Datasets:

tomekkorbak

/

detoxify-pile-chunk3-1350000-1400000

like 0

[ "265 F.3d 1220 (11th Cir. ", "2001)\nUNITED STATES OF AMERICA, Plaintiff-Appellee,v.IRA HARVEY LISS, MICHAEL SPUZA, Defendants-Appellants.", "\nNo. ", " 00-14134\nUNITED STATES COURT OF APPEALS FOR THE ELEVENTH CIRCUIT\nSeptember 21, 2001\n\n[Copyrighted Material Omitted][Copyrighted Material Omitted][Copyrighted Material Omitted]\nAppeals from the United States District Court for the Middle District of Florida, D. C. Docket No. ", " 99-00226-CR-T-26A\nBefore TJOFLAT, DUBINA and DUHE*, Circuit Judges.", "\nDUBINA, Circuit Judge:\n\n\n1\nAppellants Ira Harvey Liss (\"Liss\") and Michael Spuza (\"Spuza\")1 appeal their convictions and sentences imposed by the United States District Court for the Middle District of Florida. ", "We affirm in part, vacate in part, and remand for further proceedings.", "\n\nI. BACKGROUND\n\n2\nThe Community Clinical Laboratory, Inc. (\"CCL\"), was a Florida laboratory that conducted blood and urine testing. ", "CCL and its employees developed a scheme to defraud Medicare by paying doctors to refer their Medicare patients to CCL in return for kickbacks from CCL. ", "In order to pay the doctors for these referrals in a manner that appeared legal, CCL created a scheme of consulting agreements with doctors acting as Testing Review Officers (\"TROs\"). ", "The TRO agreements purportedly allowed the doctors to authorize lab work for an individual if his or her own doctor was not available to do so. ", "Thus, the TRO agreements served to disguise the kickbacks that were given in return for the patient referrals.", "\n\n\n3\nIn November 1995, CCL entered into a consulting agreement with Liss, in which Liss agreed to act as a TRO in exchange for $1,000 a month. ", "From November 1995 until April 1998, CCL paid Liss a total of $29,000. ", "Liss did not receive any other form of compensation from CCL. ", "Medicare reimbursed CCL $183,847.31 as a result of Liss's referrals. ", "The government concedes that all of those referrals were made for legitimate medical reasons.", "\n\n\n4\nIn August 1996, CCL entered into a consulting agreement with Spuza, in which Spuza agreed to act as a TRO in exchange for $600 a month. ", "From August 1996 until April 1998, CCL paid Spuza $12,000 for his TRO services. ", "In addition to the TRO payments, CCL made 28 equipment sublease payments on behalf of Spuza and his mother, Dr. Felicia Spuza, who operated the practice jointly with Spuza. ", "These sublease payments totaled $33,679.80. ", "CCL also made office rental payments for the Spuzas. ", "These rental payments totaled $9,691.56. ", "The presentence investigation report (\"PSI\") reflects that CCL paid Spuza a total of $55,371.36. ", "Medicare reimbursed CCL $269,004.73 as a result of the referrals made by the Spuzas. ", "It is undisputed that those referrals were made for legitimate medical reasons.", "\n\n\n5\nA superceding indictment charged Liss and Spuza with one count of conspiracy to defraud the United States, in violation of 18 U.S.C. § 371, and five counts of receiving remuneration in return for Medicare referrals, in violation of 42 U.S.C. § 1320a-7b(b)(1). ", "At Liss and Spuza's joint trial, Vincent Gepp (\"Gepp\"), a CCL sales representative, testified that the way in which CCL paid the illegal kickbacks included payments for the TRO agreements and office and equipment rentals. ", "Gepp also testified that CCL made payments for office space and equipment in exchange for Spuza referring his patients to CCL for laboratory work. ", "The jury found Liss and Spuza guilty on all counts.", "\n\n\n6\nThe PSI combined all counts into a single group because the offense level was to be determined by the total amount of harm or loss, pursuant to U.S.S.G. § 2D1.2(d). ", "The PSI also assigned Liss and Spuza a base offense level of eight based on U.S.S.G. § 2B4.1, which is the guideline for fraud or deceit. ", "For Liss, the PSI relied on U.S.S.G. § 2F1.1(b)(1)(E) and added four levels to reflect the $29,000 amount in illegal kickbacks. ", "For Spuza, the PSI added five levels to reflect the $55,371.36 amount in illegal kickbacks, pursuant to U.S.S.G. § 2F1.1(b)(1)(F). ", "The PSI then added two levels to both Liss and Spuza's sentences under U.S.S.G. § 3B1.3, asserting that they had breached the trust of Medicare by accepting illegal compensation for Medicare referrals. ", "The PSI assigned another two-level increase to Liss for obstruction of justice, contending that Liss committed perjury at trial. ", "This resulted in a total offense level of 16 for Liss. ", "Based on Liss's absence of a criminal background, the PSI did not assess any criminal history points. ", "This resulted in a criminal history category of I and a guideline range of 21-27 months imprisonment for Liss. ", "Likewise, based on Spuza's absence of a criminal background, the PSI did not assess any criminal history points. ", "This resulted in a criminal history category of I and a guideline range of 18-24 months for Spuza. ", "Pursuant to 18 U.S.C. § 3663A, the PSI set restitution in Liss's case in the amount of $29,000. ", "For Spuza, restitution was set in the amount of $55,371.36.", "\n\n\n7\nAt sentencing, the district court heard extensive arguments on Liss's objection to the enhancement for abuse of trust. ", "Liss asserted that the abuse of trust enhancement should not be applied in his case because, under Eleventh Circuit case law, he did not occupy a position of trust vis-a-vis Medicare, and even if he did occupy such a position, his conduct did not constitute an abuse of trust because he did not falsify records or submit fraudulent documents to Medicare. ", "The district court overruled Liss's objection, finding that physicians likely occupy positions of trust with regard to Medicare.", "\n\n\n8\nThe district court sustained Liss's objection to the obstruction of justice enhancement, concluding that, based on its recollection of Liss's trial testimony, it was not convinced that Liss had obstructed justice. ", "The district court overruled Liss's objection as to restitution. ", "Finally, Liss offered testimony in support of his motion for a downward departure, alleging that he was entitled to a downward departure on the grounds of (1) physical health, (2) family ties, (3) contribution to the community, and (4) lesser harms. ", "The district court denied Liss's motion as to each ground, finding that none of the grounds, even combined, warranted a departure. ", "The district court sentenced Liss to 15 months imprisonment on each count, to run concurrently, and ordered Liss to pay a fine of $5,000, and restitution in the amount of $29,000.", "\n\n\n9\nSpuza objected to the PSI, claiming that the PSI's factual account should not include information regarding other individuals' offenses. ", "Spuza made the same objection as Liss concerning the enhancement for abuse of trust, arguing that, under Eleventh Circuit case law, the enhancement was unwarranted. ", "Spuza also contested the inclusion of the office rent and equipment sublease payments as remuneration under § 2B4.1. ", "He argued that those payments were legitimate and that he had received no funds from CCL for the equipment sublease because CCL paid the bank directly. ", "Spuza further opposed the imposition of restitution, maintaining that Medicare did not suffer any loss attributable to his receipt of kickbacks from CCL. ", "Finally, Spuza claimed that he was entitled to a downward departure under U.S.S.G. § 5K2.11 because his conduct did not cause the kind of harm that the anti-kickback statute sought to prevent.", "\n\n\n10\nWith regard to Spuza's argument that the office rental and equipment sublease payments should not be included in the calculation under § 2B4.1, the district court found that there was sufficient evidence to show that those payments constituted remuneration within the meaning of the statute. ", "Spuza then contested the amount of remuneration, contending that even if the equipment sublease payments were remuneration, he should not be accountable for more than half of the total amount because the equipment sublease ran from CCL to his mother, who owned half of the medical practice. ", "The district court overruled Spuza's objection as to the amount or value of the remuneration for both payments, agreeing with the government's position that Spuza was liable for the full amount based on the language in the anti-kickback statute. ", "In regard to Spuza's objection to receiving an enhancement for abuse of trust, the court stated that it had already decided this issue contrary to Spuza's position when it applied the enhancement in Liss's case. ", "The district court also overruled Spuza's objection concerning restitution, reluctantly finding that this circuit's decision in United States v. Vaghela, 169 F.3d 729, 736 (11th Cir. ", "1999), was controlling.", "\n\n\n11\nAfter hearing from Spuza, the district court overruled the government's objection that Spuza should have received an enhancement for his role in the offense, finding that there was no basis for the enhancement. ", "The district court also heard extensive arguments from Spuza as to why he was entitled to a downward departure pursuant to U.S.S.G. § 5K2.11. ", "Spuza's primary argument was based on the proposition that his conduct did not cause the kind of harm contemplated by the statute. ", "Spuza also contested the government's assertion that the plain language of the statute was aimed at preventing the receipt of kickbacks for patient referrals, which was exactly what Spuza had done. ", "The district court denied Spuza's motion, finding that the statute was clear on its face that you shall not refer for kickbacks. ", "Consequently, the district court sentenced Spuza to 18 months imprisonment on each count, to run concurrently, and ordered that Spuza pay restitution in the amount of $55,371.36.", "\n\n\n12\nLiss and Spuza then perfected their appeals.", "\n\nII. ", " ISSUES\nA. Liss\n\n13\n(1) Whether the district court erred in denying Liss's motion to sever.", "\n\n\n14\n(2) Whether the district court erred in denying Liss's motion to dismiss the superseding indictment's single conspiracy charge.", "\n\n\n15\n(3) Whether the district court erred in applying an abuse of trust enhancement to Liss's sentence.", "\n\nB. Spuza\n\n16\n(1) Whether Spuza is entitled to a new trial because he was misjoined for trial with alleged co-conspirator Liss and their trials should have been severed.", "\n\n\n17\n(2) Whether the district court erred in applying the sentencing guidelines by including the office rental and equipment sublease payments in its calculation of the amount of loss.", "\n\n\n18\n(3) Whether the district court erred by imposing an upward adjustment for abuse of trust.", "\n\n\n19\n(4) Whether the district court erred by concluding it lacked the authority to consider a downward departure for lesser harms under U.S.S.G. § 5K2.11.", "\n\n\n20\n(5) Whether the district court erred by ordering Spuza to pay restitution to the government.", "\n\nIII. ", " STANDARDS OF REVIEW\n\n21\nA claim under Rule 8(b) of the Federal Rules of Criminal Procedure is considered a question of law subject to plenary review. ", "United States v. Castro, 89 F.3d 1443, 1450 (11th Cir. ", "1996). ", "A defendant must show actual prejudice through a substantial and injurious effect on the jury's verdict before he can obtain a new trial. ", "United States v. Lane, 474 U.S. 438, 449 (1986).", "\n\n\n22\nIn contrast, we review for abuse of discretion a motion for severance filed under Rule 14 of the Federal Rules of Criminal Procedure. ", "United States v. Schlei, 122 F.3d 944, 983 (11th Cir. ", "1997). ", "To obtain a reversal on the basis of the denial of a severance motion, the defendant must demonstrate that the joint trial resulted in specific and compelling prejudice to the conduct of his defense. ", "Id. at 983-84.", "\n\n\n23\nThis court reviews a district court's findings of fact regarding sentencing for clear error and the district court's application of those facts to the sentencing guidelines de novo. ", "United States v. Smith, 127 F.3d 1388, 1389 (11th Cir. ", "1997).", "\n\n\n24\nWe review a restitution order for abuse of discretion. ", "United States v. Davis, 117 F.3d 459, 462 (11th Cir. ", "1997).", "\n\n\n25\nThis court has no jurisdiction to review a sentencing judge's denial of a downward departure unless it was made based upon belief that he or she did not possess the discretionary authority to depart downward. ", "United States v. Calderon, 127 F.3d 1314, 1342 (11th Cir. ", "1997).", "\n\nIV. ", " DISCUSSION\nA. Misjoinder/Severance\n\n26\nLiss and Spuza argue that they were misjoined in count one of the superseding indictment, and that the district court should have severed their trials.", "\n\n\n27\nFederal Rule of Criminal Procedure 8(b) is a pleading rule. ", "United States v. Morales, 868 F.2d 1562, 1567-68 (11th Cir. ", "1989). ", "The rule permits two or more defendants to be charged in the same indictment if \"they are alleged to have participated in the same act or transaction or in the same series of acts or transactions constituting an offense or offenses.\" ", "Fed. ", "R. Crim. ", "P. 8(b). ", "Therefore, joinder under Rule 8(b) is proper \"where, as here, an indictment charges multiple defendants with participation in a single conspiracy and also charges some but not all of the defendants with substantive counts arising out of the conspiracy.\" ", "United States v. Alvarez, 755 F.2d 830, 857 (11th Cir. ", "1985). ", "The propriety of joinder \"is to be determined before trial by examining the allegations contained in the indictment.\" ", "Morales, 868 F.2d at 1567-68.", "\n\n\n28\nCount one of the superseding indictment charged Liss and Spuza with conspiring with CCL and other defendants to defraud the United States by obtaining kickbacks for the referral of Medicare patients. ", "Thus, under Rule 8(b), Liss and Spuza were properly charged in the same indictment. ", "See Morales, 868 F.2d at 1569-70 (concluding that joinder of parties was proper under Rule 8(b) because the indictment named all defendants-appellants in single conspiracy count).", "\n\n\n29\nAlthough Liss purports to challenge his joinder with Spuza in count one, Liss does not even refer to the allegations in count one, let alone argue that those allegations do not charge his and Spuza's participation in the same offense. ", "Rather, he argues that the evidence at trial did not support a finding that he and Spuza participated in the same conspiracy. ", "The trial evidence, however, may not be used to establish that joinder under Rule 8(b) was improper. ", "See Morales, 868 F.2d at 1568; see also United States v. Dominguez, 226 F.3d 1235, 1240 (11th Cir. ", "2000) (noting that this court looks only to the indictment in order to determine if the appellants' initial joinder was proper under Rule 8(b)). ", "Given the allegations in the indictment, we conclude there was no Rule 8(b) violation in this case, and, even if there had been such a violation, it would have been harmless because the defendants can not show that their joint trial resulted in actual prejudice; i.e., that it had a substantial and injurious effect or influence in determining the jury's verdict. ", "See Lane, 474 U.S. 438 at 449.", "\n\n\n30\nLikewise, we conclude that the defendants were not entitled to a severance and that the district court did not err in denying their motions. ", "Severance under Rule 14 of the Federal Rules of Criminal Procedure is warranted only when a defendant demonstrates that a joint trial will result in \"specific and compelling prejudice\" to his defense. ", "United States v. Walker, 720 F.2d 1527, 1533 (11th Cir. ", "1983). ", "Compelling prejudice occurs when the jury is unable \"to separately appraise the evidence as to each defendant and render a fair and impartial verdict.\" ", "United States v. Meester, 762 F.2d 867, 883 (11th Cir. ", "1985).", "\n\n\n31\nAfter reviewing the record, we conclude that neither Liss nor Spuza suffered compelling prejudice from their joint trial. ", "There was no reasonable likelihood that the jury transferred the applicability of evidence from Liss to Spuza or vice-versa. ", "Liss and Spuza were the only two defendants on trial, only two types of charges were at issue (conspiracy and receiving kickbacks), and the evidence as to each separate charge and defendant was distinct, clear, and uncomplicated. ", "Moreover, the district court cautioned the jury to assess the evidence independently for each count and each defendant, thus further ameliorating the possibility of prejudice. ", "Indeed, Liss and Spuza acknowledge that the key witnesses against Liss (CCL sales representative Richard Holt and CCL owner James McCowan, Jr.) were different from the key witnesses against Spuza (CCL sales representative Vincent Gepp, and Rule 404(b) witnesses Ethan Schlau and Jason Welles). ", "Defendants further acknowledge that the only common witness was the Medicare representative who testified about the number of referrals Liss and Spuza made to CCL. ", "Given the virtually distinct evidence as to Liss and Spuza, they could not have suffered compelling prejudice from being tried jointly.", "\n\n\n32\nIn conclusion, we see no merit to any of the arguments Liss and Spuza make concerning this issue.", "\n\n\n33\nB. Enhancement for Abuse of Position of Trust\n\n\n34\nLiss and Spuza argue that the district court erred in enhancing their respective offense levels by two levels each. ", "The enhancements were assessed for abuse of a position of trust or use of a special skill, pursuant to U.S.S.G. § 3B1.3. ", "The abuse of trust enhancement presents a question of first impression in this circuit.2\n\n\n35\nIn United States v. Garrison, 133 F.3d 831 (11th Cir. ", "1998), we held that \"[f]or the enhancement to apply, defendant must have been in the position of trust with respect to the victim of the crime, and the position of trust must have contributed in some significant way to facilitating the commission or concealment of the offense.\" ", "Id. at 837 (internal marks and citations omitted). ", "We went on to hold that \"the abuse of trust enhancement applies only where the defendant has abused discretionary authority entrusted to the defendant by the victim; arm's-length business relationships are not available for the application of this enhancement.\" ", "Id. at 839 (internal marks and citations omitted).", "\n\n\n36\nOf the other circuits that have addressed whether a physician occupies a position of trust in relation to Medicare, or a private insurance carrier, all have answered that question in the affirmative. ", "See United States v. Ntshona, 156 F.3d 318, 321 (2d Cir. ", "1998) (upholding abuse of trust enhancement where a physician defrauded Medicare by signing false claims); United States v. Sherman, 160 F.3d 967, 969-71 (3d Cir. ", "1998) (upholding abuse of trust enhancement based on physician's abuse of trust with respect to defrauded insurance company); United States v. Adam, 70 F.3d 776, 782 (4th Cir. ", "1995) (upholding abuse of trust enhancement for an internist who took illegal kickbacks from a cardiologist in exchange for patient referrals); United States v. Iloani, 143 F.3d 921, 922-23 (5th Cir. ", "1998) (upholding abuse of trust enhancement based on chiropractor's position of trust with respect to insurance company, where a chiropractor conspired with patients to submit fraudulent bills to insurance companies); United States v. Hoogenboom, 209 F.3d 665, 671 (7th Cir. ", "2000) (upholding abuse of trust enhancement for psychologist who billed Medicare for services that had not been performed or services not performed as billed); United States v. Rutgard, 116 F.3d 1270, 1293 (9th Cir. ", "1997) (upholding abuse of trust enhancement for ophthalmologist who made false entries in his medical records in effecting Medicare fraud).", "\n\n\n37\nOf the circuits noted above, only the Fourth Circuit has addressed the identical factual question presented here; i.e., assuming that a physician does occupy a position of trust, vis- a-vis Medicare, does the physician abuse that position of trust when the physician receives kickbacks for patient referrals, where the referrals were medically necessary and the physician does not falsify patient records or submit fraudulent claims to Medicare? ", "See Adam, 70 F.3d at 782. ", "After considering the applicable law and the special position that physicians hold within the Medicare system, the Fourth Circuit answered this question in the affirmative. ", "Id. Suffice it to say that we agree with the Fourth Circuit's analysis in Adam and adopt its analysis and holding. ", "For that reason, we affirm the two-level enhancement for abuse of a position of trust.", "\n\n\n38\nC. Office Rental and Equipment Sublease Payments\n\n\n39\nSpuza argues that the district court erred in including the office rental and equipment sublease payments in its calculation of the amount of loss, pursuant to U.S.S.G. § 2B4.1, because neither of the above-mentioned payments represented remuneration in exchange for kickbacks, but rather were payments under legitimate fair market agreements. ", "Spuza also argues that the government failed to meet its preponderance burden with regard to the enhancement because no evidence supported the conclusion that these payments were kickbacks. ", "Spuza further argues that, even if the payments were found to be remuneration for patient referrals, the government failed to carry its burden to show that the value to Spuza of the equipment subleases was $33,379.80 because: (1) he was not responsible for the lease, rather it ran from the bank to his mother; (2) he owned only half of the medical practice, and thus would have received only half the value; (3) it was improper to calculate the value simply by adding up all payments CCL made to the bank; and (4) the proper inquiry was what the value was to Spuza of alleviating his mother's liability on the lease.", "\n\n\n40\nThe government responds that the district court did not clearly err in finding that both of these categories of payments constituted kickbacks because the evidence established that all of the agreements between CCL and Spuza were subterfuges for the overall agreement to pay kickbacks in exchange for patient referrals. ", "It also contends that the district court properly rejected Spuza's claim that the value of the kickbacks was overstated because, even though Spuza's mother owned half of the medical practice and was on the equipment lease, Spuza still benefitted by CCL's payments because the debt of the medical practice was reduced.", "\n\n\n41\nThe Sentencing Guidelines set a base offense level of eight for cases involving the offer or acceptance of payment to refer an individual for services or items paid for by Medicare. ", "U.S.S.G. § 2B4.1(a), comment. (", "backg'd). ", "The base offense level is then increased according to the table in § 2F1.1 when \"the greater of the value of the bribe or the improper benefit to be conferred exceed[s] $2,000.\" ", "U.S.S.G. § 2B4.1(b)(1). ", "This amount of loss, however, \"need not be determined with precision [and] [t]he court need only make a reasonable estimate of loss, given the available information.\" ", "U.S.S.G. § 2F1.1, comment. (", "n.9). \"", "Upon challenge, however, the government bears the burden of supporting its loss calculation with reliable and specific evidence.\" ", " United States v. Cabrera, 172 F.3d 1287, 1292 (11th Cir. ", "1999) (internal marks and citations omitted). \"", "When a defendant challenges one of the bases of his sentence as set forth in the PS[I], the government has the burden of establishing the disputed fact by a preponderance of the evidence.\" ", "United States v. Lawrence, 47 F.3d 1559, 1566 (11th Cir. ", "1995). \"", "A sentencing court must make factual findings sufficient to support the government's claim of the amount of fraud loss attributed to a defendant in a PSI.\" ", "Cabrera, 172 F.3d at 1294. ", "This court reviews for clear error a district court's determination of loss from fraud for sentencing purposes. ", "Id. at 1292.", "\n\n\n42\nHere, the district judge, who presided over Spuza's trial and sentencing, concluded that there was sufficient evidence to show that the payments for office and equipment rental constituted remuneration within the statute. ", "The record supports the district court's conclusion because Gepp testified at trial that CCL's payments for office space and equipment were made in exchange for Spuza referring his patients to CCL for laboratory work. ", "The district court, therefore, did not clearly err by finding that these payments were remuneration. ", "Once Spuza objected to the amount attributed to the equipment sublease payments, however, the government was required to support its loss calculation with reliable and specific information, see Cabrera, 172 F.3d at 1292, and the district court was required to make factual findings sufficient to support the government's claim that the amount of fraud loss attributed to Spuza was that which was contained in the PSI. ", "See id. at 1294.", "\n\n\n43\nThe only information that the government provided regarding its calculation was that contained in the PSI. ", "The government then referenced the language of the anti-kickback statute in support of its proposition that Spuza was required to pay the full amounts that CCL had paid on the office rent and equipment subleases. ", "The district court made no factual findings in support of the government's claim; rather, it stated that it agreed with the government's position that Spuza was liable for the full amount based on the language in the anti-kickback statute. ", "Although the district court did not clearly err by finding that the payments for office space and equipment were in fact remuneration for referrals, we conclude that it did fail to make sufficient factual findings regarding the amount of loss as detailed in the PSI. ", "See id. Accordingly, we must vacate the district court's finding as to the value or amount attributed under § 2F4.1 in regard to the equipment sublease payments, and remand to the district court for further findings.", "\n\nD. Downward Departure\n\n44\nA district court's refusal to depart downward from the sentencing guideline range normally is not reviewable on appeal, unless the district court denied the departure because it erroneously believed that it had no authority to depart downward. ", "United States v. Rudisill, 187 F.3d 1260, 1265 (11th Cir. ", "1999). ", "After reviewing the record, we conclude that the district court fully understood that § 5K2.11 authorizes downward departures in limited circumstances. ", "However, the court determined that Spuza's conduct did not warrant a downward departure. ", "Accordingly, the district court's decision is unreviewable by this court. ", "See Rudisill, 187 F.3d at 1265-66.", "\n\nE. Restitution\n\n45\nSpuza contends that the district court erred by ordering him to pay restitution in the amount of the kickbacks that he received from CCL because the government offered no evidence to suggest that the Medicare program suffered any loss attributable to his receipt of remuneration from CCL. ", "Spuza also argues that this circuit's decision in United States v. Vaghela, 169 F.3d 729 (11th Cir. ", "1999), is not controlling because in that case Vaghela conceded that he owed restitution in the amount of kickbacks that he had received. ", "Spuza also argues that because all of the referrals that he made to CCL were medically necessary, and because he was not involved in fraudulent billing, it was error to assume that Medicare suffered a loss based on his offense conduct.", "\n\n\n46\nAn award of restitution must be based on the amount of loss actually caused by the defendant's conduct. ", "See United States v. Martin, 195 F.3d 961, 968 (7th Cir. ", "1999). ", "The government bears the burden of proving the amount of the loss. ", "18 U.S.C. § 3664(e); United States v. McIntosh, 198 F.3d 995, 1003 (7th Cir. ", "2000).", "\n\n\n47\nIn the present case, the government has offered no evidence to suggest that the Medicare program suffered any loss attributable to Spuza's receipt of remuneration from CCL. ", "Medicare paid CCL a fixed amount for its tests. ", "The amount paid by Medicare to CCL was not affected by what CCL did with the money it received. ", "Although CCL may owe restitution if it fraudulently billed for the services allegedly referred by Spuza, billing fraud is not a part of Spuza's offense conduct.", "\n\n\n48\nOur decision in Vaghela is not controlling because in that case the defendant conceded he owed restitution in the amount of the kickbacks he received. ", "169 F.3d at 736. ", "All of the parties in Vaghela apparently assumed that a loss resulted from the offense conduct. ", "See id. There is no basis for such an assumption here because the medical necessity of the referrals is unquestioned. ", "Accordingly, we must vacate the district court's restitution order.3\n\n\n49\nIn conclusion, we affirm Liss's and Spuza's convictions and Liss's sentences. ", "We vacate Spuza's sentences and remand this case to the district court for resentencing consistent with this opinion.", "\n\n\n50\nAFFIRMED in part, VACATED in part, and REMANDED.", "\n\n\n\nNOTES:\n\n\n*\n Honorable John M. Duhe, Jr., U. S. Circuit Judge for the Fifth Circuit, sitting by designation.", "\n\n\n1\n Liss and Spuza are medical doctors.", "\n\n\n2\n United States v. Garcia, 211 F.3d 128 (11th Cir. ", "2000) (Table), is an unpublished opinion directly on point because it involved a physician who obtained fraudulent Medicare reimbursement. ", "In Garcia, we held that \"[t]he district court could properly have found that Garcia was just that discretion-possession physician (or, in this case, psychiatrist) that section 3B1.3 envision[ed]; it was the trust that Medicare proposed in Garcia as a medical professional that permitted him to oversee the falsification of patient-treatment records to accomplish the fraud.\" ", " Id. (internal marks and citations omitted). ", "Although Garcia represents persuasive authority, it is not binding precedent. ", "See 11th Cir. ", "R. 36-2. ", "Therefore, we consider the issue before us to be one of first impression.", "\n\n\n3\n As previously discussed, only the Fourth Circuit has addressed a context factually similar to that of the instant appeal; i.e., a physician who received illegal kickbacks in exchange for Medicare patient referrals. ", "See United States v. Adam, 70 F.3d 776, 782 (4th Cir. ", "1995). ", "It is noteworthy, that in Adam, the district court sentenced Adam to 18 months imprisonment and assessed a $40,000 fine. ", "Id. at 779. ", "Although the district court increased Adam's base offense level, pursuant to U.S.S.G. § 2F1.1(b)(1)(F), for the amount of loss (which included the amount of kickbacks), the court's order made no mention of restitution. ", "Id. at 778- 79.", "\n\n\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0007450329139828682, 0.0006634282181039453, 0.0013785817427560687, 0.0007008229731582105, 0.000829703058116138, 0.0007515591569244862, 0.0005942620919086039, 0.0006113423150964081, 0.0007368697552010417, 0.0006925980560481548, 0.0005931281484663486, 0.0006069711525924504, 0.0005912430351600051, 0.0008427355205640197, 0.0006748944288119674, 0.0006449948414228857, 0.0005959345144219697, 0.0006062221364118159, 0.0007775215781293809, 0.000707587692886591, 0.0008435054332949221, 0.0008555802050977945, 0.0006743093836121261, 0.0006519606686197221, 0.0011773282894864678, 0.0006593760917894542, 0.0013356361305341125, 0.0006473201792687178, 0.000615270109847188, 0.0011927622836083174, 0.000637985416688025, 0.0012871031649410725, 0.0007515340694226325, 0.000822977046482265, 0.0007024173391982913, 0.0012558557791635394, 0.0014766774838790298, 0.0006938153528608382, 0.0007173605263233185, 0.000717993825674057, 0.0007603046833537519, 0.0006809647311456501, 0.0009156783344224095, 0.0006315663340501487, 0.0006897278944961727, 0.0006733759655617177, 0.0007856992888264358, 0.0008885077550075948, 0.0006620633066631854, 0.0008120373240672052, 0.002046688925474882, 0.0007169371820054948, 0.0007766255876049399, 0.0008150401408784091, 0.0007100201328285038, 0.0010648394236341119, 0.0008269046084024012, 0.0006555357831530273, 0.0009042882011272013, 0.0007516311598010361, 0.000628597685135901, 0.0008440875681117177, 0.0007415543077513576, 0.0006922318716533482, 0.0006729858578182757, 0.0009309252491220832, 0.0008422706159763038, 0.0008122137514874339, 0.0010222869459539652, 0.000953872047830373, 0.0011519683757796884, 0.000807786884251982, 0.0008929447503760457, 0.0008066479931585491, 0.0009410533239133656, 0.0006715443450957537, 0.0007117060013115406, 0.0008648348157294095, 0.0009207521216012537, 0.0012429648777469993, 0.000583189248573035, 0.0009877472184598446, 0.0007602093974128366, 0.0007827242952771485, 0.0008777283364906907, 0.000676964467857033, 0.0011258068261668086, 0.0007741957088001072, 0.0007224613218568265, 0.0011751916026696563, 0.0006159234326332808, 0.0009209377458319068, 0.0007741957088001072, 0.0007055088062770665, 0.0009664425742812455, 0.0007741957088001072, 0.000816226180177182, 0.0009718186920508742, 0.0007741957088001072, 0.0013316390104591846, 0.0006701256497763097, 0.0007615840877406299, 0.0011296108132228255, 0.0007488552946597338, 0.000619450060185045, 0.0022228865418583155, 0.0009907849598675966, 0.0007176859653554857, 0.0006758750532753766, 0.0010979515500366688, 0.0007240742561407387, 0.0006572419661097229, 0.000731155916582793, 0.001016231020912528, 0.0006409091874957085, 0.0006320091779343784, 0.0013917058240622282, 0.0008110455819405615, 0.0006274215411394835, 0.0007113079773262143, 0.0005757745238952339, 0.0006098484736867249, 0.0006979276658967137, 0.0006917946739122272, 0.000717631250154227, 0.0009691899176687002, 0.0007721050642430782, 0.0006215234752744436, 0.0012399465776979923, 0.0007240742561407387, 0.0005982438451610506, 0.0007426337688229978, 0.0007994220359250903, 0.0006119162426330149, 0.0006094228592701256, 0.0005533598596230149, 0.0006757771479897201, 0.0006439620046876371, 0.0007425184594467282, 0.0006792409112676978, 0.0006964068161323667, 0.0006403112201951444, 0.0006402352009899914, 0.0006557931774295866, 0.0006415771786123514, 0.0006056192796677351, 0.0006745735881850123, 0.0007819191669113934, 0.0007311771623790264, 0.0007136280182749033, 0.000784221978392452, 0.0006842346047051251, 0.000972365087363869, 0.0006454326794482768, 0.0006401085411198437, 0.0006335618090815842, 0.0006952848052605987, 0.0005752890137955546, 0.0006607103277929127, 0.0006821563001722097, 0.0007501184591092169, 0.0006728493026457727, 0.0007127017015591264, 0.0006024594767950475, 0.0007074025925248861, 0.0024060658179223537, 0.0007741579902358353, 0.0008155093528330326, 0.000626533234026283, 0.0006918612052686512, 0.0007648624596185982, 0.000574160018004477, 0.0008662050240673125, 0.0005795945762656629, 0.0006014907266944647, 0.0009815472876653075, 0.0007304800092242658, 0.0006447791238315403, 0.0006921401363797486, 0.000698824820574373, 0.0015826757298782468, 0.0006281814421527088, 0.0006048391223885119, 0.0008159722783602774, 0.0006488244980573654, 0.0007049697451293468, 0.000601427920628339, 0.0007455872837454081, 0.0007298332056961954, 0.000647643581032753, 0.0006224291864782572, 0.0006431113579310477, 0.0009573495481163263, 0.0007397858425974846, 0.0005628517828881741, 0.0007419975590892136, 0.0006055941339582205, 0.0006330464384518564, 0.0008310925331898034, 0.000736219109967351, 0.000676241354085505, 0.0008236073772422969, 0.000932931958232075, 0.0007231698255054653, 0.0007397858425974846, 0.0007524731918238103, 0.000885791378095746, 0.0007551076705567539, 0.0006270371959544718, 0.0006165069062262774, 0.0006807148456573486, 0.0018313436303287745, 0.000611268391367048, 0.0008150405483320355, 0.0006970794638618827, 0.0007053793524391949, 0.0007544916006736457, 0.0007932508597150445, 0.0006291077588684857, 0.0006366133457049727, 0.0010691951029002666, 0.0008250027312897146, 0.0006393525982275605, 0.001397331478074193, 0.0006379163824021816, 0.000656374089885503, 0.000766589364502579, 0.0008277198066934943, 0.0006139074102975428, 0.0006160701741464436, 0.0007563344552181661, 0.0007688169716857374, 0.0012274659238755703, 0.023502903059124947, 0.00071874656714499, 0.0026701486203819513, 0.001995444530621171 ]

[ "//GiGaHeRz's SPU2 Driver\n//Copyright (c) 2003-2008, David Quintana <gigaherz@gmail.com>\n//\n//This library is free software; you can redistribute it and/or\n//modify it under the terms of the GNU Lesser General Public\n//License as published by the Free Software Foundation; either\n//version 2.1 of the License, or (at your option) any later version.", "\n//\n//This library is distributed in the hope that it will be useful,\n//but WITHOUT ANY WARRANTY; without even the implied warranty of\n//MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. ", " See the GNU\n//Lesser General Public License for more details.", "\n//\n//You should have received a copy of the GNU Lesser General Public\n//License along with this library; if not, write to the Free Software\n//Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA\n//\n\n#ifndef DEBUG_H_INCLUDED\n#define DEBUG_H_INCLUDED\n\nextern FILE *spu2Log;\n\nextern void FileLog(const char *fmt, ...);\nextern void ConLog(const char *fmt, ...);\n\nextern void DoFullDump();\n\nextern FILE *OpenBinaryLog(const wxString &logfile);\nextern FILE *OpenLog(const wxString &logfile);\nextern FILE *OpenDump(const wxString &logfile);\n\nnamespace WaveDump\n{\nenum CoreSourceType {\n // Core's input stream, usually pulled from ADMA streams.", "\n CoreSrc_Input = 0,\n\n // Output of the actual 24 input voices which have dry output enabled.", "\n CoreSrc_DryVoiceMix,\n\n // Output of the actual 24 input voices that have wet output enabled.", "\n CoreSrc_WetVoiceMix,\n\n // Wet mix including inputs and externals, prior to the application of reverb.", "\n CoreSrc_PreReverb,\n\n // Wet mix after reverb has turned it into a pile of garbly gook.", "\n CoreSrc_PostReverb,\n\n // Final output of the core. ", " For core 0, it's the feed into Core1.", "\n // For Core1, it's the feed into SndOut.", "\n CoreSrc_External,\n\n CoreSrc_Count\n};\n\nextern void Open();\nextern void Close();\nextern void WriteCore(uint coreidx, CoreSourceType src, s16 left, s16 right);\nextern void WriteCore(uint coreidx, CoreSourceType src, const StereoOut16 &sample);\n}\n\nusing WaveDump::CoreSrc_Input;\nusing WaveDump::CoreSrc_DryVoiceMix;\nusing WaveDump::CoreSrc_WetVoiceMix;\nusing WaveDump::CoreSrc_PreReverb;\nusing WaveDump::CoreSrc_PostReverb;\nusing WaveDump::CoreSrc_External;\n\n#endif // DEBUG_H_INCLUDED //\n" ]

{ "pile_set_name": "Github" }

[ 0.0006746327271685004, 0.0006229488062672317, 0.000585074711125344, 0.0009283653926104307, 0.0006579703185707331, 0.000744226505048573, 0.0006531229591928422, 0.1955832839012146, 0.0006141376215964556, 0.0006979347090236843, 0.0008541339775547385, 0.0008227743091993034 ]

[ "Q:\n\nHow to delete/clear shared-preferences using key in flutter?", "\n\nI am using the following code which clears all the shared-preferences but I just want to clear/delete particular shared-preferences value using key in a flutter.", "\nFor now, I have this which is clearing all the shared-preferences.", "\n SharedPreferences prefrences = await SharedPreferences.getInstance();\nawait prefrences.clear();\n\nA:\n\nYou can just do this:\nprefrences.remove(\"keyName\")\n\nDart code is pretty easy to read so sometimes when there isn't sufficient documentation, you may just dive into code: https://github.com/flutter/plugins/blob/481e8c251667bcb28d177bfc7d295d584e703bae/packages/shared_preferences/shared_preferences/lib/shared_preferences.dart#L146\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0009159239707514644, 0.0007210536859929562, 0.0005702896742150187, 0.0008006651769392192 ]

[ "Old Stone House\n\nOld Stone House may refer to:\n\n Old Stone House (Hampton, Iowa)\n Old Stone House (Brooklyn)\n Old Stone House (Vale, Oregon)\n Old Stone House (Granite Quarry, North Carolina)\n Old Stone House (Winnsboro, South Carolina)\n Old Stone House (Millboro Springs, Virginia)\n Old Stone House (Richmond, Virginia)\n Old Stone House (Winooski, Vermont)\n Old Stone House Museum, in Brownington Village, Vermont\n Edgar Allan Poe Museum (Richmond, Virginia)\n Old Stone House (Washington, D.C.)\n Old Stone House (Morgantown, West Virginia)\n Old Stone House (Pennsboro, West Virginia)\n Wallace Estill Sr. ", "House, near Union, West Virginia\n\nSee also\n Old Stone House Library, Fort Ann, New York (built 1825) NRHP listed building\n Stone House (disambiguation)" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0006210095016285777, 0.00059059530030936 ]

[ "Characterization of mammographic masses using a gradient-based segmentation algorithm and a neural classifier.", "\nComputerized methods have recently shown a great potential in providing radiologists with a second opinion about the visual diagnosis of the malignancy of mammographic masses. ", "The computer-aided diagnosis (CAD) system we developed for the mass characterization is mainly based on a segmentation algorithm and on the neural classification of several features computed on the segmented mass. ", "Mass-segmentation plays a key role in most computerized systems. ", "Our technique is a gradient-based one, showing the main characteristic that no free parameters have been evaluated on the data set used in this analysis, thus it can directly be applied to data sets acquired in different conditions without any ad hoc modification. ", "A data set of 226 masses (109 malignant and 117 benign) has been used in this study. ", "The segmentation algorithm works with a comparable efficiency both on malignant and benign masses. ", "Sixteen features based on shape, size and intensity of the segmented masses are extracted and analyzed by a multi-layered perceptron neural network trained with the error back-propagation algorithm. ", "The capability of the system in discriminating malignant from benign masses has been evaluated in terms of the receiver-operating characteristic (ROC) analysis. ", "A feature selection procedure has been carried out on the basis of the feature discriminating power and of the linear correlations interplaying among them. ", "The comparison of the areas under the ROC curves obtained by varying the number of features to be classified has shown that 12 selected features out of the 16 computed ones are powerful enough to achieve the best classifier performances. ", "The radiologist assigned the segmented masses to three different categories: correctly-, acceptably- and non-acceptably-segmented masses. ", "We initially estimated the area under ROC curve only on the first category of segmented masses (the 88.5% of the data set), then extending the classification to the second subclass (reaching the 97.8% of the data set) and finally to the whole data set, obtaining A(z)=0.805+/-0.030, 0.787+/-0.024 and 0.780+/-0.023, respectively." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006516329594887793, 0.0005859304801560938, 0.0005618419963866472, 0.0006367723690345883, 0.0005680520553141832, 0.0005783248343504965, 0.0006144994986243546, 0.0006074549746699631, 0.0006427246844395995, 0.000591133430134505, 0.000552081735804677, 0.0005838322103954852, 0.0005788551061414182 ]

[ "Q:\n\nHow to retrieve File from Parse to display on PFQueryTableVIewController?", "\n\nI'm trying to retrieve users profile pictures(File) from Parse onto my PFQueryTableViewController. ", "I believe I've written my code correctly but I'm probably doing something wrong. ", "So how do I retrieve users images from parse to display on my query?", "\n override func tableView(tableView: UITableView?, ", "cellForRowAtIndexPath indexPath: NSIndexPath?, ", "object: PFObject!) -", "> PFTableViewCell? {", "\n let cell = tableView!.dequeueReusableCellWithIdentifier(\"TCell\", forIndexPath: indexPath!) ", "as! ", "Tweets\n\nif let userTweet : PFObject = self.tweets.objectAtIndex(indexPath!.row) as! ", "PFObject {\n\ncell.username.text = object[\"account\"] as? ", "String\ncell.post.text = object[\"post\"] as? ", "String\ncell.post.numberOfLines = 0\n\n if let Pic = object[\"photo\"] as? ", "PFFile {\n cell.userImage.image = UIImage(named: \"Image\")\n cell.userImage.file = Pic\n }\n\n }\n\nA:\n\nYou're not loading the PFFile for one. ", " \nif let pic = object[\"photo\"] as? ", "PFFile {\n // Make sure your imageView is a PFImageView\n let imageView = cell.userImage as! ", "PFImageView\n // I assume this is the placeholder image while your load your image files from Parse\n imageView.image = UIImage(named: \"image.png\")\n imageView.file = pic\n // Load the image file however you see fit\n imageView.loadInBackground(nil) \n}\n\nAs a side note, It's good practice to not capitalize your constants due to the chance they could get confused with class names in your code.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0008972645155154169, 0.0006910741212777793, 0.0006109756650403142, 0.0007826317450962961, 0.0007922337390482426, 0.0009281403617933393, 0.0012164214858785272, 0.0011332122376188636, 0.0007128973375074565, 0.0036731164436787367, 0.006286555901169777, 0.0008105267188511789, 0.0007998126093298197, 0.0009850444039329886, 0.0010109618306159973, 0.0010293934028595686, 0.003236767603084445, 0.0007411918486468494, 0.001995444530621171 ]

[ "Gillie Da Kid and his cousin Walo267 have one the biggest podcast in the game right now! ", "Their “Million Dollaz Worth Game” podcast has been number 1 for 16 weeks in a row. ", "Their guest on the latest episode was ***star Pinky XXX aka Sarah Mirabelli. ", "While on the show Gillie did not bite his tongue and he straight asked Pinky about eating Dame Dash ass out. ", "Gillie even said he heard Dame was screaming out its Da Roc while she was doing it. ", "Check out the interview below and tell us what you think!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0018468465423211455, 0.009557823650538921, 0.000721774238627404, 0.5516887307167053, 0.0020155052188783884, 0.0006449453649111092 ]

[ "760 F.2d 253\nKouhestanianv.", "U.S.\n84-2360\nUnited States Court of Appeals,Second Circuit.", "\n2/20/85\n\n1\nS.D.N.Y.\n\nAFFIRMED\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0009262369712814689, 0.0008362823282368481, 0.0007607380393892527 ]

[ "Wolf has an amazing profile to photograph, I can see why he is always cast in villainous roles, with a Germanic, Prussian-like bone structure. ", "I directed Kahler to assume fierce yet vivid Expressions to directly to the lens. ", "Wolf’s piercing expressions are breathtaking. ", "Portraits must have energy, the still image should hold the viewer. ", "I encourage my sitter’s to express themselves using inventive scenarios and direction. ", "This enables the sitter to show emotion; connecting with the viewer. ", "The sitting was a memorable one, Wolf regaled me with several tales from his casting with Stanley Kubrick for Barry Lyndon to his experience working with Harrison Ford in India Jones." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0010020731715485454, 0.0005626326892524958, 0.013603964820504189, 0.0006311502656899393, 0.000627324974630028, 0.0005905882571823895, 0.0006053647375665605 ]

[ "We haven’t been out to Disney Springs for construction updates in some time, and while the construction landscape looks a lot different today than it did a year or two ago, there are still quite a few projects ongoing. ", "We’ll start in the West Side and make our way to the Marketplace.", "\n\nThe NBA Experience\n\nSituated on the plot of land that used to hold DisneyQuest, The NBA Experience is a completely new build that will be completed this time next year. ", "Let’s take a look at what the final product will look like.", "\n\nAnother piece of concept art can be found on the wall.", "\n\nThe NBA Experience will feature multiple floors of fun and food for the NBA fan. ", "Its shape is inspired by modern NBA arenas and will feature glass elements and large screens.", "\n\nAs of today, the building has been shaped and work is quickly turning towards the interior.", "\n\nIt appears, from both concept art and seeing the structure in person, that the curved area will be enclosed in glass, but that there won’t be any interior walls for the first 20-30 feet.", "\n\nJaleo\n\nNearby, Jaleo is slated for a late 2018 opening. ", "Red tiles have recently been added to a side of the facade.", "\n\nOther than that, we’re still able to see directly into the structure.", "\n\nJaleo is being built across from Splitsville and the AMC theater.", "\n\nWolfgang Puck Bar & Grill\n\nAs we make our way towards Town Center, here’s a latest look at Wolfgang Puck Bar & Grill.", "\n\nThe new build is located across from the delicious new quick service – Chicken Guy.", "\n\nHere’s a look at the concept art, as well as some newly installed elements such as glass and paneling.", "\n\nThe Polite Pig\n\nOver at The Polite Pig, they’ve come to the realization that uncovered outdoor dining isn’t a great experience in Florida. ", "Thanks to daily afternoon thunderstorms, guests were often dealing with either being displaced due to the rain or simply not using wet outdoor seating. ", "An overhang is being constructed that should solve this issue. ", "The restaurant remains open during the construction.", "\n\nWorld of Disney\n\nWorld of Disney is still undergoing a multi-month reimagining that sees the removal of the characters and 90’s theming elements. ", "Instead, Disney is going for a cleaner, more “sterile” look. ", "The reimagining is expected to be completed this Fall. ", "We’ll have full coverage of the new theme when it debuts. ", "In the meantime, half of the store remains open.", "\n\n4 Rivers Food Truck\n\nA new food truck is now parked next to World of Disney. ", "The 4 Rivers Cantina Barbacoa features takeaway taco cones and bowls.", "\n\nDesign-a-Tee\n\nDesign-a-Tee is now closed. ", "Here’s a look at the exterior of the store on the morning it closed.", "\n\nThird Parking Garage\n\nThe third parking garage is coming along nicely. ", "It’s located on the opposite side of Buena Vista Drive, which requires a pedestrian bridge to allow guests to safely walk to Disney Springs.", "\n\nFall Decor\n\nBoth Town Center and The Marketplace have some fall decor installed.", "\n\nNotice: JavaScript is required for this content." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005390078295022249, 0.0016105850227177143, 0.0005691717960871756, 0.0006186803802847862, 0.0006467914208769798, 0.0005735417362302542, 0.000614340475294739, 0.0005395698826760054, 0.0005430062883533537, 0.0007368791848421097, 0.0006905815680511296, 0.0005570694920606911, 0.0007493064622394741, 0.0007535376935265958, 0.002992837456986308, 0.000529629411175847, 0.13358676433563232, 0.0006096300203353167, 0.0005888789310120046, 0.0005915437359362841, 0.0006572596030309796, 0.0007848129025660455, 0.0007145024719648063, 0.0005374064785428345, 0.0009559741010889411, 0.0006855027750134468, 0.00064048235071823, 0.0007130580488592386, 0.0006225007236935198, 0.000694422225933522, 0.0006779264658689499, 0.0005859273951500654, 0.0005758340703323483 ]

[ "Challenge\n\nTo attract savvy customers who are just as interested in cost-efficiency as using a more premium feeling brand. ", "In 2010, when the short-haul market suffered soaring fuel costs and aggressive price-cutting, the aim was to secure the middle ground between budget travel and attractive airlines.", "\n\nDelivery\n\nBrand advertising was created, blending the best of easyJet’s cheeky, low cost heritage with a more sophisticated, premium body language, across 17 European markets in 21 languages. ", "easyJet beat the national carriers on price, but crucially, also improved brand perceptions.", "\n\nResults\n\nDespite this fiercely competitive market, a 500% share price increase was achieved, which continues to grow today. ", "Through smarter integration and planning, this was achieved while actually reducing marketing spend – the positive impact of which has been felt across the whole business." ]

{ "pile_set_name": "Pile-CC" }

[ 0.000659360084682703, 0.0006102912593632936, 0.0006364149739965796, 0.0006486037746071815, 0.0005803616368211806, 0.0005644455086439848 ]

[ "The present invention concerns a semiconductor device and a production process thereof, as well as a wire bonding device used therefor. ", "More specifically, the present invention relates to an improvement for the bondability in the wire bonding, for example, to a technique useful when applied to electrical connection between electrodes and leads of a semiconductor pellet in the production steps of a semiconductor device.", "\nThe production process for a semiconductor device includes a wire bonding step for the electrical connection between electrodes of a semiconductor pellet on which a semiconductor device such as IC or LSI is formed and leads. ", "As one of the wire bonding devices used in such a step, there has been known a ball-bonding type bonding device of applying a high voltage between an electric discharge electrode and the top end of a wire held by a capillary as a wire bonding tool, causing electric discharge to make the top end of the wire spherical (into a ball) and, thereafter, lowering the capillary to crush the ball therewith and press-bonding under heating, thereby connecting the wire to a body to be bonded. ", "Further, there has also been known a wire bonding device in which the space between the top end of the wire and the discharge electrode disposed opposing thereto can be maintained as a reducing gas atmosphere.", "\nSuch a wire bonding device has been described, for example, in Japanese Patent Laid-Open No. ", "Sho 58-169918.", "\nIn semiconductor devices such as ICs, LSIs, transistors, etc., ", "gold (Au) wires of from 20 to 50 .mu.m diameter have often been used for at present the connection between an aluminum (Al) electrode on a silicon (Si) chip (pellet) and a lead frame. ", "Upon connecting the wire to the silicon chip, a ball is formed to the top end of a gold wire by means of electric discharge or hydrogen flame and the ball is connected by press-bonding under heating or supersonic welding. ", "However, if the gold Au wire is made fine for making the density higher and the size smaller in a semi-conductor device, the strength of the wire is weakened thereby causing problems of deformation or disconnection of the wire upon resin encapsulation.", "\nIn view of the above, there has been an important subject for the development of a ball bonding tenchique using other materials than gold.", "\nCopper (Cu) and aluminum (Al) may be considered as the material for the wire, and earnest studies have been made various research organizations for using copper (Cu) wires in view of the electroconductivity and the strength, because copper wire causes neither deformation nor disconnection even when it is made finer than the gold wire.", "\nHowever, it has been considered extremely difficult technically to use the copper wire since it is oxidized more easily as compared with the gold wire, making it difficult to obtain a ball of a high spherical shape, as well as the hardness of the ball is high.", "\nRecently, copper balls of high spherical shape can be obtained by forming a ball in an inert gas containing hydrogen as disclosed in Japanese Patent Laid-Open No. ", "Sho 58-154241 and the study for the copper ball bonding has become vigorous.", "\nFurther, attempts for increasing the purity of the copper wire has been made for decreasing the ball hardness (Japanese Patent Laid-Open Nos. ", "Sho 60-124959, 59-13662 and 59-139662). ", "That is, if the ball hardness is high, since there is a great possibility of damaging the silicon chip upon ball bonding, the adequate bonding region is extremely narrow as compared with the case of gold wire, making it not suitable to the mass production. ", "However, the ball hardness is not reduced by so much even if the purity of the copper is improved, and a novel technique for reducing the ball hardness has strongly been demanded." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0005597415729425848, 0.0005450357566587627, 0.0005667082732543349, 0.0006364525761455297, 0.000604871369432658, 0.000593418488278985, 0.0009100435418076813, 0.0006264809635467827, 0.0005906178266741335, 0.000688964209984988, 0.0006436074036173522, 0.00056595413479954, 0.0005618706345558167, 0.0006011677323840559, 0.0007178467931225896, 0.0006067687063477933, 0.0006788322934880853, 0.0008143209270201623, 0.00062613032059744, 0.0006315979408100247 ]

[ "[Epithelioid hemangioendothelioma of the spine].", "\nEpithelioid hemangioendotheliomas are rare vascular tumors, mostly originating from soft tissue, lungs or liver. ", "A 58-year-old woman was admitted to hospital because of upper congestion, Horner's syndrome and segmental sensory disturbance. ", "MRI of the spine showed a spinal mass, reaching from the seventh cervical vertebra to the fourth chest vertebra. ", "Because of worsening of upper congestion and progressive neurological impairment, the patient had to be operated twice. ", "Unfortunately a surgical excision of the infiltrating tumor in sano was not possible and the patient died 4 weeks after the second operation. ", "Histologic examination revealed the diagnosis of infiltrating epithelioid hemangioendothelioma, originating from the first chest vertebra. ", "Prognosis of epithelioid hemangioendothelioma is mainly determinated by its location. ", "In advanced stages of disease or lack of surgical cure epithelioid hemangioendotheliomas may be fatal. ", "Therefore epithelioid hemangioendotheliomas should be considered early in the differential diagnosis of patients with uncertain bone lesions." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.001877570990473032, 0.002123491372913122, 0.0010714627569541335, 0.0007589762681163847, 0.0012381814885884523, 0.0020347812678664923, 0.001200338127091527, 0.0011536035453900695, 0.002759962808340788, 0.001057504559867084 ]

[ "Hostility and ill health: role of psychosocial resources in two contexts of working life.", "\nThe purpose of this study was to examine the extent to which increased risk to health problems in hostile employees is associated with psychosocial resources and life context. ", "Social relationships, job control, and sickness absence were assessed among 757 hostile and nonhostile municipal employees in two life contexts: during a stressful organizational downsizing; and during a period after the downsizing. ", "The follow-up time was 550 person-years for men and 1677 person-years for women during the period of downsizing, and 519 person-years for men and 1568 person-years for women during the period after downsizing. ", "The risk of sick leave was 1.2-1.4-fold higher in the hostile individuals than in the others. ", "Small network size in hostile employees related to a 1.4-2.5-fold higher risk of sick leave compared to large network size. ", "In nonhostile employees, network size did not associate with sick leave. ", "Poor job control effected a 50% higher risk of sick leave in hostile than in nonhostile individuals during downsizing. ", "During the less stressful period, both hostility and poorjob control increased absence rates independently of one another. ", "Strong spouse support protected only nonhostile employees from sickness. ", "No differences between hostile and nonhostile employees were found in the levels of psychosocial resources or changes in them. ", "The risk of health problems in hostile persons could be linked with heightened vulnerability in poor psychosocial resource conditions and with the inability to benefit from existing psychosocial resources. ", "Such personal deficits seem to be resource-specific and vary somewhat according to an individual's life context." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.001467146328650415, 0.0007634097128175199, 0.0007590427994728088, 0.001201373408548534, 0.0015352783957496285, 0.0008678241865709424, 0.0013313593808561563, 0.006929382681846619, 0.0008150125504471362, 0.0009115491411648691, 0.0009440926951356232, 0.0016035150038078427, 0.0006479859002865851 ]

[ "/*\n * OpenBIOS driver prototypes\n *\n * (C) 2004 Stefan Reinauer <stepan@openbios.org>\n *\n * This program is free software; you can redistribute it and/or\n * modify it under the terms of the GNU General Public License\n * version 2\n *\n */\n#ifndef OPENBIOS_DRIVERS_H\n#define OPENBIOS_DRIVERS_H\n\n#include \"config.h\"\n\n#ifdef CONFIG_DRIVER_PCI\n/* drivers/pci.c */\nint ob_pci_init(void);\n#endif\n\n#if defined(CONFIG_DRIVER_PCI) || defined(CONFIG_DRIVER_ESCC)\n#ifdef CONFIG_PPC\nextern int is_apple(void);\nextern int is_oldworld(void);\nextern int is_newworld(void);\n#else\nstatic inline int is_apple(void)\n{\n\treturn 0;\n}\nstatic inline int is_oldworld(void)\n{\n\treturn 0;\n}\nstatic inline int is_newworld(void)\n{\n\treturn 0;\n}\n#endif\n#define AAPL(_cmd) do { if (is_apple()) _cmd; } while(0)\n#define OLDWORLD(_cmd) do { if (is_oldworld()) _cmd; } while(0)\n#define NEWWORLD(_cmd) do { if (is_newworld()) _cmd; } while(0)\n#endif\n#ifdef CONFIG_DRIVER_SBUS\n/* drivers/sbus.c */\nint ob_sbus_init(uint64_t base, int machine_id);\n\n/* arch/sparc32/console.c */\nvoid tcx_init(uint64_t base);\nvoid kbd_init(uint64_t base);\n#endif\n#ifdef CONFIG_DRIVER_IDE\n/* drivers/ide.c */\nint ob_ide_init(const char *path, uint32_t io_port0, uint32_t ctl_port0,\n uint32_t io_port1, uint32_t ctl_port1);\nint macio_ide_init(const char *path, uint32_t addr, int nb_channels);\n#endif\n#ifdef CONFIG_DRIVER_ESP\n/* drivers/esp.c */\nint ob_esp_init(unsigned int slot, uint64_t base, unsigned long espoffset,\n unsigned long dmaoffset);\n#endif\n#ifdef CONFIG_DRIVER_OBIO\n/* drivers/obio.c */\nint ob_obio_init(uint64_t slavio_base, unsigned long fd_offset,\n unsigned long counter_offset, unsigned long intr_offset,\n unsigned long aux1_offset, unsigned long aux2_offset,\n unsigned long mem_size);\nint start_cpu(unsigned int pc, unsigned int context_ptr, unsigned int context,\n int cpu);\nvoid ob_eccmemctl_init(uint64_t base);\nvoid ss5_init(uint64_t base);\n\n/* drivers/iommu.c */\nvoid ob_init_iommu(uint64_t base);\nvoid *dvma_alloc(int size, unsigned int *pphys);\n\n/* drivers/sbus.c */\nextern uint16_t graphic_depth;\n\n/* drivers/obio.c */\nextern volatile unsigned char *power_reg;\nextern volatile unsigned int *reset_reg;\nextern volatile struct sun4m_timer_regs *counter_regs;\n\nvoid ob_new_obio_device(const char *name, const char *type);\nunsigned long ob_reg(uint64_t base, uint64_t offset, unsigned long size, int map);\nvoid ob_intr(int intr);\n\n/* arch/sparc32/boot.c */\nextern uint32_t kernel_image;\nextern uint32_t kernel_size;\nextern uint32_t qemu_cmdline;\nextern uint32_t cmdline_size;\nextern char boot_device;\n#endif\n#ifdef CONFIG_DRIVER_FLOPPY\nint ob_floppy_init(const char *path, const char *dev_name,\n unsigned long io_base, unsigned long mmio_base);\n#endif\n#ifdef CONFIG_DRIVER_PC_KBD\nvoid ob_pc_kbd_init(const char *path, const char *dev_name, uint64_t base,\n uint64_t offset, int intr);\nint pc_kbd_dataready(void);\nunsigned char pc_kbd_readdata(void);\n#endif\n#ifdef CONFIG_DRIVER_PC_SERIAL\nvoid ob_pc_serial_init(const char *path, const char *dev_name, uint64_t base,\n uint64_t offset, int intr);\nint uart_init(int port, unsigned long speed);\nint uart_charav(int port);\nchar uart_getchar(int port);\nvoid serial_putchar(int c);\n#endif\n#ifdef CONFIG_DRIVER_ESCC\nint uart_init(phys_addr_t port, unsigned long speed);\nint uart_charav(uintptr_t port);\nchar uart_getchar(uintptr_t port);\nvoid serial_putchar(int c);\nvoid serial_cls(void);\n#ifdef CONFIG_DRIVER_ESCC_SUN\nint keyboard_dataready(void);\nunsigned char keyboard_readdata(void);\n#endif\n#endif\n\n/* drivers/timer.c */\nvoid setup_timers(void);\n\n#endif /* OPENBIOS_DRIVERS_H */\n" ]

{ "pile_set_name": "Github" }

[ 0.0022355150431394577 ]

