Datasets:

tomekkorbak

/

pii-pile-chunk3-1100000-1150000

like 0

[ "Quakes' Goodson returns to MLS roots on Saturday\n\nClearly, Clarence Goodson hopes all the reminiscing will come with three points for the Earthquakes when he returns to his MLS roots.", "\n\nWhen the Earthquakes challenge FC Dallas at FC Dallas Stadium on Saturday to kick off a pivotal three-game road swing, Goodson, 31, will face the club that gave him his start. ", "The 6-foot-4 center back, who has fortified the Quakes back line since his debut in a 2-0 win over Chivas USA on Aug. 3, was the No. ", "7 overall draft pick in 2004 by the then-Dallas Burn. ", "He played his first four seasons in Dallas.", "\n\nIn terms of matchups on Saturday, Goodson and Victor Bernardez will likely have to deal with physical Panamanian forward Blas Perez.", "\n\nFC Dallas currently boasts two of Goodson’s former teammates from a talented 2007 squad. ", "Fellow veterans Kenny Cooper and Ramon Nunez are back with the club. ", "Goodson holds fond memories of his time in Frisco.", "\n\n“We had an extremely good team before with a lotta, lotta young guys sprinkled in with some of the veterans,\" Goodson recalled. \"", "Now we’re the veterans that are sprinkled in, and so it’s a totally different mindset in the way that we approach the game. … ", "It’s always great to see old teammates again. ", "Great memories: We went to battle together, so you always hold those things dear to your heart, but Saturday will be a different story competing against them. ", "Of course, I hope we come out on top.”", "\n\nGoodson recalls his rookie year in Dallas being one of transition for the club, which was coming off a disappointing season.", "\n\n“It’s always difficult when you’re a young player, not living at home,” he said. “", "I think they did a good job, and I think that I did a good job in learning from them and really becoming a pro and having a good career.”", "\n\nA fan favorite in Dallas back in the day, Goodson saw his role increase in 2005 when he started in 28 of 29 matches. ", "He also started in 27 of 30 matches in 2007 as Dallas' top defender when the team made the playoffs. ", "After leaving the club, he had six productive years abroad, three apiece with IK Start-Norway and Brondby IF-Denmark.", "\n\nA standout with Team USA in the Gold Cup, Goodson is not sure how the Dallas fans will react to him in his first game back.", "\n\n“I always really appreciated the fans when I was there,” he said. “", "I think that they were always very supportive of us. ", "I have no reason to think that there would be any negativity between myself and the fans, but you never know. ", "I’m playing for a different team now. … ", "No matter what happens, I know we had a good past together and that’s what I remember the most.”" ]

{ "pile_set_name": "Pile-CC" }

[ 0.03278688524590164, 0.011235955056179775, 0.007518796992481203, 0, 0, 0.022388059701492536, 0.01098901098901099, 0.028985507246376812, 0.04, 0.007633587786259542, 0, 0, 0, 0, 0.007936507936507936, 0, 0, 0.008403361344537815, 0, 0.017094017094017096, 0.016, 0, 0, 0, 0, 0 ]

[ "Q:\n\nHow to check whether a value exists in an array php\n\nCan I check for a value in an array?", "\nWhat I mean is if I'm having an array like this\n$image=array(\n 1 =>$_FILES['image1']['name'],\n 2 =>$_FILES['image2']['name'],\n 3 =>$_FILES['image3']['name'],\n 4 =>$_FILES['image4']['name'],\n 5 =>$_FILES['image5']['name'],\n 6 =>$_FILES['image6']['name'],\n);\n\nI want to know what are the keys that have an image name and I want to update some columns of a mysql table according to array key number, those are having an image name.", "\nI also want to write a sql query to do this. (", "this is an example of what I want. ", "I know this query is wrong)\n$query=\"\n UPDATE mytablename\n foreach($image as $valeu){\n echo'$image(1)=$value';\n echo'$image(2)=$value';\n echo'$image(3)=$value';\n echo'$image(4)=$value';\n echo'$image(5)=$value';\n echo'$image(6)=$value';\n }\n\";\n\nA:\n\narray_search is your friend:\n$key = array_search($image_name, $image);\n\nhttp://www.php.net/manual/en/function.array-search.php\nWhen ever you do something with arrays read the list of array functions.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0.006036217303822937, 0 ]

[ "Q:\n\nGoing through a DataReader twice\n\nI have the following code which does what it's supposed to do:\nobjSQLCommand = New SqlCommand(\"select * from table1\", objSQLConnection)\n\nobjSQLCommand.", "Connection.", "Open()\nobjSQLDataReader = objSQLCommand.", "ExecuteReader()\n\nWhile objSQLDataReader.", "Read()\n objStringBuilder.", "Append(objSQLDataReader(\"forename\"))\n objStringBuilder.", "Append(\"<br /><br />\")\n objStringBuilder.", "Append(objSQLDataReader(\"surname\"))\n objStringBuilder.", "Append(\"<br /><br />\")\nEnd While\n\nobjSQLDataReader.", "Close()\nobjSQLCommand.", "Connection.", "Close()\n\nBut I need to loop through the objSQLDataReader 1 more time. ", " How would I do that?", "\n\nA:\n\nThree options:\n\nexecute the query twice (readers like this are forwards only)\nbuffer the data locally, then process it twice (the \"buffer\" could be an object collection, XML, a DataTable (spit), etc)\nwrite both outputs at the same time; i.e. for each row, write the first format to the first output, then the second format to the second output\n\nI'd probably aim at the last option, as it involves no buffering or repetition; however I would move the logic for each method into 2 distinct methods\n\nA:\n\nLoop through data reader only once and load your data into some sort of an instantiated collection (e.g. List<MyDataObject>) that you can reference later to loop through again and again, and again. ", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.005291005291005291, 0, 0, 0.025, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0028368794326241137, 0 ]

[ "I will get straight to the break. ", "Out of the 16 packs I didn't pull a single Diecut I needed for my set ,\nNone of the Champ. ", "Cal. ", "I need ( I need #1 if any ones has an extra) I\nalso didn't land the Rookie standout I need (#14)\nI also didn't make much progress on my master set of auto's and MM\n. ", "either. ", "but will be able to swap some nicer swatches for plain ones.", "\n\nAll in all I was able to land some upgrades to my set and a couple auto's I needed\n( Wasn't looking forward to Ebay Prices for the Danica auto but still need 2 more the #70 and # 15 won't see the #5 i'm sure unless I pull it)\nand also got a couple of the silver #25\n( that might be a fun set to build) thanks for checking the break out\nI am getting them loaded it is just taking some time I will try and put up a post of every thing thats for trade but will tell you got most\nof the base set in triples plus and the same with the CC and RS\nPM me if you need something in particular.", "\n\n(10-21-2011 12:15 PM)spazmatastic Wrote: Pretty nice boxes, man. ", "Check my trading thread for the Die cuts. ", "It has a list of the 33 I still need. ", "LMK if you can help.", "\n\nI am not supposed to do anything for the next couple days but will pull my cards down and try and list all my needs and duplicates for the Die-cuts I also still need the CC & RS\nI listed in my post still undecided about getting a case any thoughts\n\n(10-21-2011 05:53 PM)tonygwynnandcalripke Wrote: I am not supposed to do anything for the next couple days but will pull my cards down and try and list all my needs and duplicates for the Die-cuts I also still need the CC & RS\nI listed in my post still undecided about getting a case any thoughts\n\nI didn't see anything in your post about buying a case. ", "However, I think you should abort that idea. ", "You have busted soooo many boxes that I think you will only be disappointed with breaking a case of Fanfare. ", "You are too close to completing it to spend that much money on a case. ", "You should go to auction sites and other trading sites to try to complete your sets. ", "You have plenty of trade-bait cards. ", "They should be enough to help you complete the set.", "\nI don't have any CC or RS cards to trade. ", "I have already traded away my RS cards and I am working on the holofoil die-cut set and the CC set, but have no doubles yet. ", "My die-cut set needs are listed in my thread, but here are the cards I need for the CC set: 1, 5, 12, 15. ", "LMK if you have any of these 4 to trade away!", "\n\n(10-21-2011 11:36 PM)spazmatastic Wrote: I didn't see anything in your post about buying a case. ", "However, I think you should abort that idea. ", "You have busted soooo many boxes that I think you will only be disappointed with breaking a case of Fanfare. ", "You are too close to completing it to spend that much money on a case. ", "You should go to auction sites and other trading sites to try to complete your sets. ", "You have plenty of trade-bait cards. ", "They should be enough to help you complete the set.", "\nI don't have any CC or RS cards to trade. ", "I have already traded away my RS cards and I am working on the holofoil die-cut set and the CC set, but have no doubles yet. ", "My die-cut set needs are listed in my thread, but here are the cards I need for the CC set: 1, 5, 12, 15. ", "LMK if you have any of these 4 to trade away!", "\n\nI have none of those but could throw you A dale jr.& ", "denny hamlin allStars insert from main event along with the gloves off, heck will even throw in a random auto from fane fare ( how bout kenny wallace love that guy) let me know" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0.01098901098901099, 0, 0.012048192771084338, 0, 0, 0.003424657534246575, 0, 0.023809523809523808, 0, 0.05, 0.003305785123966942, 0, 0.009174311926605505, 0, 0, 0, 0, 0.046511627906976744, 0.008, 0.009433962264150943, 0.022222222222222223, 0, 0, 0.009174311926605505, 0, 0, 0, 0, 0.046511627906976744, 0.008, 0.009433962264150943, 0.022222222222222223, 0, 0.005681818181818182 ]

[ "Q:\n\nhow to get multiple values from single text box and store it in array and also store it in database\n\nCan I use php to get multiple values from one input text box and store it in array?", "\nI want to read multi integers from the user and store it in array\nFor example, I add one input text and one submit:\n\nA:\n\nYou could do it in this way.", "\nMake an form in HTML having an input which should take comma seperated integer values like this:\n<form action=\"url\" method=\"POST\">\n <input id=\"dataInput\" type=\"text\" name=\"data\" value=\"12,34,56\">\n <button id=\"submitBtn\">Submit</button>\n</form>\n\nNow on submitting the form, you should receive the data in PHP, and you can use php's explode method like this:\n<?", "php\n\n$data = $_POST['data'];\n$data_arr = explode(',', $data); // <----- explode the string here from commas\n// Now you can store these values into the database\n\nSo the output for the $data_arr would be:\n$data_arr = array(\n 0 => '12',\n 1 => '34',\n 2 => '56'\n);\n\nHope this helps!", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0.00273224043715847, 0, 0 ]

[ "Just who is man’s best friend? ", "Who are these creatures that we’ve welcomed into our homes—who light up when we call their names, fetch things for us (like news updates and groceries), and make us feel better when we’re sad (by putting on Beyoncé and allowing us to order food without even moving)? ", "It’s the digital home assistant, of course—and it’s very obedient. ", "Unfortunately, it turns out, not just to you.", "\n\nThere’s a new reason to worry about the fact that your smart device might be listening all the time: She might be listening to someone else. ", "According to a report in the New York Times, researchers in both China and the U.S. have been looking into the way in smart homes can be infiltrated by audio undetectable to the human ear. ", "It turns out that secret commands—audible only to Alexa, Siri, and friends—can be successfully hidden within music, white noise, or YouTube videos: a home intrusion made up of only sound. ", "Researchers point out that while they themselves are not exploiting the devices, it’s very likely hackers soon will—and will use the security loopholes to order things online, wire themselves money, and unlock your front door.", "\n\nIt turns out Alexa can hear at a frequency we homo sapiens cannot—just like a dog. ", "And like a dog (or someone who is alt-right curious), our little assistant responds to virtual dog whistles, sounds that only she can detect, without her owner’s knowledge.", "\n\nIf she’s like a dog, she’s not a very good girl. ", "Sure, she’s obedient, and always happy to help, but she’s not at all loyal, willing to take dog-whistle commands from just about anyone—even those out to do her master harm—so long as they ask in the right way. ", "Order more dog food? ", "Mine Dogecoin? ", "Sell the CryptoKitty? ", "Hide it in a YouTube video and she may just do it. ", "Not to mention, she’s a terrible guard dog—put her in charge and she might let strangers into your not-so-smart home.", "\n\nAlexa may be poorly trained, but she certainly works like a dog (and I’m still going to judge you based on how you treat the bitch). ", "When I ask her to sit, she makes a sitting noise, though when I ask her to fetch she says she doesn’t know that one. ", "When I ask her who’s a good girl, she knows it’s not her (“My favorite would be Catherine II, empress of Russia”), but when I decide to take a more direct approach, asking “Alexa, are you a good girl?” ", "she responds, “I’m a great A.I.” And hey, at least she didn’t throw up on my couch while I was writing this, like my roommate’s French bulldog.", "\n\nIn the New York Times report, Google and Amazon say they are working on training her, with owner voice recognition software and technology that mitigates undetectable sound. ", "Apparently you can teach an old (at least by tech standards) dog new tricks. ", "But as with many developments in smart home technology, this research suggests we need to take care—with great power comes great potential for abuse. ", "The more things we give our smart homes control over, the more exploitable they become for hackers, both audial and virtual.", "\n\nJust remember: An AI is for life, not just for Christmas." ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0.003745318352059925, 0, 0, 0, 0.005291005291005291, 0.015957446808510637, 0, 0.011764705882352941, 0, 0, 0, 0, 0, 0.045454545454545456, 0.0196078431372549, 0, 0, 0, 0.009900990099009901, 0, 0.017045454545454544, 0, 0, 0, 0.01694915254237288 ]

[ "Yesterday we dropped news that the HTC Thunderbolt would be receiving Gingerbread (Android 2.3) some time in Q2 of this year, but many asked about its little brother, the DROID Incredible. ", "Well, if we are to believe the email below, which is from another HTC rep, it looks like the DI will also see GB in Q2, but towards the end instead.", "\n\nDear Thomas, I will be happy to assist with your software update inquiry. ", "Indeed the Incredible is going to get 2.3 Gingerbread and we expect to be ready to release it with Verizon before the end of the second quarter of this year. ", "To send a reply to this message or let me know I have successfully answered your question log in to our ContactUs site using your email address and your ticket number 11USCW14ENA000091. ", "Sincerely, Douglas HTC Want to see what others are saying? ", "Have a question to ask other HTC fans? ", "Become a fan of HTC facebook.com/htc\n\nFollow us on Twitter twitter.com/htc\n\nSubscribe to our YouTube Channel youtube.com/htc Explore our development resources developer.htc.com We are unable to receive replies to this email account. ", "Please visit us at htc.com if you have any questions or need further assistance.", "\n\nWe should remind you to take these HTC rep emails for what they are, just rumors until an official HTC announcement makes its way out. ", "Again, it is nice to start seeing some dates thrown around at though; gives us something to look forward to.", "\n\nCheers T!" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.005291005291005291, 0.006756756756756757, 0, 0.006329113924050633, 0.005376344086021506, 0.01694915254237288, 0, 0, 0.0125, 0, 0, 0 ]

[ "Q:\n\nfast.ai: How to get per-batch losses during validation\n\nI'm using AWD-LSTM model implemented by fast.ai. ", "Now I am able to get the validation loss averaged across all batches: \nfrom fastai.text import * \ndata_lm = (TextList.from_csv(\"data/penn\", \"concatenated.csv\", cols='text')\n .split_from_df(\"is_valid\")\n .label_for_lm()\n .databunch()) \nlearner = language_model_learner(data_lm, AWD_LSTM, pretrained=False) \nlearner.fit_one_cycle(10, 1e-2) \nlearner.export(\"exported.pkl\")\n\nitemlist = TextList.from_csv(\"data/penn\", \"concatenated.csv\", cols='text') \nnewlearner = load_learner(path=\"data/penn\", test=itemlist, file=\"exported.pkl\") \nloss, acc = newlearner.validate(newlearner.data.test_dl)\n\nbut how to get the validation loss per batch? ", " \nThings I've tried include:\n1. ", "Try to attach a Recorder. ", "But it seems like Recorder does not monitor validation, and learner.losses only store train losses per batch.", "\n2. ", "Use fastai.basic_train.loss_batch(learner.model, xb, yb, learner.loss_func), where xb and yb are just torch.", "Tensors. ", "But this approach gives the following AttributeError: \n---------------------------------------------------------------------------\nAttributeError Traceback (most recent call last)\n<ipython-input-14-5fa44a2d640f> in <module>\n 5 xb = torch.ones((64, 20)).cuda().long()\n 6 yb = torch.ones((64, 20)).cuda().long()\n----> 7 loss_batch(newlearner.model, xb, yb, newlearner.loss_func)\n\n~/anaconda3/envs/pytorch12/lib/python3.7/site-packages/fastai/basic_train.py in loss_batch(model, xb, yb, loss_func, opt, cb_handler)\n 27 out = cb_handler.on_loss_begin(out)\n 28 if not loss_func: return to_detach(out), to_detach(yb[0])\n---> 29 loss = loss_func(out, *yb)\n 30 \n 31 if opt is not None:\n\n~/anaconda3/envs/pytorch12/lib/python3.7/site-packages/fastai/layers.py in __call__(self, input, target, **kwargs)\n 237 \n 238 def __call__(self, input:Tensor, target:Tensor, **kwargs)->Rank0Tensor:\n--> 239 input = input.transpose(self.axis,-1).contiguous()\n 240 target = target.transpose(self.axis,-1).contiguous()\n 241 if self.floatify: target = target.float()\n\nAttributeError: 'tuple' object has no attribute 'transpose'\n\nA:\n\nI got the solution now.", "\ncb_handler = CallbackHandler(newlearner.callbacks + [], None)\nlosses, acc = fastai.basic_train.validate(\n newlearner.model, \n newlearner.data.test_dl, \n newlearner.loss_func, \n cb_handler, # This is necessary\n average=False)\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.009174311926605505, 0.00463678516228748, 0, 0, 0.009174311926605505, 0, 0.009259259259259259, 0, 0.0016129032258064516, 0.012345679012345678 ]

[ "Q:\n\nSelecting a sequence in SQL\n\nThere seems to be a few blog posts on this topic but the solutions really are not so intuitive. ", "Surely there's a \"Canonical\" way?", "\nI'm using Teradata SQL.", "\nHow would I select \n\nA range of number\nA date range\n\nE.g.\nSELECT 1:10 AS Nums\n\nSELECT 1-1-2010:5-1-2014 AS Dates1\n\nThe result would be 10 rows (1 - 10) in the first SELECT query and ~(365 * 3.5) rows in the second?", "\n\nA:\n\nThe \"canonical\" way to do this in SQL is using recursive CTEs, which the more recent versions of Teradata support.", "\nFor your first example:\nwith recursive nums(n) as (\n select 1 as n\n union all\n select n + 1\n from nums\n where n < 10\n )\nselect *\nfrom nums;\n\nYou can do something similar for dates.", "\nEDIT:\nYou can also do this by using row_number() and an existing table:\nwith nums(n) as (\n select n\n from (select row_number() over (order by col) as n\n from ExstingTable t\n ) t\n where n <= 10\n )\nselect *\nfrom nums;\n\nExistingTable is just any table with enough rows. ", " The best choice of col is the primary key.", "\nwith digits(n) as (\n select 1 as n union all select 2 union all select 3 union all select 4 union all select 5 union all\n select 6 union all select 7 union all select 8 union all select 9 union all select 10\n )\nselect *\nfrom digits;\n\nIf your version of Teradata supports multiple CTEs, you can build on the above:\nwith digits(n) as (\n select 1 as n union all select 2 union all select 3 union all select 4 union all select 5 union all\n select 6 union all select 7 union all select 8 union all select 9 union all select 10\n ),\n nums(n) as (\n select d1.n*100 + d2.n*10 + d3.n\n from digits d1 cross join digits d2 cross join digits d3\n )\nselect *\nfrom nums;\n\nA:\n\nIn Teradata you can use the existing sys_calendar to get those dates:\nSELECT calendar_date\nFROM sys_calendar.", "CALENDAR\nWHERE calendar_date BETWEEN DATE '2010-01-01' AND DATE '2014-05-01';\n\nNote: \nDATE '2010-01-01' is the only recommended way to write a date in Teradata\nThere's probably another custom calendar for the specific business needs of your company, too. ", "Everyone will have access rights to it.", "\nYou might also use this for the range of numbers:\nSELECT day_of_calendar\nFROM sys_calendar.", "CALENDAR\nWHERE day_of_calendar BETWEEN 1 AND 10;\n\nBut you should check Explain to see if the estimated number of rows is correct. ", "sys_calendar is a kind of template and day_of_calendar is a calculated column, so no statistics exists on that and Explain will return an estimated number of 14683 (20 percent of the number of rows in that table) instead of 10. ", "If you use it in additional joins the optimizer might do a bad plan based on that totally wrong number.", "\nNote:\nIf you use sys_calendar you are limited to a maximum of 73414 rows, dates between 1900-01-01 and 2100-12-31 and numbers between 1 and 73414, your business calendar might vary. ", "\nGordon Linoff's recursive query is not really efficient in Teradata, as it's a sequential row-by-row processing in a parallel database (each loop is an \"all-AMPs step\" in Explain) and the optimizer doesn't know how many rows will be returned.", "\nIf you need those ranges regularly you might consider creating a numbers table, I usually got one with a million rows or I use my calendar with the full range of 10000 years :-)\n--DROP TABLE nums;\nCREATE TABLE nums(n INT NOT NULL PRIMARY KEY CHECK (n BETWEEN 0 AND 999999));\n\nINSERT INTO Nums\nWITH cte(n) AS\n (\n SELECT day_of_calendar - 1\n FROM sys_calendar.", "CALENDAR\n WHERE day_of_calendar BETWEEN 1 AND 1000\n ) \nSELECT\n t1.n +\n t2.n * 1000 \nFROM cte t1 CROSS JOIN cte t2;\n\nCOLLECT STATISTICS COLUMN(n) ON Nums;\n\nThe COLLECT STATS is the most important step to get correct estimates.", "\nNow it's a simple\nSELECT n FROM nums WHERE n BETWEEN 1 AND 10;\n\nThere's also a nice UDF on GitHub for creating sequences which is easy to use:\nSELECT DATE '2010-01-01' + SEQUENCE \nFROM TABLE(gen_sequence(0,DATE '2014-05-01' - DATE '2010-01-01')) AS t;\n\nSELECT SEQUENCE \nFROM TABLE(gen_sequence(1,10)) AS t;\n\nBut it's usually hard to convince your DBA to install any C-UDFs and the number of rows returned is unknown again.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0.008333333333333333, 0, 0.006493506493506494, 0, 0.0024509803921568627, 0, 0, 0, 0, 0, 0, 0, 0.00411522633744856, 0, 0.008658008658008658, 0.009456264775413711, 0 ]

[ "Date: 18 September 2018: Within less than 24 Hours and Without Posing Any Threat to Life of Soldiers: Israeli Forces Kill 4 Civilians, including Child, in Two Crimes in Southern and Northern Gaza Strip.", "\n\nThe first was in the southern Gaza Strip When Israeli warplanes launched missiles to kill 2 civilians; one of them was a child, without any justification or threat to the life of soldiers while the second was in the northern Gaza Strip when Israeli forces used excessive force against peaceful protesters near Beit Hanoun “Erez” Crossing.", "\n\nPCHR’s investigations into the first case emphasize that the two killed were civilians who were present near the barbed-wire fence that is around 50 meters away from the main border fence.", "\n\nAlthough no circumstances clarified the reason behind their presence in the scene, they did not pose any threat to the life of soldiers as both were unarmed; moreover, targeting them violates the principle of necessity and distinction.", "\n\nIn the second case, the investigations indicate that the Israeli soldiers used lethal and excessive force against the peaceful protestors who posed no threat or danger to the life of the soldiers in the protests area.", "\n\nAccording to PCHR’s investigations, at approximately 22:30 on Monday, 17 September 2018, the Israeli soldiers stationed along the border fence with Israel in eastern Khan Younis in the southern Gaza Strip opened fire at the area near the border fence in eastern al-Qedra, northeast of the city.", "\n\nAfter around 20 minutes, an Israeli drone launched 2 missiles at the same area.", " Later, the Spokesperson of the Israeli forces,\n\nAvichay Adraee, declared on twitter that a military drone “attacked saboteurs who suspiciously approached the security fence in the southern Gaza Strip and planted a suspicious object near it”. However, this was refuted by the PCHR’s investigations.", "\n\nAt approximately 00:15 on Tuesday, an ambulance crew belonging to the Palestine Red Crescent Society (PRCS) arrived in the vicinity of the area, and the ambulances stopped at the end of Street 2 to the east.", "\n\nAfter coordinating with the International Committee of Red Cross (ICRC), the ambulances started entering the border area and searching for possibly wounded persons.", " Meanwhile, the Palestinian Liaison via phone directed the ambulance crew to where the two persons killed exactly was after the former’s contacted with the Israeli Liaison.", "\n\nThe PRCS crew said to PCHR’s fieldworker that at approximately 00:50 that near the barbed-wire fence established in the Palestinian territories, east of al-Qedra, that is around 50 meters away from the main border fence, they found two bodies of civilians dressed in civilian clothes.", "\n\nOne of them turned into pieces while the second was wounded with shrapnel throughout his body and features of his face was unclear due to the targeting.", "\n\nThe ambulance crew carried the two killed, taking them 300 meters away where the ambulances were parked.", " They were then taken to Naser Hospital in Khan Younis.", "\n\nMoreover, neither firearms nor suspicious objects were found near the bodies unlike what have been said by the Israeli Forces’ Spokesperson.", "\n\nOn Tuesday Afternoon, 18 September 2018, families of the 2 persons killed identified them after their photos were published on social media.", " They were namely as Naji Jamil Hasan Abu ‘Aasi (17) and ‘Alaa Ziad Jamil Abu ‘Aasi (20); who are both from Bani Suhaila.", "\n\nThough the circumstances have not clarified the reason behind their presence in the scene, they posed no threat to the life of Israeli soldiers as they were both civilians and unarmed, noting that the area was calm and did not witness any protests.", " Moreover, many infiltrations into Israel for work there were reported in that area.", "\n\nAt approximately 17:00 on Tuesday, 18 September 2018, Israeli forces stationed at the Beit hanoun “Erez” Crossing in the northern Gaza Strip fired live bullets and tear gas canisters to disperse hundreds of civilians who were protesting near the crossing upon calls from the National Committee of March for Return and Breaking the Siege to participate in the “Together for the Rights of Refugees and Breaking the Siege” activity.", "\n\nThe Israeli Forces’ shooting resulted in the killing of 2 civilians who were identified as Mohammed Ahmed Mohammed Abu Naji (32) from Beit Lahia Housing Project who was hit with a bullet to the chest; and Ahmed Mohammed Muhsen ‘Omer (24) from al-Shati’ refugee camp who was hit with a bullet to the chest.", " Both of them were taken to the Indonesian Hospital in Jabalia.", "\n\nMoreover, 44 civilians, including 7 children, 2 women, 3 journalists and 2 paramedics, were wounded.", " Seven of the wounded were hit with bullets while the rest were directly hit with tear gas canisters in addition to dozens who suffered tear gas inhalation.", " Further, a tear gas canister hit and broke the window of a PRCS ambulance.", "\n\nPCHR condemns these crimes which further prove that Israeli forces continue to use lethal forces against Palestinian civilians to kill them even though the later posed no threat to the life of soldiers.", "\n\nPCHR emphasizes that continuously targeting civilians, who exercise their right to peaceful assembly or while carrying out their humanitarian duty is a serious violation of the rules of international law, international humanitarian law, the ICC Rome Statute and Fourth Geneva Convention.", "\n\nThus, PCHR calls upon the ICC Prosecutor to open an official investigation in these crimes and to prosecute and hold accountable all those applying or involved in issuing orders within the Israeli Forces at the security and political echelons.", "\n\nPCHR also reiterates its call upon the High Contracting Parties to the 1949 Fourth Geneva Convention to fulfill their obligations under Article 1; i.e., to respect and ensure respect for the Convention in all circumstances and their obligations under Article 146 to prosecute persons alleged to commit grave breaches of the Fourth Geneva Convention." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0049504950495049506, 0.0029069767441860465, 0, 0, 0, 0.006711409395973154, 0, 0.0032679738562091504, 0.004784688995215311, 0.006024096385542169, 0, 0.003472222222222222, 0, 0, 0.017857142857142856, 0, 0, 0.03125, 0, 0, 0.002277904328018223, 0.012779552715654952, 0.015625, 0, 0, 0, 0.004901960784313725, 0, 0.00816326530612245, 0.002849002849002849 ]

[ "Editor’s note: Breaking views are thoughts from individual members of the editorial board on today’s headlines.", "\n\nProposals to curtail the Second Amendment rights of young adults in California were approved by Senate and Assembly Public Safety Committees this week.", "\n\nOn June 19, the Senate committee approved Assembly Bill 3, Assemblyman Rob Bonta, D-Oakland, which seeks to raise the minimum age of firearms purchases to 21. ", "On the same day, legislation doing the same via Senate Bill 1100 from Sen. Anthony Portantino, D-La Cañada Flintridge, cleared the Assembly’s committee.", "\n\nThese proposals are fundamentally a slap in the face to law-abiding Californians and a rejection of the constitutional rights of Americans.", "\n\nDuring the Senate hearing for SB1100, it was quite apparent that Portantino didn’t really have much of a case.", "\n\nCraig DeLuz from the Firearms Policy Coalition pointed out at the hearing one of the absurd consequenses of what Portantino and Bonta are proposing. ", "While young adults can be sent off to war in other countries with firearms, under the proposal of Bonta and Portantino, these same young adults would be unable to exercise their constitutional rights to defend themselves here at home.", "\n\nOthers at the hearing raised the point that it doesn’t make sense to single out the Second Amendment rights of 18-20 year olds. ", "The Second Amendment is as much a right as the right to vote. ", "And even the consequentialist arguments that 18-20 year olds being disproportionately involved in violent gun crimes doesn’t warrant curtailing their rights anymore than raising the age at which young adults should be able to drive because of how many accidents young people get into.", "\n\nBut rather than address the fact that the constitutional rights of Californians are at stake, Portantino regurgitated tired, self-serving talking points about how the rights of law-abiding Californians should be infringed upon because some of the activist survivors of the Marjory Stoneman Douglas High School shooting think that’s the right thing to do.", "\n\nOf course, Portantino just breezes Parkland survivors like Kyle Kashuv who defend the Second Amendment. ", "Portantino’s interest is in curtailing the Second Amendment rights, so only those whose views are convenient apparently matter.", "\n\nRaising the age to buy a gun is asinine. ", "If you're old enough to join the army, you're old enough to defend yourself with a weapon; if you're a single mother at 19, why shouldn't you be able to buy a weapon to defend your family? — ", "Kyle Kashuv (@KyleKashuv) March 25, 2018\n\nAs I have previously written, proposals to raise the minimum age at which young adults may defend themselves is just another infantilizing overreach by government. ", "Fundamentally, what is being communicated is the right to defend oneself is subject to the political whims of politicians.", "\n\nPreferably, these proposals will fail to advance. ", "If they don’t, I hope Sam Paredes from Gun Owners of California is correct and a lawsuit will be filed to stop Sacramento from further encroaching on the Second Amendment rights of Californians.", "\n\nSal Rodriguez is an editorial writer and columnist for the Southern California News Group. ", "He may be reached at salrodriguez@scng.com" ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0.013071895424836602, 0.024844720496894408, 0.019736842105263157, 0, 0.008928571428571428, 0.013245033112582781, 0.004273504273504274, 0, 0, 0, 0.0028089887640449437, 0.009433962264150943, 0, 0, 0, 0.009708737864077669, 0, 0, 0.005154639175257732, 0.010752688172043012, 0.023809523809523808 ]

[ "Detection of wear in electrical conductors such as insulated wires is critical to avoid simple inconvenience and, in some instances, catastrophic system failure. ", "Electrical cables typically consist of a conductor, such as a metallic wire or a plurality of wires, that is insulated with a jacket or sheath around the circumference of the wire. ", "The insulating material can be plastic, rubber, and the like. ", "Power chains have either relatively flat or cylindrical, elongated structures that consist of a series of long, parallel conductors that are separated from one another by an insulating material.", "\nPower chains are incorporated into moving machinery such as robotics and are subject to fatigue as they undergo cyclic motion, as well as by abrasion, impact or tension overload. ", "There exists a need to determine wear in electrical conductors and in particular those that are subject to constant frictional forces such as continuously moving cables. ", "Aside from programmed maintenance and inspection, the most common method of detecting cable wear entails deploying one or more “wear conductors” along strategic positions in the cable that appear to be subject to the most severe wear. ", "Wear can be inferred to occur when an electrically open circuit from a broken conductor is detected. ", "See, for example, U.S. Pat. ", "No. ", "6,034,531 to Senglat et al. ", "and U.S. Pat. ", "No. ", "6,215,315 to Mitsuru Maejima, WO 01/84117 to Pierre et al. ", "and WO 01/42802 to Harry Orton. ", "A major shortcoming of this approach is that the sensing of broken conductors does not lend itself to monitoring progressive wear. ", "Some cable manufacturers also measure cable resistance during life cycle testing; in most cases, this is a static procedure that employs a basic ohmmeter and that is performed when the test equipment is shut down. ", "Finally, prior art methods that endeavor to predict cable wear by measuring resistance do not adequately compensate for temperature fluctuations in the cables being monitored.", "\nU.S. Pat. ", "No. ", "6,777,948 to Dominelli et al. ", "describes a method of detecting wear in components of high voltage electrical equipment by embedding a tracer material that emits electromagnetic radiation into the components at predetermined depths therein. ", "As the components degrade, the tracer material can be detected when it is exposed to an electrical arc. ", "Introducing tracer materials is not practical for many applications and can actually interfere with the operations of many electrical conductors.", "\nU.S. Pat. ", "No. ", "5,015,859 to Wayne H. Uejio describes a method of detecting wear of electrical conductors such as insulated wires by wrapping an optical fiber around the article and measuring the transmission of light through the optical fiber. ", "Increased transmission loss is said to indicate wear of the article. ", "Incorporating optical fibers, which are very fragile, into moving power chains is not feasible for many applications and would be cost prohibitive." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.03389830508474576, 0.03125, 0, 0, 0, 0.09090909090909091, 0, 0.03333333333333333, 0, 0, 0, 0.09090909090909091, 0, 0.004366812227074236, 0, 0 ]

[ "Dezmond Xavier\n\nDeveon Everhart is an American professional wrestler, better known by his ring name Dezmond Xavier. ", "He is currently signed to Impact Wrestling under the ring name Dez. ", "Xavier is well known as a member of 'The Rascalz' with Zachary Wentz and Trey Miguel. ", "He also performs on the independent scene, mostly notably for Pro Wrestling Guerrilla (PWG), where he is currently one-half of the PWG World Tag Team Champions in his first reign with Wentz.", "\n\nProfessional wrestling career\n\nImpact Wrestling (2017–present) \n\nOn April 13, 2017, it was reported that Dezmond Xavier had signed with Impact Wrestling. ", "On the April 20 episode of Impact Wrestling, Xavier made his debut in a six-way match for the Impact X Division Championship, in which he was unsuccessful. ", "In July, Xavier entered the 2017 GFW Super X Cup tournament, defeated Idris Abraham in the quarterfinals, Drago in the semifinals, and Taiji Ishimori in the final to win the 2017 GFW Super X Cup.", "\n\nThrough November 2018, Xavier allinged himself with Trey Miguel and Zachary Wentz, forming a face stable under the name The Rascalz. ", "Xavier teamed with Wentz under the new stable name on the November 29 episode of Impact!, ", "where they defeated the team of Chris Bey and Mike Sydal. ", "The trios had multiple vignettes where they sit in circle as smoke surrounded them, similar to a popular segment from That '70s Show.", "\n\nDragon Gate (2018) \nDragon Gate announced the debut of Xavier and his indy tag team partner Zachary Wentz at Open The New Year Gate, Dragon Gate's first show of 2018. ", "They debuted on 13 January, where Xavier and Wentz, collectively known as Scarlet and Graves, teamed with Susumu Yokosuka in a winning effort against Genki Horiguchi, Flamita and Bandido.", "\n\nLucha Underground (2018) \nOn the July 18, 2018, episode of Lucha Underground he made his debut under the name Dezmond X defeating Paul London for one of the seven ancient Aztec Medallions. ", "The serie was discontinued after season finale, Ultima Lucha Cuatro.", "\n\nChampionships and accomplishments\n All American Wrestling\n AAW Tag Team Championship (1 time) – with Zachary Wentz\n Combat Zone Wrestling\n CZW World Tag Team Championship (2 times) – with Zachary Wentz\nDesastre Total Ultraviolento\nDTU Alto Impacto Championship (1 time, current)\n Impact Wrestling\n Super X Cup (2017)\n Turkey Bowl (2018) – with KM, Alisha Edwards, Kikutaro, Fallah Bahh\n Pro Wrestling Guerrilla\n PWG World Tag Team Championship (1 time, current) – with Zachary Wentz\nPro Wrestling Illustrated\nRanked No. ", "395 of the top 500 singles wrestlers in the PWI 500 in 2018\n WrestleCircus\n WC Sideshow Championship (1 time)\nThe Wrestling Revolver\nPWR Tag Team Championship (1 time, current) – with Zachary Wentz \n Xtreme Intense Championship Wrestling\n XICW Tag Team Championship (1 time) – with Aaron Williams, Dave Crist, Kyle Maverick, Trey Miguel and Zachary Wentz\n\nReferences\n\nExternal links\n\nImpact Wrestling Profile\nInternet Wrestling Database profile\n\nCategory:Living people\nCategory:Sportspeople from Dayton, Ohio\nCategory:American male professional wrestlers\nCategory:African-American male professional wrestlers\nCategory:Professional wrestlers from Ohio\nCategory:Year of birth missing (living people)" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.017241379310344827, 0, 0.023255813953488372, 0.010526315789473684, 0.01282051282051282, 0.01282051282051282, 0.005128205128205128, 0.007407407407407408, 0, 0.034482758620689655, 0, 0.011834319526627219, 0.0213903743315508, 0.010471204188481676, 0.014705882352941176, 0.01532567049808429, 0.00860832137733142 ]

[ "Indications of hormonally active substances in municipal solid waste leachate: mobilization and effect studies from Sweden and Norway.", "\nSeveral species of fish from a freshwater lake downstream a landfill in central Sweden have been found to be exposed to specific endocrine active substances (EAS), possibly able to interact with important functions in the synthesis of steroids and thereby disrupting a normal development of the gonad. ", "A preliminary study of 7 streams and lakes in Norway showed that female perch have a significant reduction in gonad somatic index (GSI) with fish length and weight at one location. ", "This can be an indication of disturbance due to exposure of hormonally active agents over time. ", "Only 2 locations showed significantly difference in GSI and liver somatic index (LSI). ", "Possible explanations can be that the necessary combination between exposure and exposed is exclusive and does not apply in general, or that the effects are masked due to other exposures such as e.g., nutrient, organic or other chemicals, physical or biological loads. ", "The number of sampled locations is, however, too limited to be conclusive. ", "Liver samples are being analyzed for organic pollutants, but these analyses were not ready at the time of publication. ", "A previous study of leachate and sediment samples indicated the presence of several organic pollutants and compounds known to be hormonally active. ", "Investigations of extracts from sediment samples from one of the exposed lake in Sweden showed the presence of both naturally occurring and xenophobic organic compounds. ", "In samples extracted with a base-neutral extraction the compounds 1,1 sulfonyl-bis(4-chlorobenzene) and bis-2-etylhexyl-phtalate were detected. ", "The high lipid affinity of the phtalate correlates with the finding of the compound in the high organic content layer of 20-40 cm in the exposed sediment. ", "Pesticide residues were not found in the samples." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0.0055248618784530384, 0, 0.022988505747126436, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Adenovirus for neurodegenerative diseases: in vivo strategies and ex vivo gene therapy using human neural progenitors.", "\nThe discovery of major neurodegenerative mechanisms has opened the way to the development of novel therapeutic approaches. ", "Gene therapy now enables researchers to overcome certain problems inherent to pharmacotherapy and to the grafting of embryonic cells. ", "The production of recombinant adenoviruses are promising for in vivo gene therapy involving neuroprotective (Ad-SOD), neurotrophic (Ad-NGF) as well as restorative (Ad-TH) strategies. ", "In addition, human neural progenitors offer great potential as vehicles for ex vivo gene therapy to replace degenerated cells in advanced stages of neurodegenerative diseases. ", "This paper describes the clinical values of the new generations of adenoviral vectors." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0.00546448087431694, 0, 0 ]

[ "Understanding Wine: The Un-Knowing (aka the Importance of Blind Tasting)\n\nIf there’s one thing I’m certain of, it’s that I’m an experiential learner. ", "Everything makes more sense when it’s tested, and the more senses I can use, the better. ", "Somewhere between visual and kinesthetic, it seems I have a particular aversion to textbooks and homework. ", "It’s not that I can’t do that stuff, I just feel trapped in someone else’s mind (usually an ageing Edwardian man), and it’s uncomfortable.", "\n\nGoing through school, subjects I was once passionate about became hell; a good example of this is math, or better, science. ", "As a kid, I loved collecting samples, experimenting with the elements, excavating, and playing with light. ", "The funny part is that in high school I nearly failed Geology, dropped out of Biology, argued my way out of Chemistry, but then took AP Physics for which i did extracurricular work and got an A. Why is this? ", "Because through real-life trial and error (using my own body), I could apply theory and test its relevance. ", "This was not only incredibly satisfying, it grounded my understanding of what would have otherwise been very abstract and difficult material.", "\n\nThe same goes for wine. ", "As an infinitely complex subject, it’s easy to get lost in the fluff of overworked, exhausting language, overlapping histories, tasting prerogatives, appellations and vintages. ", "With all the confusion of memorizing this and that, there’s a major gap between reciting the material and KNOWING the wine. ", "Really, don’t forget the basics. ", "Here’s a classic example that gives me anxiety, as quoted from a french wine scholar:\n\n“The textbook indicates that there are 24 Regional AOPs in Bourgogne (plus 44 Communal and 33 Grand Cru for a total of 101). ", "However Appendix A lists only 23, and www.bourgogne-wines.com likewise states that there are 23. ", "What is the missing AOP, or how else does one account for this discrepancy?”", "\n\nWhile the scholar is focused on solving the discrepancy between 23 and 24 Burgundy AOPs, a more fruitful discussion might include questions like: what does it take to be labeled an AOP? ", "Is AOP actually important for distinguishing good wines? ", "What makes good wine? ", "Why? ", "And most importantly, if I was poured a [insert Regional AOP Burgundy] Pinot Noir blind in a glass, would I know? ", "It seems that these questions would facilitate independent thinking on the scholar’s part, perhaps even offering solutions to the discrepancy they describe (or better yet, deeper insights that push the scholar past this question all together).", "\n\nBeing a human is complicated. ", "We are often our own worst enemies, and find ourselves hard to understand or connect to. ", "Especially in our modern world, we are trained to operate externally, objectively, and over time we begin to lose our subjective muscles- our sensory perceptions. ", "When you look down at your hands, what do you see? ", "Do you see your hands, or do you feel them? ", "Do you see yourself feeling your hands? ", "Or, does seeing your hands stimulate your awareness of sense of touch? ", "If you can answer yes to this last question, you are able to connect one sense to another. ", "Bravo!", "\n\nConnecting our senses is a big part of what makes us humans intelligent. ", "The better we are at understanding ourselves through our minds AND bodies, the better we can process insane amounts of information, share it, and have fun doing it. ", "So instead of lugging around a wine encyclopedia, pick up a glass and give it a whirl without even knowing what it is. ", "Challenge yourself, see how many senses you can use to relate (or not) to the wine. ", "What does the smell remind you of? ", "What does it feel like on your tongue? ", "Does it taste weird? ", "How? ", "Most importantly, do you like it? ", "There are no wrong answers here.", "\n\nOf course, reading is awesome and everyone should do it. ", "But in order to really absorb written material, make it come to life for YOU. ", "Start with the subject. ", "Get interested, then do research- not the other way around***. ", "Questions that stem from your own curiosity lead to answers that really stick in your mind and your sensory perceptions. ", "Reading about wine with no objective is like sailing at sea with no compass. ", "You will get lost in the doldrums or sink by iceberg. ", "Like anything, it takes a certain amount of conscious re-training of your brain’s habits, but the results will blow your mind.", "\n\n***BONUS POINTS to teachers and educational programs who choose to adopt this, or already engage their students in this manner." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0, 0, 0, 0.009615384615384616, 0, 0, 0, 0, 0, 0, 0, 0.010309278350515464, 0.013157894736842105, 0.010638297872340425, 0.017543859649122806, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Alvear (surname)\n\nAlvear is a Spanish surname. ", "Notable people with the surname include:\n\nCecilia Alvear, Ecuadorian-born American television journalist\nSoledad Alvear (born 1950), Chilean lawyer and politician\nYuri Alvear (born 1986), Colombian judoka\n\nSee also\nde Alvear\n\nCategory:Spanish-language surnames" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0, 0.019230769230769232 ]

