuating\r\r circumstances and, therefore, specific intent cannot be\r\r inferred from DRC's actions. ", " Cf. ", "Stratus, 40 F.3d at 17\r ___ _______\r\r (Title VII plaintiff alleging disparate treatment must show\r\r that he or she was treated differently from persons similarly\r\r situated in all relevant aspects).", "\r\r In addition, DRC's actions when Barbour finally did\r\r submit certification make Barbour's claim of unlawful\r\r\r\r -23-\r 23\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r motivation even more implausible. ", " Despite Barbour's failure\r\r to comply with express company policy, DRC nevertheless\r\r reviewed Barbour's disability claim on January 7. ", " Although\r\r the form was submitted over two weeks late, Nickles called\r\r Dr. McCartin to inquire about the listed disability of\r\r \"hypertension.\" ", " Based on what she learned in that\r\r conversation, DRC chose not to accept Barbour's form as a\r\r valid certification of disability.4 Even if DRC was\r\r mistaken in its evaluation of Barbour's disability, as long\r\r as that determination was in good faith and formed the basis\r\r of the decision it is permissible under section 510. ", " Zappia,\r ______\r\r 1993 WL 437676 at *3. ", " Barbour has failed to produce any\r\r evidence of bad faith.", "\r\r Barbour next argues that specific intent can be\r\r inferred from the mere fact that DRC knew he was in the\r\r process of applying for benefits at the time of termination.", "\r\r It is undisputed that Barbour informed Wilkinson on or around\r\r December 4 that he was considering applying for disability\r\r\r \r ____________________\r\r 4. ", " In fact, DRC set forth five justifications for its\r decision to deny Barbour's disability claim: (1) Dr. McCartin\r did not see Barbour until December 30, two weeks after the\r disability allegedly began; (2) the condition listed on the\r form, \"hypertension,\" was different than the alcohol problem\r or bleeding condition which was expected given Barbour's\r previous statements to DRC supervisors; (3) Barbour appeared\r to have been \"shopping around\" for a physician after Dr.\r Prescott refused to complete the form; (4) the length of\r disability (undetermined) did not coincide with medical\r guidelines; and (5) Barbour failed to keep his follow-up\r appointment with Dr. McCartin scheduled for January 7. ", "\r\r -24-\r 24\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r leave. ", " It is also undisputed that during their discussion,\r\r Barbour and Wilkinson discussed the odor of alcohol on\r\r Barbour's breath and the possibility of an alcohol problem.", "\r\r However, these facts add little to Barbour's proof: \"[E]ven\r\r if [Barbour] could establish that [DRC] knew that [Barbour]\r\r definitely planned to apply for . . . ", "disability benefits, he\r\r would still be required to offer some evidence that this\r\r knowledge somehow influenced\" DRC's employment actions.", "\r\r Corcoran v. GAB Business Servs., ", " Inc., 723 F. Supp. ", "966, 971\r ________ __________________________\r\r (S.D.N.Y. 1989). ", " As was the case in Corcoran, Barbour has\r ________\r\r failed to produce any evidence suggesting that the prospect\r\r of paying disability benefits influenced DRC's decisions. ", " To\r\r the contrary, we find it significant that the option of a\r\r medical leave of absence was first suggested by DRC.", "\r\r Barbour's supervisor, Zimmerman, approached Barbour and\r\r suggested that he apply for a medical leave to address his\r\r alcohol problem. ", " Prior to their discussion, Barbour was\r\r unaware that he would even qualify for disability benefits.", "\r\r We think it is highly unlikely that DRC would have suggested\r\r such an option if it ultimately intended to deprive Barbour\r\r of benefits: DRC had no way of knowing that Barbour would\r\r fail to submit the proper documentation.", "\r\r Barbour finally suggests that a factfinder could\r\r infer unlawful intent if DRC imposed criteria on Barbour that\r\r were harsher than that imposed on other employees whose\r\r\r\r -25-\r 25\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r illnesses were less likely to lead to permanent long-term\r\r disability. ", " Even if such an inference would be permissible,\r\r Barbour has produced no evidence that his illness was more\r\r likely to lead to long-term disability. ", " In fact, the\r\r evidence strongly suggests that DRC would have granted\r\r Barbour disability benefits had he submitted appropriate\r\r documentation of his alcohol condition. ", " In 1987 and 1988,\r\r DRC provided disability benefits to all seventy-six other\r\r employees who applied for disability benefits. ", " Of these, at\r\r least sixteen employees applied for and received disability\r\r benefits for conditions related to the abuse of alcohol.", "\r\r In sum, we hold that Barbour has failed to present\r\r evidence that would enable a reasonable jury to conclude that\r\r DRC's actions were motivated by a desire to interfere with\r\r Barbour's benefits.", "\r\r III.", "\r III.", "\r ____\r\r CONCLUSION\r CONCLUSION\r __________\r\r Because Barbour has failed to raise an issue of\r\r fact as to whether DRC intended to interfere with his ERISA\r\r benefits, the district court properly granted summary\r\r judgment in favor of DRC on Barbour's ERISA claim.", "\r\r Affirmed.", "\r _________\r\r\r\r\r\r\r\r\r\r -26-\r 26\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r Dissent follows.", "\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r -27-\r 27\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r CYR, Circuit Judge (dissenting). ", " The court aptly\r CYR, Circuit Judge (dissenting).", "\r ______________\r\r acknowledges, supra at p. 15, that an inference of\r _____\r\r intentional discrimination is \"particularly\" appropriate\r\r where a \"finding of pretext is accompanied by a suspicion of\r\r mendacity,\" Hicks, 113 S. Ct. ", "at 2749, but then abandons\r _____\r\r basic summary judgment procedure en route to its holding that\r\r fair findings of pretext and suspicion of mendacity are\r\r precluded on the present record. ", " Allowed their rightful\r\r role, the incumbent requirements that all credibility\r\r assessments and fair inferences be indulged favorably to the\r\r party resisting summary judgment, Woodman v. Haemonetics\r _______ ___________\r\r Corp., 51 F.3d 1087, 1091 (1st Cir. ", " 1995), do not admit of\r _____\r\r the findings the court deems compelled. ", " \r _________\r\r Conspicuously affected by alcoholism and in poor\r\r health, Barbour had used much of his sick leave by December\r\r 4, 1987. ", " On that day, his supervisor, Earl Zimmerman, called\r\r Barbour aside and asked whether he had considered taking\r\r long-term medical disability leave (\"medical disability\r\r leave\"). ", " Upon learning that Barbour had never considered it,\r\r Zimmerman urged him to do so: \"It's a good deal, and I don't\r\r see why you shouldn't qualify for it. ", " I really would like to\r\r call John Wilkinson [DRC vice-president for human resources]\r\r . . . ", "and tell him you are on the way down to see him and do\r\r that.\" ", " \r\r\r\r\r\r -28-\r 28\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r On Zimmerman's advice, Barbour went to see\r\r Wilkinson, who handed him an undated medical disability leave\r _______\r\r form to be returned \"within 10 days of the date your leave\r\r commences or the date of this notice, whichever is later.\"", "\r __ _____\r\r (emphasis added). ", " The form itself made no mention that\r\r failure to file on time could result in termination, nor did\r\r Wilkinson ever mention that it should be returned by a date\r\r certain.", "\r\r On December 7, Barbour went on medical disability\r\r leave. ", " Three days later, Patricia Nickles, the benefits\r\r administrator for DRC, mailed a certified letter warning that\r\r Barbour could be terminated if he did not return the enclosed\r\r medical certification form (dated December 10) by December\r\r 18. ", " As the letter was misaddressed, Barbour never received\r\r it.5 \r\r There is no record evidence that DRC had ever\r\r terminated or threatened to terminate an employee for failing\r\r to comply with the ten-day filing provision. ", " Rather, on at\r\r least ten occasions DRC had accepted late medical\r\r certification forms. ", " Moreover, this marked the first time\r\r\r\r\r\r\r \r ____________________\r\r 5. ", " Although DRC had the correct street address, the letter\r had been addressed to a post office box (as well as a street\r address) which Barbour had relinquished sometime after he\r moved in 1984. ", "\r\r -29-\r 29\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r that any DRC employee had ever been threatened with adverse\r\r action before the ten-day filing period had expired.6\r\r On December 15, Barbour called to advise Nickles\r\r that he had been unable to return the medical form because\r\r his physician had been on vacation. ", " During their\r\r conversation, Barbour informed Nickles that he had never\r\r received a certified letter dated December 10. ", " In response,\r\r Nickles simply reassured Barbour that a \"form letter [had\r\r been] sent out. ", " Don't get shook. ", " We will work with you but\r\r keep in touch.\" ", " She never mentioned that failure to return\r\r the completed form within the next three days could, let\r\r alone would, lead to Barbour's termination. ", " Moreover, though\r\r she knew Barbour had never received the December 10 letter\r ________\r\r warning that termination could result unless the form were\r\r returned by December 18, Nickles neither mailed nor handed\r\r Barbour another copy, nor did she ask for Barbour's correct\r ___ ___ ___ ___ ___ _________ _______\r\r mailing address. ", " \r _______ _______\r\r On December 16, Barbour's physician, a specialist\r\r in hematology, advised him that the certification form should\r\r be completed by a general practitioner. ", " Although Barbour\r\r left telephone messages with John Wilkinson's office, so\r\r informing him, the calls were never returned. ", " Two days\r\r \r ____________________\r\r 6. ", " On one other occasion, in early 1988, DRC warned an\r employee nineteen days after the ten-day period had elapsed.", "\r _____\r Thus, the record supports a fair inference that the ten-day\r provision was being applied inconsistently or selectively at\r or about the time Barbour was terminated. ", "\r\r -30-\r 30\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r later, on December 18 unbeknownst to Barbour the deadline\r ________\r\r for filing the medical form he left a telephone message\r\r for Nickles: \"If you don't reach [me] this morning, [I'll]\r\r get to you this afternoon. ", " Having trouble getting doctor's\r\r signature. ", " [Don't] want to terminate.\" (", "emphasis added).", "\r _____ ____ __ _________\r\r On December 21, after conferring with Wilkinson,\r _____ __________ ____ _________\r\r Nickles telephoned to tell Barbour that he had been\r\r terminated for failure to return the medical forms by\r\r December 18. ", " During their telephone conversation, Barbour\r\r volunteered his correct mailing address. ", " On December 22,\r\r Nickles mailed Barbour a notice of voluntary termination\r _________ ___________\r\r based on his failure to return the required medical form by\r\r December 18. ", " That same day, in the belief that Wilkinson,\r\r rather than Nickles, had the authority to act in behalf of\r\r DRC, Barbour contacted Wilkinson and was told to continue to\r _________ ____ __ ________ __\r\r seek medical certification.", "\r ____ _______ _____________\r\r On December 30, Barbour was examined by a general\r\r practitioner, who diagnosed hypertension. ", " At 9:45 a.m. the\r\r following day, Barbour was advised by the doctor's office\r\r that the signed medical certification form could be picked\r\r up. ", " Barbour immediately informed Wilkinson, through his\r ________ _________\r\r secretary, that the form had been signed. ", " The record is\r\r silent as to whether he told the secretary that he did not\r\r yet have the form in hand. ", " The secretary told Barbour that\r\r was \"fine\" and Barbour should \"bring [the] form over today.\"", "\r ____\r\r\r\r -31-\r 31\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r (emphasis added). ", " Thus, as late as December 31, DRC had\r\r evinced its readiness to receive the medical form. ", " See id.\r ___ ___\r\r at 1094 (vicarious admissions by employee). ", "\r\r Barbour did not pick up the form on December 31,\r\r due to car trouble. ", " When he called DRC during the afternoon\r\r of December 31 to explain the delay, no one answered the\r\r telephone. ", " Due to the New Year holiday, the medical\r\r certification form was not received by Barbour until January\r\r 4, 1988, the next business day. ", " He delivered it to DRC the\r\r same day. ", " Yet on January 7, after conferring with Wilkinson,\r _____ __________ ____ _________\r\r Nickles sent a certified letter to Barbour informing him that\r\r his claim for medical benefits would not be considered\r _____ ___ __ __________\r\r because Barbour had failed to comply with the ten-day filing\r\r provision.7 On January 10, 1988, Barbour finally received\r\r the missent termination letter dated December 22, 1987.", "\r\r A rational factfinder reasonably could infer from\r\r the foregoing evidence that DRC not only induced Barbour to\r\r take medical disability leave but that it utilized its\r\r hitherto dormant ten-day filing provision as a pretext for\r\r \r ____________________\r\r 7. ", " Notwithstanding its categorical notification to Barbour\r that the disability benefits application would not be\r considered, DRC now contends on appeal that it was considered\r and rejected on the basis of late submission and because the\r ___ _______ ___\r disability claim was based on hypertension, not alcoholism.", "\r __________ _____ ___ _____ __ ____________ ___ __________\r Should this belated representation be credited by the\r factfinder, it could buttress the inference that failure to\r file the form within ten days was not the true motive for\r ____\r terminating Barbour. ", " In these circumstances, Barbour need\r demonstrate no more at summary judgment. ", " See Woodman, 51\r ___ _______\r F.3d at 1094. ", "\r\r -32-\r 32\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r terminating Barbour after it had misled and lulled him into\r\r believing that the ten-day provision would not be enforced as\r ___\r\r a ground for termination, all in order to avoid liability for\r\r an ERISA-based medical disability claim. ", " See id. at 1094. ", "\r ___ ___\r\r First, short of ignoring the summary judgment\r\r prescripts that all credibility assessments and reasonable\r\r inferences are to favor Barbour, see id. at 1091, it cannot\r ___ ___\r\r be inferred that Barbour was ever informed, until after the\r _____ _____ ___\r\r ten-day period had expired, that his employment could be \r _______ ______ ___ _______\r\r let alone would be terminated for tardiness in filing the\r __________\r\r medical certification form. ", " On the other hand, the trier of\r\r fact reasonably could infer from Barbour's initial\r\r conversation with John Wilkinson, at which time Barbour was\r\r handed an undated medical certification form, that Wilkinson\r\r implicitly assured him that the ten-day provision would not\r\r be enforced against him. ", " Such an inference is strengthened\r\r by the December 15 statement Nickles made to Barbour, that\r\r though a certified letter had been sent to Barbour, he should\r\r not \"get shook. ", " We will work with you but keep in touch.\" ", " \r\r Second, even after Barbour was notified that he had\r\r been terminated, he received decidedly mixed signals from\r\r DRC. ", " Although Nickles informed him that he had been\r\r terminated, her superior Wilkinson as late as December\r ________\r\r 31 held open the prospect that DRC would accept the medical\r\r form. ", " Not until January 10, 1988, when he finally received\r\r\r\r -33-\r 33\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r the misaddressed December 22, 1987, termination letter, and\r\r the January 7 letter informing him that the disability claim\r\r application would not be considered, was Barbour unambiguous-\r\r ly informed of the consequences of failing to comply with the\r\r ten-day provision. ", " By then, of course, it was too late. ", "\r\r Finally, the bald statement in the December 22\r\r termination letter that DRC had presumed based on his\r ________\r\r failure to return the medical forms that Barbour had\r\r voluntarily terminated his employment, notwithstanding his\r ___________ __________\r\r flat advice to the contrary on December 18, see supra p. 4,\r ___ _____\r\r and his ongoing efforts to obtain medical certification at\r\r DRC's suggestion, imperatively bespeaks pretext and mendacity\r\r with sufficient clarity to demonstrate that the inferences\r\r relied on by DRC, and endorsed by the majority, are not\r\r compelled.8 \r _________\r\r Since it cannot be demonstrated without\r\r indulging impermissible inferences and credibility\r\r assessments that a rational factfinder would be compelled\r _________\r\r to find that DRC did not actively encourage Barbour to take\r __ ____ ___ ___\r\r medical disability leave before obtaining medical\r\r certification, then lull him into the fateful belief that\r\r\r \r ____________________\r\r 8. ", " The spirited argument advanced by the court in defense of\r the inferences it deems compelled, see supra note 3,\r ___ _____\r necessarily presumes that the employer's undeniably\r ambivalent conduct can only have been activated by the\r innocent intent and motives ascribed to it by the court an\r exercise appropriately reserved for the factfinder.", "\r\r -34-\r 34\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r strict compliance with its ambivalent ten-day filing policy\r\r would not be enforced, id. at 1094-95 (prima facie case,\r ___ _____ _____\r\r combined with showing of pretext and suspicion of mendacity,\r\r precludes summary judgment on issue of intentional\r\r discrimination); see generally, Hicks, 113 S. Ct. ", " at 2749,\r ___ _________ _____\r\r 2749 n.4 & 2756 (where plaintiff adduces enough competent\r\r evidence to support inference of discrimination, the case\r\r must go to the trier of fact), I respectfully dissent.", "\r _ ____________ _______\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r\r -35-\r 35\r\r\r\r\r\r\r\r\r\r\r\r\r\r\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.01567398119122257, 0.014388489208633094, 0, 0.005305039787798408, 0.009708737864077669, 0.004651162790697674, 0, 0, 0.005141388174807198, 0, 0, 0.004405286343612335, 0.01818181818181818, 0, 0, 0, 0, 0.0017006802721088435, 0.003424657534246575, 0, 0.009389671361502348, 0, 0, 0.004016064257028112, 0, 0, 0, 0.006289308176100629, 0, 0.0047169811320754715, 0, 0, 0.010752688172043012, 0.003424657534246575, 0, 0.0031847133757961785, 0, 0.005208333333333333, 0.007462686567164179, 0.0034602076124567475, 0.003215434083601286, 0, 0.008064516129032258, 0.005681818181818182, 0, 0, 0, 0, 0.004405286343612335, 0.0072992700729927005, 0.0034129692832764505, 0.00392156862745098, 0, 0, 0, 0, 0, 0, 0, 0.004464285714285714, 0.0036363636363636364, 0, 0, 0.009259259259259259, 0, 0, 0, 0.0022371364653243847, 0, 0, 0, 0, 0.05263157894736842, 0, 0, 0, 0.014184397163120567, 0, 0.015625, 0, 0.018518518518518517, 0.005847953216374269, 0, 0.07692307692307693, 0.125, 0, 0.004016064257028112, 0, 0, 0, 0, 0, 0.004694835680751174, 0, 0.006578947368421052, 0.004866180048661801, 0, 0, 0, 0, 0, 0.00641025641025641, 0, 0, 0, 0, 0, 0.006622516556291391, 0, 0.007246376811594203, 0, 0, 0, 0, 0, 0.004329004329004329, 0.00641025641025641, 0.006493506493506494, 0, 0, 0.011299435028248588, 0, 0, 0.0027247956403269754, 0, 0.002717391304347826, 0, 0, 0, 0, 0, 0.009433962264150943, 0.006369426751592357, 0, 0, 0, 0, 0, 0.008695652173913044, 0, 0, 0, 0, 0, 0.0625, 0.024390243902439025, 0, 0, 0.03571428571428571, 0, 0, 0, 0.03333333333333333, 0, 0.0021231422505307855, 0, 0, 0, 0, 0.03125, 0, 0, 0, 0, 0.004761904761904762, 0, 0.05263157894736842, 0, 0.0032679738562091504, 0, 0.0041928721174004195, 0, 0, 0.003289473684210526, 0.005208333333333333, 0, 0, 0, 0, 0, 0.0037735849056603774, 0, 0.001834862385321101, 0, 0, 0.005434782608695652, 0, 0, 0, 0.003703703703703704, 0.004694835680751174, 0, 0.0031446540880503146, 0, 0.0053475935828877, 0, 0.0038910505836575876, 0, 0, 0.0016806722689075631, 0, 0.0024096385542168677, 0.05, 0, 0.004366812227074236, 0, 0, 0, 0, 0, 0, 0, 0.003105590062111801, 0, 0, 0.002777777777777778, 0.002066115702479339, 0, 0, 0.005714285714285714, 0, 0, 0, 0.005714285714285714, 0.009523809523809525, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0030303030303030303, 0.004761904761904762, 0, 0, 0.006578947368421052, 0, 0, 0.006535947712418301, 0, 0, 0.0024271844660194173, 0, 0, 0, 0.00425531914893617, 0.0048367593712212815, 0, 0.004901960784313725, 0.0049504950495049506, 0.005780346820809248, 0, 0.05, 0, 0.00398406374501992, 0, 0, 0.00847457627118644, 0.0035842293906810036, 0, 0, 0, 0, 0, 0, 0, 0, 0.002070393374741201, 0, 0, 0, 0, 0, 0, 0, 0, 0.0044444444444444444, 0.0044444444444444444, 0, 0.00847457627118644, 0, 0.002173913043478261, 0, 0.004672897196261682, 0, 0.006734006734006734, 0.003484320557491289, 0, 0, 0, 0.004395604395604396, 0, 0, 0, 0, 0.0056179775280898875, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.006389776357827476, 0, 0, 0.005681818181818182, 0, 0.009259259259259259, 0, 0, 0, 0, 0, 0, 0, 0.001763668430335097, 0, 0, 0, 0, 0.008695652173913044, 0.0022471910112359553, 0, 0, 0.002688172043010753, 0, 0, 0.0058823529411764705, 0.0038022813688212928, 0, 0, 0.00065359477124183, 0, 0.0018552875695732839, 0, 0 ]