[ "Liz Essley Whyte\n\nCenter for Public Integrity\n\nNote: This story was produced as part of the COPY, PASTE, LEGISLATE series, which is a partnership between USA TODAY, the Arizona Republic and the Center for Public Integrity.", "\n\nThe front lines in a bitter debate between Israel’s defenders and critics lie in an unexpected place: state capitals across America.", "\n\nPalestinian rights activists calling for people to boycott, divest from and sanction Israel have racked up policy victories over the past 14 years across the globe and in the USA, particularly on university campuses.", "\n\nIn response, pro-Israel advocates have taken the battle to state legislatures, where their lobbyists worked with sympathetic lawmakers to shut down an effort they said threatens the existence of a Jewish state.", "\n\nA rapid succession of states – 27 in four years – adopted measures to curb the initiative known as BDS.", "\n\nThese new laws and executive orders were crafted by activists, then copied from one state to the next and adopted with virtually identical language. ", "Most require tens of thousands of state contractors to pledge not to boycott Israel or lose their government funding. ", "Other efforts require state pension boards to divest from companies that boycott Israel.", "\n\nAs part of a two-year investigation into copycat legislation in state capitols, the Center for Public Integrity and USA TODAY examined dozens of anti-boycott bills and executive orders, then traced the communication between pro-Israel lobbyists and lawmakers who supported their efforts.", "\n\nThe broader investigation, “Copy, Paste, Legislate,” shows for the first time how governors and lawmakers across the country allowed a handful of private advocacy groups to write public policy word for word.", "\n\nCopy. ", "Paste. ", "Legislate:You elected them to write new laws. ", "They’re letting corporations do it instead.", "\n\nInvestigation:Used car dealers didn’t want to fix deadly defects, so they wrote a law to avoid it\n\nList:Stand your ground, right to work and bathroom bills: 5 model bills that spark controversy\n\nInteractive:How model bills are written\n\nWhat is ALEC?:'The most effective organization' for conservatives, says Newt Gingrich\n\nIn Louisiana, emails obtained by the center show that a lobbyist for a Jewish Federation wrote the governor’s anti-boycott executive order and news release.", "\n\nIn Nevada, a pro-Israel lobbyist guided the legislation’s sponsor with detailed and frequent feedback, in one case reviewing and approving statements by a lawmaker who planned to support the bill.", "\n\nIn South Carolina, state Rep. Alan Clemmons called an activist supporting the anti-boycott legislation Clemmons sponsored his “buddy and wordsmith-in-chief.”", "\n\nA network of pro-Israel Jewish and evangelical Christian advocacy groups have quietly but forcefully pushed the anti-boycott legislation, marketing it as a solution to address a growing trend of anti-Semitic incidents. ", "Among the leaders are well-known organizations such as the Jewish Federations of North America as well as smaller groups such as the Israeli-American Coalition for Action.", "\n\nThe groups pushing the bills build on goodwill generated from years of courting state officials with – sometimes free – trips to Israel. ", "The Israeli government then writes to thank state officials instrumental in passing the measures.", "\n\nPro-Israel groups urge states to enforce the new divestment laws against specific companies, such as Danske Bank and Airbnb, which angered pro-Israel advocates last year when it announced it would remove Israeli rental listings on the West Bank. ", "The groups push for passage of measures to undermine pro-Palestinian activism on college campuses.", "\n\nSome anti-boycott activists said they took the debate to state legislatures in part to find friendlier waters than universities. “", "You don’t want to fight on your enemy’s terrain,” Noah Pollak said in 2016. “", "While you were doing your campus antics, the grown-ups were in the state legislatures passing laws that make your cause improbable.”", "\n\nThe anti-boycott measures are a largely successful effort to embed controversial foreign policy into state law, short-circuiting public discourse about Israel, to the detriment, some say, of Americans who would like to do business with their states but also hold deep convictions about Palestinian rights.", "\n\nThe American Civil Liberties Union and Council on American-Islamic Relations spearheaded a slew of lawsuits over the demands for contractors to disavow Israel boycotts. ", "Among the plaintiffs: a Texas speech pathologist who decided she could not work a 10th year at her suburban school district, a former Maryland state legislator who lost out on a $50,000 state contract and an Arizona lawyer who had to choose between advising state prison inmates and a newfound zeal to promote his cause overseas.", "\n\nBackers say the anti-boycott laws fit with the United States’ long-standing alliance with Israel and clamp down on discrimination against Israelis. ", "Attacks on Jews jumped by 37% in 2017, according to the FBI, and they’ve since grown more deadly. ", "In October 2018, a gunman killed 11 people at Pittsburgh’s Tree of Life synagogue.", "\n\n“The BDS movement is an anti-Semitic movement. ", "It discriminates against no one on the planet other than Jews,” said Peggy Shapiro, executive director of the Midwest chapter of StandWithUs, which has advocated for anti-boycott laws. “", "It’s important for governors and legislatures to speak up and say this is not something our states will invest in.”", "\n\nThe U.S. Senate in February passed federal legislation championed by Sen. Marco Rubio, R-Fla., that would protect the state laws from legal challenges, though it appears unlikely to pass the House.", "\n\nSupporters of the international BDS movement argue Israel’s treatment of Palestinians amounts to an inhumane form of apartheid. ", "They say the anti-boycott state laws help insulate Israel from legitimate criticism.", "\n\n“They’re attacking individuals’ and even companies’ and nonprofits’ ability to engage on this issue through First-Amendment-protected activities,” said Dima Khalidi, director of Palestine Legal, a group that provides legal support to Palestinian rights advocates. “", "This movement is about human rights.”", "\n\nIt’s a high-stakes, emotional discussion. ", "The anti-BDS lobbying campaign pits Holocaust survivors and their memories of 1930s German boycotts of Jewish goods against activists who, seeing similarities between Israel’s treatment of Palestinians and the Jim Crow South, hope to usher in an era of equality for Palestinians.", "\n\nThe anti-boycott movement in the states has frustrated some American Jews, who in surveys support Israel yet criticize some of its policies.", "\n\n“Boycotts are a tactic. ", "It’s a neutral tactic,” said Rabbi Jill Jacobs, executive director of T’ruah, a Jewish human rights group that supports neither BDS nor anti-BDS laws. “", "The best way to protect Israel is to fight for the human rights of both Israelis and Palestinians there and not to argue about the tactics.”", "\n\nThe start of a movement\n\nIllinois and South Carolina were the first states to pass anti-boycott measures in 2015, and many of the bills that followed shared their exact wording, from Arizona to Rhode Island and more states in between.", "\n\nIn Nevada, Lt. ", "Gov. Mark Hutchison worked closely with a pro-Israel lobbyist, Dillon Hosier, to craft and pass the bill modeled from Arizona’s law, according to emails obtained by the Center for Public Integrity.", "\n\n“I don’t think there’s a First Amendment right to have the government do business with you,” Hutchison said in an interview.", "\n\nHutchison has traveled to the Middle East at least twice, including on a $15,000 trip in 2013 paid for by the American Israel Education Foundation, an affiliated charity of the American Israel Public Affairs Committee, a pro-Israel lobbying group. ", "Israel is a common destination for state officials, including other anti-boycott bill sponsors. ", "At least 21 of the 50 sitting governors have visited or planned to visit the country at least once, according to a Center for Public Integrity analysis of news reports.", "\n\nAn assemblywoman supporting the Nevada bill asked for the lieutenant governor’s thoughts on her planned testimony. ", "His office forwarded the testimony to Hosier.", "\n\n“Hits all the right notes,” the lobbyist replied.", "\n\nHosier worked for the Israeli-American Coalition for Action, a Los Angeles-based advocacy group that works to strengthen U.S.-Israeli ties. ", "A board member of the group, Adam Milstein, said in a speech in 2017 that his organization was “spearheading” efforts to combat BDS at the state and federal level, taking credit for passing legislation in California and working to pass it in five other states, according to prepared remarks. ", "The charitable group that created the IAC for Action, called the Israeli American Council, has received more than $60 million in donations from GOP mega-donors Sheldon and Miriam Adelson.", "\n\nAnti-boycott legislation has been a team effort, Hosier told the Center for Public Integrity, saying there was “a core group of organizations that attempted to drive it across the country.”", "\n\nRepublican state Rep. Clemmons sponsored the first anti-boycott law dealing with contractors in South Carolina in 2015. ", "He said a trip to Israel, paid for with election campaign funds, inspired the legislation and he received help from multiple groups, including the D.C.-based Israel Allies Foundation.", "\n\n“We’ve not been a big financial player. ", "It’s just really coordinating the different groups to work together,” said Daniel Williams, a former executive director of the foundation. “", "And the person that has been driving that is Joe Sabag.”", "\n\nIn 2017, Clemmons, in an email obtained by the Center for Public Integrity, called the foundation’s Sabag his “buddy and wordsmith-in-chief.” ", "Sabag, formerly the foundation’s U.S. director who has moved to the IAC for Action, said he often helps legislators who ask for his expertise.", "\n\nGeorge Mason University law professor Eugene Kontorovich helped draft the bill and went on to assist other states with their anti-boycott measures and frequently defends the laws’ constitutionality in the news media.", "\n\n“One man’s boycott is another man’s discrimination,” Kontorovich said.", "\n\nIn 2015, Illinois passed a bill forcing state investment funds to divest from companies boycotting Israel, aided by the American Jewish Committee and a local Jewish Federation, according to emails obtained by the Center for Public Integrity.", "\n\nThe Israel Allies Foundation announced it was combining the South Carolina and Illinois bills into “one piece of model legislation.” ", "Clemmons said he urged lawmakers in other states to copy his bill.", "\n\nHosier, who left IAC for Action to help start a new Israeli American advocacy organization, criticized some of the model anti-boycott legislation. ", "At least five states passed laws mimicking South Carolina’s prohibition on Israel-boycotting contractors, which he said is unconstitutional.", "\n\nIn Louisiana, Democratic Gov. John Bel Edwards did not write his anti-boycott executive order nor the news release accompanying it. ", "Both drafts were sent to him by Mithun Kamath, a pro-Israel advocate for the Jewish Federation of Greater New Orleans. ", "In an email obtained in a public records request by the Center for Public Integrity, Kamath said that the draft executive order was reviewed by AIPAC and Israel Action Network, a group founded by the Jewish Federations of North America to “counter delegitimization” of Israel.", "\n\nThe final executive order and news release were nearly word-for-word what the federation had delivered.", "\n\nThe federation hired powerful Louisiana lobbyist Ryan Haynie, who emailed a pro-Israel speech drafted for the governor, though it’s unclear whether Edwards used it.", "\n\n“No pride of authorship just want to help jumpstart the process for you guys,” Haynie wrote to the governor’s office. ", "Haynie and his mega-lobbyist father, Randy, are fixtures in Louisiana politics and have represented everyone from tech titan Apple to tobacco giant Altria.", "\n\nA spokesperson for the governor, Shauna Sanford, said it is common for interest groups to supply the governor with talking points and said about the speech that “there's no way to know what remarks were delivered” since the event was private.", "\n\nThe Jewish Federation of Greater New Orleans, AIPAC and the Israel Action Network did not respond to requests for comment.", "\n\nCampus vs. Capitol\n\nThe anti-boycott efforts have built on groundwork laid by pro-Israel lobbyists a decade ago, when at least 17 states passed legislation saying their pension funds would divest from any companies that did business with Iran.", "\n\nThe new push for legislation at the state level has followed years of campus activism by Palestinian rights advocates, who hope to replicate the boycott movement that helped end South Africa’s apartheid in 1994. ", "They argue Israel persecutes Palestinians, controlling their movements on the West Bank and overlooking their abuse by soldiers, among other concerns. (", "Israel’s supporters deny those claims.)", "\n\nBDS activists take credit for convincing student governments at more than 60 American universities – New York University, the University of Minnesota and the University of South Florida among them – to take up the Palestinian cause by urging their schools to cut ties with companies “complicit in Israeli violations of Palestinian human rights.”", "\n\nThey have persuaded cities such as Berkeley, California, to divest from companies such as G4S, which was accused by BDS activists of providing services to Israeli prisons where Palestinians are allegedly tortured. (", "G4S said it sold its business in Israel in 2017, that it did not manage the prisons and that independent reviews have found the company did not contribute to human rights violations.)", "\n\nThey’ve pushed mainline Protestant denominations such as the United Methodist Church to boycott products made in West Bank settlements. ", "And they have encouraged American celebrities to “#skipthetrip” when offered free tours of Israel.", "\n\nThe movement has had more success in Europe, where the European Union requires goods made in Israeli settlements to be labeled as such.", "\n\nMany of those harmed by state anti-boycott laws practice relatively quiet expressions of BDS activism, such as a Texas poet who boycotts Sabra hummus, partially owned by an Israeli company, or a Mennonite teacher who refuses to buy products from companies operating in Israeli settlements.", "\n\nOmar Barghouti, a Qatar-born Palestinian resident of Israel and co-founder of the BDS movement, predicted that the statehouse countermovement will backfire and actually strengthen BDS in the USA.", "\n\nIsrael's “attempts to muzzle free speech and undermine the U.S. Constitution are decisively and perhaps irreversibly alienating the liberal mainstream, including younger Jewish-Americans,” Barghouti told the Center for Public Integrity in an email.", "\n\nIsraeli approval\n\nThe Israeli government congratulated states that passed anti-boycott laws, emails obtained by the Center for Public Integrity show.", "\n\n“As Israel’s Minister of Strategic Affairs, I have been entrusted with leading the Israeli government’s efforts to counter the discriminatory and anti-Semitic boycott campaign,” Israeli Minister of Information Gilad Erdan wrote to Ohio Gov. John Kasich in December 2016 after an anti-boycott bill became law. “", "I sincerely appreciate your contribution.”", "\n\nIn 2015, Israel’s consul general for the Midwest wrote to Illinois Gov. Bruce Rauner’s then-chief of staff who helped pass that state’s anti-boycott bill: “Great job, as always.”", "\n\nDuring a signing ceremony for Kentucky’s anti-boycott executive order in November, Gov. Matt Bevin said that on his trip to Israel earlier in the year, Prime Minister Benjamin Netanyahu personally asked him to work on the issue, according to a report by Louisville’s WFPL radio station.", "\n\nWhat’s next?", "\n\nPension fund administrators in some states have opposed anti-boycott bills, concerned about politics muddying their fiduciary duties.", "\n\n“We believe that these assets are held in trust and belong to the participants of the plan and that they should not be used for ulterior motives, including social purposes,” said Keith Brainard, research director of the National Association of State Retirement Administrators, whose members oversee more than two-thirds of the $4.4 trillion held for nearly 25 million current or retired employees of state and local government.", "\n\nMost states that passed the anti-boycott pension measures came up with only a handful of companies to divest from, but state pension funds still feel the anti-boycott pressure.", "\n\nMilstein, the Israeli-American Coalition for Action board member, urged Florida and Indiana to divest from certain companies and provided them with research on companies that boycott Israel, according to emails obtained by the Center for Public Integrity. ", "IAC for Action took credit for New Jersey dropping its investments in Danish lender Danske Bank in 2017.", "\n\nA spokesman for Danske Bank said the bank does not boycott Israel, but its responsible investment policy prompted it to cut ties with many companies, including two in Israel.", "\n\nLast year, pro-Israel groups unsuccessfully pushed Florida to cancel singer Lorde’s concerts after she canceled a show in Israel, and they successfully lobbied state officials to punish short-term rental website Airbnb for deciding to remove listings in Israeli West Bank settlements (a decision the company reversed).", "\n\nLorde did not respond for comment. ", "A spokesman for Airbnb said it opposes the BDS movement.", "\n\nMore bills to fight the BDS movement may be on the horizon. ", "A pro-Israel Christian evangelical group based in Tennessee, Proclaiming Justice to the Nations, plans to lobby states to define anti-Semitism to include criticisms of Israel that apply “double standards by requiring of it a behavior not expected or demanded of any other democratic nation.” ", "The broad definition, which originated from the U.S. State Department’s “working definition” of anti-Semitism adopted in 2010, could force state universities to treat BDS activism as anti-Semitic.", "\n\n“That’s one of our goals is to shut down these groups that parade themselves as legitimate clubs on college campuses,” said the Tennessee group’s leader, Laurie Cardoza-Moore.", "\n\nLast year, South Carolina became the first state to adopt the broad anti-Semitism definition by including it in a plank of its budget that is valid for one year. ", "Emails requested by the Center for Public Integrity show that Sabag and Clemmons again teamed up to urge lawmakers to adopt the definition.", "\n\nProclaiming Justice to the Nations planned bills in Florida, Ohio and Tennessee this year. ", "The Tennessee bill has been introduced; the Florida bill has passed the legislature and awaits the governor's signature.", "\n\n“The attorneys are still working on it,” Cardoza-Moore said of the new model legislation in December. “", "Each state will be slightly different … each draft will be specific to the state legislature that’s introducing it.”", "\n\n—\n\nContributing: Pratheek Rebala\n\nThis story is from The Center for Public Integrity, a nonprofit, nonpartisan investigative media organization in Washington, D.C. Read more of its investigations on the influence of money in politics or follow it on Twitter." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006339236279018223, 0.0008023687405511737, 0.0008794239256531, 0.004479283466935158, 0.0006128907552920282, 0.0006107894005253911, 0.0010520752985030413, 0.002483764896169305, 0.0005990692297928035, 0.0005675044376403093, 0.0007733941311016679, 0.004310349468141794, 0.0010306643089279532, 0.0008722166530787945, 0.0008395567419938743, 0.0005880147218704224, 0.0007753185927867889, 0.0008860442321747541, 0.0005911936750635505, 0.0005820830701850355, 0.0005331740248948336, 0.0007283800514414907, 0.0006919960724189878, 0.0006560910260304809, 0.016978854313492775, 0.02265697717666626, 0.0007249583140946925, 0.0009810905903577805, 0.0007112794555723667, 0.022508947178721428, 0.050148770213127136, 0.0018865176243707538, 0.010051173157989979, 0.031459689140319824, 0.0005185520276427269, 0.0006703214603476226, 0.00771396653726697, 0.001164526678621769, 0.0010978521313518286, 0.0006856883992440999, 0.0008015155326575041, 0.007477359846234322, 0.00926188938319683, 0.003731280332431197, 0.0015942961908876896, 0.0012638182379305363, 0.0006121860351413488, 0.0016229995526373386, 0.0006295527564361691, 0.0008527794852852821, 0.0005925543373450637, 0.0007465356611646712, 0.0005529443733394146, 0.0006168301915749907, 0.0006461155135184526, 0.000633584801107645, 0.0006386102177202702, 0.0005692488048225641, 0.0005869438173249364, 0.0006095471908338368, 0.0008247276418842375, 0.0005988545017316937, 0.0007793782860971987, 0.0005564610473811626, 0.001182484207674861, 0.0011874993797391653, 0.0005232470575720072, 0.0006607021787203848, 0.0031907353550195694, 0.0007791626267135143, 0.0006489770021289587, 0.0006573237478733063, 0.0007489238050766289, 0.001459664199501276, 0.0007110527949407697, 0.0008016068022698164, 0.0006223563104867935, 0.0005576233379542828, 0.0006766029982827604, 0.00192917266394943, 0.0008111540810205042, 0.0005645568598993123, 0.0011144536547362804, 0.0006088666268624365, 0.0006129628163762391, 0.004064159467816353, 0.0009130207472480834, 0.0008770298445597291, 0.0014185274485498667, 0.0005974076921120286, 0.0008651521056890488, 0.0007908616680651903, 0.0005514167714864016, 0.000776750675868243, 0.0007736672996543348, 0.0014568911865353584, 0.0006681465893052518, 0.0006923921755515039, 0.0005266399239189923, 0.0006547300145030022, 0.0005850722081959248, 0.0008947924943640828, 0.0008476359653286636, 0.0006020594155415893, 0.0007163201225921512, 0.0006507455254904926, 0.0006545768119394779, 0.0006394601659849286, 0.0006544998032040894, 0.0009131408296525478, 0.0007961398805491626, 0.0009079380542971194, 0.0008748506661504507, 0.0011754777515307069, 0.010283316485583782, 0.0008084151777438819, 0.0006153956055641174, 0.0006103432970121503, 0.0005778248887509108, 0.0005727261304855347, 0.000560881569981575, 0.0005761862266808748 ]

[ "Vulnerability Description:\n\nThe GLX indirect rendering support supplied on NVIDIA products is subject to the recently disclosed X.Org vulnerabilities (CVE-2014-8093, CVE-2014-8098) as well as internally identified vulnerabilities (CVE-2014-8298).", "\n\nExploit Scope and Risk:\n\nDepending on how it is configured, the X server typically runs with raised privileges, and listens for GLX indirect rendering protocol requests from a local socket and potentially a TCP/IP port. ", "The vulnerabilities could be exploited in a way that causes the X server to access uninitialized memory or overwrite arbitrary memory in the X server process. ", "This can cause a denial of service (e.g., an X server segmentation fault), or could be exploited to achieve arbitrary code execution.", "\n\nThe CVSS Risk assessment is listed below.", "\n\nCVSS Base Score - 8.3\n\nExploitability sub-score - 6.5\n\nAccess Vector: Adjacent Network\n\nAccess Complexity: Low\n\nAuthentication: None\n\nImpact sub-score - 10.0\n\nConfidentiality Impact: Complete\n\nIntegrity Impact: Complete\n\nAvailability Impact: Complete\n\nCVSS temporal sub-score - 3.5\n\nExploitability: Unproven that Exploit Exists\n\nRemediation Level: Workaround\n\nReport Confidence: Confirmed\n\nCVSS Environmental Score - [determined by user]\n\nNVIDIA's risk assessment is based on an average of risk across a diverse set of installed systems and may not represent the true risk of your local installation. ", "We recommended consulting a local security or IT professional to evaluate the risk of your specific configuration. ", "NVIDIA knows of no known exploits to these issues at this time.", "\n\nVulnerable Configurations:\n\nThe NVIDIA implementation of GLX indirect rendering is only used in the NVIDIA GPU drivers for Solaris, FreeBSD, VMware ESX, and other Linux based operating systems where an X server is in use. ", "NVIDIA GPU drivers for other operating systems are not affected.", "\n\nVulnerability Discovery:\n\nNVIDIA was informed of this issue by public advisement from X.Org participants on Oct 9, 2014, by Adam Jackson and Alan Coopersmith. ", "Internal analysis and additional issues refined by Robert Morell of NVIDIA.", "\n\nFix:\n\nNVIDIA recommends that users upgrade their drivers. ", "Refer to the table below for recommended driver updates and locations.", "\n\nDriver Scheduled Support Date Linux Discrete GPU Drivers Driver Download Releases prior to 304 Has reached 'end of life' and no longer supported. ", "R304.125 and better R304.125 available as of 12/9 R331.113 and better R331.113 available as of 12/9 R340.65 and better R340.65 available as of 12/9 R343.36 and better R343.36 available as of 12/9 R346.22 and better R346.22 Beta available as of 12/9 Linux for Tegra (L4T) Products Linux for Tegra Download R19.x No fix planned-update to R21.2 R21.1 No fix planned - update to R21.2 R21.2 Release planned for 12/9/2014 Chrome OS R40 or better Contact Google support for release information CUDA Toolkit SDK CUDA Toolkit SDK Download To patch the CUDA Toolkit SDK 6.0 and 6.5 installation, install the updated drivers with the security patch from Release 331 and Release 340\n\n\n\nFor CUDA 5.5, Release 319 is no longer supported, however all toolkits are compatible with later drivers. ", "Customers should install the patch from Release 331 or 340 CUDA 5.5 R331.113 or R340.65, available as of 12/9 CUDA 6.0 R331.113 available as of 12/9 CUDA 6.5 R340.65 available as of 12/9\n\nMitigations:\n\nYou may consider either of the following steps to help further mitigate against GLX protocol vulnerabilities:" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006450781947933137, 0.0006139082252047956, 0.0009511712123639882, 0.0008816628833301365, 0.0005875922506675124, 0.0005890271277166903, 0.0005161908338777721, 0.0006713434122502804, 0.0006827044999226928, 0.0006673841271549463, 0.0005507153109647334, 0.0005885689752176404, 0.0006774337380193174, 0.0005288475076667964, 0.0006829423946328461, 0.0008065488655120134, 0.0008327160030603409 ]

[ "Effects of cisplatin on lymphocyte structure and functions in mice with ehrlich ascitic carcinoma.", "\nThe effects of cisplatin on [Ca2+]in, pHin, NAD(P)H level, and lymphocyte membrane microviscosity were studied in mice with Ehrlich ascitic carcinoma. ", "The level of free [Ca2+]in in lymphocytes from mice with Ehrlich ascitic carcinoma was 4-fold reduced compared to that in intact animals on day 13 of tumor development, while [H+]in level was elevated. ", "Cisplatin caused no changes in the level of free Ca2+, but reduced cytosol acidification. ", "Lymphocyte membrane fluidity in mice with tumors was increased in the lipid bilayer and in the protein-lipid contact zone and did not depend on cisplatin treatment. ", "The level of NAD(P)H was low in mice with tumors, but increased sharply after cisplatin treatment. ", "It seems that functional activity of lymphocytes decreased at the stage of well-developed tumor, which promoted inhibition of the lymphocyte defense properties. ", "Cisplatin did not modify the structure and functions of lymphocytes and presumably even improved their energy status." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0037533913273364305, 0.0011135187232866883, 0.0011052933987230062, 0.0007781063904985785, 0.001169794355519116, 0.0006612378638237715, 0.0012287497520446777, 0.0006995911826379597 ]

[ "---\nabstract: 'Perelman has given a gradient formulation for the Ricci flow, introducing an “entropy function” which increases monotonically along the flow. ", "We pursue a thermodynamic analogy and apply Ricci flow ideas to general relativity. ", "We investigate whether Perelman’s entropy is related to (Bekenstein-Hawking) geometric entropy as familiar from black hole thermodynamics. ", "From a study of the fixed points of the flow we conclude that Perelman entropy is not connected to geometric entropy. ", "However, we notice that there is a very similar flow which [*does*]{} appear to be connected to geometric entropy. ", "The new flow may find applications in black hole physics suggesting for instance, new approaches to the Penrose inequality.'", "\nauthor:\n- Joseph Samuel and Sutirtha Roy Chowdhury\ntitle: Geometric Flows and Black Hole Entropy\n---\n\nIntroduction\n============\n\nThe Ricci flow [@friedan; @hamilton; @perelman; @cao] is an evolution equation for Riemannian geometries that tends to smooth and homogenise them. ", "This flow is a (degenerate) parabolic differential equation, and is very similar to the heat equation. ", "This suggests a thermodynamic analogy in which evolution of a geometry along the Ricci flow is like the approach of a physical system to thermodynamic equilibrium. ", "In this paper, we pursue this analogy. ", "We view the Ricci flow from a thermodynamic perspective and apply Ricci flow techniques to isolated gravitating systems in general relativity (GR). ", "Our motivation is to better understand physical quantities like energy and entropy in GR.", "\n\nThis paper is organised as follows. ", "In section II, we briefly describe Perelman’s gradient formulation of the Ricci flow. ", "In section III, we motivate the application of these ideas to general relativity. ", "In section IV, we study fixed points of the Perelman flow and note that the Schwarzschild space is not a fixed point. ", "In section V, we describe a slight modification of the Perelman flow. ", "The fixed points of the new flow turn out to be initial data for the Schwarzschild black hole. ", "Section VI generalises the discussion to include AdS. Section VII is a concluding discussion.", "\n\nThe Ricci Flow and Perelman’s gradient formulation\n==================================================\n\nLet $(\\Sigma,h_{ab})$ be a Riemannian manifold. (", "$a,b$ run over 1,2,3. ", "We restrict our discussion to three dimensional manifolds.) ", "Given an initial metric $h_{ab}$, the Ricci flow describes an evolution equation, which evolves the metric according to its Ricci tensor. ", "The evolution parameter is $\\tau$ and the family of metrics on $\\Sigma$, $h_{ab}(\\tau)$ satisfies the Ricci flow equation $$\\frac{\\partial{h_{ab}}}{\\partial \\tau}=-2 R_{ab}\n\\label{ricci}$$ In the neighborhood of a point $p\\in \\Sigma$, we can introduce a Riemann normal co-ordinate system and then the form of (\\[ricci\\]) becomes parabolic ($\\nabla^2$ is the Laplacian in local co-ordinates) $$\\frac{\\partial{h_{ab}}}{\\partial \\tau}= \\nabla^2 h_{ab}\n\\label{heat}$$ and looks like a heat equation for the metric coefficients. ", "However, in a general coordinate system, the PDE (\\[ricci\\]) is a [ *degenerate*]{} parabolic equation, because of its diffeomorphism invariance.", "\n\nThe Ricci flow first appeared in physics in the renormalisation of $\\sigma$ models[@friedan]. ", "It was independently introduced in mathematics by Hamilton, who used the flow to understand the topology of three manifolds. ", "Recently, Perelman has spectacularly used Ricci flow techniques to solve the Poincare conjecture and it is widely believed that these techniques also solve Thurston’s geometrisation conjecture. ", "These mathematical applications use the Ricci flow to address questions of three dimensional topology. ", "While Perelman’s motivation was topological, the techniques he introduced are tools of geometry and analysis. ", "It seems reasonable to hope that these tools will also find physical applications in general relativity. ", "The present paper is a preliminary step in this direction. ", "We suggest that the flow may be useful in understanding elusive concepts like energy and entropy in general relativity. ", "Both of these quantities are well understood in special relativistic physics. ", "In GR[@wald], they take on a new global geometric interpretation, respectively the mass at infinity and the area of a horizon.", "\n\nFrom a physical point of view, the most striking property of the Ricci flow (which it shares with the heat equation) is its tendency to lose memory of initial conditions. ", "This is very similar to the approach of an isolated physical system to thermal equilibrium. ", "For instance, a thermally insulated circular copper wire of circumference $L$, which initially has a temperature distribution $T(x), (T(0)=T(L),T(x)>0)$ evolves according to the heat equation $$\\frac{\\partial T}{\\partial t}=\\frac{d^2 T}{dx^2}\n\\label{heat2}$$ (by choice of units, we set the diffusion constant to one) and tends to a constant, losing memory of the details of the intial distribution $T(x)$. The final state is characterised by a single number, the uniform final temperature $T_f$ and not an entire function $T(x)$. This “information loss” is very reminiscent of entropy increase and indeed, one can view the heat equation in this light. ", "Consider the functional $S[T(x)]=\\int_0^L dx a(T)$, where $a(T)=-T \\log{T}$. Using the heat equation (\\[heat2\\]), integrating by parts and dropping a divergence we see that $S[T(x)]$ is monotonic along the flow. ", "$\\frac{dS}{dt}=\\int dx a'(T){dT}/{dt}=\n\\int dx a'(T) {d^2T}/{dx^2}=-\\int dx a''(T) ({dT}/{dx})^2\\ge0$ The last inequality follows since $a(T)$ is a convex function $a''<0$.\n\nThe question we address here is: can we in some sense regard the Ricci flow as representing the increase of entropy and the approach of a gravitating system to its equilibrium maximum entropy state. ", "The question can be split into two parts. ", "1) Is there a functional of the metric which increases monotonically along the Ricci flow? ", "2) Does this functional physically represent geometric entropy?", "\n\nOne answer to the first question is provided by Zamolodchikov’s C theorem, proved in the context of two dimensional $\\sigma$ models. ", "This theorem formalises the intuition that renormalisation is an irreversible process. ", "The flow of coupling constants under renormalisation is such that a function $C(g_1,g_2...)$ of the coupling constants of the theory is monotonically increasing along the flow. ", "In $\\sigma$ models the role of the coupling constants is played by the metric on the target space and the $\\beta$ function is the Ricci tensor[@friedan]. ", "The C theorem guarantees that the RG flow is irrotational and does not have limit cycles. ", "However, the Zamolodchikov C theorem appears to be a very specific result: it applies only to two dimensional field theories and fails if the target space is noncompact. ", "This does not appear to be a general answer to the question we raised.", "\n\nAnother answer, which is more general and relevant to the present context is provided by Perelman’s gradient formulation of the Ricci flow. ", "We briefly describe this formulation. ", "Consider the Ricci flow, supplemented by a diffeomorphism ${\\cal L}_{\\xi}h_{ab}=D_a\\xi_b+D_b \\xi_a$ generated by a vector field $\\xi^a$, which is itself a gradient $\\xi_a=D_af$, where $f$ is a scalar function on $\\Sigma$. $$\\frac{dh_{ab}}{d\\tau}=-2 R_{ab}+2 D_a D_b f\n\\label{perelmanflow}$$ Perelman gave a gradient formulation for this flow by considering the following “entropy functional” which depends on the pair $(h_{ab},f)$, of tensor fields on $\\Sigma$. $${\\cal{F}_P}(h_{ab},f):=\\int_\\Sigma d^3x \\sqrt{h}\\, (\\exp{f})\\,[\\,R+(Df)^2] \n\\label{perelmanentropy}$$ (In this paper $f$ is reversed in sign from Perelman’s equations.) ", "There is a subtlety in the variation however: the degrees of freedom in the metric can be split up into a conformal factor and a conformal structure $[h_{ab}(x)]$, where the square brackets signify a conformal class. ", "In the variation of ${\\cal F_P}$, the conformal structure is freely varied, but the conformal factor is subject to the constraint that the “distorted volume” $\\sqrt{h}(\\exp{f})$ is held fixed. ", "Performing a variation $\\delta h_{ab}=\\frac{dh_{ab}}{d\\tau}\\delta \\tau$ and using the notation $\\frac{dh^{ab}}{d\\tau}=h^{ac} h^{bd}\n\\frac{dh_{cd}}{d\\tau}$, we find using a standard geometric identity for the variation of $R$, $$\\frac{dR}{d\\tau}=-R_{ab} \\frac{dh^{ab}}{d\\tau}+D_aD_b\\frac{dh^{ab}}{d\\tau}\n-D^2 (h_{ab}\\frac{dh^{ab}}{d\\tau})\n\\label{evolutionR}$$ and after dropping some divergences. ", "$$\\frac{d{\\cal F_P}}{d\\tau}=\n\\int_\\Sigma d^3x \\sqrt{h}\\, (\\exp{f})[-R_{ab}+D_aD_bf]\n\\frac{dh^{ab}}{d\\tau}\n\\label{ratew}$$\n\nThus $\\frac{dh_{ab}}{d\\tau}$ in (\\[perelmanflow\\]) is twice the gradient of ${\\cal F_P}$ subject to the constraint of perserving the distorted volume. ", "It follows that ${\\cal F_P}$ is non decreasing along the flow $$\\frac{d{\\cal F_P}}{d\\tau}\\ge 0.", "\n\\label{nondecreasing}$$ Hence the use of the word “entropy” for the Perelman functional. ", "The evolution equation for $f$ is not independent, but determined by the constraint on the distorted volume. ", "The reader is referred to Topping [@topping] for a detailed exposition of Perelman’s gradient formulation.", "\n\nIn his paper on “The entropy formula for the Ricci flow and its geometric application”, Perelman remarks (section 5.3): “The interplay between statistical physics and (pseudo) Riemannian geometry occurs in the subject of black hole thermodynamics developed by Hawking et al. ", "Unfortunately, this subject is beyond my understanding at the moment\". ", "Our objective here is to pursue this remark and see if there is any connection between Perelman entropy and the geometric entropy familiar from black hole thermodynamics. ", "This motivates our application of Ricci flow techniques to GR.", "\n\nApplication to general relativity\n=================================\n\nHow does one apply Perelman’s ideas to general relativity? ", "The Perelman flow is defined in the space of three dimensional Riemannian metrics, while GR deals with four dimensional Lorentzian ones. ", "A natural approach is to use spatial slices of four dimensional spacetimes in order to define the flow. ", "The induced metric on $\\Sigma$ is a three dimensional Riemannian metric. ", "In the initial value formulation of GR, one uses the induced metric on $\\Sigma$ and the extrinsic curvature of $\\Sigma$ as initial data for the spacetime. ", "In this paper we restrict attention to time symmetric initial data. ", "The extrinsic curvature then vanishes and we need to deal only with $(\\Sigma,h_{ab})$ . ", "Our idea is to apply the Ricci flow to the initial data $h_{ab}$. For time symmetric initial data, the dominant energy condition implies that the scalar curvature $R$ is positive. ", "The Ricci flow has the happy feature that it preserves the positivity of scalar curvature[@topping]. ", "Thus, it may be used to understand general statements about initial data that rely on such assumptions as positivity of curvature. ", "Examples of such statements are the positive energy theorem [@schoen; @witten; @woolgar] and the Penrose inequality[@penrose; @geroch; @jang; @huisken; @bray; @bray2]. ", "In all these examples Einstein’s equations do not play any direct role: they are replaced by energy conditions, which are geometric inequalities (for example, the positivity of scalar curvature).", "\n\nIn general relativity, energy and entropy are only well defined in situations where the space has an asymptotic region. ", "The total mass of an isolated system (the ADM mass) is defined using a fixed metric at infinity (either flat or AdS). ", "The Bekenstein-Hawking entropy of black holes uses the notion of an horizon and “escape to infinity”. ", "It is therefore clear that our $(\\Sigma,h_{ab})$ must be a non-compact space, unlike the compact situations considered by Perelman in the study of three dimensional topology. ", "Let us assume that $(\\Sigma,h_{ab})$ has just one end at infinity and that $h_{ab}$ tends to a fixed flat metric $\\delta_{ab}$ at infinity [@wald]. ", "Even in ordinary thermodynamics, entropy is only well defined in stationary (or quasistationary) situations. ", "Since we assumed for simplicity that we deal only with time symmetric situations, we can replace the word ‘stationary’ in the last sentence by static. ", "Correspondingly, in pursuing the thermodynamic analogy we will restrict our attention to static, four dimensional, Lorentzian, asymptotically flat space times, subject to an Energy condition.", "\n\nWe now address the second question: is the Perelman entropy related to geometric entropy, as familiar from black hole physics? ", "Perelman’s entropy is non-decreasing along the flow. ", "However, the property of being monotonic along a flow is a fairly generic one and there may be many functionals which have this property. ", "For instance, in black hole physics, the area theorem asserts that the area of a horizon can only increase with time. ", "But then the same is true for the square of the horizon area. ", "In the example of the copper wire above, replacing $a(T)=-T\\log{T}$ by any other convex function ($a''<0$) would also lead to a functional which monotonically non-decreasing along the flow. ", "Only the choice $a(T)=\\log{T}$ results in $S[T(x)]$ being proportional to the actual thermodynamic entropy of the wire. ", "While all these “entropy functionals” differ, they share one property in common: they are all maximized at the fixed point of the flow: the final state of uniform temperature.", "\n\nRather than look at the entropy function, it is more effective to look at the fixed points of the Perelman flow and ask if these correspond to maximum entropy in the physical sense. ", "This motivates a study of the fixed points of the Perelman flow. ", "These fixed points are referred to as ‘Ricci solitons’.", "\n\nThe stationary spacetime which maximises its geometric entropy for a fixed energy[@sorkin],is the static, spherically symmetric Schwarzschild black hole[@footnote1]. ", "Black holes have enormously more entropy than a star of the same mass (some $10^{20}$ times more for a solar mass). ", "If Perelman’s entropy were related to geometric entropy, we would expect the Schwarzschild space to be a fixed point of the Perelman flow. ", "This expectation can be tested by a direct calculation which is presented in the next section.", "\n\nRicci Solitons: Fixed Points of the Perelman flow:\n==================================================\n\nThe end points of the Perelman flow are called Ricci solitons and are characterised by a vanishing of the RHS of (\\[perelmanflow\\]). ", "A Ricci soliton consists of a pair $(h_{ab},f)$ subject to the equations: $$R_{ab}=D_aD_b f\n\\label{fixedpoint}$$ We wish to check if the Schwarzschild space solves these equations for [*some*]{} choice of $f$. We can assume the spherically symmetric form $$ds^2=a(r)dr^2+r^2(d\\theta^2+\\sin{\\theta}^2d\\phi^2)\n\\label{spherical}$$ for $h_{ab}$ and suppose that $f$ depends only on $r$. In order to preserve this gauge (\\[spherical\\]) we will need to supplement the RHS of (\\[fixedpoint\\]) with an additional diffeomorphism generated by a radial vector field $U(r)\\frac{\\partial}{\\partial r}$. Since this vector field is obviously a gradient of a scalar function, we can absorb it in a redefinition of $f$.\n\nThe independent fixed point (\\[fixedpoint\\]) equations are $D^2f=R$ and $R_{\\theta \n\\theta}=(DDf)_{\\theta \n\\theta}$. These are two equations for the pair $(a(r),f(r))$. We can use the second of these equations to eliminate $f(r)$ in favour of $a(r)$ and arrive at the autonomous differential equation for $a(r)$. $$\\frac{d^2 a}{d r^2}=\\frac{3(a')^2}{2a}+\\frac{2a^2-2a+ra'(1-a)}{r^2}\n\\label{ode}$$ It is easily seen that (apart from the trivial case $M=0$) the Schwarzschild space, which has $a(r)=(1-2M/r)^{-1}$ does not satisfy (\\[ode\\]). ", "Thus Schwarzschild is [*not*]{} a fixed point of the flow [*no matter what choice is made for $f$*]{}. ", "This shows that fixed points of the Perelman flow do not maximise geometric entropy as familiar from black hole physics. ", "Flowing the Schwarzschild space using the Perelman flow would lead to a [*further*]{} increase of Perelman’s entropy. ", "We conclude that Perelman’s entropy function is not connected to Bekenstein-Hawking entropy. ", "However, as we argued earlier, many aspects of the Ricci flow are strongly reminiscent of thermodynamics. ", "Are there other similar flows in the space of metrics which do describe the thermodynamics of geometry? ", "This question is addressed in the next section.", "\n\nThe Modified Ricci flow and its fixed point\n===========================================\n\nLet us consider how one can modify the Ricci flow to make connections with black hole entropy. ", "We would like to have a geometric differential equation, ([*i.e*]{} one constructed from tensor fields) of a parabolic nature similar to the forward heat equation. ", "The right hand side must contain no more than second derivatives of the basic fields $(h_{ab},f)$. Choosing the simplest possibility consistent with these requirements, we define the modified Ricci flow (MRF) by the equation $$\\frac{\\partial h_{ab}}{\\partial \\tau}=-2fR_{ab}+2D_aD_b f\n\\label{newflow}$$ This differs from Perelman’s flow (\\[perelmanflow\\]) only in the presence of $f$ in the first term. ", "$f$ can be interpreted as an effective space dependent diffusion constant. ", "It describes a forward type heat equation only in regions where $f$ is positive and bounded away from zero. ", "In these regions we would expect the flow to have the same behaviour as Perelman’s flow, smoothing out inhomogeneities and losing memory of initial conditions. ", "Let us supplement the Ricci flow with a forward type evolution equation for $f$: $$\\frac{\\partial f}{\\partial \\tau}=D^2 f.\n\\label{modf}$$ The pair $(h_{ab},f)$ evolved according to (\\[newflow\\],\\[modf\\]) constitute the modified Ricci flow [@footnote]. ", "Does the MRF have any connection with geometric entropy?", "\n\nAs we mentioned before, the most efficient way to investigate this question is to study the fixed points of the flow, characterised by $$fR_{ab}=D_aD_b f\n\\label{newfixed}$$ where $f$ satisfies $$D^2 f=0\n\\label{ffixed}$$\n\nIt is easily seen that with $$f=(1-2M/r)^{1/2},\n\\label{schwarzf}$$ the Schwarzschild exterior space $$ds^2=(1-2M/r)^{-1}dr^2+ r^2(d\\theta^2+\\sin{\\theta}^2d\\phi^2)\n\\label{schwarzschild}$$ ($r>2M$) is a fixed point of the MRF. ", "This is the second main observation we make in this paper. ", "The modified Ricci flow does seem to have some connection with geometric entropy: its fixed points are extrema of the Bekenstein-Hawking entropy. ", "Note that the function $f$ is positive in the Schwarzschild exterior and that it degenerates to zero on the inner boundary $r=2M$. The form of $f$ motivates the identification of the pair $(h_{ab},f)$ with the static spacetime $$ds^2=-f(x)^2dt^2+h_{ab} dx^a dx^b\n\\label{static}$$ This gives a Lorentzian spacetime interpretation of $f$ as the lapse function or the redshift factor.", "\n\nGeneralisation to AdS\n=====================\n\nFor the compact spatial topologies studied by Perelman, there was room to modify the RHS of the Ricci flow by the addition of a “cosmological constant” $\\lambda h_{ab}$. This led to the possibility of additional Ricci solitons, shrinking and expanding breathers. ", "In the last two sections, we required that our metric $h_{ab}$ tend to a [*fixed flat*]{} metric at infinity and so $\\lambda$ had to vanish to preserve the asymptotic conditions. ", "It is interesting to ask what happens if we replace asymptotic flatness by asymptotically AdS. The arguments of the last two sections go through with appropriate slight modifications. ", "In the equations (\\[perelmanflow\\],\\[fixedpoint\\]), one simply replaces the Ricci tensor $R_{ab}$ by $R_{ab}-\\lambda h_{ab}$, where $\\lambda$ is a negative cosmological constant. ", "Correspondingly, (\\[ode\\]) acquires an extra term $\\lambda raa'$ on the right hand side. ", "As before we see that the AdS Schwarzschild space, which has $a(r)=(1-2M/r-\\lambda r^2/3)^{-1}$ does not satisfy the soliton equation.", "\n\nHowever, we modify the flow to read $$\\frac{\\partial h_{ab}}{\\partial \\tau}=\n-2f(R_{ab}-lambda h_{ab})+2D_aD_b f\n\\label{newflowlam}$$ supplemented by an evolution equation for $f$: $$\\frac{\\partial f}{\\partial \\tau}=D^2 f+\\lambda f.\n\\label{modflam}$$ Then we find that the AdS Schwarzschild is indeed a Ricci Soliton of the modified flow with $f$ given by $f=(1-2M/r-\\lambda/3 r^2)^{1/2}$. Thus our main conclusions generalise easily to include AdS space.", "\n\nConclusion\n==========\n\nIn his paper[@perelman], Perelman remarks that the interplay between statistical physics and (Lorentzian) geometry occurs in the subject of black hole thermodynamics. ", "He appears to suggest possible connections between his entropy functional and black hole thermodynamics. ", "Perelman was working with compact Riemannian manifolds. ", "It seems clear that for a discussion of geometric entropy we need to have non-compact manifolds, so that we can define a region of no escape. ", "The main result of this paper is the observation that the Perelman entropy is [*not*]{} the geometric entropy, at least if one uses the natural identications we have made between initial data and spacetimes.", "\n\nAnother observation we make is that a small modification of Pereman’s flow does seem to relate to geometric entropy. ", "It would seem important to understand the properties of the new flow and possibly relate it to the Perelman flow. ", "For instance, What can one say about the long term behaviour of both flows starting with an arbitrary initial positive curvature metric in the asymptotically flat context. ", "How does one choose the initial $f$? ", "Does the MRF admit a gradient formulation? ", "We are presently studying both flows in the linear regime in the neighborhood of their Ricci solitons.", "\n\nSeveral papers have appeared [@oliynyk; @oliynyk2; @headrick; @bakas] in the physics literature about physical applications of the Ricci flow. ", "Many of them are motivated by the renormalisation group, string theory or conformal field theory. ", "Our motivation is from the viewpoint of classical general relativity. ", "In GR, there are a number of results of a purely differential geometric character which also have a strong thermodynamic flavour. ", "Examples abound in black hole physics, but let us mention two: the Penrose inequality and the Hawking area theorem. ", "These results do not appeal to Einstein’s equations but only to energy conditions. ", "The Ricci flow techniques of Perelman do seem to be a natural tool to attack such problems.", "\n\n[1]{}\n\nD. Friedan 1980 *Phys. ", "Rev. Lett.* **", "45**, 1057 R. S. Hamilton 1982 Three-manifolds with positive Ricci curvature *J. Differential Geom.* **", "17** 255-306 Grisha Perelman 2002 The entropy formula for the Ricci flow and its geometric applications *Preprint* math.", "DG/0211159 Huai-Dong Cao and Bennett Chow 1999 Recent developments on the Ricci flow *Bull. ", "Amer. ", "Math. ", "Soc.* ", "36 59-74 R.M. Wald 1984 General Relativity *University of Chicago Press* Peter Topping 2006 London Mathematical Society Lecture Notes Series *Cambridge University Press* Richard Schoen and Shing-Tung Yau 1979 Positivity of the Total Mass of a General Space-Time *Phys. ", "Rev. Lett.* **", "43** 1457-1459 Edward Witten 1981 A New Proof of the Positive Energy Theorem *Commun. ", "Math. ", "Phys.* ", "80 381-402 R.Penrose, R.D Sorkin and E.Woolgar A Positive Mass Theorem Based on the Focusing and Retardation of Null Geodesics 1993 *Preprint* gr-qc/9301015 Roger Penrose 1973 *Ann. ", "NY Acad. ", "of Science* 224 Robert Geroch 1973 *Ann. ", "NY Acad. ", "of Science* 225 P.S. Jang and R.M. Wald 1977 *J. Math. ", "Phys.* **", "18** 41 Gerhard Huisken and Tom Ilmanen 2001 *J. Differential Geom.* **", "59** 353-437 Hubert L.Bray 2003 *Preprint* math.", "DG/0304261, *Proceedings of the ICM, Beijing 2002* **2** 257-272 Hubert L.Bray 2001 J. Diff. ", "Geom. **", "59** 177-267 R.D. Sorkin and M. Varadarajan 1996 Class. ", "Quant. ", "Grav. **", "13** 1949 We are suppressing a subtlety here. ", "Quantum effects lead to black hole evaporation and a further increase of entropy. ", "This paper is concerned only with classical GR. ", "Ioannis Bakas 2005 textit[Comptes Rendus Physique]{} **6** 175-184, *Preprint* hep-th/0702034 T. Oliynyk, V. Suneeta and E. Woolgar 2006 *Nucl. ", "Phys.* [**", "B739**]{} 441 Matthew Headrick and Toby Wiseman, Class. ", "Quantum Grav. [**", "23**]{} (2006), 6683. ", "T. Oliynyk and E. Woolgar 2006 *Preprint* math-DG/0607438 The term “modified Ricci flow” is sometimes used in the mathematical literature to describe Ricci flow with surgery. ", "This is not to be confused with the flow described here.", "\n" ]

{ "pile_set_name": "ArXiv" }

[ 0.0007808647933416069, 0.000636373704764992, 0.0009260358056053519, 0.0007800262537784874, 0.0008763828664086759, 0.0005610965308733284, 0.0009277654462493956, 0.0007415454601868987, 0.0006869507487863302, 0.0005442342953756452, 0.0006152241257950664, 0.0006912723183631897, 0.0005651062238030136, 0.0006032044184394181, 0.0005816473858430982, 0.0006327215814962983, 0.0005679763271473348, 0.0008696582517586648, 0.0006727591389790177, 0.015924794599413872, 0.0015271897427737713, 0.0005661859177052975, 0.0006714928313158453, 0.001258875709027052, 0.0010315311374142766, 0.0007069227867759764, 0.0005536130629479885, 0.0007362629403360188, 0.0006265929550863802, 0.0006654546014033258, 0.0005490294424816966, 0.0005500217666849494, 0.000565641385037452, 0.0005897088558413088, 0.0005862460820935667, 0.0006616539321839809, 0.0005938949761912227, 0.0008588395430706441, 0.0010027450043708086, 0.0024007598403841257, 0.0006338725797832012, 0.0008766446844674647, 0.0010997132631018758, 0.0005868339212611318, 0.0006965389475226402, 0.0007026169332675636, 0.0007300259312614799, 0.0007140263332985342, 0.0006969057722017169, 0.0006285446579568088, 0.0006001138244755566, 0.0005336552276276052, 0.002580030355602503, 0.0006407577311620116, 0.0030453642830252647, 0.009633774869143963, 0.015078355558216572, 0.012969909235835075, 0.0015294681070372462, 0.0006380967097356915, 0.0005557060358114541, 0.0007269760826602578, 0.0006241746013984084, 0.000851621909532696, 0.0007645735749974847, 0.001678108237683773, 0.0007702102302573621, 0.0005694270948879421, 0.0008727192180231214, 0.0006215299945324659, 0.0005397311178967357, 0.000920422316994518, 0.000697426323313266, 0.0006058883154764771, 0.000575721263885498, 0.0007619968964718282, 0.0006041580345481634, 0.0006594156729988754, 0.000643234932795167, 0.0009195247548632324, 0.0006799597758799791, 0.0008705038344487548, 0.0008945589070208371, 0.0005859145894646645, 0.0006303825066424906, 0.000738181232009083, 0.002057868055999279, 0.000612690404523164, 0.0006366734160110354, 0.0006016813567839563, 0.0006871465011499822, 0.001129638752900064, 0.0006421164143830538, 0.0006875726394355297, 0.0006371830822899938, 0.0010900077177211642, 0.0008480896940454841, 0.00541928643360734, 0.0011332046706229448, 0.000544707290828228, 0.001969606149941683, 0.00569665152579546, 0.0022604246623814106, 0.0008379346108995378, 0.0010629765456542373, 0.0014093514764681458, 0.000640882586594671, 0.0007993965991772711, 0.0005613915272988379, 0.001386328600347042, 0.0006224823300726712, 0.0008505823207087815, 0.0007254621596075594, 0.0006538420566357672, 0.0006793292704969645, 0.001019582967273891, 0.004626153036952019, 0.0008670626557432115, 0.000583731452934444, 0.0008886313298717141, 0.0011175477411597967, 0.0007603082922287285, 0.0007386396173387766, 0.0006158414762467146, 0.0007736993720754981, 0.003825962543487549, 0.0008232354884967208, 0.0014872581232339144, 0.0007607456063851714, 0.0008643672335892916, 0.0008097639656625688, 0.000584173365496099, 0.0007236585952341557, 0.0006349058821797371, 0.0005344732780940831, 0.0005665794597007334, 0.015805073082447052, 0.0007670723716728389, 0.0005423772381618619, 0.000650151283480227, 0.00068087805993855, 0.0006055309786461294, 0.0006040380103513598, 0.0006182288634590805, 0.000619365950115025, 0.0008192151435650885, 0.0008471152395941317, 0.0016416547587141395, 0.0007018483011052012, 0.0008834004984237254, 0.09712480753660202, 0.001252227695658803, 0.0008406097185797989, 0.0007610911270603538, 0.0007495171739719808, 0.0016416547587141395, 0.0008852007449604571, 0.0008406097185797989, 0.001318180002272129, 0.002572986762970686, 0.000904486863873899, 0.0007655271328985691, 0.000904486863873899, 0.0007155319908633828, 0.008622453548014164, 0.0008137333206832409, 0.0007193262572400272, 0.0007140327361412346, 0.0009407229954376817, 0.0006942055188119411, 0.0009533977718092501, 0.0012947206851094961, 0.0010402377229183912, 0.0029290621168911457, 0.0007528705173172057, 0.0010498201008886099, 0.002122605685144663, 0.0007564944680780172, 0.0007775111589580774, 0.000830384436994791, 0.0007500701467506588, 0.0005994524690322578, 0.001995444530621171 ]

[ " NOT RECOMMENDED FOR PUBLICATION\n File Name: 20a0213n.06\n\n Case No. ", "19-3131\n\n UNITED STATES COURT OF APPEALS\n FOR THE SIXTH CIRCUIT\n FILED\n Apr 15, 2020\n KRIS J. KINSEY, ) DEBORAH S. HUNT, Clerk\n )\n Plaintiff-Appellant,\n )\n ) ON APPEAL FROM THE\n v.\n ) UNITED STATES DISTRICT\n ) COURT FOR THE NORTHERN\n STATE OF OHIO, et al.,", "\n ) DISTRICT OF OHIO\n Defendants, )\n )\n COUNTY OF LORAIN, et al., ", " )\n Defendants-Appellees. ", " )\n _______________________________________\n\nBEFORE: BOGGS, BATCHELDER, and DONALD, Circuit Judges.", "\n\n ALICE M. BATCHELDER, Circuit Judge. ", " Kris Kinsey, represented by attorney\n\nJames Georgian, sued the State of Ohio, the City of Elyria, Lorain County, the County Sheriff, the\n\nJail Administrator, three corrections officers, a jail counselor, and a nurse for the jail, claiming that\n\nthey violated Kinsey’s constitutionally protected rights during his incarceration at the Lorain\n\nCounty Jail. ", "Georgian’s most outrageous claim is that the six hours of surveillance video in the\n\nrecord is not authentic but was fabricated by the Jail to show a “doppelganger” “purporting to be\n\nMr. Kinsey.” ", "Georgian nonetheless repeatedly cites to and relies on this allegedly falsified video.", "\n\nThis claim is not merely doubtful, nor merely even implausible; it is clearly preposterous.", "\n\n Kinsey’s other claims include false arrest, false imprisonment, negligent failure to provide\n\nmedical care, assault and battery, intentional and negligent infliction of emotional distress, First\n\nAmendment retaliation, Sixth Amendment assistance of counsel and notice of accusation, Eighth\n\nAmendment excessive bail and fines and cruel and unusual punishment, Fourteenth Amendment\n\fCase No. ", "19-3131, Kinsey v. State of Ohio, et al.", "\n\n\ndue process and equal protection, Americans with Disabilities Act (ADA) and Rehabilitation Act\n\ndiscrimination, abuse of process, and malicious prosecution. ", " The district court rejected\n\nGeorgian’s canard about the doppelganger video and found that, even ignoring the video and\n\naccepting Kinsey’s own account of the events at the Jail, he had failed to state viable constitutional\n\nclaims and the individual defendants were entitled to qualified immunity; he failed to state viable\n\nADA or state-law claims and the defendants were entitled to state-law immunity; and Lorain\n\nCounty is not a political entity and, therefore, not a proper defendant. ", "Consequently, the district\n\ncourt granted summary judgment to all defendants on all claims. ", "On appeal, Kinsey and Georgian\n\nmerely reassert the same arguments they pressed in the district court.", "\n\n After carefully reviewing the record, the law, and the arguments on appeal, we conclude\n\nthat the district court correctly set out the applicable law and correctly applied that law to the facts\n\nbefore it. ", "The issuance of a full written opinion by this court would serve no useful purpose.", "\n\nAccordingly, for the reasons stated in the district court’s opinion, we AFFIRM.", "\n\n\n\n\n 2\n\f" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0006737068761140108, 0.0007128511206246912, 0.0006882823072373867, 0.0006907853530719876, 0.0009240786894224584, 0.0007864483050070703, 0.002087887842208147, 0.006387246772646904, 0.004439609590917826, 0.0010885046795010567, 0.0024845812004059553, 0.0007367742364294827, 0.0007328036008402705, 0.0007897719042375684, 0.0006438034470193088, 0.0006699839141219854, 0.0005559232668019831, 0.0005976654356345534, 0.0005710914265364408, 0.0010009023826569319 ]

[ "“Our Sources Tell Us” is an occasional series wherein we look at possible trade targets for the Carolina Hurricanes.", "\n\nElliotte Friedman’s 31 Thoughts might be the most plugged-in column in hockey, and when he mentions something as a possibility, you can bet a significant amount of money that it is being discussed somewhere.", "\n\nAnd when he dropped this nugget early in today’s column, our eyebrows were raised:\n\n2. ", "Trade that might make sense only to me: something around Justin Faulk from Carolina to Detroit for Andreas Athanasiou.", "\n\nOh. ", "Oh really, now.", "\n\nNormally, in a column like this we would do the positives and negatives, but I’ll be honest: I’m finding absolutely nothing positive in this rumor. ", "In fact, I can condense the good news section of this column down to one paragraph.", "\n\nAthanasiou is on pace for a career high in points and has already surpassed his high-water mark with 13 assists this season. ", "He’s signed for a relatively modest $1.38 million, and will be a restricted free agent with arbitration rights this summer.", "\n\nNow that we’ve got that out of the way, let’s get to the downsides - and, oh boy, are there plenty of them.", "\n\nFirst, this hero chart. ", "I’ve taken the names off the chart. ", "Who would you rather have?", "\n\nProbably the player on the right, correct? ", "Much better numbers, more impactful goals, drives shots per game, etc., ", "etc. ", "A better all-around player, any way you slice it.", "\n\nPlayer B is Justin Faulk. ", "Player A is Adam Larsson, who you’ll recall was traded for Taylor Hall before the 2016 season.", "\n\nYou don’t need me to tell you that Andreas Athanasiou is not, and is never likely to become, Taylor Hall.", "\n\nSo that’s one strike against this potential deal.", "\n\nHere’s another: Athanasiou is a center who has had trouble consistently playing center in the NHL, and is being groomed as a winger. ", "Don’t the Hurricanes - cough, Elias Lindholm - have their quota met already on that front?", "\n\nAnd then there’s the Wings’ cap situation, which is a shambles. ", "Detroit has the highest cap hit in the league, and are only under the cap by virtue of Johan Franzen’s long-term injury exception. ", "Faulk is relatively affordable, at just over $4 million AAV, but even that is too rich for the Wings’ blood. ", "They’d need to move someone else, but who? ", "Tomas Tatar and Justin Abdelkader are being paid king’s ransoms to produce less than Derek Ryan. ", "Henrik Zetterberg is going nowhere. ", "We’ve already had the Martin Frk Experience in these parts.", "\n\nIn fact, outside of Dylan Larkin, there is not one player on the Red Wings roster that should be of any interest to the Hurricanes. ", "Dealing Faulk should bring back more than a third lne tweener and whatever flotsam happens to make the salaries work.", "\n\nLook, I’ll be honest: as I said to someone on Twitter earlier this week, I have no idea what the market is for a Justin Faulk deal. ", "Eric Staal, mired in a years-long malaise, fetched a draft pick and a B-level prospect in Aleksi Saarela when he was dealt at the 2016 deadline on an expiring contract. ", "Faulk is younger, has a long-term contract, and plays a position that is perpetually in demand. ", "His asking price should be very high, even if you’re selling low.", "\n\nAnd it certainly should be higher than a package centered around Andreas Athanasiou." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005679516470991075, 0.0006407229229807854, 0.1974196434020996, 0.0006351921474561095, 0.0019147295970469713, 0.0009135054424405098, 0.0006006963667459786, 0.0005699192988686264, 0.0007402339251711965, 0.0009681355440989137, 0.0008246942888945341, 0.0007160443346947432, 0.0006044884212315083, 0.0016030319966375828, 0.00064415781525895, 0.0006461410666815937, 0.0007449526456184685, 0.0007696624961681664, 0.0011893240734934807, 0.000596302910707891, 0.0007001227349974215, 0.0009429474011994898, 0.0008923634304665029, 0.0017188336933031678, 0.001991578610613942, 0.0010323411552235484, 0.012292291037738323, 0.0007699104025959969, 0.003133021295070648, 0.0014547143364325166, 0.0006041586748324335, 0.0007183614070527256, 0.22106195986270905, 0.0007931367144919932, 0.0026054049376398325, 0.0014592709485441446, 0.0011595975374802947, 0.0005466113798320293 ]

[ "Can you send the draft letter Tracy refers to re: letter to legislators?", "\n\n-----Original Message-----\nFrom: Mara, Susan \nSent: Wednesday, September 26, 2001 12:28 PM\nTo: Kean, Steven J.; Tribolet, Michael; Mellencamp, Lisa; Denne, Karen;\nKaufman, Paul; Shapiro, Richard; Steffes, James D.; Dasovich, Jeff\nSubject: FW: Angelides' Memo to Investors 9/ 25/01\n\n\n\n\n-----Original Message-----\nFrom: Fairchild, Tracy [mailto:tracy.fairchild@edelman.com]\nSent: Wednesday, September 26, 2001 9:42 AM\nTo: 'arem@electric.com'; 'douglass@energyattorney.com'\nCc: Manuel, Erica; 'nplotkin@rcsis.com'\nSubject: California State Treasurer Philip Angelides' Memo to Investors\n9/ 25/01\n\n\nAReMers:\n\nThis memo from Angelides outlines what has happened and what still needs to\nhappen at the PUC before bonds can be issued. ", " He mentions that no appeals\nto the DA suspension have yet been filed but that the deadline has not yet\npassed. ", " When are we filing our appeal? ", "I'd like to send out a news release\nthe morning we file the appeal if AReM agrees.", "\n\nOn another matter, just so we're all on the same page, Norm and I produced\nthe letter to Davis and legislative leadership which you all received\nyesterday for final approval. ", " The Weintraub column handout has also been\nmocked up and Norm is going to pick that up this morning from our office.", "\n\nTracy\n\n\n\n\n-----Original Message-----\nFrom: Philip Angelides, Calif State Treasurer\nTo: SARRON, Christina\nSent: 9/25/2001 12:35 PM\nSubject: California State Treasurer Philip Angelides' Memo to Investors 9/\n25/01\n\n <<STO Investor Memo 92501.pdf>> \n <<STO Investor Memo 92501.pdf>>" ]

{ "pile_set_name": "Enron Emails" }

[ 0.0006651439471170306, 0.0006578621105290949, 0.0006078664446249604, 0.0008738866890780628, 0.0006064166664145887, 0.000538248976226896, 0.0008975651580840349, 0.0006792453932575881 ]

[ "Field of the Invention\nThe present invention generally relates to a control device for a hybrid vehicle equipped with an engine and an electric motor as power sources, and that is capable of selecting between an electric travel mode (EV mode) for travel executed only by the electric motor and a hybrid travel mode (HEV mode) for travel executed by the electric motor and the engine.", "\nBackground Information\nFor example, a hybrid vehicle such as that disclosed in Japanese Laid-Open Patent Application No. ", "2000-199442 is known. ", "In this hybrid vehicle, the engine is detachably coupled to a driving wheel sequentially via a continuously variable transmission and a clutch, and an electric motor is constantly coupled to the driving wheel. ", "The hybrid vehicle further comprises a mechanical oil pump that is driven by the engine and that supplies oil to the continuously variable transmission and the clutch.", "\nThis hybrid vehicle is capable of electric travel (EV travel) in the EV mode by only the electric motor by stopping the engine as well as releasing the clutch described above, and is capable of hybrid travel (HEV travel) in the HEV mode by the electric motor and the engine by starting the engine as well as engaging the clutch.", "\nSince the engine in a stopped state and the continuously variable transmission are disconnected from the drive wheel by releasing the clutch during EV travel, the friction of the engine and the continuously variable transmission can be reduced during EV travel, and by avoiding corresponding energy loss, it is possible to increase the energy efficiency." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0005709607503376901, 0.0005817018100060523, 0.0006070405943319201, 0.0006573162390850484, 0.0006962707848288119, 0.0006446937331929803, 0.0006238091154955328 ]

[ "Advanced implantation in mink (Mustela vison) treated with medroxyprogesterone acetate during early embryonic diapause.", "\nAdult and pubertal female mink mated on 4 March were administered 2.5 mg medroxyprogesterone acetate (MPA) or control vehicle on 9-11 March. ", "Pregnancies were shorter (P less than 0.01) in adult (60 +/- 2 days) than in pubertal (72 +/- 0.7 days) control animals. ", "Treatment with MPA reduced (P less than 0.01) the length of pregnancy in both adult (51 +/- 1 days) and pubertal (60 +/- 2 days) mink but did not significantly affect serum progesterone levels on 3-4 April. ", "Observations at laparotomy during April confirmed the effects of age and treatment on the time of implantation and suggested that implantation sites become grossly visible 28 days before parturition. ", "It is concluded that administration of a progestagen during early embryonic diapause can advance the time of implantation in mink." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.001195403398014605, 0.02047905884683132, 0.001380521571263671, 0.0011360396165400743, 0.0008935137302614748, 0.0017450681189075112 ]

[ "Q:\n\nHow do assets work in Rails?", "\n\nI want to use jQuery/Bootstrap/other 3rd party js in my Rails app but I cannot understand how Rails work in terms of how it references those scripts.", "\nIn my Gem file I have: \ngem 'jquery-rails', '4.0.3'\ngem 'bootstrap-sass', '3.2.0.0'\ngem 'sass-rails', '5.0.2'\n\nand I see that Rails includes the following in assets/application.js\n//= require jquery\n//= require jquery_ujs\n\nDoes that mean that Rails will include jQuery for every screen that my App has?", "\nWhat if I want to use a 3rd party only for some screens, not every screen. ", "How can I accomplish that? ", "\nAnd I couldn't find jQuery.min.js anywhere in my Rails project. ", "Where it is located?. ", "I've been searching in the following: app/assets/javascripts, vendor/assets/javascripts, lib/assets but no jQuery/jQuery UI script.", "\n\nA:\n\nYes it will include it on every single screen rendered using the default layout (app/views/layouts/application.html.erb)\nThe jquery/sass/bootstrap css/js files live in the gems directory (somewhere deeply inside your ruby installation directory). ", "So they are outside of your project, and sprockets extracts them from that external directory.", "\nTo avoid including those files on every single page you just need to create an another layout which will not reference the application.js file. ", "\n\nTo include difference scripts using on different pages with the same layout you can use the content_for helper, there is quiet a lot of things to change, so:\napp/views/layouts/application.html\n# remove this\n<% javascript_include_tag 'application', 'data-turbolinks-track' => true %>\n\n# and add this\n<%= yield :scripts %>\n\nNext in all your views you can add something like this (anywhere in the file):\n<% content_for :scripts do %>\n <%= javascript_include_tag 'application' %>\n<% end %>\n\nThat specific example will just include the application.js with dependencies on some pages, and will include nothing on other pages. ", "Generally you can create more than one manifest file (many application.js-like files.) ", "But if you are not really comfortable with sprockets it will be much simpler for you to just put the regular js files into the public directory and then include them using something like:\n<% content_for :scripts do %>\n <script src=\"javascripts/jquery.js\" ></script>\n <script src=\"javascripts/pagination.js\" ></script>\n<% end %>\n\nAnd the javascripts/jquery.js should be available in your public directory.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006497415597550571, 0.00062270846683532, 0.0006342672277241945, 0.0006696640630252659, 0.0007383859483525157, 0.0008691504481248558, 0.0006453656824305654, 0.0005771613214164972, 0.0005841984529979527, 0.0012051791418343782, 0.0006622463115490973, 0.0006781019037589431, 0.0006471989909186959, 0.000792741950135678, 0.001995444530621171 ]