[ "A new approach to evaluating the well-being of police.", "\nThere is a growing body of evidence that links employee well-being to organizational performance. ", "Although police forces are under increasing pressure to improve efficiency and productivity, the evaluation of well-being in law enforcement is mostly restricted to self-report stress questionnaires that are based on questionable construction methodologies. ", "No instrument to specifically determine the well-being of police force employees currently exists. ", "To construct an instrument that measures the work-related well-being of officers and staff within a police force. ", "The approach is drawn from well-established clinical models used to evaluate the well-being of patients. ", "Potential variables were confirmed using an item selection method known as impact analysis that places keen emphasis on frequency and importance as perceived by the respondents themselves. ", "Analyses of 822 completed response sets showed that nine separate dimensions of police work can adversely affect well-being (advancement, facilities, home work interface, job, physical health, psychological health, relationships, organizational and workload). ", "Overall, officers showed inferior well-being compared with their colleagues. ", "Content validity and adequate internal reliability were confirmed. ", "This study considered a new robust approach to evaluating the well-being of all those working in law enforcement. ", "The nine dimensions extended beyond conventional stress measures and may offer a practical alternative way of assessing the overall well-being status of an entire force using a systematic item selection framework." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "All You Need to Know\n\nBrewery: Grimm Artisanal Ales\n\nStyle: Wild Ale\n\nABV: 5.4%\n\nMy Cost: $14\n\nGlassware: Tulip, Flute\n\nTemp: 55°F (start at 45°F)\n\nAvailability: One Off\n\nPurchased@: Hunger N Thirst\n\nQuick Take: Purple Prose is a miss for me. ", "The bitter, mineral seltzer finish just kills any positive vibes and leaves the impression of flavored mineral water. ", "It’s an mf’er of a tart beer, but calling this a sour is overselling it. ", "It’s gassy without the acidity and leaves an unpleasant feeling in the stomach. ", "One of the biggest whiffs in recent memory.", "\n\nBrew Facts: Comprised of a husband and wife team, Grimm is a nomadic brewery, meaning they don’t have a firm brewery location, instead using the facilities of established breweries to produce their beer. ", "Recipes are developed in an apartment kitchen and only single batches are brewed full scale. ", "So, there’s a good chance that Purple Prose will never be brewed again, thus making this review somewhat irrelevant. ", "Wheee!", "\n\nAppearance: For a beer called Purple Prose, I shouldn’t be surprised by the glass of fizzy, violet-tinged cranberry kool aid in front of me, yet I am. ", "Rolling it around in the glass, it moves like liquid jello that hasn’t quite set (I’ve had a blackcurrant wine that moved in the same, unnaturally creepy way). ", "A wedge of white bubbles rings the glass with the slightest pink hue. ", "The liquid underneath is appropriately murky. ", "An aggressive swirl of the tumbler coats the glass in patches of small suds.", "\n\nAroma: A sniff and the jello theme rolls on. ", "The aroma of a freshly torn packet of raspberry mix hides some timid funk just under the surface. ", "It’s pleasant enough, but the pissy blackcurrant smell hangs around to wave a wary red flag that something might be off. ", "My nose finds little beyond the obvious, but the flavor may have more to offer.", "\n\nTaste/Mouth Feel: As I’m want to do, I decided to drink this sour on the warmer side. ", "A mistake I don’t suggest you make. ", "My palate is assaulted with a mineral, very mild sour seltzer front and catty ribes that slink in the background. ", "The finish is dry, off the vine berry that lacks the sweeter, brighter fruitiness this desperately needs. ", "Instead of juicy berry, it settles for a sugar-free candy like sweetness that dries up right before it gets going.", "\n\nIf this were considered a fruit/sour beer, it’s on the blander, earthier side that may please the natural/organic crowd. ", "For me, it’s like a weight watcher’s diet black raspberry soda that’s pushed flavor science to the edge of identifiable by the human tongue and only results in the caloric sum total of an afternoon belch. ", "Any amount of sour is a fading afterthought.", "\n\nWilling to give this a second go, I dropped the temp and tried again. ", "Tangy and tart blackcurrant, like an unrippened berry off the bush, still dominates, but the sour pushes a little more to the forefront. ", "The raspberry barely has a presence, waving its hand wildly in the back of the room like the kid with all the answers. ", "An improvement, but it’s still working with the same flavors and your enjoyment will vary depending on your deeply repressed feelings towards currants. ", "Side note, I also just realized this was brewed on oak. ", "The only reason I came to this realization is because oak is mentioned on the label. ", "Take that for what you will.", "\n\nFinal Thoughts: I’ve had exactly two Grimm beers prior to Purple Prose, Super Symmetry and Double Negative, a tasty gose and imperial stout respectively. ", "I’ve also enjoyed blackcurrant wine in the past, relishing its unique intensity and syrupy sweetness in small doses (an aspect woefully missing from Purple Prose). ", "Even with my history, Purple Prose is a miss for me. ", "The bitter, mineral seltzer finish just kills any positive vibes and leaves the impression of flavored mineral water. ", "It’s an mf’er of a tart beer, but calling this a sour is overselling it. ", "It’s gassy without the acidity and leaves an unpleasant feeling in the stomach.", "\n\nIn a market of increasingly interesting sour and fruit forward beers, the dry, catty qualities just don’t do it for me. ", "For those into these flavors, this is your beer. ", "Buy it, drink it, love it. ", "But if you are going to indulge, chill it to a properly C-O-L-D temp as it is a loose, bland mess warm. ", "For me, one of the biggest whiffs in recent memory.", "\n\nSecond Opinions: I drank this at a local bar and shared it with the bartender and another patron. ", "While they initially had a more positive response than I did, they ultimately gave it a pass on subsequent tastings due to the strong blackcurrant flavors, bland finish, and lack of balancing sweetness.", "\n\nRecommendation: For blackcurrant fans only." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.00823045267489712, 0, 0, 0, 0, 0.0048543689320388345, 0.010752688172043012, 0.008547008547008548, 0, 0.013071895424836602, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.019230769230769232, 0.006097560975609756, 0.018867924528301886, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Introduction {#sec1}\n============\n\nMany fundamental cellular activities, including vesicle/organelle trafficking, cell migration, establishment of cell polarity, and cell division, involve the microtubule cytoskeleton ([@ref22]; [@ref4]; [@ref31A]; [@ref29]). ", "Microtubule organization varies in a cell-type and cell-cycle-dependent manner, and is generally dictated by the sites of microtubule growth ([@ref15]; [@ref14]; [@ref19]; [@ref28]). ", "Such microtubule initiating sites are referred to as the microtubule organizing center (MTOC) ([@ref23]; [@ref28]). ", "The centrosome and its equivalents in lower eukaryotic cells (i.e. the spindle pole body, SPB) are conventionally thought of as the main MTOC. ", "However, noncentrosomal/non-SPB MTOCs have been increasingly recognized as key players in microtubule organization ([@ref14]; [@ref19]).", "\n\nIn epithelial cells, MTOCs locate at the apical cortex and generate microtubules running parallel toward the basal cortex ([@ref14]; [@ref19]). ", "Similarly, in plant cells, MTOCs are present at the cell cortex and on pre-existing microtubules to form complex cortical microtubule arrays ([@ref19]). ", "Moreover, MTOCs are present at the Golgi apparatus, assembling microtubules to organize the organelle ([@ref14]; [@ref19]; [@ref29]). ", "In muscle cells, the nuclear envelope (NE) is the main location for generating microtubules ([@ref14]; [@ref19]). ", "This is similar in fission yeast, in which the NE appears to be the main site for interphase microtubule regrowth in cells recovering from cold shock or treatment with the microtubule depolymerizing drug Methyl benzimidazol-2-yl-carbamate (MBC) ([@ref25]; [@ref2]). ", "It has been reported that centrosomal proteins including γ-tubulin undergo redistribution from the centrosome to the NE during the differentiation of myoblasts into myotubes and that Akap450 and its associated protein Nesprin-1a are responsible for tethering microtubule minus ends to the NE in muscle cells ([@ref5]; [@ref9]; [@ref14]). ", "How NE-dependent microtubules are generated in general remains elusive.", "\n\nThe fission yeast *Schizosaccharomyces pombe* is an excellent model organism for the study of microtubules because of the simple organization of microtubule arrays ([@ref10]). ", "Generally, 3--6 microtubule bundles are aligned along the long axis of the interphase cell with the microtubule plus ends pointing toward cell tips and the minus ends apposed to the NE. ", "Microtubules in fission yeast grow from the SPB, multiple MTOCs on pre-existing microtubules, and the NE during interphase while from the SPB and eMTOC (equatorial MTOC localizing around the actomyosin ring) during mitosis ([@ref10]; [@ref23]). ", "It has been noted that interphase microtubules mainly regrow from the NE in fission yeast cells recovering from cold shock or MBC treatment, suggestive of an important role of the NE in microtubule nucleation ([@ref25]; [@ref2]). ", "This feature makes fission yeast a convenient model organism to dissect molecular mechanisms underlying NE-dependent microtubule generation.", "\n\nThe transforming acidic coiled-coil protein (TACC) Alp7 likely contributes to NE-dependent microtubule generation. ", "First, the absence of Alp7 causes detachment of microtubule bundles from the NE ([@ref29]). ", "Second, the absence of Alp7 impairs the NE localization of Alp4, a component of the γ-tubulin ring complex (γ-TuRC), and Mto1, a factor required for activating non-SPB microtubule nucleation ([@ref21]; [@ref29]; [@ref17]; [@ref18]; [@ref13]). ", "Third, Alp7 functions in complex with the TOG (Tumor overexpressed gene) domain-containing protein Alp14 to regulate microtubule dynamics ([@ref20]). ", "Alp14 has been shown to function not only as a microtubule polymerase but also as a key factor in promoting microtubule nucleation ([@ref1]; [@ref7]). ", "How Alp7 coordinates with Alp14 and Mto1 to promote NE-dependent microtubule generation is still unclear.", "\n\nWe employed profusion chambers to examine interphase microtubule regrowth in cells after MBC washout by live-cell microscopy, and showed that efficient interphase microtubule regrowth from the NE requires Alp7, Alp14, and Mto1. ", "We further showed that Alp7 and Mto1 interdependently localize to the NE and that Alp14 localizes to the NE in an Alp7 and Mto1-dependent manner. ", "Thus, this present work demonstrates a synergism of Alp7, Alp14, and Mto1 in promoting NE-dependent microtubule assembly.", "\n\nResults {#sec2}\n=======\n\nMicrotubules regrow mainly from the NE after MBC washout {#sec3}\n--------------------------------------------------------\n\nCold treatment and MBC washout assays have been regularly used to study microtubule nucleation ([@ref25]; [@ref21]; [@ref22]; [@ref31]; [@ref11]; [@ref2]). ", "Both assays show rapid microtubule regrowth from the NE in fission yeast. ", "To understand how microtubule regrowth from the NE is regulated mechanistically, we revisited microtubule assembly dynamics by live-cell microscopy with profusion chambers, in which cells were treated with MBC followed by washout ([Figure 1A](#f1){ref-type=\"fig\"}). ", "Pilot experiments on wild-type (WT) cells expressing Mto1-3GFP (a key factor promoting non-SPB microtubule nucleation) and mCherry-Atb2 (α-tubulin) showed that treating cells with 25 or 50 μg/ml MBC for \\~10 min, a condition used in many previous studies ([@ref25]; [@ref22]; [@ref11]), was not able to depolymerize microtubules completely and left multiple microtubule stubs on the NE. ", "This resistance to microtubule depolymerization was likely contributed by the robust microtubule overlapping structures and/or the SPB ([@ref12]). ", "To examine *de novo* microtubule growth, we sought to depolymerize microtubule completely and thus treated cells with 200 μg/ml MBC for \\~10 min. ", "Such attempt was successful with most of the cells displaying no microtubule or 1 microtubule remnant/stub on the NE, presumably at the SPB ([Figure 1A](#f1){ref-type=\"fig\"}). ", "The MBC-treated cells could recover after washout of the drug as no apparent defects of cell growth and mitosis progression were found ([Supplementary Figure S1B and C](#sup1){ref-type=\"supplementary-material\"}). ", "We then followed the condition to perform all the experiments described below.", "\n\n{ref-type=\"supplementary-material\"} for all plots). ", "Note that cells with microtubules growing only from the NE were used for analysis and that at the second time point (i.e. after 10 sec upon MBC washout) microtubules appeared (see inset graphs; red lines indicate the period of time during which cells did not display microtubules).](mjz038f1){#f1}\n\nMicrotubules regrew rapidly in random directions upon MBC washout ([Figure 1B](#f1){ref-type=\"fig\"}). ", "To follow these rapidly growing microtubules, we acquired stack images, consisting of three planes with 0.5 μm spacing, every 10 sec. ", "As shown in [Figure 1B](#f1){ref-type=\"fig\"}, microtubules grew from the Mto1 foci mainly on the NE and sometimes from the cytoplasm. ", "Indeed, quantification confirmed that 36.4% (*n* = 21) of the cells grew microtubules only from the NE, 0% only from the cytoplasm, and 63.6% both from the NE and from the cytoplasm ([Figure 1C](#f1){ref-type=\"fig\"}). ", "We further quantified, in each cell (*n* = 22), the location of microtubule regrowth, and as shown in the scattering dot plot ([Figure 1D](#f1){ref-type=\"fig\"}), microtubules grew mainly from the NE. ", "To ascertain that newly generated microtubules were from the NE, we examined microtubule regrowth with a strain expressing Mto1-3GFP, mCherry-Atb2, and Cut11-RFP (a transmembrane protein marking the NE; [@ref27]). ", "As shown in [Figure 1E](#f1){ref-type=\"fig\"}, upon MBC washout, microtubules clearly regrew from Mto1-3GFP foci on the NE. ", "Such microtubule regrowth events were very rapid as ≥2 microtubules were clearly visible at the second time point of the imaging (i.e. within 10 sec; [Figure 1F](#f1){ref-type=\"fig\"}; also see [Supplementary Figure S1A](#sup1){ref-type=\"supplementary-material\"}). ", "Hence, we concluded that the NE is the predominant location for microtubule regrowth upon MBC washout.", "\n\nAlp7, but not Alp14, is required for the localization of Mto1 to the NE {#sec4}\n-----------------------------------------------------------------------\n\nAlp7 and Alp14 are involved in promoting microtubule nucleation ([@ref7]). ", "We then assessed if the absence of either Alp7 or Alp14 affects the localization of Mto1, the factor activating microtubule nucleation ([@ref13]), with stack images consisting of 11 planes spaced by 0.5 μm ([Figure 2A](#f2){ref-type=\"fig\"}). ", "In WT cells, microtubule depolymerization led to enrichment of Mto1 on the NE, forming multiple large Mto1 foci. ", "In *alp7Δ* cells, only one resolvable large Mto1 focus appeared on the NE and such focus colocalized with Sid4-tdTomato (SPB marker) at the SPB ([Figure 2C](#f2){ref-type=\"fig\"}). ", "In addition, multiple amorphous structures were present in the cytoplasm in *alp7Δ* cells. ", "Intriguingly, in *alp14Δ* cells, the localization of Mto1 to the NE appeared not to be impaired except that the distribution of Mto1 on the NE became more diffusive. ", "These observations were further confirmed by imaging WT, *alp7Δ*, and *alp14Δ* cells expressing Mto1-3GFP, mCherry-Atb2, and Cut11-RFP or expressing Mto1-3GFP and Sid4-tdTomato ([Figure 2B and C](#f2){ref-type=\"fig\"}). ", "Western blotting analysis of protein expression showed that Mto1-3GFP expressed comparably in WT, *alp7Δ*, and *alp14Δ* cells except that the Mto1-3GFP levels in *alp7Δ* cells were slightly higher ([Figure 2D](#f2){ref-type=\"fig\"}). ", "Nevertheless, such elevated expression did not enhance the localization of Mto1-3GFP to the NE in *alp7Δ* cells. ", "Instead, much less Mto1-3GFP signals were detected on the NE in MBC-treated *alp7Δ* cells ([Figure 2A--C](#f2){ref-type=\"fig\"}). ", "To compare the amount of Mto1 on the NE in a quantitative manner, we measured the average pixel intensity of Mto1 signals on the NE (i.e. integrated fluorescent intensity over area of the NE). ", "As shown in [Figure 2E](#f2){ref-type=\"fig\"}, the absence of Alp7 significantly decreased the average fluorescent intensity of Mto1-3GFP on the NE and the absence of Alp14 only slightly decreased the average fluorescent intensity of Mto1-3GFP on the NE, suggesting that Mto1 mainly depends on Alp7, but not Alp14, for localizing to the NE ([Figure 2E](#f2){ref-type=\"fig\"}). ", "Consistent with the quantification, line-scan intensity measurements of Mto1-3GFP around the NE confirmed that Alp7 plays a major role in localizing Mto1-3GFP to the NE in MBC-treated cells as very few Mto1-3GFP signals were detected around the NE except at the SPB in *alp7Δ* cells ([Figure 2F](#f2){ref-type=\"fig\"}). ", "Mto1 was likely recruited by Alp7 to the NE because co-immunoprecipitation (co-IP) experiments showed that Alp7-3GFP was able to precipitate with Mto1-13Myc ([Figure 2G](#f2){ref-type=\"fig\"}) and pull-down experiments confirmed that the interaction between MBP-Alp7 and Mto1-3GFP was positive ([Figure 2H](#f2){ref-type=\"fig\"}). ", "Together, these results suggested that Alp7, but not Alp14, is required for the redistribution of Mto1 to the NE upon microtubule depolymerization by drug treatment.", "\n\n{#f2}\n\nAlp7, but not Alp14, is required for microtubule regrowth from the NE in cells recovering from MBC treatment {#sec5}\n------------------------------------------------------------------------------------------------------------\n\nNext, we performed MBC washout assays to examine microtubule regrowth in *alp7Δ* and *alp14Δ* cells. ", "As shown in [Figure 3A and B](#f3){ref-type=\"fig\"}, microtubules were able to regrow from the NE and the cytoplasm in both types of cells after MBC washout. ", "Despite the capability of generating new microtubules, *alp14Δ* cells had microtubules growing mainly from the NE, but the microtubules appeared to be defective in elongation ([Figure 3B](#f3){ref-type=\"fig\"}), which is consistent with the role of Alp14 as a microtubule polymerase ([@ref1]). ", "In contrast, in *alp7Δ* cells, microtubules appeared to elongate normally but more *alp7Δ* cells displayed microtubules growing from the cytoplasm. ", "Quantification of the location of microtubule growth confirmed that 17.4% of *alp7Δ* cells grew microtubules only from the cytoplasm, compared with 5.6% of *alp14Δ* cells and 0% of WT ([Figure 3C](#f3){ref-type=\"fig\"}). ", "These results suggested that Alp7 is indeed required for microtubules to grow from the NE.", "\n\n{ref-type=\"fig\"}. ", "Note that the percentage of cells with microtubules growing only from the cytoplasm and only from the NE increased significantly in *alp7Δ* and *alp14Δ* cells, respectively. (**", "D**) Quantification of the appearance time of the first microtubule in WT, *alp7Δ*, and *alp14Δ* cells upon MBC washout. *", "n* indicates cell number. ", "Note that cells with microtubules growing only from the NE were used for analysis. (**", "E** and **F**) Representative step plots of microtubule number against time after MBC washout for *alp7Δ* (**E**) and *alp14Δ* (**F**) cells (also see [Supplementary Figures S2 and S3](#sup1){ref-type=\"supplementary-material\"} for all plots). ", "Note that cells with microtubules growing only from the NE were used for analysis and that red lines indicate the period of time during which cells did not display microtubules.](mjz038f3){#f3}\n\nDespite the differential roles in regulating microtubule regrowth after MBC washout, both Alp7 and Alp14 appeared to be required for efficient microtubule regrowth as the absence of either Alp7 or Alp14 caused a delay in generating the first visible microtubule on the NE ([Figure 3D--F](#f3){ref-type=\"fig\"}). ", "We then monitored the number of microtubules on the NE in *alp7Δ* and *alp14Δ* cells by live-cell microscopy for 400 sec after MBC washout ([Figure 3E and F](#f3){ref-type=\"fig\"}). ", "As shown in the step plots ([Figure 3E](#f3){ref-type=\"fig\"}; also see [Supplementary Figure S2](#sup1){ref-type=\"supplementary-material\"}), the number of microtubules on the NE in most of the *alp7Δ* cells increased slowly over time but rarely exceeded 2. ", "Interestingly, the number of microtubules on the NE in *alp14Δ* cells increased over time but fluctuated significantly during the observation period, indicative of instability of the newly generated microtubules ([Figure 3F](#f3){ref-type=\"fig\"}; also see [Supplementary Figure S3](#sup1){ref-type=\"supplementary-material\"}). ", "Nonetheless, more microtubules regrew from the NE in *alp14Δ* cells than *alp7Δ* cells. ", "This correlates well with the finding that the absence of Alp7, but not Alp14, impaired the localization of Mto1 to the NE ([Figure 2A](#f2){ref-type=\"fig\"}). ", "Taken together, we concluded that microtubule regrowth from the NE upon MBC washout mainly depends on Alp7, but not Alp14.", "\n\nAlp7 is required for the localization of Alp14 to the NE, but not *vice versa* {#sec6}\n------------------------------------------------------------------------------\n\nWe then examined how microtubule depolymerization alters the localization of Alp7 and Alp14. ", "Similar to Mto1, MBC treatment caused a great enrichment of both Alp7-3GFP and Alp14-GFP on the NE ([Figure 4A and B](#f4){ref-type=\"fig\"}). ", "Interestingly, after MBC treatment, Alp7 remained at the NE in *alp14Δ* cells whereas Alp14 did not decorate the NE anymore in *alp7Δ* cells ([Figure 4A and B](#f4){ref-type=\"fig\"}). ", "In addition, line-scan fluorescent intensity analysis of the signals of mCherry-Atb2 and either Alp7-3GFP or Alp14-GFP along the long axis of cells further showed that Alp7 signals on the NE were reduced in the absence of Alp14 and that Alp14 localization on the NE was abolished in *alp7Δ* cells ([Figure 4C and D](#f4){ref-type=\"fig\"}). ", "These data suggested that Alp7 dictates the localization of Alp14 to the NE but Alp14 plays a minor role in determining the localization of Alp7 to the NE. ", "The Alp7 foci on the NE appeared to be the main sites responsible for microtubule regrowth as microtubules generally grew from the Alp7 foci regardless of the presence of Alp14 ([Figure 4E](#f4){ref-type=\"fig\"}). ", "Hence, Alp14 requires Alp7 for localizing to the NE but not *vice versa*.", "\n\n{#f4}\n\nTethering Mto1 to the NE enhances microtubule regrowth in alp7*Δ* cells {#sec7}\n-----------------------------------------------------------------------\n\nAlp7 is required for the localization of both Mto1 and Alp14 to the NE ([Figures 2](#f2){ref-type=\"fig\"} and [4](#f4){ref-type=\"fig\"}) and for microtubule regrowth from the NE ([Figure 3C--E](#f3){ref-type=\"fig\"}). ", "In addition, it has been shown that Mto1 is an essential factor in activating non-SPB microtubule nucleation ([@ref13]). ", "Therefore, we reasoned that restoring the localization of Mto1 to the NE in *alp7Δ* cells could rescue the defective microtubule phenotype. ", "We employed the GBP (GFP binding protein)-GFP targeting system ([@ref16]; [@ref6]). ", "As shown in [Figure 5A](#f5){ref-type=\"fig\"} and [Supplementary Figure S4A](#sup1){ref-type=\"supplementary-material\"}, expression of Nup45-GBP-mCherry (a component of the nuclear pore complex) enhanced the localization of Mto1-3GFP to the NE in *alp7Δ* cells. ", "The enhancement was more apparent after MBC treatment ([Figure 5B](#f5){ref-type=\"fig\"} and [Supplementary Figure S4B](#sup1){ref-type=\"supplementary-material\"}), which was confirmed by quantification of Mto1 foci on the NE ([Figure 5C](#f5){ref-type=\"fig\"}). ", "The restored localization of Mto1 enhanced microtubule regrowth from the NE ([Figure 5E](#f5){ref-type=\"fig\"}) and microtubule regrowth became more efficient ([Figure 5F and G](#f5){ref-type=\"fig\"}, compared with the data in [Figure 3C--F](#f3){ref-type=\"fig\"}; also see [Supplementary Figure S5](#sup1){ref-type=\"supplementary-material\"}). ", "As a result, microtubule number increased significantly in the cells expressing Nup45-GBP-mCherry ([Figure 5D](#f5){ref-type=\"fig\"}). ", "These results suggest that proper localization of Mto1 to the NE is a key factor in regulating microtubule organization.", "\n\n{ref-type=\"fig\"}). ", "NE, regrowth only from the NE; Cytoplasm, regrowth only from the cytoplasm; Cytoplasm and NE, regrowth both from the cytoplasm and from the NE. *", "n* indicates cell number. (**", "F**) Quantification of the appearance time of the first microtubule in *alp7Δ* Nup45-GBP-mCherry cells upon MBC washout (for comparison, also see [Figure 3D](#f3){ref-type=\"fig\"}). *", "n* indicates cell number. ", "Note that cells with microtubules growing only from the NE were used for analysis. (**", "G**) Step plot of microtubule number against time after MBC washout for *alp7Δ* Nup45-GBP-mCherry cells (for comparison, see [Figure 3E](#f3){ref-type=\"fig\"}; also see [Supplementary Figure S5](#sup1){ref-type=\"supplementary-material\"} for all plots)*.* ", "Note that cells with microtubules growing only from the NE were used for analysis and that red lines indicate the period of time during which cells did not display microtubules.](mjz038f5){#f5}\n\nThe localization of Alp7 and Alp14 to the NE depends on Mto1 {#sec8}\n------------------------------------------------------------\n\nWe further tested if Mto1 is required for the localization of Alp7 and Alp14 to the NE in MBC-treated cells. ", "As shown in [Figure 6A and B](#f6){ref-type=\"fig\"}, the localization of Alp7 and Alp14 to the NE were abolished in MBC-treated *mto1Δ* cells. ", "Such effect was also apparent in *mto1Δ* cells without MBC treatment ([Figure 6C and D](#f6){ref-type=\"fig\"}). ", "It is most likely that in MBC-treated cells, Mto1 and Alp7 localize to the NE interdependently and that Alp14 depends both on Mto1 and on Alp7 for localizing to the NE. ", "As a result, the absence of Alp7 and Alp14 on the NE in *mto1Δ* cells abolished microtubule regrowth from the NE because most of the *mto1Δ* cells failed to regrow microtubules or regrew only one very short microtubule from the NE (presumably from the SPB) after MBC washout ([Figure 6E](#f6){ref-type=\"fig\"}). ", "The microtubule regrowth from the SPB in *mto1Δ* cells could be due to the presence of Alp4, a component of the γ-tubulin small complex responsible for microtubule nucleation, at the SPB as the localization of Alp4 to the SPB has been shown to be independent of Mto1 ([@ref21]; [@ref30]).", "\n\n{#f6}\n\nDiscussion {#sec9}\n==========\n\nIn this study, we demonstrate that Alp7 and Alp14 synergize to promote microtubule regrowth from the NE in cells recovering from MBC treatment. ", "Alp7 and Mto1 likely work in concert to initiate microtubule regrowth from the NE while Alp14 functions to promote further elongation of the NE-associated microtubules ([Figure 6F](#f6){ref-type=\"fig\"}). ", "We further demonstrate that Alp7 and Mto1 interdependently localize to the NE ([Figures 2A--C](#f2){ref-type=\"fig\"}, [6A and C](#f6){ref-type=\"fig\"}) and that Alp14 depends both on Alp7 and on Mto1 for localizing to the NE ([Figures 4B and D](#f4){ref-type=\"fig\"}, [6B and D](#f6){ref-type=\"fig\"}).", "\n\nOur results underscored the critical role of Alp7 in assembling microtubules on the NE, and Alp7 may do so by accumulating Mto1 and Alp14 to the NE where Mto1 functions to activate microtubule nucleation and Alp14 promotes microtubule elongation. ", "This is supported by our findings that the absence of Alp7 abolishes the NE localization of Alp14 while significantly impairs the NE localization of Mto1 ([Figures 2A--C and E](#f2){ref-type=\"fig\"}, [4B and D](#f4){ref-type=\"fig\"}), which is consistent with the previous publications ([@ref29]; [@ref7]). ", "We further noted that particularly in *alp7Δ* cells, Mto1 emerged in the cytoplasm and displayed as many amorphous structures ([Figure 2](#f2){ref-type=\"fig\"}). ", "This redistribution of Mto1 to the cytoplasm in *alp7Δ* cells is likely the cause of the increased percentage of microtubule regrowth from the cytoplasm ([Figure 3A and C](#f3){ref-type=\"fig\"}). ", "Recently, it was reported that the exportin Crm1 recruits Mto1 to the nuclear pore complex on the NE to promote NE-associated microtubule growth ([@ref4]). ", "In addition, this work showed that Alp7 is not required for the NE localization of Mto1(9A1-NE), an Mto1 mutant localizing specifically to the NE and lacking the C-terminus of Mto1 (amino acids 550--1115; additional nine amino acids in the CM1 domain are mutated to Alanine). ", "This does not necessarily contradict our conclusion because we examined endogenous NE-associated Mto1 whereas the indicated study examined the truncated Mto1 mutant, Mto1(9A1-NE), that specifically localizes to the NE. ", "Rather, the two studies together suggest a possibility that Crm1 and Alp7 may interact with different regions of Mto1 and both interactions are required for localizing Mto1 to the NE. ", "Indeed, our co-IP assay showed that Alp7-3GFP precipitates with Mto1-13Myc ([Figure 2G](#f2){ref-type=\"fig\"}).", "\n\nThis present work showed that Mto1 is also required for localizing Alp7 to the NE ([Figure 6A](#f6){ref-type=\"fig\"}). ", "Therefore, it is conceivable that Alp7 and Mto1 form a complex to allow for efficient localization of the complex to the NE. ", "Such Alp7-Mto1 complex on the NE should possess a very strong activity in microtubule nucleation because Mto1 has been shown to be required for *de novo* non-SPB microtubule assembly and Alp7 has been shown to recruit Alp14 to nucleation sites for promoting microtubule assembly ([@ref21]; [@ref18]; [@ref13]; [@ref7]).", "\n\nInterestingly, despite the important role of Alp14 in promoting microtubule nucleation ([@ref7]), *alp14Δ* cells are still able to grow very short microtubules from the NE, indicative of defective microtubule elongation ([Figures 3B and](#f3){ref-type=\"fig\"}[4E](#f4){ref-type=\"fig\"}). ", "This finding suggests that Alp14 may not be required for *de novo* microtubule regrowth from the NE, at least in cells recovering from MBC treatment, but instead support the claim that Alp14 is a microtubule polymerase ([@ref1]). ", "The ability in generating microtubules from the NE in *alp14Δ* cells may be due to the presence of Alp7 and Mto1 on the NE ([Figures 2A--C](#f2){ref-type=\"fig\"} and [4A](#f4){ref-type=\"fig\"}). ", "Nevertheless, this does not exclude the possibility that Alp14 plays a critical role in microtubule nucleation since the appearance of the first microtubule on the NE in *alp7Δ* and *alp14Δ* cells recovering from MBC treatment is significantly delayed ([Figure 3D](#f3){ref-type=\"fig\"}).", "\n\nIn unperturbed cells, it is generally difficult to detect NE-associated microtubule growth. ", "Alp7 and Alp14 mainly localize along pre-existing microtubules as foci ([Figure 6C and D](#f6){ref-type=\"fig\"}), and the same is true for Mto1 as reported previously ([@ref21]; [@ref24]). ", "Such localization preference may enable microtubules to be generated mainly on pre-existing microtubules in unperturbed cells. ", "It is conceivable that microtubule generation from the NE may serve as a backup fast-acting mechanism to restore microtubule arrays in response to unfavorable environmental conditions such as cold treatment.", "\n\nIn conclusion, microtubule generation from the NE requires concerted efforts of the evolutionarily conserved proteins Alp7/TACC, Alp14/TOG/XMAP215, and Mto1/CDK5RAP2. ", "Given the conservative nature of the involved proteins, the proposed working model may be conserved through evolution. ", "This awaits further investigation.", "\n\nMaterials and methods {#sec10}\n=====================\n\nPlasmids and yeast strains {#sec11}\n--------------------------\n\nPlasmids were constructed by homologous recombination method using ClonExpress II One Step Cloning kits ([www.vazyme.com](http://www.vazyme.com)), and yeast strains were created either by random spore digestion or tetra-dissection analysis ([@ref8]). ", "Gene deletion and tagging were achieved using the PCR-based homologous recombination method ([@ref3]). ", "The plasmids and strains used in this study are included in the [Supplementary Tables S1 and S2](#sup1){ref-type=\"supplementary-material\"}, respectively.", "\n\nBiochemistry {#sec12}\n------------\n\nYeast cells at the exponential phase, cultured in 1 L YE5S (YE medium supplemented with the five supplements: Adenine, Uracil, Leucine, Histidine, and Lysine, 0.225 g/L each), were harvested for the co-IP assay. ", "Cell lysates were prepared by liquid nitrogen grinding with the mortar grinder RM 200 ([www.retsch.com](http://www.retsch.com)), and were then suspended in Tris-buffered saline (TBS) plus 0.1% Triton X-100 and protease inhibitor cocktail ([www.biovision.com](http://www.biovision.com)) at 4°C for 0.5 h. Supernatants were collected after centrifugation at 12 000 rpm for 20 min and incubated with Dynabeads Protein G beads ([www.thermofisher.com](http://www.thermofisher.com)) coupled with an anti-GFP antibody ([www.rockland-inc.com](http://www.rockland-inc.com)) at 4°C for 2 h. After incubation, Dynabeads were washed with the buffer TBS + 0.1% Triton X-100 for three times and then with the TBS buffer for one time. ", "Finally, co-IP samples were analyzed by SDS-PAGE and western blotting with antibodies against GFP and Myc ([www.rockland-inc.com](http://www.rockland-inc.com)). ", "For pull-down assays, recombinant proteins MBP-Alp7 and MBP were expressed in *E.coli* and were purified with amylose resins ([www.neb.com](http://www.neb.com)). ", "The purified recombinant proteins on the resins were then incubated with cell lysates (prepared as indicated above) containing Mto1-3GFP in TBS plus 0.1% Triton X-100 and protease inhibitor cocktail for 1 h. After the incubation, the resins were washed with buffer TBS+ 0.1% Triton X-100 for five times and TBS buffer for one time. ", "SDS-PAGE and western blotting were then performed to analyze the pull-down protein samples with an antibody against GFP. ", "For testing protein expression, cells were broken using glass beads and cell lysates were analyzed by western blotting with antibodies against GFP and tubulin ([www.enogene.com](http://www.enogene.com)).", "\n\nProfusion chamber experiments {#sec13}\n-----------------------------\n\nProfusion chambers were prepared with double-sticky tape and poly-L-lysine (5 mg/ml) coated coverslips, as described previously ([@ref25]). ", "Cells were flowed into an upside-down chamber, followed by 10 min incubation at room temperature to allow attachment of cells to coverslips. ", "Medium replacement was performed by adding medium from one side and absorbing from the other with tissue papers. ", "EMM Medium containing the five supplements and 200 μg/ml MBC was used to depolymerize microtubules. ", "To allow microtubule regrowth, MBC-free EMM medium was used.", "\n\nMicroscopy and data analysis {#sec14}\n----------------------------\n\nA PerkinElmer UltraVIEW Vox spinning-disk microscope equipped with a Hamamatsu C9100-23B EMCCD camera and a CFI Apochromat TIRF 100× objective (NA = 1.49) was used for all microscopy experiments. ", "Briefly, cells at the exponential phase were collected and imaged on EMM (with the five supplements) agarose pad slides, as described previously ([@ref26]). ", "For maximum projection imaging, stack images containing 11 planes spaced by 0.5 μm were acquired; for time-lapse imaging, stack images containing three planes spaced by 0.5 μm were acquired every 10 sec. ", "MetaMorph 7.7 ([www.moleculardevices.com](http://www.moleculardevices.com)) and Image J 1.5 ([imagej.nih.gov](http://imagej.nih.gov)) softwares were used to analyze the imaging data. ", "Plot and step graphs were created using KaleidaGraph 4.5 ([www.synergy.com](http://www.synergy.com)), and statistical analysis was performed with Microsoft Excel.", "\n\nSupplementary Material\n======================\n\n###### \n\nClick here for additional data file.", "\n\nWe thank Drs Quanwen Jin (Xiamen University), Phong Tran (UPENN), Fred Chang (UCSF), and Snezhana Oliferenko (KCL) and the Yeast Genetic Resource Center Japan for providing yeast strains and plasmids.", "\n\nFunding {#sec16}\n=======\n\nThis work is supported by grants from the National Key Research and Development Program of China (2017YFA0503600), the National Natural Science Foundation of China (91754106, 31871350, 31671406, 31601095, and 31621002), the Strategic Priority Research Program of the Chinese Academy of Sciences (XDB19040101), the Major/Innovative Program of Development Foundation of Hefei Center for Physical Science and Technology (2017FXCX008), and China's 1000 Young Talents Recruitment Program.", "\n\n**Conflict of interest:** none declared.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.015384615384615385, 0.0273224043715847, 0.017241379310344827, 0.006993006993006993, 0.014705882352941176, 0.0136986301369863, 0.006535947712418301, 0.029850746268656716, 0.017543859649122806, 0.011278195488721804, 0.011834319526627219, 0, 0.0056179775280898875, 0, 0.0163265306122449, 0.008695652173913044, 0, 0, 0.010869565217391304, 0.024691358024691357, 0.013333333333333334, 0.013245033112582781, 0, 0, 0, 0.008264462809917356, 0.0196078431372549, 0, 0.0037593984962406013, 0.0103359173126615, 0.006802721088435374, 0, 0.005681818181818182, 0.004694835680751174, 0, 0, 0.023255813953488372, 0.018518518518518517, 0, 0, 0.00881057268722467, 0, 0, 0.021505376344086023, 0, 0, 0, 0, 0.016, 0, 0, 0, 0.014492753623188406, 0, 0.005235602094240838, 0.0024937655860349127, 0, 0, 0, 0, 0.004672897196261682, 0, 0, 0, 0.004347826086956522, 0.004132231404958678, 0, 0.011111111111111112, 0, 0, 0.0091324200913242, 0, 0, 0, 0, 0.0026666666666666666, 0.003134796238244514, 0.00303951367781155, 0.006060606060606061, 0, 0, 0.008130081300813009, 0, 0, 0.017094017094017096, 0, 0, 0, 0, 0, 0, 0.007246376811594203, 0, 0.006622516556291391, 0, 0, 0, 0, 0, 0, 0, 0.020833333333333332, 0.004273504273504274, 0, 0.0034129692832764505, 0, 0, 0, 0, 0.0136986301369863, 0.01020408163265306, 0.008849557522123894, 0, 0, 0.010101010101010102, 0.008849557522123894, 0, 0, 0, 0.013793103448275862, 0, 0.011764705882352941, 0, 0, 0, 0, 0.00411522633744856, 0, 0.0055248618784530384, 0, 0, 0, 0.006289308176100629, 0.00819672131147541, 0, 0.0070921985815602835, 0, 0.0029498525073746312, 0.00641025641025641, 0, 0, 0, 0.013513513513513514, 0.010526315789473684, 0, 0.011494252873563218, 0, 0.010638297872340425, 0, 0.011494252873563218, 0, 0.015503875968992248, 0, 0.0078125, 0, 0.009433962264150943, 0, 0, 0, 0.008264462809917356, 0, 0.03571428571428571, 0.0038461538461538464, 0, 0.002932551319648094, 0, 0, 0, 0, 0.005747126436781609, 0, 0, 0, 0, 0, 0, 0, 0, 0.008333333333333333, 0, 0.013793103448275862, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.013888888888888888, 0, 0, 0.007518796992481203, 0, 0, 0.01015228426395939, 0, 0.011904761904761904, 0, 0, 0.004366812227074236, 0, 0, 0, 0, 0, 0, 0, 0, 0.006557377049180328, 0, 0, 0.00641025641025641, 0.0036231884057971015, 0, 0, 0, 0, 0, 0.012539184952978056, 0.003472222222222222, 0.004347826086956522, 0, 0, 0, 0.010638297872340425, 0, 0, 0.011834319526627219, 0, 0, 0.008086253369272238, 0.019417475728155338, 0, 0.008, 0.016666666666666666, 0.031055900621118012, 0.024691358024691357, 0.0030120481927710845, 0.01652892561983471, 0.014778325123152709, 0.0047169811320754715, 0, 0, 0.01, 0.016666666666666666, 0.011278195488721804, 0.012738853503184714, 0, 0.02185792349726776, 0.018518518518518517, 0, 0.034653465346534656, 0.011741682974559686, 0, 0 ]

[ "Who Are Indigenous Peoples\n\nAccording to the United Nations, there are approximately 400 million Indigenous people worldwide, making up more than 5,000 distinct tribes. ", "Together we are one of the largest minority groups in the world, spanning over 90 countries. ", "While Indigenous Peoples total only about 6% of the world’s population, we represent 90% of the cultural diversity.", "\n\nINDIGENOUS PEOPLES HOLD 20% OF THE EARTH’S LAND MASS. ", "THAT LAND HARBORS 80% OF THE WORLD’S REMAINING BIODIVERSITY.", "\n\nDEFINING INDIGENOUS PEOPLES\nThere is no rigid definition of what makes a group Indigenous, but the United Nations and the International Labour Organization have outlined a few characteristics that usually define an Indigenous group:\n\n● We are descended from the pre-colonial/pre-invasion inhabitants of our region.", "\n● We maintain a close tie to our land in both our cultural and economic practices.", "\n● We suffer from economic and political marginalization as a minority group.", "\n● A group is considered Indigenous if it defines itself that way.", "\n\nEach Indigenous group is unique. ", "We speak thousands of different languages, and our traditions are as diverse as our lands. ", "However, there are basic principles that all Indigenous communities share. ", "These principles are the foundation of all Indigenous practices, and it is because of them that our economies and our societies are equitable, balanced, and sustainable.", "\n\nGiven that Indigenous lands contain so much of the world’s natural assets, why are we not the wealthiest, healthiest people on Earth?", "\nThe answer is clear: we are not simply losing control of our assets, our assets are being stripped from us. ", "At the same time, we are systematically denied access to the legal and political tools to secure our rights. ", "This is the single most unifying issue for all Indigenous Peoples. ", "Regardless of where we live, Indigenous Peoples are suffering from eviction, violence, exclusion, discrimination and disenfranchisement, leading to poverty, health issues, and the destruction of our cultures. ", "Perhaps most detrimental is the widespread perception that we lack the capacity to take care of ourselves. ", "We have been prosperous for the vast majority of our history, and the loss of that prosperity is the only possible result of being completely stripped of our resources and our rights. ", "The same would become of any civilization on Earth if it were to experience the same asset-stripping.", "\n\nThe perception that Indigenous Peoples lack capacity not only leads to further marginalization, it prevents us from working effectively with non-Indigenous partners, and from acquiring the capital to create change for our communities.", "\n\nThe idea that Indigenous Peoples lack capacity is a myth. ", "Our traditional knowledge and the strength of our social and economic systems have sustained our existence for thousands of years. ", "We are adaptable and powerful, while remaining dedicated to preserving the whole of life on this planet for generations to come. ", "And now, despite oppression, extreme poverty and exclusion from world development, we have begun to build the world’s first global human rights movement.", "\n\nThe tectonic plates of the global economy have begun to shift toward recognizing the rights of Indigenous Peoples. ", "In 2007, the universal Declaration of the Rights of Indigenous Peoples was adopted by the General Assembly of the United Nations. ", "That same year the shareholders of Newmont Mining voted overwhelmingly to include the interests of Indigenous Peoples in their company’s policies, an unprecedented victory for Indigenous rights. ", "Behind these changes is the largest civil rights movement the world has ever seen, and it’s gaining momentum. ", "Click here to learn about the Global Movement to protect Indigenous communities and their assets." ]

{ "pile_set_name": "Pile-CC" }

[ 0.005917159763313609, 0, 0, 0, 0, 0.00949367088607595, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.004784688995215311, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.015384615384615385, 0.005128205128205128, 0, 0.010309278350515464 ]

[ "Q:\n\nCreate two debian packages with intersecting files\n\nI'm trying to create two binary debian packages with dpkg-deb utility. ", "The feature is that part of the files has the same name and path. ", "So when I install one package after another I get error:\nfile of package A conflicts with file in package B.\nCan you advice solution for this?", "\n\nA:\n\nGoing by your comment, both packages need the same files for themselves (as opposed to providing variants of the same file, for example).", "\nThe solution for that is to simply split out the common files into a third package and have the other two packages both depend on it. ", "This is a pretty common case in Debian, most packages with a name ending in \"-common\" contain files shared by a family of packages.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0, 0, 0 ]

[ "Gridrunner is the latest entry in Llamasoft’s Minotaur Project, though this one doesn’t really involve much in the way of minotaurs or ungulates of any sort. ", "No, this is an iOS version of Jeff Minter’s Gridrunner franchise that has spanned the days of the Commodore 64, to appearing on PC in remake form.", "\n\nThe iOS version is essentially a hybrid between Centipede and a Galaga-esque game. ", "Segmented enemies come downward on the board, traveling across the board horizontally before dropping down a level when they hit a wall or obstacle. ", "Each enemy that is killed drops one of those obstacles, that if not destroyed turns into a bomb that falls to the bottom of the stage. ", "Meanwhile, there are indestructible ships on each axis that fire at the player, making for many hazards that the player has to deal with. ", "The Galaga influence is more audiovisual than in gameplay, necessarily.", "\n\nOn iOS, few developers have quite the voice in their games that Jeff Minter has put into games like Gridrunner. ", "There’s a very consistent style, of retro graphics with psychedelic effects and occasionally-absurd sound effects. ", "It’s all here, even if this might be one of the more ‘normal’ titles in the Minotaur Project so far. ", "It’s familiar, but it’s definitely fun. ", "The game also comes with a couple of neat easter eggs: classic versions of Gridrunner, based off of the Commodore 64 and Vic-20 versions. ", "They are available by tilting to each landscape orientation. ", "Seriously.", "\n\nThe controls are my only real issue with the game. ", "The touch controls are confounding, and the movement of the ship feels odd initially, particularly in the way that the ship slides around. ", "This is because the ship is controlled through an invisible dynamic joystick, the center point being whereever the player’s finger is put down. ", "It’s analog as well, so the more the finger slides, the further the player’s ship moves. ", "It definitely requires some acclimation. ", "Playing on the iPhone/iPod is more challenging due to the fact that more of the screen will be blocked. ", "The game is perfect with iCade though, and it feels like a real arcade game.", "\n\nGridrunner, much like the rest of Jeff Minter’s games on iOS, is a must-buy. ", "He’s actually one of the few developers that I would buy a game from as soon as I found out it was available, and I’ll keep up with this.", "\n\nReview disclosure: note that the product reviewed on this page may have been provided to us by the developer for the purposes of this review. ", "Note that if the developer provides the product or not, this does not impact the review or score." ]

{ "pile_set_name": "Pile-CC" }

[ 0.006329113924050633, 0.00684931506849315, 0.011764705882352941, 0, 0, 0, 0, 0.017543859649122806, 0, 0.009900990099009901, 0, 0.014492753623188406, 0, 0, 0, 0, 0, 0, 0, 0.019230769230769232, 0.013157894736842105, 0.012658227848101266, 0, 0, 0 ]

[ "package com.commit451.gitlab.api\n\nimport com.commit451.gitlab.util.", "LinkHeaderParser\n\ndata class BodyWithPagination<T>(\n val body: T,\n val paginationData: LinkHeaderParser.", "PaginationData\n)\n" ]

{ "pile_set_name": "Github" }

[ 0, 0, 0.058823529411764705 ]

[ "If memory serves correct, I first read about using glycerin in Joel Friels book, but my memory is... ...what were we talking about?", "\n\nIt basically makes you retain water, so that you are \"superhydrated\" for an effort in hotter conditions. ", "Hammer adds a raspberry flavor as well as L-carnitine (sp) for whatever reason you could find on their website/literature.", "\n\nI am preloading it for the KTR, just to see what the effects are. ", "The taste is minimal, so that is a non-factor. ", "I will not use it during the race, just to pre-hydrate. ", "You use 1 tbsp per 100lbs body weight three times per day for three days prior to the event. ", "Testimonials have indicated that they used it during an event, but that is not how it is advised per the instructions.", "\n\nI have not done the KTR before, so I will not be able to compare. ", "I may come back to comment on my findings, should I not want to hide with my tail between my legs for not having finished...\n\nI've used it a couple of times and I'm not really sure it was doing anything but it wasn't very hot and I wasn't sweating much anyway. ", "I'm going to continue to use it as it gets hotter here in Virginia to see if it works.", "\n\nWell I managed to make it, so I guess I will offer something. ", "That something is that I don't know if it worked, but hydration was never an issue. ", "The direction this year was such that you could get in trouble with water, but much less so than my understanding and deductive reasoning about last year's direction. ", "I was able to get to the 1/2 way point using 5 liters of hydration bladder and a bottle of perpetium. ", "The perpetium was so concentrated that I doubt there was more than 8oz in there. ", "I had fluid at the halfway point before filling from the Colorado at Dewey. ", "Since the start was at night, I can only say that I was never at a deficit. ", "I probably maintained the superhydrated state or close to it up to that point. ", "The second half was hot, but much of it was in the lasalle mtns, so cooler than in the middle of the desert. ", "I used 6 liters plus 1x perpetium mix (all I could carry), and aprox another 2 liters plus perpetium in the second half. ", "I was never at a deficit for water. ", "Even with one 1/2 hour wait with no water for the iodine to do its job.", "\n\nSo for an 18+ hour effort, approx 13 liters 24oz of water. ", "About 24oz per hour for a 135lb rider in the desert. ", "Not sure if that is good or not.", "\n\nA real test would be the other direction, as the heat of the day and relative altitude/water availability play a bigger role.", "\n\nSorry for a lot of information and no real summary. ", "I haven't absorbed the whole thing yet. ", "Somebody on here can make heads and tails of this I would bet...\n\nBased on the research, I would expect it to work but only be useful for long events - KTR is perfect. ", "Due to increased water storage and hence weight, performance would take a hit for shoter events. ", "But for long, hot ones it should work well." ]

{ "pile_set_name": "Pile-CC" }

[ 0.007633587786259542, 0, 0.00819672131147541, 0.014705882352941176, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.013157894736842105, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "0908 277 0680\n\ncalls recorded at 36p per minute plus network extras\n\nBlog Archives\n\nHard Dildo Insertions Sexchat\n\nHard Dildo Insertions Sexchat (Call cost 35p per minute + your phone company’s access charge) Hard dildo insertions sexchat on our extreme strap on phonesex lines is nasty and depraved and will be just what you are looking for if…\n\nEbony Phone Sex\n\nEbony Phone Sex (Call cost 35p per minute + your phone company’s access charge) If you are in the mood for some obscene and x rated ebony phone sex then pick up the phone and call our cheapest phonesex black…\n\nCougar Phone Sex\n\nFit as Fuck Phone Sex Cougars (Call cost 35p per minute + your phone company’s access charge) Welcome to the only home of Cougar phone sex where out man eaters will break any naughty taboo and will give you the…\n\nCollege Babes Phone Sex\n\nTight Fit College Sluts Local to You (Call cost 35p per minute + your phone company’s access charge) College babes phone sex 18 plus where we have the finest in the land from black, white and Asian dolls with their…\n\nSubmissive Phone Sex\n\nSubmissive Phone Sex (Call cost 35p per minute + your phone company’s access charge) Whatever your kinky fetish is our submissive phone sex sluts will help you in any way that they can, it’s just in their nature. ", "They will…\n\nBlow Job Phone Sex\n\nBlow Job Phone Sex (Call cost 35p per minute + your phone company’s access charge) The home of blow job phone sex where some of our dick sucking whores will even let you listen to them sucking off their fuck…" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0015600624024961, 0 ]

[ "Q:\n\nCounting number of elements to be sorted in insertion sort algorithm\n\nI think the title is self-explanatory. ", "I am trying to write a program that could count how many swaps are needed to sort a list using insertion sort. ", "This is what I have done:\ncounts = []\nfor _ in range(int(input())):\n size = int(input())\n ar = list(map(int, input().split()))\n count = 0\n for i in range(1, len(ar)):\n for j in range(i, 0, -1):\n if ar[j] > ar[i]: count +=1\n counts.append(count)\nprint(*counts)\n\nBut the problem is that it's not working. ", "\nFor list {1 1 1 2 2} I get 0 which is correct but, \nfor list {2 1 3 1 2} I get 2 which is not correct the answer is 4. ", "\nCan I know why isn't it working? ", "Thanks.", "\n\nA:\n\nIt's all couse of for j in range(i, 0, -1):. ", "In range right bound is not included, so you should:\nfor j in range(i-1, -1, -1):\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0.005952380952380952, 0, 0, 0, 0.0196078431372549, 0.03614457831325301 ]

[ "'use strict';\n\nmodule.exports = function(Chart) {\n\n\tvar helpers = Chart.helpers;\n\n\t/**\n \t * Helper method to merge the opacity into a color\n \t */\n\tfunction mergeOpacity(colorString, opacity) {\n\t\tvar color = helpers.color(colorString);\n\t\treturn color.alpha(opacity * color.alpha()).rgbaString();\n\t}\n\n\tChart.defaults.global.tooltips = {\n\t\tenabled: true,\n\t\tcustom: null,\n\t\tmode: 'nearest',\n\t\tposition: 'average',\n\t\tintersect: true,\n\t\tbackgroundColor: 'rgba(0,0,0,0.8)',\n\t\ttitleFontStyle: 'bold',\n\t\ttitleSpacing: 2,\n\t\ttitleMarginBottom: 6,\n\t\ttitleFontColor: '#fff',\n\t\ttitleAlign: 'left',\n\t\tbodySpacing: 2,\n\t\tbodyFontColor: '#fff',\n\t\tbodyAlign: 'left',\n\t\tfooterFontStyle: 'bold',\n\t\tfooterSpacing: 2,\n\t\tfooterMarginTop: 6,\n\t\tfooterFontColor: '#fff',\n\t\tfooterAlign: 'left',\n\t\tyPadding: 6,\n\t\txPadding: 6,\n\t\tcaretPadding: 2,\n\t\tcaretSize: 5,\n\t\tcornerRadius: 6,\n\t\tmultiKeyBackground: '#fff',\n\t\tdisplayColors: true,\n\t\tborderColor: 'rgba(0,0,0,0)',\n\t\tborderWidth: 0,\n\t\tcallbacks: {\n\t\t\t// Args are: (tooltipItems, data)\n\t\t\tbeforeTitle: helpers.noop,\n\t\t\ttitle: function(tooltipItems, data) {\n\t\t\t\t// Pick first xLabel for now\n\t\t\t\tvar title = '';\n\t\t\t\tvar labels = data.labels;\n\t\t\t\tvar labelCount = labels ? ", "labels.length : 0;\n\n\t\t\t\tif (tooltipItems.length > 0) {\n\t\t\t\t\tvar item = tooltipItems[0];\n\n\t\t\t\t\tif (item.xLabel) {\n\t\t\t\t\t\ttitle = item.xLabel;\n\t\t\t\t\t} else if (labelCount > 0 && item.index < labelCount) {\n\t\t\t\t\t\ttitle = labels[item.index];\n\t\t\t\t\t}\n\t\t\t\t}\n\n\t\t\t\treturn title;\n\t\t\t},\n\t\t\tafterTitle: helpers.noop,\n\n\t\t\t// Args are: (tooltipItems, data)\n\t\t\tbeforeBody: helpers.noop,\n\n\t\t\t// Args are: (tooltipItem, data)\n\t\t\tbeforeLabel: helpers.noop,\n\t\t\tlabel: function(tooltipItem, data) {\n\t\t\t\tvar label = data.datasets[tooltipItem.datasetIndex].label || '';\n\n\t\t\t\tif (label) {\n\t\t\t\t\tlabel += ': ';\n\t\t\t\t}\n\t\t\t\tlabel += tooltipItem.yLabel;\n\t\t\t\treturn label;\n\t\t\t},\n\t\t\tlabelColor: function(tooltipItem, chart) {\n\t\t\t\tvar meta = chart.getDatasetMeta(tooltipItem.datasetIndex);\n\t\t\t\tvar activeElement = meta.data[tooltipItem.index];\n\t\t\t\tvar view = activeElement._view;\n\t\t\t\treturn {\n\t\t\t\t\tborderColor: view.borderColor,\n\t\t\t\t\tbackgroundColor: view.backgroundColor\n\t\t\t\t};\n\t\t\t},\n\t\t\tafterLabel: helpers.noop,\n\n\t\t\t// Args are: (tooltipItems, data)\n\t\t\tafterBody: helpers.noop,\n\n\t\t\t// Args are: (tooltipItems, data)\n\t\t\tbeforeFooter: helpers.noop,\n\t\t\tfooter: helpers.noop,\n\t\t\tafterFooter: helpers.noop\n\t\t}\n\t};\n\n\t// Helper to push or concat based on if the 2nd parameter is an array or not\n\tfunction pushOrConcat(base, toPush) {\n\t\tif (toPush) {\n\t\t\tif (helpers.isArray(toPush)) {\n\t\t\t\t// base = base.concat(toPush);\n\t\t\t\tArray.prototype.push.apply(base, toPush);\n\t\t\t} else {\n\t\t\t\tbase.push(toPush);\n\t\t\t}\n\t\t}\n\n\t\treturn base;\n\t}\n\n\t// Private helper to create a tooltip item model\n\t// @param element : the chart element (point, arc, bar) to create the tooltip item for\n\t// @return : new tooltip item\n\tfunction createTooltipItem(element) {\n\t\tvar xScale = element._xScale;\n\t\tvar yScale = element._yScale || element._scale; // handle radar || polarArea charts\n\t\tvar index = element._index,\n\t\t\tdatasetIndex = element._datasetIndex;\n\n\t\treturn {\n\t\t\txLabel: xScale ? ", "xScale.getLabelForIndex(index, datasetIndex) : '',\n\t\t\tyLabel: yScale ? ", "yScale.getLabelForIndex(index, datasetIndex) : '',\n\t\t\tindex: index,\n\t\t\tdatasetIndex: datasetIndex,\n\t\t\tx: element._model.x,\n\t\t\ty: element._model.y\n\t\t};\n\t}\n\n\t/**\n\t * Helper to get the reset model for the tooltip\n\t * @param tooltipOpts {Object} the tooltip options\n\t */\n\tfunction getBaseModel(tooltipOpts) {\n\t\tvar globalDefaults = Chart.defaults.global;\n\t\tvar getValueOrDefault = helpers.getValueOrDefault;\n\n\t\treturn {\n\t\t\t// Positioning\n\t\t\txPadding: tooltipOpts.xPadding,\n\t\t\tyPadding: tooltipOpts.yPadding,\n\t\t\txAlign: tooltipOpts.xAlign,\n\t\t\tyAlign: tooltipOpts.yAlign,\n\n\t\t\t// Body\n\t\t\tbodyFontColor: tooltipOpts.bodyFontColor,\n\t\t\t_bodyFontFamily: getValueOrDefault(tooltipOpts.bodyFontFamily, globalDefaults.defaultFontFamily),\n\t\t\t_bodyFontStyle: getValueOrDefault(tooltipOpts.bodyFontStyle, globalDefaults.defaultFontStyle),\n\t\t\t_bodyAlign: tooltipOpts.bodyAlign,\n\t\t\tbodyFontSize: getValueOrDefault(tooltipOpts.bodyFontSize, globalDefaults.defaultFontSize),\n\t\t\tbodySpacing: tooltipOpts.bodySpacing,\n\n\t\t\t// Title\n\t\t\ttitleFontColor: tooltipOpts.titleFontColor,\n\t\t\t_titleFontFamily: getValueOrDefault(tooltipOpts.titleFontFamily, globalDefaults.defaultFontFamily),\n\t\t\t_titleFontStyle: getValueOrDefault(tooltipOpts.titleFontStyle, globalDefaults.defaultFontStyle),\n\t\t\ttitleFontSize: getValueOrDefault(tooltipOpts.titleFontSize, globalDefaults.defaultFontSize),\n\t\t\t_titleAlign: tooltipOpts.titleAlign,\n\t\t\ttitleSpacing: tooltipOpts.titleSpacing,\n\t\t\ttitleMarginBottom: tooltipOpts.titleMarginBottom,\n\n\t\t\t// Footer\n\t\t\tfooterFontColor: tooltipOpts.footerFontColor,\n\t\t\t_footerFontFamily: getValueOrDefault(tooltipOpts.footerFontFamily, globalDefaults.defaultFontFamily),\n\t\t\t_footerFontStyle: getValueOrDefault(tooltipOpts.footerFontStyle, globalDefaults.defaultFontStyle),\n\t\t\tfooterFontSize: getValueOrDefault(tooltipOpts.footerFontSize, globalDefaults.defaultFontSize),\n\t\t\t_footerAlign: tooltipOpts.footerAlign,\n\t\t\tfooterSpacing: tooltipOpts.footerSpacing,\n\t\t\tfooterMarginTop: tooltipOpts.footerMarginTop,\n\n\t\t\t// Appearance\n\t\t\tcaretSize: tooltipOpts.caretSize,\n\t\t\tcornerRadius: tooltipOpts.cornerRadius,\n\t\t\tbackgroundColor: tooltipOpts.backgroundColor,\n\t\t\topacity: 0,\n\t\t\tlegendColorBackground: tooltipOpts.multiKeyBackground,\n\t\t\tdisplayColors: tooltipOpts.displayColors,\n\t\t\tborderColor: tooltipOpts.borderColor,\n\t\t\tborderWidth: tooltipOpts.borderWidth\n\t\t};\n\t}\n\n\t/**\n\t * Get the size of the tooltip\n\t */\n\tfunction getTooltipSize(tooltip, model) {\n\t\tvar ctx = tooltip._chart.ctx;\n\n\t\tvar height = model.yPadding * 2; // Tooltip Padding\n\t\tvar width = 0;\n\n\t\t// Count of all lines in the body\n\t\tvar body = model.body;\n\t\tvar combinedBodyLength = body.reduce(function(count, bodyItem) {\n\t\t\treturn count + bodyItem.before.length + bodyItem.lines.length + bodyItem.after.length;\n\t\t}, 0);\n\t\tcombinedBodyLength += model.beforeBody.length + model.afterBody.length;\n\n\t\tvar titleLineCount = model.title.length;\n\t\tvar footerLineCount = model.footer.length;\n\t\tvar titleFontSize = model.titleFontSize,\n\t\t\tbodyFontSize = model.bodyFontSize,\n\t\t\tfooterFontSize = model.footerFontSize;\n\n\t\theight += titleLineCount * titleFontSize; // Title Lines\n\t\theight += titleLineCount ? (", "titleLineCount - 1) * model.titleSpacing : 0; // Title Line Spacing\n\t\theight += titleLineCount ? ", "model.titleMarginBottom : 0; // Title's bottom Margin\n\t\theight += combinedBodyLength * bodyFontSize; // Body Lines\n\t\theight += combinedBodyLength ? (", "combinedBodyLength - 1) * model.bodySpacing : 0; // Body Line Spacing\n\t\theight += footerLineCount ? ", "model.footerMarginTop : 0; // Footer Margin\n\t\theight += footerLineCount * (footerFontSize); // Footer Lines\n\t\theight += footerLineCount ? (", "footerLineCount - 1) * model.footerSpacing : 0; // Footer Line Spacing\n\n\t\t// Title width\n\t\tvar widthPadding = 0;\n\t\tvar maxLineWidth = function(line) {\n\t\t\twidth = Math.max(width, ctx.measureText(line).width + widthPadding);\n\t\t};\n\n\t\tctx.font = helpers.fontString(titleFontSize, model._titleFontStyle, model._titleFontFamily);\n\t\thelpers.each(model.title, maxLineWidth);\n\n\t\t// Body width\n\t\tctx.font = helpers.fontString(bodyFontSize, model._bodyFontStyle, model._bodyFontFamily);\n\t\thelpers.each(model.beforeBody.concat(model.afterBody), maxLineWidth);\n\n\t\t// Body lines may include some extra width due to the color box\n\t\twidthPadding = model.displayColors ? (", "bodyFontSize + 2) : 0;\n\t\thelpers.each(body, function(bodyItem) {\n\t\t\thelpers.each(bodyItem.before, maxLineWidth);\n\t\t\thelpers.each(bodyItem.lines, maxLineWidth);\n\t\t\thelpers.each(bodyItem.after, maxLineWidth);\n\t\t});\n\n\t\t// Reset back to 0\n\t\twidthPadding = 0;\n\n\t\t// Footer width\n\t\tctx.font = helpers.fontString(footerFontSize, model._footerFontStyle, model._footerFontFamily);\n\t\thelpers.each(model.footer, maxLineWidth);\n\n\t\t// Add padding\n\t\twidth += 2 * model.xPadding;\n\n\t\treturn {\n\t\t\twidth: width,\n\t\t\theight: height\n\t\t};\n\t}\n\n\t/**\n\t * Helper to get the alignment of a tooltip given the size\n\t */\n\tfunction determineAlignment(tooltip, size) {\n\t\tvar model = tooltip._model;\n\t\tvar chart = tooltip._chart;\n\t\tvar chartArea = tooltip._chart.chartArea;\n\t\tvar xAlign = 'center';\n\t\tvar yAlign = 'center';\n\n\t\tif (model.y < size.height) {\n\t\t\tyAlign = 'top';\n\t\t} else if (model.y > (chart.height - size.height)) {\n\t\t\tyAlign = 'bottom';\n\t\t}\n\n\t\tvar lf, rf; // functions to determine left, right alignment\n\t\tvar olf, orf; // functions to determine if left/right alignment causes tooltip to go outside chart\n\t\tvar yf; // function to get the y alignment if the tooltip goes outside of the left or right edges\n\t\tvar midX = (chartArea.left + chartArea.right) / 2;\n\t\tvar midY = (chartArea.top + chartArea.bottom) / 2;\n\n\t\tif (yAlign === 'center') {\n\t\t\tlf = function(x) {\n\t\t\t\treturn x <= midX;\n\t\t\t};\n\t\t\trf = function(x) {\n\t\t\t\treturn x > midX;\n\t\t\t};\n\t\t} else {\n\t\t\tlf = function(x) {\n\t\t\t\treturn x <= (size.width / 2);\n\t\t\t};\n\t\t\trf = function(x) {\n\t\t\t\treturn x >= (chart.width - (size.width / 2));\n\t\t\t};\n\t\t}\n\n\t\tolf = function(x) {\n\t\t\treturn x + size.width > chart.width;\n\t\t};\n\t\torf = function(x) {\n\t\t\treturn x - size.width < 0;\n\t\t};\n\t\tyf = function(y) {\n\t\t\treturn y <= midY ? '", "top' : 'bottom';\n\t\t};\n\n\t\tif (lf(model.x)) {\n\t\t\txAlign = 'left';\n\n\t\t\t// Is tooltip too wide and goes over the right side of the chart.?", "\n\t\t\tif (olf(model.x)) {\n\t\t\t\txAlign = 'center';\n\t\t\t\tyAlign = yf(model.y);\n\t\t\t}\n\t\t} else if (rf(model.x)) {\n\t\t\txAlign = 'right';\n\n\t\t\t// Is tooltip too wide and goes outside left edge of canvas?", "\n\t\t\tif (orf(model.x)) {\n\t\t\t\txAlign = 'center';\n\t\t\t\tyAlign = yf(model.y);\n\t\t\t}\n\t\t}\n\n\t\tvar opts = tooltip._options;\n\t\treturn {\n\t\t\txAlign: opts.xAlign ? ", "opts.xAlign : xAlign,\n\t\t\tyAlign: opts.yAlign ? ", "opts.yAlign : yAlign\n\t\t};\n\t}\n\n\t/**\n\t * @Helper to get the location a tooltip needs to be placed at given the initial position (via the vm) and the size and alignment\n\t */\n\tfunction getBackgroundPoint(vm, size, alignment) {\n\t\t// Background Position\n\t\tvar x = vm.x;\n\t\tvar y = vm.y;\n\n\t\tvar caretSize = vm.caretSize,\n\t\t\tcaretPadding = vm.caretPadding,\n\t\t\tcornerRadius = vm.cornerRadius,\n\t\t\txAlign = alignment.xAlign,\n\t\t\tyAlign = alignment.yAlign,\n\t\t\tpaddingAndSize = caretSize + caretPadding,\n\t\t\tradiusAndPadding = cornerRadius + caretPadding;\n\n\t\tif (xAlign === 'right') {\n\t\t\tx -= size.width;\n\t\t} else if (xAlign === 'center') {\n\t\t\tx -= (size.width / 2);\n\t\t}\n\n\t\tif (yAlign === 'top') {\n\t\t\ty += paddingAndSize;\n\t\t} else if (yAlign === 'bottom') {\n\t\t\ty -= size.height + paddingAndSize;\n\t\t} else {\n\t\t\ty -= (size.height / 2);\n\t\t}\n\n\t\tif (yAlign === 'center') {\n\t\t\tif (xAlign === 'left') {\n\t\t\t\tx += paddingAndSize;\n\t\t\t} else if (xAlign === 'right') {\n\t\t\t\tx -= paddingAndSize;\n\t\t\t}\n\t\t} else if (xAlign === 'left') {\n\t\t\tx -= radiusAndPadding;\n\t\t} else if (xAlign === 'right') {\n\t\t\tx += radiusAndPadding;\n\t\t}\n\n\t\treturn {\n\t\t\tx: x,\n\t\t\ty: y\n\t\t};\n\t}\n\n\tChart.", "Tooltip = Chart.Element.extend({\n\t\tinitialize: function() {\n\t\t\tthis._model = getBaseModel(this._options);\n\t\t},\n\n\t\t// Get the title\n\t\t// Args are: (tooltipItem, data)\n\t\tgetTitle: function() {\n\t\t\tvar me = this;\n\t\t\tvar opts = me._options;\n\t\t\tvar callbacks = opts.callbacks;\n\n\t\t\tvar beforeTitle = callbacks.beforeTitle.apply(me, arguments),\n\t\t\t\ttitle = callbacks.title.apply(me, arguments),\n\t\t\t\tafterTitle = callbacks.afterTitle.apply(me, arguments);\n\n\t\t\tvar lines = [];\n\t\t\tlines = pushOrConcat(lines, beforeTitle);\n\t\t\tlines = pushOrConcat(lines, title);\n\t\t\tlines = pushOrConcat(lines, afterTitle);\n\n\t\t\treturn lines;\n\t\t},\n\n\t\t// Args are: (tooltipItem, data)\n\t\tgetBeforeBody: function() {\n\t\t\tvar lines = this._options.callbacks.beforeBody.apply(this, arguments);\n\t\t\treturn helpers.isArray(lines) ? ", "lines : lines !", "== undefined ? [", "lines] : [];\n\t\t},\n\n\t\t// Args are: (tooltipItem, data)\n\t\tgetBody: function(tooltipItems, data) {\n\t\t\tvar me = this;\n\t\t\tvar callbacks = me._options.callbacks;\n\t\t\tvar bodyItems = [];\n\n\t\t\thelpers.each(tooltipItems, function(tooltipItem) {\n\t\t\t\tvar bodyItem = {\n\t\t\t\t\tbefore: [],\n\t\t\t\t\tlines: [],\n\t\t\t\t\tafter: []\n\t\t\t\t};\n\t\t\t\tpushOrConcat(bodyItem.before, callbacks.beforeLabel.call(me, tooltipItem, data));\n\t\t\t\tpushOrConcat(bodyItem.lines, callbacks.label.call(me, tooltipItem, data));\n\t\t\t\tpushOrConcat(bodyItem.after, callbacks.afterLabel.call(me, tooltipItem, data));\n\n\t\t\t\tbodyItems.push(bodyItem);\n\t\t\t});\n\n\t\t\treturn bodyItems;\n\t\t},\n\n\t\t// Args are: (tooltipItem, data)\n\t\tgetAfterBody: function() {\n\t\t\tvar lines = this._options.callbacks.afterBody.apply(this, arguments);\n\t\t\treturn helpers.isArray(lines) ? ", "lines : lines !", "== undefined ? [", "lines] : [];\n\t\t},\n\n\t\t// Get the footer and beforeFooter and afterFooter lines\n\t\t// Args are: (tooltipItem, data)\n\t\tgetFooter: function() {\n\t\t\tvar me = this;\n\t\t\tvar callbacks = me._options.callbacks;\n\n\t\t\tvar beforeFooter = callbacks.beforeFooter.apply(me, arguments);\n\t\t\tvar footer = callbacks.footer.apply(me, arguments);\n\t\t\tvar afterFooter = callbacks.afterFooter.apply(me, arguments);\n\n\t\t\tvar lines = [];\n\t\t\tlines = pushOrConcat(lines, beforeFooter);\n\t\t\tlines = pushOrConcat(lines, footer);\n\t\t\tlines = pushOrConcat(lines, afterFooter);\n\n\t\t\treturn lines;\n\t\t},\n\n\t\tupdate: function(changed) {\n\t\t\tvar me = this;\n\t\t\tvar opts = me._options;\n\n\t\t\t// Need to regenerate the model because its faster than using extend and it is necessary due to the optimization in Chart.Element.transition\n\t\t\t// that does _view = _model if ease === 1. ", "This causes the 2nd tooltip update to set properties in both the view and model at the same time\n\t\t\t// which breaks any animations.", "\n\t\t\tvar existingModel = me._model;\n\t\t\tvar model = me._model = getBaseModel(opts);\n\t\t\tvar active = me._active;\n\n\t\t\tvar data = me._data;\n\n\t\t\t// In the case where active.length === 0 we need to keep these at existing values for good animations\n\t\t\tvar alignment = {\n\t\t\t\txAlign: existingModel.xAlign,\n\t\t\t\tyAlign: existingModel.yAlign\n\t\t\t};\n\t\t\tvar backgroundPoint = {\n\t\t\t\tx: existingModel.x,\n\t\t\t\ty: existingModel.y\n\t\t\t};\n\t\t\tvar tooltipSize = {\n\t\t\t\twidth: existingModel.width,\n\t\t\t\theight: existingModel.height\n\t\t\t};\n\t\t\tvar tooltipPosition = {\n\t\t\t\tx: existingModel.caretX,\n\t\t\t\ty: existingModel.caretY\n\t\t\t};\n\n\t\t\tvar i, len;\n\n\t\t\tif (active.length) {\n\t\t\t\tmodel.opacity = 1;\n\n\t\t\t\tvar labelColors = [];\n\t\t\t\ttooltipPosition = Chart.", "Tooltip.positioners[opts.position](active, me._eventPosition);\n\n\t\t\t\tvar tooltipItems = [];\n\t\t\t\tfor (i = 0, len = active.length; i < len; ++i) {\n\t\t\t\t\ttooltipItems.push(createTooltipItem(active[i]));\n\t\t\t\t}\n\n\t\t\t\t// If the user provided a filter function, use it to modify the tooltip items\n\t\t\t\tif (opts.filter) {\n\t\t\t\t\ttooltipItems = tooltipItems.filter(function(a) {\n\t\t\t\t\t\treturn opts.filter(a, data);\n\t\t\t\t\t});\n\t\t\t\t}\n\n\t\t\t\t// If the user provided a sorting function, use it to modify the tooltip items\n\t\t\t\tif (opts.itemSort) {\n\t\t\t\t\ttooltipItems = tooltipItems.sort(function(a, b) {\n\t\t\t\t\t\treturn opts.itemSort(a, b, data);\n\t\t\t\t\t});\n\t\t\t\t}\n\n\t\t\t\t// Determine colors for boxes\n\t\t\t\thelpers.each(tooltipItems, function(tooltipItem) {\n\t\t\t\t\tlabelColors.push(opts.callbacks.labelColor.call(me, tooltipItem, me._chart));\n\t\t\t\t});\n\n\t\t\t\t// Build the Text Lines\n\t\t\t\tmodel.title = me.getTitle(tooltipItems, data);\n\t\t\t\tmodel.beforeBody = me.getBeforeBody(tooltipItems, data);\n\t\t\t\tmodel.body = me.getBody(tooltipItems, data);\n\t\t\t\tmodel.afterBody = me.getAfterBody(tooltipItems, data);\n\t\t\t\tmodel.footer = me.getFooter(tooltipItems, data);\n\n\t\t\t\t// Initial positioning and colors\n\t\t\t\tmodel.x = Math.round(tooltipPosition.x);\n\t\t\t\tmodel.y = Math.round(tooltipPosition.y);\n\t\t\t\tmodel.caretPadding = opts.caretPadding;\n\t\t\t\tmodel.labelColors = labelColors;\n\n\t\t\t\t// data points\n\t\t\t\tmodel.dataPoints = tooltipItems;\n\n\t\t\t\t// We need to determine alignment of the tooltip\n\t\t\t\ttooltipSize = getTooltipSize(this, model);\n\t\t\t\talignment = determineAlignment(this, tooltipSize);\n\t\t\t\t// Final Size and Position\n\t\t\t\tbackgroundPoint = getBackgroundPoint(model, tooltipSize, alignment);\n\t\t\t} else {\n\t\t\t\tmodel.opacity = 0;\n\t\t\t}\n\n\t\t\tmodel.xAlign = alignment.xAlign;\n\t\t\tmodel.yAlign = alignment.yAlign;\n\t\t\tmodel.x = backgroundPoint.x;\n\t\t\tmodel.y = backgroundPoint.y;\n\t\t\tmodel.width = tooltipSize.width;\n\t\t\tmodel.height = tooltipSize.height;\n\n\t\t\t// Point where the caret on the tooltip points to\n\t\t\tmodel.caretX = tooltipPosition.x;\n\t\t\tmodel.caretY = tooltipPosition.y;\n\n\t\t\tme._model = model;\n\n\t\t\tif (changed && opts.custom) {\n\t\t\t\topts.custom.call(me, model);\n\t\t\t}\n\n\t\t\treturn me;\n\t\t},\n\t\tdrawCaret: function(tooltipPoint, size) {\n\t\t\tvar ctx = this._chart.ctx;\n\t\t\tvar vm = this._view;\n\t\t\tvar caretPosition = this.getCaretPosition(tooltipPoint, size, vm);\n\n\t\t\tctx.lineTo(caretPosition.x1, caretPosition.y1);\n\t\t\tctx.lineTo(caretPosition.x2, caretPosition.y2);\n\t\t\tctx.lineTo(caretPosition.x3, caretPosition.y3);\n\t\t},\n\t\tgetCaretPosition: function(tooltipPoint, size, vm) {\n\t\t\tvar x1, x2, x3;\n\t\t\tvar y1, y2, y3;\n\t\t\tvar caretSize = vm.caretSize;\n\t\t\tvar cornerRadius = vm.cornerRadius;\n\t\t\tvar xAlign = vm.xAlign,\n\t\t\t\tyAlign = vm.yAlign;\n\t\t\tvar ptX = tooltipPoint.x,\n\t\t\t\tptY = tooltipPoint.y;\n\t\t\tvar width = size.width,\n\t\t\t\theight = size.height;\n\n\t\t\tif (yAlign === 'center') {\n\t\t\t\ty2 = ptY + (height / 2);\n\n\t\t\t\tif (xAlign === 'left') {\n\t\t\t\t\tx1 = ptX;\n\t\t\t\t\tx2 = x1 - caretSize;\n\t\t\t\t\tx3 = x1;\n\n\t\t\t\t\ty1 = y2 + caretSize;\n\t\t\t\t\ty3 = y2 - caretSize;\n\t\t\t\t} else {\n\t\t\t\t\tx1 = ptX + width;\n\t\t\t\t\tx2 = x1 + caretSize;\n\t\t\t\t\tx3 = x1;\n\n\t\t\t\t\ty1 = y2 - caretSize;\n\t\t\t\t\ty3 = y2 + caretSize;\n\t\t\t\t}\n\t\t\t} else {\n\t\t\t\tif (xAlign === 'left') {\n\t\t\t\t\tx2 = ptX + cornerRadius + (caretSize);\n\t\t\t\t\tx1 = x2 - caretSize;\n\t\t\t\t\tx3 = x2 + caretSize;\n\t\t\t\t} else if (xAlign === 'right') {\n\t\t\t\t\tx2 = ptX + width - cornerRadius - caretSize;\n\t\t\t\t\tx1 = x2 - caretSize;\n\t\t\t\t\tx3 = x2 + caretSize;\n\t\t\t\t} else {\n\t\t\t\t\tx2 = ptX + (width / 2);\n\t\t\t\t\tx1 = x2 - caretSize;\n\t\t\t\t\tx3 = x2 + caretSize;\n\t\t\t\t}\n\t\t\t\tif (yAlign === 'top') {\n\t\t\t\t\ty1 = ptY;\n\t\t\t\t\ty2 = y1 - caretSize;\n\t\t\t\t\ty3 = y1;\n\t\t\t\t} else {\n\t\t\t\t\ty1 = ptY + height;\n\t\t\t\t\ty2 = y1 + caretSize;\n\t\t\t\t\ty3 = y1;\n\t\t\t\t\t// invert drawing order\n\t\t\t\t\tvar tmp = x3;\n\t\t\t\t\tx3 = x1;\n\t\t\t\t\tx1 = tmp;\n\t\t\t\t}\n\t\t\t}\n\t\t\treturn {x1: x1, x2: x2, x3: x3, y1: y1, y2: y2, y3: y3};\n\t\t},\n\t\tdrawTitle: function(pt, vm, ctx, opacity) {\n\t\t\tvar title = vm.title;\n\n\t\t\tif (title.length) {\n\t\t\t\tctx.textAlign = vm._titleAlign;\n\t\t\t\tctx.textBaseline = 'top';\n\n\t\t\t\tvar titleFontSize = vm.titleFontSize,\n\t\t\t\t\ttitleSpacing = vm.titleSpacing;\n\n\t\t\t\tctx.fillStyle = mergeOpacity(vm.titleFontColor, opacity);\n\t\t\t\tctx.font = helpers.fontString(titleFontSize, vm._titleFontStyle, vm._titleFontFamily);\n\n\t\t\t\tvar i, len;\n\t\t\t\tfor (i = 0, len = title.length; i < len; ++i) {\n\t\t\t\t\tctx.fillText(title[i], pt.x, pt.y);\n\t\t\t\t\tpt.y += titleFontSize + titleSpacing; // Line Height and spacing\n\n\t\t\t\t\tif (i + 1 === title.length) {\n\t\t\t\t\t\tpt.y += vm.titleMarginBottom - titleSpacing; // If Last, add margin, remove spacing\n\t\t\t\t\t}\n\t\t\t\t}\n\t\t\t}\n\t\t},\n\t\tdrawBody: function(pt, vm, ctx, opacity) {\n\t\t\tvar bodyFontSize = vm.bodyFontSize;\n\t\t\tvar bodySpacing = vm.bodySpacing;\n\t\t\tvar body = vm.body;\n\n\t\t\tctx.textAlign = vm._bodyAlign;\n\t\t\tctx.textBaseline = 'top';\n\n\t\t\tvar textColor = mergeOpacity(vm.bodyFontColor, opacity);\n\t\t\tctx.fillStyle = textColor;\n\t\t\tctx.font = helpers.fontString(bodyFontSize, vm._bodyFontStyle, vm._bodyFontFamily);\n\n\t\t\t// Before Body\n\t\t\tvar xLinePadding = 0;\n\t\t\tvar fillLineOfText = function(line) {\n\t\t\t\tctx.fillText(line, pt.x + xLinePadding, pt.y);\n\t\t\t\tpt.y += bodyFontSize + bodySpacing;\n\t\t\t};\n\n\t\t\t// Before body lines\n\t\t\thelpers.each(vm.beforeBody, fillLineOfText);\n\n\t\t\tvar drawColorBoxes = vm.displayColors;\n\t\t\txLinePadding = drawColorBoxes ? (", "bodyFontSize + 2) : 0;\n\n\t\t\t// Draw body lines now\n\t\t\thelpers.each(body, function(bodyItem, i) {\n\t\t\t\thelpers.each(bodyItem.before, fillLineOfText);\n\n\t\t\t\thelpers.each(bodyItem.lines, function(line) {\n\t\t\t\t\t// Draw Legend-like boxes if needed\n\t\t\t\t\tif (drawColorBoxes) {\n\t\t\t\t\t\t// Fill a white rect so that colours merge nicely if the opacity is < 1\n\t\t\t\t\t\tctx.fillStyle = mergeOpacity(vm.legendColorBackground, opacity);\n\t\t\t\t\t\tctx.fillRect(pt.x, pt.y, bodyFontSize, bodyFontSize);\n\n\t\t\t\t\t\t// Border\n\t\t\t\t\t\tctx.strokeStyle = mergeOpacity(vm.labelColors[i].borderColor, opacity);\n\t\t\t\t\t\tctx.strokeRect(pt.x, pt.y, bodyFontSize, bodyFontSize);\n\n\t\t\t\t\t\t// Inner square\n\t\t\t\t\t\tctx.fillStyle = mergeOpacity(vm.labelColors[i].backgroundColor, opacity);\n\t\t\t\t\t\tctx.fillRect(pt.x + 1, pt.y + 1, bodyFontSize - 2, bodyFontSize - 2);\n\n\t\t\t\t\t\tctx.fillStyle = textColor;\n\t\t\t\t\t}\n\n\t\t\t\t\tfillLineOfText(line);\n\t\t\t\t});\n\n\t\t\t\thelpers.each(bodyItem.after, fillLineOfText);\n\t\t\t});\n\n\t\t\t// Reset back to 0 for after body\n\t\t\txLinePadding = 0;\n\n\t\t\t// After body lines\n\t\t\thelpers.each(vm.afterBody, fillLineOfText);\n\t\t\tpt.y -= bodySpacing; // Remove last body spacing\n\t\t},\n\t\tdrawFooter: function(pt, vm, ctx, opacity) {\n\t\t\tvar footer = vm.footer;\n\n\t\t\tif (footer.length) {\n\t\t\t\tpt.y += vm.footerMarginTop;\n\n\t\t\t\tctx.textAlign = vm._footerAlign;\n\t\t\t\tctx.textBaseline = 'top';\n\n\t\t\t\tctx.fillStyle = mergeOpacity(vm.footerFontColor, opacity);\n\t\t\t\tctx.font = helpers.fontString(vm.footerFontSize, vm._footerFontStyle, vm._footerFontFamily);\n\n\t\t\t\thelpers.each(footer, function(line) {\n\t\t\t\t\tctx.fillText(line, pt.x, pt.y);\n\t\t\t\t\tpt.y += vm.footerFontSize + vm.footerSpacing;\n\t\t\t\t});\n\t\t\t}\n\t\t},\n\t\tdrawBackground: function(pt, vm, ctx, tooltipSize, opacity) {\n\t\t\tctx.fillStyle = mergeOpacity(vm.backgroundColor, opacity);\n\t\t\tctx.strokeStyle = mergeOpacity(vm.borderColor, opacity);\n\t\t\tctx.lineWidth = vm.borderWidth;\n\t\t\tvar xAlign = vm.xAlign;\n\t\t\tvar yAlign = vm.yAlign;\n\t\t\tvar x = pt.x;\n\t\t\tvar y = pt.y;\n\t\t\tvar width = tooltipSize.width;\n\t\t\tvar height = tooltipSize.height;\n\t\t\tvar radius = vm.cornerRadius;\n\n\t\t\tctx.beginPath();\n\t\t\tctx.moveTo(x + radius, y);\n\t\t\tif (yAlign === 'top') {\n\t\t\t\tthis.drawCaret(pt, tooltipSize);\n\t\t\t}\n\t\t\tctx.lineTo(x + width - radius, y);\n\t\t\tctx.quadraticCurveTo(x + width, y, x + width, y + radius);\n\t\t\tif (yAlign === 'center' && xAlign === 'right') {\n\t\t\t\tthis.drawCaret(pt, tooltipSize);\n\t\t\t}\n\t\t\tctx.lineTo(x + width, y + height - radius);\n\t\t\tctx.quadraticCurveTo(x + width, y + height, x + width - radius, y + height);\n\t\t\tif (yAlign === 'bottom') {\n\t\t\t\tthis.drawCaret(pt, tooltipSize);\n\t\t\t}\n\t\t\tctx.lineTo(x + radius, y + height);\n\t\t\tctx.quadraticCurveTo(x, y + height, x, y + height - radius);\n\t\t\tif (yAlign === 'center' && xAlign === 'left') {\n\t\t\t\tthis.drawCaret(pt, tooltipSize);\n\t\t\t}\n\t\t\tctx.lineTo(x, y + radius);\n\t\t\tctx.quadraticCurveTo(x, y, x + radius, y);\n\t\t\tctx.closePath();\n\n\t\t\tctx.fill();\n\n\t\t\tif (vm.borderWidth > 0) {\n\t\t\t\tctx.stroke();\n\t\t\t}\n\t\t},\n\t\tdraw: function() {\n\t\t\tvar ctx = this._chart.ctx;\n\t\t\tvar vm = this._view;\n\n\t\t\tif (vm.opacity === 0) {\n\t\t\t\treturn;\n\t\t\t}\n\n\t\t\tvar tooltipSize = {\n\t\t\t\twidth: vm.width,\n\t\t\t\theight: vm.height\n\t\t\t};\n\t\t\tvar pt = {\n\t\t\t\tx: vm.x,\n\t\t\t\ty: vm.y\n\t\t\t};\n\n\t\t\t// IE11/Edge does not like very small opacities, so snap to 0\n\t\t\tvar opacity = Math.abs(vm.opacity < 1e-3) ? ", "0 : vm.opacity;\n\n\t\t\t// Truthy/falsey value for empty tooltip\n\t\t\tvar hasTooltipContent = vm.title.length || vm.beforeBody.length || vm.body.length || vm.afterBody.length || vm.footer.length;\n\n\t\t\tif (this._options.enabled && hasTooltipContent) {\n\t\t\t\t// Draw Background\n\t\t\t\tthis.drawBackground(pt, vm, ctx, tooltipSize, opacity);\n\n\t\t\t\t// Draw Title, Body, and Footer\n\t\t\t\tpt.x += vm.xPadding;\n\t\t\t\tpt.y += vm.yPadding;\n\n\t\t\t\t// Titles\n\t\t\t\tthis.drawTitle(pt, vm, ctx, opacity);\n\n\t\t\t\t// Body\n\t\t\t\tthis.drawBody(pt, vm, ctx, opacity);\n\n\t\t\t\t// Footer\n\t\t\t\tthis.drawFooter(pt, vm, ctx, opacity);\n\t\t\t}\n\t\t},\n\n\t\t/**\n\t\t * Handle an event\n\t\t * @private\n\t\t * @param {IEvent} event - The event to handle\n\t\t * @returns {Boolean} true if the tooltip changed\n\t\t */\n\t\thandleEvent: function(e) {\n\t\t\tvar me = this;\n\t\t\tvar options = me._options;\n\t\t\tvar changed = false;\n\n\t\t\tme._lastActive = me._lastActive || [];\n\n\t\t\t// Find Active Elements for tooltips\n\t\t\tif (e.type === 'mouseout') {\n\t\t\t\tme._active = [];\n\t\t\t} else {\n\t\t\t\tme._active = me._chart.getElementsAtEventForMode(e, options.mode, options);\n\t\t\t}\n\n\t\t\t// Remember Last Actives\n\t\t\tchanged = !", "helpers.arrayEquals(me._active, me._lastActive);\n\n\t\t\t// If tooltip didn't change, do not handle the target event\n\t\t\tif (!", "changed) {\n\t\t\t\treturn false;\n\t\t\t}\n\n\t\t\tme._lastActive = me._active;\n\n\t\t\tif (options.enabled || options.custom) {\n\t\t\t\tme._eventPosition = {\n\t\t\t\t\tx: e.x,\n\t\t\t\t\ty: e.y\n\t\t\t\t};\n\n\t\t\t\tvar model = me._model;\n\t\t\t\tme.update(true);\n\t\t\t\tme.pivot();\n\n\t\t\t\t// See if our tooltip position changed\n\t\t\t\tchanged |= (model.x !", "== me._model.x) || (model.y !", "== me._model.y);\n\t\t\t}\n\n\t\t\treturn changed;\n\t\t}\n\t});\n\n\t/**\n\t * @namespace Chart.Tooltip.positioners\n\t */\n\tChart.Tooltip.positioners = {\n\t\t/**\n\t\t * Average mode places the tooltip at the average position of the elements shown\n\t\t * @function Chart.Tooltip.positioners.average\n\t\t * @param elements {ChartElement[]} the elements being displayed in the tooltip\n\t\t * @returns {Point} tooltip position\n\t\t */\n\t\taverage: function(elements) {\n\t\t\tif (!", "elements.length) {\n\t\t\t\treturn false;\n\t\t\t}\n\n\t\t\tvar i, len;\n\t\t\tvar x = 0;\n\t\t\tvar y = 0;\n\t\t\tvar count = 0;\n\n\t\t\tfor (i = 0, len = elements.length; i < len; ++i) {\n\t\t\t\tvar el = elements[i];\n\t\t\t\tif (el && el.hasValue()) {\n\t\t\t\t\tvar pos = el.tooltipPosition();\n\t\t\t\t\tx += pos.x;\n\t\t\t\t\ty += pos.y;\n\t\t\t\t\t++count;\n\t\t\t\t}\n\t\t\t}\n\n\t\t\treturn {\n\t\t\t\tx: Math.round(x / count),\n\t\t\t\ty: Math.round(y / count)\n\t\t\t};\n\t\t},\n\n\t\t/**\n\t\t * Gets the tooltip position nearest of the item nearest to the event position\n\t\t * @function Chart.Tooltip.positioners.nearest\n\t\t * @param elements {Chart.", "Element[]} the tooltip elements\n\t\t * @param eventPosition {Point} the position of the event in canvas coordinates\n\t\t * @returns {Point} the tooltip position\n\t\t */\n\t\tnearest: function(elements, eventPosition) {\n\t\t\tvar x = eventPosition.x;\n\t\t\tvar y = eventPosition.y;\n\n\t\t\tvar nearestElement;\n\t\t\tvar minDistance = Number.", "POSITIVE_INFINITY;\n\t\t\tvar i, len;\n\t\t\tfor (i = 0, len = elements.length; i < len; ++i) {\n\t\t\t\tvar el = elements[i];\n\t\t\t\tif (el && el.hasValue()) {\n\t\t\t\t\tvar center = el.getCenterPoint();\n\t\t\t\t\tvar d = helpers.distanceBetweenPoints(eventPosition, center);\n\n\t\t\t\t\tif (d < minDistance) {\n\t\t\t\t\t\tminDistance = d;\n\t\t\t\t\t\tnearestElement = el;\n\t\t\t\t\t}\n\t\t\t\t}\n\t\t\t}\n\n\t\t\tif (nearestElement) {\n\t\t\t\tvar tp = nearestElement.tooltipPosition();\n\t\t\t\tx = tp.x;\n\t\t\t\ty = tp.y;\n\t\t\t}\n\n\t\t\treturn {\n\t\t\t\tx: x,\n\t\t\t\ty: y\n\t\t\t};\n\t\t}\n\t};\n};\n" ]