[ "Archive for the ‘Independent Foreign Fiction Prize 2012’ Category\n\nThis is a novel I probably would not have read had it not made it onto the Independent Foreign Fiction Prize shortlist. ", "There’s something about that single name that says both quirky and indulgent (Prince? ", "Bidisha? (", "again, never actually read her due to my single name prejudice) Bjork?). ", "Speaking of Bjork, Sjon also writes song lyrics and has worked with her in the past – they’re both Icelandic – another anti-recommendation in my view. ", "At this point I’d love to say either: a) I was so right – it’s terrible; or b) I was so wrong – it’s amazing. ", "Unfortunately, life is never that straightforward (just ask Jonas Palmason, the novel’s protagonist) and both convictions were predominant at different points in my reading – in fact, it’s a while since I read a book that left me so undecided.", "\n\nThe novel opens in Iceland in 1635 where we find Jonas exiled to a barren island with his wife for offending his country’s religious authorities:\n\n“Jonas is a rogue, Jonas is a sly, disreputable fellow, Jonas is a braggart, Jonas is a liar, Jonas is a foolish dreamer…”\n\nJonas exists at a time when science and superstition coincide. ", "His enquiring mind is demonstrated in the descriptions of plants and animals that litter the text, providing a little relief from his often intense monologue. ", "From his childhood he is regarded as a healer and we learn that he searched in vain for the healing stone bezoar which he hoped to find in the skulls of ravens. ", "It is his healing which eventually leads to his exile:\n\n“But the leechbook would later land me in such desperate straits that I will never again be able to return to society but am fated instead to sit here talking nonsense to birds.”", "\n\nOnly in one brief section of the novel (where we are transferred temporarily to third person) does Jonas leave the island, being taken to Copenhagen where he meets with the learned professor Ole Worm. ", "They bond when Jonas identifies a unicorn’s horn belonging to the Danish King as that of a narwhal – an instance of science beginning to challenge superstition:\n\n“For the next three decades the brightest luminaries of Western philosophy wrangled over the existence of the fantastic horned beast…until the sceptics finally prevailed.”", "\n\nHowever, this period of happiness soon ends when Jonas returns to Iceland to clear his name with a letter from the Danish King only to be exiled to his island once again.", "\n\nOne of my difficulties with the novel was that I couldn’t always divine Sjon’s intentions. ", "He presents an intriguing picture of a man who is clearly both intelligent and curious trapped in a society that is mired in superstition and religion. ", "However, Jonas himself is deeply religious, and not without his irrational beliefs – one of his proudest achievements is ridding a community of a ‘walking corpse’. ", "This makes him all the more convincing, but harder to identify with. ", "Few of the other characters make any impression – we are very much within Jonas’s mind for much of the novel. ", "Even his monologues are addressed to fellow creatures rather than fellow humans.", "\n\nWhat saves the novel for me are passages of astounding lyricism and imagination. ", "The first few pages, which present to us the creation of man from the point of view of Lucifer, are stunning. (", "The bleak tone of this Prelude, where man is presented as cruel and savage, is a recurring theme, never more evident than when a group of Basque sailors, hunting whales of the coast of Iceland, are slaughtered without mercy.) ", "Every time I felt Jonas’s meandering thoughts were becoming a little tedious, the next page would suddenly make me sit up and take note with a striking image or tale. ", "For that reason, though I can’t whole-heartedly endorse From the Mouth of the Whale, I am sure that many readers will love it, and it is likely to make an impression on all.", "\n\nI first read New Finnish Grammar last year on the back of an enthusiastic review from Nicholas Lezard in The Guardian who described it as “something special”. ", "I was, however, underwhelmed. ", "This is not to say I regarded it as a poor novel or undeserving of praise, but I simply didn’t feel it stood out among the other novels I was reading (admittedly, I was spending the year reading experimental fiction). ", "Now that it has reached the shortlist of the Independent Foreign Fiction Prize (as well as being a finalist for the Best Translated Book Award) I thought it was only fair to try again, knowing that the fault was as likely to be mine as the book’s.", "\n\nThe novel begins with an introduction by an ex-patriot Finnish doctor, Petri Friari, who has compiled and edited the manuscript which follows, but is also an important character, the catalyst for the story we are about to hear, “having set the author of these pages on a mistaken course, thus wreaking his destruction.” ", "The doctor’s complex relationship with his homeland (his father was executed during civil war and he now lives in exile in Germany) is at least partly responsible for his conviction that the unconscious man who is brought to him and wakes with no memory is Finnish, the only clues to his identity being the name Sampo Karlajainen written on a label on his jacket and a handkerchief with the matching initials S.K.\n\n“It is true, I too would have liked to have been sailing back to Finland; to take advantage of the chaos of war in order to do away with the neurologist from the military hospital in Hamburg and replace him with the Helsinki university student of twenty-six years earlier.”", "\n\nFor he soon sends Karlajainen to Finland in the belief that this will enable him to recover his identity as he relearns the Finnish language which Friari considers his mother tongue. ", "The novel’s concern with identity, nationality and language is clear, and is explored in some detail when Karlajainen arrives in Finland. ", "Unable to locate the doctor he has been referred to by Friari, he helps in the military hospital and befriends the Military Chaplain, Olof Koskela, a fiercely patriotic if slightly unhinged individual who regales him with tales from Finnish mythology. ", "Karlajainen’s fascination with Koskela is hard to fathom, especially as he shows no desire to be close to anyone else, but perhaps, as with Friari, he is looking for someone to tell him who he is:\n\n“I found his words both complicated and intriguing; each day they bound me ever more closely to my new (or old?) ", "identity.”", "\n\nHowever, he remains doubtful as to his true identity:\n\n“We had mingled but not totally bonded, Finland and I; something in me remained untouched by this mingling as though deep down some buried identity was refusing to be wiped out and was struggling furiously to rise to the surface.”", "\n\nAn encounter with one of the nurses, Ilma, in a bar might offer some companionship, but Kaarlajainen finds he cannot accept it:\n\n“Ilma – perhaps she was the answer; but I could not love Ilma without first knowing who I was.”", "\n\nWhen Koskjela leaves to fight the Russians, Karlajainen is entirely alone. ", "When he discovers the truth about who he is, he is filled with despair and the novel heads towards the tragic conclusion intimated in the introduction.", "\n\nNew Finnish Grammar, then, has both an interesting set-up and an intelligent presentation. ", "It pursues its themes of identity, nationality and language with some subtlety using its wartime setting and its small cast of characters. ", "It suffers a little from the blandness of the prose which leaves each of the narrators sounding the same. ", "Perhaps that’s why I found Karlajainen’s predicament unengaging for much of the novel, and was ultimately left rather cold by the ending. ", "It is clear, however, that Marani is an interesting writer and there is enough here to make me look forward The Last of the Vostyachs, published next month, and perhaps even his Europanto work, Las Adventures Des Inspector Cabillot, which follows.", "\n\nThe Independent Foreign Fiction Prize shortlist was announced yesterday as follows:\n\n• Alice by Judith Hermann, translated from the German by Margot Bettauer Dembo (The Clerkenwell Press) • Blooms of Darkness by Aharon Appelfeld, translated from the Hebrew by Jeffrey M. Green (Alma Books) • Dream of Ding Village by Yan Lianke, translated from the Chinese by Cindy Carter (Corsair) • From the Mouth of the Whale by Sjón, translated from the Icelandic by Victoria Cribb (Telegram Books) • New Finnish Grammar by Diego Marani, translated from the Italian by Judith Landry (Dedalus) • The Prague Cemetery by Umberto Eco, translated from the Italian by Richard Dixon (Harvill Secker)\n\nAs usual, my random reading of the long list has left me with half the shortlist still to read. ", "New Finnish Grammar must remain something of a favourite having been chosen as a finalist for the Best Translated Book Award as well. ", "Eco would seem an unlikely winner as the Prize has tended to go to less well known authors. ", "Similarly, Dream of Ding Village has perhaps had too much publicity. ", "I’ll try to read the rest of the short list before the winner is announced on the 14th May.\n\nSeven Houses in France is something of a departure for Bernardo Atxaga as it is not set, like his previous novels available in English, in his native Basque Country. ", "Nor is it set in France, the titular seven houses being an ambition of the wife of Captain Lalande Biran, a Belgian soldier who has spent the last seven years in the Congo trying to obtain the wherewithal to allow her dream to come true through the smuggling of ivory and mahogany. ", "The year is 1903 and Belgium is a colonial power, but though you might expect Atxaga to be interested in the mechanics of colonialism, this is, in fact, a story of individuals and the setting a means of creating the claustrophobia necessary for it to be enacted in all its intensity.", "\n\nThe novel begins as Biran’s military outpost is upset by a new arrival, Chrysostome, a young man so serious as to be entirely humourless:\n\n“Frowning and resisting the desire of the Captain, the other officers and the NCOs to have their bit of fun, Chrysostome solemnly stuffed the trousers and short into his canvas bag and donned the red fez.”", "\n\nHe is, however, a crack shot, something which angers the long-serving Van Thiegel, particularly when he is beaten by Chrysostome in a shooting competition and has to suffer the commiserating comment, “Don’t worry Lieutenant. ", "You shoot pretty well for a man of your age.” ", "His resentment leads him to encourage the rumour that Chrysostome is a ‘poofter’:\n\n“’I don’t know what it is with Chrysostome…but he seems to positively avoid the company of women.’”", "\n\nThis poisonous relationship (like the black mamba to which Atxaga likens it) lies at the dark heart of the novel, inextricably heading towards its tragic outcome. ", "However what makes the novel most enjoyable is Atxaga’s presentation of his cast of characters; each has a memorable literary tic used to represent their thought process. ", "Van Thiegel’s mind is one of competing compartments: when he is drunk it is a roulette wheel. ", "Biran is a poet and frequently describes the events he witnesses as if writing the first few lines of a poem. ", "Most amusingly, Donatien, his batman, hears the voices of his brothers and sisters in his head when faced with a problem:\n\n“Donatien saw a path. ‘", "It’s the path that leads to the girl’s mugini,’ he heard a voice inside him say. ", "It was his intelligent brother. ‘", "I don’t know what to do!’ ", "Donatien cried, and at that very moment, his homosexual brother…spoke to him in a voice from beyond the grave, ‘Leave the earrings where they are.’”", "\n\nWhen a journalist, Lassalle, arrives from Belgium to cover the erection of a statue of the Virgin Mary in a remote part of the Congo, he narrates his thoughts as newspaper articles.", "\n\nReligion is to the fore and Chrysostome’s fear of women is the result of the sight when a child of a man suffering from syphilis, encouraged by the local priest. ", "The blue ribbon of his medal of Our Lady is always visible. ", "His faith is echoed by the camp cook, Livo, who, when things begin to go wrong, seeks the advice of a local wise woman. ", "It might even be said that Biran’s faith lies in his wife. ", "All beliefs, however, lead towards death, though Atxaga’s comic undermining of his characters makes it seem less than a tragedy.", "\n\nKyung-Sook Shin won the Man Asian Prize with Please Look After Mother, her sixth novel and the first to be translated into English. ", "It was also a huge commercial success in her native South Korea. ", "The conceit is a fairly simple one, though beautifully executed: on the way to visit her children in Seoul, So-nyo, is separated from her husband when he boards a crowded train and she does not. ", "The story of the subsequent search for her is told from the shifting perspectives of family members as they re-evaluate their understanding of their mother now that she is missing.", "\n\nShin begins adventurously in the second person from the point of view the eldest daughter, Chi-hon, a writer whom we can only imagine bears some resemblance to the author. ", "We soon discover that the search the family will undertake for their mother is as much an internal one of memories as it is an external one of handing out fliers:\n\n“Until last autumn you thought you knew your mother well – what she liked, what you had to do to appease her when she was angry, what she wanted to hear.”", "\n\nIt is quickly clear, as they attempt to put together a flier, that So-nyo is largely unknown to her family. ", "Even the year the children thought she was born is not the true one as their father reveals (“This is the first time you’ve heard this.”). ", "They have no up-to-date photograph. ", "As Chi-hon remembers her mother, it is frequently a story of not knowing:\n\n“When was it you realised that Mother didn’t know how to read?”", "\n\nAnd more recently:\n\n“Mother got headaches? ", "So severe that she couldn’t even cry?…You could no longer say you knew mother.”", "\n\nThis first part, tracing the estrangement between mother and daughter, already makes for an excellent novel, but Shin goes on to provide the eldest brother, Hyong-chol’s, story in the second part, before the father’s narrative in part three. ", "Each section takes us further back and, ironically, as we develop a clearer understanding of So-nyo, we increasingly see how she has been marginalised by her husband and family even as she has sacrificed herself for them. ", "Her life has been one of hardship and difficulty:\n\n“Now you probably can’t even imagine it, but in those days we were always worried we would run out of food. ", "We were all like that. ", "The most important thing was eating and surviving.”", "\n\nThe narratives are therefore often characterised by guilt and regret. ", "Her husband, for example, recalls his refusal to talk about his brother’s death:\n\n“Now you realise how cowardly you were. ", "You lived your entire life heaping all your pain onto your wife. ", "Kyun was your brother, yet your wife was the one who needed to be consoled.”", "\n\nIn the final section Shin gives us So-nyo’s own voice, in a way that may not please all readers, but which allows narrative closure and provides the necessary completion of her portrait. ", "It would have been ironic if, in a novel about a woman who is ignored, the reader also did not hear her.", "\n\nThough it may seem sentimental in summary, and it certainly has a mass appeal that makes it easy to see why the novel has been a best-seller, I found it genuinely moving. ", "It charts that journey from childhood, when we feel we know our parents completely, through our own development into adults, when we often, like So-nyo’s children, give them little thought, to the often belated realisation that there may be areas of their life, external and internal, we are completely ignorant of.", "\n\nUmberto Eco’s fiction has always showed a fascination with stories. ", "In his previous novel, the disappointing The Mysterious Flame of QueenLoana, an elderly bookseller immerses himself in memories of the stories of his youth; in what remains his most famous novel, The Name of theRose the mystery is centred on a library. ", "In The Prague Cemetery the stories may not literally poison, but nonetheless they are designed to infect minds. ", "In it, Eco turns his historical gaze on the rise of modern anti-Semitism by shining a light on the dark art of propaganda.", "\n\nThe protagonist and narrator (at least, for the most part) is a double agent in more ways than one: not only does he play one side against the other, largely for financial inducement, but he begins the novel uncertain of the singularity of his identity:\n\n“Yesterday, which I thought was Tuesday the 22nd of March, I woke up thinking I knew perfectly well who I was – …Simone Simonini, born in Turin, father from Turin, mother French.”", "\n\n(Both name and nationality also have a double nature). ", "He is removing his own disguise one morning when he spots the costume of another:\n\n“I was wondering what third-rate actor I might have given accommodation to over the past few days when I realised that I too had been in disguise…Was I someone, then, who dressed alternately as a respectable gentleman and as a priest?”", "\n\nOur central character is a secret agent and propagandist who is so uncertain of the truth he does not even know himself. ", "He is also unaware of the damage he has caused over his long career, regarding himself as a man that rarely kills, yet unable to explain the corpses he has hidden beneath his house. ", "The novel, then, is his attempt to regain his present by retelling his past.", "\n\nEco, of course, excels in the intricacies of history, and the novel abounds with historical events and personages. ", "Simonini inherits his anti-Semitism from his grandfather, who tells him tales of the Templars, the Masons, and Jewish plans for world domination. ", "His father is more considered; even when quoting the views of a priest against Jesuits he comments:\n\n“But I have always been amused… that Gioberti took some of these ideas second-hand from The Wandering Jew, a novel by Eugene Sue, published the year before.”", "\n\nAs we shall see, fiction will reappear as fact frequently throughout the novel, and Simonini himself is soon an avid reader of Dumas, whose ideas he will later borrow and adapt. (", "Dumas himself later appears, apparently confusing reality with story, as an enthusiastic supporter of Garibaldi). ", "Simonini’s father and grandfather die and he works for the family lawyer, who he feels has cheated him, to make ends meet. ", "Part of that job entails forging documentation, and this brings him to the attention of the secret service. ", "As a reward for entrapping a group of radicals he asks for the lawyer to be imprisoned. ", "Later, when asked for information he does not have, he decides to invent it:\n\n“Hence the idea that I might sell Bianco not only a few scraps of gossip I had picked up here and there, but an entire document taken from the Jesuits.”", "\n\nWhether the document is true or false is never the issue –when Simonini initially pretends to be angered at the suggestion it may be a forgery, Bianco tells him, “Even if this document is all your own handiwork, it suits me and my superiors to present it to the government as genuine.” ", "It is this same document, reappearing in different forms to suit different audiences throughout the novel, which leads to the famous forgery The Protocols of the Elders of Zion. (", "It will also not surprise you to learn that Simonini is also involved in framing Dreyfus).", "\n\nFor a novel with such an unpleasant central character, The Prague Cemetery is generally very readable, with a fast-moving plot which can be (as Eco himself admits) a little confusing. ", "As with his previous novel, it is illustrated throughout, with the many prints giving the impression of something fabricated, like the many forgeries Simonini creates, from existing sources. ", "Eco has often celebrated the power of stories, but here he shows their danger: though the novel ends before the 19th century, it is the 20th century that is most in our minds.", "\n\nAs befitting a novel about inaction, very little happens in Dag Solstad’s Professor Andersen’s Night – most of the drama is, in fact, confined to one paragraph. ", "Spending Christmas Eve alone, Professor Andersen glances across at the apartment opposite to see a young woman standing at the window. ", "A man appears and Andersen watches as he\n\n“…put his hands around the woman’s neck and squeezed. ", "She flailed her arms about, Professor Andersen noticed, her body jerked, he observed, before she all at once became completely still beneath the man’s hands and went limp.”", "\n\nThe parenthetical ‘noticed’ and ‘observed’ reveal Andersen’s detached, philosophical nature, but still his first thought is to phone the police. ", "His thought, however, is not matched by his actions:\n\n“’It was murder, I must call the police,’ he thought, but still did not lift the receiver.”", "\n\nInstead he watches the window, now with the curtains drawn. ", "The longer he waits the more difficult it becomes to phone. ", "He cannot understand his own inaction:\n\n“I know I should have done it but I can’t. ", "That is how it is, I simply cannot do it.”", "\n\nHe speculates that perhaps the fact that the murder is irreversible and therefore any phone call could only lead to the arrest of the murderer, but not save the victim, has caused him to hesitate, but when he goes to discuss it with a friend he finds he cannot bring the subject up. ", "The novel becomes not so much about Andersen deliberating whether to contact the police or not, but attempting to understand why he did not do so immediately. ", "That Andersen can find no mention of the murder (or missing women) in the newspapers adds to the sense of unreality.", "\n\nIt would be difficult to sustain a novel simply on this (though Solstad does deliver one or two more twists before the end), but Andersen also seems to be at a potential turning point in how he views his own life. (", "The ‘night’ of the title, therefore, refers to more than simply the night of the murder, but a period of doubt). ", "As a Boxing Day dinner party demonstrates, he belongs to a group of middle-aged intellectuals who spent their youth as radicals in the 1960s but are now part of the establishment, even though they did not like to see themselves as such:\n\n“They were strongly disinclined to regard themselves as pillars of society…They denied being what they were…They continued to be against authority, deep inside they were in opposition, even though they were now, in fact, pillars of society who carried out the State’s orders…”\n\nSolstad uses a wonderful conceit of a photograph of the dinner party as viewed in 25 years’ time to convey his point. ", "This idea of time passing reoccurs when Andersen asks a friend what he knows about his great-grandparents:\n\n“…there is probably barely a hundred years between the birth of the eldest of them and you. ", "And already they’re no longer part of your consciousness.”", "\n\nAndersen also doubts his own calling as a professor of literature:\n\n“Literature is not going to survive, not in the way we think of it. ", "Its survival is just a matter of form and that is no longer enough. ", "All enthusiasm lies in the present…”\n\nProfessor Andersen’s Night is not a book you would choose to cheer yourself up, but nor is it unremittingly bleak. ", "Andersen’s relationship with his students is one cause for optimism. ", "It is also not a novel that provides easy conclusions; instead it is one which provokes uncomfortable thoughts, as the best literature always does.", "\n\nMatthias Politycki’s Next World Novella is the only second title I have read from Peirene Press (the first wasMaybe This Time), and both have been strange and wonderful in equal measure, suggesting I should explore a little further. ", "Peirene specialise in finding authors already respected in their own countries but unknown here, and then delivering them to us in beautifully produced short volumes – their books are just long enough to while away an evening.", "\n\nNext World Novella proclaims its brevity in the title, as well as its interest in the after-life. ", "No surprise, then, that it begins with a death. ", "Ageing academic Hinrich Schepp rises late one morning to discover his wife, Doro, lying dead at her desk:\n\n“I don’t understand, thought Schepp, understanding.”", "\n\nHe finds her slumped over one of his manuscripts – she often edited his work for him – and decides:\n\n“…that was the first, the most important thing to do. ", "He had to read those pages, find out what her last message was.”", "\n\nWhat she has been editing is not one of his scholarly papers, but a novel he began and abandoned many years before. ", "Politycki teasingly reveals her final words before we (or Schepp) can fully understand them – as the novella progresses what we understand has to be frequently reinterpreted.", "\n\nThe ‘next world’ has united Schepp and Doro since they first met. ", "Both are Sinologists, with Doro specialising in the I-Ching. ", "She believes that after death you come to the shore of a cold, dark lake which you must enter – when she confesses that this terrifies her shortly after they first meet, Schepp finds himself promising that he will die first and wait for her. ", "To some extent, this is the foundation stone of their marriage, and it is their marriage that comes under the microscope in what follows:\n\n“Had he been wrong about her his entire life?”", "\n\nHinrich decides to reread his manuscript, Marek the Drunkard, in order to interpret Doro’s comments. ", "Marek, we discover, is an unassuming man of little means, who has fallen in love with a waitress, Hanni, but lacks the courage to speak up. ", "Doro, it seems, has interpreted the novel as a fictionalised version of Hinrich’s life, adding such comments as “Why not call him Hinrich and be done with it!” ", "In particular she identifies Hanni as a waitress, Dana, at the bar La Pliff where her husband often went. ", "Hinrich regards this as ridiculous:\n\n“The only parallel with Hanni being that Dana had been a waitress too – although decades later!”", "\n\nHowever, as the story of Dana is revealed we see the remarkable parallels which Doro has alluded to. ", "Hinrich is forced to re-evaluate his relationship with Doro. ", "Just as Doro has discovered the manuscript, she has also discovered Dana. ", "Doro has written her own ending to the story of Marek and Hanni, of Hinrich and Dana. ", "More revelations follow and we are even offered alternative endings: one in which Hinrich dies and another in which they both live.", "\n\nFor such a short novel Next World Novella feels full of ideas. ", "Politycki uses the setting well: the rotting flowers, the fly, the fact that Hinrich’s reflection takes place as his wife’s corpse cools next to him. ", "A further ‘next world’ is touched on when it is suggested that Hinrich’s life would be different if only he had not had laser surgery on his eyes. ", "At one point Doro speculates that:\n\n“…the process of dying only really begins when the soul is judged and purified”\n\nIt is this process that the novel sets out to describe. ", "It is exactly the kind of book that you hope the Independent Foreign Fiction Prize will draw your attention to.", "\n\nDream of Ding Village seems to be only the second of Yan Lianke’s novels to be translated into English, the first having been the earlier Servethe People. ", "Whereas, from the title onward, Serve the People seems more in keeping with the satirical style he is associated with (it will not surprise you to learn that both novels have been banned in China), Dream of Ding Village, for all it is equally scathing in its portrayal of government both nationally and locally, is probably in that category of documentary fiction which only seems satirical because you can hardly believe that it happened. ", "As the title suggests, Lianke tells his story – that of the spread of AIDs in rural China through blood collection – by focusing on the events in one village. ", "By adopting a communal narrative rather than centring the story on an individual, Lianke emphasises that this ‘plague’ destroyed communities as well as lives, while at the same time making it clear that Ding Village is simply representative of the devastation which many villages experienced.", "\n\nThe novel begins with the village already decimated by death:\n\n“Choked by death, it will not die. ", "In the silent shades of autumn, the village has withered, along with its people. ", "They shrink and wither in tandem with the days, like corpses buried underground.”", "\n\nIt is already clear that those who have sold their blood might be taken any day by the ‘fever’. ", "How long they will last varies, but they will eventually die. ", "Lianke is not interested in the tension that he might create by sketching the arrival of the ‘plague’; he is concerned with the individual stories of those who have it. ", "As the novel progresses, we hear the tales of those who, for various reasons, chose to sell blood. ", "This retrospective approach adds to the pathos. ", "The common denominator is often a desperate poverty: selling blood seems an almost miraculous chance of prosperity. ", "Thatched roofs are replaced with tiles; houses develop second storeys. ", "Only later is the cost made plain.", "\n\nIn keeping with a novel about death, the narrator is also dead, not from AIDs but\n\n“…because my dad had run a blood collection station in Ding village ten years earlier….He wasn’t just a blood merchant, he was a blood kingpin.”", "\n\nThe narrator, his twelve-year-old son, is poisoned in revenge, and, just in case we have any doubt that Ding Hui is the villain of the piece, we are immediately told that “the day I died my dad didn’t even cry.” ", "Ding Hui profits from the suffering of others throughout: having first become wealthy form buying and selling blood, he goes on to exploit the sale of coffins, and finally makes money out of arranging marriages between those who have died single.", "\n\nIf Ding Hui is the villain, then the hero is his father, the narrator’s Grandpa, who apologises to the village on behalf of his son when Hui refuses. ", "As school caretaker, he then opens the school to the sick and looks after them. ", "A respected figure in the village at the beginning, this respect dwindles due to the behaviour of his sons. ", "His other son, Ding Liang, is a more ambiguous character. ", "Though frequently selfish, and characterised by his lazy grin which suggests he takes nothing seriously, he begins an affair with a married woman who, like him, has the ‘fever’. ", "Although his father is ashamed by this behaviour, which is used to blackmail him at one point, Liang simply wants to continue living life as fully as he can, and some of the scenes between Liang and his mistress are genuinely tender, especially as they near death, though never sentimental.", "\n\nThe only aspect of the novel I felt to be unnecessary was the conceit of the Grandpa’s dreams. ", "Sometimes they allowed him to foresee what would happen; at other times they worked through symbolism. ", "Generally they interrupted rather than added to the narrative which was strong enough without them. ", "Indeed, it is the strength of the story, grounded in an appalling truth, which makes this novel so vital. ", "But, though Ding Hui borders on caricature at times, and the ending is a little too neat, it is a story that is also skilfully told.", "\n\n“With his eyes closed, Tengo could not be sure which world he belonged to.”", "\n\nThis follows a discussion with his lover about the moon after he tells her that the novel he is writing is set in a world with two moons, an idea he has borrowed from Air Chrysalis. ", "Two moons in the sky have already been identified by Aomame as a facet of 1Q84:\n\n“Overhead, the two moons worked together to bathe the world in a strange light.”", "\n\nIn Book Two, remembering again the one time they have met, Tengo pictures\n\n“…the moon – standing out against the sky, about three quarters full…Like him, Aomame was staring at the moon in broad daylight, still gripping his hand, her face deadly serious.”", "\n\nWhen he opens his eyes, he sees “another moon in the sky”:\n\n“The moon was as taciturn as ever. ", "But it was no longer alone.”", "\n\nThis occurs shortly after he decides to look for Aomame, and, although Fuka-Eri suggests that his perception of the two moons is related only to writing Air Chrysalis with her, it seems also to represent his connection with the woman he has always loved but previously made no effort to locate. “", "What kind of reality mimics fictional creations?” ", "Tengo asks himself, referencing his own writing. ", "But Murakami keeps returning to the song Paper Moon, where the paper moon of the title is made real by love and belief. ", "1Q84 is the world where Tengo and Aomame are connected by story: in Book One this was largely structural, their two narratives running side by side; in Book Two their stories become increasingly entangled.", "\n\n1Q84, therefore, is, above all, a love story, and that love becomes central to the action in Book Two. ", "While Tengo’s narrative becomes backward looking – a visit to his dying father, a reunion with Fuka-Eri – and esoteric – an extended interlude based on a story he reads, Aomame’s takes on the tenor of a thriller as she prepares to kill the cult leader Fukado. ", "Murakami’s ambiguous attitude towards the cult (one might say, towards everything) is demonstrated when Fukado not only confirms his more than human qualities, but also asks Aomame to kill him – he, too, is being used by the Little People and his death will leave them without a host. ", "He also explains that, although this would mean that they would hunt her down and kill her, it would keep Tengo safe, allowing her to sacrifice herself for him.", "\n\nHow well you take all this may depend not only on your tolerance of the more fantastical elements, but also how you feel about mixing sex with children. ", "It’s true that we discover that Fukado did not rape his daughter, but that he had intercourse with her Dohta, a shadow self created in an air chrysalis by the Little People – and that he was unable to move at the time. ", "We see the same thing happen to Tengo at the hands (or, more accurately, loins) of Fuka-Eri (who becomes an increasingly creepy character in this Book). ", "Murakami goes out of his way, however, to emphasise her youth during their encounter:\n\n“It seemed inconceivable that his adult penis could penetrate her small newly made vagina.”", "\n\nHe also links it to Tengo’s memory of Aomame. ", "In his own mind, Tengo associates this with a sexual awakening:\n\n“In his memory, Aomame remained a skinny little girl without breasts, but he was able to bring himself to ejaculation with the thought of her in gym clothes.”", "\n\nThough this physical attraction fades fro Tengo, it is noticeable how frequently Aomame, in the other narrative, refers to the smallness of her breasts, refusing to have them enlarged when she has the opportunity. ", "When Tengo discovers an air chrysalis waiting for him on his father’s bed, it is the ten-year-old Aomame who is inside.", "\n\nIf you’re wondering whether it all makes sense, the answer is probably that it doesn’t matter. ", "1Q84 isn’t ‘metaphorical’ or ‘symbolic’. ", "Its over-riding concern seems to be with making a meaningful connection between two people. ", "Both Aomame and Tengo lived in solipsistic worlds, estranged from their parents and without close friends. ", "Most other characters in the novel are equally isolated. ", "The cult itself is an example of retreating into a private world; as, one might argue, is the novel itself. ", "The dynamic of the dual narrative is union, and it is the question of whether Aomame and Tengo can find each other that is the novel’s main driving force." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0106951871657754, 0, 0.1, 0, 0.006622516556291391, 0, 0.00411522633744856, 0.020833333333333332, 0, 0, 0, 0.009852216748768473, 0.003003003003003003, 0.005813953488372093, 0, 0, 0.006097560975609756, 0, 0.00909090909090909, 0, 0, 0.009009009009009009, 0.004424778761061947, 0.005988023952095809, 0, 0.012422360248447204, 0, 0, 0.008097165991902834, 0.003105590062111801, 0.00436046511627907, 0.010810810810810811, 0.007246376811594203, 0.011904761904761904, 0.006430868167202572, 0, 0, 0.008849557522123894, 0.025974025974025976, 0, 0, 0, 0, 0.007246376811594203, 0.012145748987854251, 0.015384615384615385, 0.014925373134328358, 0.010869565217391304, 0, 0.003861003861003861, 0.0035460992907801418, 0.0035335689045936395, 0, 0, 0, 0, 0, 0.005847953216374269, 0.010638297872340425, 0, 0.00684931506849315, 0, 0, 0, 0.006756756756756757, 0.00546448087431694, 0, 0, 0.008333333333333333, 0, 0.0078125, 0, 0, 0, 0, 0.011494252873563218, 0, 0, 0, 0, 0.007246376811594203, 0, 0, 0.004098360655737705, 0, 0, 0, 0, 0, 0, 0, 0.013157894736842105, 0.005291005291005291, 0, 0, 0, 0, 0.003952569169960474, 0.008928571428571428, 0, 0.0022935779816513763, 0, 0, 0, 0, 0, 0, 0.02054794520547945, 0.007751937984496124, 0.0055248618784530384, 0.017543859649122806, 0.008130081300813009, 0, 0, 0.008695652173913044, 0.006944444444444444, 0, 0.011111111111111112, 0.005376344086021506, 0.005235602094240838, 0, 0.006134969325153374, 0.007407407407407408, 0.010416666666666666, 0.005813953488372093, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.004608294930875576, 0, 0.0015772870662460567, 0.005, 0, 0, 0, 0, 0, 0, 0.01276595744680851, 0, 0.01, 0, 0.012578616352201259, 0, 0, 0, 0.005747126436781609, 0.014705882352941176, 0.01639344262295082, 0.004132231404958678, 0, 0.02912621359223301, 0.007142857142857143, 0.0125, 0.018867924528301886, 0.015037593984962405, 0.009708737864077669, 0.03278688524590164, 0.013513513513513514, 0.03488372093023256, 0.007633587786259542, 0.015384615384615385, 0.013333333333333334, 0.006802721088435374, 0, 0.009009009009009009, 0.006369426751592357, 0.0022727272727272726, 0.006289308176100629, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.004672897196261682, 0.0040650406504065045, 0.006578947368421052, 0, 0, 0.017241379310344827, 0, 0.006896551724137931, 0.010309278350515464, 0, 0, 0, 0.007575757575757576, 0, 0.005434782608695652, 0.006211180124223602, 0.00390625, 0, 0, 0.003355704697986577, 0, 0, 0.008333333333333333, 0.004878048780487805, 0, 0.0038461538461538464, 0.010526315789473684, 0, 0, 0.0091324200913242, 0.006535947712418301, 0.0056179775280898875, 0.020833333333333332, 0.004484304932735426, 0.004629629629629629, 0.008403361344537815, 0, 0, 0, 0.009345794392523364, 0, 0, 0.006493506493506494 ]