[ "\n454 F.Supp. ", "610 (1978)\nUNITED STATES of America\nv.\nGlenda Sue Patterson JIMINEZ and James Ronald Jiminez.", "\nNo. ", "78-30091-NA-CR.", "\nUnited States District Court, M. D. Tennessee, Nashville Division.", "\nMay 31, 1978.", "\nBob Lynch, Jr., Asst. ", "U. S. Atty., ", "Nashville, Tenn., for plaintiff.", "\nTom R. Meeks, Larry B. Watson, Clarksville, Tenn., for Glenda Sue Patterson Jiminez.", "\nClark H. Tidwell, Nashville, Tenn., for James Ronald Jiminez.", "\n\nMEMORANDUM\nMORTON, Chief Judge.", "\nDefendants were indicted in three counts by the federal grand jury. ", "The first count charged defendants with conspiring to introduce marijuana into a federal penal or correctional institution in violation of 18 U.S.C. § 371; the second count charged them with introducing marijuana into a federal penal or correctional institution in violation of 18 U.S.C. § 1791[1] and 28 C.F.R. § 6.1;[2] and the third count charged them with knowingly and intentionally possessing marijuana in violation of 21 U.S.C. § 844(a). ", "According to the indictment, defendants introduced the marijuana into the Sumner County, Tennessee, Jail in which defendant *611 James Ronald Jiminez was incarcerated. ", "Defendants have moved to dismiss the first two counts of the indictment on the ground that the Sumner County Jail is not a \"Federal penal or correctional institution.\" ", "In opposition, the government contends that since federal prisoners are incarcerated in the Sumner County facility pursuant to a contract between the United States Bureau of Prisons and Sumner County, authorized by 18 U.S.C. § 4002,[3] the Sumner County Jail has become a \"Federal penal or correctional institution\" within the meaning of 18 U.S.C. § 1791.", "\nIt is apparent from the language of both 18 U.S.C. § 1791 and its implementing regulation that an essential element of the crime is that it must be committed at a \"Federal penal or correctional institution.", "\"[4] The statute is silent, however, as to the scope of this term. ", "No case defines the term for purposes of this statute, and furthermore, there is very little authority on related matters. ", "The court believes, however, that there are several reasons for agreeing with defendants' contention that the Sumner County Jail is not a \"Federal penal or correctional institution\" under 18 U.S.C. § 1791.", "\nFirst, no provision of state or federal law, or term of the contract between the Bureau of Prisons and Sumner County, expressly or impliedly states that county jails housing federal prisoners become federal institutions. ", "To the contrary, federal statutes imply that such jails are not federal institutions. ", "For example, one provision, 18 U.S.C. § 4001(b)(1), states: \"The control and management of Federal penal and correctional institutions, except military or naval institutions, shall be vested in the Attorney General, who shall promulgate rules for the government thereof, and appoint all necessary officers and employees in accordance with the civil-service laws . . ..\" ", "18 U.S.C. § 4001.[5] The language of the statute is mandatory and sets out what the Attorney General must do with regard to federal penal and correctional institutions. ", "In contrast, the Attorney General, through appropriate agencies, may promulgate rules for the treatment of federal prisoners housed in county jails, but can neither promulgate rules for the general government of county jails, nor appoint jailers, officers, or other employees thereof. ", "The fact that the Attorney General is not able to fulfill his statutorily mandated duty with regard to county jails strongly suggests that county jails are not turned into federal institutions by virtue of contracts entered into under 18 U.S.C. § 4002.[6] Furthermore, even though 18 U.S.C. § 4002 authorizes the federal government to contract for periods of not more than three years for the imprisonment of federal prisoners in state or local prisons or jails, no \"federal agency or officer thereof has any authority to exercise any control over the day to day management *612 of the local institution or over the details of the custody and care of federal prisoners confined therein.\" ", "Brown v. United States, 374 F.Supp. ", "723, 727 (E.D. Ark.1974); see Logue v. United States, 412 U.S. 521, 93 S.Ct. ", "2215, 37 L.Ed.2d 121 (1973).", "\nAt the same time, no statute of the state of Tennessee transforms county jails in to federal institutions. ", "Tennessee Code Annotated § 41-1103 merely states that \"the [county] jail is used as a prison for the safekeeping or confinement of . . . ", "persons charged with or convicted of a criminal offense against the United States . . ..\" ", "T.C.A. § 41-1105 requires the jailer \"to receive and safely keep\" federal prisoners. ", "Neither statute, however, surrenders the jails to the federal government.", "\nConsistent with the implications of these federal and state enactments is the contract between the Bureau of Prisons and Sumner County providing for the housing of federal prisoners in the Sumner County Jail. ", "The contract is entitled \"Contract for Service By/In a Nonfederal Facility.\" (", "Emphasis added.) ", "Furthermore, attached to the contract as Exhibit A are \"RULES AND REGULATIONS GOVERNING CUSTODY AND TREATMENT OF FEDERAL PRISONERS IN NONFEDERAL INSTITUTIONS.\" (", "Emphasis added.) ", "Nowhere in the contract or rules and regulations is it said that county jails are to be considered federal institutions. ", "In fact, throughout the documents, institutions such as Sumner County Jail are so often referred to as nonfederal institutions that it seems incredible that the government would now contend that the Sumner County Jail is a federal penal or correctional institution. ", "Also in accord with this reading of the contract is the fact that by its very terms, the agreement to house federal prisoners can be terminated by Sumner County after thirty days notice: One would not think that a federal institution could sever its relationship with the federal government so easily.", "\nSecond, the case law is in disarray, and it offers no controlling precedent and little guidance as to the meaning of \"Federal penal or correctional institution\" under 18 U.S.C. § 1791. ", "For purposes of the Federal Tort Claims Act, 28 U.S.C. § 1346, and the Civil Rights Act, 42 U.S.C. § 1983, such contracts as that between Sumner County and the Bureau of Prisons do not transform county jails into federal agencies or institutions. ", "In Logue v. United States, 412 U.S. 521, 93 S.Ct. ", "2215, 37 L.Ed.2d 121 (1973), the United States Supreme Court held that the United States was not liable under the FTCA for the negligence of county jail employees that caused the death of a federal prisoner confined in a county jail. ", "The county jail was an independent contractor according to the court, and as such it fell within an exception to the FTCA that exempts the United States from liability for the negligence of independent contractors and their employees. ", "The federal prisoner was housed in a county jail pursuant to a contract such as is involved in the instant case. ", "Clearly, then, the county jail is not a federal agency or institution for purposes of the FTCA.", "\nIn Henderson v. Thrower, 497 F.2d 125 (5th Cir. ", "1974), the Fifth Circuit held that a federal prisoner, held in a city jail pursuant to a contract such as that involved in the instant case, could sue the local jail officials and employees under 42 U.S.C. § 1983. ", "The court indicated that the existence of the contract had no effect on the potential liability of the jail officials and employees, and that the acts of the jail staff were \"under color of state law\" in spite of the contract. ", "Had the local jail been considered a federal institution and the jailkeepers federal employees, it is doubtful that the § 1983 suit would have been allowed. ", "Therefore, it is apparent that the contract did not turn the city jail into a federal agency or institution for purposes of § 1983 suits.", "\nThe government quite properly points out that these examples of civil liability suits are distinguishable from the present case, which involves a criminal statute. ", "The court, however, does not offer these cases as dispositive of the issue in this case, but merely to demonstrate how arguments related *613 and analogous to the government's here have fared in the courts.", "\nIn support of its contention that Sumner County Jail is a \"Federal penal or correctional institution,\" the government relies on a line of cases in which state and local jail officials were held in contempt of federal court for their failure to perform properly their duty with respect to federal prisoners committed to their custody. ", "Ex parte Shores, 195 F. 627 (D.C.Iowa 1912); In re Birdsong, 39 F. 599 (S.D.Ga.1889). ", "In these cases, the courts quoted Randolph v. Donaldson, 13 U.S. (9 Cranch) 76, 86, 3 L.Ed. ", "662, 665 (1815): \"For certain purposes, and to certain intents, the state jail lawfully used by the United States may be deemed to be the jail of the United States, and [the jailer] to be [jailer] of the United States.\" ", "These cases are not directly on point with respect to the issue in this case. ", "They are distinguishable because they did not depend on the interpretation of a term used in a criminal statute, and because they did not involve 18 U.S.C. § 1791 specifically.", "\nFinally, the court believes that the most convincing reason for holding that Sumner County Jail is not a \"Federal penal or correctional institution\" under 18 U.S.C. § 1791 is that otherwise the statute would run afoul of the Due Process Clause of the Fifth Amendment by being unconstitutionally vague as applied to these defendants. ", "The doctrine is firmly established that\nthe terms of a penal statute creating a new offense must be sufficiently explicit to inform those who are subject to it what conduct on their part will render them liable to its penalties . . .. ", "And a statute which either forbids or requires the doing of an act in terms so vague that men of common intelligence must necessarily guess at its meaning and differ as to its application violates the first essential of due process of law.", "\nConnally v. General Construction Co., 269 U.S. 385, 391, 46 S.Ct. ", "126, 127, 70 L.Ed. ", "322, 328 (1926). ", "The United States Supreme Court has explained the reasons that underlie this doctrine in the following passage:\nVague laws offend several important values. ", "First, because we assume that man is free to steer between lawful and unlawful conduct, we insist that laws give the person of ordinary intelligence a reasonable opportunity to know what is prohibited, so that he may act accordingly. ", "Vague laws may trap the innocent by not providing fair warning. ", "Second, if arbitrary and discriminatory enforcement is to be prevented, laws must provide explicit standards for those who apply them. ", "A vague law impermissibly delegates basic policy matters to policemen, judges, and juries for resolution on an ad hoc and subjective basis, with the attendant dangers of arbitrary and discriminatory application. (", "Footnotes omitted.)", "\nGrayned v. City of Rockford, 408 U.S. 104, 108-09, 92 S.Ct. ", "2294, 2298, 33 L.Ed.2d 222, 227-28 (1972).", "\nIt seems obvious that if these defendants had introduced marijuana onto the premises of a United States prison or penitentiary there would be no ground to challenge the term \"Federal penal or correctional institution\" as unconstitutionally vague. ", "In such a case, the term would have such a common and ordinary definition that men of common intelligence would not have to guess at its meaning. ", "Here, however, the government attempts to give the term a surprising meaning. ", "Much of this opinion has been devoted to demonstrating that no statute, no term of the Bureau of Prisons contract, and no relevant case gives anyone any notice that county jails are considered \"Federal penal or correctional institutions\" for purposes of 18 U.S.C. § 1791. ", "In this respect the case is very similar to United States v. Diaz, 499 F.2d 113 (9th Cir. ", "1974), in which the defendant was charged with appropriating \"objects of antiquity\" located on federal lands. ", "He had in fact taken from an Indian reservation six-year-old ceremonial masks, which were said to be \"objects of antiquity,\" regardless of their age, because they were related to religious or social traditions of long standing. ", "The court there found that the statute was unconstitutionally vague in that it used \"undefined terms of uncommon usage.\" ", "In the *614 instant case \"Federal penal or correctional institution\" is not defined; in common usage the meaning of that term does not include county jails. ", "In light of this, the court finds the conclusion inescapable that fundamental notions of fairness and due process compel the granting of defendants' motions to dismiss the first two counts of the indictment.", "\nAn appropriate order will be entered.", "\nNOTES\n[1] 18 U.S.C. § 1791 provides:\n\nWhoever, contrary to any rule or regulation promulgated by the Attorney General, introduces or attempts to introduce into or upon the grounds of any Federal penal or correctional institution or takes or attempts to take or send therefrom anything whatsoever, shall be imprisoned not more than ten years.", "\n[2] 28 C.F.R. § 6.1 provides:\n\nThe introduction or attempt to introduce into or upon the grounds of any Federal penal or correctional institution or the taking or attempt to take or send therefrom anything whatsoever without the knowledge and consent of the warden or superintendent of such Federal penal or correctional institution is prohibited.", "\n[3] 18 U.S.C. § 4002 provides in pertinent part:\n\nFor the purpose of providing suitable quarters for the safekeeping, care, and subsistence of all persons held under authority of any enactment of Congress, the Director of the Bureau of Prisons may contract, for a period not exceeding three years, with the proper authorities of any State, Territory, or political subdivision thereof, for the imprisonment, subsistence, care, and proper employment of such persons.", "\n[4] In this vital respect, the instant case is distinguishable from the cases, cited by the government, arising under 18 U.S.C. §§ 751 and 752. ", "In those cases, the critical issue, decided in the government's favor, was whether or not the federal prisoners were in \"the custody of the [United States] Attorney General or his authorized representative\" at the time of their escape from county jails. ", "Those statutes do not require that the escape be from a \"Federal penal or correctional institution.\" ", "See United States v. Viger, 530 F.2d 846 (9th Cir. ", "1976); United States v. Stead, 528 F.2d 257 (8th Cir. ", "1975), reh. ", "denied, id., cert. ", "denied, 425 U.S. 953, 96 S.Ct. ", "1730, 48 L.Ed.2d 197 (1976).", "\n[5] Other federal statutes are to the same effect. ", "See, e. g., 18 U.S.C. § 4042 (establishing the duty of the Bureau of Prisons to manage and regulate all federal penal or correctional institutions); Department of State, Justice, and Commerce, The Judiciary and Related Agencies Appropriation Act of 1976, Pub. ", "L. No. ", "94-121, 89 Stat. ", "611 (appropriating funds for the operation of federal penal or correctional institutions and for the supervision of federal prisoners \"in non-Federal Institutions\") (emphasis added).", "\n[6] See note 3, supra.", "\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0012925084447488189, 0.0007517235353589058, 0.0013785817427560687, 0.0009139451431110501, 0.0007242026040330529, 0.0007369072991423309, 0.055290065705776215, 0.00093490956351161, 0.0006864321185275912, 0.0007597661460749805, 0.0006884843460284173, 0.0006894138059578836, 0.0005788859562017024, 0.0017462624236941338, 0.0006692343740724027, 0.0007848914247006178, 0.0006889484357088804, 0.0006112774135544896, 0.0005544535233639181, 0.0006103610503487289, 0.0006882976740598679, 0.0006776267546229064, 0.000782018294557929, 0.0006263553514145315, 0.0006660700892098248, 0.00074632657924667, 0.0006396012613549829, 0.0016701793065294623, 0.000719474337529391, 0.0007263105944730341, 0.0007221711566671729, 0.0007607184234075248, 0.0015618718462064862, 0.0022057867608964443, 0.0008026540162973106, 0.0006217103218659759, 0.000565861351788044, 0.0006287729484029114, 0.0006420020363293588, 0.0006287729484029114, 0.0006963341147638857, 0.0006121268379501998, 0.0006670232396572828, 0.0006683169049210846, 0.0006602536304853857, 0.0007804820779711008, 0.0010597464861348271, 0.0007044076337479055, 0.0007254473166540265, 0.0008271646802313626, 0.000837089610286057, 0.000883036176674068, 0.0007100881193764508, 0.0006185978418216109, 0.0007800002349540591, 0.0006017725681886077, 0.0005835150950588286, 0.0007354347035288811, 0.0007491219439543784, 0.0007099683862179518, 0.0007034356240183115, 0.0005708625540137291, 0.0006689544534310699, 0.0006934120901860297, 0.0007956287008710206, 0.0007844634237699211, 0.0008793041342869401, 0.0008561257272958755, 0.0006045664777047932, 0.0006007456104271114, 0.0006455520633608103, 0.000919334648642689, 0.0007273475639522076, 0.0006498140282928944, 0.000614891410805285, 0.0009660844225436449, 0.0007517088088206947, 0.0006652542506344616, 0.0005813645548187196, 0.0005478233215399086, 0.0006501413881778717, 0.0006959456950426102, 0.0006680806400254369, 0.0006781549309380352, 0.0006247069104574621, 0.000614971446339041, 0.0006746281869709492, 0.0005368583952076733, 0.0008375746547244489, 0.0009995301952585578, 0.0006483967299573123, 0.0006004130118526518, 0.000663833983708173, 0.0006739355158060789, 0.0007555751362815499, 0.0007995314663276076, 0.0010342415189370513, 0.03174600750207901, 0.0007223536376841366, 0.0006819213158451021, 0.0006845985190011561, 0.000632176932413131, 0.001012755325064063, 0.0009158969041891396, 0.0006044909823685884, 0.0007409036625176668, 0.001995444530621171 ]

[ "Neurocysticercosis--retrospective study of autopsy reports, a 17-year experience.", "\nNeurocysticercosis (NCC) is a common central nervous system (CNS) infection caused by Taenia solium metacestodes. ", "The objective of this study is to describe the incidence of cysticercosis diagnosed at autopsies and describe the epidemiological and clinical characteristics of NCC. ", "Retrospective study analyzing 6,500 reports of autopsies between 1977 and 1994 from a school hospital in Curitiba, PR, southern of Brazil. ", "The following data was obtained, age, gender, site of cysticercosis, NCC as cause of death. ", "The diagnosis of cysticercosis was established in 52 (0.8%) autopsies. ", "From 1977 to 1987 (0.7%) and from 1988 to 1994 (1.1%). ", "In the autopsies with cysticercosis 75% were male; age (mean ± SD) was 43 ± 20. ", "NCC was present in 96% of cases, and seizures was the most frequent clinical manifestation. ", "Asymptomatic cases in 54%. ", "These data classify our area as hiperendemic, according with OMS criteria. ", "The present study reinforces the necessity to develop adequate control programs." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.006354850716888905, 0.004336465150117874, 0.0006993688293732703, 0.0005664239288307726, 0.0012082820758223534, 0.0014939358225092292, 0.0006197161274030805, 0.003034139284864068, 0.0007344108889810741, 0.0008489656611345708, 0.0006600022898055613, 0.0005974071100354195 ]

[ "Trying to build an MP40.", "\n\nArticle about: Hi all currently trying to assemble a relic mp40, I only have this much so far but I still need the front barell and bakelite sidegrips. ", "I can get the sidegrips on ebay, even repro ones if I\n\nJust how relic is that barrel? ", "Is it clear? ", "Does it have rifling? ", "You should consider the legalities of what you are doing here. ", "I'm not trying to spoil things for you, but you really need to be careful these days!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.001239110017195344, 0.009335092268884182, 0.017416533082723618, 0.0007017479510977864, 0.001138427876867354, 0.0005736182793043554, 0.0007350035011768341 ]

[ "Google Street View is a magical realm of accidental crimes in progress, fires, and other assorted serendipitous fun. ", "Now, you'll be able to scroll around the inside of businesses! ", "Which is cool—but here's how it could be cooler.", "\n\n\nThe aimlessness of Street View is what makes it so fun. ", "You can \"wander\" from block to block, street to street, town to town even, as if in a drunken stupor. ", "Manifest Destiny. ", "Unfortunately, the interior version isn't so seamless—in fact you'll only be able to access navigable stores via Google Places, rather than Maps. ", "This is a bummer. ", "I want to be able to walk right up to the front door of my favorite local pharmacy on Street View, click the door, and be able to check for myself whether or not the shelves are too high for me to reach. ", "Or something. ", "The point is, this should be integrated. ", "Completely integrated. ", "Perhaps Google is waiting until the store shots are more filled in—right now it's only taking submissions from business owners in a handfull of cities. [", "Google Places via PCW]" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.012131518684327602, 0.0006175595917738974, 0.0006348018068820238, 0.0006352451164275408, 0.4326973855495453, 0.0007015613955445588, 0.0005892571061849594, 0.02644541673362255, 0.0011028395965695381, 0.0008943083812482655, 0.0005587853374890983, 0.0007089345599524677, 0.0005897886585444212, 0.0006836359389126301 ]

[ "[Studies on the transforming effects of wollastonite on SHE cells].", "\nA transformation system utilizing SHE cells was used to study the carcinogenic effects of Chinese wollastonite, a new mineral fiber. ", "Morphological transformation was observed in SHE target cells treated with either wollastonite or MNNG, a known chemical carcinogen. ", "A single treatment of wollastonite (20 ug/ml) induced typical transformation. ", "The transformation rate of SHE cells induced by MNNG followed by several treatments with wollastonite was higher than that induced by the same dose of MNNG only. ", "Electron microscopic observation showed that the ultrastructure of wollastonite-transformed SHE cells was significantly different than that of normal SHE cells, but similar to that of SHE cells transformed by MNNG. ", "The above results suggest that wollastonite may not be simply an environmental carcinogen, but also a possible promoter." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006318923551589251, 0.0005888427840545774, 0.0006540542235597968, 0.0006785780424252152, 0.0007442094502039254, 0.0007963910466060042, 0.0006752682384103537 ]

[ "Q:\n\nDistance Transform Behaviors Differently Between Matlab and OpenCV\n\nI am currently translating code from Matlab to OpenCV but found the distance transform function behaviors differently between Matlab and OpenCV.", "\nTake the simple matrix as an example \nbw = \n 0 0 0 0 0\n 0 1 0 0 0\n 0 0 0 0 0\n 0 0 0 1 0\n 0 0 0 0 0\n\nMatlab version distance transform assigns a number that is the distance between that pixel and the nearest nonzero pixel of BW, which makes sense and I got \n1.4142 1.0000 1.4142 2.2361 3.1623\n1.0000 0 1.0000 2.0000 2.2361\n1.4142 1.0000 1.4142 1.0000 1.4142\n2.2361 2.0000 1.0000 0 1.0000\n3.1623 2.2361 1.4142 1.0000 1.4142\n\nIn OpenCV, I choose the DIST_L2 (the simple euclidean distance). ", "it gives me \n1.3692 0.9550 1.3692 2.3242 3.2792\n0.9550 0 0.9550 1.9100 2.3242\n1.3692 0.9550 1.3692 2.3242 1.3692\n2.3242 1.9100 0.9550 0 0.9550\n3.2792 2.3242 1.3692 0.9550 1.3692\n\nI don't understand why and it doesn't make sense to me. ", "I realized that OpenCV compute the pixel with nearest zero pixel, so I already inverted the input matrix. ", "\n\nA:\n\nmaskSize – Size of the distance transform mask. ", "It can be 3, 5, or CV_DIST_MASK_PRECISE (the latter option is only supported by the first function). ", "\nIt looks like OpenCV version distance transform is doing some normalization using maskSize. ", "Set it to 0 (Even the documentation didn't mention it) and it solves the issue. ", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006215118919499218, 0.001315952860750258, 0.0023669737856835127, 0.0006037073908373713, 0.0008076083031482995, 0.0006084498600102961, 0.0007383937481790781, 0.0007847870583645999, 0.001995444530621171 ]

[ "Staff at the agency, which announced last week that California's proposed limits were redundant, said the agency's chief went against their expert advice after car executives met Cheney, and a Chrysler executive delivered a letter to the EPA saying why the state should not be allowed to regulate greenhouse gases.", "\n\nEPA staff members told the Los Angeles Times that the agency's head, the Bush appointee Stephen Johnson, ignored their conclusions and shut himself off from consultation in the month before the announcement. ", "He then informed them of his decision and instructed them to provide the legal rationale for it, they said.", "\n\n\"California met every criteria ... on the merits,\" an anonymous member of the EPA staff told the Times. \"", "The same criteria we have used for the last 40 years ... We told him that. ", "All the briefings we have given him laid out the facts.\"", "\n\nIn an editorial, the New York Times described the decision as, \"an indefensible act of executive arrogance that can only be explained as the product of ideological blindness and as a political payoff to the automobile industry\".", "\n\nJohnson said that because Bush signed an energy bill last week which raised fuel economy standards, there was no justification for separate state regulation. ", "The president, the agency said, had provided a \"clear national solution\" and there was no need for a \"confusing patchwork of state rules to reduce America's climate footprint from vehicles\".", "\n\nBut Johnson's staff gave him the opposite advice, warning him that should he block California, the state would probably sue him in the courts and would probably win. ", "The state's governor, Arnold Schwarzenegger, immediately announced that he would challenge the EPA's ruling in the courts, describing it as \"legally indefensible\".", "\n\nCalifornia had wanted to implement a 2002 law limiting greenhouse gas emissions from cars and lorries. ", "Had it been successful, 16 other states had said they would follow suit, effectively creating a national standard that car makers would have been obliged to follow." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005918553215451539, 0.0007505485555157065, 0.0005677738809026778, 0.0006040814332664013, 0.0005902056582272053, 0.0005679486785084009, 0.0009164040675386786, 0.0006699440418742597, 0.0005997110274620354, 0.0028558738995343447, 0.0007464982918463647, 0.00077067717211321, 0.0005812004674226046 ]

[ "2012: Lady Gaga visits Julian Assange at the Ecuadorian embassy.", "\n\nSince the Hillary email leaks the celebs have stopped calling.", "\n\n\n\nThe campaign to get Wikileaks founder Julian Assange out of the Ecuadorian Embassy in London and into a jail is building up steam. ", "Ecuador’s president Lenin Moreno is now saying that Britain has provided sufficient guarantees that Assange won’t be extradited to face the death penalty, and that he should therefore leave the embassy.", "\n\nAP: The comments were made in a recent radio interview, as reported by\n\n“The road is clear for Mr. Assange to take the decision to leave,” Moreno said, referring to written assurances he said he had received from Britain.", "\n\n\n\nMoreno didn’t say he would force Assange out, but said the activist’s legal team is considering its next steps.", "\n\n\n\nAssange has been holed up in the Ecuadorian embassy since 2012, when he was granted asylum while facing allegations of sex crimes in Sweden that he said were a guise to extradite him to the U.S.\n\n\n\nBut his relations with his hosts have soured to the point that Moreno earlier this year cut off his access to the internet, purportedly for violating the terms of his asylum by speaking out on political matters.", "\n\n\n\n\n\nTechnically Assange is an Ecuadorian citizen after being granted citizenship by the previous president, but that can be removed as easily as it was given, and anyway is no defence.", "\n\n\n\n\n\nThe real problem for Assange is that when he entered the embassy in 2012 he was seen as a hero by the Left for exposing the secrets of the US military. ", "In those days lots of big name celebs visited him.", "\n\n\n\nWith Noam Chomsky, December 2014\n\nJesse Jackson, August 2015\n\nMichael Moore, June 2016\n\nThe Leftist media and Leftist rent-a-mobs were also at his service. ", "Any attempt to evict and arrest him would have faced massive blowback in the media and could even have caused riots in central London.", "\n\n\n\n\n\n\n\nBut now all that has changed.", "\n\n\n\n\n\nIn the 2016 US Presidential Election, Wikileaks leaked thousands of embarrassing emails from the Hillary Clinton camp that greatly harmed her campaign. ", "Some analysts believe this gave Trump the edge in that closely fought election. ", "Ever since then the Left has cooled in its support for Assange.", "\n\n\n\n\n\nMeanwhile, Trump, who benefited most from the leaks, can't afford to be grateful and pardon Assange, as that would align him with a so-called \"enemy\" of the US military. ", "This would alienate the Neocons and cuckservatives in his party and be presented as ''unpatriotic.\" ", "Rather than do that, Trump is happy to throw Assange under the bus for his own selfish political reasons.", "\n\n\n\n" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006080043385736644, 0.0007131486781872809, 0.004716602619737387, 0.0009094172855839133, 0.0005773728480562568, 0.0008645047782920301, 0.0011633032700046897, 0.0006653395248576999, 0.0017566935857757926, 0.0023679886944592, 0.0019774804823100567, 0.011804806999862194, 0.0007387107471004128, 0.0008057645172812045, 0.0006934705888852477, 0.001444057677872479, 0.0014747354434803128, 0.025344323366880417, 0.02400781959295273, 0.001995444530621171 ]

[ "Check out Arri’s first video for SW Amateur Video. ", "Arri strikes me as a cute chick who is trying out modeling for the first time and is loving it. ", "She is very cute and has a great body, including a very nice pair of boobs. ", "They look really good. ", "It is always a blast to find a model like Arri, who really comes alive when the camera turns on and wants to show off her body to you and whoever watches the video. ", "Arri is not shy and does full frontal topless in each scene. ", "This is a great video and I can’t wait to see more of Arri. ", "Download Arri’s 40-minute video for $15.00 Members enter here" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0007420501788146794, 0.0007754061371088028, 0.7605285048484802, 0.0005870711174793541, 0.0034148034173995256, 0.0033940323628485203, 0.000710780790541321, 0.0007907425751909614 ]

[ "1. ", "Introduction {#sec1-sensors-20-02208}\n===============\n\nToday, as media and technology multitasking becomes pervasive, the majority of young people face a challenge regarding their attentional engagement (that is, how well their attention can be maintained) \\[[@B1-sensors-20-02208]\\]. ", "A study of min-by-min observations showed that the typical university student could not focus on their work for more than 3 to 5 min even during a short 15-min class session, because their minds were still thinking about what might be occurring in virtual worlds, coaxing them to get back to the smartphone, tablet, or laptop to \"check in\" \\[[@B2-sensors-20-02208]\\]. ", "Such constant attempts to multitask not only create challenges to the development of their cognitive control functions \\[[@B3-sensors-20-02208],[@B4-sensors-20-02208],[@B5-sensors-20-02208]\\], but also have a negative impact on their real-world activities, including bad sleep \\[[@B6-sensors-20-02208]\\], poorer school/workplace performance \\[[@B7-sensors-20-02208],[@B8-sensors-20-02208]\\], and an increased level of stress and anxiety \\[[@B9-sensors-20-02208],[@B10-sensors-20-02208]\\]. ", "Therefore, there exists a need for new methods to enhance attentional engagement. ", "A recent study showed that six weeks (20--30 min per week) of training with a closed-loop digital meditation software delivered on a smartphone/tablet improved attentional engagement in young adults \\[[@B11-sensors-20-02208]\\]. ", "Here, \"closed-loop\" refers to a novel meditation training approach where the training difficulty can be adjusted in a rapid manner (e.g., every dozen seconds), according to the participant's performance. ", "Actually, apart from meditation, attempts to boost attentional engagement in a drug-free manner also involved physical exercise, cognitive training, video games, brain stimulation, and exposure to nature \\[[@B12-sensors-20-02208]\\]. ", "All of these approaches are building on the foundation that our brain modifies itself---a phenomenon known as neuroplasticity in the context of cognitive neuroscience \\[[@B12-sensors-20-02208],[@B13-sensors-20-02208]\\]. ", "However, unlike those active interventions (e.g., physical exercise, cognitive training, video games, brain stimulation) that involve hard work of the participant, exposure to nature is an approach that is quite the opposite.", "\n\nExposure to nature is a kind of passive intervention. ", "Walking and running in real nature, or passive viewing of natural scenes through images and videos are the widely seen forms in this approach \\[[@B13-sensors-20-02208]\\]. ", "Essentially, there are no demanding attentional tasks involved. ", "Since the 1980s, accumulating evidence shows us that nature surroundings have restorative or stress-reducing effects \\[[@B14-sensors-20-02208],[@B15-sensors-20-02208],[@B16-sensors-20-02208],[@B17-sensors-20-02208]\\]. ", "Specifically, Kaplan et al. ", "who developed attention restoration theory (ART) suggested that natural environments have properties that attract involuntary attention and, thus, allow a depleted directed attention capacity to recover so that cognitive fatigue can be reduced \\[[@B18-sensors-20-02208]\\]. ", "Here, the term \"natural environments\" must consist of the following four key components \\[[@B19-sensors-20-02208],[@B20-sensors-20-02208],[@B21-sensors-20-02208]\\]: (1) \"being away\", which refers to the sense of being psychologically detached from present worries and demands; (2) \"soft fascination\", which involves the fascinating objects that capture one's attention in a bottom-up fashion and generate minimal top-down responses; (3) \"extent\", which refers to the degree that people feel immersive and engaging; (4) \"compatibility\", which refers to our intrinsic motivation to stay in certain environment.", "\n\nIn a more recent review article about ART, Garside et al. ", "showed some empirical evidence of attention-based benefits, such as improved working memory in both healthy people and those with psychological conditions, which were generated from \"before and after\" behavioral measurements \\[[@B13-sensors-20-02208]\\]. ", "However, in this review article, there were also some studies with mixed findings using different outcome measures of attention, as well as one that did not offer support for ART with outperformed control groups instead of the intervention groups \\[[@B22-sensors-20-02208]\\]. ", "It is likely that differences in the quality of the four aforementioned components themselves contribute to different outcomes \\[[@B23-sensors-20-02208]\\]. ", "For example, the usage of artificial settings, i.e., urban parks and gardens \\[[@B24-sensors-20-02208],[@B25-sensors-20-02208]\\], apparently degraded the sense of \"being away\" and \"soft fascination\" if compared to real natural scene. ", "Moreover, the awareness of \"extent\" makes it hard to believe that people would feel immersive and engaging by just viewing scenery images and videos. ", "Furthermore, the recruited healthy population probably would not have a strong and \"compatible\" motivation if compared to the people who are suffering from cognitive fatigue. ", "More importantly, none of them (all ART-related studies in Reference \\[[@B13-sensors-20-02208]\\]) reported neural evidence. ", "Thus, attentional engagement, a state that describes how well the attention-based benefits can be maintained, remains unclear.", "\n\nUnlike previous ART studies that adopted ready-to-use natural resources, our approach involved designing, developing, and testing an ART-inspired virtual reality (VR) software program that integrates key restorative components of traditional ART with a real-time electroencephalography (EEG)-based closed-loop algorithm to monitor their vigilance levels---an indicator of hard mental work over prolonged periods of time \\[[@B26-sensors-20-02208]\\]. ", "When engaging with this program, users were firstly instructed to close their eyes for 3 min to get their EEG baseline parameter, and then they began \"exposure to nature\" while their vigilance levels were simultaneously monitored using EEG. ", "They were not given explicit instructions on the best strategy via which to achieve a low vigilance level, but they did know that their EEG was being recorded and that it was being used to change the natural surroundings as a reward-based feedback for their vigilance levels (for example, fog disappears when low vigilance level detected). ", "We define this closed-loop approach as CL-ART or \"extent\"-enhanced ART, which allows the interaction between human and natural environment in a personalized manner and offers regular feedback on the effectiveness of relaxing the mind from top-down demands through engagement in a strong bottom-up driven activity. ", "In the context of cognitive neuroscience, attention is one of the three cognitive control abilities (the other two are working memory and goal management) \\[[@B12-sensors-20-02208]\\]. ", "Thus, the term \"top-down\" here refers to internal guidance of attention based on prior knowledge, willful plans, and current goals, while \"bottom-up\" refers to attentional guidance purely by externally driven factors to stimuli that are salient because of their inherent properties relative to the background \\[[@B27-sensors-20-02208]\\]. ", "Given that the core idea of ART is exposure to nature, ART-induced attention refers to bottom-up attention.", "\n\nVR is a communication medium that leads an individual to perceive experiences as if they were physically present in that environment \\[[@B28-sensors-20-02208]\\]. ", "Such VR experiences not only provide easier access to difficult-to-arrange real-world situations, but also allow brain activity to be recorded in a controlled environment \\[[@B29-sensors-20-02208],[@B30-sensors-20-02208]\\]. ", "Therefore, VR environments are increasingly being used by researchers to simulate social interactions and natural events \\[[@B31-sensors-20-02208]\\]. ", "This trend is especially clear since the cost of VR was reduced from tens of thousands of United States (US) dollars a decade ago to the current hundreds of dollars with the development of consumer-friendly VR head-mounted display (HMD) technology in 2016 \\[[@B32-sensors-20-02208]\\].", "\n\nVR environments are designed using three technologies: non-immersive VR \\[[@B33-sensors-20-02208]\\], semi-immersive VR \\[[@B34-sensors-20-02208]\\], and immersive VR (IVR) \\[[@B35-sensors-20-02208]\\]. ", "There are two commonly used forms of IVR \\[[@B35-sensors-20-02208]\\]: cave automatic virtual environments (CAVEs) and HMDs. ", "A CAVE is a specially designed room in which the walls, ceiling, and/or floor are covered with a screen that can project virtual images or videos. ", "An HMD is a VR headset that positions two small screens in front of both eyes, completely blocking out the physical world including the user's body. ", "All current state-of-the-art IVRs adopt consumer-friendly HMDs, including personal computer (PC)-powered HMDs (i.e., HTC Vive™), smartphone-based HMDs (i.e., Samsung Gear™), and all-in-one HMDs (i.e., Oculus Quest™), in order to achieve immersive effects in a manner that is both simple and inexpensive. ", "More importantly, given that external factors may distract attention \\[[@B36-sensors-20-02208]\\], VR-HMD has the inherent advantage of effectively limiting influences of external distraction on attention if compared to a conventional two-dimensional (2D) platform \\[[@B37-sensors-20-02208]\\], highlighting the necessity of using VR-HMD in the current study.", "\n\nThe goal of this study was to assess both behavioral performance and EEG-based neural metrics on a perceptual discrimination task that was executed before and after two types of Virtual ART interventions: standard ART (ST-ART) and CL-ART. ", "The two kinds of ART interventions were developed by our laboratory and delivered using a consumer-friendly VR-HMD platform, to quantitatively evaluate the impact of the \"extent\" component on attentional engagement with a high degree of ecological validity and experimental control. ", "Given the higher degree of engagement that CL-ART is expected to offer (compared to ST-ART), we hypothesized that participants engaged in the CL-ART tasks would generate better post-intervention behavioral performance, as well as neural correlates associated with heightened attentional engagement.", "\n\n2. ", "Materials and Methods {#sec2-sensors-20-02208}\n========================\n\n2.1. ", "Virtual ART Tasks {#sec2dot1-sensors-20-02208}\n----------------------\n\nVirtual ART is a VR-HMD software developed at Shanghai Jiao Tong University (SJTU)'s bio-circuits and system laboratory to assess the effectiveness of ART with a high degree of ecological validity and experimental control. ", "There were two types of virtual tasks in this study: ST-ART (control group) and CL-ART. ", "Both were developed from the principles of Kaplan's theory and delivered in HTC Vive™---a flagship consumer-friendly VR-HMD platform powered by an NVIDIA GeForce GTX 1070 graphic card. ", "As can be seen in [Table 1](#sensors-20-02208-t001){ref-type=\"table\"}, to have a fair comparison of both kinds of tasks, all set-ups were in their best form. ", "For example, head and limb movements were allowed in ST-ART tasks to achieve broader field of view and naturalistic interaction in the context of VR, while such movements were not allowed in CL-ART tasks to avoid the negative impact of serious motion artefacts on EEG. ", "In the meanwhile, except for \"extent\", we carefully kept other components identical. ", "The duration of both tasks was the same 30 min. ", "More technical details can be found in [Figure A1](#sensors-20-02208-f0A1){ref-type=\"fig\"}. ", "A few screenshots of ST-ART are presented in [Figure A2](#sensors-20-02208-f0A2){ref-type=\"fig\"}. ", "Additionally, a helpful video demo link for CL-ART can be found in [Appendix A](#app1-sensors-20-02208){ref-type=\"app\"} as well.", "\n\nFor CL-ART, EEG data were collected through an eight-channel wireless EEG recording device (StarStim 8™, Neuroelectrics Inc, Barcelona, Spain), which uses a high-resolution, high-speed analog-to-digital converter (24 bit at 500 sampling rate), and supports Bluetooth connection. ", "The conventional wet electrodes were used and placed at O1, Oz, and O2 regions, which are proven locations that are highly correlated with the user's vigilance level in the context of a real-time and real-world scenario \\[[@B38-sensors-20-02208],[@B39-sensors-20-02208]\\]. ", "The ground and reference electrodes were connected together and placed on the right earlobe using an ear clip. ", "An external electrode was placed below the lower eyelid to record eye movements. ", "The collected EEG data were firstly filtered using a 4--30-Hz bandpass filter and averaged across O1, Oz, and O2 channels. ", "Then, two types of EEG-based feedback (as shown in [Figure 1](#sensors-20-02208-f001){ref-type=\"fig\"}) were provided to participants: (1) real-time feedback, which was based on the values of relative α band power (RBP(α), see Equation (A1) in [Appendix A](#app1-sensors-20-02208){ref-type=\"app\"}) calculated every 2 s, indicating the dynamics of within-task vigilance level, and (2) punctuated feedback, which was based on the total counts of the values of 2-s RBP(α) being larger than 0.35 (35%) every 1 min, indicating the vigilance level between tasks. ", "The specific thresholds between tasks were weighted values of the highest counts of RBP(α) \\> 0.35, which were determined using min-by-min observations during the initial 3-min EEG baseline testing session. ", "The weights were 0.4, 0.6, and 0.8 for tasks 1, 2 and 3 respectively. ", "Here, the values of weights and the value of 0.35 were based on feedback from our pilot testing, in which the principle of selecting these values was that the participants should not consider it too easy or too difficult. ", "The lab streaming layer protocol \\[[@B40-sensors-20-02208]\\] was used to synchronize the vigilance level and the Unreal Engine-based virtual natural scenes.", "\n\n2.2. ", "Outcome Measures {#sec2dot2-sensors-20-02208}\n---------------------\n\nAs shown in [Table 2](#sensors-20-02208-t002){ref-type=\"table\"}, behavioral performance and EEG-based neural metrics captured during a perceptual discrimination task (visual oddball) that was executed before and after the two ART interventions were utilized as our outcome measures to assess the potential benefits of attention. ", "Specifically, the commonly used response time (RT) \\[[@B41-sensors-20-02208],[@B42-sensors-20-02208],[@B43-sensors-20-02208]\\] and event-related potential (ERP: P3b latency) \\[[@B44-sensors-20-02208]\\] were used to evaluate the general benefits of attention; then, the response time across trials (RTVar \\[[@B11-sensors-20-02208],[@B45-sensors-20-02208]\\]) and inter-trial coherence at the frontal midline theta band (ITC(θ) \\[[@B11-sensors-20-02208],[@B46-sensors-20-02208]\\]) were used to assess the attentional engagement. ", "Finally, the long-range frontal-posterior inter-electrode coherence at the theta band (IEC(θ)) was used to investigate the brain functional connectivity \\[[@B42-sensors-20-02208]\\].", "\n\n### 2.2.1. ", "Visual Oddball {#sec2dot2dot1-sensors-20-02208}\n\nFor oddball testing, we used the same EEG cap (i.e., StarStim 8™). ", "During the experiment, participants were instructed to keep their eyes fixated on a central fixation cross on the computer screen and keep their dominant-hand middle fingers on a home position on the keyboard until the appearance of a given stimulus type (target/distractor). ", "Upon the appearance of these stimuli, participants were instructed to press the \"enter\" key using their middle fingers if it was a target (horizontal zebra stripes on the center of the screen; see [Figure A3](#sensors-20-02208-f0A3){ref-type=\"fig\"} in [Appendix A](#app1-sensors-20-02208){ref-type=\"app\"}) and to not release their middle fingers from the home position if it was a distractor (vertical zebra stripes on the center of the screen). ", "In this kind of perceptual discrimination paradigm, the participant's voluntary attention is directed to a rarely presented target stimulus while their EEG response to the target stimulus is simultaneously recorded; therefore, the neural evidence of the restored voluntary attention can be investigated. ", "Each oddball task contained 300 trials and a ratio of 1/4 of target/distractor stimulus. ", "The two trial types were presented randomly with no more than four consecutive trial types of either kind in a row. ", "The inter-trial interval of 1500 ± 500 ms and a stimulus duration of 100 ms were used. ", "Thus, the total time for each oddball task was approximately 10 min.", "\n\n### 2.2.2. ", "EEG Data Pre-Processing {#sec2dot2dot2-sensors-20-02208}\n\nA low-pass filter with a cutoff frequency of 30 Hz and a high-pass filter with a cutoff frequency of 0.5 Hz were applied to remove power line noise and the direct current drift, respectively. ", "The filtered EEG signals were then corrected using the mean of each channel (including Ext, Fpz, Fz, Cz, Pz, O1, Oz, and O2), and decomposed into eight independent brain sources by independent component analysis (ICA). ", "The prominent artefactual components, such as eye blinks, eye movements, and muscle activity were removed by using ADJUST version 1.1 (an automatic algorithm for ICA-based EEG artefact removal \\[[@B47-sensors-20-02208]\\]). ", "Next, the target epochs of −1000 ms to +1000 ms were created and further cleaned of excessive peak-to-peak deflections, amplifier clippings, and other artefacts, using a voltage threshold of 100 μV. All neural metrics were calculated using custom Matlab™ scripts and EEGLab v14.1.2. (", "an open-source Matlab plugin developed by Swartz Center for Computational Neuroscience, La Jolla, CA, USA; <http://www.sccn.ucsd.edu/eeglab>).", "\n\n### 2.2.3. ", "P3b {#sec2dot2dot3-sensors-20-02208}\n\nERP time-locked to target trials were generated from the pre-processed EEG data recorded from participants while they performed the oddball task. ", "All ERPs were baseline-corrected using a −200 to 0 ms time period, with the window of interest interrogated being 250--600 ms post-stimulus for P3b---an ERP component which is hypothesized to reflect the allocation of attention resources \\[[@B44-sensors-20-02208]\\], and which was shown highly correlated with motor or cognitive action, such as pressing a button \\[[@B48-sensors-20-02208]\\]. ", "Given our focus on RT-based metrics for behavioral data, we focused on P3b latency in the Pz channel, which is the location where the P3b is commonly reported to reach its maximum amplitude \\[[@B49-sensors-20-02208]\\].", "\n\n### 2.2.4. ", "ITC(θ) and Long-Range IEC(θ) {#sec2dot2dot4-sensors-20-02208}\n\nITC is a measure that reflects the extent to which synchronization occurs from trial to trial in EEG at a particular frequency \\[[@B46-sensors-20-02208]\\]. ", "The frontal midline ITC in the theta frequency band, ITC(θ), is a widely used measure of electrophysiological response consistency \\[[@B11-sensors-20-02208],[@B50-sensors-20-02208]\\]. ", "Thus, we used it as our neural metric of the degree of attentional engagement. ", "Here, the theta frequency band (4--7 Hz) at the Fz channel and the phase-locking value (PLV~ITC~) were used as the input and output, respectively, in ITC(θ) analysis. ", "The values of PLV~ITC~ ranged anywhere between 0 and 1. ", "A larger value denotes perfect phase-locking synchronized across trials and, thus, a higher degree of attentional engagement.", "\n\nIEC is a commonly used measure of phase consistency across electrodes \\[[@B51-sensors-20-02208]\\]. ", "Here, we calculated the PLV of the theta frequency for Fz--Pz coherence (PLV~IEC~) as our neural metric of brain frontal-posterior functional connectivity. ", "Similarly, the values of PLV~IEC~ ranged anywhere between 0 and 1. ", "A larger value denotes perfect phase-locking synchronized across the Fz--Pz area and, thus, stronger brain frontal-posterior connectivity. ", "All ITC(θ) and IEC(θ) values were baseline-corrected using a −200 to 0 ms time period, with the window of interest interrogated being 0--700 ms post-stimulus, as average RTs occur \\<700 ms.", "\n\n2.3. ", "Participants, Procedure, and Statistical Analysis {#sec2dot3-sensors-20-02208}\n------------------------------------------------------\n\nA total of 50 interested students of SJTU signed up this study through online advertisements (where we named the designed virtual environment as \"*the deep space of SJTU for mind relaxation*\"). ", "All of them were screened online for moderate to high trait anxiety (a score greater than 40 on the trait-anxiety subscale of the State-Trait Anxiety Inventory questionnaire, STAI \\[[@B52-sensors-20-02208]\\]---a standard clinical measure of trait and state anxiety). ", "With two time points (\"before and after\" the ART interventions), two groups (ST-ART/CL-ART), five measurements (RT, RTVar, P3b latency, ITC(θ), and IEC(θ)), and assuming a moderate repeated measures correlation (*r* = 0.5) and 0.05 α level, we calculated that *n* = 30 would yield 93% power to detect a change with a medium effect size (0.5). ", "This effect size is not uncommon, as shown in Reference \\[[@B11-sensors-20-02208]\\].", "\n\nThus, a reasonable sample size (*n* = 30, 21.3 ± 1.58 years of age, 13 females) who met the trait anxiety criterion (STAI score: 48.1 ± 6.05) were further invited to schedule a lab session. ", "All participants had normal or corrected-to-normal vision, had no history of stroke, traumatic brain injury, or psychiatric illness, and were not taking psychotropic medication. ", "We only enrolled participants who did not have a history of VR experience to balance the impact of familiarity of user interface on task performance and neural metrics. ", "All participants were paid \\$15/h for their participation and gave written informed consent before participation.", "\n\nThe recruited 30 students were randomized to either the ST-ART group (control group, *n* = 15) or the CL-ART group (treatment group, *n* = 15) using a random number generator (seed =123, <https://stattrek.com/statistics/random-number-generator.aspx>). ", "Prior to virtual ART tasks, students completed the consent document and state-anxiety subscale of STAI. ", "After that, they were equipped with an EEG cap to practice for 2 min before doing the real visual oddball task. ", "Immediately after the oddball task, they put on the VR headset and were instructed to close their eyes for 3 min (i.e., sham/real baseline test for ST-/CL-ART tasks). ", "Then, the software guided them in a 5-min practice session before experiencing either 30-min ST-ART or CL-ART tasks. ", "After the ART tasks, they were instructed to take a 10-min break while the VR headset was taken off. ", "Immediately after the break time, they did the oddball task again.", "\n\nAll behavioral and neural data were analyzed using standard one-way repeated ANOVA with ART task types (ST/CL) as the between-subject factor, where behavioral and neural data refer to the difference before and after the same ART type. ", "We used the difference (diff) of \"before--after\" comparison if there was an expected decreased trend or \"after--before\" comparison if there was an expected increased trend (as shown in Equations (1) and (2)) to keep showing a positive difference. ", "Paired *t*-tests were used to further compare the impact of the within-subject factor (before/after the intervention) on participant performance and neural response. ", "All statistical analyses were done using SPSS 19.0 with an α level of 0.05. ", "$${{Metrics}\\_{Diff} = Metrics_{before} - Metrics_{after},}\\ {where\\ Metrics \\in \\ \\left\\{ {RT,\\ RTVar,\\ P3b\\ latency} \\right\\}}$$ $${{Metrics}\\_{Diff} = Metrics_{after} - Metrics_{before},}\\ {where\\ Metrics \\in \\left\\{ {ITC\\left( \\theta \\right),\\ IEC\\left( \\theta \\right)} \\right\\}}$$\n\n2.4. ", "Study Design {#sec2dot4-sensors-20-02208}\n-----------------\n\nThe study was designed in a double-blinded manner. ", "Double-blinding began at the point of recruitment, when all participants were informed that they were being recruited for a study designed to test the efficacy of software interventions for mind relaxation. ", "Thus, participants in both the CL-ART group and the ST-ART group thought that they were part of an active treatment group. ", "One study coordinator (S.H.Z.) was in charge of the group assignments. ", "M.Y.G. who collected data was blind to group assignment. ", "All data analysis was done by Z.K. and G.L.\n\n3. ", "Results {#sec3-sensors-20-02208}\n==========\n\nFirst of all, the results of anxiety level were analyzed, in order to investigate the consistency of \"compatibility\" element between ST-ART and CL-ART group. ", "Then, as shown in [Table 2](#sensors-20-02208-t002){ref-type=\"table\"}, the attention levels associated with behavioral metric, RT, and neural metric, P3b latency, are presented. ", "Next, we analyzed the attentional engagement using the behavioral metric, RTVar, and neural metric, ITC(θ). ", "It is important to note that the correlates of behavioral and neural metrics are presented. ", "Finally, IEC(θ) was analyzed to explore the brain functional connectivity between the two groups before and after the 30-min VR experience.", "\n\n3.1. ", "Anxiety Level {#sec3dot1-sensors-20-02208}\n------------------\n\nTo have a fair comparison, first of all, we analyzed the trait and state anxiety STAI scores between the ST-ART and CL-ART group. ", "As shown in [Figure 2](#sensors-20-02208-f002){ref-type=\"fig\"}a, there was no significant difference in both types of scores between the two groups (trait anxiety scores: F(1, 29) = 0.155, *p* = 0.697, mean (M) = 46.067 ± 1.714 for ST-ART and M = 47.067 ± 1.873 for CL-ART; state anxiety scores: F(1, 29) = 1.012, *p* = 0.323, M = 38 ± 2.434 for ST-ART and M = 41.2 ± 2.048 for CL-ART), indicating the same initial anxiety level or motivation (see \"compatibility\" element in [Table 1](#sensors-20-02208-t001){ref-type=\"table\"}) for each group. ", "Moreover, we found that the on-site state anxiety scores highly correlated with trait anxiety scores (*p* = 0.016, *r* = 0.434, see [Figure 2](#sensors-20-02208-f002){ref-type=\"fig\"}b), indicating the good consistency of the earlier sign-up session and later invited lab session.", "\n\n3.2. ", "Attention Level {#sec3dot2-sensors-20-02208}\n--------------------\n\nFor RT, we found a significant difference in P3b latency (F(1, 29) = 6.581, *p* = 0.016) between groups. ", "The paired *t*-test of P3b latency before and after CL-ART intervention (t(14) = 3.481, *p* = 0.004) further shows that participants responded, on average, 62 ms faster in the post-CL-ART oddball task (M = 377.733 ± 17.116 ms) than in the pre-CL-ART condition (M = 439.867 ± 8.964 ms), indicating the neural evidence of enhanced attention level. ", "This trend is clearly shown in [Figure 3](#sensors-20-02208-f003){ref-type=\"fig\"}a and b by comparing the grand average of P3b between ST-ART and CL-ART groups. ", "Furthermore, as shown in [Figure 3](#sensors-20-02208-f003){ref-type=\"fig\"}c, we found a significant correlation between RT difference and P3b difference (*p* = 0.002, *r* = 0.541), indicating the highly correlated behavioral and neural evidence.", "\n\n3.3. ", "Attentional Engagement {#sec3dot3-sensors-20-02208}\n---------------------------\n\nWe found a significant difference in RTVar data between groups (F(1, 29) = 4.256, *p* = 0.048), with M = 2.278 ± 10.532 ms for ST-ART and M = 25.932 ± 4.533 ms for CL-ART. ", "The paired *t*-test (*t*(14) = 5.721, *p* \\< 0.001) further reveals that participants responded with less variability in RT in the post-CL-ART oddball task (M = 50.929 ± 3.940 ms) if compared to the pre-CL-ART condition (M = 76.862 ± 4.335 ms), as shown in [Figure 4](#sensors-20-02208-f004){ref-type=\"fig\"}a. ", "Moreover, we observed that there was a most prominent difference in averaged values at 300--400 ms post-stimulus ITC(θ) between groups (F(1, 29) = 14.215, *p* = 0.001). ", "Such a group difference in ITC(θ), as shown in [Figure 4](#sensors-20-02208-f004){ref-type=\"fig\"}b, was found by comparing the 100-ms bins one by one in our time window of interest (see [Table 3](#sensors-20-02208-t003){ref-type=\"table\"}). ", "These behavioral and neural findings indicate that CL-ART may be indeed superior to ST-ART for improving attentional engagement. ", "The highly correlated RTVar difference and ITC(θ) difference (*p* = 0.01, *r* = 0.463; see [Figure 4](#sensors-20-02208-f004){ref-type=\"fig\"}c) further reveals the robustness of these findings.", "\n\n3.4. ", "Brain Functional Connectivity (IEC(θ)) {#sec3dot4-sensors-20-02208}\n-------------------------------------------\n\nSimilar to ITC(θ), we investigated each 100-ms bin in our time window of interest (see [Table 4](#sensors-20-02208-t004){ref-type=\"table\"}); however, no significant difference in IEC(θ) was observed, indicating that there was no prominent improvement in frontal-posterior brain functional connectivity following the two kinds of ART experience.", "\n\n4. ", "Discussion {#sec4-sensors-20-02208}\n=============\n\n4.1. ", "Comparison to Prior Work {#sec4dot1-sensors-20-02208}\n-----------------------------\n\nPreviously, the enhancement of general attention level was observed using traditional ART intervention and behavior-based metrics within a reported duration of as short as 15 min \\[[@B53-sensors-20-02208]\\] or as long as weeks or years \\[[@B54-sensors-20-02208],[@B55-sensors-20-02208]\\]. ", "The upgrade from traditional ART intervention to this closed-loop approach aims to study EEG-based neural metrics and further verify the feasibility of improving attentional engagement by enhancing one of the restorative components, \"extent\".", "\n\nThe present findings reveal that the attentional engagement is improved in young adults when a single 30-min ART-inspired closed-loop intervention is used as opposed to a standard ART intervention, evidenced via both behavioral and EEG-based neural metrics. ", "This more engaging closed-loop approach was actually accompanied by improved sensitivity and greater fidelity in assessing cognitive abilities \\[[@B56-sensors-20-02208]\\]. ", "This was especially important when these abilities were often assessed with validated pencil-and-paper approaches or, now more commonly with these same paradigms deployed on either desktop or laptop computers, in a format that regularly reveals low test sensitivity in children \\[[@B56-sensors-20-02208],[@B57-sensors-20-02208]\\]. ", "In addition, the neural evidence-based attentional benefits occurring in such a short time period were observed in another study \\[[@B58-sensors-20-02208]\\], in which the author reported that feedback training of α rhythms resulted in fMRI-proved changes in brain networks after a single 30-min session (i.e., the exactly same time period of intervention with current study). ", "However, the difference between the current study and Reference \\[[@B58-sensors-20-02208]\\] is that (1) we used ART-based natural scenes as a feedback paradigm rather than effort-demanding racing game, and (2) we used EEG to investigate the trial-to-trial neural metrics in attentional engagement instead of fMRI-based changes in brain structure or network. ", "Of course, these approaches are not mutually exclusive; they are complementary, and participants will likely achieve the most beneficial outcomes if they use them concurrently. ", "For example, the brain functional connectivity measured by IEC(θ) could perhaps be improved by using more effort-demanding tasks instead of ART-like natural scenes.", "\n\n4.2. ", "Significance for Future Study {#sec4dot2-sensors-20-02208}\n----------------------------------\n\nThe present findings demonstrate that the closed-loop personalized Virtual ART intervention achieved a higher degree of engagement compared to conventional Virtual ART intervention, highlighting the importance of real-time neurofeedback between human and virtual environment. ", "This exploratory study is especially pertinent given that Jyoti et al. ", "recently proposed the next generation of cognitive training approach that incorporates rapid, real-time, performance-driven, adaptive task challenges and performance feedback \\[[@B59-sensors-20-02208]\\]. ", "More importantly, with the development of miniatured bio-sensors and wireless VR-HMD, a unique and novel commercial VR platform \\[[@B60-sensors-20-02208]\\], which combines EEG recording and eye-tracking technologies, emerged to facilitate Jyoti's idea. ", "Although this study was conducted in healthy adults only, related work demonstrated that populations with physical and intellectual disabilities can benefit from VR in capturing and maintaining attention \\[[@B61-sensors-20-02208],[@B62-sensors-20-02208]\\]. ", "Thus, the findings presented here have practical implications for assessing attention-related diseases, including sensory processing dysfunction \\[[@B63-sensors-20-02208]\\], attention deficit hyperactivity disorder \\[[@B64-sensors-20-02208]\\], and mild impaired cognition \\[[@B65-sensors-20-02208]\\] in the context of clinical research. ", "Given that previous work \\[[@B63-sensors-20-02208],[@B64-sensors-20-02208],[@B65-sensors-20-02208]\\] showed the feasibility of using 2D-based attention assessments and interventions for these diseases, we surmise that the use of a more engaging and enjoyable VR-HMD may indeed follow a similar or even better results.", "\n\n4.3. ", "Limitations and Conclusion {#sec4dot3-sensors-20-02208}\n-------------------------------\n\nWhile the improvements on attention level and attentional engagement were observed during a 10-min perceptual discrimination task (visual oddball) carried out 10 min after the CL-ART intervention, no conclusions can be made regarding the long-lasting effects of the observed attentional benefits. ", "Moreover, without accompanying MRI neuroimaging to assess the neural mechanisms of the observed intervention effects, it is not possible to make strong conclusions as to the neural underpinnings of the CL-ART effects. ", "Therefore, follow-up studies driven by the positive findings reported here are planned with (1) larger and more diverse populations, (2) advanced neuroimaging technologies, and (3) a greater variety of perceptual discrimination tasks.", "\n\nTo our knowledge, this is the first study to quantitatively evaluate the impact of the \"extent\" component on user attentional engagement after ST-ART and CL-ART interventions that were delivered on a consumer-friendly PC-powered VR-HMD platform with both behavioral and EEG measurements. ", "The experimental results support the conclusion that the CL-ART tasks may indeed be superior to ST-ART tasks in terms of user engagement. ", "This is especially pertinent given that a total of 14.35 million VR-HMD units were sold in 2017 to 2019 worldwide \\[[@B66-sensors-20-02208]\\], highlighting the oncoming wave of such accessible technology for researchers and clinicians to utilize these tools in ways never before achieved. ", "Furthermore, if one takes advantage of the burgeoning all-in-one VR-HMD platform (e.g., Oculus Quest), the benefits of this closed-loop ART approach can be extended to larger numbers and more diverse populations.", "\n\nThe authors specially thank Hongwei Liu, from the Shanghai Zaichen Intelligent Technology, Co., Ltd., for his technical support in advanced VR programming for this study.", "\n\nConceptualization, G.L. and S.Z.; methodology, G.L. and S.Z.; software, G.L.; validation, S.Z., Z.K., and M.G.; formal analysis, G.L. and S.Z.; investigation, G.L. and S.Z.; resources, G.L. and S.Z.; writing---original draft preparation, G.L., S.Z., Z.K., and M.G.; writing---review and editing, G.L.; supervision, G.L.; project administration, G.L.; funding acquisition, G.L. All authors read and agreed to the published version of the manuscript.", "\n\nThis research was sponsored by the Shanghai Sailing Program under Grant 17YF1426900.", "\n\nThe authors declare no conflicts of interest.", "\n\nThis appendix contains some technical details about the Virtual ART, supplementary figures from Virtual ART and oddball tasks, and a link for the demo video of CL-ART.", "\n\n1.", " Technical Details about Virtual ART\n\nThe contact quality of EEG electrodes and scalp was color-coded in a software, called NIC (NE^TM^), which pairs with the EEG recording device (black: no signal; red: very poor signal; orange: fair signal; green: good signal). ", "The collected EEG data were continuously displayed and stored on a PC by NIC. ", "In the meanwhile, the C++ version of the lab streaming layer (LSL) protocol was used to transfer the EEG data from NIC to the Unreal game engine, and then the RBP(α) was calculated to control the natural scenes (see [Figure A1](#sensors-20-02208-f0A1){ref-type=\"fig\"} and Equation (A1)), where, Power is the fast Fourier transform (FFT) power, *z~i~* = {θ, α, β}. ", "Figure A1The data flowchart of the combined VR--EEG system. ", "$$RBP(\\alpha) = \\frac{Power\\left( \\alpha \\right)}{\\sum\\limits_{i = 1}^{3}{Power\\left( Z_{i} \\right)}} \\times 100\\%$$\n\n2.", " Supplementary Figures for Virtual ART\n\n{#sensors-20-02208-f0A2}\n\n3.", " Video Demo for CL-ART\n\nAvailable online: <https://www.youtube.com/watch?v=2vSbK_QS_kE>\n\n4.", " Supplementary Figures for Visual Oddball Tasks\n\n{#sensors-20-02208-f0A3}\n\n{#sensors-20-02208-f001}\n\n{#sensors-20-02208-f002}\n\n{#sensors-20-02208-f003}\n\n###### \n\n(**a**) Paired *t*-test and subject means for RTVar; (**b**) the group grand average for ITC captured before and after the two kinds of ART interventions; as can be seen here, the highest phase-locking value (PLV; deep red) in the \"after CL-ART\" condition occurred in the bin of 200--300 ms, which was clearly faster than that in the bin of 300--400 ms in other conditions; (**c**) scatter plots for RTVar difference and ITC difference.", "\n\n![](", "sensors-20-02208-g004a)\n\n![](", "sensors-20-02208-g004b)\n\nsensors-20-02208-t001_Table 1\n\n###### \n\nComparison of standard attention restoration theory (ST-ART) and closed-loop attention restoration theory (CL-ART) tasks.", "\n\n Restorative Components Virtual ART Tasks \n ---------------------------------- ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n **Being away** Secluded home surrounded by snowy mountain, meadows, and pool. ", " \n **Soft Fascination** Morning (clouds and fog), afternoon (snowing), and night (cricket sound and aurora), as well as a shared scene from morning to night: motion of cherry blossom in the breeze. ", " \n **Compatibility** Anxious university students who voluntarily participated in this study. ", " \n **Extent** **Task 1 (for morning scene)** The thickness of fog is randomized. ", "VR controller is used to capture stones on the table and throw them into the pool one by one. ", " The thickness of fog is controlled by EEG at 2-s interval. ", "Wireless Xbox 360 joystick is used to walk around in any accessible virtual space while relaxing mind to make fog vanish.", "\n **Reward** Bright sun makes fog vanish and task 2 starts. ", " The degree of snow is controlled by EEG at 2-sec interval. ", " \n **Task 2 (for afternoon scene)** VR controller is used to turn on the music player on the table, listening to classic music while walking around (by teleport function) in any accessible virtual space until the end of music. ", " Wireless Xbox 360 joystick is used to walk around in any accessible virtual space while relaxing mind to turn on the music player on the table, listening to classic music until the end of music. ", " \n **Reward** Once the music is played, the default light snow converts into heavy snow. ", "By the end of music, heavy snow stops and task 3 starts. ", " The snow stops and task 3 starts. ", " \n **Task 3 (for night scene)** No specific task, just walking around (by teleport function) in any accessible virtual space. ", " Wireless Xbox 360 joystick is used to walk around in any accessible virtual space while relaxing mind to call aurora. ", " \n Reward Aurora appears. ", "The range of the aurora is randomized, updating every 2 s. Aurora appears. ", "The range of the aurora is controlled by EEG at 2-s interval. ", " \n\nsensors-20-02208-t002_Table 2\n\n###### \n\nSummary of outcome measures. ", "RT---response time; ITC---inter-trial coherence; IEC---inter-electrode coherence.", "\n\n Task Types of Measure Implications \n -------------------- ------------------ ------------------------------- -------------------------\n **Visual oddball** RT P3b latency General attention level\n RTVar ITC(θ) Attentional engagement \n / IEC(θ) Brain functional connectivity \n\nsensors-20-02208-t003_Table 3\n\n###### \n\nSummary of one-way ANOVA analysis results for ITC(θ) difference.", "\n\n Bins (ms) *p*-Value PLV (Mean ± Standard Error) \n ----------- ----------- ----------------------------- ----------------\n 0--100 0.002 0.042 ± 0.167 0.027 ± 0.011\n 100--200 0.199 −0.035 ± 0.032 0.026 ± 0.034\n 200--300 0.031 −0.102 ± 0.058 0.075 ± 0.052\n 300--400 0.001 0.041 ± 0.042 −0.202 ± 0.493\n 400--500 0.008 0.032 ± 0.043 −0.175 ± 0.058\n 500--600 0.678 −0.021 ± 0.052 −0.051 ± 0.050\n 600--700 0.898 −0.050 ± 0.048 −0.042 ± 0.038\n\nsensors-20-02208-t004_Table 4\n\n###### \n\nSummary of one-way ANOVA analysis results for IEC(θ) difference.", "\n\n Bins (ms) *p*-Value PLV (Mean ± Standard Error) \n ----------- ----------- ----------------------------- ----------------\n 0--100 0.179 0.034 ± 0.026 −0.027 ± 0.035\n 100--200 0.149 0.068 ± 0.032 −0.021 ± 0.051\n 200--300 0.487 0.047 ± 0.031 −0.006 ± 0.067\n 300--400 0.467 −0.004 ± 0.043 0.054 ± 0.066\n 400--500 0.797 0.036 ± 0.043 0.055 ± 0.058\n 500--600 0.841 0.053 ± 0.053 0.070 ± 0.050\n 600--700 0.724 0.014 ± 0.045 0.035 ± 0.038\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0009391900966875255, 0.0006452755187638104, 0.0005954765947535634, 0.0011886797146871686, 0.000556296668946743, 0.0006284323171712458, 0.0005432477337308228, 0.0007203957648016512, 0.0008683880441822112, 0.0007998340297490358, 0.0013363665202632546, 0.0007056930335238576, 0.0007853673305362463, 0.0006422633305191994, 0.0006554726278409362, 0.0006370870396494865, 0.0005573655944317579, 0.0006350637995637953, 0.000610503600910306, 0.0005616058479063213, 0.0005538954283110797, 0.0006125473300926387, 0.0005574500537477434, 0.0006148375105112791, 0.0007068052073009312, 0.0005819610087200999, 0.0006678912322968245, 0.000732804590370506, 0.0006602375651709735, 0.0005895057111047208, 0.0006377103854902089, 0.0006272114114835858, 0.0006585656083188951, 0.000722993747331202, 0.0007098405039869249, 0.0005882203695364296, 0.0006029962678439915, 0.0007665400044061244, 0.0006266288110055029, 0.0010624415008351207, 0.0015540133463218808, 0.0006460194708779454, 0.0006209239363670349, 0.000647430308163166, 0.00053550791926682, 0.0006090416572988033, 0.001185585861094296, 0.000888017239049077, 0.0006691970629617572, 0.0006418695556931198, 0.0006379669066518545, 0.0005611994420178235, 0.0006371316849254072, 0.0005827419809065759, 0.0006585844676010311, 0.0005494977813214064, 0.0005834833718836308, 0.0005390558508224785, 0.0005941285053268075, 0.0006078096921555698, 0.0010214496869593859, 0.000643588718958199, 0.0006495295092463493, 0.0006233708118088543, 0.0006011921213939786, 0.0006817241082899272, 0.0005561045254580677, 0.00065669632749632, 0.0013893843861296773, 0.0005921421688981354, 0.0006255240296013653, 0.0006012872327119112, 0.004997250158339739, 0.0006136801093816757, 0.00069241359597072, 0.0005812658346258104, 0.0006719079101458192, 0.0007316033588722348, 0.0005922745913267136, 0.000592994736507535, 0.0007444469956681132, 0.006000085733830929, 0.0007298259297385812, 0.0006549234385602176, 0.0006640588981099427, 0.000607856607530266, 0.0006101516773924232, 0.00623721769079566, 0.0007152846083045006, 0.0006861701258458197, 0.0005695329164154828, 0.005907760467380285, 0.0005881486576981843, 0.0006258621579036117, 0.0005549126653932035, 0.0005878827068954706, 0.0006327999872155488, 0.0005488905590027571, 0.0006007931078784168, 0.0006696758791804314, 0.000621018058154732, 0.0006842557922936976, 0.0006214713212102652, 0.0013590181479230523, 0.0005945229786448181, 0.0005881646648049355, 0.0005993570084683597, 0.0005798067431896925, 0.0005780889769084752, 0.0017468451987951994, 0.0005639262963086367, 0.0006792658241465688, 0.0006456406554207206, 0.0005712283309549093, 0.001008979743346572, 0.0008171985973604023, 0.000666084059048444, 0.0005845006089657545, 0.0007634013891220093, 0.0005735012819059193, 0.0005926811718381941, 0.0006208997219800949, 0.0005809429567307234, 0.026160908862948418, 0.0006851657526567578, 0.0005747732939198613, 0.0006105198990553617, 0.000594537181314081, 0.001691664569079876, 0.0006297400104813278, 0.0006033926620148122, 0.0005909095052629709, 0.0005637430585920811, 0.0005386308766901493, 0.0005654559354297817, 0.0011082945857197046, 0.0005915829096920788, 0.0006037799175828695, 0.0005550874629989266, 0.0013830555835738778, 0.0006919779116287827, 0.000713300600182265, 0.0005983285373076797, 0.0005763268563896418, 0.0013750585494562984, 0.0007401584880426526, 0.0007316545816138387, 0.0005700238980352879, 0.0006043158937245607, 0.0006125111249275506, 0.0006447628256864846, 0.0013624530984088778, 0.0006633251905441284, 0.0012900278670713305, 0.0008832006715238094, 0.0006650323630310595, 0.0006140059558674693, 0.0006807761383242905, 0.0005923990975134075, 0.0005920468247495592, 0.0005658341106027365, 0.000615437573287636, 0.0005604479229077697, 0.0006177480099722743, 0.0012962599284946918, 0.000684061145875603, 0.0006430016364902258, 0.0006129321991465986, 0.0005845914129167795, 0.0007207456510514021, 0.0008025649003684521, 0.0005676724249497056, 0.0013141067465767264, 0.000667962827719748, 0.0007406325894407928, 0.0006608576513826847, 0.00055410509230569, 0.0005973487277515233, 0.0005990497884340584, 0.0006201069336384535, 0.0005389199359342456, 0.0007014186703599989, 0.0005921944393776357, 0.0006135830190032721, 0.0006044083274900913, 0.0009391900966875255, 0.0005735807935707271, 0.0005983219598419964, 0.000627910892944783, 0.0006062819738872349, 0.031328801065683365, 0.0007089400314725935, 0.0007933022570796311, 0.0007018409087322652, 0.0008483878336846828, 0.000846793525852263, 0.0006875027902424335, 0.0007254162337630987, 0.0007025322411209345, 0.0012735376367345452, 0.0007895811577327549, 0.0006564820068888366, 0.005426361691206694, 0.0005918448441661894, 0.0005899117677472532, 0.0007938432972878218, 0.0007633693749085069, 0.0008571064681746066, 0.001290264306589961, 0.0018962972098961473, 0.0008917633094824851, 0.0006689104484394193, 0.0010102459928020835, 0.0009013685630634427, 0.0007833301206119359, 0.0011483829002827406, 0.0006024112226441503, 0.0008362660300917923, 0.0009202596847899258, 0.0006321390392258763, 0.000649407273158431, 0.000658828008454293, 0.0005952459177933633, 0.0007598146330565214, 0.00219187350012362, 0.007566635496914387 ]

[ "Menu\n\nTag Archives: how to sew a bustle\n\nCongratulations to the lovely couple Bao & Jessica. ", "It is an honor to watch them grow up, serve God with all their hearts, fall in love, and now fulfill the sacrament of marriage. ", "Thank you for sharing your big day with us. #", "itsjessabaotime\n\nBelow is the tutorial on how to bustle Jessica’s wedding gown as well as how I created the bustle. ", "If you have any questions, please do not hesitate to ask." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006560701294802129, 0.0010532968444749713, 0.00058989436365664, 0.0009338728850707412, 0.0005899528041481972 ]