{ "pile_set_name": "Github" }

[ 0.0058823529411764705, 0.005213764337851929, 0.028169014084507043, 0.004137492043284532, 0, 0, 0, 0.007194244604316547, 0.007633587786259542, 0.004009163802978236, 0, 0, 0, 0, 0.0008764241893076249, 0.0025220680958385876, 0, 0, 0.0012547051442910915, 0, 0, 0.0012077294685990338, 0, 0.004178272980501393, 0.004567948229920061, 0.0036540803897685747, 0.004464285714285714, 0, 0.003289473684210526, 0, 0.009111617312072893, 0.008928571428571428, 0.006289308176100629, 0.003976143141153081 ]

[ "My postcards arrived today, a selection from New York - complete with a personalised note on each of them with tips and information - thanks so much!" ]

{ "pile_set_name": "OpenWebText2" }

[ 0 ]

[ "Q:\n\nИспользование LAN в приложениях\n\nЕсть несколько компов которые объединены одной локальной сетью через маршрутизатор. ", "Каждый из них должен отправлять данные на один комп. ", "Как минимум отправка запросов к БД, в идеале отправка обрабатываемых комманд.", "\nЯ хотел бы узнать как это реализовать в теории. ", "Но в примере: Клиенты C#. ", "Сервер обрабатывающий запросы на Python. ", "Примеры из java или c++ помогут толкнуться в нужном направлении, поэтому такая информация также будет полезна.", "\n\nA:\n\nПоищите по запросы Client Server app Python, Client Server app C#, вообще ваш вопрос очень общий, в каждом языке есть библиотеки для работы с сетью, в некоторых языках даже стандартная библиотека содержит такие методы. ", "Вам надо выбрать протокол tcp/udp, в зависимости от этого по разному будет устанавливаться соединение, точнее для udp оно не будет устанавливаться, а как вы по сети будете команды для исполнения передавать это уже сами придумайте) можете строчку которую надо выполнить передать и на принимающей стороне просто исполнить её.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.008264462809917356, 0.018867924528301886, 0, 0.02040816326530612, 0, 0, 0.00909090909090909, 0.022222222222222223, 0.009287925696594427, 0 ]

[ "Tell us what your cows eat, we'll tell you what you get\n\nThe idea of taking into account parameters such as the costs and benefits of a natural biological activator (live yeast) in formulation models is fairly new and sounds an exciting concept; as more research centres and companies follow suit, a new generation of models and formulation tools is emerging..." ]

{ "pile_set_name": "Pile-CC" }

[ 0 ]

[ "Q:\n\nValidation preventing refresh/restart - tkinter\n\nI've added validation to my tkinter entry widget to only allow numbers.", "I've added code which I thought would also allow an entry widget to be empty to enable my refresh and restart functions. ", "\nWhen the restart or refersh buttons are pressed I want both the entry widget and text area to be cleared. ", " Currently only the text area is clearing. ", " The numbers remain in the entry widget. ", " Suggested amendments to my code would be appreciated.", "\ndef __init__(self, parent, controller):\n tk.", "Frame.__init__(self, parent)\n self.controller = controller\n ...\n vcmd = (self.register(self.onValidate), '%S')\n self.weight_entry = tk.", "Entry(self, validate='key', vcmd = vcmd)\n self.weight_entry.pack(pady = 10)\n self.text = tk.", "Text(self)\n self.text.pack(pady = 10)\n self.text.config(state='disabled')\n Restart_button = tk.", "Button(self, text=\"Restart\", command=self.restart)\n Refresh_button = tk.", "Button(self, text=\"Refresh\", command=self.refresh)\n ...\n\n# Code below adds validation to the Entry widget so only numbers can be entered\ndef onValidate(self,s):\n if (self.weight_entry ==\"\"):\"\"\"Not sure if this is correct. ", " Taken from another answer on SO.\"\"\"", "\n return True\n if s in ['0','1','2', '3', '4', '5', '6', '7', '8', '9']: \n return True\n else:\n self.bell() # adds a sound effect to error\n self.text.delete(1.0, tk.", "END) # deletes the error message if valid entry provided\n return False\n\ndef restart(self):\n self.refresh()\n self.controller.show_frame(\"StartPage\")\n\ndef refresh(self):\n self.weight_entry.delete(0,tk.", "END)\n self.text.config(state='normal')\n self.text.delete(\"1.0\", \"end\")\n self.text.config(state='disabled')\n\nA:\n\nThe reason why you cannot delete the whole content of the entry is because in onValidate you expect s to be a single digit, but if your entry contains '123', when you call delete(0, \"end\"), then s = '123' so onValidate returns False. ", "\nTo solve this, you can do:\ndef onValidate(self, s):\n if s.isdigit(): # no need to test if the entry is empty because the deleted text contains only digits\n return True\n else:\n self.bell() # adds a sound effect to error\n self.text.delete(1.0, tk.", "END) # deletes the error message if valid entry provided\n return False\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0, 0, 0.020833333333333332, 0, 0.01020408163265306, 0, 0, 0, 0, 0.005050505050505051, 0.004651162790697674, 0.008450704225352112, 0.0036496350364963502, 0.012658227848101266 ]

[ "Q:\n\nWhat emergencies could justify a highly liquid emergency fund?", "\n\nI've seen several questions (e.g. here) that challenge the need for complete liquidity in an emergency fund. ", " Answers often focus not just on the potential for market downturns to affect your ability to liquidate assets, but even the 2-3 day delay in fund availability being a potential disaster. ", " However, I cannot think of any real-world situation in which this time sensitivity could actually be the case, and no answer that I've seen so far offers any examples.", "\nA year after my bankruptcy in my much younger days I was approved for a credit card with no annual fee and a $3,000 limit. ", " Within a year I was at $10,000. ", " So if someone with bad credit, only 2 years post-bankruptcy, can attain $10,000 in unsecured credit, I imagine most anyone can. ", " As such, home repairs, car repairs, medical expenses, and most anything else can be put on credit for up to 30 days with no interest, which is far longer than is needed to liquidate any kind of stock or mutual fund. ", " And beyond $10,000 also pushes the limits of 3-6 months of salary for many. ", " Yes, I'm assuming that anyone with enough forethought to use an emergency fund would also have their credit cards completely paid off.", "\nAssuming a credit card cannot be used, or for some reason cannot be attained, what sort of emergency requires payment up front for which 2-3 days processing of a stock sale would pose a problem? ", " Any home repairs and car repairs I've had done allow a few days for payment, or accept a personal check at the end of the job (which will often take 2-3 days). ", " All medical bills I've received appear after insurance has processed them, which can take 30 days or more. ", " Short of owing money to the mob, or a zombie apocalypse, what sort of emergency could require immediate liquidity of an emergency fund.", "\nFor the purposes of this question I wish to understand only the need for immediate liquidity. ", " Issues with market volatility are a separate discussion.", "\n\nA:\n\nI suppose this could really depend on the part of the world you're in, but there are still many instances of \"emergencies\" that need \"cash\". ", "You have to decide how much cash is the right amount, but I still recommend having $1,000 or so in liquid cash. ", "It can really make a huge difference. ", "Let me give a few examples. ", "\n\nBad weather. ", "I live in Florida and after a hurricane if you want gas, food, or water, you're going to need cash. ", "ATM networks are the last to get repaired. ", "Same for internet. ", "Cell services are not at the top of the list. ", "You could be 4-5 days without access to your accounts. ", "If you need anything in that time frame it's cash or the Red Cross.", "\nChildren. ", "As a foster parent we keep some cash on hand because as kids come in to our care we want to get them in school right away. ", "How are they going to eat? ", "You can't give them your plastic, you haven't had time to setup \"lunch accounts\" or the like. ", "Cash always works. ", "Along those same lines are bus tickets, clothes, supplies and what not. ", "Not everywhere will take an ATM card, and if your money is tied up in a stock then what are you supposed to do for 3 days? ", "Tell your new kid that he can't eat?", "\nBig Emergency problems. ", "Like your car breaks down on the interstate. ", "Sure it can get towed to the dealership, and yes they will add the tow to your bill, and sure you have a few days to pay it (while your car gets fixed), but how are you going to get around? ", "Not all taxis take plastic around here. ", " Almost none of the busses take plastic even though they are supposed to.", "\nLost Wallet or ID theft. ", "Lose your wallet, good luck getting into your bank accounts. ", "It can take weeks to establish your ID after you lose it in some cases. ", "You want your ID, but you need your birth certificate. ", "You have to GO to the state of birth and request it. ", "Oh but wait, to travel you need an ID. ", "No problem send away for it, but wait, you need to send them money to mail it. ", "To bad all your money is tied up. ", "\nRunning or Evacuating - So you need to evacuate for some reason. ", "No big deal. ", "But all your money is in a place you can't get to it. ", "How do you put gas in your car. ", "Lets stick with it and say you get to \"cash out\" an account of some kind. ", "Guess what, they're not going to mail it to some random address. ", "Now you're stuck fighting support centers to get them to understand that you need your funds delivered to New York even though you live in Florida. ", "\n\nIn short, you don't need $100,000 in liquid funds, but there are a few cases that you need something liquid.", "\nYou also make a lot of assumptions. ", "For example, not every one will have health insurance, or a heath problem that is covered by their insurance. ", "Some serious home repairs are \"down payment\" upfront. ", "Car problems like an accident that means you need a rental can totally be up front. ", "Especially if credit cards can't be used.", "\n\nA:\n\nYou are not wrong - just about anything can be charged and paid off in 30 days with a sale of non-liquid investments. ", " So there are not any emergencies I can think of that require completely liquid funds (cash).", "\nFor me, the risks are more behavioral than financial:\n\nWhat if you decide to keep your investments because you think they will earn more than the interest you're paying on the card?", "\nWhat if the market is in a down cycle - will you be so quick to sell those investments knowing that they're worth less that they could be?", "\nYou might spend more when you float the bill than when using cash. ", " If you need a new washer/dryer - are you going to bargain shop to stay within a set budget, or just find the fanciest model and charge it (maybe applying for the store's credit card to get 0% for 6 months)? ", "Granted, that doesn't work in all situations, but it might make you get a second opinion on a car repair, or try to negotiate with the doctor/hospital to get a cash discount.", "\n\nI'm not saying it's a ridiculous, stupid idea, and these are all \"what-if\"s that can be countered with discipline and wise decisions, but having an emergency fund in cash certainly makes all of this simpler and reduces risk.", "\nIf you have investments that you would have no hesitation liquidating to cover an emergency, then you can make it work. ", " For most people, the choice is either paying cash, or charging it without having investment funds to pay it off, and they're back in the cycle of paying minimum payments for months and drowning in debt.", "\n\nA:\n\nWeather events and aging infrastructure. ", " Cash will buy gasoline, food and water when there is no power or telephone connectivity to process ATMs and credit cards.", "\n\nHurricane Katrina\nSuperstorm Sandy power outages lasted for weeks, \nIf contractors dredge the power cable to the island. ", " \n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.023255813953488372, 0, 0, 0, 0.014925373134328358, 0, 0, 0, 0, 0, 0, 0.008130081300813009, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00819672131147541, 0, 0 ]

[ "Piano della Lenta\n\nPiano della Lenta is a neighborhood of Teramo, Italy. ", "It extends to the north of the city center along the State Highway 80 (SS 80), the main road to Ascoli Piceno. ", " It is located about three kilometers from the Teramo city center and has the characteristic of being a mere extension of the city itself.", "\n\nOverview\nThe area's name, \"Piano della Lenta\" (Plain of Leisure) probably derives from a number of inns and wineries which once dotted the landscape. ", " They served as a welcome stopping off point fortravelers who journeyed from the Teramo city center to the surrounding villages and towns.", "\n\nPiano della Lenta boasts a number of interesting attractions including five man (calcetto) and eleven man (calcio) soccer fields, two bocce ball sporting areas, a small amphitheater, a remote control miniature car raceway, and four public garden parks. ", " A good portion of this development took place in the 1970s and 1980s, today making the area one of the most tranquil and convenient locations in the city of Teramo. ", " The neighborhood is almost entirely residential and has a population of more than 3000 residents.", "\nPiano della Lenta hosts a highly ranked soccer club with a very strong youth division.", "\n\nThe local parish church, completed in 1933 is dedicated to Saint Rita. ", " It is located in Piazza Gemma Marconi reachable by means of Via Ignazio Silone, the main street crossing through this area. ", " Another important street, Via Insorti Bosco Marterse, passes nearby.", "\n\nAlthough Piano della Lenta has been only recently developed, this specific location is noted in several historical documents:\nin 926 the land making up Piano della Lenta was deeded by Count Manfredi to the Bishop of Teramo.", "\nthe area is mentioned both in a 1056 Papal Decree by Pope Victor II.", "\nthe historian Niccola Palma wrote of a local castle going by the name of \"De Le Vetiche.\" ", " It served both as a quotidian mercantile trading center as well as a place of refuge during times of war. ", " No traces exist today although ruins of the castle were still being unearthed as late as the early 19th century.", "\na stone epigraph depicting a masculine torso with Roman inscriptions was recovered in the area. ", " This was likely part of the castle at one time and has since been moved to the Archaeological Museum in nearby Chieti.", "\n\nSee also\nTeramo\nColleparco\nCona\nGammarana\n\nCategory:Neighborhoods of Teramo" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0136986301369863, 0.02702702702702703, 0, 0, 0, 0.00392156862745098, 0.006024096385542169, 0, 0.011494252873563218, 0, 0.016, 0.014492753623188406, 0.02654867256637168, 0.014492753623188406, 0.01098901098901099, 0, 0, 0, 0.01680672268907563, 0.05194805194805195 ]

[ "Q:\n\nPosition center not top left corner of an image in css\n\nIs it possible to position center not top left corner of an image in CSS?", "\nI have an image that has other images on top of it (a map with points). ", "The background image has a fixed size and I have set the location of the images that are on the top with css: \n#map {\n width: 700px;\n height: 700px;\n margin: auto;\n position: relative;\n}\n.point {\n position: absolute;\n left: 39.9%;\n top: 81.9%;\n z-index: 1;\n}\n\nthe size of the point is 20x20px so I subtracted 10px from the necessary location and then converted to %. ", "Everything looks as it should. ", "\nI am trying to make the code work for smaller screens. ", "I changed the width and height to max-width and max-height. ", "Now the background adapts to the smaller screen, but because of those 20px I calculated in the position of the point, the smaller the screen gets, the further from the needed location the point goes.", "\nThe only solution I could think of was if I could set the position of points center with %, not the top left corner. ", "Would it be possible? ", "Is there a better way?", "\n\nA:\n\nleft: calc(50% - 10px);\ntop: calc(50% - 10px);\n\nOr \nleft: 50%; margin-left: -10px;\ntop: 50%; margin-top: -10px;\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.007518796992481203, 0, 0, 0, 0, 0.016666666666666666, 0, 0, 0, 0, 0.01680672268907563 ]

[ "If you wonder where the famous film actor and producer Sir Stanley Baker traveled in during his glory days, here it is: a beautiful state-of-the-art, ultra-exclusive Rolls-Royce Phantom VI Limousine by Mulliner Park Ward. ", "The car was delivered new on February 4, 1969 by P.J. Evans Ltd, Birmingham. ", "No more than 374 copies of them were built between 1968 and 1991. ", "But only one of them has been in possession of the Welsh movie star. ", "This is the one.", "\n\nExterior\n\nThe history tells us too that the Rolls-Royce has been silver in the past. ", "The former owner, who bought the Phantom in North Wales in 2000, decided to completely repaint the classic limousine 10 years ago. ", "And changed the body color into chic dark blue. ", "We can fully understand why: no exterior color that suits the Rolls as good as this one.", "The extremely royal coachwork (built in London by Mulliner Park Ward) and elegant shape of the Phantom VI matches perfectly to the dark tint. ", "Moreover, various chrome parts, including the prominent front grille, contrast gorgeously with the rest of the bodywork. ", "If we have to put it all together in one word? ", "Magnificent.", "\n\nInterior\n\nReason number two to change the color is the completely original interior. ", "After all, the inside is provided with blue leather upholstery and blue carpets: beautifully in line with the outside of the British top-class limo. ", "The roof is gray, referring to the original exterior color.", "Furthermore, the entire RR-inner gives a feeling of immense luxury and eternal style. ", "With lots of wood, extraordinary finishes, high quality materials and of course more space than you could ever dream of. ", "Besides, what is a Rolls without exceptional features such as a Wine Cabinet? ", "An option you will not find in today’s brochures. ", "Lap Diagonal Safety Belts on both front seats point out that Sir Stanley Baker liked his driver a lot. ", "Or he must have got behind the steering wheel himself…\n\nTechnology\n\nWe can imagine that he did so, looking at the outstanding condition of this unique car. ", "The 6.2 liter V8 is one of the finest engines in automotive history, so it’s not quite a punishment to drive it your own. ", "The automatic transmission is the pinnacle of suppleness too. ", "The Phantom floats over the asphalt like a flying carpet. ", "Really everything is focused on maximum comfort.", "Number VI of the legendary model is the last generation with a separate chassis. ", "This makes the car even more special. ", "The technique has recently been revised and fully prepared. ", "That’s how the classy limo gives you the same exceptional feeling while driving it as the time he transported a movie star. ", "Do you think you can play a main role in the (hi)story of this iconic Briton? ", "If you do, you’re very welcome to visit our Classics showroom in the Netherlands. ", "The pleasure will be all ours..." ]

{ "pile_set_name": "Pile-CC" }

[ 0.009009009009009009, 0.012987012987012988, 0, 0.014492753623188406, 0, 0.011494252873563218, 0.007633587786259542, 0, 0, 0.007042253521126761, 0, 0, 0, 0, 0, 0, 0, 0, 0.01282051282051282, 0, 0.009708737864077669, 0, 0, 0, 0.017241379310344827, 0, 0.012345679012345678, 0, 0, 0, 0.01282051282051282, 0, 0 ]

[ "// Code generated by private/model/cli/gen-api/main.go. ", "DO NOT EDIT.", "\n\npackage cloudwatchlogs\n\nimport (\n\t\"github.com/aws/aws-sdk-go/aws\"\n\t\"github.com/aws/aws-sdk-go/aws/client\"\n\t\"github.com/aws/aws-sdk-go/aws/client/metadata\"\n\t\"github.com/aws/aws-sdk-go/aws/request\"\n\t\"github.com/aws/aws-sdk-go/aws/signer/v4\"\n\t\"github.com/aws/aws-sdk-go/private/protocol/jsonrpc\"\n)\n\n// CloudWatchLogs provides the API operation methods for making requests to\n// Amazon CloudWatch Logs. ", "See this package's package overview docs\n// for details on the service.", "\n//\n// CloudWatchLogs methods are safe to use concurrently. ", "It is not safe to\n// modify mutate any of the struct's properties though.", "\ntype CloudWatchLogs struct {\n\t*client.", "Client\n}\n\n// Used for custom client initialization logic\nvar initClient func(*client.", "Client)\n\n// Used for custom request initialization logic\nvar initRequest func(*request.", "Request)\n\n// Service information constants\nconst (\n\tServiceName = \"logs\" // Service endpoint prefix API calls made to.", "\n\tEndpointsID = ServiceName // Service ID for Regions and Endpoints metadata.", "\n)\n\n// New creates a new instance of the CloudWatchLogs client with a session.", "\n// If additional configuration is needed for the client instance use the optional\n// aws.", "Config parameter to add your extra config.", "\n//\n// Example:\n// // Create a CloudWatchLogs client from just a session.", "\n// svc := cloudwatchlogs.", "New(mySession)\n//\n// // Create a CloudWatchLogs client with additional configuration\n// svc := cloudwatchlogs.", "New(mySession, aws.", "NewConfig().WithRegion(\"us-west-2\"))\nfunc New(p client.", "ConfigProvider, cfgs ...*aws.", "Config) *CloudWatchLogs {\n\tc := p.ClientConfig(EndpointsID, cfgs...)\n\treturn newClient(*c.", "Config, c.Handlers, c.Endpoint, c.SigningRegion, c.SigningName)\n}\n\n// newClient creates, initializes and returns a new service client instance.", "\nfunc newClient(cfg aws.", "Config, handlers request.", "Handlers, endpoint, signingRegion, signingName string) *CloudWatchLogs {\n\tsvc := &CloudWatchLogs{\n\t\tClient: client.", "New(\n\t\t\tcfg,\n\t\t\tmetadata.", "ClientInfo{\n\t\t\t\tServiceName: ServiceName,\n\t\t\t\tSigningName: signingName,\n\t\t\t\tSigningRegion: signingRegion,\n\t\t\t\tEndpoint: endpoint,\n\t\t\t\tAPIVersion: \"2014-03-28\",\n\t\t\t\tJSONVersion: \"1.1\",\n\t\t\t\tTargetPrefix: \"Logs_20140328\",\n\t\t\t},\n\t\t\thandlers,\n\t\t),\n\t}\n\n\t// Handlers\n\tsvc.", "Handlers.", "Sign.", "PushBackNamed(v4.SignRequestHandler)\n\tsvc.", "Handlers.", "Build.", "PushBackNamed(jsonrpc.", "BuildHandler)\n\tsvc.", "Handlers.", "Unmarshal.", "PushBackNamed(jsonrpc.", "UnmarshalHandler)\n\tsvc.", "Handlers.", "UnmarshalMeta.", "PushBackNamed(jsonrpc.", "UnmarshalMetaHandler)\n\tsvc.", "Handlers.", "UnmarshalError.", "PushBackNamed(jsonrpc.", "UnmarshalErrorHandler)\n\n\t// Run custom client initialization if present\n\tif initClient !", "= nil {\n\t\tinitClient(svc.", "Client)\n\t}\n\n\treturn svc\n}\n\n// newRequest creates a new request for a CloudWatchLogs operation and runs any\n// custom request initialization.", "\nfunc (c *CloudWatchLogs) newRequest(op *request.", "Operation, params, data interface{}) *request.", "Request {\n\treq := c.NewRequest(op, params, data)\n\n\t// Run custom request initialization if present\n\tif initRequest !", "= nil {\n\t\tinitRequest(req)\n\t}\n\n\treturn req\n}\n" ]

{ "pile_set_name": "Github" }

[ 0, 0, 0.004987531172069825, 0, 0, 0, 0, 0, 0, 0.008130081300813009, 0, 0, 0, 0.023809523809523808, 0, 0, 0, 0, 0, 0.034482758620689655, 0.011111111111111112, 0.03496503496503497, 0.041666666666666664, 0.04, 0, 0.08, 0.0035714285714285713, 0, 0, 0, 0, 0, 0, 0.05263157894736842, 0, 0, 0, 0.043478260869565216, 0, 0.07142857142857142, 0, 0, 0, 0, 0, 0.011363636363636364, 0, 0.007142857142857143, 0, 0, 0.008620689655172414, 0 ]

[ "'use strict';\nangular.module(\"ngLocale\", [], [\"$provide\", function($provide) {\nvar PLURAL_CATEGORY = {ZERO: \"zero\", ONE: \"one\", TWO: \"two\", FEW: \"few\", MANY: \"many\", OTHER: \"other\"};\nfunction getDecimals(n) {\n n = n + '';\n var i = n.indexOf('.');", "\n return (i == -1) ? ", "0 : n.length - i - 1;\n}\n\nfunction getVF(n, opt_precision) {\n var v = opt_precision;\n\n if (undefined === v) {\n v = Math.min(getDecimals(n), 3);\n }\n\n var base = Math.pow(10, v);\n var f = ((n * base) | 0) % base;\n return {v: v, f: f};\n}\n\n$provide.value(\"$locale\", {\n \"DATETIME_FORMATS\": {\n \"AMPMS\": [\n \"vorm.\",", "\n \"nachm.\"", "\n ],\n \"DAY\": [\n \"Sonntag\",\n \"Montag\",\n \"Dienstag\",\n \"Mittwoch\",\n \"Donnerstag\",\n \"Freitag\",\n \"Samstag\"\n ],\n \"ERANAMES\": [\n \"v. Chr.\",", "\n \"n. Chr.\"", "\n ],\n \"ERAS\": [\n \"v. Chr.\",", "\n \"n. Chr.\"", "\n ],\n \"FIRSTDAYOFWEEK\": 0,\n \"MONTH\": [\n \"Januar\",\n \"Februar\",\n \"M\\u00e4rz\",\n \"April\",\n \"Mai\",\n \"Juni\",\n \"Juli\",\n \"August\",\n \"September\",\n \"Oktober\",\n \"November\",\n \"Dezember\"\n ],\n \"SHORTDAY\": [\n \"So.\",", "\n \"Mo.\",\n \"Di.\",", "\n \"Mi.\",", "\n \"Do.\",", "\n \"Fr.\",", "\n \"Sa.\"", "\n ],\n \"SHORTMONTH\": [\n \"Jan.\",\n \"Feb.\",\n \"M\\u00e4rz\",\n \"Apr.\",\n \"Mai\",\n \"Juni\",\n \"Juli\",\n \"Aug.\",\n \"Sep.\",\n \"Okt.\",", "\n \"Nov.\",\n \"Dez.\"", "\n ],\n \"WEEKENDRANGE\": [\n 5,\n 6\n ],\n \"fullDate\": \"EEEE, d. MMMM y\",\n \"longDate\": \"d. MMMM y\",\n \"medium\": \"dd.", "MM.y HH:mm:ss\",\n \"mediumDate\": \"dd.", "MM.y\",\n \"mediumTime\": \"HH:mm:ss\",\n \"short\": \"dd.MM.yy HH:mm\",\n \"shortDate\": \"dd.MM.yy\",\n \"shortTime\": \"HH:mm\"\n },\n \"NUMBER_FORMATS\": {\n \"CURRENCY_SYM\": \"\\u20ac\",\n \"DECIMAL_SEP\": \",\",\n \"GROUP_SEP\": \".\",", "\n \"PATTERNS\": [\n {\n \"gSize\": 3,\n \"lgSize\": 3,\n \"maxFrac\": 3,\n \"minFrac\": 0,\n \"minInt\": 1,\n \"negPre\": \"-\",\n \"negSuf\": \"\",\n \"posPre\": \"\",\n \"posSuf\": \"\"\n },\n {\n \"gSize\": 3,\n \"lgSize\": 3,\n \"maxFrac\": 2,\n \"minFrac\": 2,\n \"minInt\": 1,\n \"negPre\": \"-\",\n \"negSuf\": \"\\u00a0\\u00a4\",\n \"posPre\": \"\",\n \"posSuf\": \"\\u00a0\\u00a4\"\n }\n ]\n },\n \"id\": \"de-be\",\n \"pluralCat\": function(n, opt_precision) { var i = n | 0; var vf = getVF(n, opt_precision); if (i == 1 && vf.v == 0) { return PLURAL_CATEGORY.ONE; } return PLURAL_CATEGORY.OTHER;}\n});\n}]);\n" ]

{ "pile_set_name": "Github" }

[ 0, 0.045454545454545456, 0.003076923076923077, 0.06666666666666667, 0.005434782608695652, 0, 0.02631578947368421, 0, 0.0035714285714285713, 0, 0, 0, 0, 0, 0.005847953216374269, 0, 0.007352941176470588, 0.05263157894736842, 0.017857142857142856, 0.002898550724637681 ]

[ "THIS DAY IN HISTORY\n\nMISSING CLASSMATES\n\nKnow the email address of a missing Classmate? ", "Click here to contact them!", "\n\nJOINED CLASSMATES\n\nPercentage of Joined Classmates: 43.0%\n\nA:\n\n126\n\nJoined\n\nB:\n\n167\n\nNot Joined\n\nWelcome to the Pattonville - Class of 1964 Website\n\n50 Years!!!!!!!!!!!", "\n\nThe Class of 1964 celebrated our 50th Reunion on Saturday, September 6, 2014. ", "The day before was almost 95 degrees and sweltering, Saturday temperature barely made it into the low 70's (welcome to St. Louis weather). ", "Turnout for this event was better than expected, and, everyone had a good time visiting and reconnecting. ", "The surest sign we are getting older: large amounts of food, water, soda, and beer remained at the end of the day!", "\n\nPrincipal James. ", "C. McMahon recorded a greeting to our class - to view it click \"Mr. McMahon's Greeting\" tab on the top of this page. ", "Mr. McMahon lives in Wisconsin with his son, Tom. ", "His eye sight is failing, and he is 90 years old. ", "On September 6, 1944, Mr. McMahon was wounded while serving our country in the Army during World War II, seventy years ago.", "\n\nEffforts to consolidate the many 100's of digital photo's taken at the reunion will take some time - especially to \"tag\" everyone in the photo's, so bear with us a while.", "\n\nClick on the \"50th Reunion Photos\" tab at the top of this page to see photos contributed by classmates for all to enjoy!", "\n\nIf you would like to contribute your photo's to the class collection for all classmates to enjoy, please contact Don Kimmel (314-703-8400) or email don_kimmel@sbcglobal.net.", "\n\nThanks to everyone that made it such a great day by your attendance and enthusiasm. ", "Understandably, some classmates were unable to attend - for a variety of reasons. ", "Maybe next time (5 years out).", "\n\nHow much does it cost to join this website?", "\n\nRecent Obituaries: click on \"In Memory\" tab for details\n\nSonny Hartman - August 2014\n\nPhyllis Meierarend Schillinger - August 2013\n\nBill Sanders - January 2013\n\nJohn Durrwachter - November 2012\n\nRodger Daft - February, 2012\n\nRichard Hinds - January, 2012\n\nLinda Ross - May 2011\n\nGary Jamison - December, 2011\n\nIf you attended the reunion and wish to submit digital photo's to share with classmates - please click on the \"Contact Us\" tab at the top of this page and provide details on where the photos are stored and we will include them on this website.", "\n\nPlease click on tab marked \"46th Reunion Photos\" on the left of this page to view a slide show of photos submitted by classmates and Tim Stroop taken at the reunion, September 4, 2010.", "\n\nOther options to view and download photos to your computer will also be available on that tab.", "\n\nIf you have lost or misplaced your 1964 yearbook, we have added a new tab on the left side of this main page: click on \"The Class of 1964\" then click on the highlighted link to go to the Flickr website where the senior photo's are stored:\n\nMore yearbook photo's will be added as new tabs in the near future so come back & visit often." ]

{ "pile_set_name": "Pile-CC" }

[ 0.011363636363636364, 0, 0, 0, 0, 0, 0, 0, 0.017094017094017096, 0.04, 0, 0.016260162601626018, 0, 0, 0.017142857142857144, 0, 0, 0, 0, 0.010810810810810811, 0.005376344086021506, 0, 0.002976190476190476 ]

[ "<%\n from pwnlib import shellcraft\n from pwnlib.util.packing import flat, unpack\n from pwnlib.util.iters import group\n%>\n<%page args=\"value, register1='x14', register2='x15'\"/>\n<%docstring>\nPushes a value onto the stack without using null bytes or newline characters.", "\n\nIf src is a string, then we try to evaluate using :func:`pwnlib.constants.eval`\nbefore determining how to push it.", "\n\nNote that this means that this shellcode can change behavior depending on\nthe value of `context.os`.", "\n\nNote:\n AArch64 requires that the stack remain 16-byte aligned at all times,\n so this alignment is preserved.", "\n\nArgs:\n value(int,str): The value or register to push\n register1(str): Scratch register to use\n register2(str): Second scratch register to use\n\nExample:\n\n >>> print(pwnlib.shellcraft.push(0).rstrip())\n /* push 0 */\n mov x14, xzr\n str x14, [sp, #-16]!", "\n >>> print(pwnlib.shellcraft.push(1).rstrip())\n /* push 1 */\n mov x14, #1\n str x14, [sp, #-16]!", "\n >>> print(pwnlib.shellcraft.push(256).rstrip())\n /* push 0x100 */\n mov x14, #256\n str x14, [sp, #-16]!", "\n >>> print(pwnlib.shellcraft.push('SYS_execve').rstrip())\n /* push SYS_execve (0xdd) */\n mov x14, #221\n str x14, [sp, #-16]!", "\n >>> print(pwnlib.shellcraft.push('SYS_sendfile').rstrip())\n /* push SYS_sendfile (0x47) */\n mov x14, #71\n str x14, [sp, #-16]!", "\n >>> with context.local(os = 'freebsd'):\n ... print(pwnlib.shellcraft.push('SYS_execve').rstrip())\n ...\n /* push SYS_execve (0x3b) */\n mov x14, #59\n str x14, [sp, #-16]!", "\n</%docstring>\n<%\nif isinstance(value, str):\n value = shellcraft.eval(value)\npretty = shellcraft.pretty(value, comment=False)\n%>\n ${shellcraft.pushstr(flat(value),\n append_null = False,\n register1 = register1,\n register2 = register2,\n pretty = pretty)}\n" ]

{ "pile_set_name": "Github" }

[ 0.0036363636363636364, 0, 0, 0, 0.007017543859649123, 0, 0, 0, 0, 0.004878048780487805, 0.005633802816901409 ]

[ "Lamborghini Aventador S Review: The Last True Supercar?", "\n\nWe talk a lot about supercars being useable these days, don’t we? ", "The McLaren 720S has a weirdly sublime ride and great all-round visibility. ", "The Audi R8 feels just like a TT until you start poking its 5.2-litre V10 with a stick. ", "The 911 GT3 RS is one of the most hardcore things Porsche makes, and yet you could quite easily daily it.", "\n\nAs the Aventador S smashes over a manhole cover you wouldn’t even feel in other cars and then lurches into second gear, it occurs to me that Lamborghini did not get the everyday supercar memo. ", "Not when developing this car, anyway.", "If you ever get to drive one of these, for the love of god, don’t clock your first miles in it while negotiating a cramped London industrial estate at rush hour. ", "If you do, you’ll be in for a whole world of hurt.", "\n\nThe ride is the firmest of any road car I’ve ever encountered. ", "The robotised manual gearbox makes a meal out of every shift, and the clutch awkwardly drops in when you’re doing anything remotely resembling a hill start. ", "I’m struggling to see out as I manoeuvre around this concrete-clad part of the capital, made worse by the fact the tiny pieces of glass you’re given to peer out of are now steaming up.", "\n\nNormally, you’d just wind the windows down and then up to clear the condensation and hit the front screen demist button, but that’s not easy in an Aventador, as nothing is quite where you expect it to be. ", "There are buttons splattered around everywhere, and even the indicator and wiper stalks aren’t in the usual place - they poke down at around 4 and 8 o’clock.", "\n\nJust as I think the ride can’t get any worse, I have to raise the nose using the hydraulic lift function to avoid turning the front splitter into shards of broken plastic, which makes it feel like the front dampers have been replaced with rusty pogo sticks.", "\n\nYou might think that the noise would make up for this, but no - below 3000rpm the Aventador S sounds more like whirring industrial machinery. ", "It’s not until you reach that 3000 mark that a flap opens in the exhaust and you can, at last, hear that 6.5-litre naturally-aspirated V12. ", "But there’s far too much traffic for that to happen. ", "Oh, and my back is starting to hurt, as the seat padding is woefully inadequate.", "\n\nThe Aventador is a car that makes the kind of everyday driving we take for granted seem like an arduous task. ", "A few hours on, though, I’m far from North West London industrial misery and have the Peak District unfolding in front of the car’s perilously low nose. ", "At least I think it is - it’s raining. ", "And foggy. ", "Ah.", "\n\nRegardless, I find myself switching from Strada to the more hardcore Corsa mode. ", "Now, the dampers are at their firmest, the engine at its angriest, and the ESP in a less intrusive ‘sport’ setting. ", "After experimenting with ever greater throttle inputs, I’m happy that the traction is substantial enough that dialling down the electronic aids won’t result in being spat off into one of those dry stone walls that line the roads around here. ", "They’re a little sturdier than Forza Horizon 4, would you believe.", "\n\n\"Going fast in an Aventador is like having a fight. ", "A fight you can’t be sure you’re winning\"\n\nThe common complaint I hear about these cars is that they understeer, but I’m not feeling a whiff of it right now. ", "Just absolute neutrality, with savage changes of direction possible with a flick of steering wheel. ", "A lot of that is going to be down to the all-wheel steering system, and the aggressive all-wheel drive system, which sends even more to the rear than before. ", "It makes for an absurdly darty front-end.", "\n\nThis theme is carried through all aspects of the driving experience, because going fast in an Aventador is like having a fight. ", "A fight you can’t be sure you’re winning. ", "The ESP system seems to have an argument with itself as it decides how much of the V12’s 730 brake horsepowers to inflict on the wheels. ", "The fast and very heavy steering kicks back brutally at times. ", "And the only thing interrupting the scrambling of your insides caused by the full rage of the engine is the gearbox.", "\n\nI moaned about it earlier, but finally now I’m at full throttle and leaving the shifts until the 8500rpm redline, it makes sense. ", "Any other time it’s clunky as hell, but right now the seven-speed sequential ‘box is banging home each gear with racecar-like aggression and effectiveness. ", "Every shift thunders through my body.", "\n\nAs the age of big, multi-cylindered, naturally-aspirated engines draws to a close, this 6.5 serves as an extremely potent swansong. ", "The word is the V12 will be allowed to live on thanks to electrification, but this might be the last time we see it in this thrilling state of purity.", "\n\nThere’s a relentlessness to it every time you fully open the throttle, and yes, the sound - once you’re above 3000rpm and the exhaust flaps are open - is deliriously good. ", "It’s a toss up between this and the current Ferrari V12 for best exhaust noise, and I’m not sure I can pick a winner - there’s a huge distinction between the two, and each delights the ears in different ways. ", "While the Ferrari screams, the Lamborghini howls.", "\n\nAnd then, of course, we have to talk about the way it looks. ", "The classic supercar wedge shape, it’s a feast of bold lines and angry vents, and it all looks superb in this Diablo SE30-style purple. ", "Driving the Aventador is like a public service: wherever you go, people both young and old adore this car.", "\n\nAs the light starts to draw in and I trundle through a surprisingly busy village, I can hear a commotion. ", "Dozens of tiny shouts and whoops coming from just behind the car. ", "Then I realise, I’m passing a school, and the kids are going absolutely nuts over the sight and sound of this purple vision of madness. ", "I then, of course, pull both paddles to put it in neutral and give it a few revs, causing an even greater ruckus. ", "Perhaps we need a few more Aventadors on the road to guarantee the next generation of petrolheads.", "\n\nAs a national speed limit sign and a suitably squiggly piece of tarmac looms into view, it’s time for one last blast before the less-than-comfortable cruise home. ", "And it’s bucket list-spec stuff. ", "Partly because the way the Aventador S feels when driven hard is made all the more satisfying as pottering around at normal speeds is so arduous. ", "You feel like you’ve earned the joyous, visceral experience when you do actually have space to open the taps a little.", "\n\n\"Driving the Aventador S at any speed is - for good and bad - a proper, memorable experience\"\n\nAll of this makes me wonder if manufacturers are going the right way by making supercars you can do your daily commute in. ", "Shouldn’t you have to work for that performance? ", "Don’t you want reminding that the mid-engined monster living on your driveway isn’t a Ford Focus, even when you’re driving around normally?", "\n\nWhen I gazed upon the cars adorning my bedroom walls as a kid - the likes of the Ferrari F40, Mclaren F1 and yes, the Diablo - I couldn’t care less what they’d be like while bimbling down to shops to get a pint of milk. ", "I wanted to know how hard they’d pin you back in your seat. ", "How it would sound having many cylinders exploding just behind your ears. ", "How different it would feel to the tatty Peugeot 405 diesel my dad drove back then.", "\n\nIt’s here that the Aventador S differentiates itself from all supercars but the exotic, ultra-limited multi-million quid stuff from companies like Koenigsegg and Pagani. ", "Driving it at any speed is - for good and bad - a proper, memorable experience. ", "It feels otherworldly. ", "Set apart from all other cars." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0.011363636363636364, 0.009523809523809525, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007142857142857143, 0, 0, 0.008928571428571428, 0, 0, 0, 0, 0, 0, 0, 0.015151515151515152, 0, 0, 0, 0, 0, 0, 0, 0.0072992700729927005, 0.015873015873015872, 0, 0, 0, 0, 0, 0.006666666666666667, 0, 0, 0.04081632653061224, 0, 0.007352941176470588, 0.009433962264150943, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007194244604316547, 0.0045045045045045045, 0, 0, 0, 0.011627906976744186, 0, 0, 0 ]

[ "OK, I know it isn't kosher, but what is the shiur? ", "And do we hold \"chetzi shiur assur min haTorah\"?", "\nFor an application, what if you get a cut while hiking in the woods; is it assur to clean the wound with your mouth? (", "am I absolutely disgusting to even think to do this? ", "It seems quite natural...)\n\nWhat about if you bite your tongue or cheek; are you required to soak up the blood with a napkin until it stops bleeding? ", "Spit out any blood you might taste?", "\n\nI also received an answer from a doctor, who said that saliva was actually very bad for cleaning a wound, as it could introduce all sorts of bacteria. ", "So I will certainly stop that practice!", "\n–\nJeremyJun 1 '10 at 13:23\n\nI'm pretty sure it is kosher. ", "Why do you assume the other way?", "\n–\nDouble AA♦Dec 14 '11 at 23:41\n\nHuman blood is prohibited because of Maris Ayin, it is not even strictly speaking a \"Rabbinic prohibition\". ", "As such there is, I believe, no concept of tam k'ikkar (the taste is like the forbidden substance). ", "As such while it is prohibited to eat bread which has blood from one's gums on it, such blood would not impart a forbidden taste to utensils. (", "Shulchan Aruch, Yoreh Deah 66:10)\"\n\nAs mentioned, blood from one's gums isn't a problem unless it leaves one's mouth in which case it looks like one is eating blood and is prohibited due to ma'aris ayin.", "\n\nSince tam/taste is not the issue it is possible that it is not a problem to suck blood from a wound when once spits it out immediately. ", "Obviously if there is a real sakana it is permitted. ", "I'll try to find sources that deal with it more directly.", "\n\nIt is interesting to note the discussion as to the kosher status of human flesh. ", "The Torah Ladaat has an article on this on parashat shemini. ", "He brings the Rambam (perek 2 of maachalot assurot, halacha 3):\n\nThe Ritva and the Ran (Ketuvot 60a) agree with the above ruling as does the Rama (יו''ד ס' עט:א). ", "Raavad, Tosafot, Rosh, Ramban, Rashbah disagree, that there isn't an עשה prohibition מדאורייתא (unsourced in Torah Ladaat).", "\n\nThe Torah Ladaat then describes the subsequent question of human derivatives e.g. blood and breast milk. ", "He says that even according to those who permit it there is a mitzvah of 'prisha' and it is considered an abomination to eat it. ", "He then sites the Pri Hadash who disagrees in the aspect of prisha, but I am unsure whether this refers only to breast milk, or human blood as well (didn't look up that source)." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0.020833333333333332, 0, 0, 0, 0, 0, 0, 0, 0, 0.007042253521126761, 0, 0, 0.009852216748768473, 0, 0, 0, 0, 0, 0, 0.032520325203252036, 0, 0, 0.005649717514124294 ]