[ "中島由貴\n\nmay refer to:\nYuki Nakajima (born 1990), Japanese biathlete\nYuki Nakashima (voice actress) (born 1997), Japanese voice actress\n\nSee also\nYuki (given name)\nNakajima (surname)" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.03910614525139665 ]

[ "Build ghostwriter on Mac without installing XCode\n=================================================\n\n\n### 1. ", "Acknowledgements & License\n\nThis guide is derived from [Qt without Xcode how-to][gist] by Peter Jonas ([shoogle]) / [CC BY 4.0][CC-BY]\n\n[gist]: https://gist.github.com/shoogle/750a330c851bd1a924dfe1346b0b4a08 \"GitHub gist\"\n[shoogle]: https://github.com/shoogle \"shoogle's GitHub user profile\"\n\n[![", "Creative Commons License][CC-BY-image]][CC-BY]\n\nThis work is licensed under a [Creative Commons Attribution 4.0 International License][CC-BY].", "\n\n[CC-BY]: http://creativecommons.org/licenses/by/4.0/ \"View license text on the Creative Commons website\"\n[CC-BY-image]: https://i.creativecommons.org/l/by/4.0/88x31.png \"CC BY\"\n\n\n### 2. ", "Introduction. ", "Why is this needed.", "\n\nOlder Qt versions (<5.9.1) try to use `xcodebuild` to find out where the utilities are installed.", "\nThis fails with the following error message unless Xcode is installed:\n\n> Project ERROR: Could not resolve SDK Path for 'macosx'\n> Error while parsing file `<filename.pro>`. ", "Giving up.", "\n\nYou need to tell QMake to use `xcrun` instead.", "\n\n\n### 3. ", "Configure Qt 5.5 to use `xcrun` instead of `xcodebuild`\n\nOpen a Terminal and change directory to where brew installed target mkspecs files.", "\n\n ```bash\n cd /usr/local/Cellar/qt@5.5/5.5.1_1/mkspecs/features/mac\n\n ```\n\nNow copy and paste these new commands **into the same Terminal window**\nto create backup copies of some files:\n\n ```bash\n function backup_files() {\n for file in \"$@\"; do\n [[ -f \"${file}.backup\" ]] || cp \"${file}\" \"${file}.backup\"\n done\n }\n backup_files sdk.prf default_pre.prf default_post.prf\n ```\nPress the Return key after the final command.", "\n\nIf that all went OK then run these commands to update the files:\n\n ```bash\n url_base='https://raw.githubusercontent.com/qt/qtbase'\n commit='fa7626713b3a943609453459190e16c49d61dfd3'\n dir='mkspecs/features/mac'\n curl -O \"${url_base}/${commit}/${dir}/sdk.prf\"\n curl -O \"${url_base}/${commit}/${dir}/default_pre.prf\"\n old_line='cache(QMAKE_XCODE_VERSION, stash)'\n new_line='!isEmpty(QMAKE_XCODE_VERSION): cache(QMAKE_XCODE_VERSION, stash)'\n sed \"s|^${old_line}\\$|${new_line}|\" <default_post.prf.backup >default_post.prf\n ```\n\n#### All done, please go back to the [main README](../README.md) and continue following the building steps for MacOS.", "\n" ]

{ "pile_set_name": "Github" }

[ 0.009174311926605505, 0.020202020202020204, 0, 0.015957446808510637, 0, 0, 0, 0.011428571428571429, 0, 0.020833333333333332, 0, 0.007194244604316547, 0.004555808656036446, 0.0015337423312883436, 0 ]

[ "Q:\n\nshow div when all input fields have content\n\nI have a form with a few input fields, I only want to show a div when all the input fields got content, when one of the input fields has no content the div should disappear again.", "\nI made it work with one input field, but how do I get it to work when all the input fields are filled in (don't know if its a good clean way?):", "\n$(function () { \n$('input').change(function() {\n$('.next').toggle($(this).val().length !", "== 0);\n}); });\n\nFiddle:\nhttp://jsfiddle.net/uQyH9/19/\n\nA:\n\nYou can use a filter function to check that all the input are filled.", "\nCode:\n $(function () {\n $('input').change(function () {\n $('.next').toggle($(\"input\").filter(function () {\n return this.value === \"\";\n }).length === 0)\n });\n });\n\nDemo: http://jsfiddle.net/IrvinDominin/DwF2P/\nUPDATE\nYou can check the value of the elements by type by cheking type attribute.", "\nCode:\n$(function () {\n $('input').change(function () {\n $('.next').toggle($(\"input\").filter(function () {\n var myType=$(this).attr(\"type\");\n if (myType === \"checkbox\") return !", "$(this).is(\":checked\");\n if (myType===\"radio\"){\n var myName = $(this).attr(\"name\");\n if (myName===\"\") return !", "$(this).is(\":checked\");\n return $('input[name='+ myName +']:checked').length===0\n }\n return this.value === \"\";\n }).length === 0)\n });\n});\n\nDemo: http://jsfiddle.net/IrvinDominin/pqJhg/\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0.0078125, 0.0028735632183908046, 0, 0, 0.004291845493562232 ]

[ "Some all new in-hand images are spreading like wildfire throughout the Transformers fandom of Generations Deluxe Windblade and we here at The Allspark have them with us right now to share with all of you! ", "The images are below the break, and feel free to drool over them for as long as you wish!", "\n\n\n\n\n\nLike this: Like Loading..." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.00975609756097561, 0, 0 ]

[ "Late last week, a post on Chinese Bitcoin community website 8btc gained a lot of attention in certain English-language Bitcoin circles, particularly the subreddit /r/btc. ", "The post stated that Chinese Bitcoin miners should band together and push for a hard-forking change to the Bitcoin protocol via a switch in software from Bitcoin Core to Bitcoin Classic.", "\n\nThere has been some confusion in the days after the original “Terminator Plan” was posted on 8btc, as some in the Bitcoin community appear to believe this is a genuine plan agreed upon by Bitcoin miners in China. ", "Bitcoin Magazine has reached out to two Bitcoin mining pools in China, and both have distanced themselves from the plan.", "\n\nThe Numbers Don’t Add Up\n\nWhen looking over the Terminator Plan, one of the obvious issues with the letter is that the numbers simply don’t add up. ", "The plan would supposedly involve greater than 75 percent of the hashrate coming together to support Bitcoin Classic, but roughly 20 percent of the network (represented by BTCC and BitFury) have made their support for Bitcoin Core rather clear over the past few months. ", "This means that nearly every other Bitcoin mining pool or miner ‒ even those outside of China ‒ would have to be involved in the Terminator Plan for it to be real.", "\n\n“Of course the math doesn’t add up because the plan isn’t real,” said BTCC COO Samson Mow. “", "Towards the bottom of the 8btc post it does say, ‘This is a suggestion to mining pools.’ ", "Just because something is posted in Chinese on a Chinese forum it doesn’t mean it’s true or that you’re going to get an accurate understanding via Google Translate,” he continued.", "\n\nAt least one media outlet even questioned whether BTCC’s level of support for Bitcoin Core may be on the decline but Mow was quick to dismiss this theory via Twitter:\n\n“As long as BTCC is operating Bitcoin exchanges and a Bitcoin mining pool, it’s not possible that we’d support a plan to compromise Bitcoin’s security or to hijack the development of the protocol,” Mow explained. “", "Plus, the basis of the Terminator Plan is to replace Core with Classic. ", "That’s just plain ridiculous.”", "\n\nHaoBTC Still Supports Bitcoin Core, but Not Unconditionally\n\nIn addition to Mow, Bitcoin Magazine also reached out to Eric Mu, who runs marketing and strategy for HaoBTC. ", "Mu was perplexed by the reaction to the 8btc post from the English-speaking Bitcoin community, partially due to the fact that the author of the post was anonymous.", "\n\n“As far as I know, the company never discussed the Terminator Plan, publicly or privately,” Mu said when asked if HaoBTC has discussed this plan in the past. “", "When I first read the article, my impression was that author was a bit tongue-in-cheek, but the views he expressed echoed a sentiment that has been around for some time.”", "\n\nMu then clarified HaoBTC’s stance on the block size debate:\n\n“HaoBTC’s official stance has been consistent and was clearly expressed in the Hong Kong Consensus. ", "Our support of Core over its alternatives is based on our commitment to the [Hong Kong] Consensus and dedication to building a governance model based on open dialogue between the industry and the development community, thus it is not unconditional.”", "\n\nAlthough parts of the Bitcoin community would like to see the mining community have a bigger role in protocol development decisions, Mu revealed some of the reasons miners are hesitant to take a stand. “", "Some are wary of the current Core developers all quitting in the Mike Hearn fashion, which might lead to a disastrous outcome; some simply don’t want the rest of the world to perceive Bitcoin as being controlled by the Chinese, a narrative that has gained currency in the media as demonstrated by the recent New York Times article,” explained Mu.", "\n\nAntpool Doesn’t Dismiss the Rumors\n\nOne of the oddest aspects of this story is that Bitmain CEO Jihan Wu has been unwilling to dismiss the rumors surrounding the Terminator Plan. ", "When asked about the issue on Twitter, Wu repeatedly responded by saying there is no censorship on Chinese forums and ideas are allowed to be discussed freely ‒ an obvious slight at the /r/Bitcoin subreddit where moderation is sometimes perceived to be heavy.", "\n\nHaoBTC has also sent out their own tweet regarding the Terminator Plan without offering any clarification (at the time of publication of this article):\n\n\"miners on the move following comments by at least 3 Core devs that the hardfork has no chance of being merged\" https://t.co/SZjzoEDoZy — Bixin (@BixinIM) July 3, 2016\n\nIn terms of how Jihan Wu and HaoBTC are handling the situation, Mow responded, “They’re being coy about it. ", "However, you really can’t expect us to dismiss every single rumor that r/btc speculates themselves into a frenzy over. ", "Then we’d never get any work done.”", "\n\nThe moderators of the /r/Bitcoin subreddit received some flack on social media for initially removing the 8btc post and claiming it was FUD due to editorialized titles, but it appears that they got things right on this occasion." ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0.005376344086021506, 0, 0.008333333333333333, 0, 0.014814814814814815, 0, 0.02127659574468085, 0, 0.00558659217877095, 0.010416666666666666, 0.013888888888888888, 0, 0.017341040462427744, 0.006134969325153374, 0.006211180124223602, 0, 0, 0.004016064257028112, 0.00975609756097561, 0.011560693641618497, 0.0055248618784530384, 0.003861003861003861, 0.009259259259259259, 0, 0, 0 ]

[ "Van alle kerken die er in Nederland bestaan is de kerk van Scientology waarschijnlijk het gezelligst. ", "Niet alleen kun je er Thetan-level 8 bereiken (wat zeer chill schijnt te zijn, maar wel een boel geld kost), je kunt er ook hartstikke fijn feesten. ", "Sterker nog: het lijkt erop dat het openingsfeest van het nieuwe Scientology-gebouw aan de Wibautstraat in Amsterdam het sickste feest van het jaar was. ", "Waarom we dat weten? ", "Nou, dankzij dit youtube-filmpje van AT5:\n\nZoals je kunt horen, wordt hier het lied Aan de Amsterdamse Grachten van Wim Sonneveld gezongen. ", "Wim Sonneveld zelf was ook fervent aanhanger van Scientology, en het is geen geheim dat het dorp uit zijn bekendste lied Het Dorp eigenlijk over Saint Hill Manor gaat, het landgoed waar L. Ron Hubbard woonde. ", "Hubbard schijnt ooit een conference van Sonneveld te hebben bezocht en zou na afloop de gevleugelde woorden: \"Lik me bolle reet\" hebben uitgesproken.", "\n\nOmdat youtube-filmpjes eindig zijn en het irritant is om steeds opnieuw op play te klikken, hebben we er gifjes van gemaakt. ", "Gifjes hebben de fijne eigenschap dat ze oneindig doorspelen, en dat is precies wat je wil bij deze beelden. ", "Kijk maar even mee!", "\n\nMove over, Armin! ", "Er is een nieuwe dj-superster opgestaan. ", "En wat voor een. ", "Deze man kijkt alsof hij een Kinder Surprise vol Prozac heeft gevonden. ", "Let goed op hoe hij danst: hij begint met de klassieke 'arm in de lucht', schakelt naadloos over op 'de joggende moeder', om vervolgens routineus af te sluiten met een draai aan een niet bestaande knop. ", "Ook hulde voor de danseressen op de achtergrond, die hier een indrukwekkende 'applaudisserende cyborg' neerzetten.", "\n\nXenu zal vandaag wel extra tevreden zijn in zijn vulkaan, want wát zetten deze dames een prachtige uitvoering neer van de officiële Scientology-dans. ", "Het ziet er misschien eenvoudig uit, maar ze mogen dus niet klappen op de maat van de muziek, maar op de maat van de hartslag van Tom Cruise tijdens zijn ochtendlijke darmspoeling.", "\n\nDit is bijzonder: let even niet op de zangers op de voorgrond, maar op de violist. ", "Het aantal emoties dat in krap vijf seconden op haar gezicht af te lezen is wordt enkel geëvenaard door het aantal nullen in het bedrag dat John Travolta op zijn bankrekening zag verschijnen na zijn hitkomedie over het leven van L. Ron Hubbard, Battlefield Earth.", "\n\nZo, nog even een totaalshot om te laten zien hoe fucking geweldig dit feest was. ", "Zo te zien had niet alleen de dj een halfje genomen, maar werd er in het publiek ook gretig aan de sleutel van het nieuwe Scientology-pand geroken. ", "Wel jammer dat hier zo opvallend te zien is dat de handen van de dj nep zijn (misschien vervangen door poten van een otter? ", "We zullen het pas weten als Louis Theroux hier induikt)." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.00980392156862745, 0.013422818791946308, 0.006535947712418301, 0, 0.014285714285714285, 0.009569377990430622, 0.006711409395973154, 0, 0.009174311926605505, 0.05263157894736842, 0.05, 0, 0, 0.013888888888888888, 0.009852216748768473, 0.008771929824561403, 0.006578947368421052, 0.027777777777777776, 0.011764705882352941, 0.0076045627376425855, 0, 0.006756756756756757, 0.016129032258064516, 0.017857142857142856 ]