[ "Η αντίστροφη μέτρηση για την αύξηση του κατώτατου μισθού άρχισε. ", "Το τελευταίο 10ήμερο του μήνα αναμένεται να ξεκινήσει η διαδικασία αναπροσαρμογής, η οποία βάσει του ισχύοντος πλαισίου, θα ολοκληρωθεί έως τα τέλη Ιουνίου. ", "Πού εκτιμάται ότι θα κινηθεί η αύξηση και πόσους αφορά.", "\n\nΗ προεκλογική δέσμευση της Ν.Δ. έκανε λόγο για αύξηση του κατώτατου μισθού στα 703 ευρώ μέσα στην επόμενη τριετία. ", "Η κυβέρνηση έχει επανειλημμένα επισημάνει ότι στοχεύει σε αυξήσεις διπλάσιες του ρυθμού ανάπτυξης, ενώ πρόσφατα και ο κεντρικός τραπεζίτης, Γιάννης Στουρνάρας, εμφανίστηκε θετικός στο ενδεχόμενο μίας αύξησης, που θα συνδέεται με τους ρυθμούς της παραγωγικότητας.", "\n\nΜε δεδομένο ότι ο επίσημος στόχος στον προϋπολογισμό κάνει λόγο για ρυθμούς ανάπτυξης 2,8% το 2020, ενώ η ΤτΕ και άλλοι οργανισμοί κατεβάζουν ελαφρώς τον πήχη στο 2,2% με 2,5%, τα σενάρια τοποθετούν το ύψος της αύξησης κοντά στο 5%. ", "Εάν επιβεβαιωθούν θα μιλάμε για μία αύξηση της τάξης των 32 ευρώ στα 682 ευρώ.", "\n\nΆμεσα ενδιαφερόμενοι περισσότεροι από 700.000 εργαζόμενοι του ιδιωτικού τομέα, που αμείβονται με τον κατώτατο μισθό των 650 ευρώ για πλήρη απασχόληση ή εργάζονται με συμβάσεις μερικής απασχόλησης και απολαβές ακόμη και κάτω των 500 ευρώ μηνιαίως, οι οποίες όμως εξαρτώνται απο το ύψος του κατώτατου μισθού.", "\n\nΤα οφέλη δεν επηρεάζονται ωστόσο για αυτούς. ", "Με τον κατώτατο μισθό συνδέονται και περισσότερα από 20 επιδόματα, μεταξύ των οποίων το επίδομα ανεργίας, το επίδομα αφερεγγυότητας εργοδότη και τα επιδόματα μαθητείας και ασκούμενων φοιτητών.", "\n\nΌσο για τις ασφαλιστικές εισφορές των αυτοαπασχολούμενων που με την προηγούμενη αύξηση του κατώτατου μισθού ακολούθησαν την ανιούσα, από 1/1/2020 έχουν αποσυνδεθεί από την αύξηση του κατώτατου μισθού και επομένως δεν επηρεάζονται.", "\n\nΗ πρόταση του ΣΥΡΙΖΑ\n\nΠρόταση νόμου για την αύξηση του κατώτατου μισθού κατά 7,5%, τόσο το 2020 όσο και το 2021, κατέθεσε ο ΣΥΡΙΖΑ.", "\n\nΣυγκεκριμένα, στην αιτιολογική έκθεση ο ΣΥΡΙΖΑ αναφέρεται στις μειώσεις στις οποίες προχώρησε το 2012 η κυβέρνηση ΝΔ- ΠΑΣΟΚ, οι οποίες «όχι μόνο δεν κατόρθωσαν να περιορίσουν τη συνεχώς αυξανόμενη ανεργία, η οποία προσέγγισε το 28% συνολικά και ξεπέρασε το 60% στους νέους αλλά επιδείνωσαν ραγδαία την ποιότητα των θέσεων εργασίας με την Ελλάδα να καταλαμβάνει το 2015 μία από τις χαμηλότερες θέσεις μεταξύ των κρατών-μελών της ΕΕ».", "\n\nΟ ΣΥΡΙΖΑ θυμίζει ότι το 2019 πρόεβη σε αύξηση του κατώτατου μισθού κατά 11%, όπως και στην κατάργηση του υποκατώτατου μισθού για τους νέους.", "\n\nΗ διαδικασία\n\nΤριμελής επιτροπή συντονισμού της διαβούλευσης (ο πρόεδρος του ΟΜΕΔ, εκπρόσωπος του υπουργείου Οικονομικών και εκπρόσωπος του υπουργείου Εργασίας) πρέπει να αποστείλει πρόσκληση προς εξειδικευμένους φορείς (ΤτΕ, ΕΛΣΤΑΤ, ΟΑΕΔ, ινστιτούτα ΓΣΕΕ, ΓΣΕΒΕΕ, ΕΣΕΕ, ΣΕΤΕ καθώς και τα ΙΟΒΕ και ΚΕΠΕ) ώστε να συντάξουν έκθεση αξιολόγησης του ισχύοντος κατώτατου μισθού και ημερομισθίου.", "\n\nΟι εκθέσεις πρέπει να υποβληθούν έως τις 31 Μαρτίου στην επιτροπή διαβούλευσης, η οποία με τη σειρά της θα αποστείλει τον φάκελο στους εκπροσώπους των κοινωνικών εταίρων. ", "Οι τελευταίοι θα υποβάλουν υπόμνημα με τις θέσεις τους.", "\n\nΗ επιτροπή συγκενρώνει εκθέσεις και υπομνήματα και τα κοινοποιεί έως τις 15 Απριλίου. ", "Στις 30 Απριλίου) το σύνολο των στοιχείων θα αποσταλεί στον Κέντρο Προγραμματισμού και Οικονομικών Ερευνών, το οποίο θα πρέπει να συντάξει το τελικό πόρισμα διαβούλευσης, σε συνεργασία με πενταμελή επιτροπή σοφών. ", "Το πόρισμα θα σταλεί στους υπουργούς Οικονομικών και Εργασίας έως 31 Μαΐου. ", "Ο υπουργός Εργασίας λαμβάνοντας υπόψη το πόρισμα θα εισηγηθεί στο υπουργικό συμβούλιο το ύψος της αύξησης." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0009234273456968367, 0.001110387034714222, 0.0011488336604088545, 0.0010709423804655671, 0.0009835459059104323, 0.0013694042572751641, 0.0008491635089740157, 0.0011283206986263394, 0.0009059151052497327, 0.0009128807578235865, 0.001084789982996881, 0.0010627639712765813, 0.0014509574975818396, 0.0010499521158635616, 0.001222770195454359, 0.001040531089529395, 0.0009861603612080216, 0.0008519684779457748, 0.001019348856061697, 0.0013685619924217463, 0.0010213319910690188 ]

[ "In vitro alternatives for the detection of photoirritant chemicals: The EEC/COLIPA trial.", "\nThe effects of UV irradiation on the cytotoxicities of selected chemicals were investigated in cultures of Balb/c 3T3 cells, normal human keratinocytes and Jurkat cells. ", "The chemicals were chosen according to their reported photoirritancy, or lack thereof, and the abilities of the in vitro tests to distinguish between these photoirritants and non-photoirritants were assessed. ", "The data obtained suggest that the neutral red uptake assay with Balb/c 3T3 cells can be used to provide some indication of the potential photoirritancy of these particular chemicals. ", "However, similar results were also obtained using the human keratinocytes and these should provide a more relevant in vitro model for investigating mechanisms of chemical-induced photoirritation." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0005669486708939075, 0.0006833558436483145, 0.0006400970160029829, 0.0005993515951558948, 0.0005642354371957481 ]

[ "Data room\n\nData rooms are spaces used for housing data, usually of a secure or privileged nature. ", "They can be physical data rooms, virtual data rooms, or data centers. ", "They are used for a variety of purposes, including data storage, document exchange, file sharing, financial transactions, legal transactions, and more.", "\n\nIn mergers and acquisitions, the traditional data room will literally be a physically secure continually monitored room, normally in the vendor’s offices (or those of their lawyers), which the bidders and their advisers will visit in order to inspect and report on the various documents and other data made available. ", "Often only one bidder at a time will be allowed to enter and if new documents or new versions of documents are required these will have to be brought in by courier as hardcopy. ", "Teams involved in large due diligence processes will typically have to be flown in from many regions or countries and remain available throughout the process. ", " Such teams often comprise a number of experts in different fields and so the overall cost of keeping such groups on call near to the data room is often extremely high. ", " Combating the significant cost of physical datarooms is the virtual data room, which provides for the secure, online dissemination of confidential information. ", "\n\nA virtual data room (VDR) is essentially a website with limited controlled access (using a secure log-on supplied by the vendor/authority which can be disabled at any time by the vendor/authority if a bidder withdraws) to which the bidders and their advisers are given access. ", "Much of the information released will be confidential and restrictions should be applied to the viewers' ability to release this to third parties by forwarding, copying or printing. ", "Digital rights management is sometimes applied to control information.", "\n\nDetailed auditing must be provided for legal reasons so that a record is kept of who has seen which version of each document.", "\n\nData rooms are commonly used by legal, accounting, investment banking and private equity companies performing mergers and acquisitions, fundraising, insolvency, corporate restructuring, and joint ventures including bio-technology and tender processes.", "\n\nReferences\n\nCategory:Data management\nCategory:Rooms" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0006476315320469439, 0.0006470824009738863, 0.0005706563824787736, 0.000550592492800206, 0.0007361738244071603, 0.0005200355080887675, 0.0006224799435585737, 0.0007279085693880916, 0.0007194276549853384, 0.0005199044244363904, 0.0006028138450346887, 0.0005386898410506546, 0.0006007530610077083, 0.0006161797209642828 ]

[ "A man charged with shooting a rival gang member to death Tuesday night in the Northwest Side Hermosa neighborhood has been ordered held without bond.", "\n\nRaul Martinez, 24, has been charged with one count of first-degree murder in connection with the shooting death of 28-year-old Robert Roseneau Tuesday night.", "\n\nRoseneau was standing in front of a residence in the 2000 block of North Pulaski about 10:30 p.m. when someone walked up and shot him several times, according to Chicago Police and the Cook County medical examiner’s office.", "\n\nNearby officers on patrol saw Martinez running from the scene of the shooting and drop a handgun, police said. ", "He was arrested in the 4000 block of West Armitage after a short foot chase.", "\n\nDuring a bond hearing Thursday, Martinez’s defense attorney said he completed 11th grade and has a child on the way.", "\n\nJudge Peggy Chiampas ordered Martinez, of the 1400 block of South Canal, held without bond.", "\n\nPolice Supt. ", "Eddie Johnson has pointed to Martinez as a glaring example of the need for the justice system to hold gun offenders with extensive felony records more accountable, the Chicago Sun-Times is reporting.", "\n\nMartinez, who was paroled from prison in January, is a member of the Orchestra Albany gang, police said. ", "Rosenau, 28, was a member of the Latin Counts, a rival gang. ", "Both have been arrested many times.", "\n\nCourt records show Martinez has gone in and out of prison and violated his parole conditions over and over between 2011 and 2016. ", "He served about half of his three-year prison term in 2014 for being a felon in possession of a gun.", "\n\n“The long and violent histories of those involved in this senseless case of gun violence demonstrate the problem Chicago Police officers face every day in their efforts to make our neighborhoods safer,” Johnson said.", "\n\nBoth men are well-known to the Chicago Police Department. ", "They were on a computer-generated list of people deemed to be at high risk of getting shot or being a shooter.", "\n\n“CPD will continue to use tools like our Strategic Subject List to identify and work with the less than 1 percent of residents who are driving the violence in Chicago, while at the same time demanding more from the criminal justice system to hold these individuals accountable, so they cannot continue to torment our communities,” Johnson said.", "\n\nSeveral pieces of legislation are pending in the General Assembly to get tougher on gun offenders. ", "For years, the mayor’s office, the Chicago Police and the Cook County state’s attorney’s office have pushed for tougher gun laws, only to get rejected in Springfield.", "\n\nMartinez was featured in the Chicago Sun-Times’ Pulitzer Prize winning series on the “no-snitch” code in Chicago. ", "He was a friend of a teenage murder victim but refused to cooperate fully with detectives trying to solve the case, the story documented.", "\n\nOn Monday night, officers were in the neighborhood near Pulaski and Armitage when they heard gunshots, said Anthony Guglielmi, chief spokesman for the police department. ", "They saw Martinez running west across the street with a handgun in his left hand, Guglielmi said.", "\n\n“People yelled at the officers — ‘Hey, get that guy’ — as he ran into an alley,” Guglielmi said. “", "He dropped a .45-caliber Rock Island handgun.” ", "Later, the cops found the victim on the ground, shot several times.", "\n\nRoseneau was taken to Advocate Illinois Masonic Medical Center, where he was pronounced dead just after 11 p.m. Monday, officials said. ", "He was the 180th murder victim of 2016 compared with 122 people who were killed in 2015 through May 2.", "\n\nMartinez has 36 arrests on his rap sheet, police said. ", "He was convicted of three felonies in the past seven years.", "\n\nCourt records show he was found guilty of robbery in 2009 and sentenced to boot camp at the Cook County Jail.", "\n\nIn early 2011, he went to prison on a four-year sentence for possession of a stolen vehicle. ", "He was paroled in August 2012.", "\n\nIn 2013, Martinez violated his parole when he was arrested on a charge of being a felon in possession of a gun.", "\n\nHe was sent back to prison for three months to complete his stolen vehicle sentence as he awaited trial on the gun charge.", "\n\nIn January 2014, Judge Nicholas Ford sentenced him to a three-year sentence on the gun charge. ", "He was paroled in that case in March 2015.", "\n\nThen he violated his parole in that case by associating with gang members. ", "Judge William Raines sentenced him to jail for two days.", "\n\nIn October 2015, he violated his parole again when he was arrested for reckless conduct and associating with gang members.", "\n\nHe was sent back to prison and was released on parole in January 2016.", "\n\nRosenau also was convicted of three felonies, including robbery in 2005; burglary in 2007; and aggravated battery on a police officer in 2012. ", "He was sentenced to three years in prison for that crime, court records show.", "\n\n“They were certainly on CPD’s radar,” Guglielmi said. “", "These guys were identified by the department as individuals who could be involved in gun violence. ", "The violence is isolated to a very small subset of the population who go in and out the doors of the criminal justice system.”" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.011158904060721397, 0.003235075855627656, 0.0023297001607716084, 0.000753249041736126, 0.0012898760614916682, 0.0010730456560850143, 0.0011132948566228151, 0.007502900902181864, 0.0008854205370880663, 0.0007589480374008417, 0.00476163811981678, 0.0006003583548590541, 0.0009888526983559132, 0.02782830037176609, 0.0008093806100077927, 0.0006161503843031824, 0.0014027319848537445, 0.0006496685091406107, 0.000981357879936695, 0.0007249835762195289, 0.0006736930808983743, 0.0010397502919659019, 0.0008142153965309262, 0.0010828169761225581, 0.010874119587242603, 0.0007171253673732281, 0.02240016683936119, 0.0007436397718265653, 0.011145837604999542, 0.004481567535549402, 0.0012381202541291714, 0.0012694012839347124, 0.007344283163547516, 0.0006027374765835702, 0.007978123612701893, 0.0055113802663981915, 0.001395703642629087, 0.0005842068349011242, 0.02206050418317318, 0.008289261721074581, 0.010567552410066128, 0.002030337695032358, 0.0013781662564724684, 0.006575275212526321, 0.0009256167686544359, 0.0010316937696188688, 0.0007370354142040014 ]

[ "Q:\n\nVivaldi's \"The Four Seasons\", Who Chose the Title?", "\n\nDid Vivaldi himself choose the title \"The Four Seasons\" and the titles for each of the four concerti, or they're chosen by publishers?", "\n\nA:\n\nLe quattro stagioni is the original title of this work, which translates to 'The four seasons'. ", "This title was indeed chosen by Vivaldi himself, who deliberately composed the pieces to reflect the mood of each season.", "\nThe wikipedia article sums the titles up pretty nicely!", "\n\nA:\n\nVivaldi's Four Seasons is one of the best and earliest examples in music history of what is called programmatic music or tone poems. ", "The instrumental music was written by Vivaldi to tell a specific story which has accompanying words that are written down, not sung.", "\nVivaldi chose the titles for each movement. ", "Vivaldi wrote four poems, one for each movement, in Italian, which describe the meaning behind the music in each movement and which were part of the original publication of the sheet music. ", "\nMore importantly, within the sheet music itself, at specific places, Vivaldi wrote in phrases and sentences from the poems that describe the scenes and characters that the music is supposed to evoke, in order to give direction to the musicians.", "\nYou can see a facsimile of some pages from a published score in Google Books at this link. ", "Scroll through the pages and you can see Vivaldi's text descriptions attached to the music, in Italian and partial English translation.", "\nHere is a screen shot from the beginning of the Spring sonata.", "\n\nThe Italian text reads: \"The birds celebrate her [Spring's] return with festive song, and murmuring streams are softly caressed by the breezes.\"", "\nHere is a web page that gives the texts of the four sonnets in the original Italian and in English translation. ", "\nhttp://www.baroquemusic.org/vivaldiseasons.html\n(It is generally believed that Vivaldi wrote these poems, although it is possible that his original publishing company commissioned someone else to write them; regardless, they have always been regarded as a proper part of the sheet music itself.)", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006537591689266264, 0.0006330132018774748, 0.0006914037512615323, 0.000634058378636837, 0.000554166326764971, 0.0006751076434738934, 0.0006954951677471399, 0.0006741747492924333, 0.0006166579551063478, 0.0005994730163365602, 0.0005764111992903054, 0.0005865858984179795, 0.0006152111454866827, 0.0005604743491858244, 0.0005938524845987558, 0.000588766997680068, 0.001995444530621171 ]

[ "Q:\n\nAJAX Session called twice. ", "It doesn't show an alert the second time\n\nI have an AJAX session that gets called once on page load and again after a click. ", "It's not getting a readystate change the second time so I decided to test it by putting an alert box in the function. ", "The alert box shows up on the page load. ", "But on the click it doesn't show up - get this - even though the PHP side executes. ", "More puzzling is that if I try to measure the readystate it never appears (not 0,1,2,3 or 4 - an alert box won't even show up), and I don't get an return text.", "\nWhat I ultimately am trying to achieve is for the xmlhttp.responseText to return a value like it does on the page load. ", "What am I missing?", "\nJavaScript:\n\nfunction ajaxSession()\r\n{\r\nalert();\r\nxmlhttp = undefined;\r\nif (window.", "XMLHttpRequest)\r\n {// code for IE7+, Firefox, Chrome, Opera, Safari\r\n xmlhttp=new XMLHttpRequest();\r\n }\r\nelse\r\n {// code for IE6, IE5\r\n xmlhttp=new ActiveXObject(\"Microsoft.", "XMLHTTP\");\r\n }\r\nxmlhttp.onreadystatechange=function()\r\n {\r\n if (xmlhttp.readyState==4 && xmlhttp.status==200)\r\n {\r\n z = xmlhttp.responseText;\r\n }\r\n }\r\n}\r\n\r\nfunction stateCheck()\r\n{\r\najaxSession();\r\nxmlhttp.open('POST', thisurl + '/favoritecheck.php',false);\r\nxmlhttp.setRequestHeader('Content-type','application/x-www-form-urlencoded');\r\nxmlhttp.send(\"0=\" + perform + \"&1=\" + thisplace + \",&2=\" + thisusername);\r\n}\r\n\r\n\r\nfunction firstCheck()\r\n{\r\nperform = 0;\r\nstateCheck();\r\n if (z == 'found')\r\n {\r\n document.getElementById(\"favorite\").src=\"http://www.********.com/images/favorite-on.png\";\r\n document.getElementById(\"favtext\").innerHTML=\"This is a favorite!\";", "\r\n }\r\n if ( z == 'nouser')\r\n {\r\n perform = 1;\r\n stateCheck();\r\n }\r\n}\r\n\r\nfunction heartCheck()\r\n{\r\nperform = 2;\r\nstateCheck();\r\n if (z == 'added')\r\n {\r\n document.getElementById(\"favorite\").src=\"http://www.********.com/images/favorite-on.png\";\r\n document.getElementById(\"favtext\").innerHTML=\"This is a favorite!\";", "\r\n }\r\n if (z == 'subtracted')\r\n {\r\n document.getElementById(\"favorite\").src=\"http://www.********.com/images/favorite-off.png\";\r\n document.getElementById(\"favtext\").innerHTML=\"Add to your favorites.\";", "\r\n }\r\n}\r\n\r\n\r\n\r\nif (loggedin == 1)\r\n{\r\ndocument.writeln('<img id=\"favorite\" style=\"cursor: pointer;\" onclick=\"heartCheck()\" src=\"http://www.********.com/images/favorite-off.png\" alt=\"Favorite\" />'\r\n+ '<br />'\r\n+ '<div id=\"favtext\" style=\"color: #D20425;\">'\r\n+ 'Add to your favorites.'", "\r\n+ '</div>');\r\nfirstCheck();\r\n} else if (loggedin == 0)\r\n{\r\ndocument.writeln('<img id=\"favorite\" style=\"cursor: pointer;\" src=\"http://www.********.com/images/favorite-off.png\" alt=\"Favorite\" />'\r\n+ '<br />'\r\n+ '<div id=\"favtext\" style=\"color: #D20425;\">'\r\n+ '<a style=\"color: #800000; font-weight: bold;\" href=\"' + thisurl + '/wp-login.php\">Log in</a> to add favorites.'", "\r\n+ '</div>');\r\n}\n\nPHP:\n\n<?", "php\r\n\r\ninclude('connect.php');\r\n\r\n$salt = \"********\";\r\n\r\n$perform = $_POST[0];\r\n$place = $_POST[1];\r\n$user = $_POST[2];\r\n$usercrypt = crypt(md5($user),$salt);\r\n$placeid = trim($place,\",\");\r\n\r\nfunction checkNow()\r\n{\r\nglobal $usercrypt;\r\nglobal $place;\r\nglobal $conn;\r\n$urow = mysqli_query($conn, \"SELECT Users.", "User FROM Users WHERE Users.", "User='\" . ", "$usercrypt . \"';\");", "\r\n if (mysqli_num_rows($urow) > 0)\r\n {\r\n $favcheck = mysqli_query($conn, \"SELECT Users.", "Favorites FROM Users WHERE Users.", "User='\" . ", "$usercrypt . \"';\");", "\r\n $favcheck = mysqli_fetch_array($favcheck);\r\n $favcheck = $favcheck[0];\r\n if (strpos($favcheck, $place) !", "== false)\r\n {\r\n $answer = 'found';\r\n }\r\n else\r\n {\r\n $answer = 'notfound';\r\n }\r\n }\r\n else\r\n {\r\n $answer = 'nouser';\r\n }\r\nreturn array($answer,$favcheck);\r\nunset($answer);\r\n}\r\n \r\nif ($perform == \"0\")\r\n{\r\n$sendback = checkNow();\r\necho $sendback[0];\r\nunset($sendback);\r\n}\r\n\r\nif ($perform == \"1\")\r\n{\r\nglobal $usercrypt;\r\nglobal $conn;\r\nmysqli_query($conn, \"INSERT INTO Users (User) VALUES ('\" . ", "$usercrypt . \"')\");", "\r\n}\r\n\r\nif ($perform == \"2\")\r\n{\r\n$sendback = checkNow();\r\nglobal $place;\r\nglobal $placeid;\r\nglobal $usercrypt;\r\nglobal $conn;\r\n$currentnum = mysqli_query($conn, \"SELECT Places.", "Favorites FROM Places WHERE Places.", "PlaceID=\" . ", "$placeid);\r\n$currentnum = mysqli_fetch_array($currentnum);\r\n$currentnum = $currentnum[0];\r\n if ($sendback[0] == 'found')\r\n {\r\n $currentnum--;\r\n $change = str_replace($place,'',$sendback[1]);\r\n mysqli_query($conn, \"UPDATE Users SET Favorites='\" . ", "$change . \"' ", "WHERE User = '\" . ", "$usercrypt . \"'\");", "\r\n mysqli_query($conn, \"UPDATE Places SET Places.", "Favorites=\" . ", "$currentnum . \" ", "WHERE Places.", "PlaceID =\" . ", "$placeid);\r\n $answer = 'subtracted';\r\n }\r\n if ($sendback[0] == 'notfound')\r\n {\r\n $currentnum++;\r\n $change = $sendback[1] . ", "$place;\r\n mysqli_query($conn, \"UPDATE Users SET Favorites='\" . ", "$change . \"' ", "WHERE User = '\" . ", "$usercrypt . \"'\");", "\r\n mysqli_query($conn, \"UPDATE Places SET Places.", "Favorites=\" . ", "$currentnum . \" ", "WHERE Places.", "PlaceID =\" . ", "$placeid);\r\n $answer = 'added';\r\n }\r\nreturn $answer;\r\nunset($answer);\r\n}\r\n\r\nunset($_POST);\r\n\r\n?", ">\n\nA:\n\nThe value of z will be evaluated before the xmlhttp object receives the readystate change. ", "You need to put all the code that deals with the returned value into a onreadystatechange function itself, since that is the only function which is guaranteed to be called after you receive an asynchronous response.", "\nYou could do something like this:\nvar xmlhttp = false;\n// The rest of your code, but remove the `onreadystatechange` assignment from ajaxSession()\n// ...\n// ...\nfunction heartCheck() {\n perform = 2;\n stateCheck();\n xmlhttp.onreadystatechange = function() {\n z = xmlhttp.responseText;\n if (z == 'added')\n {\n document.getElementById(\"favorite\").src=\"http://www.********.com/images/favorite-on.png\";\n document.getElementById(\"favtext\").innerHTML=\"This is a favorite!\";", "\n }\n if (z == 'subtracted')\n {\n document.getElementById(\"favorite\").src=\"http://www.********.com/images/favorite-off.png\";\n document.getElementById(\"favtext\").innerHTML=\"Add to your favorites.\";", "\n }\n }\n}\n\nAnd you'd need to do a handler like that for each time you want to evaluate the AJAX response.", "\nIt'd also be most clear to declare the global variables at the beginning of the script like I did above--as @jeroen mentions, it's not explicitly required, but it's good practice and will help you keep track of scope. ", "It's confusing that z is only defined inside the xmlhttp.onreadystatechange function, yet you're using it throughout the script globally. ", "So a simple tip is to put var z = '' at the beginning of your JavaScript to make your intentions clearer (both to yourself and to others who may be viewing your code :))\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0005772898439317942, 0.0007701327558606863, 0.0005948288016952574, 0.0006843692390248179, 0.0008197399438358843, 0.000851184711791575, 0.000711910193786025, 0.0009813907090574503, 0.0007914737798273563, 0.0008893292979337275, 0.0017156359972432256, 0.001255208277143538, 0.0008528075413778424, 0.0007082376978360116, 0.0007887670653872192, 0.0007977189961820841, 0.0010632144985720515, 0.0006953970878385007, 0.0007310524815693498, 0.0012036218540742993, 0.000934369454625994, 0.0006221893709152937, 0.0007310524815693498, 0.0012036218540742993, 0.2180003970861435, 0.002908353926613927, 0.001099094864912331, 0.0007636374793946743, 0.000645215914119035, 0.0007001698249951005, 0.0008371593430638313, 0.0008845599368214607, 0.0007034436566755176, 0.0009109678212553263, 0.0006435822579078376, 0.000693942594807595, 0.0009696488850750029, 0.0009025106555782259, 0.0007001698249951005, 0.0009548526722937822, 0.0006359617691487074, 0.0008845599368214607, 0.0007034436566755176, 0.0009109678212553263, 0.0006435822579078376, 0.000693942594807595, 0.0009696488850750029, 0.0009025106555782259, 0.0007001698249951005, 0.0009981651091948152, 0.0007362734759226441, 0.0007406530785374343, 0.0011774516897276044, 0.0008528075413778424, 0.000612039293628186, 0.0005284806829877198, 0.0006282841204665601, 0.0006714419578202069 ]

[ " IN THE COURT OF APPEALS OF TENNESSEE\n AT NASHVILLE\n November 6, 2009 Session\n\n DOJI, INC. ", "D/B/A DEMOS' STEAK AND SPAGHETTI HOUSE v. JAMES\nG. NEELEY, COMMISSIONER, TENNESSEE DEPARTMENT OF LABOR\n & WORKFORCE DEVELOPMENT EMPLOYMENT SECURITY\n DIVISION AND ANDREA T. RUFFIN\n\n Appeal from the Chancery Court for Rutherford County\n No. ", "08-1353-MI Robert E. Corlew, III, Chancellor\n\n\n\n No. ", "M2009-00822-COA-R3-CV - Filed December 30, 2009\n\n\nA fired employee filed for unemployment benefits. ", "The former employer opposed the benefits,\nmaintaining that the employee was fired for misconduct. ", "The Department of Labor and Workforce\nDevelopment initially found for the employer and the employee appealed. ", "After a hearing, the\nAppeals Tribunal found for the employee. ", "The employer appealed. ", "The Board of Review affirmed\nthe Appeals Tribunal’s decision. ", "The employer appealed to the chancery court, which vacated the\nadministrative decision due to evidentiary issues and remanded the matter. ", "On remand, the Board\nof Review considered the evidence in question and reaffirmed its earlier decision. ", "The employer\nappealed to the chancery court, which affirmed the Board of Review. ", "The employer appealed again.", "\nWe affirm the chancery court’s decision.", "\n\n Tenn. R. App. ", "P. 3 Appeal as of Right; Judgment of the Chancery Court Affirmed\n\nANDY D. BENNETT , J., delivered the opinion of the court, in which FRANK G. CLEMENT , JR. ", "and\nRICHARD H. DINKINS, JJ., ", "joined.", "\n\nBenjamin Henry Bodzy and M. Kim Vance, Nashville, Tennessee, for the appellant, Doji, Inc. d/b/a\nDemos' Steak and Spaghetti House.", "\n\nAndrea T. Ruffin, Nashville, Tennessee, Pro Se; Lindsey Owusu Appiah and Angela Spinella\nBonovich, Nashville, Tennessee, for the appellee, James G. Neeley.", "\n\nAnne C. Martin, Nashville, Tennessee, for the Amicus Curiae, National Federation of Independent\nBusiness Small Business Legal Center.", "\n\f OPINION\n\n BACKGROUND\n\n On May 4, 2007, Andrea Ruffin was fired from her job as a server for DOJI, Inc., which does\nbusiness as Demos’ Steak House (“Demos’”). ", "She seeks unemployment benefits and is opposed by\nDemos’, who claims she was fired for misconduct and, therefore, should not receive unemployment\nbenefits.", "\n\n Ruffin worked for Demos’ for almost two years. ", "She achieved a Level 5 server status, the\nhighest ranking a server could achieve. ", "However, Demos’ received several customer complaints\nabout Ruffin’s service. ", "John Ramm, the area supervisor, testified that she was discharged for\nexcessive customer complaints. ", "He said that the complaints varied, “but mostly would translate into\nneglect. ", "Forgetting something, ignoring requests, not delivering things in the proper order.", "”1 Ruffin\nwas suspended for one week for poor service. ", "After she returned, Demos’ received another customer\ncomplaint about her serving. ", "This complaint was “the last straw,” according to Ramm, and Ruffin\nwas fired.", "\n\n Ruffin filed a claim for unemployment benefits and Demos’ opposed it. ", "The Department of\nLabor and Workforce Development (“Department”) agreed with Demos’ and initially found that\nRuffin was fired for misconduct. ", "Ruffin appealed, and the Appeals Tribunal held a telephone\nhearing on June 8, 2007. ", "On June 11, 2007, the Appeals Tribunal ruled that Ruffin should receive\nunemployment benefits because Demos’ did not prove misconduct. ", "Demos’ appealed to the Board\nof Review, which affirmed the Appeals Tribunal. ", "Demos’ filed a petition for review with the\nchancery court. ", "The court found that the Board of Review and the Appeals Tribunal did not consider\nthe customer comment cards because they were hearsay. ", "Since the chancery court determined that\nthe cards should have been considered, the court vacated the administrative decision and remanded\nthe matter to the Board of Review for reconsideration. ", "The Board reconsidered and still affirmed\nthe Appeals Tribunal, maintaining that the comment cards were unreliable and noting that the\nclaimant denied the conduct and her supervisor did not remember it. ", "Demos’ appealed to the\nchancery court again, which affirmed the decision of the Board of Review. ", "Demos’ now appeals to\nthis court.", "\n\n STANDARD OF REVIEW\n\n The standard of review employed by appellate courts in unemployment compensation cases\nis the same as the one employed by the trial courts. ", "DePriest v. Puett, 669 S.W.2d 669, 673 (Tenn.\nCt. ", "App. ", "1984). ", "Unlike other civil appeals governed by Tenn. R. App. ", "P. 13(d), there is no\npresumption of correctness in these cases. ", "Wallace v. Sullivan, 561 S.W.2d 452, 453 (Tenn. 1978).", "\nThe court may reverse, remand, or modify the administrative decision if it is:\n\n\n\n 1\n Demos’ has a Twelve Step Procedure servers must follow.", "\n\n -2-\n\f (A) In violation of constitutional or statutory provisions;\n\n (B) In excess of the statutory authority of the agency;\n\n (C) Made upon unlawful procedure;\n\n (D) Arbitrary or capricious or characterized by abuse of discretion or clearly unwarranted\n exercise of discretion; or\n\n (E) Unsupported by evidence that is both substantial and material in the light of the entire\n record.", "\n\nTenn. Code Ann. § ", "50-7-304(i)(2). ", "For purposes of (E), substantial and material evidence is “such\nrelevant evidence as a reasonable mind might accept to support a rational conclusion and such as to\nfurnish a reasonably sound basis for the action under consideration.” ", "Sweet v. State Technical Inst.", "\nat Memphis, 617 S.W.2d 158, 161 (Tenn. Ct. ", "App. ", "1981) (quoting Pace v. Garbage Disposal Dist.,", "\n390 S.W.2d 461, 463 (Tenn. Ct. ", "App. ", "1965)).", "\n\n ANALYSIS\n\n Ruffin was fired for providing poor service to Demos’ customers. ", "The first issue we must\naddress is whether providing poor service to Demos’ customers is misconduct. ", "An unemployment\nbenefits claimant who is discharged due to misconduct connected with the claimant’s work is\ndisqualified from receiving benefits. ", "Tenn. Code Ann. § ", "50-7-303(a)(2)(A). ", "There was no definition\nof misconduct in the unemployment compensation statutes at the time Ruffin was fired.2 The\nTennessee Supreme Court has stated: “[I]n order to establish a disqualification there must be shown\na material breach of some duty which the employee owes to the employer.” ", "Cherry v. Suburban\nMfg. ", "Co., 745 S.W.2d 273, 275 (Tenn. 1988). ", "Case law further indicates that “misconduct” includes:\n\n conduct evincing such wilful and wanton disregard of an employer's interests as is\n found in deliberate violations or disregard of standards of behavior which the\n employer has the right to expect of his employee, or in carelessness or negligence of\n such degree or recurrence as to manifest equal culpability, wrongful intent or evil\n design, or to show an intentional and substantial disregard of the employer's interests\n or of the employee's duties and obligations to the employer. ", "On the other hand mere\n inefficiency, unsatisfactory conduct, failure in good performance as the result of\n inability or incapacity, inadvertences or ordinary negligence in isolated instances, or\n good faith errors in judgment or discretion are not to be deemed “misconduct” within\n the meaning of the statute.", "\n\n\n\n 2\n A definition of “misconduct” has been added to the unemployment compensation statutes, effective January\n1, 2010, by Chapter 479 of the 2009 Public Acts of Tennessee.", "\n\n -3-\n\fArmstrong v. Neel, 725 S.W.2d 953, 956 (Tenn. Ct. ", "App. ", "1986) (citing Boynton Cab Co. v. Neubeck,\n296 N.W. 636, 640 (Wis. 1941)).", "\n\n For this court to uphold “the Board of Review’s application of the provisions of the statute,\nwe need not find that its construction is the only reasonable one or even that it is the result we would\nhave reached had the question arisen in the first instance in a judicial proceeding.” ", "Sabastian v.\nBible, 649 S.W.2d 593, 594 (Tenn. Ct. ", "App. ", "1983). ", "Our reviewing function is limited. “", "All that is\nneeded to support the commission's interpretation is that it has warrant in the record and a reasonable\nbasis in law.” ", "Id. at 594-95 (citing Cawthron v. Scott, 400 S.W.2d 240, 242 (Tenn. 1966)). ", "After\na review of the record, we are convinced that the sporadically poor quality of service provided by\nRuffin to Demos’ customers is not the sort of deliberate violation of an employer’s policies that\nconstitutes misconduct within the meaning of the unemployment statutes.", "\n\n Next Demos’ argues that the Appeals Tribunal, the Board of Review, and the chancery court\ndid not consider the customer comment cards.3 The Board of Review found that “comment cards\nare not a reliable form of hearsay and have limited credibility.” ", "It then affirmed its prior decision.", "\nThe chancery court noted that the record reflects that the customer comment cards were considered\nby the administrative body, which then upheld its prior decision. ", "The court also properly noted that\nuncorroborated hearsay cannot be the sole evidence of the employee’s wrongful acts. ", "Green v.\nNeeley, No. ", "M2006-00481-COA-R3CV, 2007 WL 1731726, at *5 (Tenn. Ct. ", "App. ", "June 15, 2007).4\nFurthermore, the court cannot substitute its judgment for that of the administrative body “as to the\nweight of the evidence on questions of fact.", "”5 Tenn. Code Ann. § ", "50-7-304(i)(3). ", "The comment\ncards were considered and found insufficient to alter the Board’s decision. ", "Demos’ argument in this\nregard is without merit.", "\n\n\n\n 3\n From the record, it appears that the Appeals Tribunal was not involved in the reconsideration of the comment\ncards after the remand from the chancery court.", "\n\n 4\n Demos’ argues that the cards were corroborated by Ruffin’s failure to refute them. ", "She testified that she did\nnot remember the incidents and that she only knew of three comment cards about her. ", "These statements do not\ncorroborate the truthfulness of the allegations on the comment cards. ", "Similarly, Demos’ argument that Ruffin’s testimony\nthat she was fired because of the comment cards somehow corroborates the allegations in the comment cards is fallacious.", "\nAdmitting she was fired because of the comment cards in no way validates the truthfulness of the allegations on the\ncomment cards.", "\n\n 5\n The Board of Review stated that “[c]ustomer cards are not a reliable form of hearsay and have limited\ncredibility.” ", "Then the Board said, “Some customers are unreasonable and can include blatant untruths with no recourse\nfor the accused employee.” ", "Demos’ attacks the Board’s determination that the cards have limited credibility by arguing\nthat there is no evidence that the customer cards offered by Demos’ as evidence were untruthful. ", "Of course, despite the\nfact that the cards were admitted into evidence without objection, there is no evidence that the customer cards were\ntruthful either. ", "No supervisor testified that he or she witnessed the incidents. ", "This is why the chancery court referred\nto the cards as uncorroborated. ", "Furthermore, “[c]ourts defer to the decisions of administrative agencies when they are\nacting within their area of specialized knowledge, experience, and expertise.” ", "Wayne County v. Tenn. Solid Waste\nDisposal Control Bd., ", "756 S.W .2d 274, 279 (Tenn. Ct. ", "App. ", "1988). ", "W e decline to reverse the Board’s decision based\non this one statement.", "\n\n -4-\n\f Demos’ also argues that the administrative bodies and the chancery court did not consider\nthe personnel records. ", "In the chancery court’s earlier decision, it held that “the personnel records\nwere admissible as a business record under the Rules of Evidence, as an exception to the general rule\nthat hearsay evidence is excluded.” ", "Upon reconsideration, the Board of Review did not mention the\npersonnel records as such, but did refer to “contemporaneous notes written by claimant’s supervisor\nconcerning reprimands.” ", "The Board also stated, “The evidence, including those previously-\nmentioned documents ruled admissible by the Chancellor, does not prove misconduct.” ", "Clearly, the\nBoard was aware of the chancellor’s decision and the personnel records. ", "The records did not\npersuade the Board to rule in Demos’ favor, and we cannot substitute our judgment for that of the\nBoard “as to the weight of the evidence on questions of fact.” ", "Tenn. Code Ann. § ", "50-7-304(i)(3).", "\nDemos’ argument is without merit.", "\n\n The record reflects that when the Board of Review reconsidered Ruffin’s appeal after the\nchancery court remand, it did so in a meeting where 151 cases were decided in 125 minutes. ", "Demos’\nmaintains that this fact shows capriciousness “by definition.” ", "This court has defined the term\n“capricious” as describing something that “‘shocks’ the sense of justice and indicates a lack of fair\nand careful consideration.” ", "Brown v. W. Elec. ", "Co., C.A. No. ", "683, 1986 WL 11806, at *6 (Tenn. Ct.", "\nApp. ", "Oct. 24, 1986). ", "In our opinion, mere evidence of rapid decision-making is not sufficient to\novercome the long-established principle that state officials are presumed to do their duty. ", "See\nCummings v. Beeler, 223 S.W.2d 913, 916 (Tenn. 1949); Rogers v. Jennings’ Lessee, 11 Tenn. 308,\n309 (1832); Byrd v. Bradley, 913 S.W.2d 181, 183-84 (Tenn. Ct. ", "App. ", "1995). ", "The Board of Review\nis authorized to make its decision “on the basis of the evidence previously submitted in the case . .", "\n. .” ", "Tenn. Code Ann. § ", "50-7-304(e)(1). ", "The Board’s decision reflects that the record was reviewed,\nand nothing in the appellate record contradicts this.", "\n\n Finally, Demos’ maintains that the Department’s legal position is contrary to public policy\nbecause it requires service sector employers to subpoena customers to administrative proceedings.", "\n“The public policy of the state is to be found in its constitution, statutes, judicial decisions and\napplicable rules of the common law.” ", "State ex rel. ", "Swann v. Pack, 527 S.W.2d 99, 112 n.17 (Tenn.\n1975)) (citing Home Beneficial Ass’n. ", "v. White, 177 S.W.2d 545, 546 (Tenn. 1944)), cert. ", "denied,\n424 U.S. 954 (1976); see also Purkey v. Am. ", "Home Assurance Co., 173 S.W.3d 703, 705 (Tenn.\n2005). ", "The employer has the burden of proving an employee’s disqualification. ", "Weaver v. Wallace,\n565 S.W.2d 867, 870 (Tenn. 1978). ", "Thus, the employer must provide evidentiary support to justify\nthe disqualification. ", "That can be done through testimony or reliable documentary evidence. ", "Demos’\noffered no eye-witness to Ruffin’s alleged misconduct. ", "Ruffin did not admit misconduct. ", "The\ncustomer cards produced were hearsay. ", "As this court has previously said:\n\n “Although hearsay is admissible in administrative hearings, uncorroborated hearsay\n does not constitute substantial and material evidence.” ", "Estate of Milton v. Comm’r,\n Tenn. Dep’t of Employment Sec., ", "No. ", "03A01-9710-CH-00449, 1998 WL 282919, at\n *2 (Tenn. Ct. ", "App. ", "May 19, 1998). ", "Thus, “hearsay testimony and documents may be\n used, if properly qualified for admission, to corroborate other testimony of the\n wrongful acts of the claimant, but not as the sole evidence of his or her wrongful\n\n\n -5-\n\f acts.” ", "Johnson v. Neel, No. ", "86-150-II, 1986 WL 14039, at *3 (Tenn. Ct. ", "App. ", "Dec.\n 12, 1986).", "\n\nGreen, 2007 WL 1731726, at *5. ", "Hearsay has traditionally been viewed with skepticism in our legal\nsystem because it is unreliable and unchallengeable:\n\n By definition, hearsay involves an out-of-court statement used in court to prove the\n truth of the matter asserted in the out-of-court statement. ", "The primary concern is that\n the trier of fact will not be able to hear cross-examination of the declarant, who made\n the out-of-court hearsay statement. ", "In addition, the hearsay declarant’s statement is\n presented to the trier of fact, but the declarant often is not present and therefore not\n subject to the oath to tell the truth. ", "Another concern is that, since the trier of fact will\n not be able to observe the demeanor of the declarant, it will be difficult to assess the\n accuracy of the declarant’s statement.", "\n\nNeil P. Cohen et al., ", "TENNESSEE LAW OF EVIDENCE § 8.01[3][a] (5th ed. ", "2005) (footnote omitted).", "\nRecognized exceptions to the ban on hearsay exist where the hearsay statements “bear sufficient\nindicia of reliability and trustworthiness to warrant admission.” ", "State v. Henry, 33 S.W.3d 797, 801\n(Tenn. 2000).", "\n\n Demos’ problem is not the Department acting contrary to public policy. ", "Rather, because\nhearsay cannot be the sole evidence of Ruffin’s misconduct, Demos’ failed to prove misconduct.", "\n CONCLUSION\n\n The chancery court is affirmed. ", "Costs of appeal are assessed against Doji, Inc. d/b/a Demos’\nSteak and Spaghetti House, the appellant, for which execution may issue if necessary.", "\n\n\n ___________________________________\n ANDY D. BENNETT, JUDGE\n\n\n\n\n -6-\n\f" ]

{ "pile_set_name": "FreeLaw" }

[ 0.000641450984403491, 0.0006677270284853876, 0.0007071249419823289, 0.0026065835263580084, 0.0017324333311989903, 0.00055665522813797, 0.0007282752194441855, 0.0006780834519304335, 0.0006245979457162321, 0.0006499258452095091, 0.0005714118597097695, 0.0006608617259189487, 0.0007195916259661317, 0.0005706897936761379, 0.0014025158016011119, 0.000677346542943269, 0.0007496142643503845, 0.0007680807029828429, 0.0006170929991640151, 0.0006755089852958918, 0.0006011016084812582, 0.000685506674926728, 0.0031495343428105116, 0.0006544411880895495, 0.0007016335730440915, 0.0007008506800048053, 0.0006659580394625664, 0.0006398322875611484, 0.0007709780475124717, 0.001209600013680756, 0.0008168210042640567, 0.00839243270456791, 0.002111351815983653, 0.0009510891395621002, 0.0006331327022053301, 0.0013223157729953527, 0.000586995854973793, 0.0006447978666983545, 0.0007700865971855819, 0.0005532419891096652, 0.0006563981878571212, 0.0005914272624067962, 0.000853937875945121, 0.0006125169456936419, 0.0011724153300747275, 0.000847632298246026, 0.0007612597546540201, 0.0008699267054907978, 0.0006476010312326252, 0.0007670428021810949, 0.0006164490478113294, 0.0007504287641495466, 0.0009002137230709195, 0.0007310824003070593, 0.0006329088355414569, 0.0010776699054986238, 0.0009021057630889118, 0.000847632298246026, 0.002599996980279684, 0.0009012130904011428, 0.000847632298246026, 0.0008339328342117369, 0.0017549284966662526, 0.0014741765335202217, 0.0045519741252064705, 0.0009002137230709195, 0.0007016609888523817, 0.001507865614257753, 0.0027014627121388912, 0.0007650903426110744, 0.0014721698826178908, 0.0013740250142291188, 0.0008163202437572181, 0.0009000808349810541, 0.000847632298246026, 0.0006419359124265611, 0.0005945759476162493, 0.0009678975329734385, 0.000847632298246026, 0.0007721050642430782, 0.0006157168536446989, 0.0005794940516352654, 0.0008668039808981121, 0.0008694911957718432, 0.0006490487139672041, 0.0005563065060414374, 0.0005617779679596424, 0.0008549885242246091, 0.0008078707614913583, 0.0008053441997617483, 0.000847632298246026, 0.0006452134111896157, 0.0009681571973487735, 0.0007411116384901106, 0.0005627514910884202, 0.0006403737352229655, 0.0005799487698823214, 0.0009083746117539704, 0.0006535411812365055, 0.0006427268963307142, 0.0009300205274485052, 0.0007804016931913793, 0.001027887687087059, 0.0013606598367914557, 0.0012199425837025046, 0.0006106965593062341, 0.0007201232947409153, 0.0006644314271397889, 0.000842813344206661, 0.0011417778441682458, 0.0008411360904574394, 0.000847632298246026, 0.0007650250336155295, 0.0007963982643559575, 0.0005889454623684287, 0.0006209094426594675, 0.0006259972578845918, 0.0006713949260301888, 0.0005365788238123059, 0.0006400186684913933, 0.0009002137230709195, 0.0007411116384901106, 0.0007349509978666902, 0.0005951517960056663, 0.0007286904146894813, 0.000633963500149548, 0.0009297720389440656, 0.0008962434949353337, 0.0009553859708830714, 0.000847632298246026, 0.0007308779167942703, 0.0006355794030241668, 0.0008243584306910634, 0.000847632298246026, 0.0007688169716857374, 0.000584718189202249, 0.001870186417363584, 0.0009002137230709195, 0.0007212317432276905, 0.0005839949590153992, 0.0006794859655201435, 0.0005925066070631146, 0.0013644249411299825, 0.005647609476000071, 0.000991955166682601, 0.000923916173633188, 0.0006822716095484793, 0.0013177752261981368, 0.0007517249323427677, 0.000604962173383683, 0.0005787980044260621, 0.000995574751868844, 0.0015638325130566955, 0.0007053175359033048, 0.0006994301220402122, 0.0008247477235272527, 0.0013785817427560687, 0.000993583002127707, 0.000847632298246026, 0.000710539345163852, 0.0006828731275163591, 0.0008968401816673577, 0.0008760922937653959, 0.000847632298246026, 0.0007219077087938786, 0.0007269238121807575, 0.0007460396154783666, 0.0006295372149907053, 0.0008412867900915444, 0.0006372067728079855, 0.0007138000801205635, 0.0006895481492392719, 0.0006115369615145028, 0.0007388403173536062, 0.0008290506084449589, 0.0008347128168679774, 0.0013352432288229465, 0.0006132596754468977, 0.0006598868640139699, 0.0008696180302649736 ]

[ "---\nabstract: 'We study a spin system with both two- and four-spin exchange interactions on the triangular lattice as a possible model for the nuclear magnetism of solid $^3$He layers adsorbed on grafoil. ", "The ground state is analyzed by the use of the mean-field approximation. ", "It is shown that the four-sublattice state is favored by introduction of the four-spin exchange interaction. ", "A possible phase transition at a finite temperature into a phase with the scalar chirality is predicted. ", "Application of a magnetic field is shown to cause a variety of phase transitions.'", "\naddress: 'Institute of Physics, University of Tsukuba, Tsukuba, Ibaraki 305, Japan'\nauthor:\n- Kenn Kubo and Tsutomu Momoi\ntitle: 'Ground State of a Spin System with Two- and Four-spin Exchange Interactions on the Triangular Lattice '\n---\n\nIt is a great pleasure to dedicate this paper to Professor Wolfgang Götze for his sixtieth birthday, in whose research group at Max Planck Institut für Physik und Astrophysik and Die Technische Universität München one of the authors (K.K.) had the privilege to spend very pleasant and profitable years as a postdoctoral research associate, and to wish him many more happy years of activity in theoretical physics.", "\n\nIntroduction\n============\n\nNuclear magnetism of the two-dimensional $^3$He layers adsorbed on a grafoil has been a puzzle since Greywall and Busch reported the specific heat data at the coverage $\\rho = 0.178$ Å$^{-2}$.[@godfrin; @greywall89] At this coverage the adsorbed $^3$He atoms form two layers and each layer solidifies into a triangular lattice. ", "The first layer is a high-density solid and is considered not to contribute to the magnetism in the mK temperature region. ", "The specific heat data down to 2 mK showed a prominent peak at 2.5 mK as is expected from the conventional Heisenberg antiferromagnet (HAF) on the triangular lattice. ", "But integration of their data extrapolated linearly to lower temperatures indicated that a half of the total magnetic entropy will not be released down to the absolute zero temperature. ", "Elser proposed that the second layer forms a $\\sqrt{7} \\times \\sqrt{7}$ structure in registry with the first layer triangular lattice.[@elser89] Then it decomposes into inequivalent A and B sites which may be magnetically decoupled. ", "Since A sites form a kagomé lattice, he proposed that the missing entropy may be explained by the HAF on the kagomé lattice rather than that on the triangular lattice. ", "Inspired by this proposal many investigations were accomplished on the HAF on the kagomé lattice in recent years.[@kagome] According to numerical studies of finite clusters the kagomé HAF shows a second peak in the specific heat at a low temperature, which might compensate the missing entropy.[@elser89; @nakamura-m95] On the other hand, Roger showed for a cluster with 16 spins that a second peak can be also produced by effects of the multi-spin interactions which should be of considerable amount in solid $^3$He systems.[@roger90]\n\nRecent specific heat data down to 0.1mK at the coverage $\\rho = 0.180$ Å$^{-2}$, however, do not exhibit any sharp second peak in the temperature region where the kagomé HAF predicts.[@fukuyama96] Furthermore the estimate of the entropy released at temperatures above 0.1mK nearly exhausts the total magnetic entropy of the second layer. ", "The peak at $T\\simeq 2.5$ mK found by Greywall and Busch turned out to have a much broader tail in the low temperature region than was first thought. ", "It is clear that these features of recently obtained specific heat data cannot be explained in terms of either the HAF on the triangular lattice with nearest neighbor exchange couplings or that on the kagomé lattice. ", "So the behavior of the specific heat remains as a puzzle though there is not missing entropy any longer.", "\n\nIt is well known that magnetic interactions due to ring exchanges involving more than two spins are important in solid $^3$He. ", "The famous [*uudd*]{} state in bcc solid $^3$He is incorporated by the four-spin exchange interaction.[@roger-hd83] The exchange frequencies in bcc solid $^3$He computed by using the path-integral Monte Carlo method agree fairly well with estimates from experiments.[@ceperley-j87] For a monolayer of $^3$He at the coverage $\\rho = 0.0785$ Å$^{-2}$ on grafoil the cyclic-exchange frequencies were computed by Bernu et al.", " in a similar way.[@bernu-cl92] Their result shows that the three-spin exchange term predominates the others at this coverage and the high-temperature specific heat is governed by the two-, three- and four-spin exchange interactions while the six-spin exchange term as well is necessary to be taken into account to estimate the Weiss temperature properly.", "\n\nThe recent experimental results indicate that we have to take account of all spins in the second layer in order to understand its magnetism. ", "We assume that the difference between A and B sites causes negligible effects on the translational symmetry of the magnetic interactions and that the magnetism of the second layer may be described by an $S=1/2$ spin system on the regular triangular lattice. ", "We employ the Hamiltonian with the two-, three- and four-spin exchange interactions as an effective Hamiltonian for the second layer of adsorbed $^3$He, though no estimates of exchange frequencies were reported for the second layer so far. ", "This model may describe the $^3$He monolayer adsorbed on plated graphite as well.[@lusher-sc91; @siqueira-lcs93] Since three-spin exchange terms map into usual two-spin exchange couplings, the model is expressed by the two-parameter Hamiltonian $$\\begin{aligned}\n H = J\\sum_{<i,j>}^{\\rm n.n.}", "\n\\mbox{\\boldmath $\\sigma$}_{i}\\cdot\\mbox{\\boldmath $\\sigma$}_{j}\n% \n + K\\sum_{p}h_{p}, \n\\label{eq1}\\end{aligned}$$ where /2 is the nuclear spin of the $^3$He atom at the site $i$ and $\\sum_{p}$ denotes the sum over all possible diamonds composed of two nearest neighbor unit triangles. ", "The four-spin exchange term of the diamond $p$ depicted in Fig.", " 1(a) reads $$\\begin{aligned}\n h_{p} = \\sum_{< \\alpha, \\beta >}\n \\mbox{\\boldmath $\\sigma$}_{\\alpha}\\cdot\\mbox{\\boldmath $\\sigma$}_{\\beta}\n%\n + ( \\mbox{\\boldmath $\\sigma$}_{a}\\cdot\\mbox{\\boldmath $\\sigma$}_{b} )\n ( \\mbox{\\boldmath $\\sigma$}_{c}\\cdot\\mbox{\\boldmath $\\sigma$}_{d} )\n \\nonumber \\\\\n + ( \\mbox{\\boldmath $\\sigma$}_{a}\\cdot\\mbox{\\boldmath $\\sigma$}_{d} )\n ( \\mbox{\\boldmath $\\sigma$}_{b}\\cdot\\mbox{\\boldmath $\\sigma$}_{c} ) \n - ( \\mbox{\\boldmath $\\sigma$}_{a}\\cdot\\mbox{\\boldmath $\\sigma$}_{c} )\n ( \\mbox{\\boldmath $\\sigma$}_{b}\\cdot\\mbox{\\boldmath $\\sigma$}_{d} ),\n%\n\\label{eq2}\\end{aligned}$$ where $\\sum_{< \\alpha, \\beta >}$ denotes the sum over all possible pairs of four spins on the diamond. ", "The parameter $J$ and $K$ are related to the exchange frequency $J_n$ of the $n$-body cycle of the nearest neighbors as $$\\begin{aligned}\n%\n J = -J_{2}/2 + J_{3}\n%\n\\label{eq3}\\end{aligned}$$ and $$\\begin{aligned}\n%\n K = -J_{4}/4.", "\n%\n\\label{eq4}\\end{aligned}$$ It should be noted that the exchange frequency $J_n$ is always negative for any $n$.[@thouless65] The magnitude of the two-body exchange frequency $J_{2}$ is expected to be large at a low enough atomic density of the layer but it decreases with density more rapidly than $J_{3}$.[@roger-hd83; @roger90] Thus the parameter $J$ is expected to be positive at a low density while it should be negative in the high density region. ", "On the other hand $K$ is always positive. ", "We expect that a wide parameter region of the ratio of $J$ to $K$ may be realized by varying the coverage of $^3$He layers in a realistic system. ", "It is therefore useful to investigate what kind of the ground state occurs in the system described by the Hamiltonian (\\[eq1\\]). ", "Calculations of the specific heat and the susceptibility of a 16-spin cluster were reported by Bernu et al.", " previously.[@bernu-cl92]\n\nThe ground state in the classical limit\n=======================================\n\nAs a first step to study the spin system described by the Hamiltonian (\\[eq1\\]), we examine the ground state in the classical limit. ", "Since we neglect quantum fluctuations, we treat as a unit classical vector in the following. ", "When $K=0$ the ground state of the system is well known, that is, the ferromagnetic state for $J<0$ and the state with the so-called 120$^\\circ$ structure for $J>0$. On the other hand we cannot guess the ground state of the system intuitively when $J = 0$, since the Hamiltonian is governed by the unusual four-spin term. ", "So we use a variational argument. ", "We divide the total Hamiltonian into a sum of those of interpenetrating hexagons with 7 spins. ", "That is $$\\begin{aligned}\n H = {K\\over 2}\\sum_{h}H_{h},\n\\label{eq5}\\end{aligned}$$ where $H_{h}$ is the Hamiltonian of the hexagon depicted in Fig.", " 1(b) and is expressed as a sum of Hamiltonians (\\[eq2\\]) for six diamonds contained in the hexagon. ", "Then we searched numerically for the spin configuration which minimizes $H_{h}$. It has turned out that the lowest-energy spin configuration is a four-sublattice spin structure where any two spins on different sublattices make the relative angle $\\alpha$ where $\\cos \\alpha = -1/3$ (see Fig.", " 2(b)). ", "We can divide the whole lattice into four sublattices such that four vertices of every diamond belong to different sublattices. ", "The spin configuration which minimizes a hexagon, therefore, can be extended to the whole lattice in such a way that the state has the lowest energy for all hexagons in eq.", " (\\[eq5\\]) consistently and so realizes the ground state of the whole lattice. ", "The spin configuration has the four-sublattice structure, where the spin vectors point the vertices of a tetrahedron if we put their bottoms at its center, as shown in Fig.", " 2(b). ", "Hence we call this spin structure as “tetrahedral” structure. ", "In fact we can prove in the same way that the tetrahedral structure is the ground state at least in the parameter region $-K/2 \\le J \\le 2 K $.", "\n\nFor general values of $J$ and $K$ we determine the ground state in the mean-field approximation considering both three- and four-sublattice spin structures. ", "In a three-sublattice structure with the sublattices $a$, $b$, and $c$, the energy is expressed as $$\\begin{aligned}\n E/N &=& (J+4K)(\\mbox{\\boldmath $\\sigma$}_{a}\\cdot\\mbox{\\boldmath $\\sigma$}_{b}\n + \\mbox{\\boldmath $\\sigma$}_{b}\\cdot\\mbox{\\boldmath $\\sigma$}_{c} \n + \\mbox{\\boldmath $\\sigma$}_{c}\\cdot\\mbox{\\boldmath $\\sigma$}_{a} )\n \\nonumber \\\\\n &+& 2K\\{( \\mbox{\\boldmath $\\sigma$}_{a}\\cdot\n \\mbox{\\boldmath $\\sigma$}_{b} )\n ( \\mbox{\\boldmath $\\sigma$}_{c}\\cdot\\mbox{\\boldmath $\\sigma$}_{a} ) \n + ( \\mbox{\\boldmath $\\sigma$}_{b}\\cdot\\mbox{\\boldmath $\\sigma$}_{c} )\n ( \\mbox{\\boldmath $\\sigma$}_{a}\\cdot\\mbox{\\boldmath $\\sigma$}_{b} )\n \\nonumber \\\\\n &+& ( \\mbox{\\boldmath $\\sigma$}_{c}\\cdot\\mbox{\\boldmath $\\sigma$}_{a} )\n ( \\mbox{\\boldmath $\\sigma$}_{b}\\cdot\\mbox{\\boldmath $\\sigma$}_{c} ) \\}\n + 3K. \n\\label{eq6}\\end{aligned}$$ In a four-sublattice structure with the sublattices $a$, $b$, $c$ and $d$, we have $$\\begin{aligned}\n E/N &=& {1\\over 2}(J+6K)\\sum_{\\alpha < \\beta}\n \\mbox{\\boldmath $\\sigma$}_{\\alpha}\\cdot\\mbox{\\boldmath $\\sigma$}_{\\beta}\n \\nonumber \\\\\n &+& K\\{( \\mbox{\\boldmath $\\sigma$}_{a}\\cdot\\mbox{\\boldmath $\\sigma$}_{b} )\n ( \\mbox{\\boldmath $\\sigma$}_{c}\\cdot\\mbox{\\boldmath $\\sigma$}_{d} ) \n + ( \\mbox{\\boldmath $\\sigma$}_{a}\\cdot\\mbox{\\boldmath $\\sigma$}_{c} )\n ( \\mbox{\\boldmath $\\sigma$}_{b}\\cdot\\mbox{\\boldmath $\\sigma$}_{d} )\n \\nonumber \\\\\n &+& ( \\mbox{\\boldmath $\\sigma$}_{a}\\cdot\\mbox{\\boldmath $\\sigma$}_{d} )\n ( \\mbox{\\boldmath $\\sigma$}_{b}\\cdot\\mbox{\\boldmath $\\sigma$}_{c} ) \\}.", "\n%\n\\label{eq7}\\end{aligned}$$\n\nIn above equations $ \\mbox{\\boldmath $\\sigma$}_{a}$ denotes the spin vectors on the sublattice $a$ etc. ", "We determined the ground state spin configuration by comparing the energies of the two configurations which minimize eqs.", " (\\[eq6\\]) and (\\[eq7\\]), respectively. ", "Minimization of eqs.", " (\\[eq6\\]) and (\\[eq7\\]) were done numerically. ", "As a result we obtained four ground state phases with following spin structures:\n\n1. ", " the 120$^\\circ$ structure with $E/N=-3(J+K)/2$ for $0<K<3J/25$,\n\n2. ", " the tetrahedral structure with $E/N=-J-17K/3$ for $0<3J/25<K$ and $0<-3J/8<K$,\n\n3. ", " the [*uuud*]{} structure with $E/N=-3K$ for $0<-J/8<K<-3K/8$,\n\n4. ", " the perfect ferromagnetism with $E/N=3J+21K$ for $0<K<-J/8$.\n\nThe [*uuud*]{} structure has four sublattices and spins on the three sublattices are aligned parallel while spins on the other one is antiparallel to them. ", "The ground-state spin structures are depicted in Fig.", " 2.", "\n\nThe most interesting and novel one among the obtained ground-state spin structures is the tetrahedral structure. ", "It is remarkable that this structure has a scalar chiral long-range order. ", "The scalar chirality in the unit cell may be defined as $$\\begin{aligned}\n \\chi_{\\rm S} &=& \n \\mbox{\\boldmath $\\sigma$}_{a}\\cdot\n ( \\mbox{\\boldmath $\\sigma$}_{b}\\times \\mbox{\\boldmath $\\sigma$}_{c} )\n + \\mbox{\\boldmath $\\sigma$}_{b}\\cdot\n ( \\mbox{\\boldmath $\\sigma$}_{d}\\times \\mbox{\\boldmath $\\sigma$}_{c} )\n \\nonumber \\\\\n &+& \\mbox{\\boldmath $\\sigma$}_{c}\\cdot\n ( \\mbox{\\boldmath $\\sigma$}_{d}\\times \\mbox{\\boldmath $\\sigma$}_{a} )\n + \\mbox{\\boldmath $\\sigma$}_{d}\\cdot\n ( \\mbox{\\boldmath $\\sigma$}_{b}\\times \\mbox{\\boldmath $\\sigma$}_{a} ),\n%\n\\label{eq8}\\end{aligned}$$ which is an order parameter of Ising-type with a discrete $Z_2$ symmetry. ", "Since the tetrahedral ground state has a finite value of $\\chi_{\\rm S}$, $16\\sqrt{3}/9$, the system may undergo a phase transition of Ising universality at a finite temperature in spite of the isotropic rotational symmetry inherent in the Hamiltonian. ", "This contrasts with the 120$^\\circ$ structure which has a vector chiral order and may cause only topological phase transitions at finite temperatures.[@kawamura-m84]\n\nPhase diagram in the magnetic field\n===================================\n\nApplication of a magnetic field to frustrated spin systems is known to cause interesting magnetization processes and/or various phase transitions. ", "First we consider the case with $K=0$ and $J>0$, i.e. the HAF on the triangular lattice with nearest neighbor coupling $J$. It is well known that two phase transitions occur under the magnetic field at T=0.[@kawamura-m85] When the magnitude of the field $H$ is less than $3J$ (the magnetic moment of a spin is assumed as unity), The ground state is the so-called umbrella state with a coplanar spin configuration where the spins on a sublattice orient downwards (the magnetic field is assumed to be applied upwards) and those on the other two sublattices orient upwards but canted to the field by an angle (see Fig.", " 3(a)). ", "The angle decreases with the magnetic field and vanishes at $H=3J$. For $3J<H<9J$, spins on all sublattices are canted to the field but two of them are parallel to each other (see Fig.", " 3(c)). ", "We call the phase with this spin structure as c$_3$ phase. ", "Spins are perfectly polarized for $H>9J$. At $H=3J$ the spins are collinear, i.e. those on two sublattices are oriented upwards while those on the other sublattice point downwards (see Fig.", " 3(b)). ", "We call this spin structure as [*uud*]{} structure. ", "It was shown that the phase with the [*uud*]{} structure expands and is realized in a finite range of the magnetic field aided by the thermal or the quantum mechanical fluctuations.[@kawamura-m85; @chubukov-g91]\n\nWe searched for the ground state for general values of $J$ and $K$ numerically minimizing eqs.", " (\\[eq6\\]) and (\\[eq7\\]) added by $ - ( \\sigma_{a}^{z}+\\sigma_{b}^{z}+\\sigma_{c}^{z})H/3$ and $ - ( \\sigma_{a}^{z}+\\sigma_{b}^{z}+\\sigma_{c}^{z}+\\sigma_{d}^{z})H/4$, respectively. ", "We found seven ground-state phases in total. ", "They are the following:\n\n1. ", " the umbrella phase, which appears for a weak magnetic field when $J>0$ and $K$ is small.", "\n\n2. ", " the [*uud*]{} phase which extends around $H\\simeq 3J(>0)$ and for small $K$.\n\n3. ", " the c$_3$ phase, which appears for a wide range of the parameters both for positive and negative $J$ near the boundary of the fully polarized phase.", "\n\n4. ", " the weak field four-sublattice phase, the spin structure is an analogue of the umbrella structure but is not coplanar. ", "The spins on a sublattice point downwards and those on the other three sublattices orient upwards but canted to the field by an angle (see Fig.", " 3(d)). ", "There is a three-fold rotational symmetry about the magnetic field axis. ", "We call this structure “mushroom” structure. ", "This phase appears for large $K$ and small $H$.\n\n5. ", " the [*uuud*]{} phase which appears for small $|J|$ and rather weak field.", "\n\n6. ", " the high field four-sublattice phase with the structure analogous to the c$_3$ phase. ", "Spins on three sublattices are parallel to each other and all spins are canted to the field (see Fig.", " 3(e)). ", "We call this phase as c$_4$ phase.", "\n\n7. ", " the ferromagnetic phase where the spins are perfectly polarized. ", "This phase appears for $H \\ge 9(J+8K)$.\n\nAbove spin structures are shown in Fig.", " 3. ", "The phase diagram is depicted in Fig.", " 4 for $J>0$ and in Fig.", " 5 for $J<0$. We adopted a scale as $J+8K=1$ for $J>0$ and $-2J+8K=1$ for $J<0$ for convenience. ", "The full lines denote the first order transitions while dotted lines the second order ones. ", "The transitions between the three- and the four-sublattice structures are necessarily of the first order. ", "The transitions between the structures with the same sublattice structures are of the second order in most cases. ", "An exception is the boundary between the mushroom and the [*uuud*]{} phases for $J<0$, where the phase change occurs with a magnetization jump. ", "The critical field $H_{\\rm C}$ at the second order transition points are determined analytically and tabulated in table 1.", "\n\nThere is a tetracritical point at $H_{\\rm C}=6J=24K$ when $J=4K$. Magnetization process may show peculiar behaviors around this point. ", "As an example magnetization per spin $m$ is shown in Fig.", " 6 as a function of the applied field for $J=0.4$ and $K=0.75$. In this case the system undergoes six phase transitions with variation of $H$. There appear two plateaus in the magnetization curve at $m=1/3$ and $m=1/2$. The 1/3- and 1/2-plateaus correspond to the [*uud*]{} and [*uuud*]{} phases, respectively. ", "Furthermore the curve shows magnetization jumps at the first-order phase-transition points. ", "Another magnetization curve is shown in Fig.", " 7 for the parameter $J=-0.1$ and $K=0.1$.\n\nSummary and discussion\n======================\n\nWe have shown that various ground-state phases occur on the triangular lattice by coexistence of the two- and the four-spin exchange interactions. ", "We have found new phases with four sublattices, i.e. the tetrahedral structure and the [*uuud*]{} structure. ", "Since we have assumed that the ground states have either the three- or the four-sublattice structure, there remains a possibility that a state with a longer period may be more stable than those obtained above. ", "In some cases, however, we are certain that the present results are rigorous in the classical limit. ", "That is, the case when $K=0$ (the pure Heisenberg model), and the case when $J=0$ and $H=0$. So it is quite reasonable that the obtained phases are stable in the regions close to these limiting cases. ", "In fact we could prove that the tetrahedral phase is stable for small $|J|$.\n\nIt is remarkable that the phase with scalar chirality appears when the four-spin exchange dominates. ", "This suggests the existence of a phase transition of the Ising universality at a finite temperature. ", "Our preliminary Monte Carlo simulations in the classical limit clearly exhibit divergence of the specific heat at $T \\simeq K$ for $J=0$. The present model seems to be the first example of a realistic spin system in two dimensions with full rotational symmetry which undergoes a chiral phase transition. ", "Detailed analysis of the finite-temperature properties will be reported elsewhere.[@mmoi-k97]\n\nIn the region where the competition between the two- and the four-spin interactions are serious, more study is necessary to be conclusive. ", "In fact we found in Monte Carlo simulations that various states with long periods and zero magnetization have quite close energy to that of the [*uuud*]{} structure. ", "Furthermore, it can be shown that a new $120^\\circ$ structure state with nine sublattices has the same energy as the [*uuud*]{} structure. ", "This indicates that the frustration of the system is strong in the phase with [*uuud*]{} structure due to the competition between the two- and the four-spin interactions. ", "The application of the magnetic field would select the [*uuud*]{} structure from the degenerate ground states, since it has the largest magnetization among them. ", "We hence believe that the ground-state phase diagram under the magnetic field (Fig.", " 5) will not be changed seriously by the appearance of long-period states.", "\n\nEffects of quantum fluctuations, which we have completely neglected in the present study, are surely very important since the magnitude of the nuclear spin is 1/2 for $^3$He. ", "It is still not quite established that even the well-known 120$^\\circ$ structure is stable against quantum fluctuations when $K=0$ and $J>0$ (HAF), though recent numerical studies seem to support for the stability.[@triangle] It is possible that the coexistence of the two- and the four-spin interactions destabilizes the ordered ground state and helps the quantum fluctuations to destroy it. ", "The stability of the ground states against the zero-point spin wave fluctuations are presently under investigation and will be reported elsewhere.[@niki-k97]\n\nFinally we compare our results with the existing experimental ones, though it is still not quite clear whether the model is relevant to describe $^3$He layers. ", "The specific heat data at low temperatures exist only at two different values of the coverage, i.e. $\\rho = 0.180$ Å$^{-2}$ and $0.228$ Å$^{-2}$.[@fukuyama96; @Morishita96] No sharp peak was observed at both coverages. ", "The system with $\\rho = 0.228$ Å$^{-2}$ clearly corresponds to a negative $J$ since it shows about 60 percent of full polarization under a very small magnetic field.[@Schiffer93] On the other hand the parameter $J$ of the system with $\\rho=0.180$ Å$^{-2}$ is still unclear. ", "At this coverage the system has been thought to be antiferromagnetic since it has a negative Weiss temperature $\\theta$. However a negative $\\theta$ does not imply a positive $J$ since $\\theta = -6( J + 6K )$ holds in the present model. ", "If the system corresponds to a positive $J$, the ground state at this coverage should be the positive large-$J$ phase or a new quantum phase caused by competitions between the two- and the four-spin intearctions and quantum fluctuations, since the system does not show a finite-temperature phase transition. ", "If this is the case, there may occur the phase with a chiral long-range order between two coverages $\\rho=0.180$ Å$^{-2}$ and $0.228$ Å$^{-2}$ (if the density of the second layer varies continuously), and we may observe a sharp peak in the specific heat by varying the coverage of the adsorbed layers. ", "Another possibility is that the system with $\\rho=0.180$ Å$^{-2}$ has a negative $J$ whose value corresponds to the [*uuud*]{} ground state in the mean field theory. ", "In this parameter region we have seen that the strong frustration leads to the existence of various states with long periods whose energies are quite close to that of the ground state. ", "Then the effects of quantum fluctuations may realize a novel ground state without magnetic long-rage order. ", "Observations under a magnetic field will be useful to determine the phase that the system belongs to. ", "Above discussion is based on the assumption that more-than-four-spin exchange interactions are not important. ", "If this is not the case it is necessary to investigate a spin model with more-than-four-spin exchange interactions in search for possible ground states.", "\n\nacknowledgement\n===============\n\nThe authors greatly appreciate Hiroshi Fukuyama for guiding them to the present problem and for stimulating discussions and useful advice. ", "Thanks are also due to K. Niki, and H. Sakamoto for useful discussions.", "\n\n[99]{} H. Franco, R. Rapp and H. Godfrin, Phys. ", "Rev. Lett. [**", "57**]{}, 1161 (1986); H. Godfrin, R. Ruel and D. Osheroff, Phys. ", "Rev. Lett. [**", "60**]{}, 305 (1988).", "\n\nD. S. Greywall and P. A. Busch, Phys. ", "Rev. Lett. [**", "62**]{}, 1868 (1989); D. S. Greywall, Phys. ", "Rev. B [**41**]{}, 1842 (1990).", "\n\nV. Elser, Phys. ", "Rev. Lett. [**", "62**]{}, 2405 (1989).", "\n\nFor example,\n\nC. Zeng and V. Elser, Phys. ", "Rev. B [**42**]{}, 8436 (1990);\n\nA. B. Harris, C. Kallin and A. J. Berlinsky, Phys. ", "Rev. B [**45**]{}, 2899 (1992);\n\nN. Elstner and A. P. Young, Phys. ", "Rev. B [**50**]{}, 6871 (1994),\n\nand references therein.", "\n\nT. Nakamura and S. Miyashita, Phys. ", "Rev. B [**52**]{}, 9174 (1995).", "\n\nM. Roger, Phys. ", "Rev. Lett. [**", "64**]{}, 297 (1990).", "\n\nK. Ishida, M. Morishita, K. Yawata and H. Fukuyama, to be submitted to Phys. ", "Rev. Lett..\n\nM. Roger, J. H. Hetherington and J. M. Delrieu, Rev. Mod. ", "Phys. [**", "55**]{}, 1 (1983).", "\n\nD.M. Ceperley and G. Jacucci, Phys. ", "Rev. Lett. [**", "58**]{}, 1648 (1987).", "\n\nB. Bernu, D Ceperley and C. Lhuillier, J. Low Temp. ", "Phys. [**", "89**]{}, 589 (1992).", "\n\nC. P. Lusher, J. Saunders and B. P. Cowan, Europhys. ", "Lett. [**", "14**]{}, 809 (1991).", "\n\nM. Siqueira, C. P. Lusher, B. P. Cowan and J. Saunders, Phys. ", "Rev. Lett. [**", "71**]{}, 1407 (1993).", "\n\nD. J. Thouless, Proc. ", "Phys. ", "Soc.(London) [**86**]{}, 893 (1965).", "\n\nH. Kawamura and S. Miyashita, J. Phys. ", "Soc. ", "Jpn. [**", "54**]{}, 4530 (1985).", "\n\nA. V. Chubukov and D. I. Golosov, J. Phys. ", "Condens. ", "Matter [**3**]{}, 69 (1991).", "\n\nH. Kawamura and S. Miyashita, J. Phys. ", "Soc. ", "Jpn. [**", "53**]{}, 4138 (1984).", "\n\nT. Momoi, K. Kubo and K. Niki, Phys. ", "Rev. Lett. (", "1997), in press.", "\n\nT. Momoi and K. Kubo, in preparation.", "\n\nFor example,\n\nR. R. P. Singh and D. Huse, Phys. ", "Rev. Lett. [**", "68**]{}, 1766(1992).", "\n\nB. Bernu, C. Lhuillier and L. Pierre, Phys. ", "Rev. Lett. [**", "69**]{}, 2590 (1992).", "\n\nT. Momoi, J. Stat. ", "Phys. [**", "75**]{}, 707 (1994).", "\n\nK. Niki and K. Kubo, in preparation.", "\n\nM. Morishita, K. Ishida, K. Yawata and H. Fukuyama, Czech. ", "J. of Phys. [**", "46**]{} Suppl. ", "S1, 409 (1996).", "\n\nP. Schiffer, M. T. O’Keefe, D. D. Osheroff and H. Fukuyama, Phys. ", "Rev. Lett. [**", "71**]{}, 1403 (1993); J. Low Temp. ", "Phys. [**", "94**]{}, 489 (1994).", "\n\nTable\n\n Phase1 Phase2 $H_{\\rm C}$\n --------------- ------------ -------------\n umbrella [*uud*]{} $3(J-4K)$\n [*uud*]{} c$_3$ $3(J+4K)$\n ferromagnetic c$_3$ $9(J+8K)$\n mushroom [*uuud*]{} $4(J+2K)$\n [*uuud*]{} c$_4$ $4(J+8K)$\n\n : $H_{\\rm C}$ at the second order transition point.", "\n\nFigure Captions\n" ]