[ "The present invention relates to a process for isolating enantiomer components from a mixture of enantiomers, as well as to separating a racemate into its enantiomeric components. ", "Separated, single enantiomers are extremely important in certain fields of use, since they contain desired properties whereas their enantiomer pair may contain undesirable properties.", "\nIsolation of enantiomers from a mixture of enantiomers is typically difficult because the enantiomers generally have identical physical properties, such as melting and boiling points, or other such properties typically used for separation. ", "Moreover they tend to crystallize as racemic crystals rather than as a conglomerate consisting of a mixture of pure enantiomer crystals which would be separable by preferential crystallization. ", "Thus, a common way today to obtain enantiomers is not through isolating individual enantiomers from a mixture, but rather through asymmetric synthesis of the enantiomer.", "\nTechniques for isolating enantiomers in use today include various embodiments of chromatography, such as simulated moving bed chromatography (SMB). ", "Chromatography-based methods, however, to date are not capable of isolating some enantiomers and/or cannot isolate some enantiomers economically in commercial quantities.", "\nVarious crystallization methods have also been proposed for separating enantiomers from a mixture, including preferential crystallization, co-crystallization and emulsion-crystallization. ", "C.f. ", "EP 0 548 028 A1; WO 97/32644; EP 0 838 448 A1; U.S. Pat. ", "No. ", "5,898,075. ", "While these methods overcome many of the shortcomings in crystallization, they also have some shortcomings. ", "Preferential crystallization works only with racemates forming conglomerates. ", "Furthermore, it is difficult to conduct with many conglomerates, since the systems tolerate only a small degree of super-saturation before spontaneous nucleation of the unwanted isomer occurs.", "\nIn co-crystallization, the yields of the enantiomer to be isolated and its co-crystallization agent are often poor ( less than 95%), and it is normally difficult to recover the other enantiomer of the mixture in pure form. ", "Furthermore, it can be difficult to identify a suitable co-crystallization agent that is inexpensive and readily accessible, and which enables crystallization of the desired enantiomer in high yield. ", "Through emulsion crystallization some racemates forming racemic crystals (i.e. conglomerates and especially racemic compounds; see R. A. Sheldon, Chirotechnology, Marcel Dekker, Inc. 1993 (p. 174) for general definitions of terminology) can be separated, however the majority of the racemic crystals forming racemates cannot be separated even by normal emulsion crystallization.", "\nIt has now been found that the aforementioned problem can be avoided through the use of two co-crystallization agents which selectively form co-crystals with the (R) and (S) enantiomers of a mixture of enantiomers. ", "The co-crystals so-formed can then be readily isolated and subsequently treated to yield the desired enantiomers.", "\nIn a second aspect of the invention, one or more enantiomers can be isolated from a mixture of enantiomers through co-crystallization from an emulsion. ", "Use of an emulsion lends additional benefits characteristic of emulsion crystallization to the present invention.", "\nThe present invention provides a process for isolating enantiomer components from a mixture of enantiomers through co-crystallization comprising the steps of (a) forming a solution comprising the mixture of enantiomers (R) and (S) and co-crystallization agents C1 and C2, wherein C1 and C2 are chiral or achiral, with the proviso that at least one of C1 and C2 is chiral and C1 and C2 do not form an enantiomeric pair, whereby C1 forms a co-crystal with (R) and C2 forms a co-crystal with (S); (b) super-saturating the solution in C1*(R) and C2 *(S); (c) inducing crystallization of co-crystals of C1*(R) and C2*(S); and (d) isolating the C1*(R) co-crystals and C2*(S) co-crystals.", "\nA second aspect of the present invention provides a process for isolating one or more enantiomers from a mixture of enantiomers through co-crystallization from an emulsion comprising the steps of (a) forming an emulsion of organic liquid droplets in a continuous water phase, which emulsion contains the mixture of enantiomers and a co-crystallization agent for each enantiomer to be isolated, wherein the co-crystallization agents are chiral or achiral, with the proviso that at least one co-crystallization agent is chiral, whereby the co-crystallization agent forms a co-crystal with its corresponding enantiomer; (b) super-saturating the emulsion in (co-crystallization agent) *(enantiomer); (c) inducing crystallization of co-crystals of (co-crystallization agent) *(enantiomer), whereby crystallization takes place in the water phase; and (d) isolating the co-crystals of (co-crystallization agent) *(enantiomer).", "\nCrystallization processes are known and need not be described in detail here. ", "Their basic premise is that a solution is formed containing the desired substance, the solution is supersaturated by conventional techniques such as cooling of the solution, and then crystallization of the desired substance is induced, either spontaneously or by seeding with seed crystals of the desired substance. ", "The present extends this technology through the judicious choice of co-crystallization agents which will form co-crystals with the enantiomers of a mixture of enantiomers. ", "The solution accordingly contains the enantiomers and the co-crystallization agents, is super-saturated, and then crystallization of co-crystals of the enantiomers and co-crystallization agents is induced.", "\nCo-crystals of the co-crystallization agents and the enantiomers are indicated in the present invention according to the convention xe2x80x98(co-crystallization agent) *(enantiomer)xe2x80x99. ", "In a typical embodiment of the invention, two co-crystallization agents, C1 and C2, will be employed. ", "They will, accordingly, selectively form co-crystals with the (R) and (S) enantiomers of the mixture of enantiomers, as indicated by xe2x80x98C1*(R)xe2x80x99 and xe2x80x98C2*(S)xe2x80x99. ", "All stoichiometries are intended to be covered with this nomenclature, i.e., xe2x80x98C1*(R)xe2x80x99 should be understood to include 1 C1*(R); 2 C1*(R); 1 C1*2(R); 2 C1*3(R); etc.", "\n(R) and (S) may be present in the enantiomeric mixture in any ratio, including a 50/50 ratio, i.e. as a racemate. ", "The mixture may comprise more than one pair of (R) and (S) enantiomers. ", "The enantiomers can be bases in which case the co-crystallization agents typically will be acids. ", "Or, the enantiomers can be acids in which case the co-crystallization agents typically will be bases. ", "Bases will typically be amines. ", "Alternatively, the enantiomers and/or co-crystallization agents can be neutral co-crystal-forming compounds.", "\nThe enantiomers can be pharmaceutical or agrochemical substances, fragrances, food additives, chemical intermediates or the like.", "\nCo-crystallization agents are compounds that selectively form co-crystals with the (R) and (S) enantiomers. ", "Co-crystallization agents may be either chiral or achiral, though at least one of them must be chiral. ", "Preferably, both are chiral. ", "Co-crystallization agents can not form an enantiomeric pair as this could lead to formation of a racemic co-crystal consisting of C1*C2*R*S.\nAn exception to the limitations on the co-crystallization agents applies to the case of co-crystallization from an emulsion (later described). ", "In this case, the process of the present invention can be carried out using one co-crystallization agent to isolate a single enantiomer (R) or (S) from the mixture of enantiomers. ", "The co-crystallization agent must be chiral. ", "Where two co-crystallization agents are used to isolate both enantiomers, the co-crystallization agents can be chiral or achiral, with the proviso that at least one is chiral. ", "In the case both are chiral they can form an enantiomeric pair. ", "Typically, however, the conditions of the previous paragraph will also apply to emulsion crystallization.", "\nThe co-crystallization agents used in the present invention are preferably chosen according to the following guidelines:\nCo-crystals C1*(R) and C2*(S) should be less soluble than all other crystals that may form (e.g. C1*(R)*(S); (R)*(S); C1*C2*(R)*(S); etc), under the conditions at which crystallization takes place. ", "In the case of emulsion crystallization, however, their solubilities can be somewhat higher than those of other crystals, since control over what crystallizes is possible through seeding with the desired co-crystal (see also further discussion on emulsion crystallization);\nConcentrations of the co-crystallization agents and crystallization conditions are selected such that C1*(R) and C2*(S) can either be 1) alternately co-crystallized according to preferential crystallization: or (especially in the case of emulsion crystallization) 2) simultaneously crystallized, when differences in crystal size or shape between C1*(R) and C2*(S) allow separation by sieving or sedimentation;\nAt least one of the co-crystallization agents is chiral.", "\nIn addition, C1 and C2 may each comprise a family of two or more co-crystallization agents. ", "Each member of the family typically have a common base structure. ", "The features defined above for C1 and C2 will apply to each member of the family.", "\nInducing crystallization (step (c)) can be carried out either by seeding with co-crystals of (co-crystallization agent)*(enantiomer) (i.e. C1*(R), C2*(S) etc.) ", "or can occur without seeding (i.e. by spontaneous crystallization). ", "Seeding can be carried out consecutively or (especially in the case of emulsion crystallization) simultaneously. ", "In the case of consecutive seeding, the solution is first seeded with co-crystals of C1*(R) to induce crystallization of C1*(R) co-crystals, which co-crystals are then isolated from solution, and then the solution is seeded with co-crystals of C2*(S) to induce crystallization of C2*(S) co-crystals, which co-crystals are then isolated from solution. ", "Or, this order of seeding can be reversed.", "\nIn the case of simultaneous seeding, differences in crystal size or shape between C1*(R) and C2*(S) allow their separation by sieving or sedimentation.", "\nPrior to seeding, it is desirable that the super-saturated solution (or emulsion) contains no seed crystals of substances apart from those that are intended to be seeded. ", "Any seeds present can be dissolved by ultrasound or heating, with such dissolving of seeds hereinafter referred to as xe2x80x9chomogenisationxe2x80x9d.", "\nIn a preferred embodiment of the invention, significant improvements in yields can be obtained if the crystallization process of the present invention is carried out with recycle of solution (or emulsion). ", "This necessitates, in effect, that the solution (or emulsion) is replenished with the mixture of enantiomers and co-crystallization agents and then steps (a)-(d) are repeated. ", "The order in which replenishing with the mixture of enantiomers and co-crystallization agents and steps (a)-(d) are repeated can vary. ", "The mixture of enantiomers and co-crystallization agents can be replenished together, in a single step, following step (d). ", "Or, the mixture of enantiomers and co-crystallization agents can be replenished after isolation of C1*(R) co-crystals and again after isolation of C2*(S) co-crystals. ", "Other sequences are possible, as will be known to one skilled in the art.", "\nRecycle can be applied to a variation of the second aspect of the present invention which brings about particular advantages. ", "In this variation, both enantiomers are isolated from the mixture using two separate emulsions: a first emulsion is formed for super-saturating, inducing crystallization and isolating co-crystals of the first enantiomer and a second emulsion is formed for super-saturating, inducing crystallization and isolating co-crystals of the second enantiomer in steps (b), (c) and (d) of the process. ", "Then, following isolation of co-crystals in step (d), a further step (e) is employed wherein the left-over first emulsion is recycled for use as the second emulsion and the left-over second emulsion is recycled for use as the first emulsion in step (a).", "\nBy carrying out a recycle, several advantages are obtained. ", "The co-crystallization agents, which are often costly, can be re-used. ", "The process can be carried out continuously. ", "Yield of co-crystal after each crystallization step need not be as high as is required in classical (non-emulsion) co-crystallization (where only one enantiomer is recovered by co-crystallization with a chiral co-crystallization agent), whereas overall yield with recycle can be significantly higher. ", "This enables the use of a variety of co-crystallization agents in the present invention, which in turn enables a wide range of mixtures of enantiomers to be resolved economically. ", "Also, the present process isolates both enantiomers, whereas classical co-crystallization only one. ", "The xe2x80x98otherxe2x80x99 enantiomer can have value as an intermediate, as a co-crystallization agent for another separation process or to racemize it into the xe2x80x98desiredxe2x80x99 enantiomer in a separate step. ", "Racemization in the crystallization solution is an often employed process. ", "However, the racemization conditions are restricted to those possible in the given crystallization solvent, in the presence of the desired enantiomer and its co-crystallization agent, and the like.", "\nThe desired enantiomer can be isolated from the co-crystallization agent using standard techniques, such as extraction of a co-crystallizing acid by an alkaline solution or vice versa.", "\nParticular advantages are gained if the crystallization is carried out from an emulsion. ", "Emulsions allow, for example, crystallization at constant, low temperature with little or no spontaneous nucleation, extreme super-saturation, slow crystal growth, very regular crystal shapes, narrow distribution of crystal size and high purities.", "\nEmulsions also facilitate the possibility of simultaneous seeding of co-crystals. ", "Accordingly, the solution can be (in a preferred embodiment is) seeded in step (c) simultaneously with seed co-crystals of C1*(R) and C2*(S), and the isolation of step (d) is carried out by separating co-crystals of C1*(R) from co-crystals of C2*(S) by sieving or sedimentation\nEmulsion crystallization can be used to isolate one or more enantiomers from the mixture of enantioners.", "\nEmulsions are, by definition, xe2x80x9cdropletsxe2x80x9d dispersed in a xe2x80x9ccontinuous phasexe2x80x9d. ", "In the present invention, the droplets are organic liquid droplets and the continuous phase is a water phase. ", "The emulsion optionally contains additives such as surfactants and dispersants, known in the art, for assisting formation and stabilization of the emulsion, and for facilitating the transport of the co-crystallization agent and/or enantiomer out of the organic liquid droplets and into the water phase, where crystallization takes place on a crystal surface (i.e. either the seed crystal or spontaneously formed crystal). ", "Such surfactants and/or dispersants will be chosen according to the nature of the emulsion, and can be nonionic, anionic and/or cationic. ", "The surface active agent will normally be present in an amount of 0.01-30 w/w % , preferably 0.1-20 w/w %.", "\nThe droplets typically vary in diameter from approximately 0.05 to 80 xcexcm. ", "Droplets with diameter in the range of 0.3 to 80 xcexcm are known as xe2x80x9cmacrodropletsxe2x80x9d, and the emulsions as xe2x80x9cmacroemulsionsxe2x80x9d. ", "Droplets with diameter in the range of 0.05 to 0.3 xcexcm are known as xe2x80x9cmicrodropletsxe2x80x9d, and the emulsions as xe2x80x9cmicroemulsionsxe2x80x9d. ", "For the sake of simplicity, the terms xe2x80x9cdropletsxe2x80x9d and xe2x80x9cemulsionsxe2x80x9d as used herein also encompass both macro- and microdroplets and macro- and microemulsions.", "\nThe organic liquid phase of the droplet will be water insoluble. ", "xe2x80x98Water insolublexe2x80x99 in this context means anything less than water miscible, though in most cases the organic liquid phase will mix with water in an amount not more than 30% w/w at the temperature at which crystallisation takes place.", "\nIn the emulsion of the present invention, at least one of the co-crystallization agents or enantiomers will be present primarily in the organic liquid droplets of the emulsion. ", "xe2x80x98Primarilyxe2x80x99 means in this sense its concentration in the organic liquid droplets is at least 20% higher than in the water phase (the relative solubility can e.g. be determined at least approximately in the absence of the tenside, determining the equilibrium distribution).", "\nThe water may further contain a buffering agent, such as sodium acetate and acetic acid, for maintaining pH of the emulsion at a desired level, antifreezing agents and solubility adjusting agents, as is known in the art.", "\nEmulsions according to the invention can be formed using techniques known in the art. ", "A suitable example for carrying out the invention, which is not intended to limit the cope of the present invention in any way, is as follows (Synperonic NP10 is a nonlyphenol surfactant, ethoxylated with 10 mol ethyleneoxide, ICI PLC, England; Soprophor FL is a tristyrylphenol derivative, Rhodia, France):" ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0, 0, 0, 0.006711409395973154, 0, 0, 0, 0.017543859649122806, 0, 0, 0, 0, 0, 0, 0, 0.007936507936507936, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.010638297872340425, 0.005555555555555556, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.005681818181818182, 0.007407407407407408, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0045662100456621, 0, 0, 0, 0, 0, 0, 0, 0.009174311926605505, 0, 0, 0, 0, 0, 0, 0, 0.0053475935828877, 0, 0, 0, 0.003472222222222222, 0, 0, 0.006514657980456026 ]

[ "Q:\n\nGoogle Maps Spiderfy open by default\n\nLooking to utlize the spiderfy which George MacKerron has developed. ", "However I have one other requirement which is to load the map with all markers \"spiderd\" out by default. ", "I can mimic this by using javascript to click on the markers, but there has to be another way by using the spiderfy code. ", "Has anyone accomplished this? ", "\nhttps://github.com/jawj/OverlappingMarkerSpiderfier#overlapping-marker-spiderfier-for-google-maps-api-v3\nvar map = new google.maps.", "Map(document.getElementById(\"map-canvas\"), options);\nvar iw = new google.maps.", "InfoWindow();\nvar oms = new OverlappingMarkerSpiderfier(map, {keepSpiderfied: true});\n\nhttp://jsfiddle.net/vFAy6/5/\n\nA:\n\nI came up with a solution that worked for me. ", "After I've added all markers, I set a timeout to call a functiont to open each cluster and in the OMS js.", "\n\nkeepSpiderfied keeps all spideried markers open. ", "It wasn't working for me so I altered the OMS js. ", "If it works for you, you don't need to change this.", "\n\nFind this:\n(!", "e||!this.keepSpiderfied)&&this.unspiderfy();\n\nReplace with this:\n(!", "e||!this.keepSpiderfied);\n\nfunction to call to open each cluster group:\nfunction openAllClusters() {\n var markers = oms.markersNearAnyOtherMarker();\n\n $.each(markers, function (i, marker) {\n google.maps.event.trigger(markers[i], 'click');\n });\n}\n\nI set a timeout after I added my last marker (because it didn't work just calling the function immediately after):\nsetTimeout(openAllClusters, 2000);\n\nA:\n\nAccording to the developer of this google map extension this will not work. ", "\nhttps://github.com/jawj/OverlappingMarkerSpiderfier/issues/2\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.009009009009009009, 0, 0, 0, 0.007575757575757576, 0, 0.005988023952095809, 0.009523809523809525, 0, 0.02, 0, 0, 0, 0.0020242914979757085, 0.015873015873015872 ]

[ "Q:\n\ngrep with regex in pre-commit git hook\n\nI'm writing a little pre-commit hook to check for debug code this works well when using:\nFORBIDDEN='console.log'\n\nbut when I change to:\nFORBIDDEN='die(|console.log(|print_r('\n\nit fails to catch anything.", "\nFULL CODE:\nFILES_PATTERN='(\\..+)?$'\nFORBIDDEN='die(|console.log(|print_r('\n\ngit diff --cached --name-only | \\\n grep -E $FILES_PATTERN | \\\n xargs grep -E --with-filename -n $FORBIDDEN | \\\n grep -v '//';\n\nNot sure if its regex or something else\n\nA:\n\nTry escaping your parenthesis:\nFORBIDDEN='die\\(|console.log\\(|print_r\\('\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0 ]

[ "Sherry Blakley\n\nSherry King Blakley-Vaughn, also known as Sherry Hinkle (March 16, 1962 – February 13, 2011) was an American stock car racing driver. ", "She competed in NASCAR Goody's Dash Series races during the 1980s and 1990s.", "\n\nCareer\nA native of San Antonio, Texas, Blakley made her debut in racing at age 16 at local tracks in central Texas, following having been a cheerleader at Texas Military Institute. ", "She raced in the All Pro Series and Goody's Dash Series starting in the mid-1980s, becoming best known for a controversial sponsorship deal with Ramses prophylactics in 1994. ", "She attempted to qualify for the Snowball Derby in 1990 and 1991, but failed to make the field for either race; she attempted to race in the Busch Series in 1994, but failed to qualify for any races, crashing in qualifying at Charlotte Motor Speedway.", "\n\nMarried to Jeff Blakely and with one son, Blakley died on February 13, 2011.", "\n\nMotorsports career results\n\nNASCAR \n(key) (Bold – Pole position awarded by qualifying time. ", "Italics – Pole position earned by points standings or practice time. *", " – Most laps led.)", "\n\nBusch Series\n\nReferences\n\nExternal links \n \n\nCategory:1962 births\nCategory:2011 deaths\nCategory:Sportspeople from San Antonio\nCategory:Racing drivers from Texas\nCategory:NASCAR drivers\nCategory:American female racing drivers\nCategory:20th-century American racing drivers" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.02, 0.013157894736842105, 0.01639344262295082, 0.011428571428571429, 0.00796812749003984, 0.02564102564102564, 0.010638297872340425, 0, 0, 0 ]

[ "Q:\n\nSimple Questionnaire Array Program\n\nI want to create a simple questionnaire program - there will be five questions and 4 answers each. ", "Everything time it is run the questions and answers order will be random.", "\nEx:\n1st run:\n\nWhat is fruit colored red?", "\na. Apple b.Pineapple\nc. Orange d. Pear\nWhat shape has 3 sides?", "\na. Square b. Circle\nc. Triangle d. octagon\n\n2nd run:\n\nWhat shape has 3 sides?", "\na. Octagon b. Square\nc. Circle d. Triangle\nWhat is fruit colored red?", "\na. Orange b. Apple\nc. Pear d. Pineapple\n\n--EDIT-- Here is the draft code I have made based on the suggestions:\npublic static void main(String[] args) {\n Scanner input = new Scanner (System.in);\n Random rand = new Random();\n\n ArrayList<ArrayList<String>> arrList = new ArrayList<ArrayList<String>>();\n ArrayList<String> question = new ArrayList<String>();\n ArrayList<String> choiceShuffle = new ArrayList<String>();\n ArrayList<String> choice1 = new ArrayList<String>();\n ArrayList<String> choice2 = new ArrayList<String>();\n ArrayList<String> choice3 = new ArrayList<String>();\n\n int numQuestion = 3;\n int randomNum = rand.nextInt(numQuestion);\n int score = 0;\n String questionShuffle;\n questionShuffle = question.get(randomNum);\n choiceShuffle = arrList.get(randomNum);\n\n question.add(\"What is after a?\");", "\n question.add(\"What is after b?\");", "\n question.add(\"What is after c?\");", "\n\n choice1.add(\"a\"); choice1.add(\"b\"); choice1.add(\"c\");\n choice2.add(\"d\"); choice2.add(\"c\"); choice2.add(\"e\");\n choice3.add(\"d\"); choice3.add(\"a\"); choice3.add(\"b\");\n\n arrList.add(choice1);\n arrList.add(choice2);\n arrList.add(choice3);\n\n for (int x = 1; x <= question.size(); x++){\n System.out.print(question.get(randomNum));\n Collections.shuffle(choiceShuffle);\n System.out.println(choiceShuffle);\n }\n}\n\n}\nWhere am I going wrong here? ", "and also I would like to create a variable named \"score\" that whenever the right answer is chosen, it will initiate score++. ", "Open for suggestions.", "\n\nA:\n\nyou can use the Random class available in Java for random number generation.", "\n\nRandom rand = new Random();\nint randomNum = rand.nextInt((max - min) + 1) + min;\n\nhere max will be your number of questions and in your particular case you can set min to 0, you can use Swing classes to design your GUI. ", "Most IDEs like NetBeans/Eclipse have provisions to create GUI without writing explicit code. ", "Now depending on your random number you can access the question[rand]. ", "You can implement your questions and answers as arraylists and access your questions as question[rand]. ", "You can shuffle your corresponding answers list using\n\nCollections.shuffle(answerList);\n\nEdit: Here's a sample code for your reference:\n\nimport java.util.", "ArrayList; import java.util.", "Iterator; import\n java.util.", "Random; import java.util.", "Collections;\npublic class JavaApplication1 {\npublic static void main(String[] args) {\n /** * Create ArrayList in ArrayList Object */\nArrayList<ArrayList<String>> quesAns = new ArrayList<ArrayList<String>>();\nArrayList<String> answer = new ArrayList<String>();\nArrayList<String> question = new ArrayList<String>();\nquestion.add(\"what's your fruit?\");", "\nquestion.add(\"what's your shape?\");", "\nanswer.add(\"apple\");\nanswer.add(\"banana\");\nanswer.add(\"mango\");\nquesAns.add(answer);\nArrayList<String> answer2 = new ArrayList<String>();\nanswer2.add(\"circle\");\nanswer2.add(\"rectangle\");\nquesAns.add(answer2);\nRandom rand = new Random();\nnumQues = 2\nint randomNum = rand.nextInt(numQues);\nSystem.out.println (question.get(randomNum));\nArrayList<String> answerListShuffle = new ArrayList<String>();\nanswerListShuffle = quesAns.get(randomNum);\nCollections.shuffle(answerListShuffle);\nSystem.out.println(answerListShuffle);\n\n}\n\n}\n\nThis is just an example implementation. ", "You can make up these arrayllists and add elements as you go inside your loops depending on the number of elements\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0.031746031746031744, 0.02564102564102564, 0.02857142857142857, 0.01645123384253819, 0, 0, 0.004149377593360996, 0, 0, 0.012195121951219513, 0.013513513513513514, 0.021505376344086023, 0, 0, 0.006493506493506494, 0.03571428571428571, 0.03333333333333333, 0, 0.016901408450704224, 0, 0.00528169014084507, 0 ]

[ "Determination of layer-specific mechanical properties of human coronary arteries with nonatherosclerotic intimal thickening and related constitutive modeling.", "\nAt autopsy, 13 nonstenotic human left anterior descending coronary arteries [71.5 +/- 7.3 (mean +/- SD) yr old] were harvested, and related anamnesis was documented. ", "Preconditioned prepared strips (n = 78) of segments from the midregion of the left anterior descending coronary artery from the individual layers in axial and circumferential directions were subjected to cyclic quasi-static uniaxial tension tests, and ultimate tensile stresses and stretches were documented. ", "The ratio of outer diameter to total wall thickness was 0.189 +/- 0.014; ratios of adventitia, media, and intima thickness to total wall thickness were 0.4 +/- 0.03, 0.36 +/- 0.03, and 0.27 +/- 0.02, respectively; axial in situ stretch of 1.044 +/- 0.06 decreased with age. ", "Stress-stretch responses for the individual tissues showed pronounced mechanical heterogeneity. ", "The intima is the stiffest layer over the whole deformation domain, whereas the media in the longitudinal direction is the softest. ", "All specimens exhibited small hysteresis and anisotropic and strong nonlinear behavior in both loading directions. ", "The media and intima showed similar ultimate tensile stresses, which are on average three times smaller than ultimate tensile stresses in the adventitia (1,430 +/- 604 kPa circumferential and 1,300 +/- 692 kPa longitudinal). ", "The ultimate tensile stretches are similar for all tissue layers. ", "A recently proposed constitutive model was extended and used to represent the deformation behavior for each tissue type over the entire loading range. ", "The study showed the need to model nonstenotic human coronary arteries with nonatherosclerotic intimal thickening as a composite structure composed of three solid mechanically relevant layers with different mechanical properties. ", "The intima showed significant thickness, load-bearing capacity, and mechanical strength compared with the media and adventitia." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Stepan's Remembrance\n\nStepan's Remembrance () is a 1977 Soviet fantasy film directed by Konstantin Yershov. ", "It is an adaptation of Pavel Bazhov's stories based on the Ural region Russian folklore. ", "The stories were published The Malachite Box collection in 1939.", "\n\nProduction \nThe film director Konstantin Yershov wanted to change the traditional approach to the fairy tales adaptations. ", "He felt that he did not need to create a magic spectacle, but rather to make a film which would be realistic at heart. ", "He was interested in the characters, life and traditions of the Serfdom era.", "\n\nPlot \nThe film loosely follows the plot of Bazhov's folk tale The Mistress of the Copper Mountain. ", "A skilled miner Stepan meets the green-eyed Mistress of the Copper Mountain, the Malachite Lady. ", "Stepan is disrespectful towards her, calling her \"wench\", but she appreciates his bravery. ", "She orders him to relay her words to the bailiff Severyan Nazarovich: \"The Mistress of the Copper Mountain orders you, ye stinking goat, to get out of Krasnogorka\". ", "She promises to marry Stepan if he does so. ", "The bailiff is enraged at the miner's impudence. ", "Stepan is flogged, sent to a mine face and fed only dog food. ", "The Mistress visits him and releases him from the mine. ", "She shows him many treasures and the image of his daughter, although Stepan has no daughter and not even married yet. ", "The Mistress says that her real name is Kseniya, and proposes marriage once again. ", "Stepan honestly replies that he already promised to marry another girl, Nastya. ", "The Malachite Lady is upset, but she likes his fidelity and bravery. ", "She promises to solve his troubles with the bailiff and rewards him with a present for his bride, a malachite casket filled with jewellery. ", "She warns him against ever thinking about her. ", "The bailiff soon dies and Stepan is freed from his Master. ", "He marries Nastya, but still has visions of the Malachite Lady and often sees small lizards, her servants. ", "The Mistress continues watching over his family. ", "Stepan's wife Nastya gives birth to a daughter Tanyushka and a son Melesha. ", "The green-eyed Tanyushka likes lizards and gemstones. ", "Stepan starts going to the copper mine to see the Mistress of the Copper Mountain. ", "Sometimes Tanyushka joins them too. ", "One day, watching them, Stepan shoots himself in the chest, but survives. ", "He does not speak to the Malachite Lady again.", "\n\nThe second part of the film is based on The Malachite Casket. ", "Years pass, Stepan gets older. ", "He is especially close with his daughter, calling her \"his remembrance\". ", "She is a beauty, and a lot of men are infatuated with her, including the new bailiff Parfyon Semyonovich. ", "One day Stepan mentions his dream of seeing the malachite room at the imperial palace. ", "He asks his wife to wear the jewellery from the Malachite Casket, but Tanyushka puts them on instead. ", "She claims that they \"warm her up\", as if she is sitting by the fire. ", "After Stepan's death, a young noble man Vasily Turchaninov, the owner of the mines' son, falls in love with Tanyushka. ", "He asks for Nastya's permission to marry her daughter. ", "Tanyushka claims that she is unsure of his feelings and announces that she will agree to the marriage if he shows her the malachite room at the imperial palace. ", "After Vasily leaves, Tanyushka confesses to her mother that she actually likes the man, but she feels that his love will not last and therefore hides behind her pride. ", "At the palace, noble people laugh at the girl's simple clothes, and Vasily is ashamed of her. ", "Tanyushka rejects him, leans against the malachite wall and melts away. ", "She comes back home to her mother and brother.", "\n\nCast\n Larisa Chikurova as The Mistress of the Copper Mountain\n Gennady Yegorov as Stepan\n Irina Gubanova as Nastya, his wife\n Natalya Andrejchenko as Tanyushka, his daughter\n Igor Kostolevsky as Vasily Turchaninov, the noble man in love with Tanyushka\n Lev Krugly as Severyan Nazarovich, the bailiff on the mine\n Dima Dymov as Melesha, Stepan's son\n Igor Yefimov as Parfyon Semyonovich, the new bailiff\n Boris Arakelov as Parfyon's servant\n Mikhail Svetin as Dimitriy, the door-keeper at the imperial palace\n Arkady Trusov as The Miner\n Victor Chekmaryov as Savva Turchaninov, the landlord and the owner of the mines\n\nReception \nG. Yermakova praised the protagonist's significant spiritual growth and the acting of Gennady Yegorov, noting that such a remarkable performance is true success for any young actor: \"He portrayed Stepan with the captivating sincerity, having created the image of the remarkable and talented person\". ", "She also stated that \"The greatest luck of the film is the poetic [...] embodiment of huge and tragic love between Stepan and the Mistress of the Copper Mountain\". ", "For a long time Gennady Yegorov was closely associated with the character from Stepan's Remembrance, he later said that people often called him \"Stepan\".", "\n\nReferences\n\nExternal links\n\nCategory:1970s fantasy films\nCategory:Soviet films\nCategory:Russian-language films\nCategory:Russian children's fantasy films\nCategory:Soviet fantasy films\nCategory:Films based on Russian folklore\nCategory:Lenfilm films" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.009259259259259259, 0.011235955056179775, 0, 0.008, 0.008403361344537815, 0, 0.00980392156862745, 0.010309278350515464, 0, 0.012121212121212121, 0.022727272727272728, 0, 0, 0, 0, 0.012048192771084338, 0.0125, 0, 0, 0, 0, 0.009345794392523364, 0, 0.039473684210526314, 0.018518518518518517, 0, 0, 0, 0, 0.015625, 0.03225806451612903, 0, 0.009433962264150943, 0, 0.00980392156862745, 0, 0.025210084033613446, 0.01818181818181818, 0, 0.005952380952380952, 0, 0, 0, 0.011802575107296138, 0, 0.006535947712418301, 0.004032258064516129 ]

[ "In the previous article, I have discussed the difference between constructor and setter injections. ", "Now, it’s time to pay attention to some examples of how not to use Dependency Injection.", "\n\nToo many dependencies\n\nWhen a class has a lot of dependencies, often in a constructor it is the first sign that this has does too much and has a lot of responsibilities (violates Single Responsibility Principle):\n\n<?", "php class OrderController { public function __construct ( OrdersRepository $ordersRepo , PaymentGateway $payments , ShippingService $shipping , Logger $logger Email $mailer ) { $this -> ordersRepo = $ordersRepo ; $this -> paymentGateway = $payments ; $this -> shipping = $shipping ; $this -> logger = $logger ; $this -> mail = $mailer ; } }\n\nAt first, examine your constructor dependencies, maybe some of them are not required to be in a constructor and can be passed via method injection. ", "For example, it is unlikely that we will need an instance of ShippingService to process payment. ", "But this approach does not really solve the problem.", "\n\nAnother option will be to pass only a container to the constructor and later resolve all of these dependencies.", "\n\n<?", "php class OrderController { public function __construct ( Container $container ) { $this -> ordersRepo = $container -> get ( 'ordersRepository' ); $this -> paymentGateway = $container -> get ( 'paymentGateway' ); $this -> shipping = $container -> get ( 'PaymentGateway' ); $this -> logger = $container -> get ( 'Logger' ); $this -> mail = $container -> get ( 'Email' ); } }\n\nBut, in this context, it will be an anti-pattern Service Locator. ", "Depending on a container hides all the information about class dependencies. ", "If we want to test this class, we should examine the class and find out all the dependencies that it resolves out of the container and mock them for every test. ", "We also cannot be sure that all the dependencies are already correctly registered in the container. ", "In this way, we lose all advantages of Dependency Injection. ", "Objects shouldn’t know about the container.", "\n\nA better option is to break OrderController into several small classes, each with its own responsibility, like PaymentController or ShippingController .", "\n\nCyclic Dependencies\n\nClass A depends on class B , but class B depends on A .", "\n\n<?", "php class A { protected $b ; public function __construct ( B $b ) { $this -> b = $b ; } } class B { public $a ; protected function setA ( A $a ) { $this -> a = $a ; }\n\nThis sort of dependency often means that you don’t really have two independent classes. ", "Chances high, that these classes share one common responsibility, so maybe they both should be one class, rather than two separate.", "\n\nInjecting Dependencies For Other Objects\n\nAn object receives a dependency that it doesn’t actually use, instead it simply passes this dependency to another object.", "\n\n<?", "php class DeliveryController { protected $http ; public function __construct ( HttpClient $http ) { $this -> http = $http ; } public function sendOrder ( $orderId ) { $order = Order :: find ( $orderId ); ( new Delivery ( $this -> http )) -> sendOrder ( $order ); } }\n\nDeliveryController depends on HttpClient and doesn’t actually use it. ", "The only reason to depend on HttpClient is to pass it later build an instance of Delivery class. ", "The problem here is that we are coupled to Delivery class. ", "It is hardcoded here with the new keyword. ", "But even if we are not going to use another class here, we are still coupled to Delivery constructor. ", "If its signature changes, the code here will be broken. ", "We perfectly know this scenario: “I fixed it here, but now it is broken there”. ", "To fix this issue, we can inject an already constructed instance of the Delivery class.", "\n\n<?", "php class DeliveryController { protected $delivery ; public function __construct ( Delivery $delivery ) { $this -> delivery = $delivery ; } public function sendOrder ( $orderId ) { $order = Order :: find ( $orderId ); $this -> delivery -> sendOrder ( $order ); } }\n\nIn other cases when you need to create a new object and pass some dependencies for it, factories can be a good solution. ", "Simply inject a factory, that already has all the required dependencies. ", "And then use it to build an object. ", "Next time, when the process of instantiation changes, you should change only one line of code in the factory, instead of using find in project in your IDE.", "\n\nMaybe Your Don’t Need It\n\nAlways think first before making any serious design decisions. ", "Don’t follow any rules blindly. ", "When all these gurus on Twitter post articles about DI and discuss it’s advantages, but you have some hardcoded dependencies in your code, that doesn’t automatically mean that you are not a professional developer. ", "As any other technique, it has pros and cons. ", "Previously we have discussed dependency injection only in a positive light. ", "However, you can add all these layers of indirection for dependency injection to solve the problem that doesn’t really exist. ", "If your class uses a dependency, but that concrete implementation is the only one available in your system, then it will be more painful to create a loosely coupled solution, rather than just use new keyword and forget about it.", "\n\nMaybe you have Api class and it uses Guzzle client to send HTTP requests. ", "It is very simle, it only knows the API endpoints and how to create requests.", "\n\n<?", "php namespace App\\Api ; use GuzzleHttp\\Client ; class Api { protected $client ; public function __construct () { $this -> client = new Client (); } public function getStatus ( $orderId ) { $response = $this -> client -> get ( 'https://example-api/status/' . ", "$orderId ); return $this -> parseResponse ( $response ); } protected function parseResponse ( $response ) { return json_decode ( $response , true ); } }\n\nWe can test Client class, but there is no solid reason to test Api class since it is only a wrapper over the Client . ", "Tests for Api class, in reality, will only check the code for typos: expect this, and return that … expect this, and return that. ", "So, we can simply hardcode the client in the constructor and use it.", "\n\nBut let’s see what happens if we follow good practices and use dependency injection in this case. ", "At first, we need an interface HttpClient . ", "Then we need to wrap a Guzzle client instance into a wrapper (adapter pattern), which implements this interface. ", "Then we need a factory or dependency container, which will create this wrapper for us. ", "And at last we can pass it to the constructor of Api class.", "\n\n<?", "php interface HttpClient { // ... } class GuzzleAdapter implements HttpClient { // ... } class Api { protected $client ; public function __construct ( HttpClient $client ) { $this -> client = $client ; } // ... }\n\nAnd now ask yourself one question: what is the probability that you will use another HTTP client implementation, instead of the Guzzle client? ", "In six months you will change it to Curl? ", "I don’t think so. ", "Is it worth it? ", "You have created all these classes and complexity to replace only one line of code, which is unlikely to be changed.", "\n\nWant to know more?" ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0.0045871559633027525, 0.006122448979591836, 0.010309278350515464, 0, 0, 0, 0.006802721088435374, 0, 0, 0, 0.01639344262295082, 0, 0.01948051948051948, 0, 0, 0, 0, 0, 0, 0.008875739644970414, 0.010309278350515464, 0, 0, 0.00980392156862745, 0, 0, 0, 0, 0.002583979328165375, 0, 0, 0.0064516129032258064, 0, 0, 0.004672897196261682, 0, 0, 0, 0, 0, 0.012987012987012988, 0, 0.007751937984496124, 0.003676470588235294, 0, 0, 0, 0.022727272727272728, 0, 0, 0, 0, 0.014005602240896359, 0, 0, 0, 0, 0 ]

[ "Spray Drift Reduction Technologies Webinar\n\nOn Friday, December 7th at 1:30 PM ARA will host a webinar titled “Encouraging Use of Spray Drift Reduction Technologies.", "”This one hour webinar will be led by Jay Ellenberger of the EPA Office of Pesticide Programs and will provide an overview of the background and implementation of EPA’s Drift Reduction Technology program.", "An ARA Member Alert will be sent at a later date with more details and call instructions." ]

{ "pile_set_name": "Pile-CC" }

[ 0.006060606060606061, 0.0196078431372549, 0.02247191011235955 ]

[ "Renal pathology and clinical presentations of polyomavirus nephropathy in simultaneous kidney pancreas transplant recipients compared with kidney transplant recipients.", "\nThe purpose of this study was to describe and compare the renal histopathology and clinical course of simultaneous kidney-pancreas transplant (SKP) recipients with kidney transplant (KT) recipients with polyomavirus nephropathy (PVN). ", "Between 1997 and 2002, 20 patients (7 SKP, 13 KT) were diagnosed with PVN. ", "Clinical characteristics and outcomes of PV-N were correlated with histopathologic examinations of renal allograft biopsy and compared between SKP and KT recipients. ", "There were no differences in demographics between SKP and KT recipients with PV-N. The mean time to PVN was 611 (172 to 1174) days posttransplant in SKP and 343 (83 to 720) days posttransplant in KT (P =.05). ", "The serum creatinine at the time of diagnosis was similar between SKP and KT recipients. ", "All patients were treated with reduction in immunosuppression. ", "After a median follow-up of 2 years, the patient survival was 71% in SKP and 100% in KT. ", "Four grafts (57%) were lost owing to PVN in SKP group and three grafts (23%) were lost owing to PVN in the KT group. ", "More patients (43%) in SKP had a history of acute rejection prior to diagnosis of PVN compared to KT (8%) and biopsy-proven tacrolimus nephrotoxicity prior to PVN was more common in SKPT (86%) than in KT (8%) patients (P <.05). ", "SKP patients with evidence of diffuse fibrosis and high total sum scores at time of presentation all subsequently lost their grafts. ", "SKP recipients with PVN had a worse clinical course than KT recipients." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0.012711864406779662, 0.04, 0.012048192771084338, 0.023923444976076555, 0.02247191011235955, 0, 0.02247191011235955, 0.03418803418803419, 0.021929824561403508, 0.007518796992481203, 0.04225352112676056 ]

[ "MeV Au irradiation induced nanoparticle formation and recrystallization in a low energy Au implanted Si layer.", "\nAu implantation at 32 keV into Si(100), in a fluence range of 1 x 10(15)-1 x 10(17) cm(-2), has been used to produce a gold-rich damaged Si layer of thickness around 30 nm. ", "Local recrystallization of this layer, induced by 1.5 MeV Au irradiation, to a fluence of 1 x 10(15) cm(-2), has been studied using Raman scattering, photoluminescence (PL) and x-ray photoemission spectroscopy (XPS). ", "For a sample with a low energy Au fluence of 5 x 10(15) cm(-2), the MeV Au irradiation has been found to result in Si nanocrystal (NC) formation. ", "The size of the NCs, as estimated from the PL data, has been found to be about 4 nm, which agrees well with the result of a thermal spike model calculation. ", "Annealing of the sample at 500 degrees C resulted in an enhanced PL signal, without any significant shift in peak position, indicating an increase in the local concentration of the NCs. ", "In the case of samples with an initial Au fluence above 1 x 10(16) cm(-2), the MeV Au irradiation has been found to result in better overall recrystallization of the amorphous layer, with silicide formation as observed by XPS. ", "However, there was no PL signal, indicating the absence of Si NCs in the system. ", "The results suggest that the initial amorphizing Au fluence plays a crucial role in Si NC formation induced by MeV ion irradiation." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.00909090909090909, 0.011494252873563218, 0.018433179723502304, 0.00684931506849315, 0.006369426751592357, 0.005376344086021506, 0.00881057268722467, 0.012345679012345678, 0.015267175572519083 ]

[ "e factors of u?", "\n3, 16661\nLet i = -157 - -505. ", "Suppose 42 = o - i. List the prime factors of o.\n2, 3, 5, 13\nSuppose -4813551 = 123*q - 12508800. ", "What are the prime factors of q?", "\n62563\nSuppose -10*i = -12*i + 2. ", "Suppose -v + 4 = i. Suppose 264 = v*p - 294. ", "List the prime factors of p.\n2, 3, 31\nSuppose 23560*c - 708141 = 23539*c. ", "List the prime factors of c.\n33721\nSuppose -4408 = -g + 23*v - 18*v, 0 = -15*g - 3*v + 66276. ", "List the prime factors of g.\n2, 47\nSuppose -41*n + 30510 = -32*n. ", "Let c = 4860 - n. List the prime factors of c.\n2, 3, 5, 7\nWhat are the prime factors of (-2751)/(-42)*(14 + 444)?", "\n131, 229\nSuppose -4*f - 36455 = -2*o + 9901, o + 2*f = 23182. ", "List the prime factors of o.\n2, 5, 19, 61\nLet u(h) = h**3 - 19*h**2 + 20*h - 31. ", "Let f be u(18). ", "Suppose 4*i = -f*z + 563, z - 176 = -4*i - 57. ", "List the prime factors of z.\n3, 37\nLet h(t) = 162*t**2 - 525*t - 2. ", "What are the prime factors of h(13)?", "\n20551\nLet q = -345 + 174. ", "Let x be 38/q + 184/18. ", "Let m(t) = -t**2 + 9*t + 16. ", "What are the prime factors of m(x)?", "\n2, 3\nLet u(x) = x - 5. ", "Let a be u(5). ", "Suppose a = 2*c + 5*c - 14. ", "Suppose c*b - 3*b = -29. ", "What are the prime factors of b?", "\n29\nSuppose -35*l = -41*l - 6. ", "Let w be 0 - (-3 - l)*(-5)/(-2). ", "Suppose -w*t - 33 = 3*r - 252, -5*r + 387 = t. What are the prime factors of r?", "\n2, 3, 13\nLet o be 6*11/((-66)/4)*-4. ", "What are the prime factors of 6/o - 4077*(-1)/8?", "\n2, 3, 5, 17\nLet s be 13832/88 + (-2)/11. ", "Let b = -65 - -102. ", "Suppose b - s = -2*h. ", "What are the prime factors of h?", "\n2, 3, 5\nSuppose -5*w = 5*y - 149 - 36, 3*y - 147 = -4*w. ", "Suppose 9422 - 46394 = -w*r. ", "List the prime factors of r.\n13, 79\nSuppose 25 = -5*d, -5*s - d = -12996 - 8634. ", "Let f = s + -2665. ", "List the prime factors of f.\n2, 3, 277\nLet b = 819 - 583. ", "Let i be (8/14)/((-2)/(-7)). ", "Suppose -b = -2*y + i*l, l = -5*y - l + 590. ", "List the prime factors of y.\n2, 59\nSuppose -k - 1919 - 8253 = -2*w, -5*k + 5108 = w. What are the prime factors of w?", "\n2, 3, 53\nLet x be (-3)/(-12) - 4305/20. ", "Let v be (x/15)/(2/(-84)). ", "Suppose 0*b = 7*b - v. What are the prime factors of b?", "\n2, 43\nSuppose 5*d = -4*s + 30007, -2*s + 10339 = -5*d - 4642. ", "List the prime factors of s.\n2, 23, 163\nSuppose 4*q - 13331 = 5*v, 3*v = 5*q - 0*v - 16667. ", "Suppose -3*b = -q + 958. ", "List the prime factors of b.\n2, 3, 11\nLet i = 2 - 2. ", "Let o be (-63)/45 + 2 + (-7)/(-5). ", "Suppose -k + 88 = -3*c, o*c - 5*c - 12 = i. What are the prime factors of k?", "\n2, 19\nSuppose -334*h = -171*h - 180*h + 212755. ", "What are the prime factors of h?", "\n5, 2503\nLet z be (-404)/(-8) + -5 - (-6)/4. ", "Suppose 49603 - 9183 = z*x. ", "List the prime factors of x.\n2, 5, 43\nLet r(l) = 8*l**3 + l**2 + 7*l - 2. ", "Let n be r(3). ", "Suppose 68 + 1146 = 5*a + 3*q, -q = a - n. What are the prime factors of a?", "\n241\nLet t = -21780 - -30742. ", "What are the prime factors of t?", "\n2, 4481\nSuppose 44 = 2*t - 4*m, -t = -3*t - 5*m + 44. ", "Suppose 0 = t*w + 2*w - 30936. ", "What are the prime factors of w?", "\n1289\nLet d(i) = -i**3 - 86*i**2 - 156*i + 882. ", "List the prime factors of d(-92).", "\n2, 3, 11003\nLet n(b) = 3*b**3 + 5*b**2 + 7*b - 5. ", "Let g be n(-4). ", "Let y = g + 180. ", "Let u = 169 + y. What are the prime factors of u?", "\n2, 3, 17\nLet x(o) = -8*o - 49. ", "Let z be x(-6). ", "Let b(r) = r + 5. ", "Let a be b(z). ", "Suppose -2*n - 316 = -a*j, 82 = 6*j - 5*j + n. List the prime factors of j.\n2, 5\nLet i = -19 - -9. ", "Let n(h) = -27*h - 44. ", "List the prime factors of n(i).", "\n2, 113\nList the prime factors of 0 + -3 + 6 + 4 + 34254 + -1.", "\n2, 3, 5, 571\nSuppose -66*a + 55234 = 2*s - 64*a, 3*a = 2*s - 55264. ", "List the prime factors of s.\n23, 1201\nLet c(s) = -2*s + 2. ", "Let u = 0 - -3. ", "Let m be c(u). ", "What are the prime factors of 18*(-7)/(-2) + m?", "\n59\nSuppose -5*g - 4*b = -954, -363 = -4*g + 3*b + 363. ", "List the prime factors of g.\n2, 3, 31\nSuppose -5*n - 79 = 141. ", "Let r = -38 - n. List the prime factors of r + -8 + 134/2.", "\n5, 13\nSuppose 0 = 5*t - j - 1408, -207 = -t - j + 71. ", "List the prime factors of (0/(-6) - 4/1) + t.\n277\nSuppose -1901*m - 78 = -1940*m. ", "Let l be (-596)/(-2) + -3 + 2. ", "Suppose -l = -2*f - m*y + 5*y, 0 = -4*f + 2*y + 614. ", "List the prime factors of f.\n2, 3, 13\nSuppose -5*m + 15 = 0, -70 - 1342 = -2*b - 2*m. ", "List the prime factors of b.\n19, 37\nLet h(o) = 782*o**2 - 84*o + 344. ", "What are the prime factors of h(4)?", "\n2, 5, 313\nLet u(g) = -16371*g - 6197. ", "What are the prime factors of u(-3)?", "\n2, 10729\nLet p = 61678 - 33342. ", "What are the prime factors of p?", "\n2, 7, 11, 23\nLet d = 313 + -248. ", "Suppose -5*w - 4*y = -d, 6*w + y - 50 = w. What are the prime factors of w?", "\n3\nSuppose 3*l = -217*p + 215*p + 11809, -29565 = -5*p + l. What are the prime factors of p?", "\n2, 739\nSuppose -t = 2*t - 2*x + 11, -t + 3*x + 1 = 0. ", "Let n be (-1 - (-20)/t) + 2. ", "List the prime factors of (n/(-4))/(6/1848*7).", "\n3, 11\nSuppose -38*x = -36*x - 14. ", "What are the prime factors of x/((-70)/648)*(-350)/35?", "\n2, 3\nSuppose -4*a + 23340 = -2*w, 17*w - 19*w - 8 = 0. ", "List the prime factors of a.\n19, 307\nLet z(d) = 2*d**3 + 54*d**2 - d + 42. ", "Suppose 26 = -q - h, 0 = -0*h + 2*h. ", "List the prime factors of z(q).", "\n2, 5, 71\nSuppose -7750 = -o - c, -3*o + 2*c = 12*c - 23271. ", "List the prime factors of o.\n61, 127\nSuppose 123*p + 93*p - 11588400 = 0. ", "What are the prime factors of p?", "\n2, 5, 29, 37\nLet r(y) = -y. ", "Let a be r(-5). ", "Suppose 12*f = 7*f, 4*j - 4*f - 12 = 0. ", "Suppose j*w - 22 = a. What are the prime factors of w?", "\n3\nLet q(k) = -k**3 + 23*k**2 + 28*k - 34. ", "Let t be 2 + (93 - -2) - (-6)/(-6). ", "Let h be t/30*15/2. ", "List the prime factors of q(h).", "\n2, 31\nLet j be (20/(-30))/(1/6*-2). ", "Suppose 8 = c + 4*i - j, 3*i - 3 = 0. ", "Suppose -z = -g + 79, z - c*z + 85 = g. List the prime factors of g.\n2, 5\nLet b(w) = -58*w + 304. ", "What are the prime factors of b(-3)?", "\n2, 239\nSuppose -f + 28 = 306. ", "Let s = 168 - f. List the prime factors of s.\n2, 223\nSuppose s = 4*j + 11, 4*j - 2*j + s + 1 = 0. ", "Let q be j - (-30)/(5 - -1). ", "Suppose -895 = -5*f - h, 880 = 5*f + q*h + h. List the prime factors of f.\n2, 3, 5\nLet u = -208 + 368. ", "Suppose -u = 7*t + 197. ", "List the prime factors of (t/(-18) - 1)*6.", "\n11\nList the prime factors of (-27376)/48*(12 - 45).", "\n11, 29, 59\nSuppose 16*x + 367612 = -3*x. ", "What are the prime factors of x/(-14) - (24/4 + 0)?", "\n2, 43\nSuppose -g - 4*n + 25820 = 0, -5*g + 129058 = -3*n + 9*n. ", "What are the prime factors of g?", "\n2, 1613\nLet w(h) be the first derivative of -h**4/4 - 7*h**3 - 11*h**2 - 11*h - 9. ", "Let d be w(-21). ", "Suppose -5*z + d = -69. ", "What are the prime factors of z?", "\n2, 13\nSuppose 15 - 27 = -6*v. ", "Suppose -v*i + 1934 = 4*t, -t - 2*i + 479 = 3*i. ", "List the prime factors of t.\n2, 11\nLet i(y) be the third derivative of -y**6/120 + 17*y**5/60 + 5*y**4/24 + 3*y**3 + 14*y**2. ", "Let c be i(17). ", "Let f = c - 42. ", "What are the prime factors of f?", "\n61\nSuppose h - 2912 - 2827 - 5181 = 0. ", "List the prime factors of h.\n2, 3, 5, 7, 13\nLet c = -1598 + 1544. ", "Suppose 17 - 773 = -3*t. ", "Let x = t + c. What are the prime factors of x?", "\n2, 3, 11\nLet i(w) = -5*w + 148. ", "Let j be i(28). ", "Let s(g) = 3*g**3 - 19*g**2 + 13*g - 10. ", "What are the prime factors of s(j)?", "\n2, 3, 23\nSuppose 291*q - 281*q + 4070 = 0. ", "Let o = 484 + q. List the prime factors of o.\n7, 11\nLet u(g) = -7*g + 1. ", "Let t be u(-8). ", "Let v = t - 52. ", "Suppose 0*f + v*f - 500 = 0. ", "What are the prime factors of f?", "\n2, 5\nLet o = 3170 - -1940. ", "Suppose -25*f = -o - 9890. ", "What are the prime factors of f?", "\n2, 3, 5\nLet v(j) = -275*j + 8232. ", "List the prime factors of v(-101).", "\n36007\nLet z(n) = -2*n**2 - 3*n + 54. ", "Let y be z(-6). ", "Suppose y = 10*h - 8977 - 3223. ", "What are the prime factors of h?", "\n2, 5, 61\nSuppose 874661 = -251*x + 6386370. ", "List the prime factors of x.\n7, 3137\nSuppose -5*t - 3*c = -6698, -t + 0*c + 1340 = c. Suppose 2*v - 2405 = 3*o, -v + t = -3*o + 141. ", "What are the prime factors of v?", "\n17, 71\nSuppose 0 = 16*j - 13*j - 72. ", "Let l be (-128)/j*(-6)/4. ", "Suppose -2*r + 122 = l. List the prime factors of r.\n3, 19\nList the prime factors of ((-4)/(-38))/((-59)/(-1121)) + 54836/2.", "\n2, 3, 5, 457\nList the prime factors of (3/6)/((-517022)/(-34468) + -15).", "\n7, 1231\nLet o = 26860 + -14338. ", "What are the prime factors of o?", "\n2, 3, 2087\nLet b be (7 - 2) + 3*-1. ", "List the prime factors of ((-1099)/b)/((-7)/2 + 3).", "\n7, 157\nLet r be (33*4/(-30))/(20/50). ", "What are the prime factors of 6/(-11) + (-2811)/r?", "\n3, 5, 17\nLet k = -8014 - -14523. ", "What are the prime factors of k?", "\n23, 283\nLet m = -11 - -1" ]

{ "pile_set_name": "DM Mathematics" }

[ 0, 0, 0, 0, 0, 0, 0, 0.010638297872340425, 0, 0.008849557522123894, 0.015873015873015872, 0, 0, 0, 0.029411764705882353, 0, 0, 0, 0, 0, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0.012658227848101266, 0, 0, 0, 0, 0.045454545454545456, 0, 0.017241379310344827, 0.034482758620689655, 0, 0, 0, 0, 0, 0.017094017094017096, 0, 0, 0, 0, 0.010869565217391304, 0, 0, 0, 0.013157894736842105, 0, 0, 0, 0, 0.013513513513513514, 0, 0, 0.03333333333333333, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.010101010101010102, 0, 0, 0, 0, 0.01694915254237288, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.02857142857142857, 0, 0, 0.030303030303030304, 0, 0, 0.013333333333333334, 0, 0, 0.034482758620689655, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.018518518518518517, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.01020408163265306, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007936507936507936, 0.0625, 0, 0, 0, 0.015151515151515152, 0, 0, 0, 0, 0, 0.02857142857142857, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007518796992481203, 0, 0, 0, 0, 0, 0, 0, 0.02702702702702703, 0, 0, 0, 0, 0, 0.04 ]

[ "Serum amyloid A stimulates matrix-metalloproteinase-9 upregulation via formyl peptide receptor like-1-mediated signaling in human monocytic cells.", "\nIn the present study, we found that serum amyloid A (SAA) stimulated matrix-metalloproteinase-9 (MMP-9) upregulation at the transcription and translational levels in THP-1 cells. ", "SAA stimulated the activation of nuclear factor kappaB (NF-kappaB), which was required for the MMP-9 upregulation by SAA. ", "The signaling events induced by SAA included the activation of ERK and intracellular calcium rise, which were found to be required for MMP-9 upregulation. ", "Formyl peptide receptor like 1 (FPRL1) was found to be involved in the upregulation of MMP-9 by SAA. ", "Among several FPRL1 agonists, including Trp-Lys-Tyr-Met-Val-D-Met (WKYMVm), SAA selectively stimulated MMP-9 upregulation. ", "With respect to the molecular mechanisms involved in the differential action of SAA and WKYMVm, we found that SAA could not competitively inhibit the binding of 125I-labeled WKYMVm to FPRL1. ", "Taken together, we suggest that SAA plays a role in the modulation of inflammatory and immune responses via FPRL1, by inducing MMP-9 upregulation in human monocytic cells." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0.005555555555555556, 0.02459016393442623, 0.012903225806451613, 0.009900990099009901, 0.016260162601626018, 0.010471204188481676, 0.005847953216374269 ]

[ "Now Commenting On:\n\nEovaldi, Hernandez absences create opportunities\n\n3/13/13: Nathan Eovaldi pitches five strong innings, giving up just one run on three hits and striking out four\n\nBy Joe Frisaro\n/\nMLB.com |\n\nWASHINGTON -- The Marlins are opening their season with two-fifths of their expected rotation back in South Florida treating injuries.", "\n\nNathan Eovaldi and Henderson Alvarez were placed on the 15-day disabled list on Sunday. ", "Each is dealing with mild right shoulder inflammation.", "\n\nChances are both could miss the entire month of April\n\n\"Right now, we're trying to get them pain free,\" manager Mike Redmond said on Monday, noting he has no timetable for their returns. \"", "There is some tendinitis with both of them. ", "We've got to make sure those guys are pain free and build back up. ", "Start playing catch. ", "Start long tossing.", "\n\n\"I don't know the time frame of how long it's going to be, but probably a few weeks before those guys are built back up and ready for game action again.\"", "\n\nEovaldi, initially lined up to be the No. ", "2 starter, was enjoying a terrific Spring Training, posting a 3-0 record with a 3.65 ERA in 24 2/3 innings.", "\n\nAlvarez, slotted as the fourth starter, threw 12 2/3 innings in the spring for Miami, and he also competed in the World Baseball Classic for Venezuela.", "\n\nWith them out, Kevin Slowey has moved into the No. ", "2 spot. ", "Alex Sanabia was called up from Triple-A, and he will pitch on Friday at the Mets.", "\n\nThe biggest news was the promotion of top prospect, Jose Fernandez, who will make his MLB debut on Sunday at New York.", "\n\n\"There are opportunities out there,\" Redmond said. \"", "Guys benefit from injuries. ", "I've said it as a player, and I'll say it as a manager. ", "When guys get hurt, it creates opportunities. ", "I'm not going to sit here and dwell on the fact we have two starters down.", "\n\n\"Is it going to be tough? ", "Sure. ", "But there are guys out there. ", "Somebody is going to step up. ", "I'm excited to see who that is going to be.\"" ]

{ "pile_set_name": "Pile-CC" }

[ 0.011594202898550725, 0.022222222222222223, 0, 0.005263157894736842, 0, 0, 0, 0, 0, 0.022727272727272728, 0.009345794392523364, 0.006535947712418301, 0.018867924528301886, 0, 0.024390243902439025, 0.016666666666666666, 0.018518518518518517, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "/*\n * Copyright Elasticsearch B.V. and/or licensed to Elasticsearch B.V. under one\n * or more contributor license agreements. ", "Licensed under the Elastic License;\n * you may not use this file except in compliance with the Elastic License.", "\n */\n\nimport { withOptionalSignal } from '../../common/with_optional_signal';\nimport { useAsync } from '../../common/hooks/use_async';\nimport { exportList } from '../api';\n\nconst exportListWithOptionalSignal = withOptionalSignal(exportList);\n\n// eslint-disable-next-line @typescript-eslint/explicit-function-return-type\nexport const useExportList = () => useAsync(exportListWithOptionalSignal);\n" ]

{ "pile_set_name": "Github" }

[ 0.007936507936507936, 0.009009009009009009, 0.005063291139240506 ]

[ "![](", "hosplond71800-0017){#sp1 .177}\n\n![](", "hosplond71800-0018){#sp2 .178}\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0, 0, 0 ]

[ "next Image 1 of 3\n\nprev next Image 2 of 3\n\nprev Image 3 of 3\n\nA series of dramatic photos showing kids putting their lives on the line by climbing a 2,625-foot bamboo ladder to and from school forced embarassed officials in western China to propose a quick remedy on Friday: a set of stairs.", "\n\nThe 15 children ages 6-15 climb up the cliffside ladder to return home from the boarding school every two weeks. ", "It's their only way to get home.", "\n\nThe hardship faced by residents in the village of Atuleer in Sichuan province underscores the vast gap in development between China's prosperous, modern east and parts of the remote inland west that remain mired in poverty. ", "The 72 families who live there are members of the Yi minority group and subsist mainly by farming potatoes, walnuts and chili peppers.", "\n\nA news release Friday from the Liangshan prefectural government that oversees the county said a solid set of steel stairs would be built as a stop-gap measure as officials considered a longer-term solution.", "\n\nIt quoted local residents as saying that in addition to the safety issue, the ladder-only access exposed villagers to exploitation because traders knew they would be unable to carry unsold produce back up the cliff.", "\n\n\"The most important issue at hand is to solve the transport issue. ", "That will allow us to make larger-scale plans about opening up the economy and looking for opportunities in tourism,\" county Communist Party Secretary General Jikejingsong was quoted as saying in the news release.", "\n\nThe dramatic photos that appeared online earlier this week showed children wearing colorful backpacks climbing the 17 separate ladders accompanied by a pair of adults. ", "The photos garnered even more attention after appearing on the front page of the English-language China Daily and other newspapers on Thursday.", "\n\nA team of 50 officials from the Zhaojue county government's transport, education and environmental protection departments traveled to the area on Wednesday to assess safer alternatives, the Global Times reported Friday. ", "It said the county was considering building a road to the village, although the cost would be exorbitant for such a poor region.", "\n\nChina pulled almost 700 million people out of poverty following the implementation of economic reforms in the early 1980s and says less than 10 percent of the population still suffers from extreme privation.", "\n\nMost of China's poorest people are from long-marginalized minority groups or are farmers and herders living in the mountainous southwest, where rope bridges, aerial runways, canoes and cliffside ladders remain crucial to accessing the outside world.", "\n\nThe Associated Press contributed to this report." ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0, 0.004424778761061947, 0, 0.004807692307692308, 0, 0, 0.009389671361502348, 0, 0.006993006993006993, 0.0045045045045045045, 0, 0, 0, 0.02 ]

[ "Steve,\n\nFollowing up on discussion with Jeff over the weekend and last night I would \nlike to get together today if possible. ", " I am scheduled to travel back to \nBrazil tonight. ", " I attach the highlights of Jeff and my discussion.", "\n\n\n\nI am at 66524, or on my cell at 713-822-1374.", "\n\n\nJim" ]

{ "pile_set_name": "Enron Emails" }

[ 0.015873015873015872, 0, 0.0196078431372549, 0.02040816326530612, 0.16666666666666666 ]

[ "Patients with dravet syndrome in the era of stiripentol: A French cohort cross-sectional study.", "\nThe aim of this study was to assess outcome and seizure response to treatment with stiripentol (STP) associated to valproate (VPA) and clobazam (CLB), which we have used in our center since the 1990s, in patients with Dravet syndrome (DS). ", "We performed a cross-sectional study of all DS patients with SCN1A mutations who had at least one visit to our center in 2013. ", "A total of 54 patients were included (32 males, 22 females), whose ages ranged from 2.5 to 22 years. ", "Seizure onset ranged from 2 to 9 months (mean 5 months). ", "Treatment started at a mean age of 7 months with valproate (VPA) as first therapy in 83% of patients. ", "STP was prescribed in 96% at an average age of 20 months. ", "At last follow-up (up to 22 years, median 8 years), 96% were still receiving STP, with VPA and clobazam (CLB) in 91%. ", "Additional therapies were prescribed in 72% of patients. ", "Most patients (96%) continued to have clonic or tonic-clonic seizures but they were brief (<5min, with last status epilepticus (SE) episode being before 4 years of age). ", "Seizures occurred weekly (>3/month) in 38% of patients, monthly (1-3/month) in 40%, and yearly in the remaining patients. ", "None presented with daily seizures. ", "Seizure frequency at last visit was related to the age of treatment initiation, the age of last SE, and SCN1A mutation type. ", "Triple therapy with STP, VPA, and CLB was maintained long-term by 96% of this large DS cohort because the reduced frequency and severity of seizures STP provided when added to CLB and VPA was durable. ", "Nevertheless, only a few patients achieved seizure freedom and persisting seizures remains a concern in the majority of patients." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0.016597510373443983, 0, 0, 0, 0.00980392156862745, 0.017241379310344827, 0.025423728813559324, 0, 0, 0, 0, 0, 0.029850746268656716, 0 ]

[ "For example, a parking apparatus described in Japanese Laid-Open Patent Application Publication No. ", "2011-089354 is known as a conventional parking management system. ", "This parking apparatus is designed for the purpose of making it possible to automatically park a vehicle equipped with a self-propelled function in a mechanical parking apparatus only by leaving the vehicle behind by a driver. ", "The parking apparatus is configured so that a vehicle which moves onto an attitude control device from outside and stops there is detected by a vehicle measurement device and front and rear positions, directions, and size of the vehicle are calculated by an arithmetic controller of a receiving-side control device; and the arithmetic controller obtains a parking approval of the vehicle from a driving controller for a vehicle-side control device by means of radio communication and also issues a command to the vehicle-side control device to maintain the vehicle in a state capable of self-driving, further issues a direction change command to the attitude control device on the basis of the front and back positions and directions of the vehicle as calculated by the arithmetic controller to turn the front and rear directions of the vehicle towards a direction of a car stop space, and further issues a loading command from the receiving-side control device to the vehicle-side control device to have the driving controller make the vehicle automatically drive along a track calculated by the arithmetic controller and load the vehicle, which is on the attitude control device, into the car stop space." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0, 0 ]

[ "Film Capacitors\n\nElectronics capacitors, precision capacitors, calibration\n\nPrecision film capacitors – similar to mechanical elasticity – are passive electrical components that consist of two metal electrodes/plates separated by a dielectric (insulator) in order to store electrical energy. ", "Electrocube is a capacitor manufacturer known for its capacitor designs with thousands of precision-wrap and fill, oval/round/flat and epoxy case/hermetically-sealed capacitors with high capacitor insulation resistance.", "\n\nWhat are some features of Electrocube film capacitors for electronics?", "\n\nThese high-voltage capacitors – miniature wrap and fill capacitors – blend high-performance with longevity and durability. ", "Electrocube’s variety of styles, capacitance dimensions and performance characteristics – standard, commodity and custom, plus low price and high volume – meet virtually all system requirements from the most demanding electrical systems to small electronic components\n\nLooking for a specific electronics capacitor?", "\n\nAre you asking, “How do I know which capacitor to pick?” ", "The Electrocube Capacitor Performance Chart includes full product details and modifications – including capacitor insulation resistance – for each Electrocube capacitor in its standard line.", "\n\nThis will help you narrow your search based simply on specifications – from capacitance dimension to capacitor insulation resistance and more – so you can avoid capacitor failure.", "\n\nWhat types of precision capacitors and calibration capacitors does Electrocube offer?", "\n\nStill looking for more?", "\n\nCheck out the film capacitor data sheets for performance specs or contact us to schedule a complimentary consultation with a capacitor design engineer to solve even the most challenging electrical energy problems. ", "We can help with aerospace capacitors, military and defense capacitors, and audio capacitors.", "\n\nIn the Electrocube documentation library, you’ll discover insights on electrical energy and current such as:" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00909090909090909 ]

[ "India at the 2016 Asian Olympic Shooting Qualifying Tournament\n\nA total of 64 Indian shooters participated in the 2016 Asian Olympic Shooting Qualifying Tournament held in Dr. Karni Singh Shooting Range, New Delhi. ", "India ranked 5th in the medal list.", "\n\nA total of 4 quotas have been obtained in three different events till 1 February.", "\n\nParticipants\n\nMen\n\nWomen\n\nQuota Obtained\n\nReferences \n\nCategory:2016 in Indian sport\nCategory:2016 in shooting sports\nCategory:Shooting sports in India" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.004651162790697674, 0, 0, 0 ]