[ "Q:\n\nCan I use LINQ to get more than 100 records back from a Quickbooks Online ServiceContext?", "\n\nFor my Quickbooks Online integration, I'm using the .NET SDK and was previously using LINQ to access data from a ServiceContext:\nvar paymentMethodsService = new QueryService<PaymentMethod>(ServiceContext);\n_paymentMethods = paymentMethodsService.", "Select(x => x).ToList();\n\nWhen testing, we noticed that this only returns the first 100 records. (", "Presumably because this is the default page size?)", "\nWe can get around this by using a query containing MAXRESULTS:\nvar itemsService = new QueryService<Item>(ServiceContext);\n_items = itemsService.", "ExecuteIdsQuery(\"SELECT * FROM Item MAXRESULTS 1000\").ToList();\n\nMy question is, can I achieve the same result without using a query string?", "\n\nA:\n\nI must admit I have no idea what Quickbooks Online even is, but nevertheless I think you can override default page size with LINQ Take(yourPageSize). ", "Though it's still not clear how to fetch ALL items in a collection this way, without knowing total count beforehand. ", "Hopefully you don't need to do this in your scenario (or if you do - maybe you can just use arbitrary large number for Take if you won't find another way).", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.010752688172043012, 0.016129032258064516, 0, 0, 0.013793103448275862, 0, 0.00641025641025641, 0, 0, 0 ]

[ "Molecular mechanism of the photoperiodic response of gonads in birds and mammals.", "\nAppropriate timing of various seasonal processes is crucial to the survival and reproductive success of animals living in temperate regions. ", "When seasonally breeding animals are subjected to annual changes in day length, dramatic changes in neuroendocrine-gonadal activity take place. ", "However, the molecular mechanism underlying the photoperiodic response of gonads remains unknown for all living organisms. ", "It is well known that a circadian clock is somehow involved in the regulation of photoperiodism. ", "Recently, rhythmic expression of circadian clock genes was observed in the mediobasal hypothalamus (MBH) of Japanese quail. ", "The MBH is believed to be the center for photoperiodism. ", "In addition, long-day-induced hormone conversion of the prohormone thyroxine (T(4)) to the bioactive triiodothyronine (T(3)) by deiodinase in the MBH has been proven to be important to the photoperiodic response of the gonads. ", "Although the regulating mechanism for the photoperiodic response of gonads in birds and mammals has long been considered to be quite different, the long-day-induced expression of the deiodinase gene in the hamster hypothalamus suggests the existence of a conserved regulatory mechanism in avian and mammalian photoperiodism." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0, 0.008064516129032258, 0.017543859649122806, 0.004405286343612335, 0 ]

[ "Q:\n\nDo I need to close an InputStream in Java?", "\n\nMy code is:\nInputStream confFile=classLoader.getResourceAsStream(\"myconffile.properties\");\n\nIn docs:\n\nThe close method of InputStream does nothing. ", "\n\nDoes it mean that I don't need close InputStream?", "\n\nA:\n\nYou do need to close the input Stream, because the stream returned by the method you mention is actually FileInputStream or some other subclass of InputStream that holds a handle for a file. ", "If you do not close this stream you have resource leakage.", "\n\nA:\n\nNo, it does not mean that - because InputStream is an abstract class, and getResourceAsStream() returns a concrete subclass whose close() method does something - most importantly free a file handle.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.043478260869565216, 0.006666666666666667, 0.0196078431372549, 0.005076142131979695, 0, 0.004901960784313725, 0 ]