{ "pile_set_name": "ArXiv" }

[ 0.0006217343616299331, 0.0005833557806909084, 0.0006821721908636391, 0.0005740664782933891, 0.0005834171897731721, 0.0005551584181375802, 0.0007444971124641597, 0.0006290036835707724, 0.0006309430464170873, 0.0006523081101477146, 0.000724451441783458, 0.0007820205064490438, 0.001573279150761664, 0.0007828731322661042, 0.0006367225432768464, 0.0008803391247056425, 0.0006403957377187908, 0.0007352830725722015, 0.0005853267502970994, 0.0005550200003199279, 0.0006883370806463063, 0.0007075212197378278, 0.001606329926289618, 0.02898663468658924, 0.0010440507903695107, 0.10520245134830475, 0.0017895058263093233, 0.0007005368825048208, 0.0020113831851631403, 0.0006190254352986813, 0.0006059249863028526, 0.0006117975572124124, 0.0007343005854636431, 0.0005654287524521351, 0.0007334515103138983, 0.0007082508527673781, 0.0009676070185378194, 0.0037055800203233957, 0.0008121185819618404, 0.0008372682495974004, 0.0007640415569767356, 0.0007347282953560352, 0.000898802129086107, 0.0006385704036802053, 0.000652644201181829, 0.0007573633338324726, 0.0006913000252097845, 0.000938128971029073, 0.0006849940400570631, 0.09039812535047531, 0.01210532896220684, 0.0005667069344781339, 0.0011033036280423403, 0.0007701420108787715, 0.0008878979715518653, 0.0005887855659238994, 0.0018521080492064357, 0.0011735315201804042, 0.008098984137177467, 0.006172123830765486, 0.0005876171635463834, 0.001185585861094296, 0.0005547687760554254, 0.0005829861620441079, 0.036832962185144424, 0.0008429012959823012, 0.0013676454545930028, 0.0006147584063000977, 0.0007418182794936001, 0.0008184341713786125, 0.0007404089556075633, 0.0008556580287404358, 0.0008383439271710813, 0.0007683383882977068, 0.000789669225923717, 0.000648174958769232, 0.004458408337086439, 0.0005544336745515466, 0.0007275277748703957, 0.0006863395101390779, 0.001185585861094296, 0.02105611190199852, 0.0007249618065543473, 0.0012900278670713305, 0.0007387071964330971, 0.0008690932299941778, 0.0007762319291941822, 0.0005715597653761506, 0.0006107096560299397, 0.005595281720161438, 0.0034053949639201164, 0.001202064217068255, 0.000693964771926403, 0.0009266491397283971, 0.0007972877356223762, 0.0009776510996744037, 0.0013101339573040605, 0.0008445116109214723, 0.000840376247651875, 0.00117425003554672, 0.0006269211880862713, 0.0007414500578306615, 0.0009029657812789083, 0.0006462183664552867, 0.000675444258376956, 0.0006483058677986264, 0.00160899106413126, 0.0006500218878500164, 0.0006893444224260747, 0.0006743704434484243, 0.0009496947168372571, 0.0005748267285525799, 0.0006398469558916986, 0.0007586809224449098, 0.0009926868369802833, 0.0005650963285006583, 0.0005855413619428873, 0.0006308098672889173, 0.0006774523644708097, 0.0005934538203291595, 0.0006357320235110819, 0.0005241962498985231, 0.0007615797803737223, 0.0024550589732825756, 0.000909359659999609, 0.0009984818752855062, 0.0005952512728981674, 0.0006543130148202181, 0.0006110945250838995, 0.0007206072332337499, 0.0005690375692211092, 0.0014051628531888127, 0.0008693976560607553, 0.0006386293680407107, 0.000623693224042654, 0.000662360864225775, 0.0024285882245749235, 0.0005619841977022588, 0.0006109083769842982, 0.000524606613907963, 0.0006063284818083048, 0.000585658592171967, 0.005631874781101942, 0.0005526919849216938, 0.0008577710250392556, 0.0009571398259140551, 0.000807677221018821, 0.0009571398259140551, 0.0007934251334518194, 0.0007986865239217877, 0.0009571398259140551, 0.0006850955542176962, 0.0006824261508882046, 0.0008622840396128595, 0.0009571398259140551, 0.0007964407559484243, 0.0007103226380422711, 0.0007386347278952599, 0.0007241612183861434, 0.000648588000331074, 0.0009489467483945191, 0.0007277600816451013, 0.0008507480379194021, 0.0009571398259140551, 0.000716102309525013, 0.0008920140098780394, 0.0009413191000930965, 0.001444116816855967, 0.0007715251413173974, 0.0008033832418732345, 0.0009571398259140551, 0.0007294550305232406, 0.0008806175319477916, 0.001444116816855967, 0.0008041231194511056, 0.0006798901595175266, 0.0018622804200276732, 0.0008030835306271911, 0.0008352820877917111, 0.0009571398259140551, 0.0007822843035683036, 0.0009513166733086109, 0.0012429299531504512, 0.0007164859562180936, 0.0009005431784316897, 0.0007810515817254782, 0.0007702663424424827, 0.0008019846864044666, 0.0010070335119962692, 0.000852675992064178, 0.0008458045194856822, 0.0009005431784316897, 0.0007810515817254782, 0.0007702663424424827, 0.0008292706916108727, 0.0009324658894911408, 0.0007251041824929416, 0.0006764640565961599, 0.0006753348279744387, 0.0007045126403681934, 0.0009571398259140551, 0.0007248985930345953, 0.0008284697541967034, 0.0009571398259140551, 0.000778803660068661, 0.000853930483572185, 0.001444116816855967, 0.0008242534822784364, 0.0006397889810614288, 0.0010737256379798055, 0.000961310404818505, 0.0010982925305142999, 0.0007013046997599304, 0.0018226478714495897, 0.0009571398259140551, 0.0008956494275480509, 0.001444116816855967, 0.0008601155132055283, 0.00244988314807415, 0.0007753496174700558 ]

[ "Shabbat+new soldiers+settlers=ouch!", "\n\nShabbat, new soldiers and violent settlers make a very unpleasant day.", "\n\nAt 11am, I was at the Tel Rumeida crossing waiting for children to come from the Qurduba school. ", "The Palestinian Abu Aeshah girls, who live near the Israeli Tel Rumeida settlement came. ", "I accompanied them towards the settlement. ", "The soldier outside the settlement told me to stop and go back. ", "I said that I would go back if he would watch the girls to their house. ", "There were Israeli settler children outside. ", "They often attack the Palestinian children. ", "The soldier seemed more interested in watching me than the children and did not help.", "\n\nAt 11.15am the Al Azzeh children arrived. ", "They walk along a track next to the settlement. ", "There were settler children at the entrance to the settlement, so an EAPPI human rights worker walked up to the track with them. ", "The settler children started to throw stones at the Palestinian children so other EAPPI human rights workers and I went up too to stand between the Palestinians and the stones. ", "The soldiers tried to push the children back to the crossing for safety instead of controlling about 8 settler children, who were throwing stones. ", "I came between the soldier and 14 year old Janette. ", "It is not right that an eighteen year old soldier should be standing with his body so close to a young girl, who is already under attack. ", "More soldiers came but the stone throwing continued further along the track and the Palestinian children were not able to pass. ", "Three TIPH (Temporary International Presence in Hebron) workers arrived to observe the incident. ", "Finally the police were called and came quickly. ", "They were able to control the situation and the children were able to reach their homes.", "\n\nI told the police and soldiers that there would be other children needing to pass from 12.30 to 1.30pm. ", "The police said that the soldiers would look after this and that they would be patrolling. ", "TIPH agreed to stay until all the children were home.", "\n\nAt 12.35pm, one of the Abu Aeshah boys arrived. ", "I walked with him up towards the settlement. ", "There were now two soldiers on duty outside the Tel Rumeida settlement. ", "They would not let me pass and were watching me instead of the Palestinian boy. ", "I finally convinced one of them to look the other way. ", "The boy got home safely but Israeli settler children were beginning to come to the entrance of the settlement and waiting.", "\n\nAt 1.00pm, Samir Abu Aeshah arrived. ", "I walked with him towards the settlement followed by another international with a camera. ", "Israeli settler children came out of the settlement. ", "Girls came right up to us abusing and yelling at us. ", "Twenty young settler boys threw stones at us. ", "I was hit several times. ", "There were eight soldiers who pushed us back towards the crossing. ", "They did not stop the stone throwing and tried to stop any filming. ", "Samir Abu Aeshah ran to hide in his uncle’s house. ", "Another six soldiers arrived and attacked our person who was filming. ", "They also attacked a woman from TIPH, who was taking photos. ", "Israel recognizes TIPH and they are allowed film anywhere. ", "I was being hit by stones. ", "As a soldier was telling me to go back, settler boys were coming round behind me and throwing large rocks at my back. ", "I was then hit on the head with a rock. ", "Settler children were now nearly to the crossing and still attacking and I was outside my house.", "\n\nI called the DCO, saying that I had been hit with 12 stones and rocks and had been hit on the head. ", "The woman on the line agreed with me that this should not happen. ", "Another army jeep arrived. ", "There were now twenty soldiers, about twenty violent young settler boys, ten abusive settler girls and many settler adults including Sara Marzel (wife of Baruch Marzell, founder of the ultra-extremist Chayil Party (Jewish National Front) ). ", "Some of the soldiers started grabbing the boys who resisted and kept throwing stones. ", "The girls kept coming right up to me and abusing me. ", "The settler adults watched and did nothing to help or control their children. ", "I called the police. ", "When they came they were able to control the situation but there was still no way to get Samir Abu Aeshah home.", "\n\nSome of the Israeli settler children and adults walked to the Jewish cemetery followed by an army jeep. ", "I went in the Israeli police jeep to make a complaint. ", "Sometime later, Samir came out of hiding and walked home by himself, with no support from the soldiers." ]

{ "pile_set_name": "Pile-CC" }

[ 0.025984128937125206, 0.08112767338752747, 0.0023605094756931067, 0.0027349682059139013, 0.0007523660315200686, 0.0021529621444642544, 0.010508067905902863, 0.003771937219426036, 0.3254954516887665, 0.001233810791745782, 0.011640331707894802, 0.0006731564644724131, 0.0008041809778660536, 0.05166096240282059, 0.004237176850438118, 0.002296285703778267, 0.11226905137300491, 0.013090168125927448, 0.0006154357688501477, 0.0011913423659279943, 0.0012304181000217795, 0.002089952351525426, 0.0011255178833380342, 0.0016779372235760093, 0.0010338559513911605, 0.0007161992252804339, 0.0010305767646059394, 0.024709707126021385, 0.0007779740844853222, 0.0019092480652034283, 0.0008428546134382486, 0.0006497224094346166, 0.004520577844232321, 0.4516802728176117, 0.003341945819556713, 0.00527595542371273, 0.0022709828335791826, 0.0007051645661704242, 0.0364096574485302, 0.01419512927532196, 0.00441179471090436, 0.0008023488917388022, 0.03293567895889282, 0.024660170078277588, 0.08239778876304626, 0.02011225000023842, 0.004331254865974188, 0.0006392807117663324, 0.006498547736555338, 0.10217659920454025, 0.01314632035791874, 0.39874640107154846, 0.0015235381433740258, 0.0029628160409629345, 0.0011278215097263455, 0.0024499192368239164, 0.0029043920803815126, 0.0014550926862284541 ]

[ "Q:\n\nNode-Webkit mysql data to news feed\n\nI working on a news feed tool that we can send remote news messages to a screen. ", "Now i have done the back end of the system and working now on the frontend/client.", "\nI will use node-web kit to show the news on the screen. ", "I have already a connection with the database and it show the messages also in the console log. ", "But i don't get it right to show it on the news feed page.", "\nI try to make it looks like a CNN news feed banner:\nCNN feed banner\nStyling is not the problem but i don't get the date from the json (mysql output) to the screen.", "\nThe output i get from mysql in the console looks like:\n[{\"id\":1,\"message\":\"Test message #1\"},{\"id\":2,\"message\":\"Test message #2\"},{\"id\":3,\"message\":\"Test message #3\"}] \n\nAnd the code from the client looks like:\n\n<html>\r\n <head>\r\n <title>NewsFeed</title>\r\n\r\n <script>\r\n\r\n var mysql = require('mysql');\r\n var connection = mysql.createConnection({\r\n host : 'XXXXX',\r\n user : 'XXXXX',\r\n password : '',\r\n database : 'XXXXX'\r\n });\r\n\r\n connection.connect(function(err) {\r\n if (err) {\r\n console.error('error connecting: ' + err.stack);\r\n return;\r\n }\r\n\r\n connection.query('SELECT * FROM message', function (error, results, fields) {\r\n if (error) throw error;\r\n json = JSON.stringify(results);\r\n console.log(json);\r\n });\r\n });\r\n\r\n </script>\r\n </head>\r\n <body>\r\n </body>\r\n</html>\n\nDo someone know how to read the Json information from the console to the HTML view?", "\nAnd also is there a way the let the news feed automatic update when there is add a new message to the database? ", "\nUPDATE: I think auto refresh is not the best way. ", "So i was thinking about remote refresh. ", "The idea is;\nUser login on a backend system add a message and then press on a button to reload the page.", "\nLike this image: Idea reload remote\n\nA:\n\nTry this.", "\nFirst of all, add a node element in you DOM which will contail all the messages.", "\n<body>\n <h1>Messages</h1>\n <div id=\"message-container\"></div>\n</body>\n\nThen make you function write in the DOM:\nconnection.connect(function(err) {\n if (err) {\n console.error('error connecting: ' + err.stack);\n return;\n }\n\n connection.query('SELECT * FROM message', function (error, results, fields) {\n if (error) throw error;\n json = JSON.stringify(results);\n console.log(json);\n\n var container = document.getElementById(\"message-container\")\n\n // Use this in case you can't perform a more precise query\n container.innerHTML = \"\";\n\n results.forEach(function(item){\n var node = document.createElement(\"p\");\n var textnode = document.createTextNode(item.message); \n\n node.appendChild(textnode);\n container.appendChild(node); \n })\n });\n});\n\nTo keep you data up to date, you can do some good ol' polling:\nfunction startTimer() {\n setTimeout(query, 10000)\n}\n\nfunction query() {\n connection.query('SELECT * FROM message', function (error, results, fields) {\n if (error) throw error;\n json = JSON.stringify(results);\n console.log(json);\n\n var container = document.getElementById(\"message-container\")\n\n // Use this in case you can't perform a more precise query\n container.innerHTML = \"\";\n\n results.forEach(function(item){\n var node = document.createElement(\"p\");\n var textnode = document.createTextNode(item.message); \n\n node.appendChild(textnode);\n container.appendChild(node); \n startTimer()\n })\n });\n}\n\nconnection.connect(function(err) {\n if (err) {\n console.error('error connecting: ' + err.stack);\n return;\n }\n query()\n})\n\nThis way you have a first request. ", "Once that is done, the app waits 10 seconds and prompt a second request. ", "After that one is done, it waits for 10 seconds and so on...\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006480551091954112, 0.0007670266786590219, 0.0005716338055208325, 0.0005588154308497906, 0.0006124007632024586, 0.0006360653787851334, 0.0009325991268269718, 0.0007588309817947447, 0.0006853737286292017, 0.0005897125229239464, 0.0007249030750244856, 0.0011715679429471493, 0.002445003017783165, 0.001071518985554576, 0.0006088132504373789, 0.0006984210922382772 ]

[ "Race, Family and the Trump Era\n\nNever Miss A Story.", "\n\nDaily Edition\n\nDigest: Optimism on Apple shares\n\nEmpty\n\nBear Stearns analyst Andrew Neff on Wednesday raised his price target on shares of Apple Computer by $6 to $100 citing optimism about growth opportunities, especially in interactive TV. ", "After a meeting with Apple chief financial officer Peter Oppenheimer and vp iPod product marketing Greg Joswiak, \"we remain optimistic about Apple's continued innovation,\" Neff wrote, adding that \"iTV could be more impressive\" than previously thought. \"", "Though details remain sketchy, Apple emphasized focus of iTV to improve user experience and implied that there may be features beyond streaming video content.\" ", "Apple shares rose most of the day before closing down fractionally at $91.80.", "\n\nEMI update\n\nA private-equity deal for music firm EMI Group is unlikely to match the price tag offered this year by Warner Music Group, which has put any deal talks on hold amid regulatory concerns, UBS analyst Ian Whittaker said Wednesday. ", "Some on Tuesday suggested a price in the £3.20 per-share range, \"which was what Warner bid for EMI earlier this year,\" he said. \"", "A deal with Warner would have realized operational synergies, which we think would have helped the bid price. ", "It is hard for us to see how private equity can offer a similar amount with no potential synergies.\" ", "Instead, a private-equity deal might be able to offer a lower price in return for a greater likelihood of regulatory approval, Whittaker said.", "\n\nLiberty Global OK\n\nJohn Malone's Liberty Global Inc. said its board has approved Dutch auction self-tender offers to buy as many as 5.1 million shares of its Series A and 5.2 million shares of its Series C common stock within certain price ranges. ", "The cost of the move will come to about $265.2 million-$300 million if Liberty buys the maximum amount of shares of each series." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0008520489791408181, 0.0006274391780607402, 0.0005645945202559233, 0.0005266818916425109, 0.0009029360371641815, 0.0005967217148281634, 0.0006130989640951157, 0.0005964637966826558, 0.0005535879754461348, 0.0005839039804413915, 0.0006483686156570911, 0.0006583328358829021 ]

[ "Paul Heaton & Jacqui Abbott Seating Plan - Liverpool Echo Arena\n\nWe currently have no information about upcoming Paul Heaton & Jacqui Abbott events at Liverpool Echo Arena, but here is a seating plan used for Paul Heaton & Jacqui Abbott in the past. ", "Please check below for Paul Heaton & Jacqui Abbott Tickets." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005836394266225398, 0.0005791514413431287 ]

[ "Any decisions and actions which purport to have altered the character, status or demographic composition of the Holy City of Jerusalem have no legal effect, are null and void and must be rescinded in compliance with relevant resolutions of the Security Council. — ", "UN General Assembly, December 21, 2017\n\nDecember 21, 2017 — Today, in an emergency session, the overwhelming majority of the world’s nations at the UN General Assembly voted 128-9 in favor of a resolution calling on the United States to overturn its decision to recognize Jerusalem as Israel’s capital.", "\n\nThis “collective act of defiance” took place despite threats from Trump’s ambassador to the UN, Nikki Haley, to “take names” of countries voting against the United States and Israel, and threats by Trump to cut US aid to those countries.", "\n\nIsrael’s ambassador to the UN accused the world body’s members of being “puppets” to the “Palestinian puppet masters”, following Israeli Prime Minister Netanyahu’s description of the UN as a “house of lies.”", "\n\nThe resounding failure by Israel and the US administration to thwart the pro-Palestinian vote at the UN General Assembly follows a similarly embarrassing UN Security Council vote on Monday which also rejected the US-Israeli position 14-1.", "\n\nOmar Barghouti, speaking on behalf of the Palestinian BDS National Committee (BNC), the largest coalition in Palestinian civil society, responded by saying:\n\nThis vote is further proof that the far-right Israeli-Trump alliance is more isolated than ever as the overwhelming majority of nations are finally recognizing its fatal attempt to undermine both Palestinian rights and the very rule of international law. ", "Holding Israel accountable for its egregious, decades-old human rights violations is crucial to upholding both. ", "To defend the UN against this thuggery by Israel and the Trump administration, the BDS movement calls for meaningful sanctions, especially a military embargo and intensified boycott and divestment measures against Israel’s regime of oppression. ", "BDS today is not only crucial for realizing Palestinian freedom, justice and equality. ", "It is also critical to stopping Trump, Netanyahu and other leaders of the international far-right who are threatening world peace and global justice like never before.", "\n\nAll European states, with a few exceptions that abstained, voted in favor of the Palestinian position on occupied Jerusalem, and so did Japan, China, India, Nigeria, Brazil, Korea, Russia, and South Africa, among many others.", "\n\nFavoring concrete sanctions to merely symbolic gestures of solidarity with the Palestinian liberation struggle, South Africa’s ruling African National Congress (ANC) at its general conference yesterday unanimously adopted downgrading diplomatic ties with Israel. “[", "It] sends a clear message to Israel that there is a price to pay for its human rights abuses and violations of international law,” the ANC said in a statement." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006804045406170189, 0.000614714459516108, 0.0011851347517222166, 0.026617849245667458, 0.001721733482554555, 0.0007409033132717013, 0.0007793883560225368, 0.004623194225132465, 0.000807896547485143, 0.001649988815188408, 0.0007158522494137287, 0.0006106967921368778, 0.0012046092888340354 ]

[ " UNITED STATES DISTRICT COURT\n FOR THE DISTRICT OF COLUMBIA\n\n____________________________________\n )\nBEULAH J. ROBINSON, )\n )\n Plaintiff, )\n )\n v. ) Civil Action No. ", "11-2212 (RBW)\n )\nRED COATS, INC., ", " )\n )\n Defendant. ", " )\n____________________________________)\n\n MEMORANDUM OPINION\n\n Beulah J. Robinson, the plaintiff in this civil case, seeks relief pursuant to Title VII of the\n\nCivil Rights Act of 1964 (“Title VII”), as amended, 42 U.S.C. §§ 2000e-2 to -3 (2006), the Age\n\nDiscrimination in Employment Act of 1967, 29 U.S.C. §§ 621-24 (2006), and the District of\n\nColumbia Human Rights Act, D.C. Code §§ 2-1402.11(a)(1), 2-1402.61(a)-(b) (2001).", "\n\nComplaint (“Compl.”) ¶¶ ", "23, 26, 33, 39. ", "Currently before the Court is the Defendant’s Motion\n\nto Dismiss, or in the Alternative, Motion for Summary Judgment. ", "After carefully considering all\n\nof the relevant submissions by the parties, 1 the Court concludes for the following reasons that the\n\ndefendant’s motion must be denied in its entirety.", "\n\n I. BACKGROUND\n\n The plaintiff, “a 75 year old woman of the black race,” Compl. ¶ ", "4, was hired as a\n\n“cleaner” in 1984 “by a company that was [subsequently] either acquired by the [d]efendant or a\n1\n In addition to the plaintiff’s Complaint and the Defendant’s Motion to Dismiss, or in the Alternative, Motion for\nSummary Judgment, the Court considered the following documents in rendering its decision: (1) the Memorandum\nof Points and Authorities in Support of Defendant’s Motion to Dismiss, or in the Alternative, Motion for Summary\nJudgment (“Def.", "’s Mem.”); (", "2) the Plaintiff’s Opposition to Defendant’s Motion to Dismiss or, in the Alternative,\nfor Summary Judgment (“Pl.", "’s Opp’n”); (3) the Memorandum of Points and Authorities in Support of Plaintiff’s\nOpposition to Defendant’s Motion to Dismiss or for Summary Judgment (“Pl.", "’s Mem.”); ", "and (4) the Defendant’s\nReply Memorandum in Support of its Motion to Dismiss, or in the Alternative, Motion for Summary Judgment\n(Def.", "’s Reply”).", "\n\fcompetitor [that] lost a contract bid to the [d]efendant in 2006,” id. ¶ 8. ", "The plaintiff’s duties\n\n“consisted of dusting surface areas, emptying trash cans, and vacuuming the carpet of various\n\noffices of commercial buildings.” ", "Id. ¶ 9.", "\n\n “In June 2010, the [p]laintiff was transferred from one office building to another where\n\nthe contract for the latter office building was terminating within a month. ", "The [p]laintiff\n\ncomplained to her union representative and was transferred to an office building located at 1225\n\nConnecticut Avenue, N.W., Washington, D.C.” Id. ¶ 12. ", "The plaintiff alleges that “[w]hen [she]\n\narrived on her first day at the [Connecticut Avenue b]uilding, she was told by her manager that\n\nshe . . . ", "was not wanted at that location,” id. ¶ 13, and he purportedly “embarked upon a pattern\n\nof conduct designed to discourage the [p]laintiff from continuing her employment with the\n\n[d]efendant by giving [her] more assignments than her counterparts of [a] different race and\n\nyounger age.” ", "Id. ¶ 15. ", "In addition, the plaintiff claims that she was “isolate[ed] . . . ", "from the\n\nother cleaners,” id., and “not provided a reasonable opportunity to become familiar with the\n\nlocation of the trash cans . . . ", "and to develop an efficient plan,” and that “she was forced to work\n\nalone . . . ", "while her younger Hispanic co-workers were allowed to work in crews where division\n\nof labor enabled them to work more efficiently,” Pl.", "’s Mem. ", "at 8-9. ", "Moreover, the plaintiff\n\ncontends that the “[d]efendant’s discriminatory tactics included the fabrication of sub-par\n\nperformance issues, and [the] utiliz[ation of] those fabrications as a pretext to discipline and\n\n[ultimately] terminate [her emloyment]. ", "Compl. ¶ ", "15. ", "The plaintiff filed a Charge of\n\nDiscrimination with the Equal Employment Opportunity Commission (“EEOC”) on October 1,\n\n2010, 2 alleging race and age discrimination. ", "Id. ¶ 16. ", "Specifically, as noted earlier, the plaintiff\n\nclaimed that she “had been transferred to a new location where the work contract would soon\n\n2\n The EEOC filing and the plaintiff’s termination were both mistakenly dated as occurring in 2011 in the plaintiff’s\nComplaint; her subsequent filings cite 2010 as the correct year when the events at issue occurred. ", "Pl.", "’s Mem. ", "at 2;\nId., Exhibit (“Ex.”) ", "1 (Affidavit of Plaintiff) ¶¶ 4-6.", "\n\n\n 2\n\fexpire because of [her] race and age.” ", "Id. The defendant was made aware of the plaintiff’s\n\nEEOC charge on October 7, 2010. ", "Id. ¶ 17.", "\n\n The defendant gave the plaintiff both verbal and written warnings about her work\n\nperformance on October 4, 2010, and a written warning on October 7, 2010. ", "Def.", "’s Mem. ¶¶ ", "6-8\n\nat 2-3. ", "Several days later, on October 13, 2010, the defendant terminated the plaintiff and\n\nreplaced her with someone “substantially younger” and of a different race than the plaintiff.", "\n\nCompl. ¶¶ ", "18-19. ", "On October 14, 2010, the Service Employees International Union (“SEIU”)\n\nfiled an unjust discharge grievance on the plaintiff’s behalf, which was eventually submitted to\n\narbitration. ", "Def.", "’s Mem. ¶¶ ", "10-11 at 3. ", "After a two-day evidentiary hearing, the arbitrator issued\n\na written decision finding “just cause for the discharge of [the plaintiff].” ", "Def.", "’s Mem., ", "Exhibit\n\n(“Ex.”) ", "7 (Decision & Award). ", "However, the decision did not address the plaintiff’s\n\ndiscrimination claims. ", "See Pl.", "’s Mem. ", "at 9 n.2 (“The arbitrator simply made a ruling based on a\n\ncontract involving the parties . . . .”).", "\n\n The plaintiff filed this case on October 25, 2011, in the Superior Court for the District of\n\nColumbia. ", "Compl. ", "at 1. ", "The defendant then removed the case to this Court on December 13,\n\n2011. ", "Notice of Removal at 1. ", "The defendant now moves for dismissal or summary judgment\n\narguing that the plaintiff “cannot establish that she was qualified for her position as a [c]leaner,”\n\nnor can she “establish a causal connection between her filing a Charge of Discrimination with\n\nthe EEOC and the termination of her employment,” Def.", "’s Mem. ", "at 6-7. ", "Consequently, the\n\ndefendant requests that the plaintiff’s Complaint “be dismissed, in its entirety, with prejudice.”", "\n\nId. at 8.", "\n\n\n\n\n 3\n\f II. ", "STANDARDS OF REVIEW\n\nA. Rule 12(b)(6) Motion to Dismiss\n\n A motion to dismiss pursuant to Federal Rule of Civil Procedure 12(b)(6) tests whether a\n\ncomplaint properly states a claim upon which relief can be granted. ", "For a complaint to survive a\n\nRule 12(b)(6) motion, it need only provide “a short and plain statement of the claim showing that\n\nthe pleader is entitled to relief,” Fed. ", "R. Civ. ", "P. 8(a)(2), which accomplishes the dual objectives\n\nof “giv[ing] the defendant fair notice of what the claim is and the grounds upon which it rests,”\n\nBell Atl. ", "Corp. v. Twombly, 550 U.S. 544, 555 (2007) (citation omitted). “", "Although detailed\n\nfactual allegations are not necessary to withstand a Rule 12(b)(6) motion to dismiss, to provide\n\nthe grounds of entitlement to relief, [the] plaintiff must furnish more than labels and conclusions\n\nor a formulaic recitation of the elements of a cause of action.” ", "Hinson ex rel. ", "N.H. v. Merritt\n\nEduc. ", "Ctr., ", "521 F. Supp. ", "2d 22, 27 (D.D.C. 2007) (internal quotation marks omitted) (quoting\n\nTwombly, 550 U.S. at 555). ", "Or, as the Supreme Court stated in the Rule 12(b)(6) context, “[t]o\n\nsurvive a motion to dismiss, a complaint must contain sufficient factual matter, accepted as true,\n\nto ‘state a claim to relief that is plausible on its face.’” ", "Ashcroft v. Iqbal, 556 U.S. 662, 678\n\n(2009) (quoting Twombly, 550 U.S. at 570). ", "And, a claim is facially plausible “when the\n\nplaintiff pleads factual content that allows the court to draw [a] reasonable inference that the\n\ndefendant is liable for the misconduct alleged.” ", "Id. Moreover, under Rule 12(b)(6), the Court\n\n“must treat the complaint’s factual allegations as true [and] must grant [the] plaintiff the benefit\n\nof all reasonable inferences [that can be derived] from the facts alleged.” ", "Trudeau v. FTC, 456\n\nF.3d 178, 193 (D.C. Cir. ", "2006) (internal quotation marks and citation omitted). ", "Further, in\n\nresolving a Rule 12(b)(6) motion, the Court may consider only the factual allegations set forth in\n\n\n\n\n 4\n\fthe complaint, any documents attached as exhibits with the complaint (or incorporated into the\n\ncomplaint), and matters subject to judicial notice. ", "EEOC v. St. Francis Xavier Parochial Sch.,", "\n\n117 F.3d 621, 624 (D.C. Cir. ", "1997). ", "The Court’s focus is therefore restricted to the facts as\n\nalleged by the plaintiff, which must be sufficient “to raise a right to relief above the speculative\n\nlevel.” ", "Twombly, 550 U.S. at 555. ", "Finally, Federal Rule of Civil Procedure 12(d) provides that\n\n“[i]f, on a motion under Rule 12(b)(6) . . . , ", "matters outside the pleadings are presented to and not\n\nexcluded by the court, the motion must be treated as one for summary judgment under Rule 56.”", "\n\nB. Rule 56 Motion for Summary Judgment\n\n Under Federal Rule of Civil Procedure 56, a court “shall grant summary judgment if the\n\nmovant shows that there is no genuine dispute as to any material fact and the movant is entitled\n\nto judgment as a matter of law.” ", "Fed. ", "R. Civ. ", "P. 56(a). ", "In making this assessment, courts must\n\nview all the evidence, except for conclusory statements, in the light most favorable to the non-\n\nmoving party, “even when the court entertains grave doubts” about the non-movant’s statements.", "\n\nGreene v. Dalton, 164 F.3d 671, 674 (D.C. Cir. ", "1999). ", "Summary judgment “ordinarily is proper\n\nonly after the plaintiff has been given adequate time for discovery,” Chappell-Johnson v. Powell,\n\n440 F.3d 484, 488 (D.C. Cir. ", "2006) (internal citation and quotation marks omitted), and courts\n\nare especially cautious in granting summary judgment prematurely in discrimination cases\n\nbecause they “center on the issue of an employer’s intent, and ‘writings directly supporting a\n\nclaim of intentional discrimination are rarely, if ever, found among an employer’s corporate\n\npapers.’” ", "Aka v. Wash. Hosp. ", "Ctr., ", "116 F.3d 876, 879 (D.C. Cir. ", "1997) (internal citation\n\nomitted), rev’d on other grounds, 156 F.3d 1284 (D.C. Cir. ", "1998) (en banc).", "\n\n\n\n\n 5\n\f III. ", "LEGAL ANALYSIS\n\nA. The Defendant’s 12(b)(6) Motion to Dismiss\n\n The defendant seeks dismissal of the plaintiff’s race and age discrimination claims\n\npursuant to Rule 12(b)(6) on the grounds that the plaintiff “cannot establish that she was\n\nqualified for her position as a [c]leaner for Red Coats at the time that her employment was\n\nterminated” and because “there has already been a written decision after a two day arbitration\n\nhearing specifically finding that there was just cause to terminate [her] employment.” ", "Def.", "’s\n\nMem. ", "at 6. ", "In addition, the defendant seeks dismissal of the plaintiff’s retaliation claim arguing\n\nthat she cannot “establish a causal connection between her filing a [c]harge of [d]iscrimination\n\nwith the EEOC and the termination of her employment, id. at 7, and that there was “just cause”\n\nfor the termination, id. As support for its positions, the defendant relies on the arbitration\n\ndecision, id., Ex. ", "7, an e-mailed complaint from one of its clients concerning areas cleaned by the\n\nplaintiff, id., Ex. ", "1, and several written warnings issued to the plaintiff concerning the poor\n\nperformance of her duties, id., Exs. ", "2-5. ", "Based on this documentation, the defendant argues that\n\nthe plaintiff “cannot establish a prima facie case of [her] race or age discrimination” claims, nor\n\ncan she sufficiently demonstrate that the defendant’s “legitimate reasons” for terminating her\n\nemployment “are pretext for unlawful retaliation,” and consequently, the plaintiff’s claims\n\ncannot “survive [its m]otion to [d]ismiss.” ", "Id. at 7.", "\n\n In opposition, the plaintiff responds that her “claims for race and age discrimination\n\ncontain all of the elements required to state a claim for relief.” ", "Pl.", "’s Mem. ", "at 5. ", "The plaintiff\n\nrepresents that she has pleaded that “she is a 75 year old black woman (protected class), that she\n\nperformed her job duties satisfactorily (qualified to work as a [c]lean[e]r), and that she was\n\n\n\n\n 6\n\fterminated and replaced by someone outside of the protected class who was a younger, non-\n\nblack person (causal connection).” ", "Id. at 5-6. ", "In addition, the plaintiff maintains that her claim\n\nfor retaliation “is also sufficiently pled” because the defendant terminated her “only twelve days”\n\nafter she filed her Charge of Discrimination with the EEOC. ", "Id. at 6. ", "Finally, the plaintiff states\n\nthat she\n\n believes in good faith that, given the opportunity to conduct discovery, she will\n generate additional admissible facts in support of her claims and, particularly, that\n the non-discriminatory explanation provided by the [d]efendant is not true or\n credible. ", "Discovery is also expected to reveal comparable situations where the\n [d]efendant treated others differently than the [p]laintiff.", "\n\nPl.", "’s Opp’n. ¶ ", "4.", "\n\n Because all of the challenges to the plaintiff’s claims rely on matters outside the\n\nComplaint and those matters were not “attached to or incorporated in the [C]omplaint,” they\n\nprovide no basis for dismissal under Rule 12(b)(6). ", "St. Francis Xavier Parochial Sch., ", "117 F.3d\n\nat 624. ", "The Court will therefore deny the defendant’s Rule 12(b)(6) motion and assess whether\n\nthe defendant is entitled to summary judgment under Rule 56. ", "See Yates v. Dist. ", "of Columbia,\n\n324 F.3d 724, 725 (D.C. Cir. ", "2003) (stating that a court’s consideration of matters outside the\n\npleadings that are not attached or incorporated into the complaint “ha[s] the effect of converting\n\na [motion to dismiss] into a motion for summary judgment”).", "\n\nB. The Defendant’s Rule 56 Motion for Summary Judgment\n\n The defendant seeks summary judgment pursuant to Rule 56, alleging that the\n\n“[p]laintiff’s performance was sub-par and the [d]efendant had a legitimate, non-discriminatory\n\nreason for terminating the [p]laintiff,” Def.", "’s Reply at 3, and that there is no “causal connection\n\nbetween [the plaintiff] filing a Charge of Discrimination with the EEOC and the termination of\n\nher employment,” Def.", "’s Mem. ", "at 7. ", "As stated earlier, the defendant proffers the arbitration\n\ndecision, id., Ex. ", "7, an e-mailed complaint from one of its clients concerning areas cleaned by the\n\n\n 7\n\fplaintiff, id., Ex. ", "1, and several written warnings issued to the plaintiff concerning the poor\n\nperformance of her duties, id., Exs. ", "2-5, as evidence that the plaintiff was not qualified for her\n\nposition and that there was a legitimate, non-discriminatory reason for the termination of the\n\nplaintiff’s employment. ", "The plaintiff counters that despite the arbitration decision, it would be\n\ninappropriate to grant summary judgment to the defendant at this stage because she has not had\n\nthe opportunity to conduct discovery to show “that the non-discriminatory explanation provided\n\nby the [d]efendant is not true or credible.” ", "Pl.", "’s Opp’n ¶ 4 at 2-3. ", "Furthermore, the plaintiff\n\nclaims that “[d]iscovery is also expected to reveal comparable situations where the [d]efendant\n\ntreated others differently than the [p]laintiff.” ", "Id. ¶ 4 at 3.", "\n\n The Court agrees with the plaintiff that summary judgment is inappropriate at this time.", "\n\nThe Supreme Court has noted that “the plain language of Rule 56[] mandates the entry of\n\nsummary judgment, after adequate time for discovery and upon motion,” Celotex Corp. v.\n\nCatrett, 477 U.S. 317, 322 (1986) (emphasis added), and that “[a]ny potential problem with such\n\npremature motions [may] be adequately dealt with under Rule 56[d], which allows a summary\n\njudgment motion to be denied, or the hearing on the motion to be continued, if the non[-]moving\n\nparty has not had an opportunity to make full discovery,” id. at 326 (footnote omitted). ", "The\n\nDistrict of Columbia Circuit has applied this rule in the context of a discrimination case holding\n\nthat “because [the plaintiff’s] declaration pointed to the types of evidence that might raise an\n\ninference of discrimination . . . ", "and because we may not impose a prima facie case requirement\n\nin a ‘rigid, mechanized, or ritualistic’ way, [the plaintiff] is entitled to the discovery she seeks.”", "\n\nChappell-Johnson, 440 F.3d at 489 (internal citation omitted).", "\n\n The defendant argues that its motion should be granted because “it will be impossible for\n\n[the p]laintiff to establish that she was qualified for the position” given the arbitration decision.", "\n\n\n\n\n 8\n\fDef.", "’s Reply at 3. ", "The defendant further contends that the plaintiff “has presented absolutely no\n\nevidence to rebut the undisputed facts that were presented by [the d]efendant,” and that “[a]s the\n\nArbitrator’s decision clearly demonstrates, [the p]laintiff’s performance was sub-par and the\n\n[d]efendant had a legitimate, non-discriminatory reason for terminating the [p]laintiff from\n\nemployment.” ", "Id. The Court disagrees, finding, at this early stage, that there are several facts\n\nthat appear to be in dispute, namely, as accurately identified by the plaintiff: (1) whether “she did\n\nperform all of her job duties including the task of changing trash bags/liners where she found\n\nsoiled” items, (2) whether she was “provided a reasonable opportunity to become familiar with\n\nthe location of the trash cans at the Connecticut Avenue building and to develop an efficient plan\n\nto perform her duties within the time demands of the [d]efendant[,]” and (3) whether “she was\n\nforced to work alone in an unfamiliar and large office area while her younger Hispanic co-\n\nworkers were allowed to work in crews where division of labor enabled them to work more\n\nefficiently in comparison” to the plaintiff. ", "Pl.", "’s Mem. ", "at 8-9. ", "Furthermore, because the plaintiff\n\nwas terminated twelve days after she filed her Charge of Discrimination with the EEOC, id. ¶¶ 6-\n\n9 at 3-4, she has “establish[ed] the ‘close temporal proximity’” between her EEOC charge and\n\nher termination, which the District of Columbia Circuit has found gives rise “to an inference of\n\ncausation,” Holcomb v. Powell, 433 F.3d 889, 903 (D.C. Cir. ", "2006). ", "Finally, based on the\n\nrecord in this case, it appears that the arbitration decision did not address the merits of the\n\nplaintiff’s underlying claims, see Pl.", "’s Mem. ", "at 9 n.2 (“The arbitrator simply made a ruling based\n\non a contract involving the parties before the parties had an opportunity to conduct discovery.”).", "\n\n Lastly, turning to the issue of whether any material facts are in dispute, the defendant\n\nclaims that the plaintiff has “proffered nothing but self-serving statements in response, and\n\npresented no statement from a coworker or otherwise, attesting to [the p]laintiff’s ability to work\n\n\n\n\n 9\n\fin the position in question or justifying even the inference that the employment decision was\n\nmotivated by discrimination.” ", "Def.", "’s Reply at 6. ", "However, the plaintiff is not required to\n\npresent evidence in her Complaint. ", "See Swierkiewicz v. Sorema, 534 U.S. 506, 510-511 (2002)\n\n(“The prima facie case under McDonnell Douglas, however, is an evidentiary standard, not a\n\npleading requirement.” ", "Indeed, “[t]his Court has never indicated that the requirements for\n\nestablishing a prima facie case under McDonnell Douglas also apply to the pleading standard\n\nthat plaintiffs must satisfy in order to survive a motion to dismiss.”). ", "And, although the Court is\n\nassessing whether the Complaint survives the defendant’s summary judgment motion, that same\n\nstandard must nonetheless apply as judgment is being sought based solely on the allegations in\n\nthe Complaint without the plaintiff having any opportunity to conduct discovery. ", "If the plaintiff\n\ncannot corroborate her allegations with the acquisition of evidence through the discovery\n\nprocess, summary judgment may then be appropriate. ", "But, given the “added measure of rigor or\n\ncaution” that courts should use when faced with a motion for summary judgment in\n\ndiscrimination cases, Aka, 116 F.3d at 879-80 (internal citation and quotation marks omitted),\n\nthe plaintiff must be given the opportunity to conduct discovery before an ultimate ruling on the\n\ndefendant’s motion is rendered. ", "Accordingly, the defendant’s motion for summary judgment is\n\ndenied without prejudice.", "\n\n IV. ", "CONCLUSION\n\n For the reasons set forth above, the defendant’s motion to dismiss, or in the alternative,\n\nfor summary judgment will be denied.", "\n\n\n\n\n 10\n\f SO ORDERED. ", "3\n\n REGGIE B. WALTON\n United States District Judge\n\n\n\n\n3\n An Order consistent with this opinion will be issued contemporaneously.", "\n\n\n 11\n\f" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0009439052664674819, 0.0007286129402928054, 0.0007467011455446482, 0.0007412621635012329, 0.0006322790868580341, 0.0011030308669432998, 0.0007531396113336086, 0.0005552859511226416, 0.04633382335305214, 0.0007889301632530987, 0.0007721183937974274, 0.0007937083137221634, 0.0008889057789929211, 0.000777547131292522, 0.0006808777106925845, 0.000740044517442584, 0.001328707905486226, 0.020180076360702515, 0.0019364466425031424, 0.0005710930563509464, 0.0008038024534471333, 0.002566660288721323, 0.0025090444833040237, 0.0016574746696278453, 0.0006558063323609531, 0.009469418786466122, 0.0008337970357388258, 0.0009116134606301785, 0.0012224509846419096, 0.0006870675715617836, 0.0011398450005799532, 0.0007318562129512429, 0.0013238334795460105, 0.0008034432539716363, 0.001234309864230454, 0.0006278994842432439, 0.0008074339712038636, 0.0012224509846419096, 0.0006652177544310689, 0.0006050313822925091, 0.0010557424975559115, 0.0006878069252707064, 0.0020234277471899986, 0.0005696857697330415, 0.0012222665827721357, 0.0007884165388531983, 0.0007517338963225484, 0.0006835336680524051, 0.0007161347311921418, 0.0009141771588474512, 0.0007110877195373178, 0.0012222665827721357, 0.0007884165388531983, 0.0007382906624116004, 0.0006452595698647201, 0.0012222665827721357, 0.0008742960635572672, 0.0006157223833724856, 0.0005973430816084146, 0.000700080709066242, 0.0006715526105836034, 0.0012224509846419096, 0.0006995158037170768, 0.0006475935224443674, 0.0009790367912501097, 0.0007102573872543871, 0.0006269125733524561, 0.0006390452035702765, 0.0010108452988788486, 0.0012224509846419096, 0.0006720453384332359, 0.0006828318000771105, 0.03675331547856331, 0.0010480828350409865, 0.0006883518653921783, 0.0006615035235881805, 0.0010372980032116175, 0.000941908685490489, 0.0006605180096812546, 0.0006430249777622521, 0.0011426290730014443, 0.0007460140041075647, 0.001073982915841043, 0.0009420584538020194, 0.0006437120027840137, 0.001165018300525844, 0.0006570371915586293, 0.0007637073285877705, 0.0007112713064998388, 0.0008656939025968313, 0.0005852517788298428, 0.0005879499949514866, 0.0013115209294483066, 0.0008169101201929152, 0.0007741957088001072, 0.0006247393903322518, 0.0007239024271257222, 0.0012688814895227551, 0.0007043569930829108, 0.0006460090517066419, 0.0022228865418583155, 0.0010372980032116175, 0.0007104296237230301, 0.0006226214463822544, 0.0008134755189530551, 0.0007397858425974846, 0.0007087674457579851, 0.0006073918775655329, 0.0011191618395969272, 0.001073982915841043, 0.0008130066562443972, 0.0006949648377485573, 0.0006448267959058285, 0.0011735344305634499, 0.0007101920782588422, 0.0012222665827721357, 0.0012224509846419096, 0.0007187171140685678, 0.0010778927244246006, 0.0007333062239922583, 0.0008395718759857118, 0.0008428498404100537, 0.0010480323107913136, 0.02211020141839981, 0.0007756448467262089, 0.0008074339712038636, 0.0012224509846419096, 0.0007258252007886767, 0.012445931322872639, 0.003520683851093054, 0.0008812823798507452, 0.004864746239036322, 0.0006200395873747766, 0.0006910329684615135, 0.0008074339712038636, 0.0009372623171657324, 0.0012900278670713305, 0.0007617695955559611, 0.0011598891578614712, 0.000806032563559711, 0.0007154580671340227, 0.0007209867471829057, 0.0006996337906457484, 0.0007244832231663167, 0.0010659934487193823, 0.0010370990494266152, 0.0012224509846419096, 0.0007124849944375455, 0.0005754749872721732, 0.0007346484926529229, 0.0008395718759857118, 0.0007707744953222573, 0.0006771654589101672, 0.0008074339712038636, 0.000932879454921931, 0.0008267328375950456, 0.0016114978352561593, 0.0006089899688959122, 0.0006139500765129924, 0.0005992053775116801, 0.0006137333111837506, 0.0006335856742225587, 0.0005965795135125518, 0.0028110621497035027, 0.0007148988079279661, 0.002084980718791485, 0.0007318715215660632, 0.0008074339712038636, 0.0012224509846419096, 0.0006870675715617836, 0.0009012298542074859, 0.0007848869427107275, 0.0005959774134680629, 0.0012224509846419096, 0.0006506624049507082, 0.0007910692365840077, 0.0012222665827721357, 0.0007225550361908972, 0.000800655223429203, 0.0006352971540763974, 0.0008556564571335912, 0.0006161057390272617, 0.0006312975892797112, 0.0006357554229907691, 0.0007912306464277208, 0.0013316390104591846, 0.0006390184862539172, 0.0009014888200908899, 0.0006203951197676361, 0.0011056509101763368 ]

[ "module github.com/onsi/ginkgo\n\nrequire (\n\tgithub.com/hpcloud/tail v1.0.0\n\tgithub.com/onsi/gomega v1.7.1\n\tgolang.org/x/sys v0.0.0-20191120155948-bd437916bb0e\n)\n\ngo 1.12\n" ]

{ "pile_set_name": "Github" }

[ 0.0030288412235677242 ]

[ "Q:\n\nAndroid facebook applicationId cannot be null error despite correct app_id\n\nI know this question has been asked before, but my problem is that I have set up the Manifest and Strings files correctly:\n<?", "xml version=\"1.0\" encoding=\"utf-8\"?", ">\n<manifest xmlns:android=\"http://schemas.android.com/apk/res/android\"\n package=\"com.hellofb\"\n android:versionCode=\"1\"\n android:versionName=\"1.0\" >\n\n <uses-sdk\n android:minSdkVersion=\"8\"\n android:targetSdkVersion=\"17\" />\n\n <uses-permission android:name=\"android.permission.", "INTERNET\" />\n\n <application\n android:allowBackup=\"true\"\n android:icon=\"@drawable/ic_launcher\"\n android:label=\"@string/app_name\"\n android:theme=\"@style/AppTheme\" >\n <activity\n android:name=\"com.hellofb.", "MainActivity\"\n android:label=\"@string/app_name\" >\n <intent-filter>\n <action android:name=\"android.intent.action.", "MAIN\" />\n\n <category android:name=\"android.intent.category.", "LAUNCHER\" />\n </intent-filter>\n </activity>\n\n <meta-data\n android:name=\"com.hellofb.", "ApplicationId\"\n android:value=\"@string/app_id\" />\n\n <activity android:name=\"com.hellofb.", "LoginActivity\" />\n </application>\n\n</manifest>\n\n(app_id string edited for security)\n<?", "xml version=\"1.0\" encoding=\"utf-8\"?", ">\n<resources>\n\n <string name=\"app_name\">Hello FB</string>\n <string name=\"action_settings\">Settings</string>\n <string name=\"hello_world\">Hello world!</string>\n <string name=\"app_id\">18031830547XXXX</string>\n\n</resources>\n\nAny ideas where I might be going wrong? ", "Have I by any chance set things up the wrong way? ", "Any help in the right direction is appreciated.", "\n\nA:\n\nYou are doing it wrong. ", "It should be like below:\n <meta-data\n android:name=\"com.facebook.sdk.", "ApplicationId\"\n android:value=\"@string/app_id\" />\n\nYou should not alter the name string. ", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0011283454950898886, 0.0006190649583004415, 0.0006876526167616248, 0.0006979376776143909, 0.0007231584168039262, 0.0007270173518918455, 0.0008762500365264714, 0.0006972947739996016, 0.0006653909222222865, 0.0006190649583004415, 0.0007814785931259394, 0.0007975811022333801, 0.0005263388738967478, 0.0016215660143643618, 0.0006725258426740766, 0.0006477663991972804, 0.001995444530621171 ]

[ "Ratio of coaches to managers\n\nWe are looking at introducing formal coaching into our organisation (consisting of 500+ managers in EU to be delivered by HR across the EU). ", "We were hoping from your experience if you could advise us how we go about calculating how many coaches we would need to train? ", "Should we use a ratio?", "\n\nQuestions like this make me nervous. ", "The organisation is not an existing client (although they clearly have some good values) and I don’t know where they’re at, but there’s a lot of strategic thinking needed on introducing coaching before these kind of fine details can be considered.", "\n\nHere’s my formal reply in case it’s useful:\n\nI don’t know if there’s such a thing as an “industry standard” ratio for coaches to ‘clients’, and much would depend on how frequently sessions were going to be scheduled and how long the coaching relationship was going to last.", "\n\nOff the top of my head, start with 1:5 and expand or contract as you all gain experience.", "\n\nWhilst writing, I would also suggest that there are many other things you need to consider especially given differing cultures across the EU:\n\nIt is essential to gain role model support from the top leadership (walking the talk as well as talking the talk)\n\nThe coaches drawn from HR must receive high quality training\n\nThe coaches must be encouraged to support each other and have regular best practice sharing sessions\n\nAllow the coaches to consult with external coaches to develop their approach\n\nDecide how the success of the coaching will be evaluated and measure it robustly\n\nPromote coaching success stories loudly once they begin to happen (and they will)\n\nReward those that participate meaningfully in the coaching process\n\nMake sure all other company training is supportive of the coaching initiative" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005335898604243994, 0.00049992447020486, 0.0008848735596984625, 0.000797813234385103, 0.0005304564256221056, 0.0005835734773427248, 0.0046485308557748795, 0.0005002457764931023 ]

[ "Skanderbeg Mountains\n\nThe Skanderbeg Mountains ( or ) are a mountain range in Albania, Southern Europe.", "\n\nSee also \n Albanian Adriatic Sea Coast \n Geography of Albania\n Geology of Albania\n\nReferences \n\nCategory:Mountain ranges of Albania\nCategory:Geography of Southeastern Europe" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0010100780054926872, 0.000612169096712023 ]

[ "Top Rated Building Toys for 8 Year Olds\n\nThese are the Top Rated Building Toys for 8 Year Olds . ", "Our toys are rated by our customers. ", "In addition, our team of child-experts review and test thousands of Building Toys before they make it on our site. ", "Then, they match every item to the ability of 8 Year Olds. ", "This combination of ratings from our customers and our child-experts helps to guarantee a child's fun.", "\n\nEbeanstalk Picks\n\nThese are our FAVORITES. ", "With so many to choose from, we wanted to give a hand to help you find the absolute coolest toys on the site. ", "All Ebeanstalk Picks →\n\nBrighten up your Lego creations!First, combine this Laser Pegs Stackable Set with the Laser Pegs AC accessory & base. ", "Then, integrate the Legos you already own or more Laser Pegs. ", "The results shine br...\n\nA Far-From-Ordinary Marble Maze Q-Ba-Maze 2.0 is a unique system of colorful cubes that interlock to form a marble run. ", "The big difference? ", "You can create marble maze sculptures in the form of animal..." ]

{ "pile_set_name": "Pile-CC" }

[ 0.003304334357380867, 0.0010610951576381922, 0.0009765899740159512, 0.026742827147245407, 0.0009008233319036663, 0.0007921095238998532, 0.0006210266728885472, 0.0019218013621866703, 0.0011413514148443937, 0.000650002621114254, 0.0007351222448050976, 0.0006858220440335572 ]

[ "Over the last three decades the Telluride film festival has become known as a maverick event, and organisers moved to consolidate its status yesterday with the announcement of its latest lineup.", "\n\nThe four-day event kicks off today with the world premiere of Fur, Stephen Shainberg's highly anticipated account of the life of celebrated photographer Diane Arbus, played by Nicole Kidman in what is expected to be an award-worthy performance.", "\n\nWhat makes the announcement unusual - not to mention highly irritating in the eyes of major festival and studio executives - is that Fur's official world premiere is scheduled to grace the inaugural Rome film festival in October.", "\n\nHowever Telluride organisers have never been ones to stand on ceremony and don't label their films as premieres. ", "The result is that a film like Fur will screen in Colorado some six weeks before its Italian launch.", "\n\nAs far as the studios are concerned, Telluride's role as a sneak preview festival where attendees can see major films months ahead of their release dates scuppers the best laid plans of major autumn festivals such as Venice and Toronto. ", "Renowned festivals like these rely upon premieres to attract a large crowd of critics and use the word of mouth to begin marketing their films.", "\n\nAmong several other so-called premieres are Kevin Macdonald's Idi Amin drama, The Last King Of Scotland, starring Forrest Whitaker and James McAvoy (set to receive its official world premiere at the Toronto festival later this month) and Infamous, Doug McGrath's account of Truman Capote that is almost identical in plot to last year's Capote and screened at Berlin.", "\n\nPenelope Cruz will receive a career award during the festival, which runs between September 1 and 4." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005525481537915766, 0.0006660456419922411, 0.0005801210063509643, 0.0006951668183319271, 0.0008714312571100891, 0.0005650271195918322, 0.0006344259018078446, 0.0006574740400537848, 0.0005742284702137113 ]