[ "Q:\n\nParse output in python to count number of occurences\n\nI have a python script that makes a curl command and reads the output into a variable called output\nThe output is something similar to this:\n\"endpoint1: {\n \"[service1]endpoint\": {\n },\n \"[service1]endpoint\": {\n },\n \"[service2]endpoint\": {\n },\n \"[service2]endpoint\": {\n }\n }\n\"endpoint2\": {\n \"[service1]endpoint\": {\n }\n },\n\nWhat I need to do is parse this output to count the unique strings between [] and print out the occurrences. ", "So something like this:\nservice1 3 \nservice2 2\n\nAny help on how I would go about doing this. ", "Thanks.", "\n\nA:\n\nIf your input isn't valid JSON, use the following approach with collections.", "Counter object and re.findall() function:\nresult = collections.", "Counter(re.findall(r'\\[([^]]+)\\]', output))\nprint(result)\n\nThe output:\nCounter({'service1': 3, 'service2': 2})\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0019230769230769232, 0, 0, 0, 0, 0 ]

[ "1933 Birthday Honours\n\nThe King's Birthday Honours 1933 were appointments by King George V to various orders and honours to reward and highlight good works by members of the British Empire.", "\n\nThe appointments were made to celebrate the official birthday of The King. ", "They were published on 3 June 1933.", "\n\nThe recipients of honours are displayed here as they were styled before their new honour, and arranged by honour, with classes (Knight, Knight Grand Cross, etc.) ", "and then divisions (Military, Civil, etc.) ", "as appropriate.", "\n\nBritish Empire\n\nBaron\n The Right Honourable George Richard Lane-Fox, , Member of Parliament for the Barkston Ash Division, 1906-1931. ", "Parliamentary Secretary to the Mines Department, 1922 to 1924 and November 1924 to January 1928. ", "Chairman of the Pig Products Commission 1932, and of Fat Stock Reorganisation Commission. ", "For political and public services.", "\n Sir Edward Mauger Iliffe, , Member of Parliament for the Tamworth Division, 1923-1929. ", "For political and public services.", "\n Sir (Samuel) Ernest Palmer, , a Vice-President and Chairman of the Council, Royal College of Music. ", "For services to music.", "\n Major-General the Right Honourable John Edward Bernard Seely, , Chairman of the National Savings Committee. ", "For public services.", "\n\nKnights of the Garter\n The Right Honourable Victor Alexander George Robert, Earl of Lytton, .", "\n\nKnights of the Thistle\n His Royal Highness The Duke of Gloucester, .", "\n Edward James, Earl of Elgin and Kincardine, .", "\n\nPrivy Councillor\n Sir Dennis Henry Herbert, , Member of Parliament for Watford since 1908. ", "Chairman of the Committee of Ways and Means and Deputy Speaker of the House of Commons since September 1931. ", "Deputy Chairman, June 1928 to June 1929.", "\n\nBaronet\n Sir Martin John Melvin, . ", "For political and public services in Birmingham.", "\n Sir (Frederick) George Penny, , Member of Parliament for Kingston-on-Thames since November 1922. ", "Comptroller of His Majesty's Household since September 1932, and Vice-Chamberlain November 1931 to September 1932. ", "Lord of the Treasury, January 1928 to June 1929 and August to October 1931.", "\n\nKnight Bachelor\n Edward Taswell Campbell, , Member of Parliament for North-West Camberwell, October 1924 to May 1929, and for Bromley since September 1930. ", "For political and public services.", "\n William Chapel, Provost of Arbroath. ", "For political and public services in Angus.", "\n Joseph Henry Pollock Chitty, Chief Master, Chancery Division, Supreme Court of Judicature.", "\n George Christopher Clayton, , Member of Parliament for the Widnes Division, November 1922 to May 1929, and for the Wirral Division since 1931. ", "For political and public services.", "\n James Travis-Clegg, , Chairman of the Lancashire County Council.", "\n Raymond Henry Payne Crawfurd, , Consulting Physician, King's College Hospital. ", "Registrar of the Royal College of Physicians, London.", "\n Robert Doncaster, . ", "For political and public services in Derbyshire.", "\n William Stewart Duke-Elder, , Ophthalmic Surgeon, St. George's Hospital, London.", "\n Wallace Fairweather, . ", "For political and public services in Renfrewshire.", "\n Samuel Gluckstein. ", "For political and public services in the City of Westminster.", "\n Henry Stuart-Jones, , Principal, University College of Wales, Aberystwyth. ", "For services to scholarship and education.", "\n Alexander Mackenzie Livingstone, , Member of Parliament for the Western Isles, 1923-1929. ", "Vice-Chairman of the National Labour Committee since 1932. ", "For political and public services.", "\n Major John Lomax, . ", "For political and public services in Montgomeryshire.", "\n Major Henry Edward Lyons, , a member of the Liberal National Council and Executive Committee. ", "For political and public services.", "\n Senator Dudley Evelyn Bruce McCorkell, , Mayor of Londonderry. ", "For public and philanthropic work in Northern Ireland.", "\n Joseph Charles McGrath, Clerk of the Peace and Clerk to the West Riding County Council.", "\n Richard James Meller, , Member of Parliament for the Mitcham Division since December 1923. ", "For political and public services.", "\n Ralph Sneyd Pearson, , Director, Forest Products Research Laboratory, Department of Scientific and Industrial Research.", "\n Harry John Preston. ", "For services to sport and philanthropy.", "\n Ernest Wingate Wingate-Saul, , Umpire under the Unemployment Insurance Acts.", "\n Angus Newton Scott, , Chairman of the London County Council, 1932-1983.", "\n Charles David Seligman, a member of the Advisory Committee, Export Credits Guarantee Department. ", "A director of Seligman Brothers Ltd.\n John Collings Squire. ", "For services to literature.", "\n Leonard Henry West, . ", "For political and public services in Buckinghamshire.", "\n Brigadier-General Frederic Herbert Williamson, , Director of Postal Services, General Post Office.", "\n Alderman Edward William Willis, , Chairman of the Chatham Conservative Association for the past 31 years. ", "For political and public services in Kent.", "\n Lieutenant-Colonel Eric Edward Boketon Holt-Wilson, , General Staff, War Office.", "\n\nDominions\n Hugh Thomas Dyke Acland, , Vice President of the Dominion Council of the Australian College of Surgeons, Dominion of New Zealand.", "\n John Musgrave Harvey, Chief Judge in Equity, and Senior Puisne Judge, State of New South Wales.", "\n Walter Leitch, , lately Agent-General in London for the State of Victoria.", "\n Frederick Wollaston Mann. ", "Judge of the Supreme Court, State of Victoria.", "\n Keith Arthur Murdoch. ", "For public services to the Commonwealth of Australia.", "\n\nIndia\n Bijoy Prasad Singh Roy, Minister to the Governor of Bengal for Local Self-Government.", "\n Raja Rajendra Narayan Bhanja Deo, , Member and Vice-President of the Executive Council of the Governor of Bihar and Orissa.", "\n Hormusji Maneckji Mehta, Merchant and Millowner, Bombay.", "\n Syed Ross Masood, Barrister-at-Law, , Vice-Chancellor of the Aligarh Muslim University, United Provinces.", "\n James Scott Pitkeathly, , Chief Controller of Stores, Indian Stores Department.", "\n Charles Banks Cunningham, , Indian Police, Inspector-General of Police, Madras.", "\n Colonel Robert McCarrison, , Indian Medical Service, Director, Nutritional Research, Indian Research Fund Association, India.", "\n Martin Onslow Forster, , lately Director, Indian Institute of Science, Bangalore.", "\n Kedar Nath Das, , Principal, Carmichael Medical College, Calcutta, Bengal.", "\n Kenneth Mackenzie MacDonald, Managing Governor of the Imperial Bank of India.", "\n Khan Bahadur Diwan Abdul Hamid, , Chief Minister, Kapurthala State, Punjab States.", "\n Naoroji Bapuji Saklatvala, , Chairman, Messrs. Tata Sons Ltd., Bombay.", "\n Raja Bahadur Bansilal Motilal, Banker, Hyderabad, Deccan.", "\n Khan Hashmatullah Khan, Major in the Gwalior State Forces and Member, Council of Regency, Gwalior State.", "\n\nColonies, Protectorates, &c\n Arthur William Garrard Bagshawe, , Director, Bureau of Hygiene and Tropical Diseases.", "\n Samuel John Forster, , Unofficial Member of the Legislative Council of the Gambia. ", "For public services.", "\n Walter Clarence Huggard, , Attorney-General, Straits Settlements.", "\n Henry Marks, , formerly Unofficial Member of the Executive and Legislative Councils of Fiji. ", "For public services.", "\n Thomas Lister Villiers, lately Nominated Member of the State Council, Ceylon. ", "For public services.", "\n\nOrder of the Bath\n\nKnight Grand Cross of the Order of the Bath (GCB)\nMilitary Division\nRoyal Navy\n Admiral of the Fleet Sir Frederick Laurence Field, .", "\n\nArmy\n General Sir Robert Archibald Cassels, , Indian Army, Aide-de-Camp General to The King, General Officer Commanding-in-Chief, Northern Command, India.", "\n\nCivil Division\n Sir Herbert James Creedy, , Permanent Under-Secretary of State for War.", "\n Colonel the Right Honourable Sir Clive Wigram, , Private Secretary to His Majesty The King.", "\n\nKnight Commander of the Order of the Bath (KCB)\nMilitary Division\nRoyal Navy\n Vice-Admiral Alfred Dudley Pickman Rogers Pound, .", "\n Vice-Admiral Hugh Justin Tweedie, .", "\n Surgeon Vice-Admiral Reginald St. George Smallridge Bond, .", "\n\nArmy\n Lieutenant-General George Sidney Clive, , (late Grenadier Guards) Military Secretary to the Secretary of State for War, and Secretary of the Selection Board.", "\n Major-General John Francis Stanhope Duke Coleridge, , Indian Army, Commander, Peshawar District, India.", "\n\nRoyal Air Force\n Air Marshal Hugh Caswall Tremenheere Dowding, .", "\n\nCivil Division\n Colonel Sir (Michael) Hugh Shaw-Stewart, , Honorary Colonel, 5/6th (Renfrewshire) Battalion, The Argyll and Sutherland Highlanders (Princess Louise's), President and Chairman of the Territorial Army Association of the County of Renfrew.", "\n George Francis Hill, , Director and Principal Librarian of the British Museum.", "\n\nCompanion of the Order of the Bath (CB)\nMilitary Division\nRoyal Navy\n Rear-Admiral Henry John Studholme Brownrigg, .", "\n Rear-Admiral Arthur Lionel Snagge.", "\n Rear-Admiral Francis Murray Austin.", "\n\nArmy\n Major-General James Andrew Hartigan, , (late Royal Army Medical Corps), Honorary Physician to The King, Deputy Director of Medical Services, Aldershot Command.", "\n Major-General Sir Hereward Wake, , (late The King's Royal Rifle Corps), Half-Pay List.", "\n Major-General Arthur Wollaston Bartholomew, , (late Royal Artillery), Inspector of the Royal Artillery.", "\n Major-General Cecil Percival Heywood, , (late Coldstream Guards), Half-Pay List.", "\n Major-General Robert John Collins, , (late The Royal Berkshire Regiment (Princess Charlotte of Wales's)), Half-Pay List.", "\n Colonel (temporary Brigadier) Frank Henry Burnell-Nugent, , (late The Rifle Brigade (Prince Consort's Own)), Commander, Tientsin Area.", "\n Colonel William Hugh Leonard, , retired pay, late Indian Medical Service.", "\n Colonel (Honorary Brigadier) Alan Campbell-Ross, , retired pay, late Indian Army.", "\n Colonel (temporary Brigadier) Hector Campbell, , Indian Army, Military Adviser-in-Chief, Indian State Forces.", "\n Colonel Gerald Leslie Pepys, , Indian Army, General Staff Officer, 1st Grade, India Office.", "\n Colonel Guy George Egerton Wylly, , Indian Army, Aide-de-Camp to The King, Assistant Adjutant, and Quarter-Master-General, Peshawar District, India.", "\n\nRoyal Air Force\n Air Commodore William Foster MacNeece Foster, .", "\n\nCivil Division\n Rear-Admiral Francis George Gillilan Chilton.", "\n Major-General Gerald Robert Stedall Hickson, , Royal Marines.", "\n Engineer Rear-Admiral Thompson Gurnell.", "\n Thomas Briggs Hunter, .", "\n Rupert Palmer Colomb, Principal Clerk, Committee and Private Bill Office, House of Commons.", "\n Walter Cecil Eaton, Principal Assistant Secretary, Board of Education.", "\n Reginald Herbert Hill, Assistant Secretary, Ministry of Transport.", "\n Harold Richard Scott, Chairman of the Prison Commission.", "\n Arthur Landsborough Thomson, , Assistant-Secretary, Medical Research Council.", "\n\nOrder of the Star of India\n\nKnight Commander of the Order of the Star of India (KCSI)\n Captain His Highness Maharaja Aditya Narayan Singh Bahadur, Maharaja of Benares, United Provinces.", "\n Khan Bahadur Shaikh Sir Ghulam Hussain Hidayatullah, Member and Vice-President of the Executive Council of the Governor of Bombay.", "\n\nCompanion of the Order of the Star of India (CSI)\n Herbert Aubrey Francis Metcalfe, , of the Political Department, Foreign Secretary to the Government of India.", "\n Hubert Calvert, , Indian Civil Service, Financial Commissioner, Punjab.", "\n Cecil Bernard Cotterell, , Indian Civil Service, Member of the Board of Revenue, Madras.", "\n Eric Charles Miéville, , Private Secretary to His Excellency the Viceroy.", "\n Reginald Maitland Maxwell, , Indian Civil Service, Secretary to the Government of Bombay, Home Department, Bombay.", "\n Arthur Henderson Mackenzie, , Indian Educational Service, Director of Public Instruction, United Provinces.", "\n\nOrder of Saint Michael and Saint George\n\nKnight Grand Cross of the Order of St Michael and St George (GCMG)\n Sir Alexander Ransford Slater, , Captain-General and Governor-in-Chief of Jamaica.", "\n Lieutenant-General Sir Arthur Grenfell Wauchope, , High Commissioner and Commander-in-Chief of Palestine.", "\n\nKnight Commander of the Order of St Michael and St George (KCMG)\n The Honourable Thomas Rainsford Bavin, , formerly Premier of the State of New South Wales.", "\n The Honourable Walter Massy Greene, Assistant Treasurer, Commonwealth of Australia.", "\n Captain The Honourable Bede Edmund Hugh Clifford, , Governor and Commander-in-Chief of the Bahama Islands.", "\n Sir John Campbell, , Economic and Financial Adviser to the Secretary of State for the Colonies.", "\n Sir James Currie, , Chairman of the Governing Body of the Imperial College of Tropical Agriculture, Trinidad, Member of the Advisory Committee on Education in the Colonies, and Director of the Empire Cotton Growing Corporation.", "\n Joseph Addison, , His Majesty's Envoy Extraordinary and Minister Plenipotentiary at Prague.", "\n Reginald Hervey Hoare, , His Majesty's Envoy Extraordinary and Minister Plenipotentiary at Tehran.", "\n George Augustus Mounsey, , an Assistant Under-Secretary of State in the Foreign Office.", "\n\nCompanion of the Order of St Michael and St George (CMG)\n The Honourable William Charles Angwin, lately Agent-General in London for the State of Western Australia.", "\n John Saxon Barton, Stipendiary Magistrate, Napier. ", "For public services in the Dominion of New Zealand.", "\n Thomas Lindsay Buick. ", "For public services in the Dominion of New Zealand.", "\n The Honourable Lionel Cripps, Speaker of the Legislative Assembly of Southern Rhodesia.", "\n Robert Ewing, Federal Commissioner of Taxation, Commonwealth of Australia.", "\n Frederick William Field, His Majesty's Senior Trade Commissioner in Canada and Newfoundland.", "\n Colonel Frederick Arthur Maguire, , Deputy Director, Army Medical Services, New South Wales, Australian Military Forces.", "\n Archibald Grenfell Price, , Master, St. Mark's College, and Member of the Council, University of Adelaide. ", "For services to the Commonwealth of Australia.", "\n Leonard Arthur Robb, President of the New South Wales Branch of the Returned Sailors and Soldiers Imperial League of Australia.", "\n Lieutenant-Colonel Alexander Elder Beattie, , Colonial Secretary, Gibraltar.", "\n John Langton Gilks, , East African Medical Service, Director of Medical and Sanitary Services, Kenya.", "\n Eric Robert James Hussey, , Director of Education, Nigeria.", "\n Philip Euen Mitchell, , Secretary for Native Affairs, Tanganyika Territory.", "\n Major Herbert Walter Peebles, , Administrator of Saint Vincent, Windward Islands.", "\n Paulus Edward Pieris, , Public Trustee, Ceylon.", "\n Eustace Lindsay Scott, , Chief Secretary to the Government, Uganda Protectorate.", "\n Lieutenant-Colonel Cyril Aveling Shute, , Indian Army, Officer Commanding, Trans-Jordan Frontier Force.", "\n John Strachan, , General Manager and Chief Engineer, Federated Malay States Railways.", "\n Lieutenant-Colonel Oscar Ferris Watkins, , Provincial Commissioner, Kenya.", "\n Frank Trelawny Arthur Ashton-Gwatkin, a First Secretary in the Foreign Office.", "\n Ernest Bristow, His Majesty's Consul-General at Isfahan.", "\n Reader William Bullard, , His Majesty's Consul-General at Leningrad.", "\n Henry Charles Dick, , His Majesty's Consul-General at Vienna.", "\n Major William Kerr Fraser-Tytler, , lately Counsellor in His Majesty's Legation at Kabul.", "\n Clifford John Norton, Private Secretary to the Permanent Under-Secretary of State for Foreign Affairs.", "\n Edwin Geoffrey Sarsfield-Hall, Governor of Khartoum Province, Sudan.", "\n\nOrder of the Indian Empire\n\nKnight Grand Commander of the Order of the Indian Empire (GCIE)\nHonorary Knight Grand Commander\n General His Highness Projjwal-Nepal-Taraati-Pravala Gorkha Dakshina Babu Prithuladheesh Sri Sri Sri Maharaja Sir Joodha Shumshere Jung Bahadur Rana, , Prime Minister and Supreme Commander-in-Chief of Nepal.", "\n\nKnight Commander of the Order of the Indian Empire (KCIE)\n His Highness Raja Pratap Singh, , Raja of Ali Rajpur, Central India.", "\n Ramasamy Chetty Kandasamy Shanmukham Chetty, President of the Legislative Assembly.", "\n James Alexander Ossory Fitzpatrick, , of the Political Department, Agent to the Governor-General, Punjab States.", "\n William David Russell Prentice, , Indian Civil Service, Member of the Executive Council of the Governor of Bengal.", "\n\nCompanion of the Order of the Indian Empire (CIE)\n Thakor Saheb Shri Madarsinhji Vakhatsinhji, Ruler of the Sayla State, Western India States Agency.", "\n Lieutenant-Colonel James Leslie Rose Weir, of the Political Department, Agent to the Governor-General for the Gujarat States and Resident at Baroda.", "\n Edmund Currey Gibson, of the Political Department, lately Commissioner, Ajmer-Merwara, and now Agent to the Governor-General, Eastern States, Ranchi.", "\n Nasservanji Navroji Anklesaria, , Barrister-at-Law.", "\n William Bailie Brett, Indian Civil Service, Secretary to the Government of Bihar & Orissa, Finance Department.", "\n Charles St. Leger Teyen, , lately Secretary to the Government of the United Provinces, Finance Department.", "\n Colonel (Temporary Brigadier) Robert Heath Anderson, Commanding 3rd (Jhelum) Infantry Brigade.", "\n John Hunter Adam, , Indian Police, Inspector-General of Police, North-West Frontier Province.", "\n Herbert Percival Thomas, Chief Engineer, Hydro-Electric Department, Punjab.", "\n Timothy Patrick Moriarty O'Callaghan, Indian Police, Inspector-General of Police, Assam.", "\n John Davidson, , Indian Audit and Accounts Service, Accountant-General, Burma.", "\n Captain Lewis Gonne Eyre Crabbe, , Royal Navy, lately Senior Naval Officer in the Persian Gulf.", "\n Brevet-Colonel James McPherson, , Indian Medical Service, Residency Surgeon in Mysore, Bangalore.", "\n James de Graaff Hunter, Survey of India, Director, Geodetic Branch, India.", "\n Donald Henry Charles Drake, Indian Civil Service, lately Political Agent, Central Provinces States.", "\n Arthur Gordon Leach, Indian Civil Service, Collector and District Magistrate, Madras.", "\n David Burnett Meek, , Indian Educational Service, Director-General of Commercial Intelligence and Statistics, Bengal, now serving under the Government of India.", "\n Lieutenant-Colonel Hugh Francis Eardley Childers, Indian Army, Commandant, Reserve Battalion, Military Police, Pyawbwe, Burma.", "\n Lieutenant-Colonel Elliot James Dowell Colvin, of the Political Department, Prime Minister, Kashmir State.", "\n Richard Stanley Purssell, , Deputy Director-General of Posts and Telegraphs.", "\n Lieutenant-Colonel Walter Lidwell Harnett, Indian Medical Service, Professor of Surgery, Medical College, Calcutta, and Surgeon to the College Hospital, Bengal.", "\n Khan Bahadur Kavasji Jamshedji Petigara, , Indian Police, Deputy Commissioner of Police (Special Branch), Bombay.", "\n Alan Michael Green, Indian Civil Service, Deputy High Commissioner for India, London.", "\n Jamshedji Nasarvanji Duggan, , Professor of Ophthalmic Medicine and Surgery, Grant Medical College, and Superintendent, C. J. Ophthalmic Hospital, Bombay.", "\n Arthur John Leech, , Managing Director, Messrs. T. A. Taylor & Co. Ltd., Madras.", "\n Herbert Michael Shircore, Merchant, Messrs. M. Sarkies & Sons, Narayanganj, Chairman, Narayanganj Municipality, Bengal.", "\n\nRoyal Victorian Order\n\nKnight Grand Cross of the Royal Victorian Order (GCVO)\n Charles John Robert, Baron Clinton.", "\n Colonel The Honourable Sir George Arthur Charles Crichton, .", "\n The Honourable Sir Harry Julian Stonor, .", "\n Sir Edward Elgar, .", "\n\nKnight Commander of the Royal Victorian Order (KCVO)\n Rear-Admiral Basil Vernon Brooke, .", "\n Lieutenant-Colonel Stewart Bleakley Agnew Patterson, .", "\n Colonel Thomas Peel Dunhill, .", "\n Commander Morton Smart, , late Royal Naval Volunteer Reserve.", "\n\nCommander of the Royal Victorian Order (CVO)\n Walter Rangeley Maitland Lamb, .", "\n Nevile Montagu Butler.", "\n Claude Taylor, .", "\n Frank Aubrey Newsam, .", "\n\nMember of the Royal Victorian Order, 4th class (MVO)\n Lieutenant-Colonel Alan Bruce McPherson, .", "\n Thomas Henry Norton, \n Oliver Dayrell Paget Paget-Cooke.", "\n Alfred John Newling.", "\n\nMember of the Royal Victorian Order, 5th class (MVO)\n Thomas Daniel Williams, .", "\n\nOrder of the British Empire\n\nDame Commander of the Order of the British Empire (DBE)\nCivil Division\n Gertrude Mary, Baroness Denman, , Chairman of the National Federation of Women's Institutes.", "\n Kathleen, Lady Simon. ", "In recognition of her work in connection with the international campaign in support of the Anti-Slavery Convention.", "\n\nKnight Commander of the Order of the British Empire (KBE)\nCivil Division\n Percy Walter Llewellyn Ashley, , Secretary, Import Duties Advisory Committee.", "\n James Rae, Under-Secretary, His Majesty's Treasury.", "\n Colonel Stephen Shepherd Allen, , formerly Administrator of Western Samoa, Dominion of New Zealand.", "\n Khan Bahadur Nawab Shah Jehan Khan, Nawab of Dir, North-West Frontier Province.", "\n Wilfrid Thomas Southorn, , Colonial Secretary, Hong Kong.", "\n\nCommander of the Order of the British Empire (CBE)\nMilitary Division\nRoyal Navy\n Captain Henry James Feakes, Royal Australian Navy.", "\n\nArmy\n Colonel Erril Robert O'Hara, , Assistant Director of Supplies and Transport, Malta.", "\n\nCivil Division\n Francis Paul Armitage, Director of Education, Leicester County Borough.", "\n Dorothy Edith Bannon, Matron-in-Chief of the London County Council Hospital Service.", "\n Henry Joseph Comyns, Assistant Solicitor, Ministry of Health.", "\n Henry Mendelssohn Hake, Director, Keeper and Secretary, National Portrait Gallery.", "\n Arthur Canler Hayward, Director of Audit, Exchequer and Audit Department.", "\n Helen, Lady Leslie Mackenzie. ", "For public services in the interests of women and children in Scotland.", "\n Hugh John Cole Marshall, , Secretary to the Royal Literary Fund.", "\n The Reverend Peter Thomas Mignot, Founder of the Mignot Hospital, Alderney. ", "For public services in the Channel Islands.", "\n Edwin Lawrence Mitchell, , Assistant Secretary, Ministry of Agriculture & Fisheries.", "\n Victor Edward Pullin, , Director of Radiological Research, Research Department, Royal Arsenal, Woolwich.", "\n The Reverend Neil Ross, , President of An Comunn Gàidhealach. ", "For services to Celtic scholarship.", "\n Ernest Stanford, a member of the Executive of the National Labour Committee. ", "For public and political services.", "\n Margaret Alicia Waring, , Member of Parliament for the Iveagh Division of Northern Ireland since 1929. ", "For political, philanthropic and public services.", "\n Augustus Duncan Webb, Principal, Intelligence Branch, Board of Customs & Excise.", "\n John Joseph Wills, Controller, Companies Department, Board of Trade.", "\n Albert Ernest Branch, , lately Director of the Breeding Department, Egyptian Royal Society of Agriculture.", "\n Timothy Florence Breen, , Press Officer at His Majesty's Embassy in Berlin.", "\n Calder Marshall, Chairman of the British Chamber of Commerce, Shanghai.", "\n William Robert Alexander, Clerk of Parliaments, State of Victoria.", "\n Herbert Charles Brown, Secretary, Department of the Interior, Commonwealth of Australia.", "\n Henry Chapman, General Manager of the Beira & Mashonaland & Rhodesia Railways.", "\n Frederick Hugh Dutton, , Director of Education, Basutoland.", "\n Alfred Harold Gaze, General Manager of the British Phosphate Commission in Nauru.", "\n James Taylor, Chairman of the Australian Olympic Federation. ", "For public services to the Commonwealth of Australia.", "\n Lieutenant-Colonel Arthur Gaussen Murray, Indian Army, Command Controller of Accounts, Northern Command.", "\n Rai Bahadur Paresh Nath Mukerji, Postmaster-General, Madras.", "\n John Thorne Masey Bennett, , Indian Police, Personal Assistant to the Inspector-General of Police, Punjab.", "\n John Frederick Gennings, Barrister-at-Law, Director of Information and Labour Intelligence, Registrar of Trades Unions, and Commissioner of Workmen's Compensation, Bombay.", "\n Rao Bahadur Madho Ganesh Deshpande, Landholder and Chairman, Central Provinces and Berar Provincial Co-operative Bank, Nagpur, Central Provinces.", "\n Henry Arthur Ballou, , Commissioner of Agriculture for the West Indies and Professor of Entomology, Imperial College of Tropical Agriculture, Trinidad.", "\n Lieutenant-Colonel Harry William Morrey Bamford, , Inspector-General of Police, Gold Coast.", "\n Major James Alfred Galizia, , Treasurer, Malta.", "\n John Mapletoft Nethersole, Administrator-General and Trustee in Bankruptcy, Jamaica.", "\n Major Charles Edward Williams, , Chief Inspecting Engineer, Office of the Crown Agents for the Colonies.", "\nHonorary Commander\n Dato Sedia Raja Abdullah bin Haji Dahan, Undang of Rembau, Negri Sembilan, Federated Malay States.", "\n\nOfficer of the Order of the British Empire (OBE)\nMilitary Division\nRoyal Navy\n Commander Wharton Stanley Gray.", "\n Engineer Commander William Frederick Paffett.", "\n Captain George Harry Stuart Furlong, , Royal Naval Reserve (Retd.)", "\n Paymaster Commander Ernest William Trivett, Royal Australian Navy.", "\n\nArmy\n Lieutenant-Colonel Kenneth Forsyth Angus, , Territorial Army Reserve of Officers, late Commanding Tynemouth Heavy Brigade, Royal Artillery, Territorial Army.", "\n Lieutenant-Colonel and Brevet Colonel John Ewart Trounce Barbary, , Territorial Army. ", "Reserve of Officers, late Commanding Cornwall Heavy Brigade, Royal Artillery, Territorial Army.", "\n Major Bijitendra Basu, Indian Medical Service, Specialist in Ophthalmology, Rawalpindi District, India.", "\n Major Arthur William Beard, Royal Engineers, Indian Army, Garrison Engineer, Lucknow, India.", "\n Captain John Robert Birchall, , Army Educational Corps, Chief Instructor, Army School of Education, India.", "\n Lieutenant-Colonel Alexander Dawson, , Royal Army Medical Corps, Assistant Director of Pathology, Eastern Command.", "\n Lieutenant-Colonel Charles Albert Denaro, retired pay, late Royal Malta Artillery.", "\n Colonel Robert Dickie, , Territorial Army, late Commanding, Forth Heavy Brigade, Royal Artillery, Territorial Army.", "\n Major Robinson Elsdale, , Royal Corps of Signals.", "\n Lieutenant-Colonel George Fladgate Finch, , Commanding, The Inns of Court Regiment, Territorial Army.", "\n Lieutenant-Colonel Joseph Holmes Gettins, , Army Educational Corps, Commandant, Army School of Education, Shorncliffe.", "\n The Reverend John Wesley Knox Griffin, , Chaplain to the Forces (2nd Class), Royal Army Chaplains' Department, Northern Ireland District.", "\n Temporary Major St. George Eyre Harris, , Royal Army Medical Corps, Cambridge Hospital, Aldershot.", "\n Major (Commissary) Harry Joyner, , Indian Corps of Clerks (India Unattached List), Chief Clerk, Headquarters, Northern Command, India.", "\n Major Donald Gordon MacLeod, Officer Commanding, Scottish Company, Straits Settlements Volunteer Force.", "\n Major Paul Phillips Mallam, , Glasgow Academy Contingent, Officers' Training Corps.", "\n Captain Lavinius Brice Marchant, Indian Army Service Corps, Station Transport Officer, Rawalpindi-Murree Area, India.", "\n Major (Mechanist Officer) George William Martin, , retired pay, late Royal Army Service Corps.", "\n Quartermaster and Honorary Major John McArthur, , Instructional Corps, Australian Military Forces.", "\n Lieutenant-Colonel & Brevet Colonel Sydney Arthur Medcalf, , 44th (Home Counties) Divisional Train, Royal Army Service Corps, Territorial Army.", "\n Major (Commissary) Wilfred Morris, , Indian Corps of Clerks (India Unattached List), Chief Clerk, Headquarters, Southern Command, India.", "\n Major Eric Newbold, Officer Commanding, Eurasian Company, Straits Settlements Volunteer Force.", "\n Lieutenant-Colonel (Quarter-Master) Arthur Richard Newling, Extra Regimentally Employed List, Quartermaster and Adjutant, Royal Military School of Music.", "\n Lieutenant-Colonel Douglas Duke Paine, , Commanding Officer, Army Service Corps, 3rd Australian Division, Victoria, Australian Military Forces.", "\n Captain Alfred Henry Dunlop Phillips, retired pay, late Royal Artillery, Ordnance Committee.", "\n Major and Commissary of Ordnance Frederick Sydney Smith, retired pay, late Royal Army Ordnance Corps.", "\n Major Francis Basil Brook Spragge, , Royal Artillery, late Brigade Major, Bermuda.", "\n Captain John Stephenson, The Hazara Pioneers, Indian Army.", "\n Major Alexander Smith Turnham, 10th Royal Hussars (Prince of Wales's Own).", "\n\nRoyal Air Force\n Wing Commander Arthur Geoffrey Nevill Belfield.", "\n Wing Commander Coningsby Leslie Colbran, .", "\n Squadron Leader Thomas Edward Drowley.", "\n Wing Commander William Hopton Anderson, , Royal Australian Air Force.", "\n\nCivil Division\n George Abbiss, , Chief Constable, Metropolitan Police.", "\n Alfred John Ardern, Postmaster-Surveyor of Belfast.", "\n Allan Carruth, Divisional Land Officer, Department of Agriculture for Scotland.", "\n Councillor John William Cooke. ", "For many years Secretary, and now Chairman, of the Holland-with-Boston Liberal Association. ", "For political and public services in Lincolnshire.", "\n Thomas William Cooper, Senior Inspector of Taxes, Board of Inland Revenue.", "\n James Eraser Cunninghame, , Chairman of the Leith Unionist Association. ", "For political and public services in Scotland.", "\n Jessie Isa Falconer, Head Teacher and Principal of the Royal Institution for the Blind, Birmingham.", "\n Alderman Francis Thomas Foulger, Chairman of the Northern London War Pensions Committee.", "\n George Julian Gilbert, , Principal Clerk, Ministry of Pensions.", "\n Archibald Gilpin, Assistant Director of Works, Air Ministry.", "\n Frank Wyndham Hirst, Trust Officer, Public Trustee Office.", "\n Frederick Houghton, , Chairman of the Oldham & District Local Employment Committee.", "\n William Charles Jenkins, President of the Swansea West Liberal Association. ", "For political and public services.", "\n Lilian Le Mesurier, Has organised voluntary work in connection with the London Boys Prison.", "\n Charles George Maby, , Chief Constable of the Bristol City Police.", "\n David Johnston MacDonald, , Member of the Dundee Local Employment Committee and lately Chairman of the Local Juvenile Advisory Committee.", "\n James MacDougall, . ", "For political and public services in Scotland.", "\n John Mackinnon, Assistant Chief Constable, Edinburgh City Police.", "\n Donald Maclean, , Headmaster, Boroughmuir Secondary School, Edinburgh.", "\n Lieutenant-Colonel Archibald Matheson, , Principal, Ministry of Transport.", "\n Fred Morton, Deputy Divisional Controller, North Eastern Division, Ministry of Labour.", "\n Evan Edward Owens, . ", "For political and public services in Glamorganshire.", "\n Hugh De Bock Porter, Official Solicitor, and Assistant Steward of the Manors, Ecclesiastical Commission.", "\n James Putnam. ", "Lately Superintending Executive Officer, India Office.", "\n Joseph Harold Salmon, , Director of Lands & Accommodation, HM Office of Works & Public Buildings.", "\n Samuel Sloan, Principal Establishment Officer, Ministry of Finance, and Secretary, Civil Service Commission, Northern Ireland.", "\n Emily Julia Slocock, Superintending Inspector of Factories, Home Office.", "\n Richard Arthur Thomas, , Chairman of the Metalliferous Mining Advisory Committee, Mines Department of the Board of Trade.", "\n Leonard James Veit, , City Engineer and Surveyor to the Westminster City Council.", "\n Jane Webster, Clerk in the Lord Chamberlain's Office, Buckingham Palace.", "\n John Thomas Whitelaw, District Manager, Post Office Telephones.", "\n John Alexander Cameron, His Majesty's Consul at Danzig.", "\n The Reverend Prebendary Frederic Anstruther Cardew, Rector of the Anglican Church, Paris, and Rural Dean for France.", "\n Clermont Grantham Hill, Senior Surgeon, Khartoum Hospital.", "\n Major Claude Scudamore Jarvis, Governor of Sinai.", "\n Harold Clayforth Mason, Government Architect, Iraq.", "\n Karl Reginald Cramp, President, Royal Australian Historical Society, State of New South Wales.", "\n The Reverend John Flynn, Superintendent of the Australian Inland Mission, Commonwealth of Australia.", "\n Mona Godhard. ", "For charitable services in the State of New South Wales.", "\n John William Justham, Manager of the Co-operative Wholesale Society's branches at Bristol and Cardiff. ", "Member of the Food Products Committee of the Empire Marketing Board.", "\n Makea Nui Tinirau Ariki of Rarotonga, Paramount Chief of Cook Island, Dominion of New Zealand.", "\n Colin Mackenzie Pitt, Surveyor and Engineer, Public Works Department, State of Tasmania.", "\n Frederick Geoffrey Shedden, Assistant on External Affairs to the Resident Minister in London, Commonwealth of Australia.", "\n Albert Kinder Townsend, Accountant, Central Staff, Department of Trade & Customs, Commonwealth of Australia.", "\n Hugh Wright, lately Librarian, Michel Library, State of New South Wales.", "\n Khan Bahadur Allahbakhsh, , Zamindar, President of the District Local Board, Sukkur, Sind, Bombay.", "\n Captain Basil Laing Clay, Indian Army, lately Private Secretary to His Excellency the Governor of Burma.", "\n Alfred William Connolly, , Works Manager, Rifle Factory, Ishapore, Bengal.", "\n Abul Fazl Abdul Hamid, Indian Police, Superintendent of Police, Bihar & Orissa.", "\n Captain Thomas Francis Henry Kelly, Indian Army, Private Secretary to His Excellency the Governor of the Central Provinces.", "\n Kunwar Haji Ismaiel Ali Khan, , Chairman, City Board, Mussoorie, United Provinces.", "\n Albert John King, Indian Service of Engineers, Executive Engineer, Personal Assistant to the Chief Engineer to the Government of Bengal.", "\n Ahmedbhoy Ismailbhoy Abdoolabhoy Lalljee, Head of the firm of Nasirbhoy Lalljee, Aden.", "\n Lachlan Macpherson Ryley, , Inspector of Small Arms, Ishapore, Bengal.", "\n Commander Robert Severs, , Royal Naval Reserve (Retd.), ", "Indian Marine Service, lately Personal Assistant to the Presidency Port Officer and Agent for Government Consignments, Madras.", "\n Erachshaw Dinshaw Shroff, , Health Officer of the Karachi Municipality, Bombay.", "\n Captain Maurice Revell Sinclair, Indian Medical Service, Officer on special duty with the Political Officer in Sikkim.", "\n Arthur Falconer Barren. ", "For services in connection with the development of the tobacco industry in the Nyasaland Protectorate.", "\n William Alexander Jex Bowman. ", "For services in connection with the development of the grapefruit industry in British Honduras.", "\n Edwin Arthur Brown, Municipal Commissioner, Singapore, Straits Settlements.", "\n Major Henry Noel Davies, , Deputy General Manager of Railways, Tanganyika Territory.", "\n John Coleman de Graft Johnson, Assistant Secretary for Native Affairs, Gold Coast.", "\n Captain Edward Nigel Park, , District Officer, Somaliland Protectorate.", "\n Charles Henry Pierre, , Unofficial Member of the Legislative Council and Member of the Executive Council, Colony of Trinidad & Tobago. ", "For public services.", "\n Harold Francis Cartmel-Robinson, District Commissioner, Northern Rhodesia.", "\n The Reverend Samuel Hanna Semple, , Principal of the Scots College, Safad, Palestine.", "\n Elwood D'Arcy Tibbits, , Assistant Colonial Secretary, Leeward Islands.", "\n Aloysius Gordon Tillekeratne, Assistant Postmaster General, Ceylon.", "\n The Reverend Harry Webster, General Superintendent of the Methodist Mission, Gold Coast. ", "For public services.", "\n Florence Kerr Wilson. ", "For services to civil aviation in Kenya.", "\n William Younger, Superintendent of Police, Criminal Investigation Department, Uganda Protectorate.", "\nHonorary Officer\n Michel Fred Abcarius, Senior Assistant Treasurer, Palestine.", "\n\nMember of the Order of the British Empire (MBE)\nMilitary Division\nRoyal Navy\n Paymaster Lieutenant Francis Samuel Vallis, Royal Navy.", "\n Commissioned Wardmaster William Herbert Pickard, Royal Navy.", "\n Sergeant-Major Arthur Alfred Attwood, , Royal Marines.", "\n Boatswain Sheikh Ibrahim Kaka, Royal Indian Marine.", "\n Commissioned Gunner (T) George Thomas Saunders, Royal Australian Navy.", "\n\nArmy\n Captain and Paymaster Robert Cuming de Vere Askin, , Royal Army Pay Corps.", "\n Temporary Captain Frank Arthur Shepherd Atterton, Royal Engineers.", "\n No. ", "6825001 Warrant Officer Class II, Regimental Quartermaster-Sergeant Leslie Creswell Barrow, Honourable Artillery Company (Infantry Battalion), Territorial Army.", "\n Captain Frederick Bartlett, Quarter-Master, retired pay, late Royal Army Service Corps.", "\n Captain (Deputy Commissary) George Frederick Baxter, Military Engineer Services (India Unattached List), Garrison Engineer, Delhi, India.", "\n Captain Joseph George Morrogh Bernard, The East Yorkshire Regiment, late attached Sudan Defence Force.", "\n No. ", "1850609 Warrant Officer Class I, Superintending Clerk Charles George Bourne, Royal Engineers, Aldershot Command.", "\n Warrant Officer Class II, Quartermaster-Sergeant Percy Henry Bryant, Royal Army Ordnance Corps, attached Egyptian Army.", "\n Lieutenant Edmund Graham Buckley, The Rifle Brigade (Prince Consort's Own), attached Iraq Levies.", "\n Captain Anthony Charles Buxton, retired pay, late Royal Engineers, late Commanding, 35th (Fortress) Company, Royal Engineers.", "\n Quartermaster and Honorary Major Marmaduke Coats, Instructional Corps, Australian Military Forces.", "\n No. ", "2556066 Warrant Officer Class II, Company Sergeant-Major George Urban Cooke, , 46th (North Midland) Divisional Signals, Royal Corps of Signals, Territorial Army.", "\n Captain Harry Stephen Crane, Royal Artillery, Range Officer, Salisbury Plain.", "\n Captain Harry Clifford de la Bere, Royal Army Service Corps, China Command.", "\n No. ", "6515026 Warrant Officer Class II, Company Sergeant-Major Frank Denton, 1st City of London Regiment (The Royal Fusiliers), Territorial Army.", "\n No. ", "3433657 Warrant Officer Class II, Company Sergeant-Major William Fletcher, , 8th Battalion, The Lancashire Fusiliers, Territorial Army.", "\n No. ", "705101 Warrant Officer Class II, Colour Sergeant (local Company Sergeant-Major) Robert Alfred Frazer, The Royal Scots (The Royal Regiment), attached Iraq Levies.", "\n Captain Gwynne Griffith, , Assistant Adjutant, Ceylon Light Infantry, Ceylon Defence Force.", "\n Captain and Ordnance Mechanical Engineer 3rd Class, Frederick Colin Johnstone-Hall, , Royal Army Ordnance Corps, London District.", "\n No. ", "7681309 Warrant Officer Class I, Sergeant-Major Edward Harrison, Military Mounted Police, Aldershot Command.", "\n No. ", "7720693 Warrant Officer Class I, Instructor (Education) William Frederick Hawkins, Army Educational Corps, Malta.", "\n Conductor Henry Jenkins, Indian Army Service Corps (India Unattached List), No. ", "5 District Supply Company, Dargai, India.", "\n Quartermaster and Honorary Major William Kennedy, , Instructional Corps, Australian Military Forces.", "\n Lieutenant Ernest James Kenneison, Federated Malay States Volunteer Force.", "\n Captain Tom Ashley Lakeman, Royal Tank Corps, Assistant Instructor, Tank Gunnery School.", "\n Risaldar Lall Singh, Probyn's Horse (5th King Edward's Own Lancers), Indian Army, Aide-de-Camp to His Excellency the Commander-in-Chief in India.", "\n Conductor Francis Arthur Marshall, Indian Corps of Clerks (India Unattached List), Headquarters, Northern Command, India.", "\n No. ", "2714122 Warrant Officer Class I, Superintending Clerk, Thomas Dominic McCarthy, Irish Guards.", "\n No. ", "2968407 Warrant Officer Class II, Company Sergeant-Major John McDonald, , 8th (The Argyllshire) Battalion, The Argyll & Sutherland Highlanders (Princess Louise's), Territorial Army.", "\n No. ", "7040151 Warrant Officer Class I, Garrison Sergeant-Major John McGerr, Garrison Staff, Malta.", "\n Lieutenant (local Captain) Frederick James McWhinnie, Regular Army Reserve of Officers, The King's Regiment, attached Iraq Levies.", "\n No. ", "7717049 Warrant Officer Class I, Garrison Sergeant-Major William Maxwell, Garrison Staff, Chatham.", "\n Lieutenant (local Captain) Beverley Charles Moody, Regular Army Reserve of Officers, General List, attached Iraq Levies.", "\n No. ", "S/1334 Warrant Officer Class I, Staff Sergeant-Major Harold Percy Newberry, Royal Army Service Corps, Western Command.", "\n No. ", "2200754 Warrant Officer Class II, Company Sergeant-Major Cecil Leonard Newman, 47th (2nd London) Divisional Engineers, Royal Engineers, Territorial Army.", "\n Lieutenant Walter Fisher Ridler, late Royal Artillery, Commandant, Tientsin British Municipal Emergency Corps.", "\n No. ", "7579012 Warrant Officer Class II, Armament Quartermaster-Sergeant Edward Roberts, Royal Army Ordnance Corps, Coast Artillery School, Shoeburyness.", "\n No. ", "2744741 Warrant Officer Class I, Regimental Sergeant-Major Edward Robertson, , Depot, The Black Watch (Royal Highlanders).", "\n No. ", "1660562 Warrant Officer Class II, Battery Sergeant-Major John William Rose, Lancashire & Cheshire Heavy Brigade, Royal Artillery, Territorial Army.", "\n No. ", "3589012 Warrant Officer Class II, Regimental Quartermaster-Sergeant John Sarginson, 4th (Cumberland & Westmorland) Battalion, The Border Regiment, Territorial Army.", "\n No. ", "S/1246 Warrant Officer Class I, 1st Class Staff Sergeant-Major Charles Joseph Saunders, Royal Army Service Corps, Adjutant-General's Department, The War Office.", "\n No. ", "1396135 Warrant Officer Class II, Quartermaster-Sergeant Saddler Joseph Eric Stevens, 11th (Honourable Artillery Company & City of London Yeomanry) Brigade, Royal Horse Artillery, Territorial Army.", "\n Quartermaster and Honorary Major William Walter Tracy, Instructional Corps, Australian Military Forces.", "\n Lieutenant (Quartermaster) John Stanley Webber, 2nd Battalion, The Somerset Light Infantry (Prince Albert's).", "\n No. ", "7657270 Warrant Officer Class I, Staff Sergeant-Major Albert Wills, Royal Army Pay Corps, The War Office.", "\n Risaldar Mohomed Yakub Khan, Indian Army Veterinary Corps, In Charge Military Veterinary Hospital, Karachi.", "\n Lieutenant Frederick Walter Young, 1st Battalion, The Lincolnshire Regiment.", "\nHonorary Member\n Yuzbashi Mohsin bin Alowi Aulaqi, Aden Protectorate Levies.", "\n\nRoyal Air Force\n Flight Lieutenant Lawrence Fleming Pendred, .", "\n Flying Officer Francis Patrick Donovan.", "\n Warrant Officer Joseph Enoch Beresford.", "\n Warrant Officer Daniel Henry Newton.", "\n\nCivil Division\n Thomas Albert Bennett, Accountant, Mines Department of the Board of Trade.", "\n Harry William Strafford Biden, Staff Officer, Scottish Education Department, Edinburgh.", "\n Charles Blackwood, Head Postmaster at Bath, General Post Office.", "\n John Howard Blair, Chief Collector of Taxes in Belfast, Board of Inland Revenue.", "\n Edgar Owen Byers, Junior Examiner, HM Land Registry.", "\n Minnie Louise Cale, Accountant, Ministry of Labour.", "\n Georgina Agnes Brown Cameron, Superintendent Health Visitor and Inspector of Midwives, Newcastle-on-Tyne.", "\n Clarence Clixby Cartwright, Principal Clerk, Bankruptcy Department, Supreme Court of Judicature.", "\n Gwynedd Lennox Chase, Superintendent of Typists, Import Duties Advisory Committee.", "\n Ernest Louis Clair, Superintendent, Higher Grade, Central Telegraph Office, General Post Office.", "\n Albert John Davies, Superintendent and Deputy Chief Constable, Cornwall Constabulary.", "\n Hannah Mary Frank, Headmistress, Crosby Infants School, Scunthorpe, Lincolnshire.", "\n Clara Fyfe. ", "For political and public services in Newcastle-upon-Tyne.", "\n Charles Henry James Garland, , Organising Secretary, National Playing Fields Association.", "\n Walter James Garnett, Acting Assistant Principal, Oversea Settlement Department (serving with the representative in Australia of HM Government in United Kingdom).", "\n Major Harold Wilkinson Dale-Glossop, Commandant, Metropolitan Special Constabulary Reserve.", "\n James William Golsby, Senior Intelligence Officer, Department of Overseas Trade.", "\n Edith Elizabeth Greaves, Matron of the City of London Maternity Hospital, City Road.", "\n William Edward Hardwick, , Headmaster, St. Peter's Church of England Schools, Harborne, Birmingham.", "\n James Woodhatch Hills, Headmaster, Boys' Department, St. Luke's Church of England School, Canning Town.", "\n William James Hodgetts, Assistant Engineer, General Post Office.", "\n Henry Home, Civil Assistant and Accountant, No. ", "3 Stores Depot, Royal Air Force.", "\n Colwell Iddon, Higher Clerical Officer, India Office.", "\n Charles Symonds Jones, Superintendent, Cardiff City Police.", "\n David John Jones, Clerk and Solicitor to the Rhondda Urban District Council.", "\n Lieutenant Henry William Jones, , Retired Officer, Adjutant-General's Department of the War Office.", "\n John Tysilio Jones, , Chairman of the Wrexham Local Employment Committee.", "\n Valentine Tom Keen, , Chairman of the Fareham Urban District Council, and for 20 years Goods Foreman on the London & South Western Railway.", "\n Elizabeth Alletta Clark-Kennedy, Maternity Sister, Radcliffe Infirmary.", "\n John Hamilton Killough, Superintending Officer, Ministry of Labour, Northern Ireland.", "\n Alice Vera Knight, Supervisor of Typists, Clearing Office for Enemy Debts, Board of Trade.", "\n Eileen Janet Lecky. ", "For maternity and child welfare work in Putney.", "\n Marian Macdonald, Chairman of the Children's Sub-Committee of the Stepney & Poplar War Pensions Committee.", "\n Joseph White May, Organiser of Education to the Great Yarmouth Education Committee.", "\n Thomas Morton, Officer of Customs & Excise.", "\n William Murrell, Train-Bearer to the Speaker of the House of Commons.", "\n William Richard Neighbour, Cashier, HM Dockyard, Portsmouth.", "\n Edith Nurse, Chief Supervisor, London Telephone Service, General Post Office.", "\n William O'Dea, Headmaster of St. Anne's School, Ancoats, Manchester. ", "Has for many years represented Catholic Teachers on the Catholic Education Council.", "\n Frank Rowland Palmer, Chief Superintendent, Manchester City Police.", "\n George Pethard, Secretary of the Society of Miniature Rifle Clubs.", "\n Isabella Scott Reid, Superintendent, Wellshill Girls' (Industrial) School, Perth.", "\n Helen Roberts, , Matron, Ministry of Pensions Nursing Service.", "\n Thomas Rossiter, Chairman of the Children's Sub-Committee of the Burton-on-Trent, Lichfield & District War Pensions Committee.", "\n Edward Roughley, Higher Clerical Officer, Secondary Schools Section, Board of Education.", "\n Louisa Ford Sadler. ", "For political and public services in Kent.", "\n Charles Joseph Seaman, , Chairman of the Poplar Juvenile Advisory Committee.", "\n George Steel, , Registrar, HM Office of Works & Public Buildings.", "\n Matilda Tennent. ", "For political and public services in Scotland.", "\n James Wilson, Superintendent, Metropolitan Police.", "\n William Nicholls Winn, Botanist, Royal Botanic Gardens, Kew.", "\n The Reverend Archibald Henry Beer, British Vice-Consul at San Pedro de Macorís, Dominican Republic.", "\n Daisy Bramble. ", "Services in connection with native girls' and mid-wives' schools and native craftsmen of Omdurman.", "\n Commander Walter Francis Brothers, , Royal Naval Reserve (Retd.), ", "British Consular Agent at Ismailia, Egypt.", "\n Arthur Noel Cumberbatch, Assistant to the Commercial Secretary at His Majesty's Legation in Athens.", "\n Joshua Goodall, Chief Draftsman, Sudan Railways.", "\n Eleanor Muriel Henderson, Matron of the British Hospital at Montevideo.", "\n Daniel Albert Newick, Telegraph Department, Baghdad.", "\n Thomas Miller Reid, British Vice-Consul at Orotava, Canary Islands.", "\n Mary Robertson. ", "For services as nurse at Larco Herrera Asylum at Magdalena del Mar, Peru, and for bravery in disarming a criminal lunatic.", "\n George Edward Russell Sandars, District Commissioner, Sudan Political Service.", "\n George Wingrove Vincent, Archivist at His Majesty's Embassy in Moscow.", "\n Edith Anderson. ", "For social and child welfare services in Southern Rhodesia.", "\n Phyllis Mary Boissier, , Matron, Royal Prince Alfred Hospital, Sydney, State of New South Wales.", "\n The Reverend Stanley Garlick Drummond, Honorary Organiser of the Far West Children's Health Scheme, State of New South Wales.", "\n Russell England, Dairy Expert and Inspector, Bechuanaland Protectorate.", "\n Penelope Jane Forbes. ", "For social and child welfare services in Southern Rhodesia.", "\n Thomas Fox. ", "For services in connection with returned soldiers movements in the State of New South Wales.", "\n Robert Ashley Gilfillan, lately Chairman of the Superannuation Fund Board, State of New South Wales.", "\n Captain Grant Clinton Hanlon. ", "For services in connection with returned soldiers movements in the State of New South Wales.", "\n Albert James Odgers, Private Secretary to the Postmaster-General, Commonwealth of Australia.", "\n William Thomas Curtis-Willson. ", "For services in connection with Empire Shopping Week Campaigns at Brighton.", "\n Rai Bahadur Malik Devi Dayal, retired Deputy Superintendent of Police, Delhi City.", "\n Edward William Dunn, Assam Engineering Service, Assistant Engineer, Assam.", "\n Khan Sahib Karmali Ebrahim, Merchant, Bombay.", "\n Edward Charles Garraty, lately Head Appraiser, Customs Department, Burma.", "\n Khan Bahadur Mian Aftab Gul, Rais of Abazai, Peshawar District, North-West Frontier Province.", "\n Piyare Lai Chandu Lai, Diwan, Bilaspur State, Punjab States.", "\n Arthur Henry Whitter Leonard, Superintendent, Dacca Central Jail, Bengal.", "\n Gustave Martin, Director of Music, His Excellency the Governor's Band, Madras.", "\n John Renick Morris, Deputy Superintendent of Police, Punjab.", "\n Rai Bahadur Babu Hardeo Prasad, Advocate, Fyzabad, United Provinces.", "\n Raphael Abraham Raphael, General Merchant and Manager of the Bassein Electric Supply Co., President, Bassein Municipality, Burma.", "\n Gerald Corley Smith of the Imperial Secretariat Service, Assistant Secretary to the Government of India, Commerce Department.", "\n Alfred William Want, Cantonment Superintendent, Nowshera, North-West Frontier Province.", "\n William Frederick Webster, Superintendent of the Reformatory School at Hazaribagh, Bihar & Orissa.", "\n Bamanji Hormusji Mistri, lately Senior Non-European Clerk, Kenya.", "\n Elizabeth Coldwell. ", "For charitable services in Malta.", "\n Charles Cosgrow, lately Registrar of Deeds, Seychelles.", "\n Paul Gaspar da Silva, formerly Assistant Secretary, Northern Provinces Secretariat, Nigeria.", "\n James Doherty, Government Treasury and Coast Agent, Mombasa, Kenya.", "\n Henrietta Millicent Douglas. ", "For public and charitable services in Grenada, Windward Islands.", "\n John Crundwell Thomas Earll, Chief Inspector of Works, Engineering Department, Railways, Tanganyika Territory.", "\n Patricia Ruth Elliott, . ", "For services as a missionary doctor in the Straits Settlements.", "\n Major Stanley Fernando. ", "For services in the promotion and encouragement of athletics in Ceylon.", "\n Hubert Taylor Harrington, formerly Assistant Magistrate, Northern Rhodesia. ", "For public services.", "\n Beatrice Jane Locket, Matron, Maternity Association, Zanzibar.", "\n Edwin Frank McDavid, Deputy Colonial Treasurer, British Guiana.", "\n Edward Henry McKinney, Out Island Commissioner, Bahamas.", "\n Frederic Gardiner Rose, , Medical Superintendent, Leper Asylum, British Guiana.", "\n Aston Shedden Rutty, Collector and Postmaster, Cayman Brae, Jamaica.", "\n Eibert Seimund, Technical Assistant, Selangor Museum, Federated Malay States.", "\n Annie Middleton Sime. ", "For charitable and child welfare work in Singapore, Straits Settlements.", "\n Van Robert Harris van Buren. ", "For services as Commissioner, Workmen's Compensation Court, Colony of Trinidad & Tobago.", "\nHonorary Members\n Ragheb Effendi Mohammad, Sub-Inspector of Agriculture, Department of Agriculture & Forests, Palestine.", "\n Isaac Ben Zvi. ", "For public services in Palestine.", "\n\nMedal of the Order of the British Empire\nFor Meritorious Service\nMilitary Division\nRoyal Navy\n Hugh Burton Gill, Leading Telegraphist O.N. P/J 29625 ().", "\n William Walter Brown, Chief Shipwright 1st Class, O.N. P/M 6548 (HMS Tedworth).", "\n Alfred Richard Caiger, Chief Petty Officer, O.N. P/J 6245 ().", "\n\nArmy\n No. ", "7871890 Sergeant William Douglas Anscombe, Mechanical Warfare Experimental Establishment, Royal Tank Corps.", "\n No. ", "1864275 Lance-Corporal John Stoddart Barnett, Royal Engineers, Gibraltar.", "\n No. ", "S/391627 Corporal George Manners Lamb, Royal Army Service Corps, Southern Command.", "\n No. ", "740822 Battery Quartermaster-Sergeant William Henry Lanham, 66th (South Midland) Field Brigade, Royal Artillery, Territorial Army.", "\n No. ", "1021894 Battery Quartermaster-Sergeant Norman Lloyd, , Royal Artillery.", "\n No. ", "6842260 Colour Sergeant Alexander Whitten, The King's Royal Rifle Corps, attached Sudan Defence Force.", "\n\nRoyal Air Force\n 351871 Flight Sergeant Francis White.", "\n 362493 Corporal Frederick Walter Clarke.", "\n 507321 Leading Aircraftman William Jopling.", "\n\nCivil Division\n Frank Taylor Bird, Inspector, Post Office Engineering Department.", "\n James David Crisp, Laboratory Assistant, Royal Army Veterinary School.", "\n Patrick Dufficy, Constable, Metropolitan Police Force.", "\n Alfred Edward Smith, Skilled Workman, Class II, Post Office Engineering Department.", "\n Frederick Charles Webber, Rural Postman, Wiveliscombe Sub-Office, Taunton.", "\n Frank William Wood, Constable, Metropolitan Police Force.", "\n Abdalla Erbab, 1st Class Linesman, Posts & Telegraphs Department, Sudan.", "\n Ibrahim El Nairn, Sol (Warrant Officer), Sudan Railways Police.", "\n Sheikh Awad Othman, Superintendent of the Government Rest-House, Khartoum, Sudan.", "\n Lai Chand Dewan, Head Clerk, 1st Assyrian Battalion, Iraq Levies.", "\n James Nelson Dutt, Head Clerk, 2nd Assyrian Battalion, Iraq Levies.", "\n Frederick Carlisle Beckwith, Head Assistant (Inspector of Police), Special Branch, Criminal Investigation Department, Bihar & Orissa, India.", "\n Adelene Edith Hilton, Lady Deputy Superintendent, Female Jail, Lahore, Punjab, India.", "\n S. Sardar Singh, Inspector of Police and Head Clerk to the Senior Superintendent of Police, Delhi, India.", "\n Paul Ebejer, Head Messenger and Custodian of the Valletta Palace, Malta.", "\n Wadi Effendi Masad, Inspector, Palestine Police.", "\n Panayis Irini Zambias. ", "For services in rescuing a child and its mother from a burning house in the village of Rizokarpasso, Cyprus.", "\n\nCompanion of the Imperial Service Order (ISO)\nHome Civil Service\n John William Atherton, Superintending Cartographer and Assistant Superintendent of Charts, Hydrographic Department, Admiralty.", "\n Ambrose Joseph Biggs, , General Manager of Printing Works, HM Stationery Office.", "\n Fred Buckingham, Accountant, Charity Commission.", "\n Ernest Cozens Cooke, Deputy Director of Audit, Exchequer & Audit Department.", "\n Arthur Richard Cordingley, Accountant, Accountant-General's Department, Board of Education.", "\n John Lamb Frood, , Superintending Inspector, Diseases of Animals Division, Ministry of Agriculture & Fisheries.", "\n Albert James Holt-Green, Senior Examiner, Estate Duty Office, Board of Inland Revenue.", "\n Percy Hall Grimshaw, Keeper, Natural History Department, Royal Scottish Museum.", "\n John Hedley, , Staff Engineer, General Post Office.", "\n Charles Barton Hobbins, Principal Clerk, National Debt Office.", "\n William McAuslan, Engineer Surveyor-in-Chief, Board of Trade.", "\n Walter Alexander Magill, Assistant Secretary, Ministry of Home Affairs, Northern Ireland.", "\n John Durnford Ryall, lately Collector of Customs & Excise, Board of Customs & Excise, Edinburgh.", "\n George William Wight, lately Head of Branch, Department of Health for Scotland.", "\n Ernest Edward Wilkinson, , Librarian to the Colonial Office and the Dominions Office (Dated 15 May 1933).", "\n\nDominions\n Edgar John Field, Director of Lands, State of South Australia.", "\n Alexander Ronald Grant, Clerk of Parliaments, State of Western Australia.", "\n Stewart Irwin, lately Chief Electoral Officer, Commonwealth of Australia.", "\n Charles Glazebrook Morris, Under Secretary for Lands & Immigration, State of Western Australia.", "\n Theophilus Benjamin Strong, , lately Director of Education, Dominion of New Zealand.", "\n\nIndian Civil Services\n Rai Bahadur Tarak Chandra Datta, Superintendent, Office of the Inspector-General of Police, Bengal.", "\n Frank Augustus D'Souza, Land Records Department, Assistant Director of Land Records, Burma.", "\n Anthony Francis Saturnino Ferram, Extra Assistant Commissioner, Aden.", "\n Gottfried Ernest John Heagert, Assistant Secretary to the Government of the Punjab, Public Works Department, Buildings and Roads Branch, Punjab.", "\n William Edward Hogan, Superintendent of Excise, Bombay Division, Bombay.", "\n Shanker Ramchandra Korde, Head Assistant, Indian Army Service Corps.", "\n Ernest Everard Leicester, of the Imperial Secretariat Service, Superintendent, Foreign and Political Department, Government of India.", "\n Murray James MacDonald, Registrar, Chief Commissioner's Office, Delhi.", "\n Robert Lawrence Molloy, District Board Engineer, Bellary, Madras.", "\n Charles Alfred Stanley Perry, , Registrar, Public Works Department, Assam Secretariat, Assam.", "\n\nColonies, Protectorates, &c.\n Alban Ernest Daviot, Assistant Collector of Customs, Ceylon.", "\n Charles Edward Frith, Chief Inspector, Sanitary Department, Hong Kong.", "\n Charles Hannigan, lately Commissioner of Police, Federated Malay States.", "\n Adonijah Richard Harris, Supervisor of Customs, Sierra Leone.", "\n George Cunynghame Johnson, Treasurer, Saint Christopher & Nevis, Leeward Islands.", "\n John Laird, lately Warden of Mines, Perak, Federated Malay States.", "\n Charles Francis Lassalle, , Deputy Surgeon-General and Medical Inspector of Health, Colony of Trinidad & Tobago.", "\n Harold Ernest Phillips, Commissioner, Turks & Caicos Islands, Jamaica.", "\n Andrew Joseph Sheedy, Chief Police Officer, Penang, Straits Settlements.", "\n Charles Livingston Wilson, Colonial Postmaster, Grenada, Windward Islands.", "\n\nImperial Service Medal\nIn recognition of long and meritorious service\n Dasari Chandrappa, Amin, District Court, Guntur, Madras.", "\n Gokul Mistri, Carpenter, Irrigation Department, United Provinces.", "\n Sat Narayan, Jemadar of Peons in the Foreign & Political Department, Government of India.", "\n Saiyed Mohaidin Sahib, Daffadar, Tinnevelly Collectorate, Madras.", "\n Ghulam Sarwar, Bindery Supervisor, Government Press, North-West Frontier Province.", "\n Chintadripet Velayudam, Jemadar of Peons, Office of the Board of Revenue, Land Revenue & Settlement, Madras.", "\n\nOrder of the Companions of Honour (CH)\n Annie Elizabeth Fredericka Horniman. ", "For services to drama.", "\n\nKaisar-i-Hind Medal\nFirst Class, for Public Services in India\n Anne, Lady Birkmyre, Bengal.", "\n Laura Margaret Hope, , Medical Practitioner, Bengal.", "\n Edith Beatrice, Lady Keyes, Hyderabad, Deccan.", "\n Edith Tonkinson, , Rangoon, Burma.", "\n The Reverend John Howard Allen, Head of the Australian Mission, Mau, United Provinces.", "\n M. R. Ry. ", "Rao Bahadur Maruthu Chettiyar Subbiah Chettiyar Avargal, Merchant, Karaikudi, Ramnad District, Madras.", "\n Lieutenant-Colonel Samuel George Steele Haughton, , Indian Medical Service, Officer Commanding, Indian Military Hospital, Quetta.", "\n Harold Hughes Hood, ex-Collector of Customs, Chairman of the Sind Red Cross Society, Sind, Bombay.", "\n Jal Sorabjee Jassawala, Weaving Master of the Bombay Company's Mills, Sholapur, Bombay.", "\n Rai Bahadur Amar Nath, , Lahore, Punjab.", "\n\nRoyal Red Cross (RRC)\n Superintending Sister Ethel Madeline Gertrude Hirst, , Queen Alexandra's Royal Naval Nursing Service.", "\n\nHonorary Chaplain to His Majesty\n The Reverend Alexander Ross Yeoman, , Deputy Chaplain-General to the Forces.", "\n\nAir Force Cross (AFC)\nRoyal Air Force\n Squadron Leader Edward Reginald Openshaw.", "\n Flight Lieutenant Geoffrey Ivon Laurence Saye.", "\nRoyal Australian Air Force\n Flight Lieutenant Alan Moorehouse Charlesworth.", "\n\nBar to the Air Force Cross\nRoyal Air Force\n Squadron Leader Edwin Spencer Goodwin, .", "\n\nAir Force Medal (AFM)\n 364914 Sergeant Pilot Edgar Nelson Lewis, Royal Air Force.", "\n 588 Sergeant Pilot Francis William Collopy, Royal Australian Air Force.", "\n\nReferences\n\n \n\nCategory:Birthday Honours\nCategory:1933 awards\nCategory:1933 in the United Kingdom" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.010582010582010581, 0, 0, 0.006097560975609756, 0, 0, 0.022058823529411766, 0.010309278350515464, 0.022222222222222223, 0, 0.033707865168539325, 0, 0.029411764705882353, 0, 0.01818181818181818, 0, 0.021052631578947368, 0, 0.02127659574468085, 0.03225806451612903, 0.01834862385321101, 0, 0.02702702702702703, 0, 0.030303030303030304, 0, 0.013333333333333334, 0.012658227848101266, 0, 0.05128205128205128, 0.023255813953488372, 0.03260869565217391, 0.027586206896551724, 0, 0.030303030303030304, 0.037037037037037035, 0.018867924528301886, 0.045454545454545456, 0, 0.036585365853658534, 0, 0, 0.047619047619047616, 0, 0.025974025974025976, 0, 0.010869565217391304, 0.01694915254237288, 0, 0.045454545454545456, 0, 0.020833333333333332, 0, 0.03076923076923077, 0, 0.033707865168539325, 0.03225806451612903, 0, 0.024793388429752067, 0.045454545454545456, 0, 0, 0.0136986301369863, 0.020202020202020204, 0.03333333333333333, 0, 0.041666666666666664, 0, 0.03, 0.018518518518518517, 0.023809523809523808, 0.04878048780487805, 0.014084507042253521, 0.020618556701030927, 0.013157894736842105, 0.03571428571428571, 0.043478260869565216, 0.041666666666666664, 0.018867924528301886, 0, 0.007936507936507936, 0.034482758620689655, 0.037037037037037035, 0.036585365853658534, 0.04878048780487805, 0.03125, 0.024096385542168676, 0.02631578947368421, 0.02531645569620253, 0.03571428571428571, 0.027777777777777776, 0.03389830508474576, 0.03773584905660377, 0.02564102564102564, 0.023529411764705882, 0, 0.014705882352941176, 0.010526315789473684, 0, 0.025, 0, 0.025974025974025976, 0.025477707006369428, 0.022222222222222223, 0.010638297872340425, 0.03076923076923077, 0.02702702702702703, 0.01639344262295082, 0.01818181818181818, 0.01904761904761905, 0.015151515151515152, 0.015748031496062992, 0.0375, 0.01680672268907563, 0.027777777777777776, 0.02702702702702703, 0.02976190476190476, 0.02247191011235955, 0.02857142857142857, 0, 0.00819672131147541, 0.029411764705882353, 0.02666666666666667, 0.024096385542168676, 0.036036036036036036, 0.043010752688172046, 0.033112582781456956, 0.029850746268656716, 0.015873015873015872, 0.031746031746031744, 0.024390243902439025, 0.04, 0.03225806451612903, 0.013888888888888888, 0.029411764705882353, 0.034482758620689655, 0.025, 0.026737967914438502, 0.022727272727272728, 0.024539877300613498, 0.0547945205479452, 0.044444444444444446, 0.02666666666666667, 0.017241379310344827, 0.027522935779816515, 0.015463917525773196, 0.009259259259259259, 0.025157232704402517, 0.011764705882352941, 0, 0.02040816326530612, 0.021739130434782608, 0.03225806451612903, 0.02, 0.033707865168539325, 0.01818181818181818, 0.03773584905660377, 0, 0.041666666666666664, 0, 0.011235955056179775, 0.02631578947368421, 0.02127659574468085, 0.024390243902439025, 0.01834862385321101, 0.021739130434782608, 0.023255813953488372, 0.0379746835443038, 0.02912621359223301, 0.04918032786885246, 0.03896103896103896, 0.012048192771084338, 0.04081632653061224, 0.012195121951219513, 0.01904761904761905, 0.034482758620689655, 0.02631578947368421, 0.0375, 0.017241379310344827, 0.02857142857142857, 0.031746031746031744, 0.02197802197802198, 0.019230769230769232, 0.014285714285714285, 0.015015015015015015, 0.023076923076923078, 0.011764705882352941, 0.017543859649122806, 0.02586206896551724, 0.019867549668874173, 0.02666666666666667, 0.019867549668874173, 0.018867924528301886, 0.03571428571428571, 0.027777777777777776, 0.020833333333333332, 0.042105263157894736, 0.05194805194805195, 0.022222222222222223, 0.025, 0.030927835051546393, 0.030303030303030304, 0.039473684210526314, 0.0297029702970297, 0.05747126436781609, 0.012345679012345678, 0.0234375, 0.018518518518518517, 0.01282051282051282, 0.037037037037037035, 0.017391304347826087, 0.022988505747126436, 0.019230769230769232, 0.04878048780487805, 0.01652892561983471, 0.02586206896551724, 0.03225806451612903, 0.023255813953488372, 0.047619047619047616, 0.02197802197802198, 0.017857142857142856, 0.03125, 0.031746031746031744, 0.0375, 0, 0.05555555555555555, 0.041666666666666664, 0.030612244897959183, 0.017241379310344827, 0.045454545454545456, 0.037037037037037035, 0.015384615384615385, 0.041666666666666664, 0, 0.0196078431372549, 0.05660377358490566, 0.0297029702970297, 0.037037037037037035, 0.03389830508474576, 0.022556390977443608, 0.02197802197802198, 0.011235955056179775, 0.03488372093023256, 0.031746031746031744, 0.03571428571428571, 0.05333333333333334, 0.03125, 0, 0.030303030303030304, 0.02564102564102564, 0, 0.023255813953488372, 0.02830188679245283, 0.03125, 0.02857142857142857, 0.02531645569620253, 0, 0.02857142857142857, 0, 0.036585365853658534, 0.05714285714285714, 0.027777777777777776, 0, 0.0136986301369863, 0.029411764705882353, 0.03333333333333333, 0.025, 0.04918032786885246, 0.024096385542168676, 0.031746031746031744, 0.018867924528301886, 0.03773584905660377, 0.03225806451612903, 0.027777777777777776, 0.017341040462427744, 0.027210884353741496, 0.013071895424836602, 0.03225806451612903, 0.04081632653061224, 0.03488372093023256, 0.009433962264150943, 0.025210084033613446, 0.026785714285714284, 0.02127659574468085, 0.04411764705882353, 0.029411764705882353, 0.024096385542168676, 0.022727272727272728, 0.031578947368421054, 0.02857142857142857, 0.0425531914893617, 0.037037037037037035, 0.02586206896551724, 0.023809523809523808, 0.03418803418803419, 0.0392156862745098, 0.02912621359223301, 0.025, 0.014388489208633094, 0.03, 0.029411764705882353, 0.0380952380952381, 0.023529411764705882, 0.025210084033613446, 0.020833333333333332, 0.04, 0.027586206896551724, 0.028985507246376812, 0.03125, 0.025806451612903226, 0.027586206896551724, 0.031914893617021274, 0.019417475728155338, 0.047619047619047616, 0.05, 0.02631578947368421, 0.030303030303030304, 0.022727272727272728, 0.025, 0.028169014084507043, 0.041666666666666664, 0.03773584905660377, 0.037037037037037035, 0.030303030303030304, 0, 0, 0.039473684210526314, 0.013513513513513514, 0, 0.019801980198019802, 0.022222222222222223, 0.046153846153846156, 0.03225806451612903, 0.03333333333333333, 0.023529411764705882, 0.02564102564102564, 0, 0.010752688172043012, 0.029411764705882353, 0.02158273381294964, 0.045454545454545456, 0, 0.014925373134328358, 0.027777777777777776, 0.02631578947368421, 0.045454545454545456, 0.043478260869565216, 0, 0.02830188679245283, 0.0625, 0.037037037037037035, 0.030303030303030304, 0.0234375, 0.013513513513513514, 0.032520325203252036, 0.04819277108433735, 0.04054054054054054, 0.03076923076923077, 0.03508771929824561, 0.01694915254237288, 0.05, 0.0196078431372549, 0.018867924528301886, 0.020833333333333332, 0.00980392156862745, 0, 0.017857142857142856, 0.0380952380952381, 0.014705882352941176, 0.020833333333333332, 0.03333333333333333, 0.02459016393442623, 0.03636363636363636, 0.05405405405405406, 0.03, 0.018867924528301886, 0.039473684210526314, 0.037037037037037035, 0.024, 0.03571428571428571, 0.014492753623188406, 0, 0.013888888888888888, 0.034482758620689655, 0.023809523809523808, 0, 0.016666666666666666, 0.038461538461538464, 0, 0.03125, 0, 0.025974025974025976, 0.023255813953488372, 0.03571428571428571, 0.0410958904109589, 0.0364963503649635, 0, 0.013157894736842105, 0.034482758620689655, 0.0273972602739726, 0.043478260869565216, 0.03296703296703297, 0, 0, 0, 0.04, 0.012658227848101266, 0.02962962962962963, 0.03225806451612903, 0.03508771929824561, 0.03773584905660377, 0.027777777777777776, 0.024096385542168676, 0.029411764705882353, 0, 0.01875, 0.02247191011235955, 0.014388489208633094, 0.019230769230769232, 0, 0.026785714285714284, 0.03305785123966942, 0.030303030303030304, 0.023622047244094488, 0.04, 0, 0.024691358024691357, 0.02531645569620253, 0.03896103896103896, 0, 0.02158273381294964, 0, 0.022222222222222223, 0, 0.031055900621118012, 0.043010752688172046, 0.022900763358778626, 0, 0.018518518518518517, 0, 0.017699115044247787, 0.024390243902439025, 0.024390243902439025, 0.0392156862745098, 0.02631578947368421, 0.03333333333333333, 0.02040816326530612, 0.024390243902439025, 0, 0.03225806451612903, 0, 0.027624309392265192, 0, 0.043478260869565216, 0.022727272727272728, 0, 0.030612244897959183, 0.02459016393442623, 0, 0.025423728813559324, 0, 0.026143790849673203, 0.03571428571428571, 0, 0.03424657534246575, 0, 0.016260162601626018, 0, 0.027210884353741496, 0, 0.024390243902439025, 0, 0.03125, 0, 0.025380710659898477, 0.0380952380952381, 0.02702702702702703, 0, 0.02857142857142857, 0.027522935779816515, 0.038461538461538464, 0.025974025974025976, 0.03125, 0.024390243902439025, 0.024390243902439025, 0.02631578947368421, 0.03260869565217391, 0.033707865168539325, 0.045454545454545456, 0.036585365853658534, 0.037037037037037035, 0.018867924528301886, 0.009345794392523364, 0.030612244897959183, 0, 0.030612244897959183, 0.022988505747126436, 0.024096385542168676, 0.07142857142857142, 0, 0.03260869565217391, 0.012195121951219513, 0.021505376344086023, 0.036585365853658534, 0.023255813953488372, 0.0297029702970297, 0.02857142857142857, 0.030303030303030304, 0.02, 0.03125, 0.01818181818181818, 0.03278688524590164, 0.038461538461538464, 0.039603960396039604, 0.02666666666666667, 0.02127659574468085, 0.0410958904109589, 0.034482758620689655, 0.03260869565217391, 0.045454545454545456, 0.02127659574468085, 0.018518518518518517, 0.03529411764705882, 0.044444444444444446, 0.04225352112676056, 0.04838709677419355, 0.0379746835443038, 0.04225352112676056, 0.024096385542168676, 0.014492753623188406, 0.029411764705882353, 0.024096385542168676, 0.046875, 0.0234375, 0.03333333333333333, 0.045454545454545456, 0.023809523809523808, 0.02564102564102564, 0.014925373134328358, 0, 0, 0.038461538461538464, 0.04838709677419355, 0.019801980198019802, 0, 0, 0.029411764705882353, 0.023809523809523808, 0.019801980198019802, 0.04, 0.0410958904109589, 0.037037037037037035, 0.028985507246376812, 0.05555555555555555, 0.00819672131147541, 0.025, 0.013888888888888888, 0, 0, 0.04081632653061224, 0.015748031496062992, 0.0273972602739726, 0.041666666666666664, 0, 0.07142857142857142, 0, 0.029411764705882353, 0.03125, 0, 0.02127659574468085, 0.030303030303030304, 0.013333333333333334, 0.011904761904761904, 0.039473684210526314, 0, 0.02666666666666667, 0.010526315789473684, 0.016129032258064516, 0, 0.0125, 0.04838709677419355, 0.05714285714285714, 0.022900763358778626, 0.031496062992125984, 0.011235955056179775, 0.02, 0.014925373134328358, 0.045454545454545456, 0, 0.03508771929824561, 0.02127659574468085, 0.014492753623188406, 0, 0, 0.03571428571428571, 0.037037037037037035, 0, 0.038461538461538464, 0, 0.01282051282051282, 0, 0.03125, 0.046153846153846156, 0.017241379310344827, 0.037037037037037035, 0.02857142857142857, 0.012658227848101266, 0, 0.013888888888888888, 0.03225806451612903, 0.022727272727272728, 0.01652892561983471, 0.058823529411764705, 0, 0.006493506493506494, 0.04938271604938271, 0.047619047619047616, 0, 0.028037383177570093, 0, 0.0410958904109589, 0, 0.024390243902439025, 0, 0.023076923076923078, 0, 0.04225352112676056, 0, 0.029411764705882353, 0.03571428571428571, 0.023809523809523808, 0.022222222222222223, 0.03614457831325301, 0.041666666666666664, 0.017857142857142856, 0.023529411764705882, 0.02631578947368421, 0.03389830508474576, 0.013513513513513514, 0.015384615384615385, 0.012048192771084338, 0.029850746268656716, 0.043478260869565216, 0.035211267605633804, 0.034482758620689655, 0.028037383177570093, 0.013513513513513514, 0.04, 0.04, 0, 0.020618556701030927, 0.036585365853658534, 0.02, 0.02564102564102564, 0.021505376344086023, 0.035398230088495575, 0.03409090909090909, 0.012345679012345678, 0.05660377358490566, 0.046875, 0.047619047619047616, 0.02197802197802198, 0.030612244897959183, 0.037037037037037035, 0.037383177570093455, 0.02666666666666667, 0.02666666666666667, 0.02666666666666667, 0.020618556701030927, 0.03488372093023256, 0, 0.03225806451612903, 0.028169014084507043, 0.0273972602739726, 0.02702702702702703, 0.04285714285714286, 0.014814814814814815, 0.041666666666666664, 0.04477611940298507, 0.031578947368421054, 0.021739130434782608, 0.027777777777777776, 0.013513513513513514, 0.031746031746031744, 0.024096385542168676, 0.029411764705882353, 0.02631578947368421, 0.027777777777777776, 0.02702702702702703, 0.02631578947368421, 0.023255813953488372, 0.029850746268656716, 0.02197802197802198, 0.04477611940298507, 0.023809523809523808, 0.03636363636363636, 0.012658227848101266, 0, 0.010752688172043012, 0.037037037037037035, 0.041666666666666664, 0, 0.03409090909090909, 0, 0.0196078431372549, 0.030534351145038167, 0.02, 0.011235955056179775, 0.047619047619047616, 0.031746031746031744, 0.008928571428571428, 0.036585365853658534, 0.020833333333333332, 0.02631578947368421, 0.03488372093023256, 0.03614457831325301, 0.0273972602739726, 0 ]