[ "WE SUPPORT SHELTER ORGANIZATIONS, especially the Ottawa\nHumane Society(where Bobbi adopted Terzo\nin October, 2006), the\nAylmer SPCA(where Bobbi adopted Q.T.\nPenny in 2015), as well as many others. ", "See the Fan\nClub page for all the links.", "\n\nThe World Wide Fund says\npopulations of more than 4,000 mammal, bird, fish, reptile and\namphibian species declined 60% between 1970 and 2014. ", "The report\nblames deforestation, pollution and climate change caused by humans\nfor the rapid wildlife declines.", "\n\nThe ASPCA was founded in\n1866. ", "It was the first animal welfare organization in the Americas.", "\nCanada's first SPCA was established in 1869 in Montreal.", "\n\nCanada's Animal Cruelty Act\ndates back to 1892. ", "But it's never been revised.", "\n\nThe first zoo in the U.S.\nwas established in Philadelphia.", "\n\nBerlin’s Zoologischer\nGarten is the largest zoo in the world both in terms of number of\nspecies (1,500) and animal population (14,000). ", "Germany boasts more\nthan 400 registered zoos.", "\n\nA recent study analyzed the brains\nof dogs as they listened to human speech. ", "It revealed that dogs\nunderstand both the meaning of words and the intonation used to\nspeak them. ", "They are able\nto match hundreds of objects to words and learn elements of grammar,\nand processed familiar words regardless of intonation, using the left\nhemisphere, just like humans. ", "Tone, or the emotion behind the word,\non the other hand, was analyzed in the auditory regions of the right\nhemisphere — just as it is in people.", "\n\nDalmatians are the official\nfirehouse dog because, in the 1700's, they would run alongside\nhorse-drawn carriages keeping pace, even at full sprint, and protect\nthe horses from other dogs or animals that could spook them.", "\n\nMost scientists now accept\nthat animals have distinct personalities, traits that endure over\ntime and differ between individuals of a species. ", "Researchers have\nfound evidence of personality in practically every species\nthey’ve examined, including sea anemones and insects.", "\n\nIn most\nmammal species, the cortex accounts for between 10 percent and 40\npercent of brain size. ", "In primates, it accounts for more than 50\npercent, and in humans for as much as 80 percent. ", "Humans are\nexceptional for the sheer number of their cortical neurons. ", "They have\nabout fifteen billion, or more than twice as many as chimpanzees\n(with about six billion). ", "Whales and\nelephants, the next in line after humans on the most-cortical-neurons\nlist, have about ten billion cortical neurons, but they have smaller\nbrains than chimps relative to body size. ", "Large brains\nmean that primates are wizards at acquiring, storing, and using\ninformation about their surroundings.", "It has long been understood that\nsome animals can teach their peers to perform new tasks. ", "But the most\nfamous examples involve primates or birds like ravens: Japanese\nmacaques show other monkeys how to wash sweet potatoes in streams. ", "A\ncertain group of chimps knows to fish for insects by prodding termite\nmounds with sticks, nibbled into brushes for maximum scoopage. ", "But new\nresearch suggests that bees are also capable of intricate form of\ncommunication, and can teach these to other bees. ", "They have something\ncalled a waggle dance, with which they signal the location of nearby\nfood. ", "Every 75 milliseconds a waggle lasts, roughly speaking,\nindicates to other honeybees that a nectar source is an additional\n330 feet further from the colony. ", "In recent experiements, bees were\ntaught how to pull a string to reach a sugar-filled flower\nsubstitute, and then they taught this to other bees.", "\n\nThe\nBBC Earth/PBS series Animals with Cameras, a clever female chimp who\nwanted clean the mud from her hands, determinedly climbed a tree to\nvisit a water source known to her and washed her dirty hands. ", "Cameras\nalso captured other chimps using leaves to brush their teeth and to\nweave into a comfy place to relax.", "\n\nAn incredibly clever\nchimpanzee at the Zoological Wildlife Foundation in Miami used a\nsmartphone to watch a video on Instagram from a few days before\nwhen the\nchimp and caretaker Mike Holston were horsing around. ", "The chimp not\nonly watched that specific clip but also exited out of the video,\nscrolled and clicked through to other images.", "\n\nMonkeys can understand written\nnumbers and can even count. ", "They can also understand basic parts of\narithmetic and even, in rare cases, multiplication.", "\n\nPaternal care, where\nfathers care for their children, is rare among mammals. ", "Humans fall\ninto that category, along with species like mice and lions. ", "There are\nalso a number of South American monkey species where males take on\nequal or greater childcare burdens than females. ", "But these species\nare the exceptions, not the rule. ", "Among\nmountain\ngorillas, found in the mountains of Rwanda, Uganda, and the\nDemocratic Republic of Congo, some of the strongest social bonds are\nbetween adult males and infants, even when the infants\naren’t the males’ own offspring. ", "From the time that young\ngorillas are old enough to move away from their mothers, they follow\nmales everywhere. ", "Males, in turn, are extremely tolerant. ", "Some\nregularly hold, play with, groom, and let infants sleep in their\nnests with them.", "\n\nCraig Saffoe,\ncurator of great cats at Smithsonian’s National Zoo in\nWashington, says It’s always a matriarch who actually leads a\nlion pride. ", "Although male lions appear much bigger and more\naggressive, females are more dominant. ", "They do the important\ndecision-making, are in charge of the majority of hunting and\ncub-raising, and also have to protect their territory against other\nintruding females and decide when to let in new males. ", "In a typical African\npride, there are three to six adult females. ", "Most daughters are\nrecruited to stay with their mother’s pride until they die, so\nthere are often several generations of related females in this\nmatriarchal society. ", "Two\nor three adult males also live with the females. ", "They are usually\nbrothers or pride-mates who have formed a coalition to help protect\nthe females. ", "But they spend only a few years with the pride —\nlong enough to produce more offspring — before they go out and\nseek a new one. ", "However males are usually very affectionate with all\nthe cubs in the pride, as they have no way of knowing which are\ncarrying their genes. ", "When adult males return from patrolling the\npride territory, they seem to enjoy the cubs, with lots of licking,\nhead rubbing and purring.", "\n\nA crocodile cannot stick out\nits tongue.", "\n\nA dragonfly has a life span of\n24 hours.", "\n\nA goldfish has a memory span\nof three seconds.", "\n\nA shark is the only fish that\ncan blink with both eyes.", "\n\nA snail can sleep for three years.", "\n\nAn ostrich's eye is bigger than\nits brain.", "\n\nButterflies taste with their feet.", "\n\nKevin Simler and Robin Hanson reveal, in The\nElephant In The Brain, describe Bowerbirds, a family of 20\nspecies scattered across the forests and shrub lands of Australia and\nNew Guinea. \"", "What's distinctive about these birds are their\neponymous bowers -- the elaborate structures built by the males of\nthe species to attract females. ", "Different species build their bowers\nin different shapes and sizes. ", "Some are long avenue-like walkways\nflanked by walls of vertically placed sticks. ", "Others are more like a\nmaypole, circular structures propped up against a small sapling.", "\nPerhaps most impressive are the expansive gazebo-like bowers built by\nthe humble (10-inch long) Vogelkop bowerbird. ", "These structures tower\nup to nine feet off the ground, with an opening large enough for a\nlarge human to crawl inside. ", "The zoologists who first encountered\nthese structures couldn't believe they'd been built by such a tiny\nbird, assuming instead that the local villagers had built them for\ntheir children to play in. ", "These bowers serve only a single\npurpose: they're built by the males to attract females. ", "Crucially,\nthey aren't used by the females for laying eggs and raising young.", "\nAfter mating with a male, the female flies off to build her own (much\nsmaller) cup-shaped nest up in a tree, and she raises her chicks\nentirely on her own, without any help from her mate.", "\n\nResearchers from Lund\nUniversity in Sweden trained ravens to use a simple machine where\nthey dropped a rock in a tube to earn a food reward. ", "Later, they were\nput in a room with the puzzle box (but no rock), which was then\nremoved. ", "An hour later, the birds were presented with a row of\nobjects: the rock, and several distractions. ", "Nearly all of them chose\nthe rock, and 86 percent managed to successfully use it to open the\nmachine when it was presented to them 15 minutes later. ", "Even more\nremarkable is that one\nraven in the experiment figured out how to work their rock/box\ncontraption first, then began teaching the method to other ravens,\nand finally invented its own way of doing it. ", "Instead of dropping a\nrock to release a treat, the future Ruler of the Raven Kingdom\nconstructed a layer of twigs in the tube, and pushed another stick\ndown through the layer to force it open. ", "The bird had to be removed\nfrom the experiment before it could teach any other birds how to do it.", "\n\nBees have also been proven to\nbe smarter than anyone thought. ", "In experiments where bees had to\nselect numbers on cards in order to obtain food rewards, bees\nperformed at a level consistent with that of nonhuman primates by\nunderstanding that zero is lower than one.", "\n\nSimilar experiments have shown\nthat dolphins and parrots understand the concept of zero. ", "But given\nthat bees have only about one million neurons in their brains,\ncompared to 86 billion in humans, it’s especially impressive\nthat they are such sophisticated mathletes.", "\n\nThere are many instances of interspecies bonding\nand interaction. ", "SCARS, a Greek rescue organization, provided the\nfollowing example: While\nout on a walk near the mountain town Ymitos, Greece, a wonderfully\ngallant dog named Aragon led his human directly a box of tiny kittens\nwho had been abandoned by an unknown person, like so many other\nvulnerable animals had before. ", "Luckily, Aragon was with a Second\nChance Animal Rescue Society (SCARS) volunteer who knew exactly what\nto do and who to contact. ", "Since that day, Aragon has become their\nbiggest fan, fostering the little felines and loving them like they\nwere his very own. ", "The kittens are adorable, playful, healthy and\navailable for adoption through SCARS. ", "Then\nthere's the black cat who befriended eight orphaned hedgehog babies.", "\nKeepers at Sadgorod Zoo in Vladivostok, Russia, worried as cubs\nrefused bottles. ", "But Musya, the zoo's resident cat, still had milk\nleft after taking care of several foster kittens. ", "The hedgehogs took\nto her immediately and she started producing milk for them.", "\n\nA seminar called\n“animal-assisted education” was offered for the 2016 summer\nsemester at a German university, teaching students the benefits of\nusing animals at day care centers, youth centers, and schools, for\nexample, with regard to the assumption of responsibility and mutual\nrespect. ", "It may just be a coincidence that Campus cat Fräulein\nSinner has chosen Hildesheim University over shelters and family\nhomes as her place to live, eat, sleep, and study, and has sat in on\nlectures for the past 13 years, since she turned up as a thin,\ninjured stray.", "\n\nHermit crabs rely on shells\nto protect their soft abdomens from predators and the elements. ", "They\nare always on the lookout for shells that might better suit their\nsize and situation since, as the video states, “To be left\nwithout a shell is a death sentence.” Mark Laidre\npublished a study in 2012\nthat found that hermit crabs congregate around a smaller hermit\ncrab, form a “conga line” smallest to largest, and then\ntake turns moving into a larger shell.", "\n\nPresident John Quincy Adams had\na pet alligator.", "\n\nNational Geographic\nphotographer Joel Sartore has captured portraits of more than 5,000\ncreatures to date, with more to come. ", "Photo\nArk is a multiyear National\nGeographic project with a simple goal— to create portraits of\nthe world’s species before they disappear and to inspire people\nto care. ", "Each image is a visual connection between the animals and\npeople who can help protect them.", "\n\nA new book, Ten\nMillion Aliens: A Journey thought the Entire\nAnimal Kingdom, contains a wealth of\nfascinating facts, especially about the 90% of all living creatures\nhave no backbone. ", "That means that mammals and vertebrates make up\nonly a small minority of the animal species.", "\n\nResearchers in the U.K. have\ndiscovered the strongest biological material ever recorded—in a\nbreed of aquatic snails. ", "Limpets, which are snails with shells that\nhave no obvious coiling, possess teeth made of goethite, an\niron-based mineral that is threaded into fibers. ", "It is five times\nstronger than spider silk and is now deemed the world's strongest\nmaterial. \"", "These teeth are made up of very small fibers, put\ntogether in a particular way,\" the study's lead author Asa\nBarber said. \"", "And we should be thinking about making our own\nstructures following the same design principles.\"", "\n\nIt seems the octopus has been overlooked until its\ngenome was decoded recently. ", "It turns out they have the largest\ngenome of all invertibrates, similar is size to the domestic cat, and\nmore genes than humans. ", "They have large brains which allow them to\nlearn and solve puzzles and use tools.", "\n\nOctopuses, along with cuttlefish and squid, have\nfar larger, more complex nervous systems than any of their molluscan\nrelations—or indeed, than any other invertebrates. ", "They have\neight arms, each lined with scores of suckers capable of grasping and\ntasting. ", "Octopuses lack bones or an external shell (though they have\na piece of cartilage that protects the brain). ", "As a result, their\nbodies are soft, flexible, and stretchy—properties that allow\nthem to vanish through tiny gaps. ", "A small octopus can easily get\ninside an empty beer bottle. ", "And in some species at least, the\nanimals have an astonishing capacity for camouflage, instantly\nchanging color, texture, and posture so as to blend in with lumps of\ncoral on a reef or the blankness of the sand.", "\n\nJean Cousteau and his team were the first to spend\na lot of time in the water observing and filming wild octopuses and\ngetting to know different individuals by visiting them regularly.", "\nBefore long, some of the animals would come out to greet the divers,\neven climbing onto them and going for a ride. ", "Others were shy, and\nwould stay in their holes. ", "Some appeared to develop preferences for\nparticular humans. ", "The divers wanted to know whether octopuses steal\nfish from fishermen’s nets, so they set up a net complete with\nseveral fish, and settled back to watch. ", "Sure enough, an octopus came\nand helped itself to the lot. ", "Another octopus opened a jar containing\nfood, while a third seemed disturbed by its reflection when shown a\nmirror. ", "Octopuses have 500 million neurons. ", "This is more than five\ntimes the number in a hamster, and approaches the number in the\ncommon marmoset, a kind of monkey.", "\n\nSmart animals tend to be long-lived, since a large\nbrain both takes a long time to grow and helps an animal avoid\ndanger. ", "Apes, elephants, whales and dolphins, crows and other\ncorvids, parrots: They all share these traits. ", "Except the octopus.", "\n\nIn just seven years, a single\npair of cats and their offspring could produce a staggering total of\n420,000 kittens.", "\n\nDr. Elizabeth Devitt, DVM, writing about cat color in www.catchannel.com,\ndescribes the black and white cat as born\nto be an ambassador. ", "There is\nalways a black and white cat in residence at 20 Downing Street,\nresidence of the British Prime Minister.", "\n\nAn article in Cat\nFancy\nabout cats predicting earthquakes cited the experience of Simon\nTeakettle II (Tiki) just before the huge tsunami which devastated\nsoutheast Asia, which was detected by seismographs on the other side\nof the world (including Canada's national capital, where we live). ", "In\nthe aftermath of that disaster, it was revealed that most coastal\nanimals left for higher ground hours before the quake causing the\ntsunami hit. ", "Now scientists have discovered that a certain species of\ntoad fled a town in central Italy just before an earthquake struck\nthere. ", "How many animals in Haiti and Chile predicted the quakes that\nhit there recently, or are these areas so quake-prone that the\nanimals no longer react?", "\n\nThe National Zoo documented\nstrange behavior in several of its animals in the minutes before the\nAugust 2011 earthquake struck the east coast of the U.S. Five to 10\nseconds before the quake, many apes ditched their food and began\nclimbing their tree-like structure. ", "Flamingos also seemed to know it\nwas coming, gathering into a group before the shaking began and\nremaining huddled throughout the quake. ", "Most impressively, red ruffed\nlemurs let out an alarm call 15 minutes before the quake and then\nagain just before it struck.", "\n\nDogs, cats, monkeys, and all\nother vertebrates all yawn. ", "The giraffe is the only exception, and\nnobody seems to know why.", "\n\nA giraffe can clean its ears\nwith its 21-inch tongue.", "\nGiraffes have no vocal chords.", "\nGiraffes don't yawn.", "\nA giraffe has only seven bones in his neck, like all mammals.", "\n\nGiraffes sleep only 1.9 hours a\nday in five- to 10-minute sessions. ", "Koalas, however, are the\nlongest-sleeping mammals, sleeping up to 22 hours a day.", "\n\nThe giraffe has been added to\nthe international watch list of threatened and endangered species.", "\nThe tallest land animal is now “vulnerable” to extinction\nafter its population shrunk about 40 percent in 30 years. ", "In 2015,\nthere were only about 97,562 giraffes in the world, reports the\nInternational Union for Conservation of Nature. ", "Scientists blame\nhabitat loss, in part, for the decrease in population.", "\n\nOnly one half of a\ndolphin’s brain goes to sleep at a time. ", "Dolphins are capable of\nwhat is known as unihemispheric sleep, in which one hemisphere of the\nbrain goes into a deep sleep while the other hemisphere remains\nawake. ", "This allows dolphins to sleep under water without drowning.", "\nDolphins spend approximately one third of their lives asleep.", "\n\nInside some whales and\ndolphins are small bones that show they once had back legs and that\ntheir ancestors walked on land. ", "These occasionally reappear as tiny\nrear flippers.", "\n\nBottlenose dolphins develop\nan individual vocal label known as their signature whistle, which\nthey use to broadcast their identity. ", "They have been shown to\nremember the signature whistles of other individuals even after 20\nyears of separation.", "\n\nThe longest living mammal is\nthe blowhead whale, which can live more than 200 years.", "\n\nBut\nthe ocean\nquahog, a hard shelled clam often found off the coast of New England,\nis the longest living animal in the world, often reaching 500 years\n\nNine out of ten humans are\nright-handed. ", "Most animals are closer to ambidextrous than right-or\nleft-pawed, clawed, etc. ", "Terzo favored his left paw, and so does Penny.", "\n\nAn important difference between wild and domestic\nanimals is that animals who live with humans have flatter faces, more\nrange of colors, things like floppy ears and curly tails (to use dogs\nas an example). ", "Wolves have larger brains than dogs, which allows\nthem to have flashes of insight so they can solve problems on their\nown. ", "Dogs, on the other hand, rely on humans to solve problems, so\nare much better than wolves in noticing and interpreting the gaze and\ngestures of humans.", "\n\nUnlike other animals, wolves have a variety of\ndistinctive facial expressions they use to communicate and maintain\npack unity.", "\n\nThe Vikings wore wolf skins and drank wolf blood to\ntake on the wolf's spirit in battle. ", "There were referred to as Berserkers,\nwhich is where that word came from.", "\n\nThe Greeks believed that if someone ate meat lamb\nthat a wolf had killed, he or she ran a high risk of becoming a vampire.", "\n\nUnder certain conditions, wolves can hear as far as\nsix miles away in the forest and ten miles on the open tundra.", "\n\nAnimals began to be domesticated about 15,000 years\nago, when agriculture began. ", "Humans no longer had to move around to\nfollow game, and their settlements produced a lot of garbage, which\nattracted animals who had to learn how to co-exist with humans.", "\n\nMost experts believe humans\ndomesticated dogs before donkeys, horses, sheep, goats, cattle, cats,\nor chickens. ", "Researchers speculate that early dogs crept up to the\nhuman campfire to beg or steal meat. ", "Humans began to share their\nbread, so that these early species developed the ability to digest\nstarches. ", "If wolves had wanted to get human food, they would have\nneeded to evolve both trusting behaviors and mechanisms for digesting\nstarch. ", "Dogs, in other words, evolved a mechanism for digesting\nstarches that wolves don’t have.", "\n\nAll dogs can be traced back\n40 million years ago to a weasel-like animal called the Miacis which\ndwelled in trees and dens. ", "The Miacis later evolved into the\nTomarctus, a direct forbear of the genus Canis, which includes the\nwolf and jackal as well as the dog.", "\n\nAs a single species, the\ndomestic dog embodies one of the largest collections of phenotypic\ndiversity for any species living on earth.", "\n\nThe shape of a dog’s\nface suggests how long it will live. ", "Dogs with sharp, pointed faces\nthat look more like wolves typically live longer. ", "Dogs with very flat\nfaces, such as bulldogs, often have shorter lives.", "\n\nDuring the Middle Ages,\nGreat Danes and Mastiffs were sometimes suited with armor and spiked\ncollars to enter a battle or to defend supply caravans.", "\n\nDalmatians are completely\nwhite at birth.", "\n\nBranford, Connecticut, where\nBobbi used to spend summers growing up, began to license dogs in 1908.", "\n\nThe Westminster Dog Show is\nthe longest-running continuously held sporting event in the country,\nsecond only to the Kentucky Derby. ", "It began in 1877, prior to the\ninvention of the light bulb or the building of the Washington\nMonument. ", "It predates the admission of 12 states to the Union.", "\n\nThe corn fritters known as hush\npuppys earned their name because\nthey were tossed to barking dogs in order to quiet them down.", "\n\nThe Beach Boys’ song, Shannon,\nwas written about guitarist/singer, Carl Wilson’s Irish Setter.", "\n\nPolice in Queensland, Australia tried their best to\nmake a tough K-9 cop out of a puppy named Gavel, but the young\nGerman Shepard flunked out of his training program because, as the\nBBC reported, instead of tackling hardened criminals, [Gavel]\nliked to meet strangers, and police in Australia felt he did\nnot display the necessary aptitude for a life on the front line. ", "Fortunately,\nGavel found a gig that seems far better suited to his\ntemperament... he's now the Vice-Regal Dog at Government House in Queensland.", "\n\nMany animals seem to take on a more juvenile state\nas they are domesticated, getting bigger eyes, smaller faces and less\naggressive demeanors. ", "One common way\nof achieving a domesticated form of a species might be to slow down\nthe development of the animal,\nAxelsson says. ", "It appears thatit’s\nthe development of the nervous system that’s affected, gives\nsome support to this theory.", "\n\nSome animals possess the\namazing ability to turn white during the winter: the arctic fox,\narctic hare, ptarmigan, barren-ground caribou, and ermine all change\ncolors as winter approaches, given them protection from predators\nin the snow.", "\n\nRaccoons will back down during\nfeeding to let a a mother and her cubs eat before any others.", "\n\nThe only two animals that\ncan see what's behind them without turning their heads are the rabbit\nand the parrot.", "\n\nFour of the five fastest\nland animals reside in Africa: the cheetah, the wildebeest, the lion,\nand the Thomson’s gazelle. ", "All of these animals can run at\nspeeds above 50 miles per hour, with the cheetah reaching a top speed\nof about 70 miles per hour.", "\n\nThe world's fastest land animal, the cheetah, is a successful hunter\nnot only because it is quick, but also because it can hold an\nincredibly still gaze while pursuing prey. ", "For the first time,\nresearchers have investigated the cheetah's extraordinary sensory\nabilities by analyzing the speedy animal's inner ear, an organ that\nis essential for maintaining body balance and adapting head posture\nduring movement in most vertebrates. ", "The study, published in the\njournal Scientific Reports and led by researchers at the American\nMuseum of Natural History, finds that the inner ear of modern\ncheetahs is unique and likely evolved relatively recently.", "\n\"This distinctive inner ear anatomy reflects enhanced\nsensitivity and more rapid responses to head motions, explaining the\ncheetah's extraordinary ability to maintain visual stability and to\nkeep their gaze locked in on prey even during incredibly high-speed\nhunting,\" said coauthor John Flynn, the Frick Curator of Fossil\nMammals in the Museum's Division of Paleontology.", "\nCheetahs are also typically solitary animals. ", "While males sometimes\nlive with a small group of brothers from the same litter, females\ngenerally raise cubs by themselves for about a year.", "\n\nBridget, a lioness was born\nat the Oklahoma City Zoo in 1999, lived a fairly typical zoo lion\nlife for most of her first 18 years. ", "Then she grew a mane.", "\nJennifer D’Agostino, the zoo’s director of veterinary services,\nthinks it may be an overproduction of testosterone,\nthe hormone that makes male lions develop manes at around one year\nof age. ", "An overproduction of that hormone is also implicated in the\nlush locks of wild maned lionesses in Botswana’s Okavango Delta.", "\nIt's possible that the\nlionesses’ mothers had abnormally high levels of male sex\nhormone during pregnancy, he said. ", "Researchers who study the Botswana\nmaned lionesses say they have never become pregnant, which can be a\nconsequence of elevated testosterone.", "\n\nLions can run up to 50 mph,\nbut only in a straight line and only for a few seconds at a time.", "\nConsequently, lions get as close as they can to their prey before\nthey start the chase.", "\n\nBirds evolved from dinosaurs\nand both are descended from reptiles. ", "The closest living reptilian\nrelation of a bird is the crocodile.", "\n\nHummingbirds are the only birds\nable to fly backwards. ", "They are also the only\nbirds that\ncan hover and even fly upside down. ", "One species of hummingbird\ncan dive at a rate of sixty-one miles per hour.", "\n\nThe common, or northern,\nmockingbird (Mimus polyglottos) is well known as a mimic; it has been\nknown to imitate the songs of 20 or more species within 10 minutes.", "\n\nAccording to Nature World Report, birds that ended\nup choosing their own mates had 37 percent more offspring than those\nthat were paired up by humans.", "\n\nSwiftlet nests are made from\nstrands of saliva from the male swiftlet bird. ", "Swiftlet nests\ncollected from Thai caves can fetch more than $900 per pound. ", "It is\none of the world’s most coveted and expensive food items.", "\n\nThere are about 10,000 bird species in the world.", "\nAbout 925 have been seen in the U.S. and Canada. ", "About 1,000 have\nbeen seen in Europe. ", "By far the largest concentration of bird species\nare found in South America. ", "Over 3,200 species have been seen there.", "\n\nThe brains of songbirds and parrots have twice as\nmany neurons of primate brains of the same mass and two to four times\nmore neurons that rodent brains of the equivalent mass. ", "Ravens and\nkea parrots have 1.2 billion neurons in their cerebral cortex, a\nbrain area associated with consciousness, more than capuchin monkeys\nhave. ", "The blue-and-yellow macaw has almost 2 billion neurons in the\ncerebral cortex — more than the rhesus macaques found in India\nand China.", "\n\nBirds can mimic complex sounds due to their\nfascinating physiology, which is specifically designed for sound.", "\nParrots are especially tuned into communicating from birth. ", "They\nlisten closely and recreate sounds from their flock in the wild. ", "In\ncaptivity, the domesticated parrot sees humans as their adopted flock\nand will try to speak a common language through mimicry.", "\nAdditionally, parrots are uniquely able to move their beaks to help\nshape sounds much in the way that humans use their lips.", "\n\nThe crow is actually a large\nsongbird. ", "Instead of a musical voice, it has more than 20 rough\ncalls, each of which has a different meaning. ", "Crows have 250 distinct\ncalls, including two different vocal levels, loud as a public voice,\nand a softer voice for \"chatting\" with family.", "\n\nThe raven is a relative of\nthe crow, the largest songbird of all, three times larger than a\ncardinal. ", "Jays, magpies and nutcrackers also belong to this family.", "\n\nResearch with jays has shown them to have superior\nabilities to plan for the future. ", "They will cache food in the place\nwhere they previously found breakfast, in anticipation of needing it then.", "\n\nJays, ravens, rooks, and other corvids (as well as\nparrots) have a larger neocortex than other birds. ", "Rooks, for\nexample, will drop rocks into a tube where they can see a tasty worm\njust below the reach of their beaks, until the water level rises sufficiently.", "\n\nA team of researchers in northern Australia has\ndocumented kites and falcons, colloquially termed\n“firehawks,” intentionally carrying burning sticks to\nspread fire. ", "While it has long been known that birds will take\nadvantage of natural fires that cause insects, rodents and reptiles\nto flee and thus increase feeding opportunities, that they would\nintercede to spread fire to unburned locales is astounding.", "\n\nCrows can recognize human\nfaces and tell other crows which humans are friends are which are\nenemies. ", "A recent study of crows in captivity suggested that these\nbirds memorize the faces of the humans who had initially captured\nthem — and they then warn their crow friends about them.", "\n“Even after going for a year without seeing the threatening\nhuman, the crows would scold the person on sight, cackling, swooping\nand dive-bombing in mobs of 30 or more,” wrote Stephanie Pappas\nin 2011 for LiveScience. ", "And a follow-up study of crows using\nbrain-imaging technology found that bird brains look a lot like human\nbrains when it comes to recognizing the faces of people they know.", "\n\nCrows memorize garbage\nroutes for best times to find food, and learn from each other. ", "They\nmate for life, and babies spend a long time with the family,\nlearning from parents and older siblings. ", "This exended family helps\nthe young thrive and learn, and a wider diet helps the brain develop.", "\nOmnivores have to learn how to find and deal with different foods.", "\nCrows learn, for example, the height from which to drop nuts so they\nwill crack open but not smash. ", "Social animals have to learn\nrelationships, which also require more brain power. ", "Like elephants,\ncrows gather to mark the site where a friend has died.", "\n\nWhile waiting to buy a\nticket at the Kinshicho Station in Tokyo, Yuzu resident Kinoshita\nShoji captured very amusing footage of a clever crow hopping from one\nself-service machine to another, trying to figure out how to purchase\na ticket. ", "After watching the humans for a while, the wily bird stole\na credit card from an unsuspecting commuter, but was unable to figure\nout how to put the card in the machine. ", "The bird then very politely\nreturned the credit card to the commuter upon her request.", "\n\nOnly elephants and chimps\nactually make tools. ", "Crows make hooks, which chimps don't do. ", "A crow\nwill use a short stick to retrieve a longer stick that can reach the food.", "\n\nThe mother who gives birth to\nthe largest baby on Earth is a mother elephant. ", "After enduring 22\nmonths of pregnancy, she gives birth to a blind, 200-pound calf. ", "A\nmother orangutan never puts her babies down and typically nurses them\nfor 6 or 7 years, which is the longest mother/child nursing\ndependence of any animal on Earth.", "\n\nResearchers analyzing footage of chimpanzees at\nBurgers’ Zoo in the Netherlands aggressively attacking a drone\nsay the primates planned their actions in advance and weren’t\nacting out of fear. ", "The group of chimps noticed the drone during a\npreliminary flyby and immediately grabbed twigs and long sticks\nbefore climbing to the treetops. ", "When the drone returned, they were\nprepared. ", "“The use of the stick as a weapon in this context was\na unique action,” study author Jan van Hooff, a primatologist\nwith life-long ties to the zoo, said in a statement. ", "“It seemed\ndeliberate, given the decision to collect it and carry it to a place\nwhere the drone might be attacked.” The primates have not been\ntaught to use tools, but have learned 13 unique skills by observing\nhumans visiting the zoo.", "\n\nThere are 220 species of\nowls in the world. ", "Owls can almost turn their heads all the way\naround, but it's not quite a 360 turn. ", "They can turn their necks 135\ndegrees in either direction, which gives them 270 degrees total\nmovement. ", "Owls are able to turn their heads without injury or\ncutting off blood to their brain because they have a blood-pooling\nsystem that powers their brain and eyes during a dramatic neck twist.", "\nAn owl's eyes are so well-developed that they are not balls but\nrather tubes that are held into place by a bony structure. ", "This means\nan owl can only look straight ahead. ", "An owl must turn its head to\nlook side to side. ", "Owls ears are placed asymmetrically and are\ndifferent sizes. ", "This allows them to receive sounds at different\ntimes and pinpoint the exact location of the sound.", "\n\nParakeets are enjoying a\npopulation explosion in London suburbs, devouring seed from feeders,\nfighting with native birds, and possibly threatening crops. ", "No one\nknows why the parakeets have flourished. ", "Possible reasons include\nresidents putting out more food for them, planting berries they like\nto eat, the death of a predator, or climate change. ", "Or it could be\nsimply that once there are enough parakeets, it’s easier for\nthem to find mates, and they breed faster. ", "In any case, the\ngovernment is keeping an eye on them lest they begin to ravage crops\nas they do in India. ", "“I was delighted when I first saw one in my\nyard, but when you have a flock of 300, it’s a different\nmatter,” said Dick Hayden, a retiree volunteering to help take a\ncensus of London’s parakeet population. ", "“They eat all the\nberries. ", "They ate all the food from my feeder in one day; it was ludicrous.”\n\nPenguins can identify the\nscent of close relatives, as well as their mates. ", "This means they can\nreunite with their life partners (yes, they're among the birds who\nmate for life) in crowded colonies.", "\n\nThere are 18 different kinds\nof penguins.", "\n\nYou can't tell a penguin's sex\neven by examining them closely. ", "The only way to tell is by DNA testing.", "\n\nThe Thing with Feathers: The\nSurprising Lives of Birds and What They Reveal About Being Human is\na fascinating book by Noah\nStrycker. ", "One\nof the things he says about certain birds who seem to be able to\nfind their way across long distances is: To\nbe able to find their way home from an unfamiliar place, birds must\ncarry a figurative map and compass in their brains. ", "The map tells\nthem where they are, and the compass tells them which direction to\nfly, even when they are released with no frame of reference to their\nloft. ", "Researchers have gone to great lengths to confirm that pigeons\ndon't merely memorize their outward trip. ", "In one experiment, birds\nwere transported in sealed containers filled with purified air,\nmounted on tilting turntables between coils that varied the magnetic\nfield, and exposed to loud noises and flashes of light, so that,\nunlike a blindfolded person in the backseat of a taxi who might\nremember the twists and turns of the journey, they had no external\ncues. ", "In another study, pigeons were anesthetized and unconscious\nduring the outward trip. ", "They still made it home, proving the\nexistence of an intrinsic map and compass system.", "\n\nWhile the ostrich lays the\nlargest eggs on land, the whale shark lays the largest eggs in the\nworld. ", "An egg from a whale shark measuring 14 inches in diameter was\nfound in the Gulf of Mexico in 1953.", "\n\nAbraham Lincoln had two goats\nnamed Nanny and Nanko, and they often slept in his son Tad’s bed.", "\n\nResearchers at the Life\nSciences College of Nanjing Agricultural University in China recently\ndiscovered that the endangered giant panda has a potent antimicrobial\ncompound in its bloodstream. ", "Known as cathelicidin-AM, the compound\ncan kill a wide range of bacteria, including those that are resistant\nto antibiotics. ", "According to the Daily Telegraph, cathelicidin-AM was\nable to kill bacteria in less than an hour — five hours faster\nthan other widely used antibiotics. ", "The discovery may lead to\nincreased interest in preserving the population of wild pandas. ", "There\nare about 1,600 left in the wild, and more than 300 pandas live in\nzoos and breeding centers around the world, mostly in China. ", "And for\nthose worried that this scientific breakthrough will lead to pandas\nbeing killed for their amazing antibiotic blood: fear not. ", "The\ncompound can be manufactured synthetically in the laboratory.", "\n\nNine out of every 10\nliving things live in the ocean. ", "But scientists have explored only 1%\nof the ocean depths. ", "They believe millions of new kinds of animals\nand fish are down there, waiting to be discovered.", "\n\nA starfish uses its arms to\nforce open shellfish, turns its stomach inside out onto the prey, and\ningests it.", "\n\nOut of about 33,000 species of\nfish, 2,500\nare venomous.", "\n\nResearchers have successfully\ntaught goldfish to play fetch, push levers, do the limbo, and even\nplay soccer. ", "If they are fed around the same time of day, they also\nremember that and will anticipate the feeding leading up to that\ntime, which implies they have a very good sense of time. ", "Goldfish\nalso have been shown to be able to recognize their masters and even\npick their favorites (usually the one who feeds them). ", "Around certain\npeople the goldfish is very familiar with, they will often be much\nmore active when they see the person. ", "them. ", "Around strangers, on the\nother hand, the goldfish will often hide. ", "Blind goldfish also exhibit\nthis same type of behavior, except they respond to the voice of their\nowner, similarly to how the non-blind goldfish respond to the sight\nof their owner.", "\n\nA male emperor angelfish lives\ntogether with up to five female mates. ", "If the emperor angelfish dies,\none of the females turns into a male fish and becomes the leader of\nthe group.", "\n\nThe fastest fish is the\nsailfish. ", "It can swim as fast as a car travels on the highway.", "\n\nOne of Thailand’s most\ncurious creatures is the mudskipper, which is a fish that is capable\nof walking on land and climbing trees. ", "It uses its fins to\n“walk” and can absorb oxygen through its skin and lining in\nits mouth. ", "It spends most of its time out of the water, eating the\nalgae in tidal pools.", "\n\nUnlike most other fish, the\nocean sunfish does not have a tail. ", "A female sunfish can lay 300\nmillion eggs each year. ", "Each egg is smaller than the period at the\nend of a sentence.", "\n\nSince a fish’s jaw is not\nattached to its skull, many fish can shoot their mouths forward like\na spring to catch startled prey.", "\n\nJellyfish are not fish. ", "They\nhave no eyes and no brain. ", "Some\ntypes grow up to 80 feet long!", "\n\nDolphins and humans have many of the same basic\ntraits: high intelligence, self-awareness, and sophisticated social skills.", "Some\ndolphins can understand as many as 60 words, which can make up 2,000\nsentences. ", "They are among the few mammals able to recognize\nthemselves in a mirror, and one of the few species with cells that\nact as bridges between brain areas devoted to cognition and\nself-awareness. ", "Dolphins don’t have a sense of smell, but they\ndo have a sense of taste and, like humans, can distinguish between\nsweet, sour, bitter, and salty tastes.", "\n\nBats and dolphins both use\necholocation­emitting sounds and listening for echoes to help\nlocate prey­and both went through similar evolutionary changes to\ndevelop it, scientists say in a new study. ", "They found that the two\nspecies, while evolving independently, underwent many of the same\ngenetic and physical changes, with natural selection strongly\npreferring animals with more highly developed echolocation abilities.", "\nOverall, there were 200 genomic regions where dolphins and bats had\nsimilar genetic inventions.", "\n\nA single bat can eat more than\n600 bugs in one hour.", "\n\nA bat that dies while roosting\nwill continue to hang upside until something shakes it loose. ", "Most\nbats rest, sleep, mate, and give birth upside down.", "\n\nWhales, dolphins, and\nporpoises move through the water by plunging their tails up and down\nin a vertical motion. ", "This action distinguishes them from fish, which\nmove their tails from side to side when swimming.", "\n\nA female dolphin will assist\nin the birth of another’s baby dolphin, and if it is a difficult\nbirth, the ‘midwife’ might help pull out the baby. ", "Other\ndolphins, including bulls, will swim around the mother during birth\nto protect her.", "\n\nA dolphin can produce whistles\nfor communication and clicks for sonar at the same time, which would\nbe like a human speaking in two voices, with two different pitches,\nholding two different conversations.", "\n\nWhile ancient fishermen used\nthe meat of whales for food, in the modern era whales were primarily\nhunted for oil and whalebone, a term used for the baleen. ", "Whalebone\nwas used to make corsets, umbrella ribs, handles, and brushes, while\nthe oil was used for cooking, candle wax and, much later, making margarine.", "\n\nScientists in California\nbelieve that audio captured in 1984 was a whale imitating people. ", "In\nfact, the whale song sounded so eerily human, divers first thought it\nwas a human voice. ", "Handlers at the National Marine Mammal Foundation\nin San Diego heard mumbling in 1984 coming from a tank that sounded\nlike folks chatting. ", "An acoustic analysis revealed a beluga whale's\nsounds were several octaves lower than typical whale calls.", "\nScientists think the whale's close proximity to people allowed it to\nlisten to and mimic human conversation. ", "This research was published\nonline in Current\nBiology.", "\n\nThe eyes of frogs and toads bulge out enabling them\nto see in almost all directions. ", "The close their eyes by pulling the\neyeballs deeper into the sockets, which closes the upper and lower\neyelids at the same time. ", "Most species also have a thin, partly clear\ninner eyelid attached to the bottom lid. ", "This inner eyelid is called\nthe nictitating membrane. ", "It can be moved upward when the eyes are\nopen. ", "It protects the eyes without completely cutting off the vision.", "\n\nAn intoxicated ant will\nalways fall over on its right side.", "\n\nButterflies have been sighted\nnear the top of the Empire State building, and some species live in\nmountain areas at elevations up to 5,500 meters.", "\n\nOver 3,000 species of mayfly are known worldwide,\ngrouped into over 400 genera in 42 families. ", "One, calls a\nnymph, has a long tail and wings that do not fold flat over the\nabdomen. ", "Their delicate four wings are the inspiration for Disney's Tinkerbell.", "\n\nAustin, Texas is home to the\nlargest bat colony in North America. ", "Over 1.5 million bats roost\nbeneath the Congress Avenue Bridge over Lady Bird Lake and eat\nbetween 10,000- 30,000 lbs. ", "of insects a night.", "\n\nCheetahs are the fastest\nland animal and can reach speeds up to 72mph.", "\n\nThe Mongolian pony is the only\nanimal other than an elephant capable of fending off an attack by a\nhealthy adult tiger.", "\n\nDomesticated on the Eurasian steppes before 3500\nB.C., horses carried the Huns, the Mongols, and the Pizarro brothers\nto victory over the Romans, the Chinese, and the Incas, remaking\nancient cultures into societies dependent on high-speed mobility, and\nrevolutionizing human transport.", "\n\nHorses were introduced to American Indians by\nEuropeans in the early 1500s. ", "As ownership of horses spread, it\ncreated great disruption among Native American tribes, because the\nincreased need for grazing lands caused an increase in wars among tribes.", "\n\nHorses are not only intelligent, but they use both\nsides of their brains to process information. ", "This may be because\ntheir eyes point to the sides instead of forward. ", "This is why they\nsometimes don't appear to see something to the right of them as the\ngo up the road, but may react to it coming back.", "\n\nHorses have five highly developed senses: taste,\ntouch, hearing, smell, and sight. ", "They also have an enigmatic sixth\nsense, heightened perception, which is very rare in humans.", "\n\nWild horses who live on the Outer Banks of North\nCarolina survive hurricanes by huddling together at a large tree with\ntheir backs to the wind.", "\n\nLike elephants, horses who have positive\nexperiences with a human never forget that person. ", "Horses also\nrespond better to two-syllable words than to single syllables.", "\n\nElephants communicate in all\nsorts of ways. ", "They trumpet, of course, and flap their ears and\nrumble at frequencies so low you might feel it, but never hear it.", "\nTheir feet and trunks are sensitive enough to pick up vibrations\ncreated by other\nelephants\nas far as 10 miles away. ", "These messages convey more than the presence\nof food or danger. ", "Elephants can tell if the stomper is a friend or a\nstranger, and use subtle differences in what each foot feels to\ntriangulate the location.", "\n\nWhen one Asian elephant sees\nthat another elephant is agitated, scientists have observed that the\ncalmer one will respond by touching the distressed animal with its\ntrunk. ", "“I’ve never heard that vocalization when elephants\nare alone,” Joshua Plotnik, who led the study, told Discovery.", "\n“It may be a signal like, ‘Shshh, it’s okay,’ the\nsort of sounds a human adult might make to reassure a baby.”\n\nFlamingos are pink because\nthey eat shrimp.", "\n\nA snail can sleep for three years. ", "Koalas are the longest-sleeping\nmammals, sleeping up to 22 hours a day.", "\n\nA species of earthworm in\nAustralia grows up to 10 feet in length.", "\n\nThe largest recorded lobster, caught off the coast\nof Nova Scotia in 1934, weighed 44.4 pounds and was at least 100\nyears old, according to scientists.", "\n\nThe largest fish caught with a rod and reel was a\nGreat White shark. ", "It weighed 2,664 pounds and was almost 17 feet long.", "\n\nSharks have been called “swimming noses”\nbecause their sense of smell is so good (they smell with their\nnostrils but don’t breath through them). ", "Some sharks can smell\none part of blood in 100 million parts of water and can tell which\ndirection that smell is coming from.", "\n\nA woodpecker can peck\ntwenty times a second.", "\n\nDogs have about 10 vocal\nsounds; cats have over 100.", "\n\nDog nose prints are as\nunique as human finger prints and can be used to identify them.", "\n\nWild animals are always\nfighting or fleeing to survive and that makes it hard for humans to\nget close but what if an animal was born with fewer of these neural\ncrest cells&ldots;that animal would have less adrenaline. ", "It would\nprobably be less freaked out by humans and it would pas that behavior\non to its offspring. ", "This explains why domesticated dogs are more\nlikely to have floppy rather than pointed ears, and shorter snouts.", "\n\nAccording to Discover\nMagazine, dogs and cats have gotten really good at reading people,\nalbeit in their own peculiar ways. ", "Dogs are easily influenced human\nactions or what a new study calls \"ostensive cues.\" ", "These\nare the same cues — body language, gazes — an inarticulate\ninfant picks up on when it's trying to figure out what the world's\nall about. ", "Researchers working on this new study figured out that\ndogs, true sycophants that they are, make their decisions based on\nostensive cues from people, preferring, in one instance, a plate of\nfood preferred by a person even in that plate has less food than another.", "\n\nCats, however, run a\ndifferent game on their doting human companions. ", "In a paper titled,\n\"The cry embedded in the purr,\" researchers explain\ndifferent purrs cats employ to get people to do things for them.", "\nCertain purrs, they found, sound so urgent, grating, and generally\npitiful that people will do anything — including pouring out\ndish after dish of Fancy Feast — to make it stop. ", "The\n\"solicitation purr\" is inharmonic to boot, meaning that\neven veteran cat owners who think they know all of their cat's wiles\nare susceptible to the distressing sound.", "\n\nA black Lab in New Zealand\ndonated blood to a cat. ", "When Macy’s cat friend, Rory,\naccidentally ate rat poison, a bold veterinarian took a drastic\nmeasure to save the cat’s life. ", "With time working against them,\nthe vet took a gamble that Macy’s blood would be a match with Rory’s.", "\n\nThree dogs from First Class\ncabins survived the sinking of the Titanic – two Pomeranians and\none Pekingese.", "\n\nSome scientists believe our relationship with dogs\ngoes back as far as 100,000 years. ", "One theory says that man and dog\nhave co-evolved through the centuries in untold ways; one scientist\nspeculates that we lost our own, keen sense of smell by relying on\nthe sharper sniff of our beastly hunting partners.", "\n\nRecent research indicates that the first dogs lived\nabout 33,000 years ago in Southeast Asia. ", "Using whole genome\nsequences from 58 canids (wolf and primitive dog species),\nresearchers determined that dogs from Southeast Asia have the\ngreatest genetic diversity compared with populations from other parts\nof the world. ", "They also exhibit the most genetic similarity to gray\nwolves, long believed to be dogs’ closest wild ancestor.", "\n\nIn his new book, The\nDog Who Couldn't Stop Loving,\nJeffrey Moussaieff Masson considers how a \"mutual evolution\"\nnot only impacted dogs, but also the human capacity to love and to\nfeel empathy for others.", "\n\nOf the 650 dogs that have\nseen active combat in Iraq and Afghanistan, more than 5 percent\nsuffer from canine PTSD. ", "The symptoms vary from hypervigilance and\nincreased aggression to extreme timidity. ", "The military is\nexperimenting with desensitization treatment and anti-anxiety\nmedication, but about half the dogs will half to be retired from\nservice. ", "They also stop being able to work.", "\n\nThere are five dog breeds that originated in\nCanada. ", "The most famous are the Alaskan sled dog, the Newfoundland\nand the Labrador retriever. ", "The Newfoundland dog evolved from the\nTibetan Mastiff, which was crossed with a Viking bear dog in the\nfirst century. ", "The Lab is thought to be descended from dogs abandoned\nby European fisherman.", "\n\nThirty percent of all\nDalmatians are deaf in one or both ears. ", "Because bulldogs have\nextremely short muzzles, many spend their lives fighting suffocation.", "\nBecause Chihuahuas have such small skulls, the flow of spinal fluid\ncan be restricted, causing hydrocephalus, a swelling of the brain.", "\n\nIn 2003, police in Warwickshire , England , opened\na garden shed and found a whimpering, cowering dog. ", "The dog had been\nlocked in the shed and abandoned. ", "It was dirty and malnourished, and\nhad quite clearly been abused. ", "In an act of kindness, the police took\nthe dog, which was a female greyhound, to the Nuneaton Warwickshire\nWildlife Sanctuary. ", "Jasmine started welcoming all animal arrivals at\nthe sanctuary. ", "It would not matter if it were a puppy, a fox\ncub, a rabbit or, any other lost or hurting animal. ", "Jasmine\nwould just peer into the box or cage and, when and where possible,\ndeliver a welcoming lick. ", "Jasmine, the timid, abused, deserted waif,\nbecame the animal sanctuary's resident surrogate mother, a role for\nwhich she might have been born. ", "The list of orphaned and abandoned\nyoungsters she has cared for comprises five fox cubs, four badger\ncubs, fifteen chicks, eight guinea pigs, two stray puppies and\nfifteen rabbits - and one roe deer fawn. ", "See the full story and\nphotos at: http://www.snopes.com/photos/animals/jasmine.asp\n\nThe smallest dog on record\nwas a matchbox-size Yorkshire Terrier. ", "It was 2.5? ", "tall at the\nshoulder; 3.5? ", "from nose tip to tail, and weighed only 4 ounces.", "\n\nRin Tin Tin\nwas part of a litter discovered in 1918 by an American soldier while\nserving abroad in World War I. He smuggled the pup into the U.S. from\nFrance, and trained him to jump so high he stood out from the many\nother German shepherd then working in Hollywood. ", "His breakthrough\nfilm was Where\nthe North Begins, based\non a script by Duncan. ", "He turned out to be one of Warner Brothers'\nmost profitable commodities, and lived to the age of 14.", "\n\nHelena\nKatz lives on an alpaca farm in the NWT. ", "She says that their\nlivestock dogs have different barks. \"", "One is the doggie doorbell\nto let us know someone has pulled into the driveway. ", "One is what we\ncall the patrol bark because they do it to announce to the\nunassembled masses in the bush that they're on duty. ", "They're telling\nbears, wolves, foxes and anything else out there to stay away. ", "Then\nthere's the angry bark they use if a wolf goes by. ", "The dogs tend to\nwork at night because that's when predators are out, but we don't\nusually go check unless we're hearing the angry barking, or the\nbarking goes on for a bit. ", "Livestock dogs are independent thinkers\nbecause they need to be able to analyze a situation without their\nhandler telling them what to do. ", "Consequently, we need to walk a fine\nline between demanding obedience and giving them enough room to think\nfor themselves. \"", "\n\nThere are several species of\nsquirrels, including the grey and black, which are actually the same.", "\nThey're sociable animals who live near deciduous trees, and we've\nhosted a family of black squirrels in our big maple tree for many\nyears. ", "Their relationship with Simon Teakettle II (Tiki) is on the Cat\nFacts page.", "\nFor more about squirrels, click HERE.", "\n\nThe Latin name for squirrel is sciurus,\nborrowed from the Greek word skiouros,\nmeaning critter living in the shadow of its tail.", "\n\nGroundhogs, also known as\nwoodchucks, are a type of marmot, large rodents related to squirrels.", "\nThey have a large habitat, extending throughout most of North\nAmerica, from Alaska, as far south as Alabama. ", "In the wild,\ngroundhogs usually live two to three years, but have been known to\nlive up to six years. ", "In captivity, they can live much longer. ", "The\noriginal Wiarton Willie - one of Canada's most famous prognosticating\ngroundhogs - lived to be 22 years old.", "\n\nGroundhogs are typically\n16-26 inches long, and weigh 4-9 pounds. ", "They have 22 teeth and\nmanage the length of their incisors by actively gnawing on tree bark\nand brush. ", "Two coats of fur: a thick, wooly, grey\nundercoat and a longer coat of silky brownish hairs, help to keep\nthem warm throughout the year.", "\n\nGroundhogs prefer to eat\nwild grasses, leaves, berries, and food crops. ", "They will also\noccasionally eat nuts, insects, grubs, snails, and other small\nanimals. ", "The average groundhog moves approximately 710 pounds of dirt\nwhen digging its burrow. ", "Burrows can be up to 46 feet long and up to\n5 feet underground. ", "They hibernate during the winter, usually between\nOctober and March or April, depending on the climate.", "\n\nIf in danger, a groundhog\nwill produce a high-pitched alarm whistle to warn the rest of its\nfamily. ", "This is how they got the nickname \"whistle-pig\" in\nsome regions. ", "Other groundhog sounds include squeals, barks, and\ntooth grinding.", "\n\nAccording to an article in the New\nYork Times\nby Natalie Angier, pigs are better than many other animals at\nlearning new things. ", "They can perform many tricks, including jump\nthrough hoops, bowing, spinning, and making sounds on command that\nmimic words. ", "They can be taught to roll out rugs, herd sheep, close\nand open cages, and even to play videogames with joysticks.", "\n\nA characteristis that beavers share with alligators\nand hippos is having their eyes, nose, and ears are all in a line\nclose to the top of the head. ", "This allows the animal to float with\nonly the top of the head visible above the water, and still have all\nsensory organs fully functional. ", "In addition, beavers can remain\nsubmerged for up to 15 minutes because they can store a lot of oxygen\nand also reduce their heart rate.", "\n\nBeavers take down large trees thanks to the top two\nincisors, which anchor the beaver's mouth while huge jaw muscles\npower the lower incisors. ", "Only one lower incisor cuts at a time,\nwhich is how they cut trees at an angle.", "\n\nThe hippopotamus is the\nthird largest land mammal after the elephant and white rhino. ", "A hippo\ncan live for up to 40 years.", "\n\nHippos can’t swim or\nfloat. ", "They walk or stand on surfaces below the water like sandbanks,\nspending most of the day in water to protect their sensitive skin\nfrom the sun. ", "They secrete an oily red substance that acts as a\nmoisturiser, sunblock and protects them from germs. ", "This also makes\nthem look like they are sweating blood.", "\n\nAlthough hippos can hold\ntheir breath for approximately seven minutes, most adult hippos\nresurface every three to five minutes to breathe. ", "This is an\nautomatic process – even sleeping hippo surface to breathe\nwithout waking. ", "Hippos can close their nostrils and ears to prevent\nwater from entering. ", "This is why hippo calves can suckle on land or underwater.", "\n\nMonogamy, a pair-bond between\na single male and female, is comparatively rare among mammals. ", "Small\nsongbirds, such as sparrows and warblers, are annually monogamous,\nforming new bonds each mating season. ", "Perennially monogamous\nanimals include: ducks, eagles, geese, swans, gibbons, lynx,\nmarmosets, mountain lions, wolves, foxes, and beaver.", "\n\nThe prairie vole is\nmonogamous; it forms long-term pair bonds after mating. ", "But\nthe montane\nvole, is polygamous; it mates and moves on.", "\n\nBob & Frances Walker have\nbuilt what Publisher's Weekly has called,\nthe ultimate cat-friendly fantasyland.", "\nSee \"the Cat House\" at their website,\nwhere you can use your mouse to track the cat paths through the\nfloor plan, buy their books, and take the tour.", "\n\nThe Elephant Listening Project\nat Cornell University has classified elephant sounds into distinct\ncategories. ", "These range from greetings, to protests, to reassurance,\nto annoyance, to get\nout of my way.", "\nBut it turns out these vocalizations are just a tiny fraction of the\nsounds elephants make. ", "Bob Simon, a correspondent for 60\nMinutes, investigated\nthis, and\ndiscovered that elephants talk to each other. ", "They communicate in\ntheir own secret language, most of which is inaudible to humans\nbecause it is infrasonic. ", "He also noticed that there's a protocol to\nmeeting an elephant. ", "He will offer up his trunk and he expects you to\nblow into it. ", "That way, he will remember you forever.", "\n\nNew research\nindicates that elephants can differentiate between male and female\nvoices, and between languages used by different tribes. ", "Proceedings\nof the National Academy of Sciences studied hundreds of wild\nelephants in Kenya, and discovered that the elephants reacted\ndifferently to the same phrase said in two different languages. ", "They\nreacted defensively to the Masai, who often kill them, whereas when\nthey heard voices of Kamba men, who are less threatening, they didn't react.", "\n\nElephants are terrified of\nbees and actually have a special, distinct vocalization for Run\naway the bees are angry.", "\n\nElephants have a unique way of walking. ", "Recent\nresearch indicates that they move each leg independently. ", "Cats walk\nby moving their front and back legs on one side, then the other side.", "\nThat is, the right hind leg moves forward, then the right foreleg;\nthen the sequence is repeated on the left side. ", "Only camels and\ngiraffes move in the same way. ", "Also, cats can rotate their front legs\nback and forth at a much greater range than other mammals. ", "The\nelephant is the only animal with 4 knees.", "\n\nAn elephant’s trunk is extremely complex and\nsensitive, capable of performing delicate functions like picking up a\ncoin from a flat surface or cracking open a peanut, blowing away the\nshell, and putting the kernel in its mouth. ", "The trunk\ncontains 40,000 muscles, but no bones.", "\n\nElephants are able to\nread the visual cue of pointing, picking the right bucket two thirds\nof the time­a slightly better rate than a 1-year-old human. ", "The\nscientists say pointing could be a social thing, since elephants live\nin packs that require cooperation and communication,\nand it's logical they'd used their flexible trunks for that.", "\n\nThe longest gestation period of any mammal is the\nelephant, at 22 months.", "\n\nThe Elephant Company,\nThe Inspiring Story of an Unlikely Hero\nand the Animals Who Helped Him Save Lives in World War II, by Vicki\nConstantine Croke, describes the\nJapanese occupation of Myanmar, then known as Burma, when Lt. ", "Col.", "\nJames Howard Williams and his\ncompany of elephants helped build bridges and evacuate refugees.", "\n\nThe book contains many additional facts\nabout elephants. ", "Their sense of smell\nis five times that of a bloodhound. ", "They have six sets of teeth\nthroughout their lives that move into place “not from\nunderneath, but as if moved forward along on a slow conveyor\nbelt,” and once they’ve used up their sixth set, they\nstarve to death.", "\n\nFrom The Memory of an Elephant: An Unforgettable Journey:\nAn elephant sleeps very little at night, \"usually standing,\nalways on alert,\" and takes standing naps throughout the day. ", "An\nadult elephant needs to drink 30 gallons of water a day and eat\nbetween 220 and 440 pounds of food depending on the season. ", "Elephants\ncan't jump and must have one foot on the ground at all times, and\ndespite an enormous weight of about five tons, an elephant makes no\nnoise while walking.", "\n\nWhite lions are very rare. ", "A\nfemale white lion cub, just a week old and yet to be named, made her\ndebut recently at the Belgrade Zoo in Serbia. ", "She weighs 2.8 pounds\nand traces her roots back to South Africa, where her mother, Masha, originated.", "\n\nAs herds of African lions\nwait for their prey, the oldest and weakest, no longer capable\nhunters, take their place in the tall grass and when the herd passes\nby, they roar. ", "This sends the herds in the opposite direction, into\nthe waiting pack of young lions.", "\n\nA tiger's stripes are completely unique to each\ntiger. ", "Tigers have the longest life span of all the big cats,\nand can live to up to 26 years in the wild. ", "There are five different\nspecies of tiger - Siberian, Indochinese, South Chinese, Bengal and Sumatran.", "\n\nThe leopard is the most widespread of all the big\ncats. ", "Leopards are so strong they can climb up a treecarrying\nprey twice their weight in their jaws.", "\n\nBig cats have an acute sense of hearing and a\nmother cat can hear one of her cubs crying from anything up to a mile away.", "\n\nThe blue whale can produce\nsounds up to 188 decibels. ", "This is the loudest sound produced\nby a living animal and has been detected as far away as 530 miles.", "\n\nPenguins can jump as high as six feet.", "\n\nThe Venezuelan brown bat can detect and dodge\nindividual raindrops in mid-flight, arriving safely back at his cave\ncompletely dry.", "\n\nMost people have more than\n1,460 dreams every year. ", "Animals also dream, although it's hard to\ntell what these contain. ", "Simon II (Tiki), however, was a rescued\nferal kitten, and often had dreams that disturbed his sleep\nsufficiently to cause him to twitch as if he was trying to escape\nfrom something frightening. ", "Terzo's naps, on the other hand, are\nalways tranquil.", "\n\nThere are 37 species of cats.", "\n\nThe “nine lives”\nattributed to cats is probably due to their having nine primary whiskers.", "\n\nCamelids are a species of two-hoofed mammals\nrelated to the camel and the dromedary. ", "They include the llama, which\nis quite a bit taller than the alpaca. ", "They hum when they congregate,\nand hiss and spit when they get into fights. ", "See Brinks, who\nmade it into the calendar put out by the Fort Smith Animal Shelter in\nthe NWT, in Terzo's blog (August 13).", "\n\nAn African grey parrot named\nAlex was trained by scientist Irene Pepperberg to count, recognize\nshapes and colors, and identify different textures like wool, wood,\nand paper. ", "Before he died, he had mastered more than 100 English\nwords. ", "Pepperberg has described her experiments in a book called Alex\n& Me, published by Harper Collins.", "\n\nA parrot in Japan who\nescaped from his cage was brought to a veterinary hospital, where he\ntold the staff his name and address. ", "“I’m Mr. Yosuke\nNakamura,” the bird told the veterinarian. ", "The parrot also\nprovided his full home address, down to the street number, and even\nentertained the hospital staff by singing songs. ", "The Nakamura family\ntold police they had been teaching the bird its name and address for\nabout two years.", "\n\nOn average, a 4-year-old\nchild asks 437 questions a day. ", "Cats and grey parrots probably have\njust as many questions, but can't find the words to express them!", "\n\nAfter observing the Kanyawara group of chimpanzees\nin Kibale National Park in Uganda for more than a decade, researchers\nhave concluded that differences in their play behavior may be\ngender-driven. ", "Over a hundred instances of young female chimpanzees\nplaying with sticks as though they were dolls were observed over the\nyears. ", "This sort of behavior was very rarely observed in young males.", "\nThey typically used sticks as weapons, shaking them to intimidate playmates.", "\n\nApes originated on Earth\nabout 35 million years ago, and the first apelike men appeared about\n10 million years ago. ", "The modern human species of Homo sapien has\nexisted on the earth for only 100,000 years.", "\n\nThe Barbary macaque population in Gibraltar is the\nonly wild monkey population in the European continent, having\nbeen brought from North Africa by the Moors,\nwho occupied southern Iberia, including\nSpain and Portugal, between 711 and 1492), who kept them as pets. ", "Smaller\nthan most other apes, this species resemble monkeys, but don't have tails.", "\n\nGibraltar's barbary macaque population was under\nthe care of the British Army and later the Gibraltar Regiment from\n1915 to 1991, who carefully controlled a population that initially\nconsisted of a single troop. ", "An officer was appointed to supervise\ntheir welfare, and a food allowance of fruit, vegetables and nuts was\nincluded in the budget. ", "Births were gazetted in true military\nfashion, and each new arrival was named. ", "They were named after\ngovernors, brigadiers and high-ranking officers.", "\n\nHowever, since the Barbary apes\nare one of the top tourist attractions\nin Gibraltar, a few myths have sprung\nup, including that they're all named after members of the Royal Family.", "\nTourists are also told the macaques\nwere brought to Gibraltar by the Royal Navy in 1704, although they\nactually existed in the region long before that.", "\n\nHumans share more\nsimilarities with orangutans than with chimpanzees. ", "Researchers have\nidentified 28 anatomical characteristics they share, a 98% genetic\nmatch, compared to a 97% match with the gorilla.", "\n\nChimpanzees freak out when\none chimp gets more than his fair share, so zookeepers are careful\nabout food portions. ", "Chimps are hardwired to get angry when they\nthink they’ve been cheated.", "\n\nThe bonobo, a pygmy\nchimpanzee, appears to use what’s akin to human baby talk. ", "The\nclosest relatives to humans have started to make a series of sounds\nthat parallel those of human babies before they begin to learn\nlanguage, according to new research from a psychologist at the\nUniversity of Birmingham. ", "The study analyzed the sounds of bonobos in\nthe Congo forest and discovered that they made different noises based\non positive, negative, or neutral stimuli. ", "The chimps had to\ninterpret their own sounds in different contexts, which suggests a\npotential origin for human language.", "\n\nGeorgia State University researchers have concluded\nthat chimpanzees can communicate with meaningful gestures. ", "During an\nexperiment, two language-trained chimps used meaningful clues to help\nhuman researchers find hidden food. ", "Researchers also noticed that the\nchimps use directional gestures. ", "The study’s findings may\nprovide clues about the basics of language development.", "\n\nRecent research indicates that the reason why\nchimps can't speak has to do with a single gene that has two extra\namino acids in humans. ", "When this gene mutates, humans have difficulty\nwith language. ", "Evidently this gene doesn't function well in chimps.", "\nThat may mean that chimps have the ability to compose rational\nthoughts, just not the means to express them, except by gestures,\nactions, and vocal sounds.", "\n\nCould this be the case in other animals as well?", "\nMaybe those of us who think our cats, dogs, horses, parrots, and\nother domesticated animals (including the very intelligent pig) have\nthe ability to form complex thoughts are not so silly after all.", "\n\nRecent brain scans of dogs showed areas of their\nbrains lighting up when their trainers used hand signals. ", "There was\nlittle reaction to verbal commands.", "\n\nHelena Katz lives on an alpaca\nfarm in the NWT. ", "She says that their livestock dogs have different\nbarks. \"", "One is the doggie doorbell to let us know someone has\npulled into the driveway. ", "One is what we call the patrol bark because\nthey do it to announce to the unassembled masses in the bush that\nthey're on duty. ", "They're telling bears, wolves, foxes and anything\nelse out there to stay away. ", "Then there's the angry bark they use if\na wolf goes by. ", "The dogs tend to work at night because that's when\npredators are out, but we don't usually go check unless we're hearing\nthe angry barking, or the barking goes on for a bit. ", "Livestock dogs\nare independent thinkers because they need to be able to analyze a\nsituation without their handler telling them what to do.", "\nConsequently, we need to walk a fine line between demanding obedience\nand giving them enough room to think for themselves. \"", "Most of us\nhad heard of the famous lowland gorilla, Koko, who was taught\nAmerican Sign Language when she was about a year old. ", "There were many\nstories about how she adopted a kitten. ", "Now, at 40 years old, she has\na working vocabulary of more than 1000 signs and understands about\n2000 words of spoken English. ", "Most remarkable is that she is always\nlearning, and creates signs for new things in her environment. ", "She\noften strings signs together to express something new, so that a hair\nbrush became scratch comb,\nand a ring became a finger\nbracelet.", "\n\nZoo animals know when their\nday starts and ends, they line up ready to go on exhibit in the\nmorning, they get tired and ready to get off exhibit at night. ", "I\nobserved a lot of this, and realized I hadn’t thought a lot\nabout animal jobs. ", "I began to wonder what would happen if we took\nthese working creatures and tried to entertain them instead of\nforcing them to entertain us all the time. ", "An animal's life can be\nenriched by giving them opportunities to learn and things to do.", "\n\nHyenas communicate clues about their social rank in\nthe \"laughing\" sounds they make. ", "Pitch reveals age,\nand the \"notes\" and their frequency denote whether the\nhyena is dominant or submissive. ", "They can call each other for help in\nhunting or defending their food from lions.", "\n\nScientists have identified more\nthan 800 genes in the zebra finch that reveal the tiny birds learn to\nsing in a similar way to how human babies learn to speak. ", "There's a\npossibility that this might lead to finding genetic components\nrelated to human speech disorders, such as autism and stuttering.", "\n\nFinches are known for their\nfine singing voices. ", "German criminals called snitches\n\"finks\" because they were prone to \"singing like a\nbird\" to police. ", "The word followed German and German Jewish\nimmigrants to America where it became part of our everyday\nvocabulary, primarily through films, tv and radio.", "\n\nMany animals have what appear to be human-like\nimpulses in their brain's higher centers. ", "Researchers have identified\nseven basic emotional drives common to both humans and mammals in\nsections of the mid-brain called the PAG (periaqueductal gray). ", "These\ninclude basic emotions, such as fear, rage, lust, and\nseparation-distress, but also the desire to nurture and be nurtured,\nthe drive to play, grief, despair, sadness, and joy. ", "Some examples\ninclude elephants, who keep vigil over the dead, and have been known\nto collect the scattered bones of the dead family and friends.", "\n\nSpecies from magpies to elephants can recognize\nthemselves in the mirror, which some scientists consider a sign of self-awareness.", "\n\nIn a basic numeracy test,\nlong-tailed macaque monkeys were able to understand relative\nquantities and to point out which of two plates contained more\npebbles. ", "Researchers initially performed the test using raisins,\nwhich the monkeys would then be fed as a reward; however, the\nmonkeys’ impulsive desire to eat the raisins impaired their\njudgment, and they frequently chose wrong on that test. ", "Once\nresearchers swapped out the raisins for inedible items, the monkeys\nwere able to successfully complete the task.", "\n\nCapuchin monkeys use\ndifferent vocal sounds to identify different types of predators. ", "They\nhave also been seen banging stones together to warn each other of\napproaching predators.", "\n\nSouth American Titi monkeys\nare rare among primates because they are monogamous. ", "They mate for\nlife and become distressed when separated. ", "They show affection by\nremaining close, grooming each other, intertwining their tails,\nholding hands, nuzzling, cuddling, and lip smacking.", "\n\nSome grey parrots are as smart as a five-year-old\nchild. ", "A grey parrot who shares a birthday with Terzo (Simon\nTeakettle III) is Mrs. Doyle. ", "Read about her on Terzo's blog.", "\n\nFrom The Human Age: The World Shaped By Us,\nby Diane Ackerman: \"We\nused to think that wall-climbing geckos must have suckers on the\nsoles of their feet. ", "But in 2002, biologists at Lewis & Clark\nCollege in Portland, Orgeon, and the University of California at\nBerkeley released their strange findings, and science was agog.", "\nViewed at the nano level, a gecko's five-toed feet are covered in a\nseries of ridges, the ridges are tufted with billions of tiny tubular\nelastic hairs, and the hairs bear even tinier spatula-shaped boots.", "\nThe natural force between atoms and molecules is enough to stick the\nspatulas to the surface of most anything. ", "And the toes are\nself-cleaning. ", "As a gecko relaxes a toe and begins to step, the dirt\nslides off and the gecko steps out of it. ", "No grooming required.”\n\nThere are more insects in one\nsquare mile of rural land there are humans in the entire world.", "\n\nAn intoxicated ant will always\nfall over on its right side.", "\n\nKermit the Frog is left-handed.", "\n\nAlligators are blackish/gray\nwith a rounded snout and teeth that are not readily\nvisible. ", "They\nlive in fresh water and are less\naggressive than crocodiles.", "\n\nCrocodiles are olivegreen/brown\nwith a sharp snout and visible teeth. ", "They're more aggressive and\nlive in salt water.", "\n\nSouth Florida is the only place in the world where\nalligators and crocodiles coexist in the wild.", "\n\nBears are three-gaited,\nmeaning they walk, lope or gallop. ", "It has been reported that a\ngrizzly bear can run nearly as fast as a horse (33-34 mph) for a\ndistance of 50 to 100 yards. ", "This is definitely faster than a human\nbeing. ", "The lope, slower than the gallop, is an easy, ground-covering,\nbounding gait that does not seem to tire the bear and can be\nmaintained for a long time.", "\n\nBears have been known to eat\nalmost anything, including snowmobile seats, engine oil, and rubber boots.", "\n\nA swimming polar bear can jump\n8 ft. (", "2.4 m) out of the water to surprise a seal.", "\n\nBears, seals, and dogs are\nclosely related carnivores but are on a different branch of the\nevolutionary tree than cats and hyenas.", "\n\nThe black bear is not a color\nbut a species. ", "The North American black bear can\nbe a variety of colors, and although black is dominant, other\ncolors, such as shades of brown, can turn up no matter what color the\nmother is.", "\n\nElk or wapiti are one of the largest species in the\ndeer family. ", "But moose are larger. ", "The\nNorth American male moose can weigh more than 700 kilograms and stand\nup to 2.1 metres tall. ", "Caribou are smaller, rarely exceed 300 k and\n1.5 m at shoulder height. ", "Unlike moose, both male and female caribou\ngrow antlers.", "\n\nAntlers are usually found only on male members of\nthe deer family. ", "Only reindeer (known as Caribou in North America)\nare the only females to have antlers, and these are normally smaller\nthan those of the males. ", "Male reindeer shed their antlers prior to\nwinter, while female antlers are retained throughout the winter\nmonths. ", "In most arctic and temperate-zone species, antler growth and\nshedding is annual, and is controlled by the length of daylight.", "\nAlthough the antlers are regrown each year, their size varies with\nthe age of the animal in many species, increasing annually over\nseveral years before reaching maximum size.", "\n\nMale and female reindeer antlers differ in several\nrespects. ", "Males shed their antlers prior to winter, while female\nantlers are retained throughout winter.", "\n\nMules are reputed to be more patient, hardy and\nlong-lived than horses and are described as less obstinate and more\nintelligent than donkeys.", "\n\nA zedonk is\na cross\nbetween a donkey and a zebra.", "\n\nThe American\n“buffalo” are actually bison. ", "The only true buffalo\nare the Asian water buffalo and the African buffalo.", "\n\nCows always face directly\nnorth or south while eating.", "\n\nSwiss biologists determined that stupid flies live\nlonger than smart flies because intelligence wears out flies' brains.", "\nCanadian researchers claim that straining to recall information which\nseems to be “on the tip of my tongue” makes us learn\nmistaken guesses instead of the correct answers we may (or may not)\neventually remember. (", "source: Harper's)\n\nOne in two mammal species on\nEarth are in decline and at least one in four are at risk of\ndisappearing forever, according to a scientific survey which\ndescribed the trend as an \"extinction crisis in the making.\"", "\n\nJames Spratt, an Ohio electrician, who had gone to\nEngland to sell lightning rods in 1860, saw British dogs being\nfed old ship biscuits, and thought he could make a better biscuit.", "\nHis formulation, based on guesswork, not science, succeeded and he\nsoon had a thriving business among English gentlemen who owned\nsporting dogs. ", "In 1890 the company went public and came to the US.", "\nThus, an American lightning rod salesman started the entire pet food\nbusiness. (", "written by Barbara Moss, www.barbcat.myweb.com/myweb/)\n\nAccording to a recent survey:Dog people: 15% more likely to be extroverts; cat\npeople: 11% more likely to be introverts. ", "Dog people: 30% more likely to enjoy slapstick\nhumor and impressions; cat people: 21% more likely to enjoy ironic\nhumor and puns.", "Dog people: 67% more likely to call animal control\nif they happen upon stray kittens; Cat people: 21% more likely to try\nto rescue stray kittens.", "Dog people: 11% more likely to say they'd support\ncloning, but only for animals or pets; Cat people: 17% more likely to\nhave completed a graduate degree.", "Both dog and cat people: talk to animals of all\nkinds, are equally likely to have a four-year degree, and dislike\nanimal-print clothing.", "\n\nA leveret is a young hare, especially one that is\nless than a year old.", "A polliwog is a young frog or tadpole that has not\nyet grown legs.", "A smolt is a young salmon in the midst of its first\nmigration from fresh water into the sea. ", "A shoat is a young pig that has recently been\nweaned off of its mother's milk and onto solid food.", "The word spat refers to the spawn of an oyster or\nsimilar shellfish. ", "An eyas is a young nestling hawk or falcon.", "A whelp is the young of a tiger, lion, wolf, bear,\nor dog." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0, 0.030303030303030304, 0, 0, 0.02, 0, 0, 0.007246376811594203, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.005208333333333333, 0, 0, 0, 0, 0, 0, 0, 0, 0.004878048780487805, 0, 0.013953488372093023, 0, 0, 0, 0, 0, 0, 0, 0.004310344827586207, 0, 0, 0, 0.013793103448275862, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.015873015873015872, 0, 0, 0, 0, 0.008547008547008548, 0, 0, 0, 0, 0, 0.006993006993006993, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0032679738562091504, 0.007751937984496124, 0.007874015748031496, 0, 0, 0.024390243902439025, 0.01, 0, 0, 0.0037735849056603774, 0, 0.005494505494505495, 0.02, 0.015625, 0.005917159763313609, 0, 0.005376344086021506, 0, 0, 0, 0, 0.008130081300813009, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.005376344086021506, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.02158273381294964, 0.008849557522123894, 0.003424657534246575, 0, 0, 0, 0, 0.0072992700729927005, 0, 0, 0, 0, 0.03225806451612903, 0.047619047619047616, 0, 0.014285714285714285, 0.012345679012345678, 0, 0, 0.008264462809917356, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.03296703296703297, 0.0136986301369863, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.023255813953488372, 0, 0.007462686567164179, 0, 0.019230769230769232, 0, 0.010416666666666666, 0.005376344086021506, 0.006944444444444444, 0, 0.007751937984496124, 0, 0, 0, 0, 0.008064516129032258, 0, 0, 0, 0.004672897196261682, 0.00804289544235925, 0.02127659574468085, 0, 0.022556390977443608, 0, 0.005208333333333333, 0, 0, 0.007142857142857143, 0, 0, 0, 0, 0, 0, 0.013513513513513514, 0, 0.006578947368421052, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.013245033112582781, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.017543859649122806, 0, 0, 0.009615384615384616, 0, 0, 0, 0, 0, 0.0091324200913242, 0, 0, 0, 0, 0, 0, 0, 0, 0.008298755186721992, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.005917159763313609, 0.00425531914893617, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.009708737864077669, 0, 0, 0, 0, 0, 0, 0.007352941176470588, 0, 0, 0, 0, 0, 0, 0, 0, 0.030927835051546393, 0.010256410256410256, 0, 0.006535947712418301, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007194244604316547, 0, 0, 0.018518518518518517, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.014285714285714285, 0, 0.008403361344537815, 0, 0, 0, 0.010452961672473868, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.017699115044247787, 0.01282051282051282, 0, 0.014084507042253521, 0, 0.006535947712418301, 0, 0, 0.006802721088435374, 0, 0, 0, 0, 0, 0, 0, 0.007936507936507936, 0, 0, 0, 0, 0, 0.00558659217877095, 0.0058823529411764705, 0, 0.015873015873015872, 0, 0, 0, 0, 0, 0, 0.00909090909090909, 0.004878048780487805, 0, 0, 0, 0, 0, 0.011494252873563218, 0.01694915254237288, 0, 0, 0, 0, 0.009523809523809525, 0, 0, 0, 0.015625, 0, 0, 0, 0.004878048780487805, 0.013333333333333334, 0, 0, 0, 0.0037174721189591076, 0.012658227848101266, 0.01, 0.02, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.013333333333333334, 0, 0.007692307692307693, 0.010309278350515464, 0, 0, 0, 0.008928571428571428, 0.014705882352941176, 0, 0.007407407407407408, 0.013513513513513514, 0, 0, 0, 0, 0, 0, 0, 0.007633587786259542, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.011627906976744186, 0, 0, 0, 0, 0, 0, 0, 0.009259259259259259, 0.006666666666666667, 0.008928571428571428, 0, 0, 0.008928571428571428, 0, 0, 0, 0, 0, 0.005025125628140704, 0.013422818791946308, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00881057268722467, 0, 0.010526315789473684, 0, 0, 0, 0, 0, 0, 0, 0.017094017094017096, 0.009900990099009901, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.010309278350515464, 0, 0, 0, 0, 0, 0, 0.024390243902439025, 0.005649717514124294, 0, 0.030927835051546393, 0, 0.01694915254237288, 0, 0.009523809523809525, 0, 0, 0.005, 0, 0, 0, 0, 0.011363636363636364, 0.0037593984962406013, 0, 0.004672897196261682, 0, 0, 0, 0.016483516483516484, 0.006578947368421052, 0, 0, 0, 0, 0, 0.004464285714285714, 0, 0, 0.008849557522123894, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.02, 0, 0, 0, 0, 0, 0, 0, 0, 0.007874015748031496, 0, 0, 0, 0, 0.006369426751592357, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.006329113924050633, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.011904761904761904, 0.03225806451612903, 0.0064516129032258064, 0.01775147928994083, 0.0048543689320388345, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.01639344262295082, 0, 0, 0.006622516556291391, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.014084507042253521, 0, 0, 0.006944444444444444, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.004347826086956522, 0.005494505494505495, 0, 0, 0, 0.011299435028248588, 0, 0.006896551724137931, 0.006535947712418301, 0, 0, 0, 0, 0, 0, 0, 0.034482758620689655 ]