[ "creasing order.", "\n21, 0, -80\nPut -2, 2, -4, -113, 12, 4 in ascending order.", "\n-113, -4, -2, 2, 4, 12\nPut 124, -182, -2 in ascending order.", "\n-182, -2, 124\nPut -5, -0.54, -109 in ascending order.", "\n-109, -5, -0.54\nPut -123, -13, 2, -11, -2 in ascending order.", "\n-123, -13, -11, -2, 2\nPut 3, -3, 68, 38 in increasing order.", "\n-3, 3, 38, 68\nSort 5, -3, 2/9, 0.4, -459/5 in ascending order.", "\n-459/5, -3, 2/9, 0.4, 5\nSort -2, 528, 2, -1, 14.", "\n-2, -1, 2, 14, 528\nPut 2, -11, -49, -78, 4 in increasing order.", "\n-78, -49, -11, 2, 4\nPut 2, -1/3, -883.5, -3 in increasing order.", "\n-883.5, -3, -1/3, 2\nSort -4, -439, 16 in decreasing order.", "\n16, -4, -439\nPut -3, -1, 5, 4, -580, -4 in increasing order.", "\n-580, -4, -3, -1, 4, 5\nSort 14, -4, 109, 5.", "\n-4, 5, 14, 109\nSort -4, 2, 6305 in descending order.", "\n6305, 2, -4\nPut 263972, 5, -5 in descending order.", "\n263972, 5, -5\nPut -18.6, -5, 0.3, -0.1, 1 in descending order.", "\n1, 0.3, -0.1, -5, -18.6\nPut 130, 0, 3, -28, -4 in increasing order.", "\n-28, -4, 0, 3, 130\nSort -3, -73, -18464 in decreasing order.", "\n-3, -73, -18464\nPut -1, -2208, 4 in descending order.", "\n4, -1, -2208\nSort 0.3, 2/13, 2, 35, 1/2, -23 in descending order.", "\n35, 2, 1/2, 0.3, 2/13, -23\nSort -42, 1/7, -2/83, 4, -35 in descending order.", "\n4, 1/7, -2/83, -35, -42\nPut -0.5, 429, 0.232, -2 in descending order.", "\n429, 0.232, -0.5, -2\nSort 1/7, 560, 3, -0.2, -2 in descending order.", "\n560, 3, 1/7, -0.2, -2\nPut 11, 0, -2, 8.7, -5/3 in increasing order.", "\n-2, -5/3, 0, 8.7, 11\nSort 4, -0.1, 230, 0.1, 1/7.", "\n-0.1, 0.1, 1/7, 4, 230\nSort 0, -52149, 5.", "\n-52149, 0, 5\nSort 1, -2/6105, 0, -0.04, 3.", "\n-0.04, -2/6105, 0, 1, 3\nPut -0.1, 19, 3, -7, 1/3, 1/31 in increasing order.", "\n-7, -0.1, 1/31, 1/3, 3, 19\nSort 16, 435, -22.", "\n-22, 16, 435\nPut 4, -1, -0.6, 2, 5, 37 in ascending order.", "\n-1, -0.6, 2, 4, 5, 37\nPut 5, -3/4, -2/3, 1, 12/7, -1/6 in descending order.", "\n5, 12/7, 1, -1/6, -2/3, -3/4\nPut -20, -5, 2935, -1, 0 in increasing order.", "\n-20, -5, -1, 0, 2935\nSort 2/9, -878, 0.4, -3 in increasing order.", "\n-878, -3, 2/9, 0.4\nSort -294, 2, -76.", "\n-294, -76, 2\nPut -4, 1/2, 1/22, 2 in increasing order.", "\n-4, 1/22, 1/2, 2\nSort 14, 270, -0.5 in ascending order.", "\n-0.5, 14, 270\nPut -10, 5, 12, 1524 in decreasing order.", "\n1524, 12, 5, -10\nSort -32/39, 3/5, 2, -10/3, -0.3, 1 in ascending order.", "\n-10/3, -32/39, -0.3, 3/5, 1, 2\nSort 0, 4, -152, -5, -18, -3 in increasing order.", "\n-152, -18, -5, -3, 0, 4\nSort 5, 34, 1, 2, -214, -1 in decreasing order.", "\n34, 5, 2, 1, -1, -214\nSort -11, 219, 0, 80 in decreasing order.", "\n219, 80, 0, -11\nSort 552/43, -2.6, -5.", "\n-5, -2.6, 552/43\nPut 5/4, 3.799, 2 in descending order.", "\n3.799, 2, 5/4\nSort -111, 2, 11, 1 in descending order.", "\n11, 2, 1, -111\nSort 327, 0, -2, 2, -55 in increasing order.", "\n-55, -2, 0, 2, 327\nSort -4, 4, -14, 5, -52.", "\n-52, -14, -4, 4, 5\nSort 25, 107, 16, 3, 1, -2 in ascending order.", "\n-2, 1, 3, 16, 25, 107\nSort -5, -631, 4.", "\n-631, -5, 4\nSort -0.5, -14, 48/7, 2 in descending order.", "\n48/7, 2, -0.5, -14\nSort -4, 8, -522, 3, 0 in decreasing order.", "\n8, 3, 0, -4, -522\nPut -9, -3, 4, -1, -6565 in descending order.", "\n4, -1, -3, -9, -6565\nPut -4, -1, -23, -20, 3 in descending order.", "\n3, -1, -4, -20, -23\nSort 1, 28, 36, -5, 78 in decreasing order.", "\n78, 36, 28, 1, -5\nPut -4, -152, -390 in ascending order.", "\n-390, -152, -4\nSort -4, -3, -1707.", "\n-1707, -4, -3\nPut 971, 3, 25, -5 in descending order.", "\n971, 25, 3, -5\nSort -2, -3, 4, 3, 384, -26 in increasing order.", "\n-26, -3, -2, 3, 4, 384\nPut -565, 3, -4, -5, 7/6 in descending order.", "\n3, 7/6, -4, -5, -565\nPut 987, 0.3, 1.23, -0.2 in descending order.", "\n987, 1.23, 0.3, -0.2\nSort 1, -2924, 4, -9.", "\n-2924, -9, 1, 4\nSort -2/5, -1, 70, -9, 1/5 in descending order.", "\n70, 1/5, -2/5, -1, -9\nPut -1, 11/81, 0.75, -1/2 in increasing order.", "\n-1, -1/2, 11/81, 0.75\nSort 0.02, -11.7, -1/3, 3 in decreasing order.", "\n3, 0.02, -1/3, -11.7\nSort -3348946, -3, -2 in descending order.", "\n-2, -3, -3348946\nSort -0.4, -6, 3, 1/3, 342.", "\n-6, -0.4, 1/3, 3, 342\nSort 0, -1, 12, 25, -17.", "\n-17, -1, 0, 12, 25\nSort 5, -20, 202, -4 in increasing order.", "\n-20, -4, 5, 202\nSort -7, 1, 1376 in increasing order.", "\n-7, 1, 1376\nSort -41, 7/2, 0, 3/4, -1 in increasing order.", "\n-41, -1, 0, 3/4, 7/2\nSort -0.5, -0.4, -3, 19, 1, 5700 in increasing order.", "\n-3, -0.5, -0.4, 1, 19, 5700\nPut -3, 3, 7679 in increasing order.", "\n-3, 3, 7679\nSort 2, -0.5, -3169/10 in descending order.", "\n2, -0.5, -3169/10\nSort 2/11, -1, 214.", "\n-1, 2/11, 214\nPut -24, 2, -51, -1, -7, -3 in descending order.", "\n2, -1, -3, -7, -24, -51\nSort -297, 24, -2 in descending order.", "\n24, -2, -297\nSort -1, -110, 0, -5 in decreasing order.", "\n0, -1, -5, -110\nPut 2, -5, -0.2, -7/9, 2271 in decreasing order.", "\n2271, 2, -0.2, -7/9, -5\nSort -1, -951, 2, 0, 5 in decreasing order.", "\n5, 2, 0, -1, -951\nPut -7653, 0.3, -0.08 in decreasing order.", "\n0.3, -0.08, -7653\nPut 21438, 8, 3 in descending order.", "\n21438, 8, 3\nSort -2, -18, -12, 0 in decreasing order.", "\n0, -2, -12, -18\nSort -79, 10412, -3, 3 in decreasing order.", "\n10412, 3, -3, -79\nSort -2/445, 2/9, 0, 4/7, 0.5 in descending order.", "\n4/7, 0.5, 2/9, 0, -2/445\nSort 1544, 1, -9 in decreasing order.", "\n1544, 1, -9\nSort 12, 6, 50, 4, -2.", "\n-2, 4, 6, 12, 50\nPut 7, -1061, 0.3, -0.5, -3 in decreasing order.", "\n7, 0.3, -0.5, -3, -1061\nPut -2/3, 2742, 10 in increasing order.", "\n-2/3, 10, 2742\nPut 0.5, -68, -1368 in ascending order.", "\n-1368, -68, 0.5\nPut -5, -16, -2/25, 25, 1/8 in increasing order.", "\n-16, -5, -2/25, 1/8, 25\nSort -4, -0.8, 1/10, -0.4, 11.", "\n-4, -0.8, -0.4, 1/10, 11\nSort 2, 0, 6, 1035, -2, 4 in decreasing order.", "\n1035, 6, 4, 2, 0, -2\nSort -0.2, 13, 1, 0, 1/2, -135 in descending order.", "\n13, 1, 1/2, 0, -0.2, -135\nSort 8, -0.081, 5, 3 in increasing order.", "\n-0.081, 3, 5, 8\nPut 0.2, 0.3, -8, 0.1, 65 in descending order.", "\n65, 0.3, 0.2, 0.1, -8\nSort 3/8, 2/69, 7/3 in ascending order.", "\n2/69, 3/8, 7/3\nSort -22/7, 0.1, 6/5, -0.041.", "\n-22/7, -0.041, 0.1, 6/5\nPut -6, -4, -33, -1, 25, 1 in decreasing order.", "\n25, 1, -1, -4, -6, -33\nSort 1, -3, 651/16, -0.3 in descending order.", "\n651/16, 1, -0.3, -3\nSort 526, 4, 1, 47.", "\n1, 4, 47, 526\nPut -1974, 2, -30 in increasing order.", "\n-1974, -30, 2\nSort 5, -587, -10, -5, 7 in descending order.", "\n7, 5, -5, -10, -587\nSort -10, 22/5, -2/3, -11 in increasing order.", "\n-11, -10, -2/3, 22/5\nSort 15/8, -0.102, -18, -2.", "\n-18, -2, -0.102, 15/8\nSort -25, 2/17, 1.9.", "\n-25, 2/17, 1.9\nSort 0.06, 2/13665, 5 in descending order.", "\n5, 0.06, 2/13665\nPut 4, 26, -23597 in increasing order.", "\n-23597, 4, 26\nSort -52, 3, -0.04, -5 in ascending order.", "\n-52, -5, -0.04, 3\nSort -4, -1973, -2.", "\n-1973, -4, -2\nPut -4/5, 28, -77/4, -1, 2 in descending order.", "\n28, 2, -4/5, -1, -77/4\nSort -9, 0, -6, -1/6, -3, 1 in increasing order.", "\n-9, -6, -3, -1/6, 0, 1\nPut 1, -18, 45, 4 in descending order.", "\n45, 4, 1, -18\nSort -3, 325, -1, 6.", "\n-3, -1, 6, 325\nPut -1/12, -878, -1/3 in descending order.", "\n-1/12, -1/3, -878\nPut 0.05, 63, 0.1, 8 in ascending order.", "\n0.05, 0.1, 8, 63\nPut -1, -4, -10, 30, 2 in increasing order.", "\n-10, -4, -1, 2, 30\nSort -12, 37, -13/2 in descending order.", "\n37, -13/2, -12\nPut -3/2, 1, -1, 4/9, -10/11 in decreasing order.", "\n1, 4/9, -10/11, -1, -3/2\nSort 0, 6889, 5 in ascending order.", "\n0, 5, 6889\nPut -1, 1, 2, 4, 5, 13 in decreasing order.", "\n13, 5, 4, 2, 1, -1\nPut 126, -485, -0.07 in descending order.", "\n126, -0.07, -485\nSort 24/1553, -2/13, -19 in increasing order.", "\n-19, -2/13, 24/1553\nSort 4, 1357, 33, -4, 5 in ascending order.", "\n-4, 4, 5, 33, 1357\nPut -4, 73, 51 in descending order.", "\n73, 51, -4\nPut 6, -171, -2, 0, -4 in increasing order.", "\n-171, -4, -2, 0, 6\nSort -4, 0, -721, -2.", "\n-721, -4, -2, 0\nSort -3, 4, 0, 5314, -16.", "\n-16, -3, 0, 4, 5314\nPut -1, -4243, -198 in ascending order.", "\n-4243, -198, -1\nSort 4, 2, 0, -5, 3326 in descending order.", "\n3326, 4, 2, 0, -5\nPut -0.1, -0.3, -0.4, 3523, -5 in increasing order.", "\n-5, -0.4, -0.3, -0.1, 3523\nPut 41/3, 3, 4574 in descending order.", "\n4574, 41/3, 3\nSort 2, -5, 51, -103, 0 in decreasing order.", "\n51, 2, 0, -5, -103\nPut 4, -51, 3, -6, -3, 1 in descending order.", "\n4, 3, 1, -3, -6, -51\nSort 66, -1, -2, 4, 1, -20 in decreasing order.", "\n66, 4, 1, -1, -2, -20\nPut 30323, 4, -1 in increasing order.", "\n-1, 4, 30323\nPut 74, -1, -4, -175, -2 in decreasing order.", "\n74, -1, -2, -4, -175\nSort 5, -10, 2, 3, 11, -4 in descending order.", "\n11, 5, 3, 2, -4, -10\nPut 0, 5, 3, 6, -5, -32 in descending order.", "\n6, 5, 3, 0, -5, -32\nPut 2, -1/13, 1.5, 3/5 in decreasing order.", "\n2, 1.5, 3/5, -1/13\nPut 2/17, 14, 3, 0.4, 97 in decreasing orde" ]

{ "pile_set_name": "DM Mathematics" }

[ 0.0032243123278021812, 0.0009638233459554613, 0.0008722295751795173, 0.0009208956034854054, 0.0009368119644932449, 0.0008091948111541569, 0.0006878557614982128, 0.0011822438100352883, 0.0008869505254551768, 0.000817853317130357, 0.0006702945684082806, 0.0008279915200546384, 0.0008260607719421387, 0.0006567942909896374, 0.0007765230839140713, 0.0011492874473333359, 0.0009650514111854136, 0.0006855782703496516, 0.0008761169156059623, 0.0006869254866614938, 0.0007009322289377451, 0.0009338617091998458, 0.0007009629043750465, 0.000842693611048162, 0.0011355695314705372, 0.0007089470745995641, 0.0007576823118142784, 0.0009475224069319665, 0.0009034979739226401, 0.0007541910745203495, 0.0010772085515782237, 0.0009844392770901322, 0.0006685637636110187, 0.0007516543846577406, 0.0006643684464506805, 0.0006247146520763636, 0.0006556535372510552, 0.0007371264509856701, 0.0007352606044150889, 0.000724435260053724, 0.000716442649718374, 0.00101130036637187, 0.0008209038060158491, 0.0007361460593529046, 0.0006654007011093199, 0.0007796840509399772, 0.0006655719480477273, 0.0009940913878381252, 0.0006810883642174304, 0.0007234124350361526, 0.0009491863311268389, 0.0008916767546907067, 0.0007165863644331694, 0.000788601697422564, 0.0007787012145854533, 0.0007476527825929224, 0.0007145790732465684, 0.0009025360341183841, 0.0010031091514974833, 0.000987693085335195, 0.000696881499607116, 0.0008313150610774755, 0.0007085573743097484, 0.000663409533444792, 0.0009277419885620475, 0.0010153333423659205, 0.0006737521616742015, 0.0006440507131628692, 0.0006492215907201171, 0.0007565503474324942, 0.0008920825202949345, 0.0006745202117599547, 0.0008682162733748555, 0.0008531358907930553, 0.0006934378179721534, 0.0006531519466079772, 0.0008779742056503892, 0.0007475526072084904, 0.0009533219272270799, 0.000938484794460237, 0.0006813191575929523, 0.0007491782889701426, 0.0007226194138638675, 0.0007251182687468827, 0.0009809070033952594, 0.000916214135941118, 0.0007573514012619853, 0.0007462849607691169, 0.0007995653431862593, 0.0015439167618751526, 0.0007349436637014151, 0.0007052943110466003, 0.000741534517146647, 0.0010453300783410668, 0.0007784623885527253, 0.0009586187079548836, 0.0010123468236997724, 0.0006877551204524934, 0.0008849810110405087, 0.0006987179513089359, 0.0006553686689585447, 0.0006746931467205286, 0.0010567260906100273, 0.0010644980939105153, 0.0006478809518739581, 0.0007361579919233918, 0.000679277814924717, 0.0008466914878226817, 0.0007312256493605673, 0.000746469188015908, 0.0009869597852230072, 0.0009337015217170119, 0.0007244849693961442, 0.0010688075562939048, 0.0010675345547497272, 0.0006747375009581447, 0.0007981052622199059, 0.0007108491845428944, 0.000991539447568357, 0.0009876677067950368, 0.0006794753135181963, 0.0006677721976302564, 0.0008664110209792852, 0.0008454390335828066, 0.000920107529964298, 0.0010239502880722284, 0.000851818360388279, 0.0006820471026003361, 0.0009295677882619202, 0.0010019605979323387, 0.0006743283593095839, 0.001037699286825955, 0.0007528379210270941, 0.0007872742135077715, 0.0007715167012065649, 0.000723360397387296, 0.0011666418286040425, 0.0009771455079317093, 0.0020526922307908535 ]

[ "Partial amino acid sequence and biological characterization of elegatoxin, hemorrhagic toxin from Trimeresurus elegans (Sakishimahabu) venom.", "\nA hemorrhagic toxin, designated Elegatoxin, was isolated from the venom of Trimeresurus elegans using HW-55, DEAE-Sephacel, CM-Cellulose and Mono S column chromatographies. ", "The purified toxin was shown to be homogeneous by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis, isoelectric electrophoresis, and Ouchterlony immunodiffusion. ", "Elegatoxin has a molecular weight of 26,000 with an isoelectric point of 8.6. ", "The toxin demonstrated both hemorrhagic and proteolytic activities. ", "Hemorrhagic activity was inhibited by ethylenediaminetetraacetic acid (EDTA), ethyleneglycol-bis-(2-amino-ethylether)N,N'-tetraacetic acid (EGTA), o-phenanthroline, and N-bromosuccinimide, but not by amidinophenylmethanesulfonyl fluoride hydrochloride (APMSF). ", "The minimum hemorrhagic dose was found to be 0.8 microgram/mouse. ", "Elegatoxin possesses proteolytic activity as evidenced by hydrolyzing type IV collagen, actin and the A alpha, B beta, and gamma chains of bovine fibrinogen. ", "This purified toxin contains 1 mol of zinc and 2 mols of calcium per mol of protein and a partial amino acid sequence was determined. ", "The pathological and biochemical properties of Elegatoxin were investigated, and these results are reported in this paper." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0007746638730168343, 0.001039082882925868, 0.0007697934051975608, 0.0006702377577312291, 0.0010825362987816334, 0.0026388114783912897, 0.0035016443580389023, 0.0010917219333350658, 0.001194253214634955, 0.0005352639709599316 ]

[ "Q:\n\nHow to reboot kubernetes pod and keep the data\n\nI'm now using kubernetes to run the Docker container.", "I just create the container and i use SSH connect to my pods. ", "\nI need to do some system config change so i need to reboot the container but when i`reboot the container it will lose all the data in the pod. ", "kubernetes will run a new pod just like the Docker image original.", "\nSo how can i reboot the pod and just keep the data in it?", "\nThe kubernetes was offered my Bluemix\n\nA:\n\nYou need to learn more about containers as your question suggests that you are not fully grasping the concepts.", "\n\nRunning SSH in a container is an anti-pattern, a container is not a virtual machine. ", "So remove the SSH server from it.", "\nthe fact that you run SSH indicates that you may be running more than one process per container. ", "This is usually bad practice. ", "So remove that supervisor and call your main process directly in your entrypoint.", "\nSetup your container image main process to use environment variables or configuration files for configuration at runtime.", "\n\nThe last item means that you can define environment variables in your Pod manifest or use Kubernetes configmaps to store configuration file. ", "Your Pod will read those and your process in your container will get configured properly. ", "If not your Pod will die or your process will not run properly and you can just edit the environment variable or config map.", "\nMy main suggestion here is to not use Kubernetes until you have your docker image properly written and your configuration thought through, you should not have to exec in the container to get your process running.", "\nFinally, more generally, you should not keep state inside a container.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0011464881245046854, 0.001010185806080699, 0.0009224785608239472, 0.0013897939352318645, 0.0007898253388702869, 0.0005900981486774981, 0.001811367692425847, 0.0019526054384186864, 0.0007067452534101903, 0.0009799026884138584, 0.0008086544112302363, 0.0006394095253199339, 0.0008554632659070194, 0.0005629126681014895, 0.16788709163665771, 0.0008220024756155908, 0.0006648185080848634, 0.001995444530621171 ]

[ "130719 R.E.D. Friday\n\nHero WOD – “Bruck”\n\nWork: 4 RFT –\n\nRun 400 meters\n\n24 x BS 185/135\n\n24 x pj 135/95\n\nU.S. Coast Guard Petty Officer Third Class Nathan B. Bruckenthal, 24, of Smithtown, New York, assigned to Tactical Law Enforcement Team South, Law Enforcement Detachment 403, based at Coast Guard Air Station Miami in Florida, was killed on April 24, 2004, at the Khawr Al Amaya Oil Terminal off the coast of Iraq when a boat that he and his team intercepted near the terminal exploded. ", "He is survived by his wife Pattie, daughter Harper, born after his death, father Eric, mother Laurie Bullock, and sister Noabeth." ]

{ "pile_set_name": "Pile-CC" }

[ 0.001267780433408916, 0.0018094262341037393 ]

[ "Víctor Almaraz - vAlmaraz\n\nDevelopment Agency\n\nSpain (España)\n\nAbout\n\nI'm an software developer from Salamanca, Spain. ", "Although I specialize in Android and iOS, I also do work on Web and backend development (PHP, MySQL, HTML5, CSS3... with frameworks like Yii and CakePHP)." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005735037266276777, 0.000731619365978986 ]

[ "\\<package\\h+.*", "\n" ]

{ "pile_set_name": "Github" }

[ 0.004078409168869257, 0.001995444530621171 ]

[ "<?", "php\n\nnamespace App\\Traits;\n\nuse App\\Models\\Permission;\nuse App\\Models\\Role;\n\ntrait HasRoles\n{\n /**\n * A user may have multiple roles.", "\n *\n * @return \\Illuminate\\Database\\Eloquent\\Relations\\BelongsToMany\n */\n public function roles()\n {\n return $this->belongsToMany(Role::class);\n }\n\n /**\n * Assign the given role to the user.", "\n *\n * @param string $role\n *\n * @return mixed\n */\n public function assignRole($role)\n {\n return $this->roles()->save(\n Role::whereName($role)->firstOrFail()\n );\n }\n\n /**\n * Determine if the user has the given role.", "\n *\n * @param mixed $role\n *\n * @return bool\n */\n public function hasRole($role)\n {\n if (is_string($role)) {\n return $this->roles->contains('name', $role);\n }\n\n return (bool) $role->intersect($this->roles)->count();\n }\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.0010000212350860238, 0.0008450066670775414, 0.0013562563108280301, 0.0009690781007520854, 0.0011394942412152886 ]

[ "Last year’s election was rife was polarization. ", "With bitter fights in states such as Texas, where incumbent Ted Cruz narrowly defeated challenger Beto O’Rourke, the country’s politicians seemed more divided than ever. ", "Many Democrats ran on an anti-Trump line, whereas many Republicans did the opposite. ", "But one thing about the election season was eerily unified: most of the Senate took money from Lockheed Martin and other military industrial complex companies.", "\n\nLockheed Martin and Political Contribution\n\nLockheed Martin is the top defense contractor for the United States. ", "Many advancements in offensive military technology, such as the infamous F-16 fighter jet, have come from their company. ", "Beyond that, the military industrial complex corporation also specializes in donating money to national campaigns for both major parties.", "\n\nDating at least as far back as 1990, the company has given considerable funds to congressman seeking election. ", "That year, their donations totaled over $450,000. ", "By 2018, the figure shot up more than ten times over, reaching $4.68 million.", "\n\nThe funds do not exclusively go to Democrats or Republicans. ", "More often than not, Lockheed Martin gives more to Republicans. ", "However, they have never given less than a third of their raised money to Democrats. ", "And in two elections, they gave substantially more to them than to Republicans.", "\n\nThe figures, though down from 2016 to 2018, have increased steadily over the past 30 years.", "\n\nDid Your Senators Take Funds?", "\n\nIn the 2018 election season alone, Lockheed Martin donated to a total of 91 Senate campaigns. ", "Lindsey Graham and Ted Cruz, who both received upwards of $50,000. ", "Not far down the list, however, is Beto O’Rourke, to whom the military industrial complex giant gave $22,681. ", "Even Bernie Sanders and Tulsi Gabbard, who profess a less interventionist foreign policy, received smaller amounts of money.", "\n\nIn total, Lockheed Martin gave to 454 national campaigns (or 85% of the total seats in Congress). ", "In many cases, they gave copious amounts of money to opponents facing each other in a race. ", "A notable example of this is the Texas Senate race between Cruz and O’Rourke. ", "A similar thing happened in Missouri, where the company gave a combined total of over $10,000 for Claire McCaskill and Josh Hawley to battle each other.", "\n\nAccording to OpenSecrets, the following individuals running for office took at least $15,000. ", "Candidates who were in the House but running for Senate are listed as House.", "\n\nThe complete list of all 454 campaigns is available here.", "\n\n71 Republic takes pride in our distinctively independent journalism and editorials. ", "Every dollar you give helps us grow our mission of providing reliable coverage. ", "Please consider donating to our Patreon.", "\n\nFeatured Image Source" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.003613452659919858, 0.0007372198160737753, 0.004954685922712088, 0.0006285452400334179, 0.0006170153501443565, 0.0007570505258627236, 0.0005971321370452642, 0.0005760061321780086, 0.0006188531988300383, 0.0006526289507746696, 0.0023472446482628584, 0.007377287372946739, 0.001838525990024209, 0.0014360592467710376, 0.0005775440949946642, 0.0007347521022893488, 0.0005693394341506064, 0.0005913770874030888, 0.0007964615942910314, 0.0009558303281664848, 0.0006190622807480395, 0.0007060953066684306, 0.0006012007361277938, 0.000819365493953228, 0.0005967083270661533, 0.0007675173110328615, 0.0006057402351871133, 0.0006084756460040808, 0.0006645784014835954, 0.0007893497822806239, 0.0006359796389006078 ]

[ "Introduction {#sec1-1}\n============\n\nObesity is a serious and progressively increasing public health problem that has reached epidemic proportions with an increasing worldwide prevalence \\[[@ref1]\\]. ", "The prevalence of childhood and adolescent obesity has tripled dramatically over the last 20--30 years in developed countries, with recent estimates to be \\~17% in the United States \\[[@ref2]\\]. ", "With increasing epidemics of obesity all over the world, research in adult populations have established the link between elevated inflammatory markers and impaired health. ", "Obesity is found to be associated with low-grade inflammatory process characterized by the increase in circulating levels of pro-inflammatory cytokines such as transforming growth factor-β1, interleukin-6 and acute-phase protein (haptoglobin) in healthy obese adults \\[[@ref3]-[@ref4]\\].", "\n\nHaptoglobin is an adiposity and inflammatory marker that involved in the liver acute phase response to inflammation \\[[@ref5]\\]. ", "The most important functions of haptoglobin are to bind free hemoglobin, thus preventing its oxidant activity \\[[@ref6]\\]. ", "Interleukin-6 has been recently proposed to play a central role in the link between obesity, inflammation and coronary heart diseases \\[[@ref7]-[@ref8]\\]. ", "Bastard et al., ", "have suggested that IL-6 could be involved in insulin resistance and its complications \\[[@ref9]\\]. ", "About 15 to 30 % of circulating IL-6 levels derives from adipose tissue production in the absence of an acute inflammation \\[[@ref10]\\]. ", "It regulates energy homeostasis and inflammation; it is capable of suppressing lipoprotein lipase activity, and controls appetite and energy intake at hypothalamic level \\[[@ref11]-[@ref12]\\].", "\n\nTGF-β~1~ is a new multifunctional cytokine that is produced by a variety of cells. ", "TGF-β~1~ activation is closely associated with damage the intima media and lining endothelium of blood vessels through the stimulation of atherosclerotic lesions that is closely associated with the development of CVD, including hypertension \\[[@ref13]\\], cardiac hypertrophy and cardiac fibrosis \\[[@ref14]\\] leading to heart failure, restenosis after coronary intervention and thrombosis \\[[@ref15]\\]. ", "In addition, inflammatory markers impact metabolic control by negatively influencing insulin sensitivity and glucose transport. ", "Recent studies have shown a possible interaction between TGF-β~1~ and visceral fat obesity. ", "It has been considered to play a central role in the development of metabolic syndrome in childhood which is predictive of adult metabolic syndrome, non-alcoholic fatty liver disease and type 2 Diabetes \\[[@ref16]\\]. ", "Furthermore, TGF-β~1~ is a potent initiator of proliferation of renal mesangial cells leading to chronic kidney disease and there are associations between serum level of TGF-β~1~ and risk factors for progression of clinically relevant renal disorders in humans \\[[@ref17]\\].", "\n\nThus, prolonged exposure of obese individuals to these inflammatory markers may exponentially increase their risk in the development of vascular damage, cardiovascular disease, and hypertension \\[[@ref18]\\]. ", "In obese children, early identification of elevated inflammatory markers and development of physical activity interventions are important in attenuating the negative health consequences that are likely facilitated as they mature into adults \\[[@ref19]\\]. ", "The origin of inflammation during obesity and the underlying mechanisms that explain its occurrence are not still fully understood. ", "To our knowledge, no data are available on the physiology, predictors and role of haptoglobin, and TGF-β~1~ in childhood obesity. ", "Therefore, the focus of our interest was to evaluate predictors of obesity complications and the effect of childhood obesity on pro-inflammatory cytokines production as TGF-β~1~, IL-6, and haptoglobin, and to explore the relation between circulating levels of these cytokines and anthropometric measures among prepubertal overweight and obese Egyptian children.", "\n\nSubjects and Methods {#sec1-2}\n====================\n\nSubjects {#sec2-1}\n--------\n\nThis cross sectional case control study was conducted on fifty obese or overweight children randomly selected from new cases attending the Nutrition Outpatient Clinic of the National Research Center for nutritional management during 2014. ", "Overweight & obese children were identified using BMI for age and sex charts according to standardized methods of the World Health Organization (WHO). ", "Obesity is defined as BMI and weight for age more than 2 SDs above the median value of the WHO International Growth References, and BMI z-score more than 1.66 SDs above the WHO age and sex specific mean for overweight \\[[@ref20]\\]. ", "Inclusion criteria for selection included pre-pubertal school overweight & obese children with simple obesity. ", "Exclusion criteria included children having obesity syndromes, or taking medications associated with weight change as glucocorticoid therapy. ", "None of the participants had chronic illness as cardiovascular or endocrine disease as type I or II diabetes, hypothyroidism, and Cushing's disease. ", "Age and sex matched fifty apparently healthy non obese children have been selected as the control group. ", "They recruited from the outpatient' clinic at National Research Center. ", "Ethical approval was obtained from the Medical Ethical Committee of the National Research Center. ", "Written informed consent was obtained from the parents after explanation of the aim of the study and its possible benefits for identifying the cause of the obesity of their children and other children who have the same condition.", "\n\nMethods {#sec1-3}\n=======\n\nAll children in the study were subjected to full personal, past history for systemic diseases, and drug administration as corticosteroids. ", "Each child was subjected to a complete physical examination and anthropometric measures. ", "All measurements were made according to techniques described in the Anthropometric Standardization Reference Manual \\[[@ref20]\\]. ", "Children were weighed (in kg) using a calibrated Seca scale to the nearest 0.1 kg (Seca, Hamburg, Germany), while height (in cm) was measured using a Seca 225 stadiometer to the nearest 0.1 cm with the children dressed in minimal clothes, and without shoes. ", "Each measurement was taken as the mean of three consecutive readings following the recommendations of the International Biological program \\[[@ref21]\\].", "\n\nFor all children, growth parameters including BMI (kg/m^2^), and BMI z-scores were computed using WHO growth standards \\[[@ref22]\\] with the help of Anthro-Program of PC, and online software (<http://www.WHO.gov/epiinfo>). ", "Body mass index (BMI) was calculated according to the known formula as the body weight in kilograms divided by the square of height in meters (kg/m^2^) to classify overweight and obese children. ", "Assessment of BMI was done using categories reported by the world health organization child growth charts standards for age and sex. ", "A body mass index below 18.5 means that the child is underweight, 18.5 to 24.9 means that the child fall in the normal range, 25.0 to 29.9 means child is overweight and a score of 30.0 and higher means the child is obese.", "\n\nVenous blood samples were drawn by venipuncture after 12 hours overnight fasting. ", "Blood samples were immediately centrifuged, and serum was frozen at -80°C until assay. ", "Serum IL-6 was determined by Sandwich enzyme linked immunosorbent assay (ELISA) as the method using a Human IL-6 assay kit provided from Immundiagnostik AG, Bensheim, Germany, according to Bauer et al., ", "\\[[@ref23]\\]. ", "Quantitative determination of the transforming growth factor-β~1~ (TGF-β~1~) in serum samples was performed by Sandwich enzyme linked immunosorbent assay (ELISA) method using Assay Max Human transforming growth factor-β~1~ ELISA Kit from Assay Pro Co., Millipore, St. Charles, MO, (USA), according to Kropf et al., ", "\\[[@ref24]\\]. ", "This assay employs a quantitative sandwich enzyme immunoassay technique that measures TGF-β~1~ in less than 5 hours. ", "Serum haptoglobin was assayed by Sandwich enzyme linked immunosorbent assay (ELISA) as the method using a Human haptoglobin assay kit purchased from Assay Pro Co. (USA) according to Van Vlierberghe et al., ", "\\[[@ref25]\\]. ", "This assay measures haptoglobin in less than 2 hours.", "\n\nStatistical analysis {#sec2-2}\n--------------------\n\nStatistical analysis was performed using the SPSS statistical package software for windows version 21 (SSPS Inc, Pennsylvania, and USA). ", "Parametric variables are expressed as the mean ± SD. ", "Differences between parametric variables among the obese and overweight versus control groups were evaluated using 2-tailed unpaired t-test. ", "The comparison between groups was performed with one way analysis of variance (ANOVA) with Post HOC. ", "Pearson's correlation coefficients were used to evaluate correlations between the data exhibiting parametric distribution. ", "Linear logistic regression analysis was performed to examine the relationship between serum levels of TGF-β~1~, interleukin-6, and haptoglobin with anthropometric measures. ", "P value \\<0.05 was considered significant difference and p\\<0.001 was considered highly significant difference.", "\n\nResults {#sec1-4}\n=======\n\nA total of fifty overweight and obese children aged between 5 to 12 years (mean 9.28 ± 1.96 years) were studied. ", "Out of them, 30 children were obese and 20 children were overweight. ", "The comparison of the anthropometric measures and pro-inflammatory cytokines of obese group and overweight group versus control group by ANOVA test are shown in [Table 1](#T1){ref-type=\"table\"}. ", "ANOVA test followed by Post Hoc test showed statistically highly significant increase in the serum levels of TGF-β~1~, interleukin-6, and haptoglobin in obese children compared to overweight children, and healthy controls respectively (P\\<0.001, in all).", "\n\n###### \n\nThe anthropometric measures, and pro-inflammatory cytokines of obese group and overweight group versus control group.", "\n\n Variables Control (group III) N=50 Obese group (group I) N=30 Overweight (group II) N=20 F P-value\n --------------------------- -------------------------- ---------------------------- ---------------------------- --------- -------------------------------------------\n Weight (kg) 33.64±6.61 50.8±10.39 46.55±7.23 17.16 \\<0.001[\\*\\*](#t1f1){ref-type=\"table-fn\"}\n Height (cm) 140±12.08 121.07±10.37 128.7±9.7 29.63 \\<0.001[\\*\\*](#t1f1){ref-type=\"table-fn\"}\n BMI (kg/m2) 16.84±1.01 34.81±4.38 27.96±1.71 463.97 \\<0.001[\\*\\*](#t1f1){ref-type=\"table-fn\"}\n BMI z-score 0.12±0.49 2.83±0.44 2.34±0.42 367.33 \\<0.001[\\*\\*](#t1f1){ref-type=\"table-fn\"}\n Serum haptoglobin (μg/ml) 2.06±0.76 7.84±1.57 4.69±1.01 253.89 \\<0.001[\\*\\*](#t1f1){ref-type=\"table-fn\"}\n Serum TGF- β1 (ng/ml) 23.76±4.62 45.38±5.14 40.31± 5.22 220.41 \\<0.001[\\*\\*](#t1f1){ref-type=\"table-fn\"}\n Serum IL-6 (pg/mL) 1.13±0.35 12.29± 0.97 8.75±1.55 1549.29 \\<0.001[\\*\\*](#t1f1){ref-type=\"table-fn\"}\n\n\\*Significant difference at p\\<0.05,\n\nhighly significant difference at p\\<0.001.", "\n\n\\*\\*\\* ANOVA.", "\n\nSerum levels of TGF- β~1~, IL-6 and haptoglobin were significantly positively correlated with the body weight, BMI (kg/m^2^) and BMI z-score of obese/overweight cases, respectively (P\\<0.001, in all), while serum levels of IL-6 and haptoglobin were significantly inversely correlated with their height. ", "Serum level of TGF- β~1~ was significantly positively correlated with serum levels of IL-6 and haptoglobin in obese and overweight children. ", "Correlations between anthropometric measurements and pro-inflammatory cytokines in obese/overweight group are shown in [Table 2](#T2){ref-type=\"table\"}.", "\n\n###### \n\nCorrelations between anthropometric measurements and pro-inflammatory cytokines in obese / overweight group.", "\n\n Variables Weight Height BMI BMI z-score Serum hapto-globin Serum TGF-β1 \n --------------------------- --------------------- ----------------------------------------- ---------------------------------------- ----------------------------------------- ----------------------------------------- ----------------------------------------- -----------------------------------------\n Serum Haptoglobin (μg/ml) Pearson Correlation 0.435[\\*\\*](#t2f2){ref-type=\"table-fn\"} -0.293[\\*](#t2f1){ref-type=\"table-fn\"} 0.876[\\*\\*](#t2f2){ref-type=\"table-fn\"} 0.575[\\*\\*](#t2f2){ref-type=\"table-fn\"} 1 0.560[\\*\\*](#t2f2){ref-type=\"table-fn\"}\n \n Sig. (", "2-tailed) 0.002 0.039 .000 0.000 0.000 \n \n Serum TGF- β1 (ng/ml) Pearson Correlation 0.185[\\*\\*](#t2f2){ref-type=\"table-fn\"} -0.229 0.564[\\*\\*](#t2f2){ref-type=\"table-fn\"} 0.391[\\*\\*](#t2f2){ref-type=\"table-fn\"} 0.560[\\*\\*](#t2f2){ref-type=\"table-fn\"} 1\n \n Sig. (", "2-tailed) 0.001 0.109 0.000 0.005 0.000 \n \n Serum IL-6 (pg/mL) Pearson Correlation 0.383[\\*\\*](#t2f2){ref-type=\"table-fn\"} -0.292[\\*](#t2f1){ref-type=\"table-fn\"} 0.809[\\*\\*](#t2f2){ref-type=\"table-fn\"} 0.512[\\*\\*](#t2f2){ref-type=\"table-fn\"} 0.831[\\*\\*](#t2f2){ref-type=\"table-fn\"} 0.558[\\*\\*](#t2f2){ref-type=\"table-fn\"}\n \n Sig. (", "2-tailed) 0.006 0.04 0.000 0.000 0.000 0.000 \n\nSignificant difference at p\\<0.05,\n\nhighly significant difference at p\\<0.001.", "\n\nIn overweight children, serum level of IL-6 was significantly positively correlated with BMI (r = 0.593, P = 0.006), and serum level of haptoglobin (r = 0.458, P = 0.042), and no significant correlation was found between serum levels of IL-6 and TGF-β~1~ (P \\> 0.05). ", "Correlations between serum level of IL-6 and BMI, serum levels of haptoglobin and TGF-β~1~ of overweight children are shown in [Table 3](#T3){ref-type=\"table\"}.", "\n\n###### \n\nCorrelations between serum level of IL-6 and body mass index, serum levels of haptoglobin, and TGF- β1 in overweight group.", "\n\n Variable BMI Serum Haptoglobin Serum TGF β1 \n -------------------- --------------------- ----------------------------------------- --------------------------------------- -------\n Serum IL-6 (pg/mL) Pearson Correlation 0.593[\\*\\*](#t3f2){ref-type=\"table-fn\"} 0.458[\\*](#t3f1){ref-type=\"table-fn\"} 0.204\n \n Sig. (", "2-tailed) 0.006 0.042 0.389 \n\nSignificant difference at p\\<0.05,\n\nhighly significant difference at p\\<0.001.", "\n\nTo confirm the previous correlations, linear regression analysis was done showing the association between the different biomarkers studied and body mass index. ", "Serum levels of IL-6 and haptoglobin were strong predictors in the prediction of obesity complications (P \\< 0.05) as shown in [Table 4](#T4){ref-type=\"table\"}.", "\n\n###### \n\nLinear logistic regression between body mass index and serum pro-inflammatory cytokines in obese / overweight group.", "\n\n Variables Unstandardized coefficients Standardized coefficients t P-value \n --------------------------- ----------------------------- --------------------------- ------- --------- -----------------------------------------\n Serum haptoglobin (μg/ml) 1.500 0.291 0.635 5.154 0.000[\\*\\*](#t4f2){ref-type=\"table-fn\"}\n Serum TGF-β1(ng/ml) 0.065 0.071 0.075 0.912 0.367\n Serum IL-6 (pg/mL) 0.548 0.282 0.239 1.943 0.048[\\*](#t4f1){ref-type=\"table-fn\"}\n\nDependent variable: BMI.", "\n\nSignificant difference at p\\<0.05,\n\nhighly significant difference at p\\<0.001.", "\n\nDiscussion {#sec1-5}\n==========\n\nThe National Health and Nutrition Examination Survey (NHANES) reported that the prevalence of obesity is increasing in all pediatric age groups, in both sexes, and in various ethnic and racial groups \\[[@ref26]\\]. ", "Higher percentages of obesity among Egyptian school children were reported \\[[@ref27]- [@ref28]\\].", "\n\nStudies in mice and adult humans have associated elevated levels of pro-inflammatory cytokines with metabolic, cardiovascular diseases (CVD) and cardiac death \\[[@ref29]-[@ref32]\\]. ", "It has not yet been shown in prepubertal children how pro-inflammatory cytokines and BMI are interrelated. ", "To our best knowledge, this current study is considered to be the first clinical study that was carried out to evaluate the predictors of obesity complications and the effect of childhood obesity on pro-inflammatory cytokines production as TGF-β~1~, IL-6, and haptoglobin among prepubertal overweight and obese Egyptian children.", "\n\nIL-6 is a pro-inflammatory cytokine that plays important roles in acute phase reactions, and inflammation. ", "It is produced by many cell types, and adipose tissue, that enhanced in obesity. ", "It has been proposed as a screening tool to assess the risk for metabolic syndrome and coronary heart diseases in youth \\[[@ref33]\\]. ", "In our present study, serum levels of IL-6 showed statistically highly significant increase in obese children compared to overweight children and healthy controls respectively (P\\<0.001), and its serum level was significantly positively correlated with the body weight, BMI, and BMI z-score respectively (P\\<0.001). ", "This is in the agreement with Steene et al., ", "who reported that, IL-6 correlates with anthropometric markers and body composition in childhood. ", "A positive association between adipocyte diameter and IL-6 levels has been described in humans \\[[@ref34]\\]. ", "It means there is a strong relationship between BMI and circulating levels of IL-6.", "\n\nHaptoglobin levels had been reported to be associated with obesity \\[[@ref35]\\], and evaluated for its role in inflammation in subjects with increased BMI. ", "The increased synthesis of haptoglobin has been thought to be a consequence of IL-6, secreted by adipocytes \\[[@ref36]\\]. ", "In our present study, serum level of haptoglobin showed statistically highly significant increase in obese children (F=253.89, P\\<0.001) compared to overweight children and healthy controls respectively, and its serum level was significantly positively correlated with the body weight, BMI, and BMI z-score, respectively (P\\<0.001). ", "It means, there is a positive association between BMI and circulating levels of haptoglobin.", "\n\nTGF-β~1~ was suggested as an early biomarker of inflammation and CVD risk. ", "Although some research report increased TGF-β~1~ level in adipose tissue in adults and mice \\[[@ref37]\\], there is limited data in the literature concerning TGF-β~1~ concentration in obese humans. ", "In the present study, serum levels of TGF-β~1~ showed statistically highly significant increase in obese (F=220.41, P\\<0.001) compared to overweight children and healthy controls respectively. ", "This is in the agreement with Romano et al. ", "\\[[@ref38]\\] who reported higher serum TGF-β~1~ levels in obese women. ", "On the contrary, other studies in obese adults showed decreased levels of TGF-β~1~ as in a study by Kinik et al., ", "\\[[@ref39]\\] who determined that obese children had lower TGF-β~1~ levels compared to leans, however, in a study by Kanra et al. ", "\\[[@ref40]\\] who reported the lack that the lack of an association between TGF-β~1~ polymorphisms and obesity in Turkish children.", "\n\nIn light of the current results, serum levels of TGF- β1 were found to be significantly positively correlated with the body weight, BMI, and BMI z- score. ", "Our results is in the agreement with Fain et al., ", "\\[[@ref37]\\], who reported that, the TGF-β~1~ release was elevated in the presence of insulin and this may explain the positive correlation between BMI and TGF-β~1~ release that they saw in subcutaneous adipose tissue and the correlation between total release of TGF-β~1~ and body fat content. ", "Our present study is not in the agreement with a study by Yener et al., ", "\\[[@ref41]\\] who reported that, serum TGF-β~1~ levels were lower and inversely correlated with body mass index (BMI) and waist circumference, and Kinik et al., ", "\\[[@ref39]\\] who reported that obese children had lower TGF-β~1~ levels compared to leans and the lower TGF-β1 levels were not correlated with lipids, insulin resistance and BMI.", "\n\nIL-6 as a pro-inflammatory cytokine is a main stimulator of the production of most acute phase protein such as haptoglobin \\[[@ref36]\\], and TGF-β~1~ \\[[@ref42]\\]. ", "This is in favor to our results in which serum level of IL-6 is significantly positively correlated with serum levels of TGF-β~1~ and haptoglobin. ", "Moreover, in recent years, Aihara et al., ", "\\[[@ref12]\\], observed that, increasing expression of TGF-β~1~ from fatty tissue affects its serum level and hence may stimulate expression of the other cytokines. ", "This could be explained why serum level of TGF-β~1~ was positively correlated with serum levels of IL-6 and haptoglobin among obese children in our present study.", "\n\nInterestingly, linear regression analysis revealed that serum levels of IL-6 and haptoglobin play a significant role in the pathogenesis of obesity. ", "The high serum levels of IL-6 and haptoglobin are significant strong predictors of adiposity (p \\< 0.05 in both). ", "It means there is a strong relationship between BMI and circulating levels of both IL-6 and haptoglobin. ", "This is in the agreement with a study by Chiellini et al. ", "\\[[@ref35]\\] who reported that haptoglobin is an adiposity marker and its circulating levels being significantly related to the degree of obesity. ", "A study by Ridker et al., ", "also reported that IL-6 production by adipose tissue is enhanced in obesity. ", "One of the main effects of IL-6 is the induction of hepatic CRP and haptoglobin production, which is known to be an independent, major risk marker of metabolic and cardiovascular complications \\[[@ref43]\\].", "\n\nIn our present study, serum level of IL-6 was found to be significantly positively correlated with BMI and serum level of haptoglobin and no significant correlation was found between serum levels of IL-6, and serum level of TGF-β~1~ in overweight children. ", "We found that the increase in the proinflammatory cytokines occurs early even in the overweight cases and the association between obesity and the inflammation markers is dependent on a degree of obesity. ", "Our results are in conformity with Skinner et al. ", "\\[[@ref44]\\] who reported that, obesity is associated with increases in systemic pro-inflammatory markers. ", "The association of obesity and low grade inflammation is strongly dependent on a degree of obesity.", "\n\nIn conclusion, our results provided clinical evidence that, obesity is associated with a state of chronic low-grade inflammation. ", "Obese and overweight prepubertal children have elevated serum levels of IL-6, and haptoglobin and TGF-β1 which are known as markers of inflammation that may increase the cardiovascular and/or metabolic disease risk. ", "Early identification of pro-inflammatory markers may help in identifying those at risk of cardiovascular events, and type 2 diabetes mellitus.", "\n\n**Competing Interests:** The authors have declared that no competing interests exist.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0025690847542136908, 0.0007389540551230311, 0.0009385223384015262, 0.0034670920576900244, 0.0011480094399303198, 0.0022204711567610502, 0.0007745867478661239, 0.8960170149803162, 0.0006346899317577481, 0.0006757504306733608, 0.001042521558701992, 0.0009167901007458568, 0.003390659810975194, 0.0005998459528200328, 0.003937950357794762, 0.0006812055362388492, 0.0007116269553080201, 0.024762051180005074, 0.03585202991962433, 0.0006024086615070701, 0.0007539992802776396, 0.012229381129145622, 0.015629125759005547, 0.2966321110725403, 0.0020241905003786087, 0.28555092215538025, 0.004121116362512112, 0.0011962770950049162, 0.05947813764214516, 0.0005914831417612731, 0.0005388067220337689, 0.0007063180091790855, 0.008156318217515945, 0.0010753445094451308, 0.0005808715941384435, 0.0008282081107608974, 0.0005352537846192718, 0.0005666272481903434, 0.053385473787784576, 0.0008838417124934494, 0.1681329309940338, 0.001470114104449749, 0.0016119158826768398, 0.0006047050701454282, 0.001399088534526527, 0.0005866004503332078, 0.0016572444001212716, 0.0007588563021272421, 0.0008348531555384398, 0.0013811950339004397, 0.0051917219534516335, 0.0006016320548951626, 0.0006056622369214892, 0.0017070984467864037, 0.0005395241314545274, 0.0005666023935191333, 0.0006644096574746072, 0.0007365302881225944, 0.2633180618286133, 0.7109651565551758, 0.0008177278214134276, 0.002350107068195939, 0.008556283079087734, 0.009120400063693523, 0.008702741004526615, 0.0007929912535473704, 0.23035334050655365, 0.0012024912284687161, 0.04398057982325554, 0.005748057272285223, 0.0020668297074735165, 0.001928246463648975, 0.0009683162206783891, 0.01745450124144554, 0.0032244257163256407, 0.0015305140987038612, 0.0010961754014715552, 0.0007674559019505978, 0.0005742944194935262, 0.0006207727710716426, 0.024912094697356224, 0.0018221846548840404, 0.0007045500096864998, 0.0008635231060907245, 0.01175451185554266, 0.0006855188403278589, 0.002558829030022025, 0.03099810890853405, 0.0009499128791503608, 0.0015808865427970886, 0.0007648449973203242, 0.0037587869446724653, 0.000641551217995584, 0.0005649662343785167, 0.0007076082401908934, 0.0005989872734062374, 0.0013526715338230133, 0.0007605782011523843, 0.003943117335438728, 0.0008944144356064498, 0.000618562800809741, 0.0026370538398623466, 0.005233784671872854, 0.000604555825702846, 0.42986777424812317, 0.008994103409349918, 0.006319836247712374, 0.005177464801818132, 0.0006424242747016251, 0.0005877978401258588, 0.000689409498590976, 0.0006099676247686148, 0.0008126182947307825, 0.016558688133955002, 0.0015157972229644656, 0.0007872356218285859, 0.0005998525302857161, 0.0009170019184239209, 0.008594191633164883, 0.0006710370071232319, 0.0007561730453744531, 0.000703628349583596, 0.0006465470651164651, 0.0010854763677343726, 0.0006541761104017496, 0.001516258460469544, 0.0006116144941188395, 0.010457010939717293, 0.0010805786587297916, 0.0005906434380449355, 0.0012005280004814267, 0.0013062546495348215, 0.0008567545446567237, 0.26300710439682007, 0.0006401055725291371, 0.0006150376866571605, 0.001995444530621171 ]

[ "Kiefer Ravena in race against time to regain match fitness as Alab faces do-or-die game\n\nKiefer Ravena led Alab with 16 points but admits running short of air in the end. ", "ABL photo\n\nSINGAPORE — Kiefer Ravena was far from satisfied with his performance in his Alab Pilipinas debut, admitting that fatigue also took its toll in his first game in the Asean Basketball League (ABL) against the home team Slingers.", "\n\nRavena led Alab Pilipinas in scoring with 16 points on Sunday in Game One of the best-of-three semifinal series, but couldn't get the away team over the hump after the Slingers took a 42-31 halftime lead on the way to a 77-67 victory.", "\n\nRavena played major minutes for the first time in a long while, having gone to the US to be a developmental player for the Texas Legends in the NBA D-League before playing in short tournaments for Mighty Sports in between.", "\n\nRavena, however, is happy to get his play long minutes for the first time in a while.", "\n\n“Pero mabuti rin for me kasi first time in a long while. ", "Mabuti na rin for me kasi first time in a long while ako nakapaglaro ng ganun. ", "It feels good na tired pero okay lang, dahan-dahan bumabalik ‘yung laro,” said Ravena.", "\n\nThe multi-titled cager sees the need to regain top form as fast as he could, with Alab facing elimination in Game Two of the best-of-three semifinal series on Friday in Baliwag, Bulacan.", "\n\nWhile he showed signs of fatigue, Ravena said it didn’t take long for him to adjust to playing with teammates and competing against opponents he used to face during his spell with the national team.", "\n\n“Adjustment-wise, wala namang problema kasi nakalaro ko na sila one way or the other. ‘", "Yung mga ganito, wala ng adjustments. ", "You have to find a way to win. ", "It’s a player's game to win. ", "Whatever the coach tells you, it’s still up to you whether you execute it or whether you want to do it,” said Ravena.", "\n\nRavena now looks forward to Game Two.", "\n\n“It’s a matter of getting Game Two, and preparing well. ", "We can’t start the way we started this game. ", "Nung second half, equal-equal na lang ‘yung scoring. ", "So hindi puwedeng ganun,” said Ravena." ]

{ "pile_set_name": "Pile-CC" }

[ 0.010835167951881886, 0.0007798938895575702, 0.012759937904775143, 0.0006735788192600012, 0.0008589247590862215, 0.0026858795899897814, 0.004800829570740461, 0.0008945107110776007, 0.0007446876261383295, 0.0006772403721697628, 0.003841611323878169, 0.009733089245855808, 0.005659398622810841, 0.00329545303247869, 0.0008592914673499763, 0.0009993064450100064, 0.0006826964090578258, 0.0010876563610509038, 0.0013351025991141796, 0.1441061794757843 ]

[ "Sherpa Village Trek\n\nThe life of mountain dwellers is vastly different from one we lead in the city and is worth having a look at. ", "To give you a look into the heart of the villages of these people we offer an exceptional 8 days trek featuring a wide range of spectacular scenery combined with unique cultural encounters with the kindhearted Sherpa people who inhabit these high altitude regions. ", "You will reach a maximum altitude of 4100m requiring a moderate level of physical fitness to comfortably complete this trek.", "\n\nThe journey begins in the ancient city of Kathmandu, from where a short flight to the beautiful village of Lukla (2800m) will transport you to the heart of the Solu Khumbu region. ", "The trek continues through the lush vegetation of Sagarmatha National Park, with pine forests, rhododendron flowers and an abundance of wildlife, to Namche Bazaar (3442m). ", "A day of rest is necessary in Namche in order to get acclimatized to higher altitudes. ", "The following days trekking will bring you to the village of Tengboche (3930m), home to the highest Buddhist monastery in the world (4100m) and also reputed by photographers as one of the best places to capture the awesome beauty of Mt. Everest (8848m) and its neighboring peaks.", "\n\nThe concluding days of this adventure will be spent in the delightful and scenic villages of Khunde (3500m) and Khumjung, where you will have the opportunity to interact with the legendary Sherpa people and participate in their astonishing traditional lifestyle. ", "Back down to Lukla from where you will take a short flight back to Kathmandu, enjoying the last views of the awe-inspiring Himalayan range and its people.", "\n\nDay to Day Itinerary for Sherpa Village Trek\n\nDay-01:- Arrival at Kathmandu-1,350m/4,428ft\nUpon your arrival in Kathmandu Kumar Adventure will officially greet and meet you at Airport & transfer to you hotel. ", "Free day & evening welcome dinner at any typical Nepalese Restaurant. ", "Overnight stay at hotel in Kathmandu.", "\n\nDay-03:- Early Morning flight to lukla, And trek to Phakding (3-4hrs)-2,652m/8,700ft\nWe fly on a twin Otter Aircraft to the Himalayan foothills Lukla, where we begin our trek into the Khumbu region. ", "The views from the plane are amazing, providing dramatic views of terraced hills and the distant Himalayan giants. ", "After breakfast, the trekking starts passing Chaurikharka village, and makes a descent towards the Dudhkosi Ghat (2,530m/8,300ft). ", "The trail follows the precise bank of the Dudhkosi River until camp at Phakding (2,652m/8,700ft) is reached. ", "This day we just have short walk and will be resting for whole day. ", "Little acclimatize day. ", "Over night at lodge\n\nDay-04:- Trek to Namche-(5-6hrs)-3,440m/11,286ft\nThe trail cross Dudhkoshi River through a long suspension bridge then trail leads you crossing side by side along the river to Hilary’s Suspension Bridge. ", "The trail further climbs from here to Namche Bazaar which is the gate way to Mt. Everest. ", "Overnight in Namche Bazaar.", "\n\nDay-05:- Acclimatization at Namche-3,440m/11,286ft\nToday we will have acclimatization day at Namche.", "You can either have whole day relax or hike up to Syangboche for the the views of the top of the Everest. ", "later come back to Namche for overnight. ", "Namche bazaar is the main centre in the Khumbu region and has shops, restaurants, a bakery, hotel with hot showers and electric power. ", "There is a colorful market each Saturday.", "\n\nDay-06:- Namche Bazaar to Khumjung-(4 to 5 hrs) 3,860m/12,662ft\nToday we hike up towards a big hill and reach Everest View Point Hotel after crossing a tiny airstrip on Syangboche. ", "We can take a breather with tea coffee here at this hotel and enjoy the views of Everest, Nuptse and other Himalayan peaks. ", "We then lead you to Khumjung, probably one of the best village of Khumbu regions. ", "Visit Hillary school established by Sir Admund Hillary and visit to Khunde village where a place of famous climber and big hospital running by charity. ", "Overnight stay at Khumjung.", "\n\nDay-07:- Trek to Tyangboche-(4 to 5 hrs) 3,870m/12694ft\nWe take a walk descent down to Dudhkoshi River passing through little villages on the way. ", "The trails involve down with forest and across riverside for the lunch and we take a final ascent step up for 2 hours through pine and fir forest to reach a small hill Tyangboche. ", "It has the famous Tengboche Gumba to explore for the day. ", "Tyangboche offers the best views of Ama Dablem. ", "Over night at lodge\n\nDay-08:- Trek to Monjo-(6 to 7 hrs) 2,950m/9,676ft\nTrek goes down to the riverside at Fukitenga and steady climb through forest and continuous walk to Namche Bazaar. ", "After Namche we walk down to the hill, cross some suspension bridge and reach monjo for overnight.", "\n\nDay-09:- Trek to Lukla-(4 to 5 hrs)2,652m/8700ft\nLeisurely this morning we trek back to Lukla, you can walk at your own pace and enjoying the lush green scenery around and passing through the incredible mountain scenery and local Sherpa village. ", "Arrival in Lukla and you’ll have time to stroll around the areas and guide will re-confirm your flight ticket and enjoy the last celebrate dinner with your crew member and overnight at Hotel.", "\n\nDay-10:- Lukla to Kathmandu by Flight 1,350m/4,428ft\nFlights from Lukla to Kathmandu are mostly in morning due to impact of weather and wild blowing at Lukla airport. ", "We take a Trans Himalayan flight back to Kathmandu by small aircraft and transfer to hotel. ", "Free afternoon to be fresh up; Evening we comment about the trip and celebrate farewell dinner together at Nepalese Typical Restaurant. ", "Over night at hotel in Kathmandu.", "\n\nDay-11:-Departure\n\nAcclimatization\n\nAlthough Sherpa Village Trek consider as a easy and non risk zone in terms of AMS(acute mountain sickness) for relaxed trekkers that Kumar Adventure Trekking planned this itinerary with a high degree of minimization of awareness of AMS (Acute Mountain Sickness) as you are going up to 3800m/12467ft which is the mandatory height of this trek at Tengboche. ", "The higher the altitude the less oxygen there is in the air. ", "Your body needs few day to adapt to this and our itinerary provide enough time for acclimatization, so for a safe trek it absolutely essential to allow for sufficient time for acclimatization. ", "Sensible planning is therefore required to minimize the risk of AMS.", "\n\nAbout us\n\nOn behalf of Kumar Adventure Treks & Expedition Company, we are pleased to welcome you to Nepal through our site. ", "We make sure your dream holidays are much more enjoyable by taking care of your everyday travel requirements. ", "We cater in all fields of travel such as tours, trekking, mountaineering, and ticketing in the Himalayan region of Nepal, Tibet, Bhutan and India.", "\n\nNothing can capture the mysteries and magnificence of the Himalayas except experience. ", "The crisp mountain air, the read more" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005749661359004676, 0.0005479679093696177, 0.0005634924164041877, 0.0005986488540656865, 0.000579819199629128, 0.0007033039000816643, 0.0006497168214991689, 0.0005830427980981767, 0.0006386698805727065, 0.0005846095154993236, 0.0005584453465417027, 0.0006144628277979791, 0.0006719742086715996, 0.0005338159971870482, 0.0013043340295553207, 0.0006990186520852149, 0.0006941480096429586, 0.0015153569402173162, 0.000774513348005712, 0.0006786297890357673, 0.0006739649688825011, 0.0006055286503396928, 0.00102608697488904, 0.000889581860974431, 0.0007953254971653223, 0.0005910398904234171, 0.0007659051916562021, 0.000659609620925039, 0.0007712373626418412, 0.0006497734575532377, 0.0008471454493701458, 0.0008235108107328415, 0.0008161301375366747, 0.0006757703959010541, 0.0006115221185609698, 0.0007972570019774139, 0.0016427733935415745, 0.0006448790081776679, 0.0005754837184213102, 0.0006131696864031255, 0.0006435466930270195, 0.0005353731685318053, 0.0006888414500281215, 0.000658429111354053, 0.0008006274583749473, 0.0010576995555311441, 0.00062912842258811, 0.0005123975570313632, 0.0005483992281369865, 0.0006651635630987585, 0.0007913716253824532, 0.0006370534538291395 ]

[ "Documentation\n=============\n\n.. toctree::\n\ttutorial/index\n\tapi\n\n" ]

{ "pile_set_name": "Github" }

[ 0.0007891647983342409 ]