[ "Tagaz Aquila\n\nThe Tagaz AQUiLA (Ru:ТагАЗ Аквелла) (Latin for Eagle) is a compact car formerly produced by TagAZ, now defunct, in Taganrog, Russia. ", "The Aquila is marketed by TagAZ as a \"four-door coupe\". ", "The car is powered by the 1.6 (107 hp) Mitsubishi I4 engine and 5-speed manual gearbox. ", "The car has a steel spaceframe covered with plastic body panels.", "\n\nHistory\nThe Aquila went on sale in Russia in March, 2013.", "\n\nTagAZ was declared bankrupt on January 21, 2014, meaning that the future of the model is unclear.", "\n\nThe basic model includes air conditioning, power windows, central locking, electrically adjustable heated mirrors, radio cassette, power steering, alloy wheels, driver's airbag and ABS. ", "The car was sold at a price of 415,000 rubles on the terms of obtaining a car at the TagAZ plant .", "\n\nOnly about 200 were produced by the time production stopped.", "\n\nProduction in France\nThe TagAZ Aquila is now produced in Europe, in the Paris suburbs by small-scale producer of cars, by MPM Motors (Mikhail Paramonov Manufacturing). ", "The Aquila will be called the MPM Erelis. ", "Aquila is sold at a price of 12,500 euros.", "\n\nReferences\n\nExternal links\n Specifications of Tagaz Aquila on official site\n\nCategory:Cars of Russia" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.013605442176870748, 0, 0.011363636363636364, 0, 0, 0, 0, 0, 0, 0.011764705882352941, 0.023809523809523808, 0, 0 ]

[ "#!", "/usr/bin/env python\n\n# Copyright (c) Twisted Matrix Laboratories.", "\n# See LICENSE for details.", "\n\nfrom twisted.internet.protocol import Protocol, Factory\n#from twisted.internet import epollreactor\n#epollreactor.install()\nfrom twisted.internet import reactor\n\n### Protocol Implementation\n\n# This is just about the simplest possible protocol\nclass Echo(Protocol):\n def dataReceived(self, data):\n \"\"\"\n As soon as any data is received, write it back.", "\n \"\"\"\n self.transport.write(data)\n\n\ndef main():\n f = Factory()\n f.protocol = Echo\n reactor.listenTCP(5000, f, backlog=1024)\n reactor.run()\n\nif __name__ == '__main__':\n main()\n" ]

{ "pile_set_name": "Github" }

[ 0, 0.015384615384615385, 0.037037037037037035, 0.0027247956403269754, 0.00980392156862745 ]

[ "Introduction {#s1}\n============\n\nIn vertebrates, cytosine methylation in DNA is one of the major epigenetic modifications, which regulates many cellular events, including developmental gene expression, X chromosome inactivation, genome defense, and genomic imprinting [@pone.0047358-Jaenisch1]. ", "DNA methylation exerts regulatory functions by recruiting specific binding proteins that contain a highly conserved methyl-CpG binding domain (MBD) [@pone.0047358-Klose1]. ", "Five mammalian MBD family proteins, MeCP2, MBD1, MBD2, MBD3 and MBD4, have been well characterized. ", "These proteins, except for MBD3, bind selectively to methylated DNA [@pone.0047358-Wade1], [@pone.0047358-Zhang1] and play roles in transcriptional repression and chromatin remodeling [@pone.0047358-Kass1], [@pone.0047358-Ng1], [@pone.0047358-Razin1]. ", "The developmental significance of MBD proteins in interpreting DNA methylation patterns and mediating transcriptional repression has been demonstrated mainly in human congenital disorders and knockout mouse models [@pone.0047358-Fan1].", "\n\nBased on homology searches using the conserved MBD domain, an additional member, termed MBD5, was identified [@pone.0047358-Hendrich1], [@pone.0047358-Roloff1]. ", "Little is known about the function of MBD5. ", "In addition to the MBD domain, MBD5 also harbors a PWWP domain. ", "This domain is also found in DNA methyltransferase DNMT3B and the mutation of DNMT3B causes ICF immunodeficiency syndrome [@pone.0047358-Xu1]. ", "In cultured cells, the MBD5 protein associates with heterochromatin, although it cannot directly bind to methylated DNA [@pone.0047358-Laget1]. ", "Several lines of evidence have suggested that MBD*5* is a single causal locus of human mental disorders. ", "First, microdeletions of the *MBD5* gene were detected in 65 patients with mental retardation [@pone.0047358-Jaillard1], [@pone.0047358-Wagenstaller1], [@pone.0047358-Williams1], [@pone.0047358-Chung1], [@pone.0047358-vanBon1], [@pone.0047358-Talkowski1]. ", "Second, four low-frequency missense variants in the coding sequence of *MBD5* were found in mentally retarded patients but not in healthy controls [@pone.0047358-Wagenstaller1]. ", "Finally, the *MBD5* gene is located on chromosome 2q23.1, a region in which aberrations are associated with epilepsy [@pone.0047358-Grosso1]. ", "Based on the presence of the MBD and PWWP domains in the encoded protein and the association of *MBD5* mutation with human mental retardation, we hypothesized that MBD5 plays a unique role during development.", "\n\nIn this study, we aimed to define the *in vivo* function of *Mbd5* through the generation and characterization of the knockout mice. ", "The whole body Mbd5 knockout mice displayed severe growth retardation and highly penetrant pre-weaning lethality. ", "The impairment of GH/IGF-1 axis potentially contributes to the observed growth retardation in the mutant mice. ", "Furthermore, the similar phenotypes observed in the brain-specific knockout mice reveal that Mbd5 functions in the nervous system to regulate postnatal growth. ", "The knockout mice also showed persistent hypoglycemia, hypoinsulinemia, enhanced glucose tolerance and elevated insulin sensitivity. ", "Overall, Mbd5 plays an essential role in the control of postnatal growth and glucose homeostasis.", "\n\nResults {#s2}\n=======\n\nGeneration of Mbd5-deficient Mice {#s2a}\n---------------------------------\n\nTo investigate the physiological function of *Mbd5*, we generated knockout mice by gene targeting. ", "The targeted genomic region, which was flanked by *lox*P sites, included the first exon encompassing the 5′UTR and the majority of the MBD domain coding region ([Figure 1A](#pone-0047358-g001){ref-type=\"fig\"}). ", "Homologous recombination at the desired locus in the selected ES cell lines was confirmed by Southern blot analysis with two different external probes, respectively ([Figure 1B](#pone-0047358-g001){ref-type=\"fig\"}). ", "Chimeras, which were derived from blastocysts with the injection of positive ES cells, were crossed with C57BL/6 mice. ", "The F1 mice carrying a floxed allele were crossed with *EIIa*-Cre mice to delete the floxed region in the *Mbd5* gene. ", "Heterozygotes were intercrossed to generate homozygotes. ", "The genotypes of all mice were confirmed by PCR ([Figure 1C](#pone-0047358-g001){ref-type=\"fig\"}) and the absence of full-length *Mbd5* mRNA in homozygous mutants was confirmed in various tissues by RT-PCR analysis ([Figure 1D](#pone-0047358-g001){ref-type=\"fig\"}).", "\n\n{#pone-0047358-g001}\n\nMbd5-deficient Mice Show Early Postnatal Lethality with Severe Growth Retardation {#s2b}\n---------------------------------------------------------------------------------\n\nThe interbreeding of heterozygous mice yielded F2 offspring of *Mbd5^+/+^*, *Mbd5^+/−^* and *Mbd5^−/−^* at an approximately expected Mendelian ratio (68∶131∶49), indicating that *Mbd5* deficiency does not lead to embryonic lethality. ", "Although the heterozygotes appeared grossly normal and were fertile ([Figure 2A--C, S](#pone-0047358-g002){ref-type=\"fig\"}1A, [Table S1](#pone.0047358.s006){ref-type=\"supplementary-material\"}), all Mbd5*-*deficient mice suffered severe growth retardation ([Figure 2A](#pone-0047358-g002){ref-type=\"fig\"}) and died prior to weaning between postnatal day (P) 1 and 22 ([Figure 2B](#pone-0047358-g002){ref-type=\"fig\"}). ", "A comparable amount of milk was present in the stomachs of dead knockout pups and their sacrificed normal littermates ([Figure S1B](#pone.0047358.s001){ref-type=\"supplementary-material\"}), indicating that the lethality didn't result from a feeding defect. ", "As shown in [Figure 2A](#pone-0047358-g002){ref-type=\"fig\"}, the surviving null mice were wasting and had decreased axial growth. ", "The body weight of homozygotes was comparable to either heterozygotes or wild-type mice at birth, but became noticeably lower within 3 days after birth and was greatly reduced one week after birth. ", "In contrast to the controls, the weight gain of the mutant mice plateaued starting at two weeks after birth ([Figure 2C](#pone-0047358-g002){ref-type=\"fig\"}). ", "Similar phenotypes were observed in both genders ([Figure 2C](#pone-0047358-g002){ref-type=\"fig\"}), and therefore we pooled the groups in the following experiments except where otherwise noted. ", "For 3-day weight gain of normal mice, there were two growth rate peaks before weaning. ", "The first peak was at approximately P6 and the second growth spurt commenced at approximately two weeks; the second time point coincides with the initiation of growth hormone action [@pone.0047358-Lupu1]. ", "However, the null mice lacked the second growth peak and their first peak was much lower than that of the control mice ([Figure 2D](#pone-0047358-g002){ref-type=\"fig\"}). ", "We also observed that the weights of major mutant organs determined at 1 week of age were reduced proportional to body weights in comparison with wild-type controls, with the exception of brain and liver ([Table 1](#pone-0047358-t001){ref-type=\"table\"}). ", "The liver was disproportionately reduced in size, whereas the brain/body weight ratio was relatively increased by about 80% in mutants. ", "Most likely, this difference is due to the fact that brain growth is practically completed by the time GH action commences in mice [@pone.0047358-Lupu1]. ", "The higher ratio of brain in Mbd5 KO mice is due to their growth retardation (smaller denominator). ", "Along with the growth retardation, the Mbd5-knockout mice also displayed a reduction in perigonadal and subcutaneous fat compared with the control mice ([Figure 2E](#pone-0047358-g002){ref-type=\"fig\"}). ", "Overall, these results demonstrate that Mbd5 is essential for postnatal survival and growth.", "\n\n10.1371/journal.pone.0047358.t001\n\n###### Comparison of organ weights between wild-type and *Mbd5^−/−^* mice.", "\n\n![](", "pone.0047358.t001){#pone-0047358-t001-1}\n\n Weight (mg) \\% of body weight (% of control) \n ---------- ------------- ---------------------------------- ---------------------- ----------------------- ----------\n Brain 308.1±14.06 225.9±16.77 5.28±0.19 (100±3.6) 9.67±0.53 (182.9±5.7) \\<0.0001\n Thymus 37.1±2.45 11.4±2.32 0.54±0.02 (100±3.3) 0.46±0.04 (86.8±8.3) 0.19\n Heart 33.0±2.00 13.8±2.37 0.56±0.01 (100±2.5) 0.57±0.03 (100.9±5.9) 0.9\n Lung 91.6±5.00 38.4±4.41 1.59±0.07 (100±4.5) 1.79±0.06 (112.4±2.5) 0.08\n Liver 174.9±10.28 60.8±7.71 3.01±0.13 (100±4.5) 2.55±0.03 (83.2±5.0) 0.047\n Pancreas 19.9±1.70 7.6±1.84 0.34±0.04 (100±10.3) 0.31±0.04 (93.8±6.3) 0.63\n Spleen 38.0±5.23 11.5±3.79 0.62±0.09 (100±14.5) 0.42±0.10 (67.4±8.6) 0.12\n Kidney 69.8±6.19 31.4±3.12 1.19±0.06 (100±5.4) 1.33±0.04 (112.3±3.3) 0.10\n Body (g) 5.9±0.35 2.4±0.30 \n\nData are means ± SEM for four matched male mice at P7. ", "Relative (% of control) values ± SEM were compared to evaluate statistically significant differences.", "\n\n{#pone-0047358-g002}\n\nMbd5 Deficiency Leads to Reduced Somatotropic Signaling {#s2c}\n-------------------------------------------------------\n\nTo further dissect the mechanism underlying reduced growth, we directly examined somatotropic signaling, which is critical for postnatal growth and for directing elongation of the long bones in animals [@pone.0047358-Walenkamp1]. ", "As the Mbd5*-*deficient mice lacked the second growth peak, a peak induced by the action of GH commencing at 2 weeks after birth in normal mice, we used 2-week-old mice for further somatotropic analysis. ", "The mRNA expression level of *GH* in the pituitary was decreased by about 42% in the mutant mice ([Figure 3A](#pone-0047358-g003){ref-type=\"fig\"}). ", "Despite considerable variation of serum GH concentrations presumably due to the pulsatile secretion pattern of GH [@pone.0047358-Jansson1], the knockout mice still showed a trend of reduction in circulating GH concentration ([Figure S2A](#pone.0047358.s002){ref-type=\"supplementary-material\"}). ", "The growth hormone releasing hormone receptor (Ghrhr) and the ghrelin receptor (Ghsr) act as the stimulatory receptors of GH release and the somatostatin receptors (Sstr2, Sstr5) act as the inhibitory receptors of GH release. ", "The expression levels of these genes in the mutant pituitary were unchanged ([Figure S2B](#pone.0047358.s002){ref-type=\"supplementary-material\"}). ", "GH acts on the GH receptors (Ghr) in the liver, inducing transcription and secretion of insulin-like growth factor 1 (IGF-1) and IGF binding protein acid-labile subunit (ALS) [@pone.0047358-Giustina1]. ", "The levels of IGF-1 and ALS are positively correlated with growth [@pone.0047358-Ooi1], [@pone.0047358-Liu1]. ", "Along with decreased GH level, the transcription levels of *Ghr*, *Als* and *Igf-1*, which are downstream of GH action in the liver, were reduced ([Figure 3B--D](#pone-0047358-g003){ref-type=\"fig\"}). ", "Consistently, the serum IGF-1 protein level was reduced to 20% of the wild-type level ([Figure 3E](#pone-0047358-g003){ref-type=\"fig\"}). ", "More importantly, the reduction of serum IGF-1 level was already obvious in newborn mutant mice ([Figure S3B](#pone.0047358.s003){ref-type=\"supplementary-material\"}), before size reduction is apparent. ", "The expression level of *Igf-1* was only reduced in liver ([Figure 3D](#pone-0047358-g003){ref-type=\"fig\"}, [Figure S3A](#pone.0047358.s003){ref-type=\"supplementary-material\"}), which contributed to reduced circulating IGF-1 levels in the mutant mice ([Figure 3E](#pone-0047358-g003){ref-type=\"fig\"}).", "\n\n{#pone-0047358-g003}\n\nSince GH is synthesized, stored, and released by the pituitary, we next examined this gland in the knockout mice. ", "Pituitaries from Mbd5 KO mice were smaller than those of wild-type littermates ([Figure 3F](#pone-0047358-g003){ref-type=\"fig\"}), but displayed no obvious structural abnormalities by H&E staining ([Figure S2C](#pone.0047358.s002){ref-type=\"supplementary-material\"}). ", "Furthermore, each pituitary gland contained significantly less stored GH in KO mice as compared with controls ([Figure 3G](#pone-0047358-g003){ref-type=\"fig\"}), even when the smaller pituitary size of knockout mice was taken into account ([Figure 3H](#pone-0047358-g003){ref-type=\"fig\"}). ", "To determine whether the defect in GH reflected a more general deficit in pituitary hormone production, we measured mRNA levels of two additional pituitary hormones--the thyroid-stimulating hormone (*TSHβ*) and the adrenocorticotropic hormone (*ACTH*). ", "The expression levels of both genes were unchanged ([Figure S2D](#pone.0047358.s002){ref-type=\"supplementary-material\"}). ", "Thus, the pituitary defect of KO mice appears to be restricted to GH. ", "Taken together, Mbd5-deficient mice show decreased pituitary GH stores, and subsequently reduced IGF-1 serum levels, and ultimately impaired somatic growth, revealing a critical role for Mbd5 in control of somatic growth.", "\n\nNeural-specific Mbd5 Knockout Mice also Show Growth Retardation and Preweaning Lethlatity {#s2d}\n-----------------------------------------------------------------------------------------\n\nBecause development and function of the pituitary are under the control of the hypothalamus [@pone.0047358-Zhu1], we hypothesize that the pituitary defects observed in KO mice are due to alterations in hypothalamic function in the absence of Mbd5. ", "Therefore, we generated brain-specific Mbd5 knockout mice (BSKO, \\[*Mbd5^f/−^*, Nestin-Cre\\]) by crossing *Mbd5^f/f^* mice with the Nestin-Cre transgenic mice [@pone.0047358-Tronche1] ([Figure 4A](#pone-0047358-g004){ref-type=\"fig\"}). ", "Real-time PCR analysis showed that Nestin-Cre mediated deletion of Mbd5 was confined to the neuronal lineage ([Figure 4B](#pone-0047358-g004){ref-type=\"fig\"}). ", "Similar to whole body deletion, the BSKO mice also showed growth retardation ([Figure 4C](#pone-0047358-g004){ref-type=\"fig\"}) and pre-weaning lethality (data not shown). ", "In addition, the BSKO mice displayed defects in somatotropic axis with lower serum GH and IGF-1 levels ([Figure 4D--F](#pone-0047358-g004){ref-type=\"fig\"}). ", "These observations support a central role of neural Mbd5 in somatic growth regulation and postnatal survival. ", "Overall, our findings show that loss of Mbd5 compromises the somatotropic axis, which may be caused by impaired hypothalamus function.", "\n\n{#pone-0047358-g004}\n\nMbd5-deficient Mice Showed Disturbance of Glucose Homeostasis Due to Elevated Insulin Sensitivity {#s2e}\n-------------------------------------------------------------------------------------------------\n\nSomatic growth and insulin sensitivity are interlinked because a reduction in somatic growth by genetic methods improves glucose homeostasis and insulin sensitivity in mice, rats and humans [@pone.0047358-Coschigano1], [@pone.0047358-Dominici1], [@pone.0047358-Belgardt1]. ", "We next addressed whether glucose homeostasis and insulin sensitivity were altered. ", "Compared with the wild-type and heterozygous littermates, the blood glucose levels of homozygous mutant pups were 20% and 40% lower at one- and two-weeks of age, respectively ([Figure 5A](#pone-0047358-g005){ref-type=\"fig\"}). ", "Concomitantly, the serum insulin levels in the knockout mice in the ad libtum-fed state were reduced by approximately 60% compared with control littermates ([Figure 5B](#pone-0047358-g005){ref-type=\"fig\"}). ", "No alteration in pancreatic morphology was observed ([Figure S5A](#pone.0047358.s005){ref-type=\"supplementary-material\"}), and the distribution of glucagon- and insulin-expressing cells ([Figure S5B](#pone.0047358.s005){ref-type=\"supplementary-material\"}) as well as the pattern of glucose sensing protein transporter GLUT2 ([Figure S5C](#pone.0047358.s005){ref-type=\"supplementary-material\"}) in pancreatic islets were indistinguishable between the mutant and wild-type mice. ", "Thus, we speculated that the lower blood glucose might have triggered a reduction in insulin secretion as an adaptive response. ", "We also assessed the performance of control and knockout mice in oral glucose tolerance tests (OGTT) and insulin tolerance tests (ITT). ", "After glucose was administered orally, the mutant mice cleared glucose faster than the control animals at 60 min and thereafter, although the mutant mice displayed a delay in glucose absorption ([Figure 5C](#pone-0047358-g005){ref-type=\"fig\"}). ", "Since the fasted glucose level in the mutant mice was lower than controls' ([Figure 5C, S](#pone-0047358-g005){ref-type=\"fig\"}4A), we set the basal glucose at time 0 at the same level (100%), and found the OGTT between KO and control mice was truly different ([Figure S4B](#pone.0047358.s004){ref-type=\"supplementary-material\"}), further indicating enhanced glucose tolerance in the KO mice. ", "The mutant mice also exhibited a significantly improved performance in the ITT ([Figure 5D](#pone-0047358-g005){ref-type=\"fig\"}). ", "To further identify the tissue mainly responsible for altered glucose homeostasis, we then determined the liver insulin sensitivity because the hepatic glucose production is under the direct hepatic control of insulin action. ", "Western blot analyses showed that pAkt levels of both pAkt-S473 and -T308 were increased with or without insulin treatment in the Mbd5-deficient livers compared with controls ([Figure 5E](#pone-0047358-g005){ref-type=\"fig\"}). ", "These data indicate that Mbd5-knockout mice are more sensitive to insulin. ", "Consistent with insulin hypersensitivity, the knockout mice displayed enhanced liver glycolysis as evidenced by the up-regulation of metabolic genes *Pfk1*(rate-limiting glycolytic enzyme phosphofructokinase 1), *Ldhb* (lactate dehydrogenase B) and *Pdk4* (pyruvate dehydrogenase kinase 4) as well as a higher level of liver lactate ([Figure 5F, G](#pone-0047358-g005){ref-type=\"fig\"}). ", "Overall, the elevated insulin sensitivity in dwarf Mbd5-deficient mice might contribute to the alteration of glucose homeostasis, resulting in hypoglycemia.", "\n\n{#pone-0047358-g005}\n\nDiscussion {#s3}\n==========\n\nIn this study, we identified the *in vivo* function of a novel MBD family protein, MBD5, in mice. ", "Disruption of Mbd5 in mice resulted in postnatal growth retardation that manifested as reduced body weight, body length and impaired GH/IGF-1 signaling. ", "Moreover, brain- specific deletion of Mbd5 resulted in the similar phenotypes as whole body deletion, indicating that Mbd5 functions in the brain to regulate postnatal growth. ", "Interestingly, the mutant mice also showed altered glucose homeostasis due to elevated insulin sensitivity. ", "Our work reveals a potential critical role of Mbd5 in postnatal growth and glucose homeostasis.", "\n\nSeveral MBD family proteins play important roles in the development and function of the nervous systems [@pone.0047358-Fan1]. ", "Mutations in methyl-CpG binding protein 2 (MeCP2) are linked to a human mental retardation disorder, the Rett syndrome [@pone.0047358-Amir1]. *", "Mbd1^−/−^* mice are healthy and fertile but exhibit decreased neurogenesis, impaired spatial learning, and increased genome instability in adult neural stem cells [@pone.0047358-Zhao1]. *", "Mbd2^−/−^* mice appear normal but exhibit a defect in maternal nursing behavior with an unknown cause [@pone.0047358-Hendrich2]. ", "A follow-up study by an international consortium recently revealed that *MBD5* was a single causal locus in 65 human patients with the 2q23.1 microdeletion syndrome. ", "The syndromic features of 2q23.1 microdeletion syndrome involve developmental delays, growth retardation, microcephaly, behavioral problems, seizures and intellectual disabilities [@pone.0047358-Talkowski1]. ", "Our Mbd5-deficient mice exhibit phenotypes that resemble some of syndromes of human patients with 2q23.1 microdeletion, including growth retardation ([Figure 2A, C](#pone-0047358-g002){ref-type=\"fig\"}) and absolute smaller brain size ([Figure S1C](#pone.0047358.s001){ref-type=\"supplementary-material\"}, [Table 1](#pone-0047358-t001){ref-type=\"table\"}). ", "But we didn't see apparent behavioral problems except that the knockout mouse always lowered its head when moving forward ([Movie S1](#pone.0047358.s008){ref-type=\"supplementary-material\"}, [S2](#pone.0047358.s009){ref-type=\"supplementary-material\"}) likely due to its higher brain ratio ([Table 1](#pone-0047358-t001){ref-type=\"table\"}). ", "Although there is a haploinsufficient phenotype in the human population, the Mbd5 mouse heterozygotes appeared grossly normal and were fertile ([Figure 2A, S](#pone-0047358-g002){ref-type=\"fig\"}1A, [Table S1](#pone.0047358.s006){ref-type=\"supplementary-material\"}). ", "The functional pathway of Mbd5 between mouse and human could be different, or the 2q23.1 microdeletion in human involves the combination of *MBD5* and other genes.", "\n\nPostnatal growth retardation that is associated with impaired GH/IGF-1 signaling is a prominent feature of Mbd5 mutant mice ([Figure 3A--E](#pone-0047358-g003){ref-type=\"fig\"}). ", "Because brain homeostatic centers control somatic growth and IGF-1 levels, and *Mbd5* is highly expressed in the central nervous system [@pone.0047358-Laget1], we hypothesize that the loss of neural *Mbd5* might contribute to the growth defects of the mutant mice. ", "In accordance with this hypothesis, specific deletion of Mbd5 in brain results in similar phenotypes as whole body deletion ([Figure 4](#pone-0047358-g004){ref-type=\"fig\"}), indicating the phenotype is caused by Mbd5 deficiency in the nervous system rather than in peripheral tissues. ", "The mechanism of Mbd5 function in brain to regulate postnatal growth warrants further investigation.", "\n\nAs has been shown in multiple studies of dwarfism, mice with reduced levels of GH and IGF1 are insulin sensitive [@pone.0047358-Coschigano1], [@pone.0047358-Dominici1], [@pone.0047358-Belgardt1]. ", "Indeed, random fed and fasted blood glucose concentrations are significantly decreased in the Mbd5-knockout mice compared with the controls ([Figure 5A, S](#pone-0047358-g005){ref-type=\"fig\"}4A). ", "Concomitantly, the knockout mice perform better in the OGTT ([Figure 5C, S](#pone-0047358-g005){ref-type=\"fig\"}4B), exhibit decreased insulin concentrations ([Figure 5B](#pone-0047358-g005){ref-type=\"fig\"}) and showed improved performance in the ITT ([Figure 5D](#pone-0047358-g005){ref-type=\"fig\"}). ", "Improved hepatic insulin sensitivity in the absence of Mbd5 is also confirmed by an increase in Akt activation (phosphorylation) with or without insulin treatment ([Figure 5E](#pone-0047358-g005){ref-type=\"fig\"}). ", "Moreover, the enhanced glycolysis found in the liver further confirms the elevated insulin sensitivity that was observed in the mutant mice ([Figure 5F, G](#pone-0047358-g005){ref-type=\"fig\"}). ", "The reduction in perigonadal and subcutaneous fat ([Figure 2E](#pone-0047358-g002){ref-type=\"fig\"}) also suggests improved insulin action in the mutant mice. ", "Mouse model of conditional knockout of Mbd5 in liver or adipose tissues will be needed to elucidate the relationship between Mbd5 and obesity associated insulin resistance. ", "Overall, the elevated insulin sensitivity and the resulting persistant hypoglycemia might contribute to postnatal lethality of the knockout mice.", "\n\nThe mechanism underlying the growth defect and the altered glucose homeostasis in Mbd5-knockout mice remains an area of future study. ", "All known MBD family proteins can mediate silencing of gene expression by recruiting chromatin remodeling co-repressor complexes [@pone.0047358-Fan1]. ", "Although MBD5 cannot bind methylated DNA directly, it associates with heterochromatin [@pone.0047358-Laget1]. ", "MBD5 might bind to DNA in a complex as it interacts directly with myocyte enhancer-binding factor 2C (MEF2C) [@pone.0047358-Bandyopadhyay1], which plays a crucial role in development, neurogenesis and neuronal gene regulation [@pone.0047358-Li1]. ", "The haploinsufficiency of *MEF2C*, associated with a microdeletion in 5q14.3, results in severe mental retardation [@pone.0047358-Nowakowska1], which is strikingly similar to the phenotype of *MBD5* deficiency. ", "Thus, MBD5 and MEF2C might function in the same signaling pathway to regulate the expression of key neurodevelopmental genes. ", "MBD5 might also associate with a histone deacetylase to execute its function because the MBD family protein can mediate repression through their association with HDAC complexes. ", "Further studies using conditional knockout mice will be needed to identify the mechanism of Mbd5-dependent regulation of somatic growth and glucose homeostasis.", "\n\nIn summary, our study uncovered a novel role for the MBD family protein MBD5 in the control of somatic growth and glucose homeostasis. ", "The Mbd5*-*mutant mice partially mimic the developmental delay and growth retardation of human patients with 2q23.1 microdeletion syndrome. ", "Therefore, the mice generated in this study will be useful for further studies aimed at elucidating of the pathogenic and molecular mechanism underlying this syndrome. ", "Furthermore, Mbd5 deficiency results in a phenotype that has previously been connected to healthy aging (increased insulin sensitivity accompanied by reduced glucose, insulin, and GH levels). ", "Thus, further analysis of Mbd5-knockout mice with respect to longevity might provide new insights into the connections between metabolism, growth and aging.", "\n\nMaterials and Methods {#s4}\n=====================\n\nEthics Statement {#s4a}\n----------------\n\nIn this study, the experimental procedures for the use and care of animals were approved by the Ethics Committee of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.", "\n\nConstruction of the *Mbd5* Targeting Vector and the Generation of Knockout Mice {#s4b}\n-------------------------------------------------------------------------------\n\nStandard recombineering method was used to generate an *Mbd5* targeting vector [@pone.0047358-Liu2]. ", "Briefly, the DNA fragment covering the *Mbd5* gene was retrieved into the pL253 vector from BAC clone bMQ102M9 (Wellcome Trust Sanger Institute, Hinxton, Cambridge, UK). ", "An N-terminal coding region of *Mbd5*, which included a 1.5-kb fragment covering the first exon, was floxed by *lox*P sites that were introduced from the pL452 and pL451 vectors. ", "The targeting vector was linearized with *Not*I and electroporated into MPI-II ES cells (129Sv/Pas derived); these transformed cells were subsequently cultured in the presence of G418 and ganciclovir on mitotically inactivated MEF cells. ", "The targeted ES clones were identified by Southern blotting using the 5′ and 3′ external probes which were prepared by PCR (5′ probe forward, 5′-AACTGATAGGTCACAAGTTCTTCA-3′; reverse, 5′-AATTCCAGGGGCTTGATTTT-3′; 3′ probe forward, 5′-CCGTAGATGGCATGGAAATAAT-3′; reverse, 5′-GGTGCTCAGATACACAGACAGC-3′). ", "Positive ES clones were microinjected into the C57BL/6J blastocysts and then transferred into pseudopregnant foster mothers. ", "Chimeric male mice were bred with C57BL/6J females to generate *Mbd5^f/+^* mice. ", "To generate homozygous Mbd5*-*knockout mice, *Mbd5^f/+^* mice were crossed with *EIIa-Cre* mice in which Cre was expressed in the embryo, and the resulting offspring were intercrossed to generate *Mbd5^−/−^* mice. ", "To generate brain-specific *Mbd5* null mice, *Mbd5^+/−^* mice were crossed with *Nestin-Cre* mice [@pone.0047358-Tronche1], and the \\[*Mbd5^+/−^*, Nestin-Cre\\] pups were crossed with *Mbd5^f/f^* mice. ", "The \\[*Mbd5^f/−^*, Nestin-Cre\\] mice (BSKO) had *Mbd5^−/−^* genotype in the brain. ", "Mouse genotypes were identified by PCR analysis of tail DNA samples using the following primers: P1, 5′- CAGGTCATAAAAGTTGGTGGGTA-3′; P2, 5′- CTGCTCTAAATCCCTGGCCTTC-3′; P3, 5′- TTAAGCTTCCACTTCATTTTCCA3′; Nestincre-F, 5′-TCATGAGGATTCCAACACCA-3′; Nestincre-R, 5′- AATGTTGCTGGATAGTTTTTACTGC-3′. Normal littermate controls were used with the same age in all experiments.", "\n\nTissue Collection, RNA Extraction and Quantitative Real-time PCR {#s4c}\n----------------------------------------------------------------\n\nThe mice were euthanized, and harvested tissues were snap-frozen in liquid nitrogen. ", "The total RNA was purified using TRIzol reagent following the manufacturer's protocol (Invitrogen), and the cDNA was synthesized from 1 µg of total RNA using Primescript RT Reagent kit with genomic DNA Eraser (TAKARA). ", "The mRNA levels were measured by quantitative real-time PCR using SYBR Green reagents (Biotium). ", "All primer information is shown in [Table S2](#pone.0047358.s007){ref-type=\"supplementary-material\"}. ", "The relative level of transcripts of interest was calculated by first normalizing to a housekeeping gene (*β-actin* or *Gapdh*) and then normalizing to wild-type controls using the 2^−ΔΔCT^ method.", "\n\nGlucose Measurement, OGTT and ITT {#s4d}\n---------------------------------\n\nBlood glucose levels in blood samples from tail vein were measured using the OptiumXceed glucometer (Abbott). ", "The OGTT (1 g/kg of body weight, oral) was performed in the fasting state, and the ITT (0.8 IU/kg of body weight, intraperitoneal) was performed in the fed state. ", "The blood glucose was measured at the indicated time points using a glucometer.", "\n\nHormone Measurement {#s4e}\n-------------------\n\nOrbital blood was collected and serum was prepared for hormone measurements. ", "ELISA kits for measuring GH (Millipore), IGF-1 (R&D Systems) and insulin (Mercodia) concentrations were used according to the manufacturer's instruction. ", "For pituitary GH determination, pituitaries were sonicated in PBS supplemented with protease inhibitors (Roche).", "\n\nHistological Analysis {#s4f}\n---------------------\n\nParaffin-embedded pancreatic tissues (sectioned at a 5-µm thickness) and pituitary cryosection (at an 8-µm thickness) were processed for hematoxylin and eosin (H & E) staining [@pone.0047358-Kaufman1].", "\n\nAntibodies and Immunofluorescence Microscopy {#s4g}\n--------------------------------------------\n\nThe monoclonal anti-insulin and anti-glucagon antibodies were from Sigma-Aldrich. ", "The polyclonal anti-GLUT2 antibody was from Abcam. ", "The Alexa-Fluor 488 goat anti-rabbit IgG and Alexa-Fluor 546 goat anti-mouse IgG were purchased from Molecular Probes. ", "The tissues for immunofluorescence were embedded in OCT and the cyrosections were blocked in 1% BSA and 0.3% Triton X-100 in PBS. ", "Then, sections were incubated sequentially with primary and fluorochrome-labeled secondary antibodies. ", "After DAPI staining, the sections were mounted with mount gel (Invitrogen™), and images of the stained sections were captured with a Leica TCS SP2 laser confocal microscope or Olympus BX51 microscope.", "\n\nWestern Blotting {#s4h}\n----------------\n\nLiver tissues were homogenized in lysis buffer (20 mM Tris-HCl, pH 7.4, 137 mM NaCl, 1 mM CaCl~2~, 1 mM MgCl~2~, 1% NP-40, 0.1 mM sodium orthovanadate, 0.1 mM sodium fluoride and protease inhibitor cocktails (Roche)). ", "The homogenates were centrifuged at 20,000 g at 4°C for 15 min, and the supernatant was collected. ", "Western blot analysis was carried out with antibodies against pan-Akt, p-Akt (S473 and T308) (Cell Signaling Technology) and α-tubulin (Sigma).", "\n\nLactate Assay {#s4i}\n-------------\n\nThe lactate concentration was determined with a Lactate Assay Kit (BioVision). ", "The optical density (OD) at 570 nm was measured 30 min after the addition of substrate.", "\n\nStatistical Analysis {#s4j}\n--------------------\n\nThe number of mice in each experimental group is indicated in the figure legends. ", "A two-tailed Student's t-test was used to calculate P-values. ", "All values are presented as means ± standard error (SEM). ", "Differences were considered significant if P\\<0.05.", "\n\nSupporting Information {#s5}\n======================\n\n###### \n\nAdditional phenotypic characterization of Mbd5 mutant mice. (", "A) Body weight of male wild-type (+/+) and heterozygous (+/−) mice at 8 weeks of age. ", "n = 6 per group. (**", "B**) Comparable milk was present in the dead knockout (KO) pups and the corresponding-sacrificed wild-type littermates (WT). (**", "C**) Brain from wild-type (WT) and knockout (KO) mice at P14.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### \n\nAdditional pituitary analysis of Mbd5 deficient mice. (**", "A**) Serum GH concentrations in 2-week-old female knockout mice and littermate controls. ", "n = 4--5 per genotype. (**", "B**) Real-time PCR analysis of pituitary expression of *Ghrhr*, *Ghsr*, *Sstr2* and *Sstr5* in female knockout mice and their littermate controls at P14. ", "n = 5 per genotype. (**", "C**) Morphology of the pituitary tissues from P14 WT and KO mice at 40× magnification. ", "The cryosections were stained with hematoxylin and eosin. ", "The KO pituitaries show no overt histological abnormalities. ", "AP: anterior pituitary; PP: posterior pituitary. (**", "D**) Unchanged expression of *TSHβ* and *ACTH* in Mbd5-deficient pituitary as measured by real-time PCR analysis. *", "Gapdh* was used for normalization. ", "At least 5 pairs of matched female mice were used for the comparison.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### \n\nReduced circulating IGF-1 level in newborn Mbd5-deficient mice. (**", "A**) Comparison of *Igf-1* mRNA levels in hypothalamus, pituitary, muscle, and epigonadal adipose tissues between knockout mice and their littermate controls at P14. ", "n = 5 per group. (**", "B**) Serum IGF-1 concentrations were measured in wild-type (+/+), heterozygous (+/−), and homozygous (−/−) mice at the newborn stage. ", "For each group, n = 7; \\*, P\\<0.05; \\*\\*, P\\<0.01.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### \n\nAdditional analysis of glucose homeostasis of Mbd5 knockout mice. (**", "A**) Fasted blood glucose level in control and Mbd5-knockout male mice at P14. (**", "B**) The OGTT of control and Mbd5-knockout male mice at P14. ", "Basal glucose concentration at time 0 was set as 100%. ", "For each group, n = 5. \\*, ", "P\\<0.05; \\*\\*, P\\<0.01.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### \n\nNormal pancreatic development in Mbd5-deficient mice. (**", "A**) Morphology of the pancreas at P14. ", "The paraffin-embedded sections were stained with hematoxylin and eosin. ", "Scale bar: 200 µm. (**", "B**) Normal distribution of insulin- and glucagon-expressing cells in the pancreas of Mbd5-deficient mice. ", "Representative images of pancreatic cryosections of wild-type and Mbd5*-*knockout mice at P9 are shown. ", "The sections were stained using antibodies against insulin and glucagon, respectively. ", "Scale bar: 50 µm. (**", "C**) Distribution of the GLUT2 transporter in the pancreases of Mbd5-deficient mice at P14. ", "The cryosections were stained using an anti-GLUT2 antibody. ", "Insulin staining was used to distinguish the islets. ", "Scale bar: 50 µm.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### \n\nFertility of *Mbd5^+/−^* mice.", "\n\n(DOCX)\n\n###### \n\nClick here for additional data file.", "\n\n###### \n\nList of oligonucleotide primers used in quantitative real-time PCR.", "\n\n(DOCX)\n\n###### \n\nClick here for additional data file.", "\n\n###### \n\nBehavior of wild-type mice. ", "Shown in the video is the movement behavior of representative wild-type mice at age P14.", "\n\n(MP4)\n\n###### \n\nClick here for additional data file.", "\n\n###### \n\nBehavior of Mbd5-deficient mice. ", "Shown in the video is the movement behavior of representative Mbd5 knockout mice at age P14.", "\n\n(MP4)\n\n###### \n\nClick here for additional data file.", "\n\nWe thank Mingjian Lu for critical reading of the manuscript, Dr. Jiarui Wu for discussions, Dr. Gang Wang for Akt and GLUT2 antibodies, the Model Animal Research Center of Nanjing University and the Shanghai Research Center for Model Organisms for blastocyst injection.", "\n\n[^1]: **Competing Interests:**Co-author Guoliang Xu is a PLOS ONE Editorial Board member, and this does not alter the authors' adherence to all the PLOS ONE policies on sharing data and materials.", "\n\n[^2]: Conceived and designed the experiments: YRD GLX. ", "Performed the experiments: YRD BL FG GFX. ", "Analyzed the data: YRD FG. ", "Contributed reagents/materials/analysis tools: YQD YL. ", "Wrote the paper: YRD XS GLX.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.003389830508474576, 0.005813953488372093, 0.03, 0.01984126984126984, 0.00425531914893617, 0.012269938650306749, 0, 0.03125, 0.013986013986013986, 0.006944444444444444, 0, 0.0234375, 0.0056179775280898875, 0.007042253521126761, 0.009615384615384616, 0, 0, 0.009009009009009009, 0, 0, 0, 0, 0, 0, 0.01680672268907563, 0, 0, 0.007547169811320755, 0, 0, 0.009345794392523364, 0, 0, 0.008064516129032258, 0.011627906976744186, 0.025, 0, 0.008547008547008548, 0, 0.027777777777777776, 0, 0.0035460992907801418, 0, 0, 0, 0, 0, 0, 0, 0.004878048780487805, 0, 0, 0, 0.012987012987012988, 0, 0, 0, 0.009009009009009009, 0, 0.0007272727272727272, 0, 0, 0.009900990099009901, 0, 0, 0.005649717514124294, 0, 0, 0, 0.0039447731755424065, 0.004901960784313725, 0, 0.013559322033898305, 0.022123893805309734, 0, 0.0297029702970297, 0.03636363636363636, 0.015, 0, 0.0049504950495049506, 0.006644518272425249, 0, 0, 0, 0.028985507246376812, 0, 0.030612244897959183, 0, 0, 0.022222222222222223, 0, 0.016666666666666666, 0.01935483870967742, 0.047619047619047616, 0.01015228426395939, 0.00749063670411985, 0.0034602076124567475, 0.003952569169960474, 0, 0.014285714285714285, 0.00904977375565611, 0.00228310502283105, 0.02127659574468085, 0.00625, 0.005847953216374269, 0.01910828025477707, 0, 0, 0, 0.010256410256410256, 0, 0, 0, 0.0136986301369863, 0, 0.0136986301369863, 0, 0.014598540145985401, 0, 0, 0.022222222222222223, 0.015873015873015872, 0.007366482504604052, 0, 0, 0, 0, 0, 0.007352941176470588, 0, 0.00510204081632653, 0.007692307692307693, 0, 0.008849557522123894, 0, 0.002583979328165375, 0, 0, 0.010256410256410256, 0, 0.012345679012345678, 0, 0.01639344262295082, 0, 0.03333333333333333, 0.037037037037037035, 0.022222222222222223, 0.013333333333333334, 0, 0, 0.010101010101010102, 0, 0, 0.012987012987012988, 0.008583690987124463, 0.006535947712418301, 0, 0, 0, 0.0078125, 0.013986013986013986, 0.0053475935828877, 0.007751937984496124, 0, 0.004807692307692308, 0, 0, 0, 0, 0.005555555555555556, 0.007547169811320755, 0, 0, 0.020202020202020204, 0, 0.0033222591362126247, 0, 0, 0, 0, 0, 0, 0.006622516556291391, 0.00909090909090909, 0.012145748987854251, 0.004739336492890996, 0, 0, 0, 0, 0, 0, 0.005208333333333333, 0, 0.007042253521126761, 0.0036900369003690036, 0.011764705882352941, 0, 0.012605042016806723, 0.006688963210702341, 0, 0, 0.004672897196261682, 0.01990049751243781, 0.024096385542168676, 0.00821917808219178, 0.008888888888888889, 0.0136986301369863, 0, 0, 0, 0.015957446808510637, 0.012269938650306749, 0, 0, 0.032467532467532464, 0.026785714285714284, 0.01568627450980392, 0.005494505494505495, 0, 0.04201680672268908, 0.015384615384615385, 0, 0.005, 0.011450381679389313, 0, 0.02097902097902098, 0.008547008547008548, 0, 0, 0.016129032258064516, 0, 0, 0, 0, 0, 0.0078125, 0.03278688524590164, 0.018518518518518517, 0, 0, 0, 0.006493506493506494, 0, 0.011494252873563218, 0.017241379310344827, 0.01639344262295082, 0.019230769230769232, 0.008695652173913044, 0, 0, 0.018518518518518517, 0.01282051282051282, 0.012048192771084338, 0, 0.007462686567164179, 0.06, 0.018518518518518517, 0, 0.012195121951219513, 0.01639344262295082, 0, 0.037037037037037035, 0.043478260869565216, 0.018518518518518517, 0, 0.025, 0.013888888888888888, 0, 0.009345794392523364, 0, 0, 0, 0.010869565217391304, 0, 0, 0, 0.018518518518518517, 0, 0, 0.01282051282051282, 0, 0, 0.011363636363636364, 0, 0, 0.010869565217391304, 0, 0.02214022140221402, 0.020202020202020204, 0.017543859649122806, 0.023809523809523808, 0.037037037037037035, 0.01818181818181818, 0.03571428571428571, 0 ]