[ "Q:\n\nHow can I use Ruby code in a buildr project?", "\n\nHow can use Ruby in a buildr project?", "\nI've used Ruby, JRuby, Java, and Clojure in quite a few separate projects. ", "I'm currently working on a simulation app in my standard Ruby that I wanted to try to do with a Clojure backend (I do enjoy the functional code), and JRuby gui and test suite. ", "I could also see using say, Scala, for the backend in a different project in the future.", "\nI think I'm going to give buildr (http://buildr.apache.org/) a try for my project, but I noticed that buildr doesn't seem to be set up to use JRuby code inside the project itself! ", "This seems a little silly, seeing as the tool is meant to unify the common JVM languages and is built in ruby.", "\nDoes anyone know how you would accomplish this, short of including the outputted jar in a distinct, ruby only project?", "\n\nA:\n\nYou're not very specific about how you want to use your (J)Ruby code so I'll give you one example out of many possible approaches.", "\nLet's create a directory structure and put Java and Ruby files in it,\n.", "\n├── buildfile\n└── src\n └── main\n ├── java\n │   └── Foo.java\n └── ruby\n └── app.rb\n\nwith the content of Foo.java as follows,\npublic class Foo {\n public int bar() {\n return 42;\n }\n}\n\nand a simple app.rb startup script,\nputs \"Foo.bar is #{Java::Foo.new.bar}\"\n\nYour buildfile would look somewhat like,\nVERSION_NUMBER = \"1.0.0\"\n\nrepositories.remote << \"http://www.ibiblio.org/maven2/\"\n\nJRUBY = \"org.jruby:jruby-complete:jar:1.6.3\"\n\ndefine \"ruby-example\" do\n project.version = VERSION_NUMBER\n project.group = \"org.example\"\n\n run.with JRUBY\n run.using :main => ['org.jruby.", "Main', _(:src, :main, :ruby, \"app.rb\")]\nend\n\n(the run task is documented at http://buildr.apache.org/more_stuff.html#run)\nand you can now run your application by typing,\n$ buildr run\n\nand get the following output,\n$ buildr run\n(in /home/boisvert/tmp/ruby-example, development)\nFoo.bar is 42\nCompleted in 1.884s\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0.02631578947368421, 0.005681818181818182, 0.011363636363636364, 0.0055248618784530384, 0, 0, 0, 0.013888888888888888, 0.011456628477905073, 0.003205128205128205 ]