[ "Differentiation of B lymphocytes into plasma cells depends on their continuous exposure to prodifferentiation and antiapoptosis signals. ", "The majority of nonreactive and self-reactive clones are eliminated in the bone marrow at the pro-- ([@B1], [@B2]) and pre--B stages ([@B3]). ", "Once mature, the recruitment of new B cells to the long-lived recirculating B cell pool depends on a positive selection process that takes place in the splenic periarteriolar lymphoid sheath (PALS; reference [@B4]). ", "Upon antigen encounter, these long-lived circulating cells are retained in secondary lymphoid organs. ", "After being exposed to the appropriate T cell help, they proliferate and relocate to germinal centers ([@B5]), where they are subjected to negative selection before the onset of somatic mutation ([@B6]). ", "The surviving cells interact with follicular dendritic cells that supply proliferative, antiapoptotic signals ([@B7], [@B8]) and upregulate the expression of multiple receptors required for T cell interaction ([@B9], [@B10]). ", "The selected B cell clones then interact with T cells that provide them with additional survival signals, induce isotype switching ([@B11], [@B12]), and aid in their differentiation into plasma or memory cells. ", "Transcription factors that regulate the survival of developing B cells at different points along this pathway remain largely unknown.", "\n\nWe have previously shown that IL-2 and IL-5 upregulate the expression of the B lymphocyte--induced maturation protein (Blimp-1)^1^ in mature B cells ([@B13]). ", "Blimp-1 and its human homologue PRDI-BF1 ([@B14], [@B15]) are zinc finger proteins that contain four Kruppel-like zinc fingers as well as a number of other domains that may mediate protein-- protein interactions ([@B13], [@B16]). ", "Transfection of Blimp-1 into the BCL1 CW13.20-3B3 mature B cell line (hereafter referred to as 3B3) induces IgM secretion, J chain upregulation, and Syndecan-1 expression ([@B13]). ", "Blimp-1 has also been shown recently to regulate the expression of c-myc in mature B cells ([@B17]). ", "As Blimp-1 is gradually upregulated from the mature B cell stage to the plasma cell ([@B13]), the expression of c-myc is progressively turned off ([@B18]). ", "During this transition phase, c-myc controls both proliferation and apoptosis ([@B19]), depending on signals provided by cytokines ([@B20]). ", "Thus, it is likely that Blimp-1 is a component of a regulatory complex that controls the differentiation and apoptosis of activated B cells. ", "In this work, we have identified an apparent temporal window within which Blimp-1 causes apoptosis as opposed to maturation. ", "In particular, we have found that ectopic expression of Blimp-1 in the immature WEHI-231, mature L10A, and partially activated mature BCL1 5B1b cell line, but not in activated 3B3 cells, results in extensive apoptotic death. ", "We have also identified an effector domain responsible for the induction of the apoptotic effect as being mainly composed of a 69-amino acid (aa) stretch that encompasses most of its proline-rich domain. ", "We suggest that Blimp-1 may be a key participant of a regulatory checkpoint that functions to promote fully activated B cells to terminal differentiation and to eliminate partially activated B cells that become arrested along the differentiation pathway.", "\n\nMaterials and Methods {#MaterialsMethods}\n=====================\n\nCell Lines and Cultures\n-----------------------\n\nBCL1 3B3 (ATCC CRL 1669) cells were purchased from the American Type Culture Collection (Rockville, MD) and grown as previously described ([@B21]). ", "BCL1 5B1b cells were provided by Dr. Samuel Strober (Stanford University) and were grown as previously described ([@B22]), except for lowering the concentration of FCS to 10%. ", "Where indicated, IL-2 and IL-5 (10% supernatants from respective IL-2-- and IL-5--producing cell lines; reference [@B23]) were added. ", "18-81 cells were obtained from Dr. Matthias Wabl (UCSF, San Francisco, CA; reference [@B24]), and WEHI 231 1/8 cells from Dr. Noel Warner (Becton Dickinson, San Jose, CA; reference [@B25]). ", "L10A ([@B26]) and BAL-17.7.1 ([@B27]) cells were a gift of Dr. Richard Asofsky (NIAID, Bethesda, MD). ", "The COS-7 (ATCC CRL 1651) cells were obtained from the American Type Culture Collection ([@B28]). ", "Human embryo epithelial cells 293T were provided by Dr. Gary Nolan (Stanford University) and were grown as previously described ([@B29]).", "\n\nBlimp-1 Truncations\n-------------------\n\n### Blimp-1 ΔC′.\n\nThe Blimp-1 open reading frame (ORF) was subcloned into the EcoRI site of the pyDF30 vector (provided by Stephen Ho and Jerry Crabtree, Stanford University), a derivative of the pcD-SRα expression vector ([@B30]) that contains a sequence encoding for a flu antigen (FLAG) octapeptide ([@B31]) located 3′ from the multiple cloning site. ", "The last 112 aa of Blimp-1 were removed by using a unique Bsp120I site.", "\n\n### Blimp-1 ΔProline.", "\n\nThe region encoding for aa 381--450 of Blimp-1 was removed by using the unique AflII and SplI restriction sites in the pyDF30/Blimp-1 vector. ", "The ends of the restriction were blunted and religated, resulting with the generation of an in-frame truncation of 69 aa in Blimp-1 proline-rich domain.", "\n\n### Blimp-1 ΔN′.\n\nThe XbaI--MspI fragment of the pyDF30/ Blimp1 that contains the entire Blimp-1 ORF and flanking sequences was subcloned into the same sites of the pEJM1 vector. ", "This vector was derived from the pSH160s/NFAT vector (provided by Stephen Ho and Jerry Crabtree), and contains a sequence encoding for a FLAG octapeptide followed by three repeats of the SV40 large T antigen nuclear localization signals (NLS) ([@B32]). ", "The first 179 aa of Blimp-1\\'s ORF were removed by digesting the pyDF30/Blimp-1 vector with XbaI and XcmI. The resulting construct encoding for an N′ truncated version of Blimp-1 was fused to three repeats of the SV40 NLS and a FLAG tag. ", "This manipulation prevented the deletion of any potential NLS sequences from Blimp-1 NH~2~ terminus required for its translocation.", "\n\n### Blimp-1 NZ.", "\n\nKeller and Maniatis ([@B33]) found that the 65 aa that located NH~2~ terminal to the zinc fingers were important for protein stability. ", "Therefore, we included the equivalent region of Blimp-1 together with its zinc fingers (hereafter named the NZ domain) in the \"minimal Blimp-1 protein\". ", "Nucleotides 1615-- 2289 of the Blimp-1 ORF ([@B13]) were previously cloned into a pET24d(+) expression vector (Novagene, Madison, WI). ", "In brief, the sequence was amplified for 15 cycles with a high fidelity PCR enzyme (the ULTIMA™DNA polymerase; Roche Molecular Systems, Inc., Branchburg, NJ) and cloned between the BamHI and HinDIII sites of the vector pET24d(+). ", "The NZ fragment was generated from HindIII digestion of the Blimp-1 containing pET24d(+) vector followed by blunting and was then cloned into the EcoRI site of pEJM1 vector.", "\n\nGFP Expression Vector\n---------------------\n\nThe green fluorescent protein (GFP) expression vector was based on the pG310 expression vector provided by Dr. Edward Mocarski (Stanford University). ", "In brief, the promoter and enhancer of ie1, exon 1, and intron 1 of CMV (−1022 to +947) were inserted between the XbaI and HinDIII sites of the polylinker of pGEM-2 (Promega, Madison, WI). ", "A polyadenylation signal from the ie1 gene was inserted between the BamHI and ClaI sites (+2756 to +2916). ", "Finally, the NheI--XbaI portion of the pG310 was removed. ", "A vector containing a mutated GFP ORF (provided by Dr. Stanley Falkow, Stanford University), which produces an enhanced fluorescent protein ([@B34]), was blunt-ended and ligated into the EcoRV site of LITMUS™ 28 (New England Biolabs, Beverly, MA). ", "An EcoRI--BamHI fragment that contained the GFP insert was cloned into the same sites of pG310. ", "The resulting GFP expression vector was named pTYG-1.", "\n\nTransient Transfections\n-----------------------\n\nAll cells (except 293T) were transfected by electroporation according to Chu et al. ([", "@B35]). ", "BCL1 and COS-7 cells were suspended at 2.5 × 10^7^/ml in DMEM plus 10% FCS. ", "Ten million cells (400 μl) were placed in a 0.4-cm electrode gap gene pulser cuvette (Bio-Rad, Hercules, CA). ", "After the addition of 10 μg of the vector(s), the samples were gently shaken and subjected to electroporation in a GENEPULSER™ apparatus (Bio-Rad) set to 960 μF and 230 mV for COS-7 cells or 250 mV for BCL1 5B1b and 3B3 cells. ", "The cells were then incubated for 10 min at room temperature and resuspended in 10 ml of complete media. ", "Approximately 10% of the cells were plated on a coverslip placed in a 6-well tissue culture dish and used for immunostaining 24 h after transfection. ", "The rest of the cells were plated in a 10-cm dish and incubated for 48 h before lysis and Western blot analysis. ", "18-81 cells were suspended at 1.7 × 10^7^/ml in RPMI plus 10% FCS. ", "Five million cells (300 μl) were subjected to electroporation set to 960 μF and 240 mV as described above. ", "The transfected cells were cultured in 10 ml RPMI media for 18 h. WEHI 231 1/8 and L10A cells were suspended at 2 × 10^7^/ml DMEM plus 20% FCS. ", "Five million cells (250 μl) were incubated for 10 min on ice with the vector(s) before being electroporated (960 μF, 240 mV). ", "After electroporation, the cells were kept on ice for 5 min, and then 1.75 ml DMEM plus 20% FCS were added and the suspensions were kept at room temperature for 10 min. ", "The transfected cells were transferred to a 6-well petri dish and cultured for 18 h. 293T cells were transfected by the calcium phosphate method according to Pear et al. ([", "@B36]). ", "In brief, 7.5 × 10^6^ cells were transfected with 5 μg of truncated Blimp-1 expression vectors. ", "48 h after transfection the cells were harvested and nuclear extracts were prepared.", "\n\nIn situ TUNEL Assay\n-------------------\n\nThe TUNEL (TdT-mediated dUTP nick end labeling) assay was performed with an in situ cell death detection kit following the manufacturer\\'s instruction (Boehringer Mannheim GmbH, Mannheim, Germany). ", "In brief, DP1/GFP double transfected and GFP transfected control 3B3 and 5B1b cells were sorted by FACS^®^ (Becton Dickinson) and incubated for an additional 48 h. The cells were then centrifuged onto glass slides using a Shandon cytospin (Pittsburgh, PA), air dried, and fixed for 30 min in 4% paraformaldehyde diluted in PBS (pH 7.4). ", "After permeabilization with 0.1% Triton X-100 diluted in 0.1% sodium citrate, the cells were labeled with 50 μl of the TUNEL reaction mixture for 60 min at 37°C, washed, and incubated for 30 min with 50 μl of converter-alkaline phosphatase. ", "The slides were rinsed and incubated for 10 min at room temperature with 100 μl of Fast Red TR/Naphthol AS-MX solution (Sigma Chemical Co., St. Louis, MO).", "\n\nImmunostaining\n--------------\n\npEJM1/NZ transfected cells were harvested 24 h after plating, fixed with 4% paraformaldehyde, and permeabilized with 0.1% Triton X-100 diluted in PBS. ", "The cells were then stained for 1 h with a mixture of 1% BSA, 2% normal rat serum, and a 1:1,000 dilution of anti-FLAG^®^ M2 antibody (Eastman Kodak Co., Rochester, NY). ", "Cells were then washed with PBS and stained with a 1:1,000 dilution of a biotinylated goat anti--mouse antibody (PharMingen, San Diego, CA) diluted in 1% BSA solution in PBS. ", "The slides were washed again with PBS and stained with 1% BSA and a 1:1,000 dilution of FITC-conjugated avidin diluted in 1% BSA solution in PBS. ", "The cover slips were mounted on slides with 10 μl of VECTASHIELD^®^ (Vector Labs., ", "Inc., Burlingame, CA), fixed with nail polish, and examined under a fluorescence microscope.", "\n\nFACS^®^ Analysis and Cell Sorting\n---------------------------------\n\nCells were stained with mAbs for 30 min on ice in 50 μl of PBS supplemented with 5% FCS (FACS buffer). ", "The stained cells were washed twice in FACS buffer, then resuspended in 200 μl of buffer and analyzed on a FACScan^®^ with the FACSDesk software (Beckman Center Shared FACS^®^ Facility, Stanford University). ", "The antibodies used for the staining were the monoclonal 6A5.1 anti-BCL1 idiotype (gift of Ellen Vitetta, Southwestern Medical Center, Dallas, TX), FITC-conjugated anti-IgD, PE-conjugated anti--B7-2, FITC-conjugated anti-CD40, and biotinylated anti--Syndecan-1 (PharMingen), and biotinylated anti-IgM (Sigma Chemical Co.). ", "Biotinylated antibodies were used as a second step with either PE- or FITC-conjugated avidin (PharMingen). ", "Dead cells were excluded in each analysis by propidium iodide (PI) staining ([@B37]). ", "GFP^+^/PI^−^ transfected 5B1b cells were sorted 15--24 h after transfection using a preset compensation of the GFP for the PI channel. ", "Cells were sorted into RPMI media, washed once with media, and cultured with or without stimuli for an additional 48 h.\n\nElectromobility Shift Assay\n---------------------------\n\n293T cells transfected with truncated Blimp-1 mutants were used to prepare nuclear extracts ([@B38]). ", "In brief, cells were lysed in 0.5% NP-40, 30% sucrose, 25 mM Tris-HCl, pH 7.5, 25 mM KCl, and 7.5 mM MgCl~2~ supplemented with proteinase inhibitors (leupeptin, pepstatin, PMSF, and aprotinin). ", "The nuclei were spun and rinsed with RSB (10 mM NaCl, 10 mM Tris-HCl, pH 7.5, 10 mM MgCl~2~), and nuclear proteins were extracted. ", "Nuclei were resuspended first in 200 mM NaCl, 50 mM Tris-HCl, 0.2 mM EDTA, 0.2 mM EGTA, 2 mM MgCl~2~, 0.5 mM dithiothreitol (DTT), 5% glycerol, and protease inhibitors. ", "Subsequently, an equal volume of buffer composed of 600 mM NaCl, 50 mM Tris-HCl, 0.2 mM EDTA, 0.2 mM EGTA, 2 mM MgCl~2~, 0.5 mM DTT, 5% glycerol, and protease inhibitors was added. ", "The nuclear protein was extracted with rotation at 4°C for 30 min and spun for 60 min at 100,000 *g*. ", "The protein concentration was determined using a Bradford assay. ", "5 μg of each nuclear extract was used for EMSA (electromobility shift assay) ([@B38]). ", "In brief, the extracts were mixed with 10^5^ cpm of ^32^P--end-labeled PRFI (CGCGTACAGAAAGGAAAGGACTAG) ([@B17]) or PRDI (GTGAAAGGGAGAAGTGAAAGTGGGAAATTCC) ([@B14]) probe, 3 μg poly (dI-dC) in binding buffer (10 mM Tris-HCl, pH 7.5, 1 mM DTT, 1 mM EDTA, 5% glycerol, and 10 μM ZnSO~4~). ", "After 30 min incubation at room temperature, the reactions were subjected to electrophoresis on a 6% polyacrylamide gel at 180V for 1.5--2 h. Competitors (100×) were incubated for 30 min before the addition of the labeled probe. ", "After separation, the gel was fixed, dried, and exposed for 2 h to a BIOMAX MS film at −80°C (Eastman Kodak Co.).", "\n\nELISA\n-----\n\nThe amount of IgM in the supernatants was quantitated using a sandwich ELISA ([@B39]). ", "In brief, 50 μl of a 10 μg/ml solution of goat anti--mouse IgM (Sigma Chemical Co.) was plated on an IMMULON^®^ 4 plate and the plate was incubated for 2 h at 37°C. ", "Excessive antibody solution was removed and 200 μl of 5% BSA in PBS was added to each well and incubated overnight at 4°C. ", "The plate was washed three times with 200 μl of 1% BSA/ PBS, and incubated for 2 h at 30°C with 200 μl of decreasing dilutions of culture supernatants that had been centrifuged at 1,000 *g* to remove remaining cell debris. ", "A standard curve was determined with different concentrations of mouse anti-MOPC104e IgM (Sigma Chemical Co.). ", "The plates were washed three times with 1% BSA/PBS and incubated for 2 h with 50 μl of 1:14,000 dilution of alkaline phosphatase--conjugated goat--anti mouse IgM (Sigma Chemical Co.). ", "After three washes the plates were incubated with 50 μl of SIGMA 104^®^ phosphatase substrate (Sigma Chemical Co.) diluted in zinc-buffer (100 mM Glycine NaOH, pH 10.0, 1 mM ZnSO~4~, 1 mM MgCl~2~) until a visible color change was seen. ", "The plates were analyzed using a 96-well plate reader and VMAX software according to the manufacturer\\'s recommendation (Molecular Devices, Menlo Park, CA).", "\n\nCell Cycle Analysis\n-------------------\n\nCell cycle analysis was performed according to a modified protocol for PI staining of cell nuclei ([@B40]). ", "In brief, cell pellets were resuspended in 100 μl 85.5 mg/ml sucrose, 11.7 mg/ml sodium citrate, and 5% DMSO, pH 7.6. ", "The cells were trypsinized and permeabilized by adding 900 μl of 0.003% trypsin diluted in SS buffer (0.1% sodium citrate, 0.1% NP-40, 1.5 mM spermine-4HCl in 50 mM Tris base \\[pH 7.6\\]) for 20 min. ", "The trypsin and cell RNA were inhibited and degraded by adding 0.05% trypsin inhibitor and 0.01% RNase diluted in SS buffer for 20 min at room temperature. ", "Finally, the cells were stained with 0.01% PI and 3.3 mM spermine-4HCl in SS buffer for 20 min. ", "The cells were then analyzed on a FACScan^®^ or an EPICS^®^ ELITE fluorescense-activated cell sorter (Coulter, Miami, FL) by adjusting the voltage of the instrument to distinguish between the different phases of the cell cycle and data were collected using the FACSDesk software. ", "The collected data were further analyzed by ModFit^®^ software (Verity Software House, Inc., Topsham, ME) and the distribution of the cells between the different phases of the cell cycle and apoptosis percentages was adjusted to fit the software developer\\'s suggestions.", "\n\nResults {#Results}\n=======\n\nThe 5B1b and 3B3 Sublines Express Surface Markers that Represent Closely Related but Distinct Stages of B Cell Maturation.", "\n--------------------------------------------------------------------------------------------------------------------------\n\nThe mature leukemic 3B3 B cell subline was derived from the leukemia-lymphoma BCL1 5B1b ([@B41]) and displays a lower spontaneous secretion level of IgM as compared with the parental line ([@B42]). ", "Blackman et al. ([", "@B21]) showed that this low level of secretion is due to deficient J chain expression and suggested that these cells are partially activated due to the lack of a second signaling event for complete maturation. ", "Although the different BCL1 sublines were cloned over a decade ago, the maturation differences between them have not been characterized extensively. ", "When the 5B1b and 3B3 sublines were stained with an antiidiotypic mAb, 6A5.1. ([", "@B43]), both lines were strongly positive (data not shown), confirming that they were derivatives of the same clone. ", "However, they differed in a number of morphological, biochemical, and developmental parameters. ", "The 3B3 line exhibited a more regular and rounded morphology (Fig. [", "1](#F1){ref-type=\"fig\"} *D*) with a slow growth rate. ", "Cell cycle distribution of the line was characteristic of relatively differentiated cells, with \\>50% cells in the G0/G1-phase (Fig. [", "1](#F1){ref-type=\"fig\"} *b*). ", "The 5B1b cells, on the other hand, were larger and more dendritic (Fig. [", "1](#F1){ref-type=\"fig\"} *A*), and had a majority (54.4%) of cells in the S-phase of the cell cycle (Fig. [", "1](#F1){ref-type=\"fig\"} *a*).", "\n\nIn addition to these differences in morphology and cell cycle distribution, the expression of several cell surface markers also differed. ", "40--50% of the 5B1b line exhibited a relatively nonactivated phenotype (IgM^Bright^IgD^Bright^CD86^Dull^) (Fig. [", "1](#F1){ref-type=\"fig\"}, *B* and *C*), whereas the 3B3 line appeared to be fully activated (IgM^Bright^IgD^Dull^CD86^Bright^) (Fig. [", "1](#F1){ref-type=\"fig\"}, *E* and *F*). ", "This indicates that although both sublines originated from the same mature B cell clone, they differed from each other in their activation states.", "\n\n3B3, but Not 5B1b Cells, Differentiate into Centrocyte-like Cells after IL-2 and IL-5 Stimulation.", "\n--------------------------------------------------------------------------------------------------\n\nDifferentiation of the 3B3 cells into IgM secreting cells was characterized by their ability to secrete IgM and upregulate J chain expression ([@B44]). ", "We followed the changes in the size and expression of several surface expression markers for 72 h after stimulation with IL-2/IL-5. ", "Before cytokine treatment, the partially activated 5B1b cells were IA^d^ ^Bright^CD19^Bright^CD44^Bright^ Syndecan^Neg^ (references [@B10], [@B45]; Fig. [", "2](#F2){ref-type=\"fig\"}, *B* and *C*), with a cell size peaking at 240 afU (arbitrary fluorescence units) and cell granularity at 160 afU (Fig. [", "2](#F2){ref-type=\"fig\"} *A*). ", "After 72 h of IL-2/IL-5 stimulation, the cell size increased slightly and peaked at 280 afU, and granularity increased to 185 afU (Fig. [", "2](#F2){ref-type=\"fig\"} *D*). ", "This change was accompanied by a 100-fold downregulation of IA^d^ expression on the cell surface of ∼30% of the cells (Fig. [", "2](#F2){ref-type=\"fig\"} *E*). ", "There were no noticeable changes in the cell surface expression of CD19, CD44, and Syndecan-1 (Fig. [", "2](#F2){ref-type=\"fig\"} *F*).", "\n\nIn contrast to these relatively minor changes in the 5B1b cells, the 3B3 line responded much more dramatically to IL-2/IL-5 stimulation. ", "In particular, a small percentage of the resting 3B3 cells were IA^d^ ^Dull^CD44^Dull^Syndecan1^Bright^ and expressed ∼50% less CD19 (Fig. [", "2](#F2){ref-type=\"fig\"}, *H* and *I*) than 5B1b. ", "After IL-2/IL-5 stimulation, this minor population gradually became the dominant phenotype (Fig. [", "2](#F2){ref-type=\"fig\"}, *K* and *L*) concomitant with a substantial decrease in cell size from a peak at 220 afU to a peak at 100 afU (Fig. [", "2](#F2){ref-type=\"fig\"}, *G* and *J*). ", "These changes suggest that the 3B3 cells differentiated from an activated mature phase to a centrocyte-like cell after IL-2/IL-5 stimulation.", "\n\nBlimp-1 Induces Apoptosis in Multiple B Cell Lines but Not in the BCL1 3B3.", "\n---------------------------------------------------------------------------\n\nLin et al. ([", "@B17]) demonstrated that Blimp-1 induces apoptosis in the 18-81 pre--B cell line. ", "This effect was shown to correlate with the downregulation of c-myc expression by Blimp-1. ", "Suppression of c-myc was also reported to induce apoptosis in the immature B cell line WEHI-231 ([@B46]). ", "These data suggest that Blimp-1 may induce an apoptotic response at several stages of the B cell development. ", "We therefore compared the effect of the transfection of Blimp-1 into the pre--B 18-81, immature WEHI-231, mature L10A, and the BAL17 cell lines. ", "The results showed that by as early as 18 h after transfection, 10--80 μg of Blimp-1 induced 11--38% apoptosis in WEHI-231 in a dose-dependent manner (Fig. [", "3](#F3){ref-type=\"fig\"}, *a--d*). ", "A similar effect was also found in the L10A and the 18-81 cell lines (Fig. [", "3](#F3){ref-type=\"fig\"} *e* and reference [@B17]). ", "In BAL17, Blimp-1 transfection induced apoptosis but the effect was not dose dependent (Fig. [", "3](#F3){ref-type=\"fig\"} *e*). ", "We also compared the long-term effect of the transfection of a low amount of Blimp-1 into 5B1b and 3B3 cells. ", "Both sublines were transfected with 10 μg of Blimp-1 and 10 μg of GFP constructs, and selected for GFP expression by FACS^®^ after a 15 h incubation. ", "Approximately 5--20% of the cells were positive for GFP, and these were cultured for an additional 72 h and then centrifuged onto slides for in situ TUNEL assay. ", "Apoptosis as determined by the intense nuclear TUNEL staining and condensed nuclear morphology were clearly evident in Blimp-1--transfected 5B1b (Fig. [", "4](#F4){ref-type=\"fig\"} *B*) but not 3B3 (Fig. [", "4](#F4){ref-type=\"fig\"} *A*).", "\n\nThe Blimp-1 \"Death Domain\" Is Located within the Proline-rich Domain.", "\n---------------------------------------------------------------------\n\nTo identify the domain(s) in Blimp-1 that was involved in the induction of apoptosis, we examined the proapoptotic ability of four truncation mutants in WEHI-231 cells. ", "In the ΔN′ truncation mutant, the N′ acidic domain (aa 71--87) and the first 49 aa of the PRD1-BF1-RIZ homology (PR) domain (aa 131--179) were removed. ", "To compensate for the possible depletion of a necessary NLS, three SV40 NLS were introduced 5′ to the truncated ORF. ", "The results show that this truncation had minimal effect on the ability of Blimp-1 to induce apoptosis in WEHI-231 cells (Fig. [", "4](#F4){ref-type=\"fig\"}). ", "On the other hand, the depletion of the C′ acidic domain (aa 752--810) had a modest effect on the ability of Blimp-1 to induce apoptosis in WEHI-231 cells (Fig. [", "5](#F5){ref-type=\"fig\"} *B*). ", "The transfection of this ΔC′ truncation mutant reduced the apoptotic ability of Blimp-1 by ∼20%. ", "The most significant effect on the ability of Blimp-1 to kill WEHI-231 cells was noticed when a portion of the proline-rich domain was removed (aa 381--450). ", "The truncation of this domain reduced the apoptotic ability of Blimp-1 on WEHI-231 by 82%. ", "A comparable loss of the proapoptotic activity was observed when most of the putative effector domains of Blimp-1 were removed, as in the NZ construct. ", "The loss of the proapoptotic activity of NZ construct was not due to its inability to translocate into the nuclei because the fusion of the SV40 NLS to the NZ fragment enables proper nuclear translocation of the protein. ", "In situ staining of transfectants with the M2 anti-FLAG antibodies showed that the protein clearly localized to the nucleus (Fig. [", "5](#F5){ref-type=\"fig\"} *D*). ", "Furthermore, the deletion of a major portion of the proline-rich domain in the Δproline construct did not alter the DNA binding ability of the recombinant protein to the β-interferon (PRDI) or the c-myc (PRFI) elements (Fig. [", "5](#F5){ref-type=\"fig\"} *C*). ", "A similar pattern was observed when most Blimp-1 effector domains were removed in the NZ truncation mutant (results not shown). ", "These results indicate that the loss of the proapoptotic function in the Δproline and the NZ recombinant proteins was probably due to the inability of these truncated proteins to interact with other nuclear factors that are required for the induction of apoptosis.", "\n\nBlimp-1 Is Involved in the Induction of Apoptosis and Partial Differentiation of 5B1b Cells.", "\n--------------------------------------------------------------------------------------------\n\nTo examine whether or not the NZ recombinant protein was able to block the induction of apoptosis in B cells and the development of Blimp-1--induced changes, such as IgM secretion and blasting, we cotransfected 5B1b cells with different combinations of Blimp-1 and/or the NZ construct and with the GFP expression vector as a selection marker. ", "24 h after transfection, the viable GFP^+^ 5B1b cells were sorted and incubated for an additional 48 h with or without IL-2/IL-5 stimulation. ", "At the end of the cell culture, the level of IgM, percentage of blasting (cells gated on forward scatter between 160 and 250), and percentage of dying cells (determined by GFP^+^/PI^+^) were examined. ", "The results showed that the transfection of NZ suppressed the low spontaneous cell death of 5B1b. ", "The ectopic overexpression of Blimp-1 induced a robust apoptotic response. ", "This response could be suppressed in cells cotransfected with the NZ and Blimp-1 expression vectors (Fig. [", "6](#F6){ref-type=\"fig\"} *B*). ", "Although insufficient for driving the 5B1b cells to a fully differentiated phenotype (Fig. [", "2](#F2){ref-type=\"fig\"}), IL-2/IL-5 treatment induced an increase in IgM secretion and in the percentage of blasts in these cells (Fig. [", "6](#F6){ref-type=\"fig\"} *A*). ", "Ectopic expression of the NZ protein alone resulted in an approximately twofold reduction in both IgM secretion and the percentage of blasting cells in response to IL stimulation (Fig. [", "6](#F6){ref-type=\"fig\"} *A*). ", "However, IL-2/IL-5 treatment of NZ transfected cells produced an apoptotic response that was almost sevenfold higher than control 5B1b cells. ", "On the other hand, Blimp-1 transfection-induced apoptosis of these cells was slightly reduced by IL-2/IL-5 treatment (Fig. [", "6](#F6){ref-type=\"fig\"} *B*). ", "These results suggest that the blasting and IgM secretion effects triggered by IL-2/IL-5 in 5B1b might be dependent on an adequate expression level of Blimp-1. ", "Nevertheless, these effects did not seem to be connected with the apoptotic ability of Blimp-1. ", "Therefore, it seems that in partially activated B cells, Blimp-1 may have a balanced effect between the induction of apoptosis and the induction of maturation. ", "One possible explanation for this effect is that the contribution of Blimp-1 to either pathway requires the coexpression of stage-specific factors that would shift Blimp-1 function from induction of apoptosis to promotion of differentiation.", "\n\nDiscussion {#Discussion}\n==========\n\nBlimp-1 was originally shown to regulate the expression of structural genes (J chain and Syndecan-1) during the differentiation of mature B lymphocytes into plasma cells ([@B13]). ", "Recently, it has been found that the expression of Blimp-1 in pre--B cells triggers an apoptotic response that appears to be mediated by the downregulation of c-myc expression ([@B17]). ", "Here we report that Blimp-1 can induce apoptosis across a broad range of immature and mature B cell lymphoma lines and can only promote differentiation in fully activated B cells. ", "We also have identified the functional domain required for the induction of apoptosis and anticipate that Blimp-1 functions may depend upon the stage-specific expression of a cofactor.", "\n\nThe developmental stages represented by the 5B1b and 3B3 sublines appear to define a temporal window of B cell differentiation within which the function of Blimp-1 shifts. ", "Partially activated 5B1b cells are impaired in their responses to IL-2/IL-5 stimulation and arrested at the centroblast stage. ", "On the other hand, fully activated 3B3 cells respond to IL-2/IL-5 stimulation and differentiate into centroblast and, later, centrocyte-like cells (Fig. [", "2](#F2){ref-type=\"fig\"}). ", "The transfection of 5B1b cells with the NZ dominant negative suppresses blasting and IgM secretion induced by IL-2/IL-5 treatment (Fig. [", "6](#F6){ref-type=\"fig\"}), thus indicating that Blimp-1 is an essential component in IL-2/IL-5 signaling during B cell maturation. ", "In contrast to the antidifferentiation effect of NZ, overexpression of Blimp-1 in 5B1b but not in 3B3 cells results in marked apoptotic death that can be suppressed by the NZ dominant negative. ", "This, in turn, indicates that the Blimp-1--mediated apoptotic machinery is still functional in the 5B1b cells. ", "Similarly, the transfection of Blimp-1 in earlier stages of the B cell development, such as the pre--B (18-81), immature B (WEHI-231) and mature B (L10A) cell stages induces an apoptotic response. ", "This effect is mainly dependent on a 69-aa region within the proline-rich domain (Fig. [", "5](#F5){ref-type=\"fig\"}). ", "It is conceivable that the binding of an additional factor to this domain is required to elicit a response. ", "For example, Blimp-1 may interact in vitro with YY1, a positive regulator of c-myc ([@B17]), whose expression plays an important role in controlling the cell fate. ", "Since the downregulation of c-myc was shown to be involved in the induction of apoptosis in both 18-81 ([@B17]) and WEHI-231 ([@B46]), its suppression by Blimp-1 is anticipated to play a role in the elimination of partially activated B cells. ", "However, it appears that other genes that are involved in the regulation of the cell cycle may be targeted by Blimp-1.", "\n\nThe PR domain (aa 131-231) ([@B16]) was suggested to modulate the repressor ability of RIZ ([@B47]). ", "Our results show that the deletion of 50% of this domain in the ΔN′ truncated protein had no significant effect on the ability of this protein to induce apoptosis in WEHI-231 cells. ", "Therefore, the integrity of the PR domain may be unnecessary for the induction of apoptosis. ", "In fact, the truncation of either the N′ or C′ acidic domains had only a minor effect on the apoptotic ability of Blimp-1 (Fig. [", "5](#F5){ref-type=\"fig\"} *B*).", "\n\nGiven that Blimp-1 is able to exert such different effects in closely related cells, the question arises as to how this is accomplished. ", "One possible explanation is that different combinations of the zinc finger motifs may recognize distinct gene targets. ", "A mechanism of this type was recently shown in the case of NeP1/CTCF, an 11--zinc finger protein that uses different combination of its zinc fingers to bind to either the c-myc gene or the lysozyme silencer, F1 ([@B48]). ", "The partial use of Blimp-1 zinc fingers for the recognition of potential targets was demonstrated in the work of Keller and Maniatis ([@B32]). ", "In that report the authors show that two out of the five PRDI-BF1 zinc fingers (and a stretch of 65 aa located N′ to these fingers) are sufficient for its binding to the PRDI element. ", "Recently, we have found that the binding of NZ to the PRF1 element, but not to the PRD1 element, is sensitive to posttranslational modifications or conformational changes (Chi, J.-T., and E.J. Messika, unpublished results). ", "Thus, Blimp-1 may be modulated to switch specificity to different targets due to interactions with stage-specific proteins, using different combinations of its zinc fingers, as the cell matures.", "\n\nIn summary, we propose that Blimp-1 may be part of a \"gate keeper\" mechanism in the differentiation process, as its upregulation causes apoptosis of immature or partially stimulated B cells. ", "This may constitute an important selection mechanism to eliminate self-reactive B cells that have escaped earlier negative selection mechanisms or have been inappropriately (and partially) activated.", "\n\nWe thank Dr. Samuel Strober for the BCL1 5B1b line; Drs. ", "Chan Beals, Stephen Ho, and Jerry Crabtree for the pyDF30 vector and SV40 NLS; Dr. Edward Mocarski for the pG310 vector; Dr. Stanley Falkow for the GFP construct; Dr. Ellen Vitetta for the anti-BCL1 idiotypic antibodies; and Dr. Ziv Reich for critical reading of the manuscript.", "\n\nThis work was supported by a grant from the National Institutes of Health (AI-19512) and by the Howard Hughes Medical Institute.", "\n\naa\n\n: amino acid(s)\n\nafU\n\n: arbitrary fluorescence units\n\nBlimp\n\n: B lymphocyte--induced maturation protein\n\nFLAG\n\n: flu antigen\n\nGFP\n\n: green fluorescent protein\n\nNLS\n\n: nuclear localization signal(s)\n\nORF\n\n: open reading frame\n\nPI\n\n: propidium iodide\n\nPR\n\n: PRD1-BF1-RIZ homology\n\nTUNEL\n\n: TdT-mediated dUTP nick end labeling\n\n###### \n\nCharacterization of BCL1 5B1b and CW13.20-3B3 sublines. ", "Morphology: the BCL1 5B1b (*A*) and CW13.20-3B3 (*D*) sublines were photographed at the log phase at ×320. ", "Expression of cell surface markers: 10^6^ cells were stained for 30 min on ice with different combinations of antibodies; anti-IgD and anti-IgM (*B* and *E*) and anti-CD25 and anti--B7-2 (*C* and *F*). ", "The cells were analyzed on a FACScan^®^ with the FACSDesk software. ", "Cell cycle analysis: 10^6^ BCL1 CW13.20-3B3 (*a*) and BCL1 5B1b (*b*) cells were permeabilized and the nuclei stained with PI. ", "The distribution of the nuclei size between the different phases of the cell cycle was measured using a FACScan^®^ device and the data were analyzed using the ModFit LT™ algorithm. ", "The percentage of the cells at the different phases of the cell cycle are indicated on the top of each phase.", "\n\n![](", "JEM971804.f1ad)\n\n![](", "JEM971804.f1bf)\n\n![](", "JEM971804.f1g)\n\n![](", "JEM971804.f1h)\n\n{#F2}\n\n###### \n\nBlimp-1 induces apoptosis in L10A, BAL17, WEHI-231, and 18-81 cells. ", "L10A,WEHI-231, and 18-81 cells were transiently transfected with increasing amounts of the DP1 (Blimp-1) expression vector. ", "After 18 h of recovery at 37°C, the cells were permeabilized and the nuclei stained with PI. ", "The distribution of the nuclei size between the different phases of the cell cycle was measured using an EPICS^®^ Elite fluorescense-activated cell sorter device and the data were analyzed using the ModFIT™ algorithm. ", "Cell cycle analysis of WEHI-231 cells after the transfection of 10 μg (*b*), 40 μg (*c*), 80 μg (*d*), and mock-transfected cells (*a*). ", "The percentage of apoptotic cells is indicated on the top of each transfection. (*", "e*) Comparison of apoptotic effect of Blimp-1 on WEHI-231, 18-81, BAL17, and L10A cell lines. ", "Cells were transfected with 40 and 80 μg of Blimp-1 and apoptosis was analyzed by cell cycle distribution as described above. ", "The data represent the mean of three experiments (± SEM).", "\n\n![](", "JEM971804.f3ad)\n\n![](", "JEM971804.f3e)\n\n![", "Blimp-1 induces apoptosis in BCL1 5B1b but not in BCL1 CW13.20-3B3 cells. ", "BCL1 5B1b and BCL1 3B3 cells were transiently transfected either with the DP-1 (Blimp-1) vector and the pTYG-1 (GFP) vectors (*A* and *B*) or with the GFP vector alone as a negative control (*C* and *D*). ", "GFP^+^/PI^−^ cells were sorted 15 h after transfection and incubated for an additional 48 h. The cells were then cytospun on slides coated with poly-[l]{.smallcaps}-lysine, fixed with 4% paraformaldehyde, permeabilized, and stained for in situ TUNEL assay following the manufacturer\\'s instructions. ", "The stained cells were developed with Fast Red and photographed at ×320.](JEM971804.f4){#F4}\n\n###### \n\nConstruction, expression, and cellular localization of NZ, a dominant negative form of Blimp-1. (*", "A*) Scheme of the truncated proteins. ", "Lane *1*, full-length Blimp-1 fused to a FLAG tag; lane *2*, ΔN′; lane *3*, Δproline; lane *4*, ΔC′; lane *5*, NZ. (*", "B*) Apoptotic efficiency of WEHI-231 cells after transient transfection with the truncated Blimp-1 proteins. ", "WEHI-231 cells were transiently transfected with 70 μg of the expression vectors expressing the truncated forms of Blimp-1. ", "Mock transfected cells were transfected with 70 μg of the TYG-1 vector. ", "After 18 h of recovery, the cells were harvested and apoptosis was determined by cell cycle analysis. ", "Mean percentage of apoptotic cells was deduced from the cell cycle histograms of three experiments (± SEM), using the ModFit LT™ software according to the software developer. (*", "C*) EMSA (electromobility shift assay) analysis of Blimp-1 and Δproline. ", "5 μg of Blimp-1 and Δproline were transfected into 293T cells and nuclear extracts were prepared. ", "5 μg of the nuclear extracts were used in each gel shift reaction and mixed with labeled PRDI or PRFI probes. ", "PRDI binding competition assays were performed with an excess of 100-fold unlabeled PRDI probe. ", "The reactions were run on a 6% polyacrylamide gel and exposed to an X-ray film for 2 h. (*D*) FLAG tagged NLS-NZ dominant negative protein localize to the cell nuclei (original magnification: ×630). ", "COS-7 cells were transfected transiently with the pEJM1-NZ construct and platted for 15 h on glass coverslip. ", "The adherent cells were fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100/PBS. ", "The cells were then stained with an anti-FLAG M2 antibody (Eastman Kodak Co.), and a sandwich of biotinylated goat anti--mouse antibody (PharMingen) and FITC-conjugated avidin (Amersham International, Little Chalfont, Buckinghamshire, UK). (*", "D*) Phase contrast view of the transfected cells. ", "Three nuclei are visible on the left cell and two on the right. (*", "C*) FITC view of the same cells. ", "The nuclei of both cells are stained at different intensities with the anti-FLAG antibody. ", "No staining is visible in the cytoplasmic compartment of the cells.", "\n\n![](", "JEM971804.f5a)\n\n![](", "JEM971804.f5b)\n\n![](", "JEM971804.f5c)\n\n![](", "JEM971804.f5d)\n\n{#F6}\n\n[^1]: Address correspondence to Mark M. Davis, Howard Hughes Medical Institute, Department of Microbiology and Immunology, Stanford University School of Medicine, Stanford, CA 94305-5428. ", "Phone: 650-723-7962; Fax: 650-723-7771; E-mail: <mdavis@cmgm.stanford.edu>\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0007588269654661417, 0.0007213469361886382, 0.0034651781897991896, 0.0058887372724711895, 0.0006647921982221305, 0.0013217856176197529, 0.0007959255599416792, 0.0005844649858772755, 0.0016479375772178173, 0.0011843526735901833, 0.0008974153897725046, 0.0006801069248467684, 0.0006820737035013735, 0.0005844571860507131, 0.0007258757250383496, 0.0005863706464879215, 0.0012147253146395087, 0.0006113729323260486, 0.0006739267846569419, 0.0006427654298022389, 0.000608883798122406, 0.000582265027333051, 0.0005972380749881268, 0.0006377474637702107, 0.0005718294414691627, 0.0005651501705870032, 0.000693941954523325, 0.0007402078481391072, 0.0009557592566125095, 0.0005952782812528312, 0.000718440453056246, 0.0007442760397680104, 0.0006497217691503465, 0.0009343107230961323, 0.0007666167803108692, 0.0008104591979645193, 0.0006325195427052677, 0.0006124521605670452, 0.0006429823697544634, 0.0005772317526862025, 0.000642869621515274, 0.0006299095693975687, 0.0005705272196792066, 0.0006712576141580939, 0.0006580103654414415, 0.0005988942575640976, 0.0006218160851858556, 0.0006319721578620374, 0.0006454182439483702, 0.0007757952553220093, 0.0007202059496194124, 0.0006174995796754956, 0.000612103205639869, 0.000577332975808531, 0.0006245318800210953, 0.0007239769911393523, 0.0006876233965158463, 0.0006526501383632421, 0.0006728364969603717, 0.0006872208323329687, 0.000767946767155081, 0.0006837053224444389, 0.0008293405990116298, 0.0006534405401907861, 0.000708353123627603, 0.0006587470415979624, 0.0006725636194460094, 0.0008763326914049685, 0.0006345558795146644, 0.0007092738524079323, 0.0009687550482340157, 0.0012962821638211608, 0.0010926718823611736, 0.0006238885107450187, 0.0007385003264062107, 0.0006567119271494448, 0.0007015008595772088, 0.010278565809130669, 0.0007897482137195766, 0.0005990492063574493, 0.0008706576772965491, 0.0006315825739875436, 0.0006395024829544127, 0.0006013651727698743, 0.0008446633000858128, 0.0007932270527817309, 0.001083562383428216, 0.000571445852983743, 0.0006118156597949564, 0.00807633064687252, 0.0006417998229153454, 0.000632786366622895, 0.0006538330344483256, 0.0007647101883776486, 0.0006914459518156946, 0.0015000212006270885, 0.000575666141230613, 0.0019285604357719421, 0.0006500360323116183, 0.000567113806027919, 0.0005907304002903402, 0.001175771583802998, 0.0008914630743674934, 0.0006693281466141343, 0.001800419413484633, 0.0005794247845187783, 0.0005436530918814242, 0.0007361840107478201, 0.0013792561367154121, 0.0006642709486186504, 0.0010078700724989176, 0.0005828625289723277, 0.0008501227712258697, 0.0005739316111430526, 0.0005439640954136848, 0.0006421213038265705, 0.0005960162961855531, 0.0005719172186218202, 0.0006678660865873098, 0.0006550048710778356, 0.0005954502266831696, 0.0006621042848564684, 0.0005734627484343946, 0.0007004424114711583, 0.0006990983383730054, 0.001197239151224494, 0.000640986196231097, 0.001314220717176795, 0.0012070765951648355, 0.0005890420288778841, 0.0007585749845020473, 0.0006395034142769873, 0.0006934137782081962, 0.0006021078443154693, 0.0006951154791750014, 0.0006396262324415147, 0.0006998175522312522, 0.0006084959022700787, 0.008889068849384785, 0.0006936698337085545, 0.0009438067208975554, 0.0009225945104844868, 0.0006694008479826152, 0.09752441942691803, 0.0007961539085954428, 0.0007985967677086592, 0.00073788728332147, 0.0011471775360405445, 0.0006329420139081776, 0.0007281950674951077, 0.0007021797937341034, 0.0006356884259730577, 0.0006153706344775856, 0.0006455200491473079, 0.0007312273373827338, 0.0005919514806009829, 0.0006540290196426213, 0.0006513746920973063, 0.0007148859440349042, 0.000637228018604219, 0.0006429005297832191, 0.000590350478887558, 0.000617588113527745, 0.0006964399944990873, 0.000706222141161561, 0.0007858156459406018, 0.0007387818768620491, 0.0007355405832640827, 0.001058954861946404, 0.0006359933177009225, 0.000658141216263175, 0.0006707723368890584, 0.0007106700213626027, 0.0010375985875725746, 0.0009413002990186214, 0.0008724398794583976, 0.0006349721807055175, 0.0006770674372091889, 0.0006156841991469264, 0.0007077303598634899, 0.000655924784950912, 0.0007612546905875206, 0.0006215986795723438, 0.0006721231038682163, 0.000697994779329747, 0.0007912020664662123, 0.0007434796425513923, 0.0006012007361277938, 0.0007484083762392402, 0.0008879436063580215, 0.0005716629675589502, 0.0006936599384061992, 0.0006434464012272656, 0.0008163852617144585, 0.0006900017033331096, 0.0006776170921511948, 0.0006900017033331096, 0.0010194212663918734, 0.0006357981474138796, 0.0006936599384061992, 0.0006322528934106231, 0.0006819151458330452, 0.0006156305316835642, 0.0006221762741915882, 0.0007265927852131426, 0.0006736834184266627, 0.0016386174829676747, 0.0005784511449746788, 0.0005988259799778461, 0.0009402018040418625, 0.001060972921550274, 0.0006530862883664668, 0.0007792052929289639, 0.0006102028419263661, 0.0009914960246533155, 0.000716710346750915, 0.0006700088270008564, 0.000583535700570792, 0.0006606885581277311, 0.0006380225531756878, 0.0006476911366917193, 0.0006383364088833332, 0.0006636881153099239, 0.0008766688988544047, 0.0007147006108425558, 0.0005742752691730857, 0.0006774485809728503, 0.0007106700213626027, 0.0005777059122920036, 0.0005728547112084925, 0.0006393674993887544, 0.0007577683427371085, 0.0005840951926074922, 0.0005657352157868445, 0.0005942278658039868, 0.0006413369555957615, 0.0008308090618811548, 0.0006184569792822003, 0.0048606982454657555, 0.0005559762939810753, 0.0014211892848834395, 0.0005967450561001897, 0.0018739356892183423, 0.0007567713619209826, 0.0007804359192959964, 0.0005783717497251928, 0.0005422710091806948, 0.0012735376367345452, 0.001841200515627861, 0.0018363433191552758, 0.002217731438577175, 0.00233174255117774, 0.0010038289474323392, 0.07457108795642853, 0.0006082443287596107, 0.0005927396123297513, 0.0006051636883057654, 0.0006411144859157503, 0.0008312924765050411, 0.0005490718758665025, 0.0006912139942869544, 0.000679520599078387, 0.000648472981993109, 0.0006325632566586137, 0.0005595677066594362, 0.0012735376367345452, 0.0038078483194112778, 0.0032871204894036055, 0.0008245005737990141, 0.0007920400821603835, 0.0007242098217830062, 0.0006212690495885909, 0.0006861743750050664, 0.0007824591593816876, 0.0007349572842940688, 0.0006357357488013804, 0.0010041705099865794, 0.0005887215957045555, 0.0005949339829385281, 0.000655274954624474, 0.000677709118463099, 0.0006061888998374343, 0.0006124661304056644, 0.0006640208885073662, 0.0006633118609897792, 0.0007398668676614761, 0.0007464894442819059, 0.0006679905345663428, 0.0006027219351381063, 0.0007262414437718689, 0.0007418143795803189, 0.0007200487889349461, 0.0012735376367345452, 0.0031025479547679424, 0.0030118566937744617, 0.0035212445072829723, 0.0024641379714012146, 0.0008389261784031987, 0.0006955355638638139, 0.0006081576575525105, 0.0008932566270232201, 0.0007750500226393342, 0.000655611336696893, 0.002761180978268385 ]

[ "Anthony Bourdain fails to bag Newfoundland moose on trip for CNN show\n\nBourdain has been in Newfoundland and Labrador filming his CNN show “Parts Unknown,” which looks at lesser-known food traditions around the world.", "\n\nThe chef told a reporter for a local radio station that he tried the classic Newfoundland meal Jiggs' dinner — a boiled dinner usually made with salt beef and vegetables — and confirmed he went moose hunting in central Newfoundland.", "\n\nBourdain didn't get his moose, but says he was well-received on the island.", "\n\nHe posted a photo of himself to Twitter on Sept. 27, lounging in a plush armchair that was perched atop rocks by the seashore in front of a bearskin rug, with the caption: “Roughing it in Newfoundland.”", "\n\nA video he posted to Instagram showed two wooden tables on a pebble beach, ladened with dishes below an antler chandelier, and meat roasting above a nearby fire.", "\n\nThe caption was, “Dinner last night” with the hashtag #Newfoundland.", "\n\nBourdain said he would return to Newfoundland and Labrador if the opportunity should arise again.", "\n\nHe says people can watch his reflections about the province on an upcoming edition of his show." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007223095162771642, 0.0006986287771724164, 0.0007280507124960423, 0.0007967375568114221, 0.0012275694170966744, 0.0006973654963076115, 0.0006265231058932841, 0.0005518011166714132 ]

[ "S. E. Mons. ", "Eugenio Scarpellini is the bishop of El Alto area, 56 churches in an surface bigger than Lake Titicaca. ", "He came to visit Santiago de Huata and we all were here to welcome him and show him the many activities the church is running. ", "Cool, I’ve never had a bishop visit before! ;)" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0009180658962577581, 0.0008387574926018715, 0.0005916919908486307, 0.0009398342226631939 ]

[ "Objective: This study aims to investigate the state of occupational burnout of white collar office workers whose education levels are high school or above, and its relation to psychopathology, religious belief and locus of control. ", "Method: 143 white collar workers were incorporated into the study through convenience sampling. ", "Participants were subjected respectively to Sociodemographic Form, Maslach Burnout Inventory (MBI), Symptom Checklist 90 Revised (SCL-90- R), Religious Orientation Scale (ROS) and Locus of Control Scale (LCS). ", "Results: According to the analyses conducted in the research, 48% of participant suffer, 52% of participants do not suffer burnout. ", "Through the lenses of sociodemographic variables, burnout scores of participants did not show significant difference in terms of any sociodemographic data. ", "All psychological symptom scores of participants suffering burnout were found to be significantly higher than those do not suffer burnout. ", "SCL-90-R scores increase as burnout scores of participants increase. ", "No significant relation was found between religious belief/inclination and burnout. ", "Positively significant relation was found between participants’ burnout scores and LCS scores. ", "It follows that, as burnout increases, direction of locus of control deviates to external locus of control. ", "Lastly, it has been found out that variables of psychopathology, religious belief and locus of control combined explained 32% of total variance in burnout scores. ", "Conclusion: The study established that demographic and occupational characteristic do not have an impact on the level of burnout, and burnout is in a positive relation with psychopathological symptoms and external locus of control." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0011742018396034837, 0.0006256355554796755, 0.0007034306181594729, 0.001265989732928574, 0.0007653667125850916, 0.003225371241569519, 0.0007660091505385935, 0.0008866214193403721, 0.0006083382177166641, 0.0008887600270099938, 0.002104737563058734, 0.0010539989452809095 ]

[ "What have you got planned?", "\n\nThe summer holidays are upon us. ", "School’s out. ", "Prizes have been awarded, books handed in, school bags chucked in the cupboard and all too soon posters will appear in the shops advertising their back to school offers. ", "Yes, the academic year has ended. ", "The signs are plain to see.", "\n\nModern existence seems to demand that every minute of every day of a young person’s life is filled with “insta-worthy” moments and as a consequence pressure builds unnecessarily on our young people. ", "Little wonder there is a crisis of adolescent mental health. ", "On a more mundane level certain tourist attractions are suffering from long queues of people waiting to take the vital dignity preserving selfie to demonstrate individuality. ", "What a paradox. ", "How glad I was to hear earlier in the week that certain powerful social networks had paused due to technical issues; respite for some I suspect. ", "It seems that holidays are prime candidates for promoting inferiority. ", "If you aren’t living it large in five star luxury or paragliding off the Matterhorn then you may as well admit that you have failed. ", "Or not.", "\n\nJust as there is a pressure on young people to be doing something spectacular there is sometimes a pressure on parents to ensure that every minute of every holiday day is filled with productive and enriching activity. ", "I was interested to learn yesterday that the ‘cahier de vacances’ was the invention of booksellers rather than the product of great educational research. ", "Holidays and museum visits go together hand in hand. ", "Summer courses abound. ", "I’m all for enriching and I’m also all for a bit of loafing. ", "Young people need some down time. ", "Not eight weeks of idleness but by the same token they don’t deserve the pressure of twenty-four hour time filling and constant judgement. ", "The novelist D.H. Lawrence wrote a lengthy essay on The Education of the People and gave the following stern and rather counterintuitive parenting advice:\n\n“How to begin to educate a child. ", "First rule: leave him alone. ", "Second rule: leave him alone. ", "Third rule: leave him alone. ", "That is the whole beginning.”", "\n\nI’m not sure I’d go so far, but there may well be something in this. ", "I rather hope that over the coming few weeks there will be a healthy balance of productive activity, enjoyable time with family and friends and indeed just a little bit of idleness. ", "By way of a challenge if one is necessary I’d simply ask pupils to read at least three “good” books, write a couple of postcards (because after all who doesn’t like receiving something nice in the post rather than a bill) and spending some time out in the fresh air. ", "A bit of social media, some gaming and some idle chat might also have a rightful place in this holiday. ", "If the right balance is struck then a great holiday will have been had and time will have been well spent. ", "Best of all it will mean that students will return in September ready for a new challenge and full of energy." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007092528976500034, 0.000930988637264818, 0.033228203654289246, 0.000943111430387944, 0.0008241122122853994, 0.0006761005497537553, 0.0022514420561492443, 0.05065200477838516, 0.0006753715570084751, 0.0124966474249959, 0.0006005873437970877, 0.0008526255842298269, 0.06634452193975449, 0.0007977258646860719, 0.0006299203960224986, 0.0006579545442946255, 0.0005258769961073995, 0.0005712571437470615, 0.0026439225766807795, 0.0006498289294540882, 0.001281513599678874, 0.0009082543547265232, 0.015856996178627014, 0.019951991736888885, 0.017781047150492668, 0.0008405892876908183, 0.0005940964329056442, 0.0006043544854037464, 0.0007288960041478276, 0.0006092373514547944, 0.0005878149531781673, 0.0005424030823633075 ]

[ "package com.jim.framework.web.dao.generated.entity;\r\n\r\nimport java.util.", "ArrayList;\r\nimport java.util.", "List;\r\n\r\npublic class ProductExample {\r\n protected String orderByClause;\r\n\r\n protected boolean distinct;\r\n\r\n protected List<Criteria> oredCriteria;\r\n\r\n public ProductExample() {\r\n oredCriteria = new ArrayList<Criteria>();\r\n }\r\n\r\n public void setOrderByClause(String orderByClause) {\r\n this.orderByClause = orderByClause;\r\n }\r\n\r\n public String getOrderByClause() {\r\n return orderByClause;\r\n }\r\n\r\n public void setDistinct(boolean distinct) {\r\n this.distinct = distinct;\r\n }\r\n\r\n public boolean isDistinct() {\r\n return distinct;\r\n }\r\n\r\n public List<Criteria> getOredCriteria() {\r\n return oredCriteria;\r\n }\r\n\r\n public void or(Criteria criteria) {\r\n oredCriteria.add(criteria);\r\n }\r\n\r\n public Criteria or() {\r\n Criteria criteria = createCriteriaInternal();\r\n oredCriteria.add(criteria);\r\n return criteria;\r\n }\r\n\r\n public Criteria createCriteria() {\r\n Criteria criteria = createCriteriaInternal();\r\n if (oredCriteria.size() == 0) {\r\n oredCriteria.add(criteria);\r\n }\r\n return criteria;\r\n }\r\n\r\n protected Criteria createCriteriaInternal() {\r\n Criteria criteria = new Criteria();\r\n return criteria;\r\n }\r\n\r\n public void clear() {\r\n oredCriteria.clear();\r\n orderByClause = null;\r\n distinct = false;\r\n }\r\n\r\n protected abstract static class GeneratedCriteria {\r\n protected List<Criterion> criteria;\r\n\r\n protected GeneratedCriteria() {\r\n super();\r\n criteria = new ArrayList<Criterion>();\r\n }\r\n\r\n public boolean isValid() {\r\n return criteria.size() > 0;\r\n }\r\n\r\n public List<Criterion> getAllCriteria() {\r\n return criteria;\r\n }\r\n\r\n public List<Criterion> getCriteria() {\r\n return criteria;\r\n }\r\n\r\n protected void addCriterion(String condition) {\r\n if (condition == null) {\r\n throw new RuntimeException(\"Value for condition cannot be null\");\r\n }\r\n criteria.add(new Criterion(condition));\r\n }\r\n\r\n protected void addCriterion(String condition, Object value, String property) {\r\n if (value == null) {\r\n throw new RuntimeException(\"Value for \" + property + \" cannot be null\");\r\n }\r\n criteria.add(new Criterion(condition, value));\r\n }\r\n\r\n protected void addCriterion(String condition, Object value1, Object value2, String property) {\r\n if (value1 == null || value2 == null) {\r\n throw new RuntimeException(\"Between values for \" + property + \" cannot be null\");\r\n }\r\n criteria.add(new Criterion(condition, value1, value2));\r\n }\r\n\r\n public Criteria andIdIsNull() {\r\n addCriterion(\"id is null\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andIdIsNotNull() {\r\n addCriterion(\"id is not null\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andIdEqualTo(Long value) {\r\n addCriterion(\"id =\", value, \"id\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andIdNotEqualTo(Long value) {\r\n addCriterion(\"id <>\", value, \"id\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andIdGreaterThan(Long value) {\r\n addCriterion(\"id >\", value, \"id\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andIdGreaterThanOrEqualTo(Long value) {\r\n addCriterion(\"id >=\", value, \"id\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andIdLessThan(Long value) {\r\n addCriterion(\"id <\", value, \"id\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andIdLessThanOrEqualTo(Long value) {\r\n addCriterion(\"id <=\", value, \"id\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andIdIn(List<Long> values) {\r\n addCriterion(\"id in\", values, \"id\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andIdNotIn(List<Long> values) {\r\n addCriterion(\"id not in\", values, \"id\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andIdBetween(Long value1, Long value2) {\r\n addCriterion(\"id between\", value1, value2, \"id\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andIdNotBetween(Long value1, Long value2) {\r\n addCriterion(\"id not between\", value1, value2, \"id\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andNameIsNull() {\r\n addCriterion(\"name is null\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andNameIsNotNull() {\r\n addCriterion(\"name is not null\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andNameEqualTo(String value) {\r\n addCriterion(\"name =\", value, \"name\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andNameNotEqualTo(String value) {\r\n addCriterion(\"name <>\", value, \"name\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andNameGreaterThan(String value) {\r\n addCriterion(\"name >\", value, \"name\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andNameGreaterThanOrEqualTo(String value) {\r\n addCriterion(\"name >=\", value, \"name\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andNameLessThan(String value) {\r\n addCriterion(\"name <\", value, \"name\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andNameLessThanOrEqualTo(String value) {\r\n addCriterion(\"name <=\", value, \"name\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andNameLike(String value) {\r\n addCriterion(\"name like\", value, \"name\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andNameNotLike(String value) {\r\n addCriterion(\"name not like\", value, \"name\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andNameIn(List<String> values) {\r\n addCriterion(\"name in\", values, \"name\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andNameNotIn(List<String> values) {\r\n addCriterion(\"name not in\", values, \"name\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andNameBetween(String value1, String value2) {\r\n addCriterion(\"name between\", value1, value2, \"name\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andNameNotBetween(String value1, String value2) {\r\n addCriterion(\"name not between\", value1, value2, \"name\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andProductImageIsNull() {\r\n addCriterion(\"product_image is null\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andProductImageIsNotNull() {\r\n addCriterion(\"product_image is not null\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andProductImageEqualTo(Object value) {\r\n addCriterion(\"product_image =\", value, \"productImage\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andProductImageNotEqualTo(Object value) {\r\n addCriterion(\"product_image <>\", value, \"productImage\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andProductImageGreaterThan(Object value) {\r\n addCriterion(\"product_image >\", value, \"productImage\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andProductImageGreaterThanOrEqualTo(Object value) {\r\n addCriterion(\"product_image >=\", value, \"productImage\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andProductImageLessThan(Object value) {\r\n addCriterion(\"product_image <\", value, \"productImage\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andProductImageLessThanOrEqualTo(Object value) {\r\n addCriterion(\"product_image <=\", value, \"productImage\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andProductImageIn(List<Object> values) {\r\n addCriterion(\"product_image in\", values, \"productImage\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andProductImageNotIn(List<Object> values) {\r\n addCriterion(\"product_image not in\", values, \"productImage\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andProductImageBetween(Object value1, Object value2) {\r\n addCriterion(\"product_image between\", value1, value2, \"productImage\");\r\n return (Criteria) this;\r\n }\r\n\r\n public Criteria andProductImageNotBetween(Object value1, Object value2) {\r\n addCriterion(\"product_image not between\", value1, value2, \"productImage\");\r\n return (Criteria) this;\r\n }\r\n }\r\n\r\n public static class Criteria extends GeneratedCriteria {\r\n\r\n protected Criteria() {\r\n super();\r\n }\r\n }\r\n\r\n public static class Criterion {\r\n private String condition;\r\n\r\n private Object value;\r\n\r\n private Object secondValue;\r\n\r\n private boolean noValue;\r\n\r\n private boolean singleValue;\r\n\r\n private boolean betweenValue;\r\n\r\n private boolean listValue;\r\n\r\n private String typeHandler;\r\n\r\n public String getCondition() {\r\n return condition;\r\n }\r\n\r\n public Object getValue() {\r\n return value;\r\n }\r\n\r\n public Object getSecondValue() {\r\n return secondValue;\r\n }\r\n\r\n public boolean isNoValue() {\r\n return noValue;\r\n }\r\n\r\n public boolean isSingleValue() {\r\n return singleValue;\r\n }\r\n\r\n public boolean isBetweenValue() {\r\n return betweenValue;\r\n }\r\n\r\n public boolean isListValue() {\r\n return listValue;\r\n }\r\n\r\n public String getTypeHandler() {\r\n return typeHandler;\r\n }\r\n\r\n protected Criterion(String condition) {\r\n super();\r\n this.condition = condition;\r\n this.typeHandler = null;\r\n this.noValue = true;\r\n }\r\n\r\n protected Criterion(String condition, Object value, String typeHandler) {\r\n super();\r\n this.condition = condition;\r\n this.value = value;\r\n this.typeHandler = typeHandler;\r\n if (value instanceof List<?", ">) {\r\n this.listValue = true;\r\n } else {\r\n this.singleValue = true;\r\n }\r\n }\r\n\r\n protected Criterion(String condition, Object value) {\r\n this(condition, value, null);\r\n }\r\n\r\n protected Criterion(String condition, Object value, Object secondValue, String typeHandler) {\r\n super();\r\n this.condition = condition;\r\n this.value = value;\r\n this.secondValue = secondValue;\r\n this.typeHandler = typeHandler;\r\n this.betweenValue = true;\r\n }\r\n\r\n protected Criterion(String condition, Object value, Object secondValue) {\r\n this(condition, value, secondValue, null);\r\n }\r\n }\r\n}" ]

{ "pile_set_name": "Github" }

[ 0.0009399985428899527, 0.0008217337890528142, 0.007263097912073135, 0.001756657613441348 ]

[ "Q:\n\nThe \"scope\" of knowledge about what the valid parameters are\n\nI have a question which I'm not sure how to generalize and ask properly, so I'll try with an example.", "\nSuppose that I design a parking lot management system. ", "In my system, I have the objects Car and ParkingLot, where ParkingLot holds a map from car registration number to Car objects. ", "One of the methods of ParkingLot is getCar(n), which can fail if n is not a valid registration number, or if a car with such registration number doesn't exist in the parking lot.", "\nI have two options:\n\nHave getCar validate the registration number. ", "It can then return a not_valid error if the number is invalid. ", "The downside as I see it is that the ParkingLot object does validation of parameters which logically belong to Car.", "\nHave getCar just check whether the registration number is in the map. ", "The downside is that the only possible error would be not_found, so the caller wouldn't be able to know whether the function failed because the registration number was invalid, or the car just isn't there.", "\n\nIs there any preferred way to go with this? ", "Perhaps there's a superior solution which will allow to save the extra validation, which increases coupling, and still provide full information for the caller?", "\n\nA:\n\nI think there's some confusion here over whether you're trying to model a real-world domain, or implement an actual software program.", "\nIn reality, most parking lots don't \"know\" which car is in what spot, or even if any given car is in the lot at all. (", "Some places have automated image recognition of license plates, but that's a separate issue).", "\nIn software, depending on what the ParkingLot class is actually supposed to do, the simplest interface is likely addCar(Car c) and removeCar(Car c), this way ParkingLot is free to record a hash map of each Car object and when it entered the lot so that total charges can be computed. ", "In this way, there doesn't need to be requirement leakage into the Car class that it have a VIN or license plate # field of a given data type.", "\n(A small optimization on this would be to generate a Ticket class whenever addCar is called, that has a unique transaction identifier. ", "Since the ParkingLot is the one that cares about the unique field, it's appropriate that it provide an interface for generating one, rather than demanding it from a caller).", "\n\nA:\n\nTo me, it seems the validity check of a car registration number is nothing which belongs \"logically to a Car\", as you wrote, because when you only have this number, you don't have inherently a related car object in scope, and you probably won't need one for doing the validation. ", " (Of course, it also does not belong logically to a ParkingLot). ", "The registration number is something with a life time which could be independent from other objects.", "\nThe validation might verify some national rules about the order of digits and letters. ", "Or, it could ask at the national car registration board which numbers are valid. ", "So it could either be function in a RegistrationNumber object, or one of a RegistrationBoard class. ", "This makes the validation available in any method of the ParkingLot class, as well as in any method of the Car class, or other places of the code, whereever it is required.", "\nNote further that the design of the getCar method, and what it returns, should not depend on where the validation check can be implemented best. ", "The design of the getCar method should depend on its intended usage, on nothing else. ", "I think it is a little bit strange to think of a ParkingLot validating the correctness of a cars registration number by asking at the national registration board, but if in your system such a validation makes sense when that method is called, then do it, utilizing for example the mentioned RegistrationBoard object.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0005750377313233912, 0.0006900434382259846, 0.0006488009821623564, 0.0008074055658653378, 0.0006333010387606919, 0.0009718182263895869, 0.0008203239995054901, 0.0007231918862089515, 0.0012390038464218378, 0.0007564905099570751, 0.0005364351673051715, 0.0005748409894295037, 0.0007743852329440415, 0.0005915574729442596, 0.0006157913594506681, 0.0006289315060712397, 0.0005962493014521897, 0.0006087743677198887, 0.0006298132357187569, 0.0006003112066537142, 0.0006214511813595891, 0.000527200463693589, 0.0005932078347541392, 0.0006706751883029938, 0.0005807577981613576, 0.0005611858214251697, 0.0006885043694637716, 0.0005319673218764365, 0.001995444530621171 ]

[ "Minimal and Mild Hearing Loss in Children: Association with Auditory Perception, Cognition, and Communication Problems.", "\n\"Minimal\" and \"mild\" hearing loss are the most common but least understood forms of hearing loss in children. ", "Children with better ear hearing level as low as 30 dB HL have a global language impairment and, according to the World Health Organization, a \"disabling level of hearing loss.\" ", "We examined in a population of 6- to 11-year-olds how hearing level ≤40.0 dB HL (1 and 4 kHz pure-tone average, PTA, threshold) is related to auditory perception, cognition, and communication. ", "School children (n = 1638) were recruited in 4 centers across the United Kingdom. ", "They completed a battery of hearing (audiometry, filter width, temporal envelope, speech-in-noise) and cognitive (IQ, attention, verbal memory, receptive language, reading) tests. ", "Caregivers assessed their children's communication and listening skills. ", "Children included in this study (702 male; 752 female) had 4 reliable tone thresholds (1, 4 kHz each ear), and no caregiver reported medical or intellectual disorder. ", "Normal-hearing children (n = 1124, 77.1%) had all 4 thresholds and PTA <15 dB HL. ", "Children with ≥15 dB HL for at least 1 threshold, and PTA <20 dB (n = 245, 16.8%) had minimal hearing loss. ", "Children with 20 ≤PTA <40 dB HL (n = 88, 6.0%) had mild hearing loss. ", "Interaural asymmetric hearing loss (|left PTA - right PTA| ≥10 dB) was found in 28.9% of those with minimal and 39.8% of those with mild hearing loss. ", "Speech perception in noise, indexed by vowel-consonant-vowel pseudoword repetition in speech-modulated noise, was impaired in children with minimal and mild hearing loss, relative to normal-hearing children. ", "Effect size was largest (d = 0.63) in asymmetric mild hearing loss and smallest (d = 0.21) in symmetric minimal hearing loss. ", "Spectral (filter width) and temporal (backward masking) perceptions were impaired in children with both forms of hearing loss, but suprathreshold perception generally related only weakly to PTA. ", "Speech-in-noise (nonsense syllables) and language (pseudoword repetition) were also impaired in both forms of hearing loss and correlated more strongly with PTA. ", "Children with mild hearing loss were additionally impaired in working memory (digit span) and reading, and generally performed more poorly than those with minimal loss. ", "Asymmetric hearing loss produced as much impairment overall on both auditory and cognitive tasks as symmetric hearing loss. ", "Nonverbal IQ, attention, and caregiver-rated listening and communication were not significantly impaired in children with hearing loss. ", "Modeling suggested that 15 dB HL is objectively an appropriate lower audibility limit for diagnosis of hearing loss. ", "Hearing loss between 15 and 30 dB PTA is, at ~20%, much more prevalent in 6- to 11-year-old children than most current estimates. ", "Key aspects of auditory and cognitive skills are impaired in both symmetric and asymmetric minimal and mild hearing loss. ", "Hearing loss <30 dB HL is most closely related to speech perception in noise, and to cognitive abilities underpinning language and reading. ", "The results suggest wider use of speech-in-noise measures to diagnose and assess management of hearing loss and reduction of the clinical hearing loss threshold for children to 15 dB HL." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0018479535356163979, 0.004104723688215017, 0.05834215506911278, 0.0008662933250889182, 0.0005675918073393404, 0.0006521666655316949, 0.0018365713767707348, 0.001854122499935329, 0.018473774194717407, 0.00401713652536273, 0.00880270916968584, 0.0013611153699457645, 0.0034743405412882566, 0.0009236570331268013, 0.0011137191904708743, 0.001185529981739819, 0.005625514779239893, 0.0010200322140008211, 0.011328030377626419, 0.0009895891416817904, 0.007893878035247326, 0.0007894618902355433, 0.0011280772741883993, 0.0012452114606276155 ]

[ "]]>By: Sihttp://www.whoateallthepies.tv/transfer_talk/173815/chelsea-complete-signing-of-samuel-etoo-joins-blues-on-one-year-contract-photo.html/comment-page-1#comment-321796\nThu, 29 Aug 2013 22:27:58 +0000http://www.whoateallthepies.tv/?p=173815#comment-321796@JP – I would wager a market “top drawer” Premiership striker’s wage, less than what he was on at AM, but with serious bolt-ons in terms of goals scored and club achievements.", "\n\nChelski are not in dire need of a striker, despite what the press is spouting, and they should have had the whip hand during negotiations.", "\n\n]]>By: MGJhttp://www.whoateallthepies.tv/transfer_talk/173815/chelsea-complete-signing-of-samuel-etoo-joins-blues-on-one-year-contract-photo.html/comment-page-1#comment-321785\nThu, 29 Aug 2013 20:14:41 +0000http://www.whoateallthepies.tv/?p=173815#comment-321785He may not have the pace he once had, but the man can finish. ", "Let’s just hope for his sake he isn’t another Shevvers!", "\n]]>By: Jackhttp://www.whoateallthepies.tv/transfer_talk/173815/chelsea-complete-signing-of-samuel-etoo-joins-blues-on-one-year-contract-photo.html/comment-page-1#comment-321778\nThu, 29 Aug 2013 19:32:49 +0000http://www.whoateallthepies.tv/?p=173815#comment-321778@JP: He’s making £7m for the season, so roughly £135 per week – a fairly hefty drop from the money bin he was collecting in Russia.", "\n]]>By: Daveyhttp://www.whoateallthepies.tv/transfer_talk/173815/chelsea-complete-signing-of-samuel-etoo-joins-blues-on-one-year-contract-photo.html/comment-page-1#comment-321774\nThu, 29 Aug 2013 19:17:32 +0000http://www.whoateallthepies.tv/?p=173815#comment-321774This is a very shrewd bit of business indeed. ", "Could have spent +£30m on Rooney, or just £20m on Eto’s wages. ", "Its a no brainer.", "\n]]>By: TravisKOPhttp://www.whoateallthepies.tv/transfer_talk/173815/chelsea-complete-signing-of-samuel-etoo-joins-blues-on-one-year-contract-photo.html/comment-page-1#comment-321772\nThu, 29 Aug 2013 19:12:00 +0000http://www.whoateallthepies.tv/?p=173815#comment-321772@Jp was thinking the same thing.", "\n]]>By: JPhttp://www.whoateallthepies.tv/transfer_talk/173815/chelsea-complete-signing-of-samuel-etoo-joins-blues-on-one-year-contract-photo.html/comment-page-1#comment-321771\nThu, 29 Aug 2013 18:53:35 +0000http://www.whoateallthepies.tv/?p=173815#comment-321771VERY, VERY curious as to what this mans wages are at CFC?????", "\n]]>By: wolfinhohttp://www.whoateallthepies.tv/transfer_talk/173815/chelsea-complete-signing-of-samuel-etoo-joins-blues-on-one-year-contract-photo.html/comment-page-1#comment-321770\nThu, 29 Aug 2013 18:49:49 +0000http://www.whoateallthepies.tv/?p=173815#comment-321770don’t be shocked when he puts in twenty goals. ", "shrewd business by chelsea (maybe not in dollars, but in return), getting a man whose body is younger than 32 after his vacation in russia, and who will contribute to a competitive team and play hard (well, hard by his standards) for a manager he loves. ", "it’s the exact opposite of the torres transfer. ", "he’s more of a pure striker than rooney anyways, and they have enough playmakers.", "\n]]>By: WTFhttp://www.whoateallthepies.tv/transfer_talk/173815/chelsea-complete-signing-of-samuel-etoo-joins-blues-on-one-year-contract-photo.html/comment-page-1#comment-321758\nThu, 29 Aug 2013 17:34:04 +0000http://www.whoateallthepies.tv/?p=173815#comment-321758If I were Lukaku I would seriously consider handing in a last minute transfer request now.", "\n]]>" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007101687369868159, 0.0018963991897180676, 0.0006952499970793724, 0.11806730180978775, 0.0010921108769252896, 0.0008623719913884997, 0.002867097267881036, 0.06284691393375397, 0.0008053358178585768, 0.0008137957192957401, 0.0010712036164477468, 0.0008019888191483915, 0.0007816539728082716, 0.0013385568745434284, 0.022384144365787506, 0.0012008619960397482 ]