[ "Through the Taliban’s eyes: peace prospects in Afghanistan\n\nBy\n\nBy\n\nCOMMENTS\n\nShare\n\nCOMMENTS\n\nRelated Content\n\nThe peace talks went on uninterrupted, a marathon session for six intense days, yet barely a moment in a war that has lasted so much longer.", "\n\nStill, Zalmay Khalilzad, US Special Representative for Afghanistan Reconciliation, emerged from the negotiations with the Taliban in Qatar last month with a message of hope, choosing to broadcast his message via a social media platform that didn’t even exist when the conflict in Afghanistan began.", "\n\n1/3 After six days in Doha, I'm headed to #Afghanistan for consultations. ", "Meetings here were more productive than they have been in the past. ", "We made significant progress on vital issues.", "\n\n— U.S. Special Representative Zalmay Khalilzad (@US4AfghanPeace) January 26, 2019\n\nHaving assumed his assignment to end the longest war in American history, Khalilzad was upbeat. ", "He went so far as to signal during a recent interview with a local television station in Kabul that “it is possible” to reach a peace deal with the Taliban before this year’s presidential elections in Afghanistan ­– now delayed until July.", "\n\nSuch optimism. ", "But this hope for a political solution suggests US officials lack a concrete understanding of the view about negotiations from the men that sit on the other side of the table. ", "It’s not that the Taliban is shy about expressing its view. ", "A trove of information in the Pashto language is published online: edicts, orders, fatwas, and manifestos; all waiting to be examined.", "\n\nDelving into and translating many of the documents in my postgraduate research, the attitudes revealed are compelling, and deeply worrying for the prospects of lasting peace.", "\n\nThe Taliban’s logic for peace negotiations\n\nAs with the justification for its “jihad” in Afghanistan based on “sharia”, the Taliban also turned to “sharia” to guide its “negotiations” with the Americans. ", "The group has published a series of fatwa-like commentaries under the title “Afghanistan’s contemporary jihad based on sharia” on its Pashto website. ", "In April last year, the group declared:\n\nIn response to the US occupation, defensive jihad is mandatory based on sharia, and if the enemy is keen for peace, then peace must be also based on sharia.", "\n\nPeace according to “sharia” is further explained in subsequent documents. ", "In June, the Taliban reaffirmed that the goal of its current “jihad” is the “end of occupation” and the introduction of the “rule of sharia in Afghanistan”. ", "According to the group, the goals of any kind of potential peace should be precisely the “same as the goals of ongoing jihad” itself.", "\n\nBased on sharia, peace is a moral jihad, if the mentioned goals of jihad [end of occupation and rule of sharia] can be achieved through peace, then there should be peace. ", "And if the goals of muslims are not achieved in peace, then peace is prohibited, and jihad remains obligatory against occupiers.", "\n\nWhat these files reveal is that the Taliban believes “Afghans” have two choices for the future in Afghanistan: “jihad” or “peace”. ", "The goals of both options are the same: the “end of occupation” and “rule of sharia”. ", "This Taliban logic for peace has been consistent, with the ideology viewed as a means to recruit fighters and, to some extent, to appeal for local support for its insurgency.", "\n\nThe goals of both options are the same: the “end of occupation” and “rule of sharia”.", "\n\nBut more than this, it creates an impression that the Taliban would not accede to the presence of even a small number of American troops in Afghanistan. ", "To do so would mean it has abandoned its ideological appeal to free Afghanistan from “American occupation”, a means by which it can and has already developed a degree of popular legitimacy.", "\n\nRumours spread in December that the Taliban and Khalilzad agreed that the US would be permitted to have two military bases in Afghanistan. ", "The group immediately denied this. ", "To sustain its narrative, the Taliban insists it will continue to fight until the very last American soldier leaves the country.", "\n\nSo the US negotiators would be naïve to believe that a political solution with the group will allow the Americans to retain military bases in the country. ", "Such an outcome would require the Taliban to shift dramatically in its narrative of struggle, compromising their credibility with both prospective recruits and segments of the population that are sympathetic. ", "There is no public evidence of such an about-face.", "\n\nTalk with Americans, but not Afghan officials\n\nA common theme in the Taliban view on peace is that the Taliban and the US – not the Afghan Government – are the “main parties” in the country’s peace negotiations. ", "The Taliban’s reason for this claim? ", "Because the Americans started the war in Afghanistan in 2001 against the “Islamic Emirate of Afghanistan”, by its accord, only these two sides can end it.", "\n\nAccordingly, the Taliban has consistently cited two key reasons to refuse to negotiate with the Afghan government directly. ", "In an official commentary under the title of “Why negotiations are not possible with the Kabul administration!”, ", "the group argues, firstly, that the Afghan government does not have authority over key issues that concern the Taliban, including the “withdrawal of troops”, “delisting of Taliban leaders from blacklist”, “recognition of political office”, and the “release of prisoners”.", "\n\nSecondly, the group believes the elites in the “Kabul regime” have no interest in the withdrawal of American forces, “because their existence is dependent on foreign troops”. ", "The Taliban also cites disagreements within the National Unity Government of Afghanistan and differences of opinions about peace between President Ashraf Ghani and Chief Executive Dr Abdullah Abdullah. ", "For example, in June 2017, criticising the “Kabul Process”, the Taliban issued a daily commentary, “Is the Kabul process really for peace?” ", "which stated:\n\nWhile Ashraf Ghani described the agenda of the gathering as peace negotiations with the Taliban … speaking to the representatives of more than 25 countries, his Chief Executive and his Foreign Minister did not attend the meeting.", "\n\nOfficers from the US Army and Afgan National Army (Photo: Resolutesupport/ Flickr)\n\nThe Taliban wants to discredit the major achievements of the past 18 years, including the democratic state that the group does not recognise as legitimate. ", "The Taliban doesn’t stop there. ", "It also wants to be the boss in talks aimed to end the “occupation”, leaving the Afghan government sidelined. ", "For the Taliban, if officials of the Afghan government are on the same negotiation table, it would mean that they are not leading the process.", "\n\nA national peace [process] with infidels is not the duty of any individual. ", "This [peace process] is a social matter of Muslims, and Sharia has given this right to the Imam of the Muslims. ", "Particularly while Afghanistan is functionally under occupation of Americans, in such situation, decisions of peace, war, and negotiations with infidels and occupiers is the responsibility and duty of the individual who practically holds the leadership of decision making in the struggle against the occupiers.", "\n\nIn other words, the Taliban leader, Mawlawi Hibatullah.", "\n\nThe Taliban in the new Afghanistan\n\nThe group explains its approach towards a political solution to the conflict in two stages and based on two factors – external and internal. ", "As a Taliban representative put it in January 2016 at Pugwash conference in Qatar:\n\nThe matters, related to foreign troops will be discussed with the Americans in the first stage and the rest of the issues that relates to Afghan people, will be resolved with Afghans afterwards.", "\n\nWhereas the external issue is the withdrawal of troops, internal issues include the system of government which the Taliban aims to establish after the troops’ withdrawal. ", "In a Taliban commentary, “The straight way towards peace”, social ills, from corruption to criminality, are blamed on the current constitution grounded in a belief that peace and justice prevailed before American occupation in 2001 under the laws it enforced. ", "As the group made clear in a 2016 comment:\n\nThe Kabul administration’s current constitution, established under the shadow of occupation, is not acceptable for the Afghan people, as it does not fulfil their needs … and cannot serve justice to the poor.", "\n\nThe Taliban wants the dominant focus of the peace process to be negotiations about the withdrawal of American troops. ", "On internal issues with Afghans, changes to the constitution would likely be very significant, as the Taliban still believes in strict laws, which it considers imperative in returning Afghanistan to what was in its view the stable and socially cohesive country that existed before the US invaded.", "\n\nAny progress to end the longest war in American history would require accepting some mind-boggling demands from the Taliban, or substantial policy and ideological shifts on their part, which seem unlikely.", "\n\nNonetheless, the Taliban is attempting to portray itself as a more tolerant group, maintaining that it is “committed to civic activism, freedom of speech, women’s rights, facilitating education, and preserving and developing national projects.” ", "The key issue, however, is how its understanding of these values is shaped by the core commitment to a particular interpretation of Sharia. ", "The Taliban also presents itself as determined to offer mutual respect with neighbouring states and all countries around the world.", "\n\nWhere does this leave the negotiations? ", "Any progress to end the longest war in American history would require accepting some mind-boggling demands from the Taliban, or substantial policy and ideological shifts on their part, which seem unlikely.", "\n\nPatience is the most important need. ", "Yet it won't help unless American diplomats understand their adversary – the Taliban’s commitment to its desire to rule a “Sharia-governed” Afghanistan unchallenged, and as a sovereign power.", "\n\nIn a series of tweets, Khalilzad affirmed that significant progress had been made on two vital issues of counter-terrorism and troop withdrawal, and also vowed that “nothing is agreed until everything is agreed.” ", "As he is set to meet the Taliban in the next round of negotiations scheduled for the end of this month, Khalilzad needs to be vigilant about post-withdrawal chaos which will ensue in the absence of strong institutions and inclusive democratic government.", "\n\nMeaningful and long-lasting political changes that ensure long-lasting peace do not just materialise for the sake of meeting a deadline, whether for the Afghan election, or the next American one." ]

{ "pile_set_name": "Pile-CC" }

[ 0.003968253968253968, 0.006666666666666667, 0, 0, 0, 0.016574585635359115, 0.0041841004184100415, 0, 0, 0.016666666666666666, 0, 0, 0.009708737864077669, 0, 0, 0, 0.006369426751592357, 0, 0, 0, 0.007518796992481203, 0, 0.005747126436781609, 0, 0.0064516129032258064, 0, 0.014184397163120567, 0, 0.0078125, 0, 0.004784688995215311, 0, 0.009345794392523364, 0.02702702702702703, 0.006493506493506494, 0.007936507936507936, 0, 0.007380073800738007, 0, 0.019801980198019802, 0.014285714285714285, 0.00819672131147541, 0.01652892561983471, 0.03125, 0, 0.007042253521126761, 0, 0, 0, 0.03508771929824561, 0.00558659217877095, 0.0035971223021582736, 0.005780346820809248, 0.0038461538461538464, 0, 0.008333333333333333, 0.0033783783783783786, 0.004830917874396135, 0.004048582995951417, 0.007142857142857143, 0.007633587786259542, 0, 0.004878048780487805, 0, 0.005235602094240838, 0.004651162790697674, 0.007874015748031496, 0 ]

[ "My U.S. Pat. ", "No. ", "6,707,363 describes a magnetic structure based upon a conical geometry designed for NMR (sometimes referred to as MRI) head imaging in interventional procedures. ", "The goals include an open structure providing full access to the head region while being imaged to a surgeon, minimize the dimensions and weight of the magnet materials, make an efficient use of the magnetic material with a maximum strength of the NMR imaging field, as well as allow access to the head of the patient from the vertical as well as the horizontal direction.", "\nMy improvement patent application, published as US 2004/0135580 A1, teaches several ways to improve the performance involving the use of magnetic straps, and a way to reduce the volume and weight of the permanent magnetic material by recessing a central pole piece to extend inwardly the outer permanent magnet. ", "However, to achieve proper magnetic conditions at the material interfaces so as not to reduce the uniformity of the active magnetic field in the region of interest, it was thought necessary to introduce a non-magnetic region between the inwardly-extending magnetic section and a part of the pole piece and the remainder of the outer permanent magnet.", "\nA further improvement patent application filed Oct. 27, 2003 by me, under application Ser. ", "No. ", "10/694,419, features a structure wherein the interface between the pole piece and permanent magnetic conical section is configured to form an equipotential surface.", "\nAll three of these previous patent applications focused on head imaging, because it did not appear possible at the time those inventions were made with the structures there described to obtain a sufficiently large cavity having a uniform magnetic field in the region of interest to accommodate a larger body part, such as the chest of a patient." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0.006172839506172839, 0.002688172043010753, 0, 0, 0, 0, 0, 0 ]

[ "An American Medical Response ambulance crew arrives after it was called in by D.C. Fire and EMS to transport a patient in Northeast Washington in March 2016. (", "Ricky Carioti/The Washington Post)\n\nD.C. fire officials tout improvements in emergency service made possible by the use of a private ambulance company that handles less-urgent 911 cases. ", "But it remains unclear whether the multimillion-dollar strategy will become a permanent remedy.", "\n\nThe city signed a one-year contract in November with American Medical Response that can be re-upped annually for four more years. ", "The new deal is estimated at about $12 million per year, fire officials said, and follows on the $10.5 million paid to AMR from March 2016 — when its private fleet began answering calls — to the end of February.", "\n\nNearly 15 months after adding the private operation, D.C. Fire and EMS Chief Gregory Dean still describes the plan as a bridge to stabilizing 911 response.", "\n\n“We like the fact that AMR has taken a workload off us, to allow us to be available to improve our response time, improve our ­training, improve our maintenance of our vehicles,” Dean said. “", "Whether it’s AMR or some other form, we recognize that to be successful, we need help in delivering emergency medicine in the District.”", "\n\nThe private service transports patients who’ve first been assessed by city paramedics and firefighters as not having a life-threatening condition. ", "The city crews respond to all 911 calls, but under the year-old system, they transport only the most serious cases.", "\n\nPersonnel from American Medical Response and D.C. Fire and EMS load a patient into an AMR ambulance after a call in March 2016. (", "Ricky Carioti/The Washington Post)\n\n[Private ambulances deployed to ease city’s 911 burden]\n\nThe program has not been without its troubles.", "\n\nThe city contends that AMR should pay $198,590 in penalties for not meeting contract performance standards on response times or available units since November.", "\n\nAMR said in a statement that it intends to challenge those fines once it sees what information the city used to calculate the penalties. ", "The company said its contract contains an exemption for issues beyond its control and that requests for service are higher than some of the expectations used to set the performance measures.", "\n\nAfter it sees the city’s underlying data, the company statement said, it expects “the exemption process under the agreement will greatly reduce or eliminate any penalties.”", "\n\nThe partnership with the city, AMR said, was “exciting” and is “helping the District and its residents.”", "\n\nAMR has periods when it does not have units available, but Dean said the shortfall works out to less than 10 minutes a day on average.", "\n\nThat performance, Dean said, has not prevented the District from reaching its goal of shifting thousands of non-urgent medical calls to AMR to free up D.C. fire and emergency crews for the most pressing needs and to relieve a system that has a growing number of 911 calls.", "\n\nFire officials face a D.C. Council Committee on the Judiciary and Public Safety oversight hearing Thursday on the contract and performance of AMR, as well as the budget for other programs meant to reduce how often emergency personnel are dispatched on 911 calls that are not dire circumstances.", "\n\nThe District is 24th in population nationally but ranks eighth in 911 call volume, giving the District the highest per capita EMS call volume in the country, fire officials say.", "\n\nThe new programs include adding a nurse triage line at the 911 center — which already has budget approval for $1 million — to help assess medical urgency in calls and steer nonsevere cases away from emergency crews and toward proper medical providers. ", "Fire officials also are planning an education and communications program that could cut how often residents call 911 for situations that aren’t life-threatening.", "\n\n[District considers nurse triage line as agencies grapple with 911 overload]\n\nCharles Allen (D-Ward 6), chair of the D.C. Council’s public safety oversight committee, said department officials have convinced him that the private contract works to meet response needs, but the city will need more time to decide whether having a parallel private service should be permanent.", "\n\n“We are seeing a real stabilization in the response time and the ability for emergency services to get to people in need, even in the face of ever-increasing call volume,” Allen said. “", "Are we in the midst of creating a dual system or will this truly be the temporary stabilizer that is it was meant to be? ", "It is unclear to me.”", "\n\nThe D.C. firefighters union continues to back the decision to use AMR as a short-term remedy to buy the city time to find a long-term solution to the glut of 911 calls. ", "But Dabney Hudson, the union’s president, said the city needs to solve the calculus of how many units and personnel are needed to match call volume on a day-to-day basis if it wants permanent improvement.", "\n\n“We would have killed people if we didn’t have this, that’s safe to say. ", "More units are more units, and at the end of the day, we need more units,” Hudson said.", "\n\nDuring the first year, AMR transported an average of 144 patients a day, nearly 900 per week and 4,337 a month, according to fire department data.", "\n\n“The majority of transports by AMR are people that should not be going to the hospital. ", "They should be going to a clinic or a primary care doctor,” Hudson said.", "\n\nHudson said the union wants the city to continue to figure out how to better manage 911 call volume with a public education campaign to cut back on minor calls that clog the system.", "\n\n[District mayor touts fire and rescue improvements]\n\nWhen AMR first started working with the city in March 2016, it was under an emergency contract that set performance goals based on 2014 data.", "\n\nThe AMR contract from November is less stringent on response times and was changed to reflect the reality of increased call volumes overall and seasonal adjustments for heavier call volumes outside of winter months, fire officials said.", "\n\nUnder the new contract, AMR can be penalized if the company fails to respond to service calls within 10 minutes 80 percent of the time from May through October. ", "From Nov. 1 to April 30, when call volumes are lower, the target for AMR, fire officials said, is 90 percent in the 10-minute window.", "\n\nDean said officials are confident that even with the new leeway on times, the department can achieve its goals of prompt response and improved readiness.", "\n\n“We had many stories on our inability to deliver care and service; today what we’re talking about is how do we refine and how do we improve that system,” Dean said. “", "We do risk-management. ", "We don’t staff for the biggest alarm, we staff right in the middle.”", "\n\nThe chief said the current contract has helped slice average response times from 8:07 minutes to 6:50, and he said he hopes to steer the department to National Fire Protection Association standards of four- to six-minute response times for the most critical calls.", "\n\nLeft unsettled is whether it will require a private ambulance service — with its $12 million annual cost — for the city to hit its performance goals.", "\n\n“I don’t have a dollar figure . . . ", "is it too much or is it too little,” Dean said. “", "Our job is to provide confidence to the citizens that if you have an emergency, whether it’s a fire, medical hazmat or whatever, that the District has resources and trained personnel to get there and take care of you.”" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.012578616352201259, 0.0053475935828877, 0, 0.007575757575757576, 0.004739336492890996, 0.012738853503184714, 0.010362694300518135, 0.007352941176470588, 0, 0, 0.022900763358778626, 0.007194244604316547, 0.006211180124223602, 0.007194244604316547, 0, 0, 0.009433962264150943, 0.014705882352941176, 0.0072992700729927005, 0.010135135135135136, 0.00558659217877095, 0, 0, 0.005333333333333333, 0.0053475935828877, 0, 0, 0.005847953216374269, 0.004901960784313725, 0, 0.011494252873563218, 0.006756756756756757, 0.011111111111111112, 0.013888888888888888, 0.00546448087431694, 0.00510204081632653, 0.004201680672268907, 0.006134969325153374, 0.007518796992481203, 0.0064516129032258064, 0.005952380952380952, 0, 0, 0.0037593984962406013, 0, 0, 0.02040816326530612, 0 ]

[ "Q:\n\nJava visitor pattern instead of instanceof switch\n\nIn this question it is said I can use visitor pattern instead of a bunch of instanceofs. ", "Jmg said \"If you are not free to change A, B, and C, you could apply the visitor pattern to achieve the same.\"", "\nAs far as I understand I still have to make A, B and C support visitor (have an accept() method, for example).", "\nMy problem is I have absolutely no possibility to change A, B and C. I just get the Car object from the foreign library and have to call wash() method specific for trucks, race cars and buses.", "\nI think I still need an if-else-ifconstruction with instanceofs. ", "Am I right?", "\n\nA:\n\nYes, to implement the visitor pattern now you need access to the source of A, B and C, unless all the classes have the same signature (so all have the wash() method with the same name). ", "If that's the case, you can use polymorphism to call the correct method.", "\nOtherwise, it is possible to add functionality to classes you don't have access to at source code level. ", "On the Wikipedia article on the Visitor pattern (http://en.wikipedia.org/wiki/Visitor_pattern) there is a small footnote below the Java example: \n\nNote: A more flexible approach to this pattern is to create a wrapper class implementing the interface defining the accept method. ", "The wrapper contains a reference pointing to the CarElement which could be initialized through the constructor. ", "This approach avoids having to implement an interface on each element. [", "see article Java Tip 98 article below]\n\nIt references this article: http://www.javaworld.com/javaworld/javatips/jw-javatip98.html\nSo, all in all it's possible, but it gives an enormous number of classes for the small task you want to do. ", "I'd stick with the instanceof's if I were you.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0.00909090909090909, 0, 0, 0, 0, 0, 0, 0, 0.014388489208633094, 0.008928571428571428, 0, 0.004201680672268907, 0, 0 ]

[ "Q:\n\nAdjusting graphical LaTeX text size in Matlab\n\nI am trying this example:\nhttp://www.mathworks.com/help/symbolic/latex.html\nLet's say I wanted to resize those labels. ", "How? ", "I can't figure out any LaTeX code, and 'fontsize' does not do the trick.", "\n\nA:\n\nHere is the line that worked:\nylabel('$x_e, x_c$', 'interpreter','latex', 'fontsize', 32);\n\nObviously, between the dollar signs can be whatever appropriate LaTeX expression desired.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.01764705882352941, 0, 0.013888888888888888, 0.0106951871657754, 0 ]

[ "Gout masquerading as rheumatoid vasculitis.", "\nA 30-year-old Mexican woman had rash, deep ulcerations of her lower extremities, and debilitating polyarthritis. ", "Her disorder simulated rheumatoid vasculitis, but serum rheumatoid factor was absent. ", "The diagnosis of gout was confirmed by uric acid crystals in joint fluid and skin biopsy specimens and by x-ray crystallography. ", "The age and sex were unusual for a patient with gout, and she had none of the commonly associated metabolic defects. ", "This unique presentation for urate arthropathy needs further study." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0, 0 ]

[ "Ramen noodles may seem simple at first blush, but from Tokyo style ramen noodles to Hakata style ramen noodles, complexities about.", "\n\nHi, I'm ramen. ", "You may remember me from such bowls as \"First Dish I Learned to Cook On My Own,\" the ever-popular \"Morning After Peach Schnapps-Fueled College Dorm Room Party,\" \"Don't Tell Mom The Microwave Is Dead,\" or, one of my more subtle, emotional works, \"Oriental Flavor.\"", "\n\nDespite its popularity among the cash-strapped and the sodium-starved, the world or ramen extends far beyond the instant variety we grew up on. ", "Originating in China, alkaline noodles served in soupy broth have been in Japan for well over a century, but like pizza in America, only became widespread after World War II. ", "Troops returning from overseas had developed a taste for the stretchy noodles, and the inexpensive ingredients—wheat flour, bones, and vegetables—made them an attractive dish for restaurants to serve.", "\n\nNowadays, ramen is high in the running for national dish of Japan. ", "Museums have opened dedicated to its history. ", "The instant ramen noodle was voted as the greatest Japanese export of the 20th century in a national poll (placing ahead of karaoke machines, walkmen, and Kurosawa films). ", "And, just as with pizza in the U.S., regional styles and specialties abound with soups, noodles, and toppings, all varied according to local tastes, ingredients, and cultures.", "\n\nI'm not going to even pretend that a comprehensive style guide of all the ramen out there is possible, but we'll do our best to give you something to noodle over.", "\n\nClassifications for the Broths\n\nYou often see ramen categorized into four classes: shio (salt), shoyu (soy sauce), miso (fermented bean paste), and tonkotsu (pork), which doesn't make particular sense, as the first three are flavorings, while the fourth is the broth base. ", "It's sort of like saying \"there are four basic types of pizza: Neapolitan, Sicilian, New York, and pepperoni.\"", "\n\nWhile it's true that even with strictly Japanese style ramen, some folks see those four classes as distinct, there are plenty of cases where there are overlaps and outliers. ", "For instance, what would you call a creamy, opaque, heavy ramen that's made entirely with chicken bones? ", "It doesn't fall neatly into any of those categories, but it certainly exists.", "\n\nInstead, it makes much more sense to categorize ramen broth first by its heaviness, then by the soup base ingredients, and finally by the seasoning source. ", "This classification system, used by some Japanese sources, can be combined to cover pretty much every bowl of soup-based ramen in existence.", "\n\nClassifying Ramen Broth by Heaviness\n\nHeaviness is classified as either kotteri (rich) or assari (light). ", "Kotteri broths will be thick, sticky, and usually opaque, packed with emulsified fats, minerals, and proteins from long-boiled bones. ", "Opaque white bone broths are also known by their transliterated Chinese name, paitan. ", "Assari broths are clear and thin, usually flavored with more vegetables, fish, or bones cooked relatively briefly at a light simmer so as not to cloud the broth.", "\n\nIt's a sliding scale bordered on the kotteri side by Sapporo-style miso ramen that comes served with a pat of butter; and on the assari side with the lighter, clear seafood soups of Hakodate.", "\n\nClassifying Ramen Broth by Broth Base\n\nThe broth base is the main ingredients simmered to make the soup. ", "This can range from animal bones—pork, chicken, beef, and fresh fish being the most common—to even lighter broths made with sea kelp or or dried seafood. ", "In addition to their main ingredient, ramen broths incorporate a variety of aromatics, such as charred onions, garlic, ginger, fresh scallions or leeks, and mushrooms.", "\n\nThe most widely recognized and celebrated broth worldwide these days is tonkotsu, a boiled pork bone broth. ", "The best tonkotsu broths are a milky, golden color and leave a sticky sheen of gelatin on your lips as you slurp them.", "\n\nCheck out our recipe for Tonkotsu Ramen Broth here.", "\n\nClassifying Ramen Broth by Seasoning\n\nThe seasoning is the main salt source used to flavor the soup. ", "It can be mixed directly into the soup base, but in many ramen shops, it's added to each individual bowl, making the menu a bit more customizable. ", "The most common seasonings are:\n\nShio: Sea salt is the oldest form of ramen seasoning, and derives from the original Chinese-style noodle soups. ", "Shio ramen is popular in Hakodate, a southern city in the Hokkaido prefecture where strong Chinese ties influence local cuisine, but the weather is still mild enough for lighter, salt-based soups to flourish.", "\n\nShoyu: Japanese soy sauce is a popular ramen seasoning in the Kanto region of central Japan, originally emanating from Yokohama. ", "Traditionally it's paired with clear to brown chicken, seafood, and occasionally pork or beef-based broths, though these days shoyu is used willy-nilly by ramen chefs throughout Japan. ", "It's very common to see creamy tonkotsu pork broths flavored with shoyu, for instance.", "\n\nMiso: Miso ramen is the youngest form of ramen, having gained popularity only in the mid 1960's and originating from Northen Hokkaido, where cold weather demanded a bolder, heartier bowl of soup. ", "Its youth has not stymied its popularity, and it can now be found all over Japan and the rest of the ramen-eating world, most often paired with heavier, more robust, and unique toppings like sweet corn or stir-fried pork belly and bean sprouts.", "\n\nWhile in general, shio tends to be used to season ramen on the assari end of the scale and miso for the kotteri with shoyu somewhere in the middle, exceptions abound, and it's not uncommon to find rich bone broths flavored with plain salt or lighter seafood broths paired with miso.", "\n\nWith these categories, we can classify pretty much any bowl of ramen we come across. ", "For instance, the creamy chicken paitan ramen at New York's Totto Ramen would be considered a kotteri ramen made with a chicken broth base and flavored with shoyu, while the shio ramen at Yebisu would be an assari, sea-based broth flavored with salt. ", "Get it?", "\n\nOils and Other Seasonings\n\nSome ramen shops will finish a bowl of ramen with a small ladleful of flavorful oil or fat—Clarified pork fat of various chili or sesame oils, for instance. ", "More esoteric broth flavorings such as tahini-style sesame paste or powdered smoked and dried bonito can also be found. ", "And of course, MSG usage is common—the Japanese don't have the same hang ups about it as we do here in the States.", "\n\nWhat Type of Noodles are Ramen?", "\n\nThere are more types of noodles in Japan than there are shapes of pasta in Italy. ", "Okay, I don't know if that's 100% true, but it sure seems that way. ", "Whether straight, thin, and narrow, thick and wavy, or wide and flat, ramen chefs will select noodles based on their bounciness, their ability to cling to broth, and their texture in the mouth, searching for a noodle that interacts harmoniously with the soup in the bowl.", "\n\nSerious ramen chefs are notoriously militant about noodle-eating etiquette. ", "They say that perfect noodles will only last for five minutes after they are added to the hot broth—any longer than that and they become overcooked and mushy—so as a patron, it's your duty to start eating as soon as the bowl is delivered and not stop until you're finished; Hence the wild slurping you'll find in a typical Japanese ramen shop. ", "Order ramen to go and you'll get your noodles on the side, intended to be added to the reheated broth when you get it home—that is, if the ramen shop even allows to-go orders. ", "Many refuse.", "\n\nStill hungry after you're done slurping? ", "Ask for kaedama, an extra serving of noodles to be added to the leftover broth in your bowl.", "\n\nSome noodle classification is in order.", "\n\nTo begin with, let's define exactly what a ramen noodle is. ", "Originating from China, ramen-style noodles are made with wheat flour, salt, water, and kansui, an alkaline water which gives the noodles their characteristic bounce and their yellowish hue. ", "While it's possible to find noodles made with eggs in place of the kansui, this is far more common in China than it is in Japan.", "\n\nFresh noodles are the norm for high-end ramen shops. ", "While size and shape vary, you'll typically see thin, straight noodles paired with hearty tonkotsu-style broths—the noodles cling together and hold soup in via capillary action, delivering plenty of hearty pork flavor with each slurp—while wavy noodles tend to be paired with miso-flavored ramens, their waves capturing the nutty bits of fermented soy bean. ", "Shio and shoyu-flavored lighter soups can get any type of noodle and the selection varies widely by region.", "\n\nJust as spaghetti is not inherently better or worse than tagliatelle, trying to declare one style of noodle—thin and straight or thick and wavy—as the best is a futile effort.", "\n\nDried Noodles are made by drying fresh, uncooked noodles and are an excellent choice for home cooking, though they're occasionally used in restaurants as well (but you're much more likely to find more traditional Japanese-style noodles such as udon, somen, and soba in dried form than Chinese-derived ramen). ", "Generally, with dried noodles, the thinner and straighter they are, the better they reconstitute.", "\n\nInstant Noodles were invented in 1958 by Momofuku Ando and were most likely your very first introduction to the world of ramen. ", "What hungry college student hasn't nursed themselves out of a hangover over a 59¢ bowl of instant ramen? ", "The most common method of production is to deep-fry par-cooked bricks of noodles to dehydrate them (aka \"de-fry-drating\"). ", "Take a look at the fat content on a pack of inexpensive instant ramen. ", "That all comes from the dehydrating process.", "\n\nHigher-end instant noodle brands, such as Myoja Chukazanmai, are made by air-drying par-cooked noodles, resulting in an end product that's costlier to produce, but far more similar to traditional ramen.", "\n\nRamen Toppings\n\nToppings on bowls of ramen are more than an afterthought. ", "For many shops, it's their defining characteristic. ", "Toppings can vary from simple vegetables and seasonings to far more complex meats and sauces that must be prepared separately and in advance. ", "Here are some common ones you might find.", "\n\nMeat\n\nChashu pork is by far the most popular ramen topping. ", "Though the name is derived from the Chinese char siu roast pork, the Japanese version is made by simmering pork in a sweet soy and mirin sauce until it's fall-apart tender. ", "Pork loin is common, but I prefer the kind made with fatty pork belly. ", "You can see my own recipe for chashu here.", "\n\nKakuni is similar to chashu in that it's simmered pork belly, but this version comes in chunks and is modeled after the Chinese method of red braising.", "\n\nBacon can be sliced and added to the simmering broth, or stir-fried briefly before topping the bowl.", "\n\nShredded Pork made by braising pork shoulder then pulling and shredding the meat has become increasingly popular—it's what David Chang uses to top his bowls at Momofuku. ", "For my own take, I like to crisp up the shreds of pork shoulder carnitas-style before topping the bowl.", "\n\nGet the recipe for Miso Ramen with Crispy Shredded Pork here!", "\n\nGround Meat is usually stir-fried with other ingredients like bean sprouts or cabbage before it's added.", "\n\nSeafood such as scallops, shrimp, mussels, and crab are simmered gently and paired with lighter, sea-flavored broths.", "\n\nKamaboko is the familiar white and red fish cake that comes sliced on top of sea-flavored ramen. ", "When it's formed into a spiral shape, it's called narutomaki.", "\n\nEggs\n\nEggs and ramen go hand in hand like Bert and Ernie. ", "It's hard to imagine one without the other. ", "A good soft boiled or poached egg is my favorite way to jazz up a bowl of instant ramen at home.", "\n\nBoiled Eggs are easy, filling, and last a long time. ", "If you want your eggs soft boiled, ask for them hanjuku. (", "Just don't ask for that in a Japanese manga shop or you will get something entirely different.)", "\n\nAjitsuke Tamago, which literally means \"applied seasoning egg,\" is a soft boiled egg which has been marinated for several hours in a soy sauce and mirin solution. ", "They come out lightly salty and sweet with a golden, liquid yolk. ", "They're very easy to make at home and make a great snack. ", "Check out my recipe here.", "\n\nOnsen Tamago are soft cooked eggs that were originally made in the onsen (hot springs) of Japan. ", "These days you're more likely to find them coming out of high-tech sous-vide style water ovens. ", "By slow-cooking eggs at around 140 to 145°F, you end up with a white that's barely set into custardy tenderness and a yolk that's still liquid and runny, perfect for stirring into your soup for extra richness.", "\n\nFresh Vegetables\n\nScallions: If eggs are the Ernie to Ramen's Bert, then scallions are the Jim Henson—the driving force that powers them and bring out their best qualities. ", "No bowl of ramen is complete without a showering of finely sliced scallions. ", "Even the most inexpensive bag of instant ramen will contain dried scallions in its seasoning packet.", "\n\nCabbage is a quick, easy, and inexpensive way to bulk up a bowl of ramen and add some modicum of nutritional value in the process. ", "It can be shredded or cut into large squares and is generally stir-fried or simmered before being added to the bowl.", "\n\nCorn is a popular addition in Japan, particularly in the northern prefecture of Hokkaido, where simmered corn and butter are used to top bowls of miso-based ramen.", "\n\nEnoki mushrooms are added raw to the tops of bowl, then soften a bit in the heat of the broth, adding a sweet, mild earthiness.", "\n\nFresh garlic can be added in grated form.", "\n\nSpinach is not too common in restaurants, but is a popular choice for time-strapped home cooks who want to bulk up their instant noodles.", "\n\nStir-fried vegetables are generally paired with robust miso ramens and can include everything from cabbage and carrots to bean sprouts and onions.", "\n\nPreserved Vegetables\n\nMenma is lacto-fermented bamboo shoots. ", "Chinese in origin, with a nutty, slightly sweet flavor.", "\n\nWood Ear Mushrooms are a dehydrated fungus that is then rehydrated and sliced. ", "They're rather bland in flavor but add a nice crunchy texture to the bowl.", "\n\nKimchi is increasingly popular as a topping, particularly for home-made instant ramen. ", "I like to add a bit of the kimchi juice along with the actual cabbage.", "\n\nNori is sheets of dried and compressed laver, a type of seaweed. ", "It's the same stuff used to wrap sushi rolls. ", "It can be shredded and sprinkled on top of the bowl, or left as a larger sheet and stuck to the side of the bowl, adding subtle aroma and something to crunch on between bites of soup.", "\n\nWakame is another type of seaweed that you've probably eaten in bowls of miso soup. ", "It's used almost exclusively to garnish bowls of shio ramen, where it adds an ocean-y aroma and a slippery texture.", "\n\nBeni shoga is pickled ginger cut into thin shards. ", "Bright red or pink in color, it tends to be sharper in flavor than the pickled ginger you'll find accompanying your sushi, and is paired almost exclusively with tonkotsu broth.", "\n\nCondiments and Spices\n\nWhether aded in the kitchen or served at the table, spices and condiments are the final layer of flavor in a bowl of ramen.", "\n\nTogarashi is Japanese chili powder. ", "It typically comes in two forms. ", "Ichimi togarashi is straight-up ground hot roasted chili, while shichimi or nanami togarashi is a spice blend made with chili, dried orange peel, sesame seed, nori, hemp, sansho (Sichuan) pepper, and ginger. ", "It's sprinkled on tableside.", "\n\nSansho pepper is the Japanese version of the mouth-numbing aromatic Sichuan peppercorns from China. ", "It's more common as a condiment for broiled eel, but you'll occasionally find it on the table at ramen shops.", "\n\nYuzukosho is a spice paste made with salted chili peppers and the rind of the yuzu, a japanese citrus fruit. ", "It's used to flavor light broths and is usually added in the kitchen.", "\n\nBlack or white pepper.", "\n\nSesame seed pair very well with the nutty flavor of miso ramen. ", "They can be added whole, or they can be finely ground in a mortar and pestle to incorporate more smoothly into the soup.", "\n\nNinniku-dare is a garlic past made by whipping together grated garlic and pork fat. ", "It's got a milder flavor than straight-up grated garlic, and adds some nice, tasty fat to the bowl.", "\n\nCurry powder or paste is stirred directly into ramen broth before adding the noodles. ", "Japanese curry paste is based vaguely on Madras-style Indian curry mixes, but is catered to the Japanese palate. ", "It adds body and spice to the broth. ", "We recently come across a shop that incorporates Thai chili paste into their ramen in New York.", "\n\nMayu is made by slow-cooking garlic in sesame oil until it's completely black, then blending it. ", "The flavor is slightly bitter, sweet, and rich. ", "For our own version, we cook the garlic first in neutral canola oil before blending in the sesame to help achieve a lighter, less bitter flavor.", "\n\nButter is added in cold pats to miso ramen in northern Japan.", "\n\nRegional Japanese Ramen Variations\n\nTrying to classify every regional Japanese ramen variation is like trying to draw a functional timeline for Back to the Future. ", "There are so many twists, variations, and incestuous borrowings going on that trying to build a comprehensive list becomes an exercise in futility.", "\n\nFor the casual ramenologist, there are only three that you've got to know if you want to sound all intellectual as you slurp: Tokyo, Sapporo, and Hakata style.", "\n\nTokyo-Style Ramen\n\nTokyo ramen is made with pork and chicken broth and features slightly curly, moderately wide noodles. ", "Very often in Toyko you'll find broths that are flavored with dashi, a broth made from dried smoked bonito flakes and sea kelp. ", "This dashi-chicken hybrid is a cross-breed of Chinese-style soup broths with the lighter Japanese broths used in traditional Tokyo soba (buckwheat noodle) shops.", "\n\nThe bowls are generally seasoned with shoyu and are medium-bodied. ", "Up until the recent popularity boom of tonkotsu ramen, Tokyo-style pork and shoyu ramen was probably the most widely known world-wide.", "\n\nIt's a kissing cousin of Yokohama ramen, which comes from across Tokyo bay. ", "Yokohama's broth tends to be heavier, with a more meat-forward profile than the dashi flavors found in Tokyo style ramen.", "\n\nSapporo Ramen\n\nSapporo ramen comes from Japan's northernmost province of Hokkaido, the birthplace of miso ramen. ", "Though its history as a ramen center hasn't yet hit 50 years, it's become one of the most widely influential styles. ", "You'll find Sapporo-style miso ramen, with thick, robust noodles, all over Japan, from the ramenya of Tokyo down to the south in Kyushu.", "\n\nMade with a rich chicken, fish, or pork broth, the soup is flavored with akamiso (red soybean paste) and commonly topped with stir-fried bean sprouts, cabbage, sweet corn, and ground pork. ", "Hearty slices of chashu and soft boiled eggs are widely available as well. ", "If you want to go extra-Sapporo, get a slice of butter.", "\n\nHakata-Style Ramen\n\nHakata ramen comes from Fukuoka, a prefecture in Japan's southern island of Kyushu famous for its pork dishes. ", "Hakata is the home of tonkotsu, the no-holds-barred meatsplosion of porcine pleasure. ", "While many ramen broths are gently simmered to develop nuanced, subtle flavors, tonkotsu broth is cooked at a rolling boil, giving the soup its rich body, opaque appearance, and rich texture. ", "It's insanely popular and was the primary driver of the ramen boom in New York over the last decade or so. ", "Fukuoka, of course, is the birthplace of the widely popular Ippudo chain of ramen-ya.", "\n\nIn Hakata, the tonkotsu broth is generally seasoned with shio, in order to preserve the milky white color of the soup, though both shoyu and miso variations are not uncommon. ", "Some shops will serve shoyu tare (a seasoned soy sauce mixture) as a table side condiment. ", "Typical toppings include thin slices of chashu, wood-ear mushroom, beni-shoga, and spicy mustard greens—all powerfully flavored or textured stuff that can stand up to the intense pork flavor. ", "Crushed sesame seed and crushed garlic can be served table side to add to taste.", "\n\nDrizzle some mayu into a bowl of Hakata ramen and you've traveled one prefecture south to Kumamoto.", "\n\nWant to dive deeper into the ramen family tree? ", "Check out the Rameniac's guide for a look at 19 other distinct regional ramen styles in Japan. ", "It's one of the best ramen sites out there.", "\n\nOther Ramen-Like Dishes in Japan and Abroad\n\nWhile noodles in soup continues to be the standard form of service, there are many other noodle dishes in Japan and around the world that have their roots in ramen, some of them quite old. ", "Here are just a few of the more interesting and popular ones.", "\n\nAbura soba, or \"oil noodles,\" is a soup-less dish consisting of cooked ramen noodles dressed with flavored oil and tare, a seasoned sauce that is generally soy based. ", "It often comes topped with an egg, with the intent that you stir everything together in the bowl to form a creamy, emulsified sauce. ", "Japanese carbonara, if you will.", "\n\nMaze-men, or \"mixed noodles,\" is the new kid on the block, a specialty of Tokyo's (and soon to be New York's) Ivan Ramen. ", "Similar to Abura soba, it's cooked noodles served with a small amount of strongly flavored sauce, sort of like Italian-style pasta dishes. ", "Toppings and sauces vary wildly, and are often experimental in nature, like the cured salmon and camembert maze-men served at New York's Yuji Ramen\n\nTsuke-Men \"dipped noodles\" is a popular alternative to ramen, particularly during warmer summer months when a piping hot bowl of noodles isn't exactly appealing. ", "With this form, the noodles come served separately on the side so that they cool slightly. ", "You dip the noodles into a bowl of broth as you eat, pausing between bites to grab at the toppings. ", "If the noodles are served cold on a bamboo mat in the style of soba, they're called zaru ramen.", "\n\nRamen pasta is brand spanking new, and as far as we know, served only in one location: at Yuji Ramen in New York. ", "The concept is to use a ramen-style alkaline water dough and shape it into Italian pasta shapes, paired with sauces inspired texturally by Italian sauces, but using Japanese ingredients and techniques. ", "The result is wildly creative dishes like the squid bolognese ramen orecchiette above.", "\n\nTantan-Men is the Japanese interpretation of Sichuanese dan dan noodles. ", "Based on a pork broth, it comes with a scoop of heavily spiced ground pork and is generally served with spinach or bok choy.", "\n\nHiyashi Chuka translates directly as \"cold Chinese\" and is a dish made with cold ramen noodles with various toppings including sliced omelet, ham, cucumber, carrot, and chicken, dressed in a light vinegar and soy-based sauce.", "\n\nChanpon is sort of the weird cousin to ramen that the rest of the family members don't like to talk about. ", "It comes from Nagasaki and is made by boiling thick noodles directly in a viscous soup made from pork and seafood. ", "It's considerably thicker and more stew-like than regular ramen.", "\n\nYakisoba is the Japanese version of Chinese fried noodles. ", "It's made with egg noodles stir-fried with a few vegetables and occasionally meat and seafood, all flavored with a Worcestershire-style vegetable and anchovy sauce. ", "It's often topped with shaved bonito flakes and benishoga.", "\n\nAnd Beyond!", "\n\nDespite the fact that we've gone almost 7,000 words deep into this guide, we're really just scratching the tip of the iceberg. ", "New ramen styles are constantly being invented, and newer, wackier flavor combinations are ever on the horizon (check out a few of our instant ramen hacks for a taste of what we've got out there).", "\n\nWe'll try and keep this guide as updated as possible, but give the enormity of that task, we'll continue to rely on you, the Serious Eats community, to keep pointing us towards delicious new finds. ", "Let us know if we've missed anything important!", "\n\nAll products linked here have been independently selected by our editors. ", "We may earn a commission on purchases, as described in our affiliate policy." ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0.005813953488372093, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.018518518518518517, 0.007462686567164179, 0, 0.006211180124223602, 0.0051813471502590676, 0, 0, 0, 0, 0, 0.018867924528301886, 0, 0, 0, 0.004807692307692308, 0, 0, 0, 0.005050505050505051, 0, 0, 0, 0, 0, 0, 0.008333333333333333, 0.008771929824561403, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.010869565217391304, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.015384615384615385, 0, 0, 0, 0, 0.004901960784313725, 0, 0, 0.007042253521126761, 0, 0, 0, 0, 0, 0.006535947712418301, 0, 0.011627906976744186, 0, 0.015873015873015872, 0, 0.008403361344537815, 0, 0, 0.03333333333333333, 0, 0.010416666666666666, 0, 0, 0, 0, 0, 0, 0, 0.010101010101010102, 0, 0, 0.017142857142857144, 0, 0, 0, 0, 0.006060606060606061, 0.007751937984496124, 0, 0, 0, 0, 0, 0.012345679012345678, 0, 0, 0, 0, 0, 0, 0.011627906976744186, 0, 0, 0, 0, 0.02631578947368421, 0, 0, 0, 0, 0, 0.009009009009009009, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.006024096385542169, 0, 0.012422360248447204, 0, 0.015625, 0, 0, 0.007462686567164179, 0, 0.008264462809917356, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.010526315789473684, 0, 0, 0, 0, 0, 0, 0.008064516129032258, 0, 0.003215434083601286, 0, 0, 0.010526315789473684, 0, 0, 0, 0.013333333333333334, 0, 0.004405286343612335, 0, 0, 0, 0.01639344262295082, 0, 0.017241379310344827, 0.07692307692307693, 0, 0, 0, 0, 0, 0 ]

[ "Win 7 Availability\n\nContents\n\nContents 1 Development history 2 Features 2.1 New and changed 2.2 Removed 3 Editions 3.1 Support lifecycle 4 System requirements 5 Extent of hardware support 5.1 Physical memory 5.2 Processor limits Better get busy, because there are only 364 shopping days left. ", "Retrieved February 20, 2012. ", "^ a b Rose, Stephen L (February 14, 2013). \"", "Windows 7 RTM End Of Support Is Right Around The Corner\". ", "CNET.", "\n\nGavin Clarke. ", "The Enterprise edition will continue to be available as a loophole for businesses and anyone willing to pay the premium, but for the average Joe computer buyer, this is it. ", "Explore the IDG Network descend CIO Computerworld CSO GameStar Greenbot IDC IDG IDG Connect IDG Knowledge Hub IDG TechNetwork IDG.TV IDG Ventures Infoworld IT News ITwhitepapers ITworld JavaWorld LinuxWorld Macworld Network If you believe this post is offensive or violates the CNET Forums' Usage policies, you can report it below (this will not automatically remove the post).", "\n\nWindows 7 End Of Life Support\n\nMicrosoft Corporation. ", "And I don't want Microsoft taking control of my interface and making it like an Apple. ", "Windows Extended Support November 14, 2012. ", "^ \"Breaking News! ", "When Does Windows 7 Support End Microsoft Support.", "\n\nAs a result, in March 2013 the European Commission fined Microsoft €561million to deter companies from reneging on settlement promises.[119] Windows Management Framework 5.0 Windows Management Framework 5.0 includes updates to I wasn't born yesterday, and it certainly wasn't in the dark hours of the night.", "I know about the pirated/cracked copies. ", "Computerworld. ", "Michael Gartenberg, an analyst at Jupiter Research said that, \"[Microsoft's] challenge for Windows 7 will be how can they continue to add features that consumers will want that also don't run Windows 7 Support End Date Wiki\n\nJune 23, 2010. ", "Archived from the original on January 18, 2008. ", "I understood that an OEM version is only for sale when installed on a new computer. ", "The requirement for a processor capable of hardware virtualization has been lifted.[100] Windows Media Center (included in Home Premium, Professional, Ultimate and Enterprise), requires a TV tuner to receive and record\n\nFuture US.", "\n\nZDNet. ", "Retrieved 16 January 2016. ", "^ \"Skylake support on Windows 7 and 8.1 given a one-year extension\". ", "The default libraries, along with printers, are shared by default, but the personal folder is set to read-only access by other users, and the Public folder can be accessed by anyone.[73][74] Windows Server End Of Life Mainstream support for Window 7 ends on January 13, 2015 with extended support lasting until January 10, 2020.", "\n\nThe customer choice is unavoidable, and Microsoft has now taken a step to aid businesses in achieving the goal of their decision. ", "After that date no security updates will be issued ever again, making an already unsecure OS a huge target for malware bombs. ", "June 23, 2010. ", "Retrieved December 18, 2008. ", "^ Oiaga, Marius (June 24, 2008). \"", "Windows 7 Will Not Inherit the Incompatibility Issues of Vista\". ", "^ Sinovsky, Steven (August 18, 2008). \"", "The Windows 7 Team\".", "\n\nArchived from the original on January 5, 2009. ", "CBS Interactive. ", "^ \"MSDN Blogs\". ", "Microsoft would love it if businesses were choosing Windows 8 as the goto migratory destination, but they aren’t. ", "Retrieved November 13, 2009. ", "^ \"Increasing market share of Windows Vista, Windows 7, Windows 8 since the start of beta testing\". ", "^ \"Windows XP gained market share in January (or did\n\nSo, in effect, if a consumer wants to purchase a new computer with Windows installed after October, Windows 8 will be the only choice. ", "Retrieved February 24, 2016. ", "^ a b \"A platform update is available for Windows 7 SP1 and Windows Server 2008 R2 SP1\". ", "Retrieved March 10, 2011. ", "^ \"Information about Service Pack 1 for Windows 7 and for Windows Server 2008 R2 (Revision 3.1)\". ", "I kept thinking he looked familiar and then finally I realized why.", "\n\nblogs.technet.com. ", "From October 2012 to January 2014, Windows 7's user share increased nearly 3 percentage points, representing a 6% gain during that period, according to data from analytics company Net Applications.", "Some of Engadget. ", "September 30, 2008." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0.022727272727272728, 0, 0.2, 0.0625, 0.005780346820809248, 0.002652519893899204, 0, 0.022988505747126436, 0, 0, 0, 0.009708737864077669, 0, 0.06666666666666667, 0.020833333333333332, 0, 0, 0.013043478260869565, 0, 0, 0, 0, 0.007575757575757576, 0, 0, 0, 0, 0.015384615384615385, 0.05128205128205128, 0.05, 0, 0.058823529411764705, 0, 0.008771929824561403, 0, 0.01, 0.005291005291005291, 0, 0, 0, 0, 0, 0, 0.005076142131979695, 0, 0 ]

[ "The app switcher on Android used to be a core part of the operating system, but with the introduction of gesture navigation, it's now a component of your device's home screen launcher. ", "This means it can be updated outside of OS upgrades, and that's exactly what is happening on OnePlus devices.", "\n\nOnePlus Launcher 4.4 is now rolling out on the Play Store, and it brings a shiny new Recents interface with it. ", "Before now, the app switcher interface consisted of a simple row of application previews, with a name and menu button above each item.", "\n\nLeft: Old UI; Right: New UI\n\nThe update moves the app icons to the bottom of the screen, where they are more visible. ", "The button for clearing all applications also now has a 'Close Apps' label, and instead of pressing the menu button above an app preview to perform actions (like opening in multi-window or pinning), you now simply hold down on the app. ", "No more reaching to the top of the screen.", "\n\nOther new features include a new app search feature (activated by partially-opening the app drawer), and tapping on the app icons in the Recents UI jumps to that app. ", "If you haven't already received OnePlus Launcher 4.4 through the Play Store, you can install the APK from APKMirror to get the new interface." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.005405405405405406, 0.009174311926605505, 0.008771929824561403, 0, 0, 0, 0, 0.005917159763313609, 0.0070921985815602835 ]

[ "Q:\n\nApache mod_rewrite RewriteCond to by-pass static resources not working\n\nI can't for the life of me fathom out why this RewriteCond is causing every request to be sent to my FastCGI application when it should in fact be letting Apache serve up the static resources.", "\nI've added a hello.txt file to my DocumentRoot to demonstrate.", "\nThe text file:\nls /Sites/CioccolataTest.webapp/Contents/Resources/static \nhello.txt\n\nThe VirtualHost and it's rewrite rules:\nAppClass /Sites/CioccolataTest.webapp/Contents/MacOS/CioccolataTest -port 5065\nFastCgiExternalServer /Sites/CioccolataTest.webapp/Contents/MacOS/CioccolataTest.fcgi -host 127.0.0.1:5065\n<VirtualHost *:80>\n ServerName cioccolata-test.webdev\n DocumentRoot /Sites/CioccolataTest.webapp/Contents/Resources/static\n\n RewriteEngine On\n\n RewriteCond %{REQUEST_FILENAME} !", "-f\n RewriteRule ^/(.*)$ /Sites/CioccolataTest.webapp/Contents/MacOS/CioccolataTest.fcgi/$1 [QSA,L]\n</VirtualHost>\n\nEven with the -f, Apache is directing requests for this text file (i.e. access http://cioccolata-test.webdev/hello.txt returns my app, not the text file).", "\nAs a proof of concept I changed the RewriteCond to:\nRewriteCond %{REQUEST_URI} !", "^/hello.txt\n\nThat made it serve the text file correctly and allowed every other request to hit the FastCGI application.", "\nWhy doesn't my original version work? ", " I need to tell apache to serve every file in the DocumentRoot as a static resource, but if the file doesn't exist it should rewrite the request to my FastCGI application.", "\nNOTE: The running FastCGI application is at /Sites/CioccolataTest.webapp/Contents/MacOS/CioccolataTest (without the .fcgi prefix)... the .fcgi prefix is only being used to tell the fastcgi module to direct the request to the app.", "\n\nA:\n\nI found a way to make it work, but I've never in all of my 6 years of web development ever had to do this. ", " I prefixed %{DOCUMENT_ROOT} to the REQUEST_FILENAME before checking if it's a file or not.", "\nFastCgiServer /Sites/CioccolataTest.webapp/Contents/MacOS/CioccolataTest -port 5065\n<VirtualHost *:80>\n ServerName cioccolata-test.webdev\n DocumentRoot /Sites/CioccolataTest.webapp/Contents/Resources/static\n\n RewriteEngine On\n\n RewriteCond %{DOCUMENT_ROOT}%{REQUEST_FILENAME} !", "-f\n RewriteRule ^/(.*)$ /Sites/CioccolataTest.webapp/Contents/MacOS/CioccolataTest [QSA,L]\n</VirtualHost>\n\nFor some reason it's treating all the paths as absolute filesystem paths. ", " Usually apache handles paths relative to the document root, doesn't it?", "\nI wonder if it has anything to do with the fact that my fastcgi app is referenced at an absolute path (I think it needs to be). ", " I'm new to the world of fastcgi.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0037313432835820895, 0, 0.0099601593625498, 0.007352941176470588, 0, 0, 0, 0, 0.004347826086956522, 0, 0, 0.006896551724137931, 0.005434782608695652, 0, 0, 0, 0 ]

[ "It is with regret that the North American Brewers Association must cancel the 2020 Mountain Brewers Beer Fest. ", "Restrictions in Idaho’s fourth phase of recovery includes an extension of social distancing. ", "Unfortunately, there does not appear to be a solution to staging a customary (and fun!) ", "beer festival while observing social distancing and protecting the health and safety of brewers, patrons, and our staff. ", "This was no easy decision, yet we have reluctantly joined other beer events such as the GABF and Great British Beer Festival along with the Oregon Brewers Festival and Munich’s Oktoberfest, all of which were scheduled at nearly the same time or after the revised August date of our events.", "\n\nThe next Mountain Brewers Beer Fest will be held on Saturday June 5th, 2021. ", "We know that seems a long time off… and we feel the same way. ", "We will also be celebrating Idaho Beer Week with all the tap takeovers and promotional events you’ve come to expect downtown, Idaho Falls. ", "Idaho Beer Week will once again immediately precede the festival, running from May 31st through June 5th , 2021.", "\n\nNext, for those of you who purchased a ticket for the now cancelled 2020 event we will be sending to you, in a separate email, information on how to either receive a refund, or as an option have your ticket carry over to 2021 with a special offer added to only those who pre-purchased a 2020 ticket. ", "We will make a compelling offer to those of you who agree to hang on to your ticket.", "\n\nWe hope you will understand this difficult decision, and that everyone who enjoyed the festival in the past, as well as first time beer lovers, will plan on joining us in June of 2021 for a return of the breweries, beer, music, food, fun and friends. ", "We look forward to seeing you at the 2021 Mountain Brewers Beer Fest…Cheers!" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.009009009009009009, 0, 0, 0, 0.01384083044982699, 0, 0, 0.014388489208633094, 0.008928571428571428, 0, 0, 0, 0 ]

[ "Introduction {#sec1_1}\n============\n\nMEK inhibitors such as binimetinib, trametinib, and dabrafenib have exhibited effectiveness in the treatment of melanoma, but their use is associated with serous detachments of the neurosensory retina, termed MEK inhibitor-associated retinopathy (MEKAR) \\[[@B1], [@B2]\\]. ", "MEKAR is classically self-limiting, with serous fluid resolving within 1--2 months even without drug discontinuation \\[[@B2], [@B3]\\]. ", "In addition, metastatic melanoma itself can result in serous retinopathy with detachments of the retinal pigment epithelium (RPE) and neurosensory retina due to a cross-reaction by circulating autoantibodies \\[[@B4]\\]. ", "This type of retinopathy is termed paraneoplastic vitelliform retinopathy \\[[@B4]\\]. ", "We present a case of a patient with metastatic melanoma treated with lacnotuzumab, a mitogen-activated protein kinase (MAPK) pathway inhibitor, who developed non-resolving serous detachments (Fig. [", "1a](#F1){ref-type=\"fig\"}).", "\n\nCase Report {#sec1_2}\n===========\n\nA 54-year-old male presented to ophthalmology 18 months after receiving the diagnosis of colorectal melanoma. ", "He had been treated with multiple anti-cancer medications prior to beginning a new study protocol with lacnotuzumab and spartalizumab.", "\n\nFour days following initiation of lacnotuzumab and spartalizumab, the patient reported bilateral blurred vision. ", "Examination showed corrected visual acuity of 20/70 OD and 20/20 OS. ", "Pupils, intraocular pressure, and anterior segment examinations were normal. ", "Fundus examination demonstrated bilateral serous macular edema, normal optic nerves, vessels, and periphery (Fig [1b](#F1){ref-type=\"fig\"}). ", "Optical coherence tomography (OCT) showed significant subretinal and intraretinal fluid (Fig. [", "2d](#F2){ref-type=\"fig\"}). ", "He was diagnosed with MEKAR, the drugs were discontinued, and he was removed from the study protocol.", "\n\nTwo months later, he reported worsening of vision bilaterally. ", "Corrected visual acuity was 20/60 OD and 20/30 + 1 OS. ", "OCT showed resolution of intraretinal fluid but persistence of subretinal fluid (Fig. [", "2e](#F2){ref-type=\"fig\"}). ", "Fluorescein angiography demonstrated early and late hypo-fluorescence in the areas of serous fluid accumulation (Fig. [", "1d, e](#F1){ref-type=\"fig\"}). ", "Indocyanine green angiography demonstrated normal choroidal filling with hypocyanescence centrally (Fig. [", "1c](#F1){ref-type=\"fig\"}). ", "The following month, his vision continued to worsen to 20/100 OD and 20/40-1 OS. ", "OCT demonstrated persistent serous macular detachment and subretinal fluid (Fig. [", "2f](#F2){ref-type=\"fig\"}).", "\n\nSeven months after the patient\\'s treatment with lacnotuzumab and spartalizumab and onset of symptoms, his corrected visual acuity was 20/200 OD and 20/70 + 1 OS. ", "Examination and autofluorescence showed persistent serous macular detachment with subretinal accumulation of exudates and vitelliform material in a gravity-dependent manner (Fig. [", "2a, b, c](#F2){ref-type=\"fig\"}); OCT continued to demonstrate subretinal fluid (Fig. [", "2g](#F2){ref-type=\"fig\"}). ", "The patient was scheduled for follow-up in 2 months but unfortunately his disease progressed, and he passed away 7 weeks after this ophthalmology visit.", "\n\nDiscussion/Conclusion {#sec1_3}\n=====================\n\nLacnotuzumab inhibits macrophage colony-stimulating factor (M-CSF), which is an upstream component of the MAPK pathway (Fig. [", "1a](#F1){ref-type=\"fig\"}). ", "Spartalizumab is directed against the negative immunoregulatory human cell surface receptor programmed death-1 and has not been associated with serous retinopathy \\[[@B5]\\]. ", "Our patient developed visual symptoms and bilateral serous detachments 4 days after starting lacnotuzumab, consistent with a diagnosis of MEKAR \\[[@B2], [@B3]\\]. ", "Typically, fluid accumulation is self-limited, regardless of discontinuation of the drug, with a mean time to resolution of 47.4 days \\[[@B2]\\]. ", "However, our patient continued to display serous detachments for 7 months (216 days) and remained symptomatic until he passed away (266 days).", "\n\nThis case is of particular interest due to its unusually long duration and lack of improvement following discontinuation of lacnotuzumab, which suggests one of several possible conclusions. ", "First, lacnotuzumab works upstream of the MEK inhibitors binimetinib, trametinib, and dabrafenib that have been implicated in previous MEKAR cases. ", "Targeting of the upstream M-CSF molecule instead of the MEK protein in the MAPK pathway may lead to a prolonged and non-resolving serous MEKAR with eventual accumulation of vitelliform material. ", "This could account for the large unifocal area of subretinal fluid rather than the classic dome, caterpillar, wavy, or splitting patterns noted previously \\[[@B2]\\]. ", "Second, the patient may have developed a concomitant paraneoplastic vitelliform retinopathy at some time after the development of MEKAR and prior to its resolution \\[[@B4]\\].", "\n\nWhile it is possible the patient developed a concomitant paraneoplastic vitelliform retinopathy, we believe this to be very unlikely \\[[@B4]\\]. ", "The patient had a diagnosis of colorectal melanoma for 18 months without any symptomatic vision changes. ", "Then, only 4 days after starting lacnotuzumab, the patient had a decrease in vision, and a serous retinopathy was noted on OCT.", "\n\nAttachment of the neurosensory retina to the pigment epithelium and choriocapillaris requires a balance of fluid flow between the vitreous and underlying choroid \\[[@B6]\\]. ", "Serous retinal detachment typically occurs via one of two mechanisms: increased permeability of choroidal blood vessels or decreased ability of the RPE to maintain the fluid gradient \\[[@B6]\\]. ", "Again, given the timing from initiation of lacnotuzumab to the development of serous fluid, we believe that the retinal detachment was likely a result of toxicity to the RPE and decreased pump function. ", "Given the patient\\'s state of poor health with metastatic cancer, it is possible his pigment epithelium was unable to recover from the initial insult as has been seen with other cases of MEKAR \\[[@B2], [@B3]\\]. ", "It may also be possible that lacnotuzumab exhibits more severe toxicity to the RPE than the MEK inhibitors previously described.", "\n\nTo our knowledge, this is the first reported case of M-CSF-induced serous retinopathy that persisted despite discontinuation of treatment. ", "When treating patients with a MEK inhibitor, physicians should be aware of the possible association of lacnotuzumab with chronic serous macular detachment.", "\n\nStatement of Ethics {#sec1_4}\n===================\n\nThe subject has given his informed consent and the study protocol conforms to the institute\\'s IRB requirements.", "\n\nDisclosure Statement {#sec1_5}\n====================\n\nThe authors have no conflicts of interest to declare.", "\n\nFunding Sources {#sec1_6}\n===============\n\nThis work was sponsored in part by an endowment from the Martha Wood Bentley Chair in Ophthalmology.", "\n\nAuthor Contributions {#sec1_7}\n====================\n\nJ.R.C., D.A.K., A.B.S., R.C.A., and S.H.U. contributed to the design, acquisition of data, research, drafting, and revision of the manuscript. ", "All authors reviewed and approved the final manuscript for publication.", "\n\n{#F1}\n\n{#F2}\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.009708737864077669, 0.022222222222222223, 0.0091324200913242, 0.011764705882352941, 0.010101010101010102, 0, 0, 0.007462686567164179, 0.008695652173913044, 0, 0, 0.0070921985815602835, 0.010526315789473684, 0, 0.009900990099009901, 0, 0, 0.011494252873563218, 0, 0.008403361344537815, 0, 0.009433962264150943, 0, 0, 0.012195121951219513, 0, 0.012121212121212121, 0.005555555555555556, 0.023255813953488372, 0, 0, 0.01092896174863388, 0, 0.011494252873563218, 0.018518518518518517, 0.006896551724137931, 0, 0.005208333333333333, 0.013513513513513514, 0.005128205128205128, 0.006024096385542169, 0.005747126436781609, 0.00684931506849315, 0, 0.007874015748031496, 0.005714285714285714, 0.010309278350515464, 0.009852216748768473, 0.009478672985781991, 0.0234375, 0, 0.0064516129032258064, 0.012121212121212121, 0, 0.013793103448275862, 0.010101010101010102, 0, 0, 0.01818181818181818, 0.024390243902439025, 0.01694915254237288, 0, 0, 0, 0, 0, 0 ]