[ "Hillary Clinton PAC calls on students for early support\n\nWith 1079 days until the next election and before she has announced any intent to run, Hillary Clinton supporters at Ohio University are encouraging her to campaign to be the next President of the United States.", "\n\nIn a campaign event Monday, National Communications Director for the Ready for Hillary Political Action Committee Seth Bringman held a meeting in Baker University Center for potential student and citizen volunteers to help raise awareness and further encourage former Secretary of State Clinton to run for the 2016 presidential election.", "\n\n“Our goal is to build this army of supporters,” he said. “", "Our goal is to show Hillary we are behind you if you want to run. ", "There’s no better way to do that than grassroots organizing, social media and small dollar donations.”", "\n\nBringman visited campus with the goal of creating a support base that could be activated in case Clinton would announce her candidacy, but also as a sign to Clinton that she already has a strong supporter base throughout the country that is eager for another Democrat to run the White House.", "\n\nFor a campaign strategist like Bringman, Athens is a Democratic stronghold and is key for a Democratic organization to gain access to. ", "Between a strong, liberally-leaning citizen base and the important student vote, Athens is big target population in a swing state like Ohio.", "\n\nThis is the reason why President Barack Obama visited Athens during his reelection campaign last October, and it’s also the reason why Bringman was in Athens this week.", "\n\n“Bobcats for Obama and the Athens area have been great people for Democrats to work with and we think young people like this are absolutely critical,” Br\n\ningman said. “", "You can’t be too early.”", "\n\nBringman, an Ohio native, says that this state is the starting point for many successful elections, so his presence at Ohio University is key. ", "He said that college students, an oft-sought after population in national elections, has an energy that should be harnessed for political action.", "\n\nThe Ready for Hillary Campaign is currently focused on building support nationwide not only with grassroots, boots-on-the ground strategy that Monday’s meeting utilized, but also with a strong digital presence, a strategy that proved successful for Obama’s two elections to the White House. ", "They already have over one million supporters and over 25,000 donations to the PAC, according to Bringman.", "\n\n“Our goal is to show the sheer amount of energy Hillary’s supporters have, whether they’re old Obama supporters, old Hillary supporters, new Hillary supporters, or even Republican supporters,” Bringman said.", "\n\nIn attendance at Monday’s meeting were Democratic State Rep. Debbie Phillips and Senator Lou Gentile, both in Athens to express their support for a potential Hillary 2016 ticket.", "\n\nPhillips said she was encouraged by the support that she sees for Clinton so early on, saying “[It’s an] exciting early start… It was really clear early on that southern Ohio loves Hillary.”", "\n\n“I think that her experience as Secretary of State is really a lot to build and provides an opportunity for her to work on a world stage. ", "I’m really excited to see so much early enthusiasm for Hillary….we also have elections coming up next year that will be important,” Phillips said.", "\n\nGentile echoed those sentiments, saying that the first electoral hurdle for Ohio voters will be the upcoming 2014 governor race, stating his disapproval for Republican Gov. John Kasich’s policies. ", "Gentile also explained how he had a close relationship with former Ohio Gov. Ted Strickland, and that Strickland in turn was close to the Clintons during former President Bill Clinton’s time in office.", "\n\n“As soon as I got off the plane I rushed to the hotel to tell my family I was hanging out with Hillary Clinton. ", "I’m excited to be here today to ask Hillary to run for president,” Gentile said. “", "It’s important that we start now and lay the groundwork for 2014. ", "2014 is critical, but it’s never too early to start thinking about 2016.”", "\n\nThe OU College Democrats, who helped set up for the visit, have expressed their support for the Ready for Hillary PAC. “", "I am very ready for Hillary and I hope you are all too,” said Caitlin Roberts, President of Ohio University College Democrats.", "\n\nAbout us\n\nThe New Political is an award-winning, independent publication run entirely by Ohio University students. ", "A digital-first outlet, it is solely dedicated to covering politics and government on campus, in the city of Athens and in the state of Ohio. ", "The New Political seeks to educate and empower the public as an independent voice for Athens." ]