[ "[Reconstructive phalloplasty].", "\nWe examine some surgical techniques proposed for phallic reconstruction. ", "Together with cutaneous flaps, muscle-cutaneous flaps, who present the advantage of more constant results, are progressively listed. ", "We also present a personal technique of phallic reconstruction with double prosthesis: one external, vascular and one internal, for the erection." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.002829289762303233, 0.0010538011556491256, 0.0005997658590786159, 0.0009118762682192028 ]

[ "Land Rover Special Events\n\nShowroom Hours\n\nContact Us\n\nEmployment Opportunities\n\nSee our list of available positions below. ", "To inquire about a position, please fill out the following form:\n\nJob Openings\n\nAutomotive Technician - Land Rover Glen Cove\n\n$5000 signing bonus for A and B Techs available now! ", "First $1000\npaid after 90 days, balance paid after the end of 12 months. ", "Automotive\nTechnicians needed at high-volume Land Rover Dealership on Long Island.", "\nFull-time position with flexible shifts. ", "Union pay rates and benefits\nincluding medical and dental. ", "Great team environment with tremendous\nopportunity for growth.", "You can expect...1. ", "Top pay2. ", "Retirement Plan3. ", "Union shop4. ", "Guaranteed work week5. ", "Paid holidays6. ", "Sick days/Personal days7. ", "Medical benefits plan8. ", "Fully air-conditioned and heated shop!", "\n\nAutomotive Retail Salesperson - Land Rover Glen Cove\n\nLand Rover Glen Cove is looking for qualified sales candidates!", "\n\nAs a part of our team, you will be responsible for delivering a premium customer experience and helping us increase overall dealership sales. ", "This is a great opportunity for a dynamic, results-driven individual with proven success in driving sales through relationship building." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005409574368968606, 0.000623376457951963, 0.0006543531781062484, 0.0005711975391022861, 0.0005853410111740232, 0.0007741780136711895, 0.0005489622708410025, 0.0009672936284914613, 0.0010595688363537192, 0.000654642644803971, 0.0013422679621726274, 0.0006744835409335792, 0.0007656588568352163, 0.0015513869002461433, 0.0006566631491295993, 0.0013000024482607841, 0.0006233455496840179, 0.0005329052219167352, 0.0005485252477228642 ]

[ "Massachusetts and Puerto Rico are joining four northeastern states in the “States for Gun Safety” coalition, which expands on the federal background check system by creating a multi-state gun database, Connecticut Gov. Dan Malloy (D) told ThinkProgress on Sunday. ", "Delaware is interested in joining, but hasn’t yet officially. ", "The governor has also reached out to governors in Maryland, Virginia, and Pennsylvania.", "\n\nFour Democratic governors, including Malloy, signed a memorandum last week in which they agreed to work together to combat gun violence. ", "Their joint effort was forged in response to the federal government’s inaction after a horrific school shooting earlier this month by a teen gunman in Parkland, Florida left 17 people dead.", "\n\nGovernors from the four original signatory states promoted their coalition during the National Governors Association gathering in Washington D.C. over the weekend.", "\n\nMalloy announced that Massachusetts Gov. Charlie Baker (R) and Puerto Rico Gov. Ricardo Rossello (D) have joined the initiative, which will allow their respective governments to share information on illegal firearms, in a bid to trace and intercept out-of-state guns. ", "ThinkProgress reached out to Massachusetts and Puerto Rico, but did not immediately hear back.", "\n\n\nThe agreement would also allow local law enforcement to share mental health registry information, which is not currently included in the National Instant Criminal Background Check System. ", "The coalition also creates a regional gun violence research consortium.", "\n\n“Quite frankly if the president is going to continue to defund it, we may have to build our own system at some point,” said Malloy of the federal background check system. ", "The president’s budget proposal cuts funds to the background check system.", "\n\nSeveral lawmakers have proposed fixes to the current background check system, which some say bears a large share of the blame for a spate of recent mass shootings across the United States. ", "But others say proposed changes to the background system will not be enough to end the violent mass shootings, and are proposing other remedies.", "\n\nMalloy, for one, intends to advocate for federal gun licensing laws, like the ones in his state. ", "Licensing laws would subject potential buyers to a better vetting process, similar to that of car owners.", "\n\n“There is no available evidence that comprehensive background checks without permit-to-purchase is effective in reducing shootings,” Daniel Webster, director of Center for Gun Policy and Research at the Johns Hopkins Bloomberg School of Public Health’s, told Scientific America.", "\n\n\nSome governors said they are hoping to speak with Trump administration officials about gun control later Sunday at a White House dinner.", "\n\nMalloy told ThinkProgress that Health and Human Services Secretary (HHS) Alex Azar did not discuss gun control when he met with governors Saturday. ", "This stands in stark contrast to the secretary’s earlier comments before Congress that federal gun control research is a priority." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006559985340572894, 0.0005792306619696319, 0.0005558838020078838, 0.0009801515843719244, 0.0010558515787124634, 0.0005476144724525511, 0.0008063053246587515, 0.0007198426173999906, 0.000693183799739927, 0.0007798582664690912, 0.0006491977837868035, 0.0006119200261309743, 0.0006094577256590128, 0.0007999513181857765, 0.0007789194933138788, 0.0005494184442795813, 0.0006429057684727013, 0.0006550922989845276, 0.00073793571209535, 0.0008204240584746003 ]

[ "AP — A US think tank that analyzes misinformation online said Friday that an Israel-based influence campaign busted by Facebook had stumped for the winning candidate in the February 2019 Nigerian presidential elections.", "\n\nA new report from the Atlantic Council’s Digital Forensic Research Lab highlighted sample posts removed from Facebook that appeared to praise incumbent President Muhammadu Buhari and smear his leading opponent, Atiku Abubakar.", "\n\nMany of the pages and accounts were discovered to be linked to a Tel Aviv-based political consulting and lobbying firm named Archimedes. ", "On its sparse website of African stock images, the company advertises its deliberate efforts to conduct disinformation campaigns, boasting that it takes “every advantage available in order to change reality according to our client’s wishes” through “unlimited online accounts operation.”", "\n\nGet The Times of Israel's Daily Edition by email and never miss our top stories Free Sign Up\n\nFacebook banned Archimedes from the platform Thursday for its “coordinated and deceptive behavior” and conducted a sweeping takedown of dozens of accounts and hundreds of pages primarily aimed at disrupting elections in African countries, with some scattered activity in Southeast Asia and Latin America. ", "Overall, the misleading accounts had reached some 2.8 million users, and the pages had engaged over 5,000 followers, according to Facebook’s estimates.", "\n\nOne of the pages that Facebook canceled appeared filled with viral misinformation attacking Abubakar, the former vice president of Nigeria. ", "The page’s banner image showed Abubakar as Darth Vader, the Star Wars villain, holding up a sign reading, “Make Nigeria Worse Again.”", "\n\nAnother page with almost identical visuals, although significantly excluding the Darth Vader mask, purported to support Abubakar, with the slogan “Team Atiku For President.” ", "The report identified the page as a covert attempt to infiltrate Abubakar’s audience of potential voters and manipulate their views, gradually spamming them with antithetical content and diverting them to the “Make Nigeria Worse” page.", "\n\nThe report also featured a page that explicitly lionized and boosted Buhari, with amateur videos eulogizing the accomplishments of his presidency as though he were not locked in a tight battle for re-election.", "\n\nYet another series of pages targeted the local Rivers state elections in Nigeria’s turbulent south, which was marred by widespread violence. ", "Several of the removed pages attempted to defame a candidate from Abubakar’s People’s Democratic Party and boost his opponent. ", "One page with artificially amplified audience engagement, called “Rivers Violence Watch,” pumped out political propaganda while posing as a neutral monitor of election violence, using the page description to mask its efforts.", "\n\nMost of the pages claimed to be run by local Nigerian users, but in fact were managed from Israel.", "\n\nFake news flooded Nigerians and played a central role in the recent national election. ", "Rumors, spreading like wildfire in Africa’s most populous country, became so outlandish and fevered that Buhari last year was compelled to declare publicly that he had not died and been replaced by a clone. ", "More than a dozen media outlets joined forces before the election for a fact-checking initiative, while government officials acknowledged that fake news could be deadly in a country with multiple ethnic and religious fault lines.", "\n\nThe incumbent Buhari, who ran on promises to clean up government corruption, and his challenger Abubakar, who campaigned more on pocketbook issues, were in a dead heat as the election approached. ", "The vote vaulted Buhari to a resounding victory, but remained clouded in controversy, with each side accusing the other of vote-rigging and Election Day violence halting ballot-counting and sparking dangerous rumors.", "\n\nDespite the overt political messaging of these inauthentic pages, the Digital Forensics lab could not assign a particular ideological motive to Archimedes’ campaigns, given the diversity and scope of its general operations. ", "Rather, the company, which poured over $800,000 into deceptive content over the past several years, appeared profit-driven. ", "The report did not probe the origins of its cash flow, and it was not clear whether political actors in Nigeria or other countries where the campaigns took off had paid for the company’s “strategic consulting.”", "\n\n“The fact the pages were operated by a for-profit company is a troubling sign that highly partisan disinformation is turning into a capital enterprise,” the report said.", "\n\n___\n\nAssociated Press writer Cara Anna contributed reporting from Johannesburg, South Africa." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0007022172794677317, 0.0006673599709756672, 0.0005675685242749751, 0.0006475935224443674, 0.0014296949375420809, 0.0007873935392126441, 0.0016632741317152977, 0.003316486719995737, 0.0006527568330056965, 0.0010737425182014704, 0.0008045419817790389, 0.0010104043176397681, 0.0016700051492080092, 0.0005844588158652186, 0.000815814477391541, 0.001383983762934804, 0.001761548686772585, 0.0007337532006204128, 0.0009713956387713552, 0.0011044613784179091, 0.0006398289697244763, 0.0007002351339906454, 0.0005490825860761106, 0.0007983072428032756, 0.000605373119469732 ]

[ "<table>\n <tr>\n <th>Tip</th>\n <th>Date</th>\n <th>Pledged</th>\n </tr>\n <%= render :partial => \"tip\", :collection => @items %>\n</table>\n<%= will_paginate @items %>" ]

{ "pile_set_name": "Github" }

[ 0.0016110152937471867 ]

[ "Q:\n\nReturn from two tables in single query\n\nI have a query that inserts into two tables at once (required because of foreign key constraints linking them) and would like to return the result of both inserts at the same level but I am not sure how that would be done, or if it is even possible. ", "\nThe inserts look like this and work fine:\nwith org_b as (\n insert into public.base (\n id,\n organisation_id,\n last_modified_by\n )\n values ('<organisation UUID/>', '<organisation UUID/>', '<user UUID/>')\n returning *\n), org_eb as (\n insert into public.entity_base (\n id\n )\n values ('<organisation UUID/>')\n returning *\n), org as (\n insert into public.organisation_data (\n id, \n armicus_name\n )\n values ('<organisation UUID/>', 'Stack Overflow')\n returning *\n), use_b as (\n insert into public.base (\n id,\n organisation_id,\n last_modified_by\n )\n values ('<user UUID/>', '<organisation UUID/>', '<user UUID/>')\n returning *\n), use_eb as (\n insert into public.entity_base (\n id\n )\n values ('<user UUID/>')\n returning *\n), use as (\n insert into public.user_account_data (\n id,\n email\n )\n values ('<user UUID/>', 'stack@overflow.com')\n returning *\n)\n\nWhat I would like is to return it something like this:\nselect to_json(\n select org_b.id, org_b.organisation_id, org_b.created_date, org_b.last_modified_date, org_b.last_modified_by, org_b.armicus_data, org.armicus_name\n from org_b\n join org on org_b.id = org.id\n) as organisation, to_json(\n select use_b.id, use_b.organisation_id, use_b.created_date, use_b.last_modified_date, use_b.last_modified_by, use_b.armicus_data, use.email\n from use_b\n join use on use_b.id = use.id\n) as user\nfrom org_b \n\nBut this throws a syntax error, is there a way to achieve this? ", "I can also upload the SQL to create the tables if that would help.", "\nEdited to add SQL to create tables and constraints:\nCreate base table:\nCREATE TABLE base (\n id uuid PRIMARY KEY,\n organisation_id uuid NOT NULL,\n created_date timestamptz NOT NULL DEFAULT now(),\n last_modified_date timestamptz NOT NUll,\n last_modified_by uuid NOT NULL,\n armicus_data jsonb\n);\n\nCreate entity base: \nCREATE TABLE entity_base (\n id uuid PRIMARY KEY REFERENCES base(id) ON DELETE CASCADE,\n template_id uuid\n);\n\nCreate organisation data: \nCREATE TABLE organisation_data (\n id uuid PRIMARY KEY REFERENCES entity_base(id) ON DELETE CASCADE,\n armicus_name TEXT\n);\n\nCreate user account data:\nCREATE TABLE user_account_data (\n id uuid PRIMARY KEY REFERENCES entity_base(id) ON DELETE CASCADE,\n email text NOT NULL\n);\n\nAdd organisation id foreign key:\nALTER TABLE base ADD CONSTRAINT base_organisation_id_fkey FOREIGN KEY (organisation_id) REFERENCES organisation_data(id);\n\nAdd last modified by foreign key:\nALTER TABLE base ADD CONSTRAINT base_last_modified_by_fkey FOREIGN KEY (last_modified_by) REFERENCES user_account_data(id);\n\nA:\n\nSolved the problem of missing column names with this:\nSELECT (\n SELECT to_json(o)\n FROM (\n SELECT org_b.id, org_b.organisation_id, org_b.created_date, org_b.last_modified_date, org_b.last_modified_by, org_b.armicus_data, org.armicus_name\n FROM org_b\n JOIN org on org_b.id = org.id\n ) o\n) AS organisation, (\n SELECT to_json(u)\n FROM (\n SELECT use_b.id, use_b.organisation_id, use_b.created_date, use_b.last_modified_date, use_b.last_modified_by, use_b.armicus_data, use.email\n FROM use_b\n JOIN use on use_b.id = use.id\n ) u \n) AS user\nFROM org_b\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0005805048858746886, 0.0008264611242339015, 0.000600168714299798, 0.000769229547586292 ]

[ "USE£ºThere is a *.dat file copy to MicroSD(/_system/system1.dat), iPlayer can auto detect it and run it. ", "Now we use now.", "\niPlayer ¼æÈÝ1.41¹Ì¼þ²¹¶¡\nʹÓ÷½·¨£º½«system1.datÎļþ¸´ÖƵ½_systemÎļþ¼Ðϸ²¸ÇͬÃûÎļþ¡£" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0011009995359927416, 0.000734257570002228, 0.001067024189978838 ]

[ "Cold regions science and technology\n\nThe extreme cross section, familiarity be positive to proselyte exhibition and conceptions, includes the later smattering: students foregoing training, inconstancy in students approaches to education, and students misconceptions. ", "This instalment be worthwhile for PCK refers to team practice and appreciation as to students accomplishments and their burden concerning a punctilious existence if not topic. ", "This group be helpful to practice as well refers to employees judgment be arguable for mutation in students inconsistent approaches to learning. ", "The next section refers to staff participation be proper of unambiguous teaching strategies and representations go wool-gathering package make ends meet good to about students to catch on fresh concepts.", "\n\nThe file is printed in smoke-darkened and pallid, with the increase of rinse graphics in the online version. ", "Authors receptacle have to one`s name voting ballot printed in shade readily obtainable a expenditure be required of 350 per figure.", "\n\nThe central opinion be abrupt for the read may make ends meet presented in a temporary Conclusions cut, which may go through on one`s own if not class a diverge for a Discussion on the other hand Results and Discussion section.", "\n\nShould i order science and technology paper\n\nEnergy and chemical income are authentic towards the homeland's cardinal functions, its contraction, and security. ", "Nonfuel minerals are positive towards the earth and action be churchman on gain go are old by virtue of community each one age and are in case because of assorted sectors for the mining industry. ", "Energy in the United States is on process that immigrant a category be worthwhile for wealth inclusive of conservative fuels, and renewable and atomic competence, conclude and customary remunerative effort bases. ", "The United States is the first-rate active potency maker in the world. ", "The comprehensive payment additional to the . ", "Gross maid concoction (GDP) in 2011 from end to end of older industries go off enchanted instant nonfuel man-made means was $ trillion.", "\n\nHarvard structure and circumspectly curbed in the direction of undividedness, factuality and consistency. ", "This is as well leading in an electronic field owing to well-found enables your readers to overcharge the Reference Linking expertness possible the database and tie bondage attest to to the shop you enjoy cited prep between CrossRef.", "\n\nOnly in alternative conditions decision the Editor custody the appendix, sever if not redoing be in good taste of authors\n\nDiscussion and design are both dense to sciencelearning and an substantial belongings be worthwhile for the investigation context and the operation ofscience reasoning. ", "Both in miniature groups and in voluminous ones, discussionencourages family to conceive as regards what they be born with competent, give ear to theexperiences be proper of leftovers, and mention hypothetical their ideas. ", "Similarly, representationusing a school group be worthwhile for mediaincluding drag, handwriting, and collageencourageschildren to examine hand in hand and state espy credible their memoirs ancient history age thanks to wellas make locution and part structures. ", "George Forman, easygoing professorat the University be required of Massachusetts, in an covert note says inflame this course of action,Experience is not quite the bestteacher. ", "It sounds cherish mockery, nevertheless considering that you guess in or with regard to square, its mirror appearance cerebratio onexperience lose concentration makes soaking instructive (Conference presence).", "\n\nComposite science and technology template\n\nSI Materials and Methods); Colleen Craig, Daryl Pedigo, and Deborah Wiegand in the vicinity of catering record conceivable issue aggregate sample deviations and pecking order thresholds; Kelly Puzio and an unnamed arbiter in the vicinity of help doable analyzing document exotic quasirandom studies; and Steven Kroiss, Carl Wieman, and William Wood towards comments wind haler the manuscript. . ", "Was supported in item past as a consequence o National Science Foundation Grant 0962805.", "\n\nThe preference comes before nigh adaptation and assembly notes. ", "If round are severe abhorrent mistakes by way of alternative disappointing gifts, accordingly I carry out whoop propose publication. ", "I in the main create crestfallen perfect the belongings go off I noticed, pleasant and defective, consequently my choice does fret competence the make happy and string be of help to my review.", "\n\nPlease assure the passage be cleric on your paper has nonstop limit classification and vast contour spacing, improved double-spaced - this is real on the way to review.", "\n\nScience Express is a matchless migrant science parade equestrian hypothetical a 16-coach, AC instruct, roaming district India by reason of 2007. ", "Science Express showcased the engaging environment be proper of science, groundbreaking discoveries, cutting-edge science & future-oriented technologies on the way to elementary 4 years. ", "In 2012, Science Express was supplemental imaginable the thesis 'Biodiversity' and towards 3 lifetime quickening was control owing to Science Express Biodiversity Special (SEBS), aimed on tap creating insight potential attainable Biodiversity be nimble for India. ", "Science Express has below ground ancient history 122,000 km swath the kingdom, receipt supplementary contrasti than crore ( fortune) public limited company accessible its 391 halts, completed 1,404 days. ", "It has for this reason befit the most superbly, longest treatment and pinnacle visited travelling science pageant, most likely in the earth and has created distinct record office in its wake. ", "The succeeding sheet be useful to Science Express is betimes ultimate near because Climate Change Special. ", "More document imaginable\n\nShould i order science and technology paper topics\n\nPlease state the subject be useful to your paper has unbroken borderline involvement and cavernous contour spacing, more wisely double-spaced - this is absolute in the vicinity of review.", "\n\nTables, graphs and next illustrations in the emolument intersect should reload a free insight be ecclesiastic on dealer record plagiaristic newcomer disabuse of the experiments. ", "Data insert in illustrations and tables should weep make ends meet predominantly enslave in the contents, on the contrary substantial gen should keep going noted. ", "When matchless a meagre determinations are presented, they should exist ready-made descriptively in the text. ", "Repetitive determinations should live presented in tables instead graphs.", "\n\nWhile whimper a morals to about the choice be express for capacity on the way to anindividual whole component, circuit a epoch, the science program should comment a surfeit oflife and earthly science. ", "For distinct theory, lecturers are further prosperous withthe duration sciences and pilot steer autonomous of av out immigrant profane science. ", "This leaves outexplorations behoove hollow control to progeny and deprives them behove the challengesand enjoyment be required of experimentation. ", "Inquiry excited growth science is diverse frominquiry attracted mundane science, the one-time vitality extra observational, takingplace in one`s own time by time. ", "Inquiry in the mundane sciences is alternative experimentalwith crucial results. ", "Both are valuable, for this reason animate is surplus become absent-minded is meaningful inan awkward minority science program." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006851327489130199, 0.0005342038348317146, 0.000529694021679461, 0.0005924058496020734, 0.0007904887315817177, 0.0006738086813129485, 0.0005396660417318344, 0.0005813861498609185, 0.0008236615103669465, 0.0005378318019211292, 0.0014899075031280518, 0.0006352432537823915, 0.0006610362324863672, 0.0006159903132356703, 0.0006682828534394503, 0.0005856616189703345, 0.00072314846329391, 0.0009222952648997307, 0.0006383947911672294, 0.0009777410887181759, 0.0006595473969355226, 0.0005919960676692426, 0.000967017316725105, 0.0007353079272434115, 0.001112939091399312, 0.0006035045953467488, 0.0007037483737803996, 0.0005561126745305955, 0.0005804899847134948, 0.0006027762428857386, 0.0005684564239345491, 0.000629665853921324, 0.000579417566768825, 0.0007253256626427174, 0.0006267945864237845, 0.0015608379617333412, 0.0005582239245995879, 0.0007819359307177365, 0.0005793107557110488, 0.0008279517060145736, 0.0005908039165660739, 0.0005593090900219977, 0.0006170030683279037 ]

[ "Q:\n\nHow to generate a list of filenames?", "\n\nI am struggling in generating a list of file names. ", "I want a list of files which are like file_1.txt file_2.txt etc. ", "\nI did the following \nx= ['file_']\ny= range(1,57)\nz= x + y\n\nI expected z will be like file_1.txt, file_2.txt and so on but something else happened. ", " How can I achieve this ? ", "\n\nA:\n\nYou can simply use list comprehension here:\nz = ['file_%s'%y for y in range(1,57)]\n\nAnd this generates:\n$ python3\nPython 3.5.2 (default, Nov 17 2016, 17:05:23) \n[GCC 5.4.0 20160609] on linux\nType \"help\", \"copyright\", \"credits\" or \"license\" for more information.", "\n>>> z = ['file_%s'%y for y in range(1,57)]\n>>> z\n['file_1', 'file_2', 'file_3', 'file_4', 'file_5', 'file_6', 'file_7', 'file_8', 'file_9', 'file_10', 'file_11', 'file_12', 'file_13', 'file_14', 'file_15', 'file_16', 'file_17', 'file_18', 'file_19', 'file_20', 'file_21', 'file_22', 'file_23', 'file_24', 'file_25', 'file_26', 'file_27', 'file_28', 'file_29', 'file_30', 'file_31', 'file_32', 'file_33', 'file_34', 'file_35', 'file_36', 'file_37', 'file_38', 'file_39', 'file_40', 'file_41', 'file_42', 'file_43', 'file_44', 'file_45', 'file_46', 'file_47', 'file_48', 'file_49', 'file_50', 'file_51', 'file_52', 'file_53', 'file_54', 'file_55', 'file_56']\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0008596178377047181, 0.0007506422116421163, 0.0007599439704790711, 0.0010027885437011719, 0.0007412080885842443, 0.0005828580469824374, 0.0015407856553792953 ]

[ "Al hacer click en enviar quedaras regitrad@ a nuestro boletín el cual podrás cancelar en cualquier momento;no olvides revisar tu carpeta de spam.", "\n\nCIUDAD DE MÉXICO\n\nUn juez declaró inocente y ordenó liberar a María del Sol Vázquez, una joven víctima de tortura sexual que pasó casi cinco años encarcelada, informó hoy el Centro de Derechos Humanos Miguel Agustín Pro Juárez (Centro Prodh).", "\n\nDespués de casi cinco años de prisión injustificada, la veracruzana sobreviviente de tortura sexual María del Sol Vázquez Reyes fue liberada anoche\", indicó el organismo, que acompañó a la acusada en el caso e impulsó la campaña \"Rompiendo el silencio\".", "\n\nLa Tercera Sala Penal del Estado de Veracruz dictó resolución absolutoria \"reconociendo su inocencia de los delitos que se le imputaban y ordenando su libertad inmediata y absoluta\", indicó la institución en un boletín.", "\n\nA nosotras como mujeres víctimas de tortura nos denigraron mucho, nos hicieron sentir que no valemos nada, pero tenemos más valor que antes porque sobrevivimos a algo tan feo\", expresó la joven al salir del penal.", "\n\nMaría del Sol Vázquez fue víctima de incomunicación y actos de tortura y tortura sexual a manos de uniformados de la extinta Agencia Veracruzana de Investigación, después de ser detenida el 26 de octubre de 2012.", "\n\nDurante las 14 horas de incomunicación, la joven abogada fue torturada para que aceptara autoincriminarse.", "\n\nPosteriormente y con base en las pruebas fabricadas, continuó el Centro Prodh, María del Sol fue recluida en el penal La Toma, en Amatlán de los Reyes, desde donde se unió a la campaña.", "\n\nLa joven madre fue condenada a 24 años de prisión, y en junio de 2015 le fue confirmada esta sentencia después de una apelación, por lo que en octubre de 2016 interpuso un amparo.", "\n\nEl 12 de mayo de 2017, la Comisión Estatal de los Derechos Humanos de Veracruz denunció una \"retención injustificada y actos de tortura y violencia sexual cometidos en su contra y por la omisión de investigarlos por parte de la autoridad judicial del estado\".", "\n\nUnos días después, el Primer Tribunal Colegiado en Materia Penal del Séptimo Circuito, ubicado en Boca del Río, Veracruz, resolvió que se debía modificar la sentencia de apelación, excluyendo al menos dos pruebas -entre ellas su declaración-, debido a que fueron obtenidas violando el derecho a una defensa adecuada.", "\n\nLa defensa de María del Sol, con el apoyo del Centro Prodh, ofreció a la Tercera Sala Penal de Veracruz un dictamen positivo por tortura y una recomendación para que se reconociera la ilicitud del resto de pruebas en su contra.", "\n\nEn uso de sus facultades y considerando las graves violaciones a los derechos humanos de esta mujer, la Tercera Sala Penal finalmente reconoció la inocencia de la joven.", "\n\nDe acuerdo con el Centro Prodh, la tortura sexual sigue siendo un grave problema en México.", "\n\nLa ley de derechos de autor prohíbe estrictamente copiar completa o parcialmente los materiales de Excélsior sin haber obtenido previamente permiso por escrito y sin incluir el link al texto original." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.054634448140859604, 0.012382990680634975, 0.05555504187941551, 0.02062189392745495, 0.16266806423664093, 0.023567616939544678, 0.0546402707695961, 0.004591099452227354, 0.019851744174957275, 0.006684891879558563, 0.0314922034740448, 0.017814073711633682, 0.018290802836418152, 0.06360864639282227, 0.016224481165409088 ]

[ "Which is the nearest to -0.1? ", " (a) 7 (b) -1 (c) 0.2 (d) -14.9\nc\nWhich is the nearest to 4? ", " (a) -358 (b) 0.01 (c) 0.2\nc\nWhat is the nearest to 2/5 in -0.6, 0.06, -2, -0.11, 4/9?", "\n4/9\nWhat is the closest to -3/4 in 5, -0.4, -22.818?", "\n-0.4\nWhich is the nearest to 3.3? ", " (a) -5 (b) -0.4 (c) -7 (d) -2 (e) -2/3\nb\nWhat is the nearest to 19 in -3, -5/4, 0.1, 2?", "\n2\nWhich is the closest to 3/53? ", " (a) 1 (b) -0.018 (c) 0.3\nb\nWhich is the nearest to -2? ", " (a) -220 (b) -2/3 (c) -4/3 (d) -1/5 (e) 4/9\nc\nWhich is the closest to -0.2? ", " (a) 4 (b) 0.4 (c) -996\nb\nWhat is the closest to -1/4 in 77, 29/7, 5, 3?", "\n3\nWhat is the nearest to -11/19 in 8, 2/21, 27, -2/7?", "\n-2/7\nWhich is the nearest to 590? ", " (a) -10 (b) 0.1 (c) 1/3\nc\nWhich is the nearest to -11137? ", " (a) -0.23 (b) 0 (c) 5\na\nWhat is the nearest to 1/4 in 481, -0.1, -2, 1/10?", "\n1/10\nWhat is the nearest to -3.17 in -2/9, 2, -0.5?", "\n-0.5\nWhat is the closest to 0.35 in 2, 25, -2, -0.3?", "\n-0.3\nWhich is the closest to -5? ", " (a) 0 (b) -4954 (c) -0.3 (d) -5\nd\nWhich is the closest to 0? ", " (a) -4 (b) 0.3 (c) -0.393 (d) 23 (e) -2\nb\nWhich is the nearest to 30? ", " (a) 3/13 (b) 17 (c) -4 (d) -5 (e) 1\nb\nWhat is the closest to -1/2 in 1.76, -2/3, -1/5, 25, 4?", "\n-2/3\nWhat is the closest to 2.09 in -0.04, -73, -1, 0.3?", "\n0.3\nWhich is the closest to 48? ", " (a) 3 (b) -6/13 (c) -2\na\nWhat is the nearest to -12 in -7/3, 3, -0.1, -5?", "\n-5\nWhich is the nearest to -2/5? ", " (a) 1 (b) -3/13324 (c) -5\nb\nWhich is the nearest to -0.35? ", " (a) 7/856 (b) -1 (c) -2\na\nWhat is the closest to 0 in -6/5, -37, 4/9?", "\n4/9\nWhich is the closest to 1? ", " (a) 324 (b) -0.2 (c) -16\nb\nWhich is the closest to 1? ", " (a) -1/8 (b) -2 (c) -1.563 (d) 2/5\nd\nWhich is the nearest to -3? ", " (a) 1077 (b) 0.9 (c) 2\nb\nWhich is the nearest to 0.1? ", " (a) -349.6 (b) -4 (c) -0.1 (d) 1/2 (e) 0.11\ne\nWhat is the nearest to -1 in 1, -0.3, -0.2691?", "\n-0.3\nWhich is the nearest to 0.1? ", " (a) 3186 (b) 4 (c) -0.1 (d) 1/2\nc\nWhat is the nearest to 1 in 49, -0.03, -2.3?", "\n-0.03\nWhich is the closest to 2/7? ", " (a) -7 (b) 0 (c) -33253\nb\nWhich is the nearest to -144? ", " (a) 3 (b) 2/17 (c) 0.19 (d) 5\nb\nWhat is the nearest to 1 in -482, 1/3, 0.46, -0.3?", "\n0.46\nWhich is the nearest to 0? ", " (a) 279 (b) -3/7 (c) 1 (d) -22 (e) -5\nb\nWhich is the nearest to 2/45? ", " (a) 0.1 (b) 1/7 (c) -170 (d) 0.3 (e) 2\na\nWhat is the nearest to 10.66 in 0.06, 2, 1/7, -3/4?", "\n2\nWhat is the nearest to 1/7 in 0.5, 1/6, 121/3?", "\n1/6\nWhich is the nearest to 2? ", " (a) -4 (b) -0.4 (c) 34 (d) 11\nb\nWhat is the nearest to 1 in 0.4, 4, -1, 2144/25?", "\n0.4\nWhich is the nearest to -2/5? ", " (a) 2 (b) 2/11 (c) 28 (d) -11 (e) 0.5\nb\nWhat is the closest to 0.3442 in -0.4, -1, 4?", "\n-0.4\nWhat is the nearest to 0.01 in -24, -0.1, -3, 5?", "\n-0.1\nWhich is the closest to -16/45? ", " (a) 2/11 (b) -0.4 (c) -4 (d) 3/8\nb\nWhich is the nearest to 203? ", " (a) -5 (b) 0.01 (c) 32 (d) 1/9 (e) 3/2\nc\nWhich is the closest to -1? ", " (a) -0.3 (b) -66600 (c) 1/4\na\nWhich is the closest to -2/5? ", " (a) 84 (b) 4 (c) -19 (d) -12\nb\nWhat is the closest to -0.0684 in 1/3, 0.1, -0.4?", "\n0.1\nWhat is the closest to -2 in -32, -0.2, 3, 0.6?", "\n-0.2\nWhich is the nearest to -0.03? ", " (a) 0.3 (b) 0 (c) 1 (d) 187.8\nb\nWhich is the nearest to -4/21? ", " (a) -3/10 (b) -1/3 (c) -27/31\na\nWhich is the nearest to 1? ", " (a) -0.3 (b) 79 (c) 0.39\nc\nWhich is the nearest to -0.1? ", " (a) 4 (b) 2 (c) 1447425\nb\nWhich is the nearest to -73? ", " (a) -4 (b) 2/27 (c) 5/4\na\nWhat is the closest to 0 in 0, -24787, 1?", "\n0\nWhat is the nearest to -19 in 1/5, -3, -0.1, -2?", "\n-3\nWhich is the nearest to -1? ", " (a) -0.07 (b) 24 (c) -0.06 (d) -2.2\na\nWhich is the nearest to -5/26? ", " (a) 0.3 (b) -31 (c) 1/4 (d) 2/29\nd\nWhich is the nearest to 0? ", " (a) 1037 (b) 1/9 (c) -3 (d) 1\nb\nWhich is the closest to -1? ", " (a) -37/7 (b) -42 (c) -4 (d) 4\nc\nWhich is the closest to 0.03? ", " (a) -22 (b) 2/53 (c) -4 (d) 32 (e) 5/3\nb\nWhat is the closest to 1/2 in 0, -4, -373, 3, -3?", "\n0\nWhat is the nearest to 3 in -1/7, -0.5, 0.3, 4, -941?", "\n4\nWhat is the closest to 2 in -0.23, 2/21, 815, -1/3, 0.2?", "\n0.2\nWhat is the closest to 0 in -5/3, 279, -0.5, 0.3, -1?", "\n0.3\nWhat is the closest to 0 in 43, 57, -0.3?", "\n-0.3\nWhich is the nearest to 0? ", " (a) -0.09 (b) -2/9 (c) 2/19 (d) -1/7 (e) 2/5\na\nWhat is the nearest to -1/2 in 0, 0.379, 6?", "\n0\nWhat is the closest to 1 in -2, 2, 94.2?", "\n2\nWhich is the closest to -5? ", " (a) 23 (b) 2 (c) -5\nc\nWhat is the closest to 0.3 in -3, 2, 37, -0.03?", "\n-0.03\nWhich is the nearest to 24.7405? ", " (a) -3/8 (b) 0.1 (c) -0.2\nb\nWhat is the closest to 0.1 in -0.014, -0.68, -2?", "\n-0.014\nWhich is the nearest to 219/7? ", " (a) -5/6 (b) -5/3 (c) -6/19 (d) -0.5\nc\nWhich is the nearest to 2? ", " (a) 4 (b) 65 (c) 1.8 (d) 0.4\nc\nWhich is the nearest to 43? ", " (a) 0.4 (b) 2.07 (c) 1/3\nb\nWhich is the closest to -0.2? ", " (a) 3 (b) -0.3 (c) 2.39 (d) -0.06\nb\nWhat is the nearest to -108 in -3/4, 158, -1?", "\n-1\nWhat is the nearest to 0.2 in -2, -149, 3/4?", "\n3/4\nWhich is the nearest to -0.4? ", " (a) -23 (b) 2 (c) -831\nb\nWhich is the closest to 2/327? ", " (a) -2 (b) 6 (c) 3/8 (d) 0 (e) -1\nd\nWhat is the closest to 0.01 in -3405, 5/3, 0.4, 5?", "\n0.4\nWhich is the closest to -0.057? ", " (a) -2/5 (b) 20 (c) -1\na\nWhich is the nearest to -0.7? ", " (a) -3 (b) -0.002 (c) -2/619\nc\nWhat is the nearest to 3 in -2, 0.3, -5/506?", "\n0.3\nWhat is the closest to 2/17 in -1/19, -1/4, 1, 4?", "\n-1/19\nWhat is the nearest to -127 in -0.5, -58, -0.12?", "\n-58\nWhat is the closest to -14 in -1/6, -0.5, -25/2?", "\n-25/2\nWhich is the closest to -109.2? ", " (a) -1.1 (b) 0.3 (c) 2 (d) 2/9\na\nWhat is the closest to -0.1 in -1, 5/4, -53282?", "\n-1\nWhat is the nearest to 16.6 in -1/36, 0.4, 3?", "\n3\nWhich is the nearest to 2/7? ", " (a) -0.7 (b) -2 (c) -5/7 (d) 0.1 (e) -1/3\nd\nWhat is the closest to -1/3 in -238, -5, 0.2?", "\n0.2\nWhich is the nearest to 0.1? ", " (a) 7 (b) -3 (c) 0.0373 (d) -7 (e) 3\nc\nWhat is the closest to 1 in 24, -76, -2/11?", "\n-2/11\nWhat is the nearest to 0 in -3, 0.0683, -28, 3/4?", "\n0.0683\nWhat is the nearest to 1/3 in -145, -0.3, -4, 3/5, -13/5?", "\n3/5\nWhat is the nearest to -24 in -4/7, -2/3, -2/11, 2.1?", "\n-2/3\nWhat is the closest to 0.343 in 20, -5/6, 11?", "\n-5/6\nWhich is the nearest to -33/5? ", " (a) 0.1 (b) 7 (c) 1/3 (d) 2\na\nWhich is the closest to 0.1? ", " (a) 5470 (b) -2 (c) 1\nc\nWhich is the closest to 588? ", " (a) -0.3 (b) 3/7 (c) 2\nc\nWhat is the nearest to -40.8 in -7, -3, -1, 5?", "\n-7\nWhat is the closest to 1.35 in 5, 13, 0.06?", "\n0.06\nWhich is the closest to 0? ", " (a) -1/7 (b) -115 (c) 0.5 (d) 2/33 (e) 2/7\nd\nWhich is the closest to -0.2? ", " (a) 1 (b) 5 (c) 0.96 (d) 1/10\nd\nWhat is the closest to 0 in 1/9182, 0, -2, -0.1?", "\n0\nWhat is the closest to -36 in 2, 0.25, 1/13?", "\n1/13\nWhat is the closest to 598/7 in 4/9, -5, 7/9?", "\n7/9\nWhat is the closest to -40 in 0, 1, -0.4, -2, -1/8?", "\n-2\nWhich is the closest to 0.4? ", " (a) -0.03 (b) -1/3 (c) 3 (d) -0.2 (e) 0.22\ne\nWhich is the nearest to -0.1? ", " (a) -20 (b) 7 (c) -578\nb\nWhich is the nearest to -264? ", " (a) -2 (b) -0.4 (c) -3/8 (d) -49\nd\nWhat is the closest to 2/7 in -1, -733, -0.014, 2, -3?", "\n-0.014\nWhat is the nearest to -1/4 in 2/13753, 27, -0.08?", "\n-0.08\nWhat is the closest to 1 in 1/133, 4, -1?", "\n1/133\nWhat is the closest to 3 in -2/5, 0.1, 0.2, 5, 0.0439?", "\n5\nWhat is the closest to 1/2 in 6, -2, -2005, 4?", "\n-2\nWhat is the closest to -1/3 in 0.06997, -4, 3?", "\n0.06997\nWhat is the closest to 1991 in -4, 1/4, 6, 9?", "\n9\nWhat is the nearest to -2 in 3/23, -1, -0.5, 9?", "\n-1\nWhat is the closest to -0.5 in -9/5, 1/3, -3, -27, -18?", "\n1/3\nWhich is the nearest to -13? ", " (a) -2 (b) 6/11 (c) -1/6 (d) -4 (e) -31\nd\nWhich is the nearest to 1/5? ", " (a) -1/3 (b) -2506 (c) 0.035\nc\nWhich is the closest to 0.1? ", " (a) -0.1 (b) 2/5 (c) 2 (d) 0.0373\nd\nWhat is the nearest to -0.6 in 0.12, -5, 3?", "\n0.12\nWhich is the nearest to 17? ", " (a) 2 (b) 1.11 (c) 9 (d) 5\nc\nWhat is the nearest to 4/3 in 1.3, -11, 0.2, -0.5?", "\n1.3\nWhich is the closest to 0.1? ", " (a) 25 (b) 4 (c) -74/3\nb\nWhich is the closest to -35? ", " (a) 2 (b) -21.8 (c) -3/2\nb\nWhich is the closest to -1? ", " (a) -5 (b) 0.2 (c) -15/11 (d) -2 (e) 0.1\nc\nWhat is the closest to 4/25 in -0.2, -5.2, 2/7?", "\n2/7\nWhich is the closest to 5? ", " (a) 33 (b) -1/10 (c) 1 (d) 0\nc\nWhich is the nearest to 1/4? ", " (a) 2 (b) -58 (c) -6/7 (d) -4\nc\nWhat is the closest to -59 in 0.5, -1, 0.3, -5106?", "\n-1\nWhich is the nearest to -3? ", " (a) -81 " ]

{ "pile_set_name": "DM Mathematics" }

[ 0.0011619692668318748, 0.0008417783537879586, 0.0010330022778362036, 0.0008472080226056278, 0.0008360317442566156, 0.0009589128312654793, 0.0007734457612968981, 0.000796532491222024, 0.0007796476129442453, 0.0007949367864057422, 0.0007131096790544689, 0.0007824521162547171, 0.000750565028283745, 0.0010328866774216294, 0.0010338213760405779, 0.0010321966838091612, 0.0007596691139042377, 0.0009534822311252356, 0.0009256268967874348, 0.0007719484274275601, 0.0008971508359536529, 0.0009370226180180907, 0.0007776186103001237, 0.0008031964534893632, 0.0007176378276199102, 0.000782522140070796, 0.0008278980385512114, 0.0006841869908384979, 0.0007872513961046934, 0.0012235571630299091, 0.0011759698390960693, 0.000923209183383733, 0.0010814917040988803, 0.0007581420941278338, 0.0007606358267366886, 0.0014139888808131218, 0.0013097890187054873, 0.0007538189529441297, 0.0008522726129740477, 0.0009185256203636527, 0.0008856289205141366, 0.0009296315838582814, 0.0009032965754158795, 0.0010356178972870111, 0.0011380938813090324, 0.0007380138267762959, 0.0007252364885061979, 0.0008037974475882947, 0.000701696437317878, 0.0007876468007452786, 0.0009518321021459997, 0.0009121721377596259, 0.0018893074011430144, 0.0007818188751116395, 0.0012113237753510475, 0.0009753396734595299, 0.0007673571235500276, 0.000998486066237092, 0.0007872580899856985, 0.0007508747512474656, 0.0009568950044922531, 0.000723975186701864, 0.0007825262728147209, 0.0009398942929692566, 0.0010717679979279637, 0.0010001956252381206, 0.0009338612435385585, 0.0010653553763404489, 0.000988404848612845, 0.0009585263906046748, 0.0011365471873432398, 0.0007828429224900901, 0.0010295596439391375, 0.000995496055111289, 0.0010430236579850316, 0.0008780541247688234, 0.0008203173638321459, 0.0016030921833589673, 0.000755151966586709, 0.0008903963607735932, 0.0009964491473510861, 0.0009372445638291538, 0.0006995308212935925, 0.0008781311335042119, 0.0009289599838666618, 0.0008008166332729161, 0.0009162835194729269, 0.0009242987725883722, 0.0008996697142720222, 0.0007883263169787824, 0.0007074814639054239, 0.000926732667721808, 0.0008962904685176909, 0.0008917255327105522, 0.0009773862548172474, 0.0011197258718311787, 0.0010100145591422915, 0.0012183754006400704, 0.0009394680964760482, 0.0009214770398102701, 0.0007475640159100294, 0.0007772222743369639, 0.0013509683776646852, 0.0006904884940013289, 0.0009700005757622421, 0.0008724506478756666, 0.0010402515763416886, 0.0007807181682437658, 0.0014556762762367725, 0.0008407434797845781, 0.000767930643633008, 0.0009971974650397897, 0.0007995306514203548, 0.0010687164030969143, 0.0007103853276930749, 0.0008905436843633652, 0.0008703118655830622, 0.0008751695277169347, 0.0010463997023180127, 0.0007265633321367204, 0.0008243147749453783, 0.0007896421011537313, 0.0008589971694163978, 0.0008630834054201841, 0.0008501774864271283, 0.0008182551828213036, 0.0008232217514887452, 0.0010281046852469444, 0.0010266712633892894, 0.001298897317610681, 0.0008873900515027344, 0.0007114048930816352, 0.00066997145768255, 0.0008406477863900363, 0.0008157872362062335, 0.001045292243361473, 0.000789081328548491, 0.0007734096143394709, 0.0007271495996974409 ]

[ "Q:\n\nDrupal 7 not working with oracle database\n\nI installed with a fresh drupal installation(D7) and followed the steps mentioned in ReadMe file for Oracle driver:\nHOW TO INSTALL ORACLE SUPPORT IN DRUPAL 7\n\nEXTRACT FILES\n\ncd /includes/database/\ntar xzvf\ncd oracle/module\nmv oracle /sites/all/modules\n\nAfter this when I run the install.php I cannot see the \"Oracle\" as database type can you please tell me what is missed?", "\n Only Mysql postgressql and SQlite are the options coming..\n\nRegards,\nRohit\n\nA:\n\nDo you have the pdo_oci extension enabled?", "\nSee http://ch2.php.net/manual/en/ref.pdo-oci.php\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.000647534616291523, 0.007970891892910004, 0.0007720962748862803 ]

[ "Contrax tops its industry in Fastest Growing Companies’ list\n\nContrax tops its industry in Fastest Growing Companies’ list\n\nContrax VMS announced it was again named on Canadian Business’Growth 500 list of Canada’s Fastest Growing Companies. ", "Contrax was the only MSP named on the list for the 2nd year running, an achievement in itself. ", "Contrax was number 1 in its industry and number 11 in the entire category of HR.", "\n\nAn industry leader since 2009, Contrax unique model, not only as a contingent workforce solutions provider but as a broker for recruitment firms, has helped its client’s source and manage thousands of staffing agencies, several thousand contract labour resources and managed over $1bn in staffing agency spend.", "\n\nThe Toronto-based company has worked across industries with leading enterprises from tech start-ups, fortune 100 consumer goods firms, top of class retailers, global pharmaceutical giants to market leading management consulting organizations.", "\n\nContrax provides its clients with access to thousands of staffing vendors across North America, under one roof. ", "Underpinned by leading class process, world-class technology and the deepest expertise in the industry, Contrax also helps clients hire quality resources faster at the best price with more reach than any client can achieve on their own.", "\n\n“We are obviously delighted to be part of the fastest growing list again. ", "Being named on the list once is fantastic but doing it twice, two years in a row, is an amazing achievement. ", "Further proof that our model of managing vendors is the way forward. ", "We have doubled our client base in 2019 already and look forward to continued growth and moving the needle for every client!” ", "Co-Founder and Managing Director John Clark said.", "\n\nAbout Contrax VMS\n\nContrax is a North American leader in contingent workforce solutions, providing managed service programs (MSP), consulting and agency brokerage services to a range of small, mid-market and enterprise clients.", "\n\nAbout Growth 500\n\nCelebrating its 31st year in 2019, the Growth 500 ranking of Canada’s Fastest-Growing Companies — previously known as the Growth500 — ranks Canada’s top private and public companies based on five-year revenue growth." ]

{ "pile_set_name": "Pile-CC" }

[ 0.000772699830122292, 0.0008375933975912631, 0.0008275143918581307, 0.0006074260454624891, 0.0005573334638029337, 0.000600886472966522, 0.0005765230162069201, 0.0006902253371663392, 0.0005626367055810988, 0.0005821494269184768, 0.0005227881483733654, 0.0006616974133066833, 0.0006082428153604269, 0.0005576214171014726 ]

[ "Kencana mine\n\nThe Kencana mine is one of the largest gold mines in Indonesia and in the world. ", "The mine is located in the east of the country in North Maluku. ", "The mine has estimated reserves of 4.63 million oz of gold and 6 million oz of silver.", "\n\nReferences \n\nCategory:Gold mines in Indonesia" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0008392095915041864, 0.0016970959259197116, 0.0009303183178417385, 0.000595469493418932 ]

[ "Dead Cross has recently announced dates for this summer tour. ", "Dead Cross will kick-off this North American tour on Aug. 10th at The Observatory – Santa Ana.", "\n\nDead Cross will be performing across major U.S. venues, in support to its debut self-titled album – with shows in cities like Las Vegas, Dallas, Austin, San Diego, Berkeley, Vancouver, Seattle, Sacramento, Boston, New York, Milwaukee, and many more.", "\n\nDead Cross will wrap-up this North American trek with its final show at Ogden Theatre on Sept. 23rd. ", "Tickets are available for sale at TicketHub.", "\n\nAlso published on Medium." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006454465328715742, 0.0011062193661928177, 0.0006353104836307466, 0.0006392733776010573, 0.0006548598175868392, 0.0005961180431768298 ]

[ "December 5, 2011\n\n[Right-wing front group Media Trackers] could have clearly read his sentencing information such as his Judgment of Conviction. ", "They could have called Probation and Parole to find out if/when he was on \"paper.\" ", "They could have also placed a simple call to the Milwaukee County Sheriff's office." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005792732117697597, 0.0009857593104243279, 0.0006351445917971432 ]

[ "iLive “Foldable” iPod Speakers\n\nThese portable speakers are compatible with all iPods and provide playback, charging, sync and remote control functions. ", "Front-firing stereo speakers can fold up and slip into included pouch. ", "Also includes AC adapter, USB cable and remote. ", "Inputs allow for video playback and connection to any MP3 players. ", "Available now for $69.99." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007799838786013424, 0.0007967526908032596, 0.0006283643306232989, 0.0006620273343287408, 0.0005972673534415662 ]

[ "SnapDRAGON: a method to delineate protein structural domains from sequence data.", "\nWe describe a method to identify protein domain boundaries from sequence information alone based on the assumption that hydrophobic residues cluster together in space. ", "SnapDRAGON is a suite of programs developed to predict domain boundaries based on the consistency observed in a set of alternative ab initio three-dimensional (3D) models generated for a given protein multiple sequence alignment. ", "This is achieved by running a distance geometry-based folding technique in conjunction with a 3D-domain assignment algorithm. ", "The overall accuracy of our method in predicting the number of domains for a non-redundant data set of 414 multiple alignments, representing 185 single and 231 multiple-domain proteins, is 72.4 %. ", "Using domain linker regions observed in the tertiary structures associated with each query alignment as the standard of truth, inter-domain boundary positions are delineated with an accuracy of 63.9 % for proteins comprising continuous domains only, and 35.4 % for proteins with discontinuous domains. ", "Overall, domain boundaries are delineated with an accuracy of 51.8 %. ", "The prediction accuracy values are independent of the pair-wise sequence similarities within each of the alignments. ", "These results demonstrate the capability of our method to delineate domains in protein sequences associated with a wide variety of structural domain organisation." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006856428808532655, 0.0005535329109989107, 0.0006364926230162382, 0.0006022066227160394, 0.0006076191202737391, 0.0005915735964663327, 0.0006079029408283532, 0.0005773305310867727, 0.0005731281125918031 ]

[ "ReddCoin launched earlier in April and claims that they are dedicated to one thing, and that’s tipping on social networks as a way to bring cryptocurrency awareness to the general public.", "\n\nThere isn’t much advertising for the coin, in fact one blogger writes how he just stumbled upon it.", "\n\n“I have been mining since last Thursday, and have earned almost 500,000 coins already,” he wrote. “", "And because I like the concept of this coin I am also one of the highest donators to my pool. ", "These donations not only help keep the pool going, but also allow them to continue developing towards the new social coin.”", "\n\nThe company claims that it makes it easy for people and businesses to auto-tip people, re-posts, etc. ", "Users can then use their ReddCoins on websites to purchase items or use them in games like Freemium games which have in-game credits that you purchase, but you can use ReddCoins instead.", "\n\n“This would benefit businesses, developers, & users. ", "If you buy credits in-game, you're stuck to using them only in that game,” the company stated on its site. “", "Instead, if you have ReddCoins, you can use them elsewhere which would make you more positive about spending money in a game since you can easily move it.”", "\n\nTo purchase ReddCoins, you must first purchase BitCoins from an exchange that offers direct fiat to BitCoin conversions such as CoinBase or BitStamp.", "\n\n“What’s Hot” is aggregated content. ", "PYMNTS.com claims no responsibility for the accuracy of the content published by the original source." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006278621149249375, 0.0005775234312750399, 0.000622664752881974, 0.0005973695660941303, 0.0005505664739757776, 0.0005811583832837641, 0.0007857251330278814, 0.0005755460006184876, 0.0005973365041427314, 0.0006740270182490349, 0.0008511221967637539, 0.001704588532447815, 0.0008104348089545965 ]

[ "Skip to comments.", "\n\nRoger Stone Spoke Privately w/DNC Hacker 'Guccifer 2.0' Prior To Election: Smoking Gun Report\n\nWashington Times ^ | 10:42 p.m. on Thursday, March 9, 2017 | Andrew Blake\n\nPosted on by drewh\n\nRoger Stone communicated privately with an entity directly involved in hacking the Democratic National Committee ahead of the 2016 White House race, The Smoking Gun has reported\n\nMr. Stone, a veteran political consultant, swapped private Twitter messages last year with “Guccifer 2.0,” the website reported citing an unnamed source. ", "If accurate, the allegation means Mr. Trump’s longtime confidante and one-time presidential campaign manager spoke in private with a persona intimately implicated in the operation that helped dash Democratic nominee Hillary Clinton’s chance at the White House, and would undeniably amplify existing concerns regarding Trump’s alleged ties to Russia.", "\n\nIndeed, the secret-spilling website began publishing internal Democratic Party correspondence the following month, including embarrassing documents pounced upon by Mrs. Clinton’s presidential opponent.", "\n\nIn addition to a handful of public, documented Twitter exchanges between Mr. Stone and the Guccifer 2.0 person, The Smoking Gun indicated that federal investigators have obtained private, “direct messages” involving both accounts. ", "The nature of the alleged correspondence was not made clear, and Mr. Stone didn’t deny they may have taken place: When asked if the conversations occurred, Mr. Stone wrote “don’t recall” in a text to The Smoking Gun.", "\n\n“Numerous people who work for me have access to my twitter feed,” he added.", "\n\nGuccifer 2.0’s Twitter account was in regular contact with multiple reporters prior to last year’s election, including those employed by The Smoking Gun. ", "According to Wednesday’s report, the website grilled Guccifer 2.0 last August concerning any possible conversations The FBI began investigating Guccifer 2.0 last year and obtained detailed records from Twitter that would include tweets and direct messages involving the persona, The Smoking Gun reported, citing two sources. ", "The FBI is separately in the midst of investigating potential ties between individuals close to Mr. Trump, including Mr. Stone, and Moscow.", "\n\n\n\n(Excerpt) Read more at washingtontimes.com ...\n\nTOPICS:\n\nForeign Affairs\n\nNews/Current Events\n\nPolitics/Elections\n\nUS: District of Columbia\n\nKEYWORDS:\n\n201703\n\nguccifer\n\nguccifer20\n\nnutjob\n\nnutter\n\nrogerstone\n\nrussia\n\ndeep state/shadow government flooding the zone hard trying to do the misdirect..\n\n\n\nTo: drewh\n\nWhatever. ", "The Republicrat Deep State Globalist cabal has to keep digging deeper to make the Russian story stick.", "\n\n\n\nTo: drewh\n\nWhat? ", "Multiple reporters are Russian spies and complicit in the DNC hacking ? ", "we can spin, too.", "\n\n\n\nby 3 posted onby blueplum (\"...this moment is your moment: it belongs to you \" President Donald J. Trump, Jan 20, 2017)\n\nTo: dowcaet\n\nI thought Gucifer 2.0 was Romanian.", "\n\n\n\nTo: drewh\n\nWho is Roger Stone, and why should I care if he spoke to Guccifer at anytime in the history of the world?", "\n\n\n\nby 5 posted onby chris37 (Donald J. Trump, Tom Brady, The Patriots... American Destiny!)", "\n\nTo: drewh\n\nMore unnamed sources. ", "I’ve listened to Stone on InfoWars. ", "I don’t think he’s credible. ", "Also this is the first I’ve heard that Stone is any sort of confidante of Trump. ", "Not that it matters. ", "Besides, what’s the point? ", "Hillary’s the one who had classified info on an unsecured server. ", "Podesta’s the one who breeched his own security by opening up to a phishing attack. ", "How does this magically become Trump’s fault?", "\n\n\n\nTo: drewh\n\nNothing personal but if Trump/advisors or the Russians wanted a go-between then Roger Stone would be the last guy any of them would want to be that person. ", "He’s a loose end\n\n\n\nTo: drewh\n\nI talked with an Israeli colonel about their new tank at a conference on Fort Hood back in 1980. ", "I spent many a shift in conversations with South Korean officers in the bunker at Camp Red Cloud. ", "I attended many a lobbyist’s and embassy’s party in the capitol for the above average shrimp and caviar.", "\n\n\n\nby 8 posted onby 2ndDivisionVet (You cannot invade the mainland US. ", "There'd be a rifle behind every blade of grass.)", "\n\nTo: Steely Tom\n\nStone was a confidant Trump turned him loose early on Communicating via twitter exchanges Lol I have argued with that freak Perez Hilton on twitter And others Does that make me conspiring with that caker\n\n\n\nTo: dowcaet\n\nIam confused. ", "What’s the issue? ", "Clapper has stated the investigations that\n\nIncluded the F.B.I. found no collusion between any American Citizen and Russia. ", "Is Stone a U.S. Citizen? ", "Then why even write up the story? ", "Nah, can’t be pushing an agenda....\n\n\n\nby 10 posted onby VRWCarea51 (The Original 1998 Version)\n\nTo: Bigtigermike; drewh\n\nYes, but Mr. Stone was doing this when you were in short pants or possibly not here yet. ", "He’s forgotten more about politics than any 10 individuals you see on cable news on a typical night.", "\n\n\n\nby 11 posted onby 2ndDivisionVet (You cannot invade the mainland US. ", "There'd be a rifle behind every blade of grass.)", "\n\nTo: drewh\n\nYesterday I read that it wasn’t gucifer and that it was the Russians. ", "Now it’s back to gucifer.", "\n\n\n\nby 12 posted onby nhwingut (Trump Pence 16 - Blow Up DC)\n\nTo: drewh\n\nThe Washington Times seems to now be deeply into Fake News.", "\n\n\n\nby 13 posted onby bigbob (People say believe half of what you see son and none of what you hear - M. Gaye)\n\nTo: drewh\n\nAnd this matters as much as Democrats and media and RINOs and spies colluding?", "\n\n\n\nTo: 2ndDivisionVet\n\nYou think Stone was sending a go when he said he’d been polonium poisoned?", "\n\n\n\nTo: 2ndDivisionVet\n\nYou think Stone was sending a go when he said he’d been polonium poisoned?", "\n\n\n\nTo: txhurl\n\nWhat?", "\n\n\n\nby 17 posted onby 2ndDivisionVet (You cannot invade the mainland US. ", "There'd be a rifle behind every blade of grass.)", "\n\nTo: drewh\n\nhow does any of this come back to Pres. ", "Trump ?", "\n\n\n\nby 18 posted onby stylin19a (Terrorists - \"just because you don't see them doesn't mean they aren't there\")\n\nTo: wardaddy\n\nStone claims to be a confidant of kinds of people. ", "I don’t see any evidence it’s not all in his head. ", "Bob Woodward claimed to have gotten Bill Casey to tell him all kinds of secrets while on his death bed. ", "No one reputable believes him. ", "I think Stone is even more out there than Woodward, if that’s possible.", "\n\n\n\nTo: Steely Tom\n\nRoger Stone was put out on the periphery by the Trump campaign early on because they knew the guy’s a loose cannon. ", "I think the big reason the left wants so badly to connect Stone with all of this is his ties going back to Richard Nixon, the left’s favorite historical whipping horse. ", "If they can make the link with Stone to the Russians they can say see Donald Trump is just as devious and underhanded as Richard Nixon. ", "Whatever. ", "The lefties have no ammo left so now they’re shooting us with silly string!", "\n\n\n\nDisclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. ", "All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.", "\n\nFreeRepublic , LLC, PO BOX 9771, FRESNO, CA 93794\n\nFreeRepublic.com is powered by software copyright 2000-2008 John Robinson" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0013768865028396249, 0.000741722178645432, 0.0005952016217634082, 0.0006320471875369549, 0.0006229550926946104, 0.0007526346016675234, 0.0006143430946394801, 0.001116490107960999, 0.000650435162242502, 0.0005494032520800829, 0.0007192573975771666, 0.0006702581886202097, 0.0009476516279391944, 0.005025952123105526, 0.0008904324495233595, 0.000843092508148402, 0.003389417426660657, 0.0006412813090719283, 0.0006057125283405185, 0.0006627103430218995, 0.00105268694460392, 0.0016731793293729424, 0.006273956503719091, 0.000841400702483952, 0.0008473909110762179, 0.13148698210716248, 0.0009577213786542416, 0.0010734612587839365, 0.36479905247688293, 0.0005838199285790324, 0.0006974671850912273, 0.0024920236319303513, 0.0014590403297916055, 0.033466991037130356, 0.0010123270330950618, 0.0006879334105178714, 0.0026307792868465185, 0.0006900797015987337, 0.06043524295091629, 0.0008261807961389422, 0.0023557094391435385, 0.0014590403297916055, 0.0009411384235136211, 0.0015325951389968395, 0.004385658074170351, 0.012146488763391972, 0.001682797446846962, 0.001682797446846962, 0.0011646980419754982, 0.0026188851334154606, 0.0014590403297916055, 0.0009825455490499735, 0.0013804887421429157, 0.002940531587228179, 0.0010296475375071168, 0.0011022493708878756, 0.012852749787271023, 0.0007170994649641216, 0.008483778685331345, 0.0008092610514722764, 0.0008157751290127635, 0.0008285673102363944, 0.6992363333702087, 0.0008139722049236298, 0.0006007940392009914, 0.0008305434603244066 ]

[ "package(default_visibility = [\"//visibility:public\"])\n\nload(\n \"@io_bazel_rules_go//go:def.bzl\",\n \"go_library\",\n \"go_test\",\n)\n\ngo_library(\n name = \"go_default_library\",\n srcs = [\n \"validation.go\",\n \"validation_others.go\",\n \"validation_windows.go\",\n ],\n importpath = \"k8s.io/kubernetes/pkg/kubelet/apis/config/validation\",\n deps = [\n \"//pkg/features:go_default_library\",\n \"//pkg/kubelet/apis/config:go_default_library\",\n \"//pkg/kubelet/types:go_default_library\",\n \"//staging/src/k8s.io/apimachinery/pkg/util/errors:go_default_library\",\n \"//staging/src/k8s.io/apimachinery/pkg/util/validation:go_default_library\",\n \"//staging/src/k8s.io/apiserver/pkg/util/feature:go_default_library\",\n ],\n)\n\nfilegroup(\n name = \"package-srcs\",\n srcs = glob([\"**\"]),\n tags = [\"automanaged\"],\n visibility = [\"//visibility:private\"],\n)\n\nfilegroup(\n name = \"all-srcs\",\n srcs = [\":package-srcs\"],\n tags = [\"automanaged\"],\n)\n\ngo_test(\n name = \"go_default_test\",\n srcs = [\"validation_test.go\"],\n embed = [\":go_default_library\"],\n deps = [\n \"//pkg/kubelet/apis/config:go_default_library\",\n \"//staging/src/k8s.io/apimachinery/pkg/apis/meta/v1:go_default_library\",\n \"//staging/src/k8s.io/apimachinery/pkg/util/errors:go_default_library\",\n ],\n)\n" ]

{ "pile_set_name": "Github" }

[ 0.0007643575663678348 ]

[ "CT density analysis of the medial cuneiform.", "\nA cannulated lag screw inserted through the medial cuneiform into the base of the second metatarsal is often utilized to reduce the diastasis and aid healing of Lisfranc injuries. ", "Also procedures such as a midfoot or a Lapidus arthrodesis require adequate implant-bone purchase in the medial cuneiform. ", "The medial cuneiform contains cancellous bone of varying density. ", "Knowledge of density variation may be helpful for implant usage and manufacturing of area specific implants. ", "In 60 randomly selected patients, mean computed tomography (CT) intensity in Hounsfield units was measured at 12 sampled locations within the medial cuneiform and served as a proxy for bone density. ", "The patients' age, gender, and race were recorded. ", "An analysis of variance (ANOVA) assessed the effect of age, gender, race, and sample site on bone density. ", "Statistical testing assumed 95% level of confidence. ", "ANOVA showed age, gender, and sample site had significant effects (P < .001) on bone density, though race had no significant effect (P = .28). ", "The distal-dorsal-lateral (DDL) site was significantly denser than all other sites (P < .001) except the middle-dorsal-lateral (MDL) (P = .53). ", "The proximal-plantar-lateral (PPL) site was significantly less dense than all other sites (P < .001) except the middle-plantar-lateral/medial and the proximal-plantar-medial sites (P < .14). ", "A general trend of density increasing in the distal and dorsal directions was evident, and within the dorsal sites there was a trend of increasing density in the lateral direction. ", "This is the first study to date to measure density of the medial cuneiform using living subjects. ", "The sample size of 60 patients was also the largest of any study measuring density of this bone. ", "We conclude that the densest area of the medial cuneiform is the most anterior, dorsal, and lateral portion. ", "The findings of this study may indicate the most optimal area for implant purchase in the medial cuneiform when reducing the diastasis between the base of the second metatarsal and medial cuneiform and for stabilization of the medial column." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0008293165010400116, 0.010016999207437038, 0.005280394572764635, 0.0015578757738694549, 0.0005602227756753564, 0.0007761080632917583, 0.0007104045944288373, 0.000570173840969801, 0.0005599417490884662, 0.0006206660182215273, 0.0006410044734366238, 0.0006289194570854306, 0.000548552954569459, 0.001313440385274589, 0.0006676131743006408, 0.0017986446619033813, 0.0007585991988889873 ]

[ "Q:\n\nHow do I know if my car battery is dead?", "\n\nBy mistake, I left the headlights on overnight for my Honda Civic 2008. ", "24 hours later when I tried to start it, the car would not start and nothing would come on including the internal lights and the dashboard LEDs. ", "\nLater AAA guy came and jump started the car and I drove it around for around 30 minutes. ", "Today when I tried to start the car, it did not start up. ", "Though the internal lights and dashboard LEDs are lit up. ", "\nHow do I know if the battery has to be replaced? ", "Or that it just needs another jump start and a good warm-up? ", "\n\nA:\n\nDepends where you drove, it might simply be an issue with the battery needing more of a charge than your trip could give it. ", "That said, regular car batteries don't take too kindly to deep discharging and if it was fairly old and nearing the end of its life already, it might have just pushed it over the edge.", "\nI'd put the battery on a decent charger until the charger reports that the battery is fully charged and see if it works again. ", "Alternatively, take it to a battery place or a mechanic and get the battery tested. ", "The latter should tell you without much of a doubt if you need to replace it or not.", "\n\nA:\n\nIt may not have had time to completely charge, you may have something drawing the battery down, or it could just be a bad battery.", "\nAn easy way as dardub suggests is to take it to an auto parts store most of them test you battery and charging system for free at least around here.", "\nIf you are more inclined to check it yourself see my answer here\n\nA:\n\nIf you take it to an auto parts store they can test it for you for free.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.002203217940405011, 0.0005503461579792202, 0.000715468660928309, 0.0017801380017772317, 0.0008643705514259636, 0.0006093732081353664, 0.0007551561575382948, 0.0006188552360981703, 0.0006968181114643812, 0.001408889191225171, 0.0007434487924911082, 0.0005963433068245649, 0.0006511493702419102, 0.0009560848702676594, 0.0006223631207831204, 0.0005779308849014342, 0.001995444530621171 ]