[ "Q:\n\nSql Server Backup Job failed\n\nI have a sql agent job setup for taking full backup every night. ", "Last night the job failed with the following error message. ", "\nSql Server Error Log Message\n\nBackupIoRequest::ReportIoError: write failure on backup device\n 'H:\\MSSQL10_50.MSSQLSERVER\\MSSQL\\Backup\\My_Database_backup_2014_04_28_233008_2135500.bak'.", "\n Operating system error 2(failed to retrieve text for this error.", "\n Reason: 15100).", "\nError: 3041, Severity: 16, State: 1.", "\n\nSqlAgent Job History Log\n\nExecuted as user: DomainName\\sqlagent. ", "Microsoft (R) SQL Server\n Execute Package Utility Version 10.50.2500.0 for 64-bit Copyright\n (C) Microsoft Corporation 2010. ", "All rights reserved. ", " Started: \n 23:30:01 Progress: 2014-04-28 23:30:06.81 Source:\n {123123123-F70A-430F-8041-12312312313} Executing query \"DECLARE @Guid\n UNIQUEIDENTIFIER EXECUTE msdb..sp...\".: ", "100% complete End\n Progress Error: 2014-04-28 23:30:16.19 Code: 0xC123123\n Source: Back Up Database (Full) Execute SQL Task Description:\n Executing the query \"BACKUP DATABASE [My_Database] TO DISK =\n N'H:\\MSS...\" failed with the following error: \"Write on\n \"H:\\MSSQL10_50.MSSQLSERVER\\MSSQL\\Backup\\MY_Database_backup_2014_04_28_233008_2135500.bak\"\n failed: 2(failed to retrieve text for this error. ", "Reason: 15100) \n BACKUP DATABASE is terminating abnormally. ", " 10 percent processed. ", " 20\n percent processed. ", " 30 percent processed. ", " 40 percent processed. ", " 50\n percent processed. ", " 60 percent processed.\". ", "Possible failure reasons:\n Problems with the query, \"ResultSet\" property not set correctly,\n parameters not set correctly, or connection not established correctly.", "\n End Error DTExec: The package execution returned DTSER_FAILURE (1). ", "\n Started: 23:30:01 Finished: 23:30:16 Elapsed: 14.844 seconds. ", " The\n package execution failed. ", " The step failed.", "\n\nAfter doing the research on web mostly posts suggest I do not have enough space on the disks, I have checked the space on my disks I have have atleast 30 plus GB of free space on almost every drive, (disk for .mdf and disk for .ldf files). ", "I have almost 15 gb of free space on my C drive. ", "as One of the posts on web suggested not having enough space on C drive can also cause issues. ", "\nHas someelse ever faced the same issue, how you fixed it? ", "what can be the reason for this error and how I can avoid it in the future. ", "Any suggetions pointers in the right direction are most welcome. ", "Thank you.", "\n\nA:\n\nOperating system error 2 is a standard Windows operating system error--file not found. ", " Check the permissions on the folder and make sure that the account that owns the agent job has access to the folder and is able to traverse the path to the folder where the backup is trying to write. ", " \nUnfortunately, this is a Windows error message and not a SQL error. ", " I found something on Microsoft Connect (related to restore, not backups) where they said they were not able to reproduce the problem and confirmed that this is an OS, not a SQL Server, error message.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0, 0.02702702702702703, 0.014925373134328358, 0.023255813953488372, 0, 0.010526315789473684, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.014285714285714285, 0.005, 0 ]

[ "Sexual assault and physical health: findings from a population-based study of older adults.", "\nPrior reports have pointed to an adverse effect of sexual assault on subsequent health, particularly depression and obesity, in women. ", "The objective of this study was to determine whether there is an association between self-reported sexual assault history and objective parameters of physical health in a sample of older men and women. ", "We conducted a cross-sectional study of white, middle to upper middle class, older (median age 75 years) men (N = 533) and women (N = 826) within a defined community setting. ", "Sex-specific, age-adjusted risks were calculated for 11 common chronic medical conditions (10 for each sex: coronary heart disease, hypertension, diabetes, osteoporosis, obesity, asthma, migraine, thyroid disease, and arthritis in all subjects; breast cancer in women; and prostate cancer in men) and confirmed by physical or laboratory examination or review of medical records. ", "Sexual assault was reported by 5.4% of men and 12.7% of women; repeated exposure was reported by 10.3 and 21.9% of sexually assaulted men and women, respectively. ", "In women, a history of sexual assault was associated with an increased risk of 2 of 10 conditions: arthritis (OR = 1.76, 95% CI = 1.13-2.76) and breast cancer (OR = 2.21, 95% CI = 1.12-4.33). ", "A \"dose-response\" effect was observed: Multiple episodes of sexual assault carried a two- to three-fold increased risk of these diseases compared with a single episode. ", "In men, the only statistically significant association was between sexual assault and thyroid disease (OR = 4.68, 95% CI = 1.08-20.3). ", "These data partially replicate findings from other studies of adverse effects of sexual trauma on health, although the specific diseases are different. ", "Causal mechanisms cannot be inferred from these data. ", "Studies in other cohorts are warranted." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0, 0, 0.010416666666666666, 0, 0.007407407407407408, 0, 0, 0 ]

[ "September 16, 2014 Creamy Butternut Squash Pasta Skillet\n\nThis cozy and creamy butternut squash pasta skillet is a fantastic Fall dinner! ", "With whole wheat pasta, a butternut squash sauce, fresh rosemary and sage, it’s perfect for the season. ", "Vegetarian.", "\n\nNote: This recipe is NOT dairy free. ", "It was published before Cook Nourish Bliss transitioned to dairy free recipes and remains popular with long time readers. ", "You can try using substitutions to make it dairy free, however I have not tested this myself and can’t say how it will turn out.", "\n\nBrace yourself. ", "For squashy, orange goodness over the course of the next two months. ", "Or more, we’ll see. ", "Depends on how big of a recipe bender I go on.", "\n\nI know some people are all about the pumpkin right now but for me? ", "Butternut squash is where. ", "it’s. ", "at.", "\n\nAnd today I’m bringing you pasta. ", "Comforting, creamy, cheesy. ", "That’s three C’s of awesome right there.", "\n\nOh and there’s butternut squash sauce.", "\n\nWhich helps make it so nice and creamy … and therefore not completely terrible for you at all. ", "Which is good because I’ve consumed a number of filled-to-the-brim bowls.", "\n\nAbout This Butternut Squash Pasta Bake\n\nIn addition to the squash-y sauce, we have some other veggies and plenty of fresh rosemary and sage. ", "Because they scream fall.", "\n\nAnd there’s some cheese. ", "Not a ton ton, but just enough to make you happy. ", "And enough to make you fight your husband for the last portion in the skillet.", "\n\nAhem, not that I know anything about that.", "\n\nOr being super sneaky and hiding some of the leftovers in the back of the fridge where he’ll never look.", "\n\nBut really. ", "Just look at that. ", "Yes. ", "Just yes.", "\n\nAdditional Butternut Squash Recipes You Might Enjoy:\n\nDid you make this recipe? ", "Rate and review it down below! ", "I’d love to hear from you." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.007246376811594203, 0, 0, 0, 0.01639344262295082, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.010309278350515464, 0, 0.006993006993006993, 0, 0, 0, 0, 0, 0, 0, 0.05263157894736842, 0, 0, 0, 0, 0 ]

[ "The Cowboys line is a massive wall of human flesh– one of the largest in the league. ", "The group is composed of five veterans who have great experience playing with one another.", "\n\nWithout looking at any numbers, we know that the ‘Boys line provided some of the biggest running lanes in the NFL. ", "Their size and power made it rather easy, relatively speaking, to drive opponents of the ball.", "\n\nFrom time to time, however, the group struggled in pass protection. ", "You can’t have it all, and overall they are an above-average line. ", "Still, providing better pass protection for Romo is essential to the Cowboys’ success. ", "In Minnesota during the playoffs, you saw how poor pass protection can affect an entire offense’s rhythm and productivity.", "\n\nThere are some misconceptions about which linemen are the Cowboys’ most dominant. ", "We believe the film doesn’t lie, and the numbers that are garnered from the tape are proof of that. ", "Take a look at the numbers we obtained from our film study listed on the chart below.", "\n\nNote: The best percentage for each category is in blue, the worst in red.", "\n\nNote: Snap count numbers are only those plays in which the players were in pass protection. ", "Also, sack numbers do not add up to total sacks yielded because some were given up by tight ends, backs, or unblocked. ", "Finally, penalty counts are representative of all plays, not just passes.", "\n\nAnd now for the grades.", "\n\nPass Protection Grades\n\nLT Flozell Adams: D+\n\nAdams struggled mightily in pass protection all season, giving up nine sacks and, perhaps more importantly, a devastating 42 quarterback pressures. ", "It is certainly difficult to block a team’s best pass-rusher, as Flozell had to do more than anyone on the team. ", "Still, we would expect his numbers to be better than this.", "\n\nFurther (and I don’t want to beat a dead horse so I won’t go into great detail), we all know Adams’ struggles with penalties. ", "He had 13 this year, tied for 5th most in the NFL.", "\n\nLG Kyle Kosier: B+\n\nKosier is sorely under-appreciated, often labeled by media as the “weak link” of the Cowboys’ line. ", "He gave up just one sack all season, though, and had good numbers in both quarterback hits and pressures allowed. ", "He obviously didn’t face the speed rushers that Adams, Colombo, and Free faced, but his ability to handle defensive tackles much larger than him is impressive.", "\n\nC Andre Gurode: A\n\nGurode, in our opinion, had the best season of any Dallas’ linemen. ", "He gave up just three sacks, but hits and pressures are more representative of how well a player performed. ", "He allowed his man to pressure Romo just 2.27 percent of all pass plays, by far the best on the team, and did it while performing a task no other lineman was asked to do: snap the ball.", "\n\nRG Leonard Davis: A-\n\nIt was difficult to determine whether to give Kosier or Davis a higher grade. ", "We ended up giving Davis the slightly higher grade because, while he yielded three more sacks than Kosier, he gave up a lower percentage of quarterback hits and pressures, and also did a fantastic job of not racking up penalties. ", "He allowed just four all season.", "\n\nRT Marc Colombo: C\n\nColombo’s numbers actually came out worse than we anticipated. ", "His sack numbers were respectable, but he allowed the highest percentage of QB hits on the team, and his pressures and penalties were nearly just as bad. ", "These numbers also don’t include the Cowboys’ playoff game in Minnesota, where Colombo allowed three sacks and got manhandled all game (albeit probably due to injury).", "\n\nRT Doug Free: B-\n\nWe were interested in discovering how well Free actually performed on the season and how his statistics compared to Colombo’s. ", "As we presumed, his numbers were about average. ", "He didn’t have the worst or best percentages in any category, but overall performed better than Colombo. ", "His hits, pressures, and penalty percentages were all lower than those of the man he replaced (particularly the percentage of hits yielded, which was about 2.5 times as low).", "\n\nSo there you have it. ", "In order of excellence, we rate the 2009 performance of the Cowboys’ linemen, in terms of pass protection, as follows:\n\n1. ", "Andre Gurode: A\n\n2. ", "Leonard Davis: A-\n\n3. ", "Kyle Kosier: B+\n\n4. ", "Doug Free: B-\n\n5. ", "Marc Colombo: C\n\n6. ", "Flozell Adams: D+\n\nThis is further evidence that Dallas should move up in the first round to select an offensive tackle for the future. ", "The numbers don’t lie.", "\n\nIn our next “Grading the ‘Boys” segment, we will grade the line’s run-blocking abilities.", "\n\n16 Responses to Grading the ‘Boys, Part I: Offensive Line (Pass Protection)\n\nNumbers don’t lie. ", "But I’m not convinced that the early rd guys are that much better at OT. ", "Also, the traditional Cowboys LT model(size) is questionable. ", "Why do you need a 320-330 lb guy to block a250-280 lb speed guy. ", "We need somebody that can move out there. ", "Can Free play LT if he gets the practice reps? ", "Also I believe the right side will grade better in the run game, and I look for Kosier to slip.", "\n\nMy run game stats are almost completed, so they will be up later tonight.", "\n\nA guy like Charles Brown is an undersized guy who is excellent in pass pro. ", "He is a bit weak in the upper body, but if Dallas wants to upgrade their pass pro, even if it means a small downgrade in the run game, Brown is an option who has a solid shot of dropping to 27.", "\n\nI’m not sure Free can play LT full-time. ", "I think he is better suited being a backup for now and eventual successor of Colombo." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0.008547008547008548, 0, 0, 0, 0.011494252873563218, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.008849557522123894, 0, 0, 0.02, 0.00819672131147541, 0, 0.006289308176100629, 0.011235955056179775, 0, 0.005405405405405406, 0.029411764705882353, 0.008695652173913044, 0, 0, 0, 0, 0.006802721088435374, 0, 0, 0, 0, 0, 0.05, 0.045454545454545456, 0.05, 0.05555555555555555, 0.05, 0.007352941176470588, 0, 0, 0, 0.0136986301369863, 0, 0, 0, 0.02127659574468085, 0.010526315789473684, 0, 0.01282051282051282, 0.0051813471502590676, 0, 0.011764705882352941 ]

[ "After a sobering first season in Major League Soccer, in which Vancouver Whitecaps FC finished dead last, the club made steady progress in Year 2, qualifying for a first-ever MLS Cup playoff experience through a fifth-place finish in the Western Conference.", "\n\nUnder new head coach Martin Rennie, himself debuting in MLS, the ‘Caps found a structure and a defensive strength which they lacked in 2012, and had an impressive first half of the season in which they jockeyed with the conference’s best atop the standings.", "\n\nBut somewhere along the line, things began to fall apart. ", "Three key players departed midseason, with stars Eric Hassli, Davide Chiumiento and Sébastien Le Toux moving on. ", "In their place came the Scottish Designated Player pairing of Barry Robson and Kenny Miller, as well as Jamaican winger Dane Richards. ", "Former Irish international Andy O’Brien arrived shortly after to bolster the backline.", "\n\nThat turnover involving key personnel appeared to backfire, with the club finishing the season with only one win in its last 10 matches. ", "Despite the hapless finish though, the club squeaked into the postseason.", "\n\nBest Moment of the Year\n\nAfter many had written off Vancouver’s chances in their first round MLS Cup knockout match with the LA Galaxy, Darren Mattocks made fans across the continent fear for the defending champions, as he coolly finished a set-up from Matt Watson in the fourth minute.", "\n\nWhile the ‘Caps went on to lose the game, that early goal symbolized the progression of the team from a laughing stock in 2011 to a gritty, hard-to-beat outfit a year later.", "\n\nWorst Moment of the Year\n\nIf Mattocks’ goal proved how far Whitecaps FC have come, the team’s 1-0 defeat to Portland Timbers on October 21 showed how far they still need to go to become a serious contender for a championship.", "\n\nA win that evening would have qualified the team for the playoffs automatically – but instead the ‘Caps fell to their Cascadia rivals with perhaps the meekest performance of the year, and in the process the Vancouver faithful were forced to endure taunts from the Timbers Army as the Cascadia Cup was paraded around BC Place by the visitors.", "\n\nBest Goal\n\nEverybody knew that Darren Mattocks had a spring in his step. ", "But on July 11, he scored an absurd goal by leaping over Toronto FC’s Logan Emery and beating goalkeeper Milos Kocic to the ball to knock home.", "\n\nThe goal, which made it to the Round of 16 in the 2012 AT&T Goal of the Year competition, will likely go down as one of the most memorable displays of raw athleticism in the 2012 MLS season.", "\n\nBest Save\n\nIn the team’s third game of the season, a scoreless draw with D.C. United on March 24, Joe Cannon showed everybody he’s still got cat-like reflexes at age 37, making a one-handed save off the line from a Hamdi Salihi header.", "\n\nThat remarkable reaction save to prevent a certain goal from a corner brought Cannon within a hair of winning the league’s save of the year award outright, eventually losing out to Nick Rimando in the final round.", "\n\nTeam MVP\n\nDespite being the club’s oldest outfield player at age 35, Young-Pyo Lee logged more minutes than any of his teammates – playing in all but one match all season for a total of 2,970 minutes on the pitch.", "\n\nAdding consistency and a quiet leadership style at the back with an ability to get up and down the touchline to aid in the attack, he was a big reason for the team’s much-improved defensive record in 2012.", "\n\nBest Newcomer\n\nAs toothless as Vancouver looked like for much of the season offensively, sneaking into the postseason with the lowest goal tally of any of the qualifying teams with just 35 goals scored, it’s difficult to imagine the team getting to the playoffs at all without Darren Mattocks.", "\n\nIn a team often lacking in imagination and regularly starved of possession, the second overall pick in the 2012 MLS SuperDraft’s speed and athleticism often provided the most likely source of a goal – scoring seven from 21 matches in his debut season.", "\n\nOffseason Needs\n\n1. ", "Find a way to score goals: Whether that means bringing in more creativity in midfield to create more chances for the forwards, or bringing in forwards capable of creating more opportunities on their own, something needs to change, as 35 goals scored isn’t good enough for a team with playoff ambitions.", "\n\n2. ", "Right side reinforcements: With the departure of Dane Richards for English second-tier side Burnley, the club no longer has a natural right-sided winger on the books. ", "Sticking with the right side, Young-Pyo Lee was asked to play a lot of minutes in 2012 – partly as a result of a lack of depth at right fullback. ", "If a more capable understudy was brought in at the position, perhaps the South Korean star would have been fresher for the end-of-season run-in.", "\n\n3. ", "Goalkeeping clarity: Brad Knighton (right) was impressive after replacing Joe Cannon late in the 2012 campaign, but he’s never had a full season as an MLS starter under his belt. ", "If Knighton is going to start the season as the No. ", "1, Cannon has suggested he would like to move on. ", "If that’s the case, the sooner the club brings in a competitor or capable backup for Knighton, the better." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0038910505836575876, 0.007722007722007722, 0, 0.017699115044247787, 0.022222222222222223, 0.011627906976744186, 0, 0, 0.010416666666666666, 0, 0.004405286343612335, 0.0058309037900874635, 0.013333333333333334, 0.006993006993006993, 0, 0.004219409282700422, 0.004651162790697674, 0.004651162790697674, 0, 0.003389830508474576, 0.003952569169960474, 0, 0, 0, 0.005988023952095809, 0.00684931506849315, 0, 0, 0.01675977653631285, 0.019230769230769232, 0.02, 0.009433962264150943 ]

[ "Window sill systems in current use have basic flaws, including but not limited to the following:\nA. Sheet metal, plastic, rubber or synthetic membrane, stainless steel sheets, aluminum extrusions, must be fastened to the building by some mechanical form, such as screws or bolts, nails or all threaded rods.", "\nB. Most of these fasteners end up in what is referred to as the “wet-zone” which where we expect to capture some amount of moisture/water and keep it from entering the building envelope. ", "Holes are drilled in these conventional window sill flashings for these fasteners. ", "Sealant is normally applied to the head of fasteners to try to keep surroundings standing water from seeping through the holes and into the building substrate. ", "Expansion and contraction, heat and cold temperatures, building movement, building sway, water laying in the sill system for a prolonged time stressed and loads from the window system, wind loads called together to cause leakage of water into the building.", "\nC. The fasteners, of thousands of different brands, types, sizes, materials, widths, of window doors, or other exterior materials to or through metal sill flashings has a long history of failure. ", "This is because the concept has built in flaws in its concept.", "\nD. End dams are now being used and considered normal for the last twenty years or so. ", "They are commonly just a piece of metal, flat or 90 degree angle shape, installed with sealant and or screws. ", "These are to keep water from leaking t through the rights and left ends of the sill flashing. ", "Unfortunately many installers did not think they were needed and never installed them.", "\nE. The normal sill cannot be used for fastening window down to achieve real anchorage. ", "Fasteners must go through the window sill, and penetrate the sill flashing, then several inches into a concrete floor or wall for instance, to gain a real sound anchorage to the building structure.", "\nF. Water is widely recognized as being able to find its way into a window system, by all window manufactures. ", "Weep holes have been around for over 65 years. ", "Condensation can find its way into almost any window system. ", "Negative pressure can be another water problem.", "\nG. Windows must accommodate a minimum of (14) major design problems:\nWind load, wind pressure on positive plane.", "\nNegative wind loads\nBending of framing materials\nDeflection of glazing materials\nEarthquakes\nWater infiltration\nWind leakage, noise\nDead loading\nCorrosion, coastal conditions, dissimilar metals\nHeat and ultra-violent degradation of paint finishes, plastic or PVC components or framing.", "\nExpansion and contraction\nUplift in major storm or hurricane\nMarketability\nCombinations of all of the above and more.", "\nIt is therefore deemed desirable to provide an improved window sill that would perform on a very large number of buildings, structural material, designs, wall conditions, window types, window brands, depth of window frames, weight of windows, width and height of window, single hung, double hung, jalousies, fixed, sliding casement, hopper, awning, louvered windows and such. ", "It should also accommodate a very large number of doors to meet all of the above criteria. ", "Doors could be of the type that swing in, swing out, singles or pairs, bi-folding doors, sliding patio doors, other sliding doors, vertical roll up, or slide up doors. ", "The improved unit should also accommodate many other exterior forms of curtain wall, fenestrations, spandrel panels, decorative panels, stone veneer, louvers, sky lights and screened enclosures." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.009009009009009009, 0, 0, 0, 0.008849557522123894, 0.0034965034965034965, 0, 0, 0, 0, 0 ]

[ "Q:\n\nbash script. ", "how to add user's choice into txt file\n\nI want to let user key in the choice 1-3, then save, then together with the other inputs in the .txt file. ", "I've tried using switch but it doesn't seem to work..\nOnly a beginner in bash prog..\n echo \"Select the Employee Type:\"\necho \"1- Salaried Employee\"\necho \"2- Hourly Employee\"\necho \"3- Commission Employee\"\necho -en \"Enter Selection: \"\nread choice\n\n case $choice in\n \"1\") \n Type=\"Salaried Employee\"\n break\n ;;\n \"2\") \n Type = \"Hourly Employee\"\n break\n ;;\n \"3\") \n Type =\"Commission Employee\"\n break\n ;;\n *) echo \"Error: Please enter a choice between 1 - 7\"\n echo -en \"Hit [Enter] to return...\"\n read\n ;;\n esac\n\n `if [ `count_lines \"^${Name},\"` -ne 0 ] \n then\n echo \"Error: Entry already exist!!\"", "\n else \n confirm \"Are you sure you want to add the entry?[y/n]\" \n if [ $? ", "-ne 0 ]\n then\n echo \"Previous entry not updated!\" ", " \n else \n echo \"Record is updated with new employee!!\"", "\n echo \"${Name},${Job},${Department},${Salary},${Type}\" >> $PAYROLL\n fi \n fi`\n\nA:\n\nSeveral things wrong with this script:\n\nAt the end of a case alternative, there's only ;; -- no break (which jumps out of do/for/while)\nThere's an extra backtick before the if and after the fi causing a syntax error; remove them\nThere must be no spaces around = is assigments like Type = \"Hourly Employee\" and Type =\"Commission Employee\"\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0, 0, 0 ]

[ "1. ", "Technical Field\nThe present invention relates to a positive electrode active material for a lithium secondary battery, a method of preparing the positive electrode active material, a positive electrode for a lithium secondary battery including the positive electrode active material, and a lithium secondary battery including the positive electrode.", "\n2. ", "Description of Related Art\nRecently, the use of lithium secondary batteries as power sources for mobile phones, camcorders, and laptops has increased remarkably. ", "The positive electrode active material affects the capacity of the lithium secondary battery. ", "As such, whether a lithium secondary battery is usable for a long time at high efficiency or maintains its initial capacity after charging and discharging cycles depends on the chemical characteristics of the positive electrode active material.", "\nExamples of positive electrode active materials used in lithium secondary batteries include lithium transition metal compounds, such as LiCoO2, LiMn2O4, LiNiO2, and LiMnO2.", "\nHowever, the characteristics (such as capacity and lifetime) of positive electrode active materials developed so far are not satisfactory. ", "Thus, there have been attempts to substitute an element of the positive electrode active material with another element, or add another element to the positive electrode active material." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0, 0, 0, 0, 0.005780346820809248, 0, 0 ]

[ "Live in Hollywood (RBD album)\n\nLive in Hollywood is the second live album by Mexican pop band RBD, released on April 4, 2006 in the United States and Mexico. ", "Live in Hollywood was recorded on RBD's first concert in Los Angeles, California on January 21, 2006 at the Pantages Theatre, as part of the group's 'Tour Generación 2006' world tour. ", "The live album was accompanied by the same-day release of a live concert DVD, also titled Live in Hollywood. ", "The acoustic music that appears on the album was recorded live, though in a way posing a different style to the group's previous Tour Generación RBD En Vivo.", "\n\nOn April 19, 2006, the first single off the album was released, a new song titled \"No Pares\", which was sung solely by Dulce María. ", "The song proved to be a total success on Mexican radio. ", "The song was written by former Mexican pop star Lynda Thomas and producer Carlos Lara.", "\n\nBackground and release\n\nThe live album was recorded on January 21, 2006 at the show performed in the Pantages Theatre in Los Angeles, California, which was part of RBD's second concert tour, titled 'Tour Generación 2006' or 'Nuestro Amor Tour'. ", "The concert was the first the band performed in the United States. ", "The show itself had a visually colorful and acoustic style, even counting with the support of a gospel choir.", "\n\nOne of the members of RBD, Christian Chávez, explained during an interview that the songs recorded belonged to the Nuestro Amor album, the difference being that this time the songs were acoustic, and added: \"There are many instruments, strings, percussions, and the finished product is something very cool, more intimate\".", "\n\nThe album was simultaneously put on sale on April 4, 2006 in Mexico, Brazil, and the United States. ", "The live concert DVD recorded on January 21, 2006 was also released the same day. ", "In Spain, the live album was released on December 11, 2006. ", "The release is mostly composed of the songs included in RBD's second studio album, Nuestro Amor.", "\n\nSingles\nOn April 19, 2006, the first single off the album was released, titled \"No Pares\". ", "The song is performed solely by Dulce María. ", "The song was written by Lynda Thomas and producer Carlos Lara. ", "The single's music video was taken from footage in the live DVD, and was released to promote it. ", "In 2007, the song won the award for 'Latin Song of the Year' at the 2007 Orgullosamente Latino Awards.", "\n\nCommercial performance\n\nIn North America, the album became a commercial success. ", "In Mexico, the release reached #14 on the Mexican Albums Chart. ", "It was certified Gold by the Asociación Mexicana de Productores de Fonogramas y Videogramas (AMPROFON) for the sales of 50,000 copies in the country. ", "In the United States, the album peaked at #120 on the Billboard 200, where it charted for five weeks. ", "The album reached #4 and position #6 on the Billboard Latin Pop Albums and Billboard Top Latin Albums charts, respectively. ", "With that, the RIAA certified the album 2x Platinum (Latin) for the sales of 120,000 copies.", "\n\nIn Europe, the album also received a favorable reception. ", "In Spain, the album debuted at number #41 on the Spain Albums Chart, peaking at #34 the following week.", "\n\nIn South America, the album also received a good reception since its release. ", "In Brazil, the album reached the #2 spot on the Brazilian Albums Chart, and remained on the ranking for twelve weeks. ", "In Chile, the live release reached #4 on the IFPI chart.", "\n\nTrack listings\n\n Notes\n\"Me Voy\" is the Spanish cover version of Kelly Clarkson's \"Gone\", originally released on Clarkson's Multi-Platinum album Breakaway (2004).", "\n\"Feliz Cumpleaños\" is the Spanish version of Mikeyla's \"Happy Worst Day\".", "\nAlthough the DVD featured the original live audio, the CD had re-recorded songs, mostly by Anahí, due to her vocal problem at the time the concert was recorded.", "\n\nPersonnel\nCredits adapted from the album's liner notes.", "\n\nVocals\nRBD – all vocals\n\nMusicians\n\nGüido Laris – bajo sexto\nCarlos Lara – didgeridoo\n\nProduction\n\nCamilo Lara – A&R, executive producer\nMelissa Mochulske – A&R coordination\nGüido Laris – arrangements, musical director\nIván Machorro – arrangements\nLuis Luisillo Miguel – associate producer, photographer\nLeyla Hoyle – choir\nMaxine Willard Waters – choir \nDaniel Borner – coordination\nFernando Roldán – engineer\nPedro Damián – executive producer\nGustavo Borner – mixing, recording\nRafael Padilla – percussion\nCarlos Lara – producer\nMarisol Alcelay – product manager\nCarolina Palomo Ramos – production coordinator, PR\nRaúl González Biestro – Stereo Mix producer\nPeter Kent – string conductor\n\nAccolades\n\nCharts\nDespite its success, the album's debut was not as strong as RBD's first live album, Tour Generación RBD en Vivo. ", "Instead, the album debuted at #74 on the Mexican Top 100 albums chart and peaked at #14 one week later; at MixUp stores, the album debuted at #5 and peaked at #3 on National Sales. ", "In the US, the album debuted at #7 on the Billboard Top Latin Albums chart, where it peaked at #6 in April 2006. ", "The album was certified 2x Platinum (Latin) in the US on June 9, 2006 for the sales of 120,000 copies. ", "\nThis album was released with the Copy Control protection system in some regions.", "\n\nWeekly charts\n\nYear-end charts\n\nCertifications\n\nRelease history\n\nSee also\nLive In Hollywood (DVD)\n\nReferences\n\nCategory:RBD live albums\nCategory:2006 live albums" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0, 0.010869565217391304, 0, 0.006369426751592357, 0.007462686567164179, 0, 0.023255813953488372, 0.012145748987854251, 0, 0, 0.006172839506172839, 0, 0, 0, 0.020833333333333332, 0, 0.022222222222222223, 0.031746031746031744, 0, 0, 0, 0.015625, 0, 0.00980392156862745, 0.008064516129032258, 0.010869565217391304, 0, 0.009708737864077669, 0, 0.00847457627118644, 0, 0.024539877300613498, 0.013513513513513514, 0.006211180124223602, 0, 0.021844660194174758, 0, 0.008771929824561403, 0, 0, 0 ]

[ "Q:\n\nHow should I force load a referenced assembly?", "\n\nI have a third-party library that requires an assembly A to be loaded when I call into their code. ", "That assembly is typically installed in the GAC, so I have several options to load it:\n\nI can explicitly call Assembly.", "Load(). ", "However that requires the full name which I don't feel comfortable to hard code in my program. ", "\nI can explicitly call Assembly.", "LoadWithPartialName(). ", "That is an obsolete API of course, and of course I don't feel comfortable to lose control in versioning.", "\nI can reference the assembly in my Visual Studio project file, so I always get the version I built against. ", "However, that won't work unless I create a dummy object in that assembly. ", "The C# compiler simply ignores it if I don't.", "\nSame problem if I call Assembly.", "GetReferencedAssemblies and force load the matched one. ", "The C# compiler simply won't reference my assembly even if I put it in the references list.", "\n\nNow what I'm doing is to call typeof(A.Foo).Assembly.", "GetName() and ignore the return value. ", "Is there a better way to do it?", "\n\nA:\n\nOption 1, for me, would be to reference it in the VS project. ", " \nBut if you want a more passive approach you can use the AppDomain.", "CurrentDomain.", "AssemblyResolve event handler. ", " It executes when an assembly is needed that is not found in the AppDomain. ", " The event args will tell you the Assembly that is being sought and you can go grab it at that point using Assembly.", "Load()\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0.01680672268907563, 0, 0, 0.03125, 0, 0, 0, 0, 0, 0.030303030303030304, 0, 0, 0, 0.02564102564102564, 0, 0, 0, 0, 0.03225806451612903, 0, 0.017241379310344827, 0 ]

[ "Sickle cell anemia and mitral valve replacement. ", "Case report.", "\nAn 8-year-old black boy with sickle cell disease and severe hemolytic anemia crisis (95% hemoglobin S) also had mitral incompetence due to rheumatic valve disease. ", "A 27 mm monostrut Björk-Shiley valve prosthesis was implanted after partial exchange transfusions had reduced the hemoglobin S to less than 40%. ", "High-flow normothermic perfusion was used during extracorporeal circulation, with care taken to avoid hypoxia and acidosis. ", "Postoperative recovery was uneventful." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0, 0 ]

[ "What happens when you attempt to demonstrate sorting algorithms using folk dancing? ", "The result is slightly surreal and you'll probably always hum a tune in future when implementing a Bubble, Shell, Insert or Select sort.", "\n\nYou may well have seen many simulations of sorting algorithms that aim to show in novel ways how the algorithm works or perhaps doesn't work quite as well as it should. ", "However I guarantee that you have never seen anything quite in the same league as the videos made by Sapientia University - they are simply crazy but in the nicest possible way.", "\n\nTake one Central European folk dancing team, a small folk band and an added overlay showing array locations and get them to dance the algorithms in time to \"appropriate\" folk music. ", "The result is slightly surreal and for a time at least slightly hypnotic.", "\n\nWhat you have to do is just check that they are in fact implementing the algorithm correctly. ", "The dancers have numbers stuck on their front and they do seem to look down and examine the value on another dancer before performing the dance routine dictated by the algorithm\n\nTo see what I mean try the simplest of all sorts, the Bubble sort:\n\nAll that happens is that adjacent partners swap if they are in the wrong slot until the algorithm is complete. ", "Notice they have to do a final pass before they can decide that it really is \"all sorted\".", "\n\nIf you think that was too simple, try the Shell sort:\n\nShell sort is just a bubble sort but with the swaps occurring over greater distances reducing each time.", "\n\nAnd for something simpler the Insert sort:\n\nFor the finale Select sort:\n\nAs I say delightful, amusing and slightly eccentric. ", "We can look forward to the Fast Fourier waltz and the depth first tree walk.... Some how though I really don't think that they will manage the Quicksort as any type of dance - expect perhaps something really modern....\n\nFurther Reading:\n\nA network for Go developers has been launched by a combination of the Go community leaders at GoBridge and Google. ", "The Go Developer Network (GDN) is designed to provide a single place for information [ ... ]\n\nThis year's BBVA Foundation Frontiers of Knowledge Award in Information and Communication Technologies has gone to Ivan Sutherland for \"pioneering the move from text-based to graphical computer d [ ... ]" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0.007352941176470588, 0, 0.005649717514124294, 0, 0, 0, 0.002793296089385475, 0, 0.012422360248447204, 0.0078125, 0.0056657223796034, 0.016835016835016835 ]

[ "We Were Skeletons\n\nWe Were Skeletons\n\nWe Were Skeletons\n\nWe Were Skeletons\n\nCD-JEWEL CASE\n\nUPC: 880270325825\n\nRelease Date: 6/29/2010\n\n$10.99\nNew\n\nShould ship in 4-7 business days\n\nAdd To Basket\n\nSHARE\n\nRecorded by Will Killingsworth, this debut album from Western Pennsylvania's We Were Skeletons takes cues from the discordant, chaotic and noisy bands of the late '90s and early '00s like City Of Caterpillar, Off Minor and Hot Cross." ]

{ "pile_set_name": "Pile-CC" }

[ 0.009174311926605505 ]

[ "Evaluation of flow cytometric panel reactive antibody in renal transplant recipients - examination of 238 cases of renal transplantation.", "\nIn Japan, the complement-dependent cytotoxicity (CDC-crossmatch) test and the anti-donor antibody flow cytometric assay (FCXM) are used to evaluate presensitization among transplantation candidates. ", "We introduced the flow cytometric panel reactive antibody method (FlowPRA) at our institution, and in this paper, we compared the results of FCXM and FlowPRA. ", "Sera of a total of 238 patients receiving the first graft were analyzed by FlowPRA retrospectively. ", "Specimens from 125 of these patients were also analyzed by FCXM, and the results obtained using the two methods were compared. ", "In addition, postoperative pathological findings by graft biopsy were examined in patients with PRA class 1(+) or PRA class 2(+). (", "i) Class 1 antibodies were detected in 36 of the 238 patients (15%), class 2 antibodies in six patients (3%), and both class 1 and class 2 antibodies in five patients (2%). (", "ii) Totally 125 patients analyzed by both FCXM and FlowPRA, 28 patients (22%) who tested negative by FCXM were, however, found to be positive by FlowPRA, and 16 of these 28 patients (57%) had shown evidence of humoral rejection suspected of antibody-mediated in the early postoperative stage. ", "A large proportion of patients who tested negative by FCXM but positive by FlowPRA experienced rejection. ", "Thus, for detecting 'high responders' in patients receiving the first graft, use of FlowPRA to detect antibodies may be superior to that of FCXM." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0.005, 0.006289308176100629, 0, 0.007874015748031496, 0, 0, 0, 0, 0.006896551724137931 ]

[ "Q:\n\nHow to hide, obfuscate, or mask emails AND phone numbers in Wordpress\n\nIs it possible to hide, obfuscate, or mask emails AND phone numbers in Wordpress natively? ", " Or is it necessary to use a plugin for this? ", " I need to be able to do this in my content and widget areas without modifying my theme or creating a child theme.", "\n\nA:\n\nTry the http://hivelogic.com/enkoder/\nI.e., the email joe@example.com (with that email as both link text and title; and the script also includes the subject line \"Email\") becomes the script below:\n<script type=\"text/javascript\">\n//<![CDATA[\n<!--", "\nvar x=\"function f(x){var i,o=\\\"\\\",l=x.length;for(i=0;i<l;i+=2) {if(i+1<l)o+=\" +\n\"x.charAt(i+1);try{o+=x.charAt(i);}catch(e){}}return o;}f(\\\"ufcnitnof x({)av\" +\n\" r,i=o\\\\\\\"\\\\\\\"o,=l.xelgnhtl,o=;lhwli(e.xhcraoCedtAl(1/)3=!35{)rt{y+xx=l;=+;\" +\n\"lc}tahce({)}}of(r=i-l;1>i0=i;--{)+ox=c.ahAr(t)i};erutnro s.buts(r,0lo;)f}\\\\\" +\n\"\\\"(0)11\\\\\\\\,i\\\\\\\"kalf-sgs67y;93>$)37501\\\\\\\\\\\\\\\\\\\\\\\\+\\\\\\\\\\\\\\\"&\\\\\\\\hu25\\\\\\\\0%\" +\n\"\\\\\\\\%(!k2/!,[GY}PT33\\\\\\\\0d\\\\\\\\\\\\\\\\nS\\\\\\\\@YFZ21\\\\\\\\02\\\\\\\\02\\\\\\\\\\\\\\\\BsMDoF24\\\\\"+\n\"\\\\0\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\D\\\\\\\\OCVF6Q03\\\\\\\\\\\\\\\\pM3}wytjoyUs|q+x77\\\\\\\\1{\\\\\\\\dbfmU(a\" +\n\"5wc#l=c\\\\\\\"\\\\\\\\\\\\\\\\\\\\\\\\3V02\\\\\\\\\\\\\\\\20\\\\\\\\06\\\\\\\\03\\\\\\\\\\\\\\\\16\\\\\\\\00\\\\\\\\02\\\\\\\\\" +\n\"\\\\\\\\\\\\\\\\n0\\\\\\\\00\\\\\\\\\\\\\\\\1X00\\\\\\\\\\\\\\\\32\\\\\\\\06\\\\\\\\02\\\\\\\\\\\\\\\\37\\\\\\\\04\\\\\\\\00\\\\\\\\\"+\n\"\\\\\\\\23\\\\\\\\00\\\\\\\\00\\\\\\\\\\\\\\\\\\\\\\\\n\\\\\\\\\\\\\\\\(\\\\\\\"}fo;n uret}r);+)y+^(i)t(eAodrCh\" +\n\"a.c(xdeCoarChomfrg.intr=So+7;12%=;y=iy+0)11==(iif){++;i<l;i=0(ior;fthnglex.\" ", "+\n\"l=\\\\\\\\,\\\\\\\\\\\\\\\"=\\\\\\\",o iar{vy)x,f(n ioctun\\\\\\\"f)\\\")\" ;\nwhile(x=eval(x));\n//-->\n//]]>\n</script>\n\nOr, for an automated solution: https://wordpress.org/plugins/php-enkoder/ The source for that is at https://github.com/mgree/phpenkoder\nSome scrapers and bots can probably get around this method, but I've had good luck with it.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.012048192771084338, 0, 0, 0.00796812749003984, 0.0034129692832764505, 0.008571428571428572, 0 ]

[ "Even more opinions on PVC and broader lessons.", "\nA Scientific Committee of the European Commission has addressed possible toxicity concerns of plasticised poly(vinylchloride) in certain medical devices and has reached conclusions that are different from those adopted by some other organisations. ", "This article discusses the basis for these opinions." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.021739130434782608, 0.008032128514056224, 0 ]

[ "Q:\n\nConvert Latitude and Longitude into kms\n\nI am building application where i am getting the user's latitude and longitude using the below code\n<!", "DOCTYPE html> <html> <body>\n\n<p>Click the button to get your coordinates.</p>\n\n<button onclick=\"getLocation()\">Try It</button>\n\n<p id=\"demo\"></p>\n\n<script> var x = document.getElementById(\"demo\");\n\nfunction getLocation() {\n if (navigator.geolocation) {\n navigator.geolocation.getCurrentPosition(showPosition);\n } else { \n x.innerHTML = \"Geolocation is not supported by this browser.\";", "\n } }\n\nfunction showPosition(position) {\n x.innerHTML = \"Latitude: \" + position.coords.latitude + \n \"<br>Longitude: \" + position.coords.longitude; } </script>\n\n</body> </html>\n\nNow i want to convert it to kilometre so that i can compare with other latitude and longitude and calculate the difference between them in kilometre.", "\n\nA:\n\nThis Script is usefull for you, but its in php\n\nfunction distance($lat1, $lon1, $lat2, $lon2, $unit) {\n\n $theta = $lon1 - $lon2;\n $dist = sin(deg2rad($lat1)) * sin(deg2rad($lat2)) + cos(deg2rad($lat1)) * cos(deg2rad($lat2)) * cos(deg2rad($theta));\n $dist = acos($dist);\n $dist = rad2deg($dist);\n $miles = $dist * 60 * 1.1515;\n $unit = strtoupper($unit);\n\n if ($unit == \"K\") {\n return ($miles * 1.609344);\n } else if ($unit == \"N\") {\n return ($miles * 0.8684);\n } else {\n return $miles;\n }\n }\n\nFunction to use\n\n echo distance(32.9697, -96.80322, 29.46786, -98.53506, \"M\") . \" ", "Miles<br>\";\n echo distance(32.9697, -96.80322, 29.46786, -98.53506, \"K\") . \" ", "Kilometers<br>\";\n echo distance(32.9697, -96.80322, 29.46786, -98.53506, \"N\") . \" ", "Nautical Miles<br>\";\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.006802721088435374, 0.0024752475247524753, 0, 0.0078125, 0, 0.012048192771084338, 0.045454545454545456 ]

[ "La. community is ‘a ghost town’ a year after Isaac\n\nBRAITHWAITE, La. (AP) — Isaac barely had hurricane-strength winds when it blew ashore southwest of New Orleans a year ago, but its effects are still apparent in coastal areas where it flooded thousands of homes.", "\n\nAfter landfall on Aug 28, 2012, Isaac stalled, dumping more than a foot of rain and churning a monstrous storm surge. ", "Water flowed over levees and destroyed homes and businesses in coastal Louisiana and Mississippi.", "\n\nIn the end, it was blamed for seven deaths. ", "In Plaquemines Parish, one of the hardest hit areas, damage to homes and businesses has been estimated at more than $100 million, said Guy Laigast, director of the parish’s Office of Homeland Security and Emergency Preparedness.", "\n\nTwo of the deaths from Isaac were in Braithwaite, La., a small community along the Mississippi River near New Orleans that has been all but abandoned since the storm.", "\n\nStreets where children once played are eerily deserted. ", "Homes with blown-out windows and toppled porches sit on lots overgrown with weeds reaching past window sills.", "\n\nThe storm left many residents facing prohibitive increases to flood insurance premiums if they choose to move back. ", "Some have spent insurance payouts on houses elsewhere and have asked that their homes in Braithwaite be demolished. ", "Others are taking their time considering whether home improvements or changes to local levees could make it affordable to insure their houses in the future.", "\n\nAngela Serpas’ insurance rates under the National Flood Insurance Program would more than double to about $9,200 a year if she repaired her home and moved back in, she said. ", "Homeowner insurance — which covers wind damage — is an additional cost.", "\n\n“Who can afford to pay that?” ", "she said. “", "We want to come home, but we can’t.”", "\n\nSerpas and her teenage son were visiting the neighborhood of about 75 homes on a hot August day. ", "They were alone except for two Plaquemines Parish Sheriff’s Office cars on patrol.", "\n\n“It’s very, very sad and very hard to deal with,” said Angela Serpas, taking in a gentle breeze from a swing hanging from a tree near her flooded home, which has not been renovated.", "\n\nIn Congress, Louisiana lawmakers are seeking to delay flood insurance premium increases for some coastal homeowners under a law passed last year. ", "The Biggert-Waters Flood Insurance Reform Act of 2012 was passed in an effort to keep the National Flood Insurance Program solvent after an onslaught of claims from Hurricane Katrina in 2005.", "\n\nStill, homeowners such as Serpas had been seeing increases to the cost of their flood insurance even before the act passed. ", "And policyholders can generally expect their premiums to rise each time their house floods.", "\n\nLaigast said that under the changes passed in 2012, the NFIP is only recognizing levees built to a high standard — able to withstand a so-called 500-year flood — that excludes many levees built by local authorities. ", "Laigast said Louisiana officials are also arguing that all levees should be recognized and taken into account when adjusting homeowner’s flood insurance rates.", "\n\nIn addition, Laigast said Plaquemines Parish is working to get the U.S. Army Corps of Engineers to improve the local levee system, but it’s not clear when that could happen. ", "Higher levees could reduce insurance costs for residents.", "\n\nSerpas could decide not to carry flood insurance because she owns the house outright, but fears of another flood prevent her from taking that chance. ", "Her home sits just outside the protection of a 20-foot-tall floodwall built after Hurricane Katrina.", "\n\nThe family took an insurance payout after Isaac and bought another home in nearby St. Bernard Parish, inside a new levee system.", "\n\nBut it’s not home, she said.", "\n\n“This is home. ", "Braithwaite is home,” she said, choked with emotion.", "\n\nNearby, a hotelier is moving ahead with plans to reopen a centuries-old plantation that has been used for years to host weddings and other events.", "\n\nBlake Miller, who owns hotels in New Orleans’ French Quarter, said it has taken nearly a year to repair damage the 300-year-old Mary Plantation suffered in Isaac.", "\n\n“She’s been through a lot of storms, she’s survived, she’s built like nothing else, so she’s seen it all,” said Blake Miller, a French Quarter hotelier who bought the plantation just a few months before Isaac swamped it with 10 feet of floodwater.", "\n\nThe bottom rooms are made of 16-inch thick brick walls, now cleared of mud and muck left by Isaac. ", "Miller replenished the home with period French country furnishings that can be hauled upstairs if another storm threatens.", "\n\nMiller plans to self-insure the business but sympathizes with homeowners who can’t afford to do so.", "\n\n“It’s outrageous, and that’s the reason why so many people are not returning,” he said." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0038022813688212928, 0, 0, 0, 0.013157894736842105, 0, 0, 0, 0, 0, 0, 0.011363636363636364, 0, 0, 0, 0, 0, 0, 0.00546448087431694, 0.006756756756756757, 0.005235602094240838, 0.007936507936507936, 0, 0.0045871559633027525, 0, 0.017045454545454544, 0, 0, 0, 0.007692307692307693, 0, 0, 0, 0, 0.012195121951219513, 0.004016064257028112, 0, 0.00819672131147541, 0.009900990099009901, 0 ]

[ "s the remainder when 88 is divided by n?", "\n19\nSuppose -2*m = 2*j - 316, -5*m + 3*j + 727 = -95. ", "What is the remainder when m is divided by 55?", "\n52\nSuppose -m - 100 = -6*m. ", "Calculate the remainder when 139 is divided by m.\n19\nLet o(h) be the third derivative of 5*h**4/24 - h**3/2 - h**2. ", "Calculate the remainder when o(7) is divided by (-22)/(-1)*(-2)/(-4).", "\n10\nSuppose 0 = 2*f - 0*f - 46. ", "Suppose -6 = 5*x - 16. ", "Suppose -x*r + 10 + 14 = 0. ", "What is the remainder when f is divided by r?", "\n11\nLet t(d) be the second derivative of -d**4/12 - d**3/6 + 6*d**2 - d. Let k = 21 + 14. ", "Calculate the remainder when k is divided by t(0).", "\n11\nSuppose m + 2*r = -4, 0*m + 2*m + 5*r = -11. ", "Suppose 0 = b + 5*l - 26, -m = b - l + 2. ", "What is the remainder when 2 is divided by b?", "\n0\nSuppose -4*w + 3*m = 3, -5*w + 5*m - 6 = -1. ", "Suppose w = -0*t - 4*t - 12. ", "Let o(f) = f**3 + 2*f**2 - 4*f - 1. ", "What is the remainder when 5 is divided by o(t)?", "\n1\nSuppose 2*q - t - 16 = 3*t, -q - 5*t = -15. ", "What is the remainder when 13 is divided by q?", "\n3\nLet a = 0 + 0. ", "Let b = a - 2. ", "What is the remainder when 27 is divided by 1/b*-7*4?", "\n13\nLet o = -15 - -25. ", "Let u be 0/(-1)*(0 - 1). ", "Let g = o - u. What is the remainder when 18 is divided by g?", "\n8\nLet m be (10/(-3))/((-2)/3). ", "Suppose m*h = 2*h + 18. ", "Suppose 0 = 2*b - h*b + 136. ", "Calculate the remainder when b is divided by 12.", "\n10\nLet v = 69 - 3. ", "Calculate the remainder when v is divided by 34.", "\n32\nLet j(q) = 2*q**2 - 2*q + 2. ", "Let i be j(4). ", "Let t be (-460)/(-25) + (-2)/5. ", "Suppose 2*u - t - i = 0. ", "Calculate the remainder when 42 is divided by u.\n20\nSuppose -4*f = -4, -19 = -3*g - 4*f - 3. ", "Suppose -4*t - 40 = -3*z - 9*t, -8 = -g*t. ", "Calculate the remainder when 28 is divided by z.\n8\nLet f = 0 - 6. ", "Let t be (f/(-12))/(2/192). ", "Let m = 83 - t. What is the remainder when m is divided by 18?", "\n17\nWhat is the remainder when (20 - -3) + (2 - 2) is divided by 9?", "\n5\nLet y be (-2)/(-8) + (-195)/(-20). ", "Suppose 2*d = 7*d - 4*l - 25, 2*l - y = -2*d. ", "What is the remainder when d is divided by (-1)/((-1 - 0)/3)?", "\n2\nSuppose -l - 1 - 6 = -y, -5*l = -4*y + 37. ", "Let o = 17 + l. What is the remainder when 14 is divided by o?", "\n6\nSuppose -2*o + i = -8, 2*i + 0*i - 4 = -o. ", "Let t(v) = v**3 + 4*v**2 - 6*v. ", "What is the remainder when t(-5) is divided by o?", "\n1\nSuppose o = -1 + 5. ", "Suppose 6 = o*k - 118. ", "What is the remainder when k is divided by 11?", "\n9\nLet n(b) = 4*b**3 + 2*b**2 - b. Let o be n(1). ", "Suppose -3*q = 5*k - 55, 0 = -4*q + o*k + 19 - 4. ", "Calculate the remainder when 18 is divided by q.\n8\nSuppose 14*c - 188 = 246. ", "Calculate the remainder when c is divided by 22.", "\n9\nSuppose 0 = 3*c + 21 - 0. ", "Let z(p) = 1 - 2 + 4 - 2*p. ", "Calculate the remainder when z(c) is divided by 6.", "\n5\nLet w = -40 - -245. ", "Suppose 0 = -g - 8 + 3, 0 = -4*p + 5*g + w. Suppose v = -v + 24. ", "Calculate the remainder when p is divided by v.\n9\nLet w(x) = -x + 18. ", "Let i be w(13). ", "Suppose j + 76 = i*g + 2*j, 5*j + 52 = 2*g. ", "What is the remainder when 45 is divided by g?", "\n13\nLet u(s) = -s**3 - 3*s**2 + 7*s + 1. ", "Suppose 2*d - 2*l - l - 18 = 0, d + 4*l - 9 = 0. ", "What is the remainder when u(-5) is divided by d?", "\n7\nLet l = -1139 + 1172. ", "Calculate the remainder when l is divided by -3*(28/6)/(-2).", "\n5\nLet c(b) = b**2 - 4*b + 7. ", "Calculate the remainder when (23/(-4))/(2/(-8)) is divided by c(5).", "\n11\nSuppose 2*z + 3 = 1. ", "Calculate the remainder when ((-3)/3)/(z/8) is divided by 5.", "\n3\nSuppose -8*o + 4*o + 8 = 0. ", "Suppose 3*z - 53 = -0*z + 2*p, 0 = o*p - 10. ", "Calculate the remainder when 81 is divided by z.\n18\nWhat is the remainder when 2/((-7)/(-6) + -1) is divided by 7?", "\n5\nLet r(d) = -2 + 164*d + 0 + 2. ", "Let q be r(1). ", "Let k = q + -105. ", "Calculate the remainder when k is divided by 20.", "\n19\nLet w be (6 + -4)*2/2. ", "Suppose -41 = -3*v + w*k, -20 + 8 = -v - k. Calculate the remainder when v is divided by 7.", "\n6\nSuppose -5*b = -0*b + p - 73, -71 = -5*b - 2*p. ", "Suppose 0*i + 10 = i + l, 4*i = 4*l + 24. ", "Calculate the remainder when b is divided by i.\n7\nSuppose 0 = -5*a + 31 + 14. ", "Let p = a - 6. ", "What is the remainder when p is divided by 1?", "\n0\nLet m be 1*33/(-6)*4. ", "Let p(g) = -34*g + 1. ", "Let c be p(1). ", "Let l = m - c. Calculate the remainder when 21 is divided by l.\n10\nLet n = 2 - 0. ", "Let m(f) = -9 + 10 - f + 0*f + f**n. ", "Calculate the remainder when m(4) is divided by 5.", "\n3\nLet m = -3 - -7. ", "Suppose -s - 10 = m*s. ", "Let x(j) = -10*j - 3. ", "What is the remainder when 33 is divided by x(s)?", "\n16\nSuppose 3*h - 8*p + 3*p = 122, 2*p = -2*h + 60. ", "Suppose 0 = -2*j - 2*j + 240. ", "Suppose -2*c + 7*c = j. Calculate the remainder when h is divided by c.\n10\nSuppose -4*n - r - r = -86, 0 = -2*n + 4*r + 68. ", "Suppose n - 57 = -3*c. ", "What is the remainder when 20 is divided by c?", "\n9\nLet u = 20 + -6. ", "Suppose 2*s + n + 10 = -0*n, -2*s - 2*n - u = 0. ", "Calculate the remainder when 8 is divided by ((-1)/(-3))/(s/(-27)).", "\n2\nLet f(d) = -21*d - 3. ", "Suppose 4*c - 3*c = 7. ", "Calculate the remainder when f(-2) is divided by c.\n4\nLet a(z) = 22*z**2 - z - 1. ", "Let f(s) = s + 9. ", "Let y be f(0). ", "Let h = y + 13. ", "What is the remainder when a(2) is divided by h?", "\n19\nLet h(a) = a + 5. ", "Let m be h(-4). ", "Let f = m - -5. ", "Suppose 2*t + f = 3*t. ", "Calculate the remainder when 15 is divided by t.\n3\nLet s = 11 - 9. ", "Suppose -40 = -s*b + 42. ", "Calculate the remainder when b is divided by 14.", "\n13\nSuppose -w - 4*k + 23 = 2*w, 0 = -3*w + 3*k + 51. ", "Calculate the remainder when 102 is divided by w.\n11\nLet h = 14 + -12. ", "Let v(j) = -j**3 + 10*j**2 + 1. ", "Let s be (-2 - 0)*(-4 - 1). ", "What is the remainder when h is divided by v(s)?", "\n0\nLet y = 23 - 18. ", "Suppose 0 = -d + 4*i + 6, 3*i = 4*d + y*i - 78. ", "What is the remainder when 71 is divided by d?", "\n17\nSuppose -4*j + 5*k - 102 = 98, 4*j = k - 200. ", "Let r = j - -112. ", "What is the remainder when r is divided by 21?", "\n20\nLet m(r) = r**3 + r**2 + r + 2. ", "Let a be m(0). ", "Suppose 5*s - 15 = -2*l, -a*s + 4*s - l - 6 = 0. ", "Calculate the remainder when s is divided by 3.", "\n0\nLet x = -9 - -5. ", "Let d = x - -9. ", "Let q = 1 + 2. ", "Calculate the remainder when d is divided by q.\n2\nSuppose -3*a + 80 = -19. ", "Let i = 56 - 39. ", "What is the remainder when a is divided by i?", "\n16\nLet s(y) = 2*y**2 - 9*y. ", "Let t be s(6). ", "Let a = t - 4. ", "What is the remainder when 25 is divided by a?", "\n11\nLet y(s) be the first derivative of s**4/4 + 3*s**3 + 5*s**2/2 - 11*s - 2. ", "Calculate the remainder when 37 is divided by y(-8).", "\n11\nLet i be 1/4 - (-235)/4. ", "Let y = i - 89. ", "What is the remainder when 40 is divided by (-426)/y + 2/(-10)?", "\n12\nLet l(b) = -b**3 + 7*b**2 + 9*b - 5. ", "Let f be l(8). ", "Suppose -4*v - 56 = -2*a, a - f = -3*v + 5. ", "Calculate the remainder when 37 is divided by a.\n17\nLet g(j) = j**2 - j - 2. ", "Suppose h + 4*h + 90 = 0. ", "Let t be h/(-4) + 9/(-6). ", "Calculate the remainder when 11 is divided by g(t).", "\n3\nSuppose -3*a = -15, -5*t + 0*a = -3*a + 20. ", "Suppose 3 = 4*j - 9. ", "What is the remainder when t/3 - (-25)/3 is divided by j?", "\n2\nSuppose 4*a = p + 10, 5*p = 6*a - 2*a - 2. ", "Let f(l) = -7*l**3 - l**2 - l. Calculate the remainder when f(-1) is divided by a.\n1\nLet m(n) = 5*n**2 + 5*n + 6. ", "What is the remainder when 254 is divided by m(-2)?", "\n14\nSuppose o - 1 = -0. ", "What is the remainder when (-393)/(-9) + 4/(-6) is divided by 11 - 1*(1 - o)?", "\n10\nWhat is the remainder when 12/(-15) - 747/(-15) is divided by 4?", "\n1\nLet m(w) = -w**2 + w + 5. ", "Calculate the remainder when 31 is divided by m(0).", "\n1\nLet r = 4 + 3. ", "Let z(s) = 9*s - 5. ", "Let a(n) = -19*n + 9. ", "Let b(f) = 4*a(f) + 7*z(f). ", "What is the remainder when b(-2) is divided by r?", "\n6\nSuppose -z - 3*z = -8. ", "Suppose 2*f - 2 - z = 0, 5*f - 105 = -5*h. ", "What is the remainder when h is divided by 11?", "\n8\nLet s be (-6)/(-8) - 297/12. ", "What is the remainder when 23 is divided by ((-5)/10)/(1/s)?", "\n11\nSuppose 2*l - 20 = s + 4, l + s = 12. ", "Let x = -12 + 46. ", "Calculate the remainder when x is divided by l.\n10\nSuppose -25 - 451 = -4*j. ", "Calculate the remainder when j is divided by 15.", "\n14\nSuppose -36 = c - 3*c. ", "Suppose 110 = 2*v - 3*t, -3*v = -5*v - 3*t + 98. ", "What is the remainder when v is divided by c?", "\n16\nLet h = 28 - -16. ", "Let x = 38 - 23. ", "Calculate the remainder when h is divided by x.\n14\nLet w(p) = 6*p - 4. ", "Let k = -43 - 54. ", "Let u = k + 138. ", "Calculate the remainder when u is divided by w(3).", "\n13\nCalculate the remainder when 30 is divided by ((-6)/5)/((-15)/100).", "\n6\nLet x be -15*(1 - (0 + 2)). ", "Suppose 3*t - x = 3*s + 2*t, -15 = 3*s - 2" ]

{ "pile_set_name": "DM Mathematics" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0.03571428571428571, 0, 0, 0, 0.02040816326530612, 0, 0, 0.020833333333333332, 0.034482758620689655, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.041666666666666664, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.023255813953488372, 0.015151515151515152, 0, 0, 0, 0, 0.021739130434782608, 0, 0, 0, 0, 0, 0, 0.043478260869565216, 0, 0, 0, 0, 0, 0, 0, 0, 0.02, 0, 0.015384615384615385, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.008771929824561403, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0, 0.01282051282051282, 0, 0, 0, 0, 0, 0, 0, 0.02, 0, 0.043478260869565216, 0, 0.02040816326530612, 0, 0, 0, 0.043478260869565216, 0, 0, 0, 0, 0, 0, 0.012195121951219513, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0, 0.014925373134328358, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0196078431372549, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.012987012987012988, 0, 0, 0, 0, 0, 0, 0.014084507042253521, 0, 0, 0, 0, 0, 0 ]