{ "pile_set_name": "Pile-CC" }

[ 0.011194029850746268, 0.014749262536873156, 0, 0.015151515151515152, 0, 0.013651877133105802, 0.0072992700729927005, 0, 0.011764705882352941, 0, 0, 0.013793103448275862, 0, 0.006825938566552901, 0.009433962264150943, 0.023923444976076555, 0.022222222222222223, 0.015625, 0.007142857142857143, 0.0136986301369863, 0.005025125628140704, 0.01990049751243781, 0.008771929824561403, 0.024390243902439025, 0, 0, 0.00819672131147541, 0.023809523809523808, 0.008547008547008548, 0, 0 ]

[ "Q:\n\nHow can I move MkMapView.userLocation on iPhone?", "\n\nI want to make an application that will need userLocation, but MkMapView.userLocation is just readonly, can't be change. ", "how can I use it? ", "can I setting userLocation like\nmyMap.userLocation=MyCurrentLocation;\nany code I need to make it easy?", "\n\nA:\n\nYou need CLLocationManager to get the current location of the user updated. ", "The locationManager:didUpdateToLocation:fromLocation: method of CLLocationManagerDelegate will update you the current user location.", "\nYou may follow this tutorial to learn to implement it.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.019230769230769232, 0, 0, 0, 0, 0, 0, 0 ]

[ "The present invention relates generally to integrated circuit (IC) designs, and more particularly to a word line voltage control circuit for memory devices.", "\nPerformance requirements for microprocessors, portable devices, and wireless devices have increased significantly over the last few decades. ", "Device sizes have been shrinking continuously in order to meet the heightened performance requirements. ", "As a result, a large number of logic circuits and memory cells are packed in a relatively small memory chip. ", "Low power design becomes very important for the memory chip to reduce power consumption and remain thermally stable.", "\nVarious circuits and methods have been developed to reduce current leakage for memory devices, such as static random access memory (SRAM) and dynamic random access memory (DRAM), during a stand-by or sleep mode. ", "One method uses a well bias to reduce sub-threshold leakage in a standby mode. ", "In another method, a lower supply voltage is used to reduce junction leakage, sub-threshold leakage and gate leakage. ", "In yet another method, the voltage at a power supply node of a memory device is reduced to the lowest possible level during a sleep mode, such that the data can be retained in memory cells, while the peripheral logic circuits are completely turned off. ", "This is typically called a full-sleep-mode design.", "\nIn a full-sleep-mode design, the power consumption of the sleep mode is reduced below than that of the standby mode. ", "In some cases, the power consumption of the sleep mode can be reduced to below one tenth of the standby mode power consumption. ", "It is anticipated that the full-sleep-mode design will become more popular in reducing power consumption of memory devices.", "\nConventionally, the full-sleep-mode design requires an additional AC (alternating current) voltage control circuit connected to word lines of a memory device. ", "In the normal operation mode, a decoder is enabled to control the word lines, while the AC voltage control circuit is disabled. ", "In the sleep mode, the decoder is disabled and the AC voltage control circuit generates a signal to pull the word lines to either ground voltage or VSS.", "\nSince the conventional voltage control circuit is connected to AC power, it is complex in design. ", "Accordingly, there is a need for a word line voltage control circuit that can achieve the functions of the AC voltage control circuit while being simpler in design." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00625, 0.0078125, 0.006578947368421052, 0.010101010101010102, 0.006097560975609756 ]

[ "The timing of a serious crash east of Calgary is tragic because Chestermere is working with the province to improve the safety of that intersection, says Mayor Patricia Matthews.", "\n\nFive people were involved in a serious crash just east of Calgary on Tuesday afternoon. (", "@ssssdevine/Twitter)\n\nA 17-year-old male, who RCMP say is currently on life support, is not expected to survive after three vehicles collided at the intersection of Highway 1 and Highway 791. ", "Friends and family members gathered Wednesday night for a vigil.", "\n\n\"As a mother of teenagers, I can't imagine the pain and anguish these families must be going through,\" said Matthews.", "\n\nThree people were injured in the crash. ", "The 17-year-old was transported to hospital by STARS air ambulance.", "\n\nA 16-year-old girl from Langdon and a 47-year-old woman from Chestermere were also injured.", "\n\n\"We anxiously await the final implementation of an interchange at this location. ", "We will continue to advocate to Alberta Transportation for improvements to this intersection so heartbreaking accidents like this one can be avoided in the future,\" Matthews added." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0056179775280898875, 0, 0.010416666666666666, 0, 0, 0, 0, 0, 0, 0.005555555555555556 ]

[ "The present invention relates to enhanced inversion, dispersion and activation systems and devices. ", "More particularly, the present invention relates to enhanced organic polyelectrolytes (polymers) and organic polyelectrolyte solution inversion, dispersion and activation using electrohydraulic discharge energy delivered into the polymer or polymer solution. ", "The present invention is applicable to situations in which an organic chemical, polymer or enzyme must be disentangled or uncoiled to obtain optimum performance. ", "As a result, less polymer and less energy in activating the polymer are used when the polymer or polymer solution is optimally activated, reducing costs and improving efficiency.", "\nPolymers have been widely used in sludge (biosolid) conditioning applications, such as dewatering applications where fine solid particles are removed from biosolids. ", "Polymers are also used extensively in water treatment, wastewater treatment and industrial water treatment. ", "They are also widely used in the food and chemical industries.", "\nIn general, polymers are organic macro-molecules composed as chains of five or more individual monomer building blocks linked together in a linear or branched configuration. ", "Various functional groups may be located along the chain. ", "Such functional groups provide charged sites which may be used to neutralize electrical charges on colloidal particles. ", "The functional groups along the chain may possess a negative charge (anionic polymer), positive charge (cationic polymer), or an overall neutral charge (nonionic polymer).", "\nPolymers are typically available in dry form, liquid solutions, and inverse emulsions. ", "These \"neat\" preparations are diluted in water, mixed into solution and activated by an inversion process of mixing and aging to achieve increased activity. ", "The purpose of the activation process is to allow the coils of the polymer to loosen and unwind, increasing the exposure of the functional charge sites to increase the effectiveness and performance of the polymer. ", "During the aging process, the diluted polymer solution is allowed to sit in a tank with gentle or no stirring. ", "In sludge dewatering applications, for example, when a polymer is optimally activated by exposing more of its functional groups, less polymer is required and higher cake solids are obtained. ", "This results in lower operational cost and better performance.", "\nFor ease of understanding, the present invention, as well as most of the background of the invention, will be discussed by reference to the dewatering of biosolids. ", "It will be understood, however, that the inventions may be employed in a wide variety of applications and technologies, including but not limited to water, wastewater and industrial water treatment as well as in the food, chemical and petrochemical industries.", "\nIn the past, and in most current biosolid dewatering applications, activation of polymers is accomplished by equipment specified by design engineers. ", "In many instances, specific polymer preparation requirements are not met because of misinformation or misunderstanding between equipment designers, consultants and contractors. ", "These facilities usually include pumps and calibration devices which allow a specified dilution of the polymer and water. ", "This solution is then transferred to a mixing and aging tank where the polymer solution is activated. ", "Polymer mixing and aging facilities are not usually designed to accommodate any particular type of polymer. ", "FIGS. ", "1A and 1B schematically show a variety of systems typically used to activate polymer. ", "These methods require, among other things, expensive equipment with high maintenance costs. ", "Moreover, optimizing the equipment for a particular polymer is usually difficult and requires expensive modifications as well as constant attention and adjustment. ", "Thus, in most cases, polymer activation is not optimal.", "\nIn biosolid dewatering applications, for example, it is first necessary to determine the type and amount of polymer to achieve the required conditioning, making it necessary to calculate such parameters as the solution strength, usage and feed rate for each operation (see e.g., Chemicals Used for Dewatering, Ch. ", "13, pp. ", "254-57). ", "In such applications, water-soluable polymers are typically used, such as: methyl cellulose, carboxyl methyl cellulose and cellulose ethers; starches (ethers and acetates); polyvinyl alcohol (PVA), ethylene oxide polymers, polyvinyl pyrollidione, polyethyleneimine; as well as others. ", "The dewatering calculations are complicated because of the continually changing composition of the biosolids and the fact that polymers in solution are only active and effective for certain finite periods of time. ", "In practice, once the solution strength, usage and feed rates are calculated, the values are sometimes doubled to provide for a margin of error. ", "This necessarily results in increased polymer usage and energy costs.", "\nStatic, in-line mixing technology to mix and activate polymers has been studied. ", "The technology is appropriate for certain polymers only and suffers from, among other things, clogging problems. ", "In the early 1980s, for example, in-line blending systems were developed that led to enhanced polymer activation. ", "These systems are still in use today, particularly in the biosolid dewatering field; for example, to activate polymer solutions prior to or after being mixed with the biosolids to be treated. ", "In many instances, these systems actually cause decreased performance in polymer activation because no means for aging the polymer is provided and/or the fragile polymer is over-mixed.", "\nOne such currently available method and apparatus is described in U.S. Pat. ", "No. ", "5,164,429 to Brazelton et al., ", "which is typical of the present state of polymer activation. ", "In this type of system, polymers are activated by some form of rotating mixing mechanism to impart mechanical energy into the polymer solution and cause activation of the charge sites. ", "Polymers are mixed in their diluted solution and further activated by mixing in separate and distinct zones of the mechanisms. ", "Other systems use in-line mixing devices, or a combination of the two.", "\nThe claims of these devices is that the polymer solution is activated sooner than if the solution were traditionally mixed and allowed to age. ", "However, none of the systems are able to change the physical or chemical characteristics of the polymer solution needed for activation. ", "Another presently popular in-line mixer-type of system is available as the Polymaster of Komax Systems, Inc., Wilmington, Calif. Still other examples of polymer dilution/activation systems and devices are described in U.S. Pat. ", "Nos. ", "5,284,627 and 5,252,635, both to Brazelton, et al.", "\nA novel technology still in its infancy is the use of pulsed-plasma discharges (\"pulsed power\") in aqueous solutions to treat water and wastewater. ", "High energy underwater discharges can induce a number of physical and chemical effects on solids and chemical compounds dissolved and suspended in water. ", "Depending upon the energy of the pulse and the frequency of the pulses, these effects include the formation of high temperature, high pressure plasma, shock waves and electromagnetic radiation, including UV and X-rays.", "\nPulsed power technology, as currently employed, generally employs high frequency pulses (generally greater than one pulse per second) of electrical energy, typically of a millisecond's duration, to solids or organisms in a liquid which is between two electrodes. ", "The pulsed power technology currently employed also typically require relatively high energy level pulses (of approximately 1,500 joules/second). ", "One of the earlier devices for generating pulsed power, commonly referred to as a pulsar, is shown and described in U.S. Pat. ", "No. ", "3,220,873 to R. H. Wesley, for applications such as the removal of constituents from solutions as precipitates and impregnation of surfaces with desired substances.", "\nSome, including R. H. Wesley, have attempted to apply pulsed power technology directly to the treatment of wastewater. ", "For example, U.S. Pat. ", "No. ", "4,458,153, issued to R. H. Wesley, teaches the application of pulse power techniques, including electromagnetic fields, to directly treat wastewater to kill any microorganisms contained therein.", "\nOthers have also attempted to apply pulsed power technology to wastewater precipitation and treatment. ", "A series of related patents, U.S. Pat. ", "Nos. ", "4,917,785, 4,957,606 and 5,026,484, all issued to Christian H. A. Juvan, generally deal with the separation and/or precipitation of solids contained in a liquid through the use of high energy electrical discharge pulses.", "\nHigh frequency, high energy pulsed power technology for the use in the dewatering of sludge and treatment of wastewater has also been attempted. ", "Some have tried to apply pulsed power techniques to the treatment of the wastewater/sludge alone, without the subsequent use of polymers in the liquid. ", "Others have attempted to first apply pulsed power to the wastewater and then add polymers activated in the standard manner for dewatering after pulsing the biosolid solution. ", "These attempts have largely been unsuccessful due to high energy uses, inadequate system design and poor performance. ", "There are no known attempts to apply pulsed power technology (and particularly low frequency/low energy pulsed power technology) to polymer activation, either before or after the polymer solution is added to the liquid to be treated." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.009259259259259259, 0.16666666666666666, 0, 0, 0, 0, 0, 0, 0, 0.010526315789473684, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0043859649122807015, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.006097560975609756, 0.008333333333333333, 0, 0, 0.005154639175257732, 0, 0, 0, 0.004545454545454545, 0, 0, 0, 0, 0 ]

[ "ANCHORAGE – Senator Bill Wielechowski (D-Anchorage) announced today he will introduce legislation in the upcoming legislative session to make furnishing or selling an e-cigarette to a minor illegal.", "\n\nNationally, the number of middle and high school students who have smoked e-cigarettes doubled from 2011-2012, according to a recently published report from the U.S. Center for Disease Control and Prevention. ", "Of those who reported trying e-cigarettes, more than 20% of middle and 9% of high school students said they had never smoked conventional cigarettes. ", "Analysts predict the e-cigarette market will approach $2 billion in sales by the end of 2013 and may exceed $10 billion by 2017.", "\n\n“About 90% of adult smokers started puffing before they were 18,” said Senator Wielechowski. “", "The e-cigarette market is exploding. ", "Alaska should act now to discourage the sale of these potentially harmful products to our kids. ", "We don’t need more Alaskans hooked on nicotine when we’re spending millions to help others kick the habit.”", "\n\nE-cigarettes are battery-powered devices that heat liquid nicotine and other additives to create an inhalable vapor. ", "There is currently no government oversight over them. ", "Consequently, there is no way for public health experts, the medical community or consumers to know what chemicals are in e-cigarettes or what the short- and long-term health implications might be. ", "The FDA has announced that it intends to expand its jurisdiction to include e-cigarettes, but has not yet issued rules.", "\n\nTwenty five states have already restricted sales of e-cigarettes. ", "In addition, forty state attorney generals, including Alaska’s, wrote a letter last September to the FDA “seeking immediate regulatory oversight of e-cigarettes, an increasingly widespread addictive product.” ", "The letter noted that nicotine in e-cigarettes “has immediate biochemical effects on the brain and body at any dosage, and is toxic in high doses.”", "\n\nE-cigarettes cartridges often contain flavorings, such as Fruit Loops and gummy bears, making them appealing to kids. ", "Initial lab tests by the Food and Drug Administration in 2009 found detectable levels of toxic cancer-causing chemicals, including an ingredient used in anti-freeze, in two leading brands of e-cigarettes. ", "There are currently no ingredient disclosure requirements.", "\n\n“Cigarette smoking remains the leading preventable cause of disease, disability and death in the United States, responsible for 443,000 deaths each year,” said Senator Wielechowski. “", "Products that act as a gateway to this dangerous and addictive habit should be carefully regulated. ", "Alaska should do everything possible to prevent e-cigarettes from getting in the hands of our children.”" ]

{ "pile_set_name": "Pile-CC" }

[ 0.005050505050505051, 0.004739336492890996, 0, 0, 0.010416666666666666, 0, 0, 0, 0, 0, 0, 0.008403361344537815, 0, 0.004784688995215311, 0, 0.008333333333333333, 0.004878048780487805, 0, 0.005405405405405406, 0, 0 ]

[ "Openbookings.org is an online booking software\nthat allows you to manage in an unified way the\ntimetables of all the shared resources of your\ngroup, association, or company. ", "Such shared\nresources might be vehicles, conference rooms,\ncomputers, video projectors, cameras, etc.", "\n\nConceptDraw Project is an unique project planning\ntool designed for efficient planning and tracking\nof multiple projects. ", "Business activity often\nrequires the planning several simultaneous\nprojects with different dependences and limited\nresources to drawn on. ", "ConceptDraw Project makes\nit possible to easily share resources between\nprojects, establish links between them, and\norganize them in a single workspace to\nsuccessfully plan projects of any size and complexity.", "\n\npAgenda is a cross-platform calendar and schedule.", "\nIt uses the SQLite database to handle multiple\nschedules with ease in single, small, portable\nfiles which are easy to backup or transfer. ", "It is\nsimple and functional, but its strongest feature\nis how well it prints out a daily schedule with a\nsingle click.", "\n\nUniMatrix is an application for planning your\neveryday business at university. ", "It helps you to\nmanage your lessons and exams. ", "The program starts\nup by presenting you with your upcoming lessons,\nand it can show all necessary information on one\nscreen. ", "Internationalized versions are available.", "\n\nAdmelix is a live CD distribution based on Ubuntu\nLinux with tools for business administration. ", "Its\nmain objective is to guide managers of small and\nmedium-size businesses towards GNU/Linux and open\nsource software. ", "In addition to the live CD, the\nproject's Web site provides information about open\nand free tools for business administration.", "\n\nGchore is a simple tool that tracks your chores\nand reminds you to do them on a daily basis. ", "It is\nnot a general todo list, but is better suited for\nrepeating tasks, such as taking out the garbage on\nMondays.", "\n\nVa Temps is a time-tracking tool that collects the time spent on several\nprojects running concurrently. ", "Each running project gets a fraction of\nthe real time based on its priority and the number of running tasks.", "\n\nQTodo is a todo-list manager that was designed to\nhelp the user to actually get things done. ", "You can\nadd todo items to different lists, set priorities,\nthe status of an item, deadlines, and more. ", "Items\ncan be sorted, filtered, copied, cut, and pasted.", "\nThe lists can be printed to paper. ", "It also\nfeatures deadline management with alerts that you\ncan fine-tune or just disable with a tray icon." ]

{ "pile_set_name": "Pile-CC" }

[ 0.005747126436781609, 0, 0, 0, 0.004784688995215311, 0, 0, 0, 0.024691358024691357, 0, 0, 0.024390243902439025, 0.01020408163265306, 0.008333333333333333, 0, 0, 0, 0, 0, 0.010526315789473684, 0, 0, 0, 0 ]

[ "R Mohan\n\nThrice, I was unmoved\n\nA year back, I was working late night (I am lazy, but sometimes I do work:)\n\nAround 1.30 AM, I heard voices outside my flat. ", "I found my neighbors were standing outside the apartment complex. ", "When I enquired for the reasons, they wondered how come I didn’t feel the earth quake.", "\n\nI didn’t wonder. ", "Why?", "\n\nYesterday (11-4-2012), I was having lunch in a hotel. ", "I heard the table shaking a tiny bit. ", "I thought it might be due to my restless legs hitting against the table. ", "None of the people eating alongside me felt anything, while in the neighborhood everybody felt it.", "\n\nWhen I went out, I saw several people were standing in the road. ", "The hotel owner ran up to me and whispered in my ears that there were earth tremors around the city. ", "We didn’t have anything in the hotel.", "\n\nIn the late afternoon, while I was watching TV, I saw again my neighbors coming out of the apartment. ", "They were once again surprised.", "\n\nI didn’t wonder. ", "Why?", "\n\nI was chanting the mantra for protection\n\nI was listening to ‘OM HOWM VUM JOOM SAHA’ CD (running time is 3 minutes) for the last two years, based on Naran’s suggestion that this mantra has the capacity to shake away the earth quacks and any natural calamities.", "\n\nBach Flower Remedies for Divine Grace\n\nFor those who are not comfortable pronouncing this mantra, he suggests to keep in every residence the Bach Flower Remedies:\n\nSTAR OF BETHLEHEM: shock-absorber and\n\nROCK ROSE (what happens when you panic? ", "You shake. ", "It is a sudden loss of control. ", "Earthquake is nothing but the earth-shaking): to restore control.", "\n\nSWEET CHESTNUT: to have Divine grace. ", "The Divine grace is nothing but the infinite flow of Divine love. ", "Where there is flow of love one is always under the constant protection of the Divine from any calamities.", "\n\nWhile others were shaking with fear, she was on a lifting mood\n\nMalini took the Bach Flower remedy SWEET CHESTNUT just a few minutes before the first tremor in Chennai. ", "Her boss asked her to go out and get him something from the local shop. ", "While she was buying the stuff outside, the tremor was felt. ", "People working in her building came out of it, fearing some calamity. ", "Without realizing the issue, she happily went back to her office, using the lift." ]

{ "pile_set_name": "Pile-CC" }

[ 0.006369426751592357, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00816326530612245, 0, 0, 0, 0, 0, 0, 0.005847953216374269, 0, 0, 0, 0 ]