text
stringlengths 4
518k
|
|---|
This article reports an evaluation of the Coulter Counter model S-Plus VI automatic analyser for haematology, and data are presented on linearity, carry-over, precision, accuracy and stability of the instrument, when compared with a model S-Plus IV/D.The three-part differential count provided by Coulter S-Plus VI has been compared with manual eye counting. The results show a good agreement with only 2.5% of discrepancies in 2271 routine samples.Advantages of the new instrument include: reduction of running costs, largely due to manpower saving; simple and easy use, and improved operator safety, there being no need for human contact with blood. |
Obesity, the excess accumulation of adipose tissue, is one of the most pressing health problems in both the Western world and in developing countries. Adipose tissue growth results from two processes: the increase in number of adipocytes (hyperplasia) that develop from precursor cells, and the growth of individual fat cells (hypertrophy) due to incorporation of triglycerides. Adipogenesis, the process of fat cell development, has been extensively studied using various cell and animal models. While these studies pointed out a number of key factors involved in adipogenesis, the list of molecular components is far from complete.The advance of high-throughput technologies has sparked many experimental studies aimed at the identification of novel molecular components regulating adipogenesis. This paper examines the results of recent studies on adipogenesis using high-throughput technologies. Specifically, it provides an overview of studies employing microarrays for gene expression profiling and studies using gel based and non-gel based proteomics as well as a chromatin immunoprecipitation followed by microarray analysis (ChIP-chip) or sequencing (ChIP-seq). Due to the maturity of the technology, the bulk of the available data was generated using microarrays. Therefore these data sets were not only reviewed but also underwent meta analysis.The review also shows that large-scale omics technologies in conjunction with sophisticated bioinformatics analyses can provide not only a list of novel players, but also a global view on biological processes and molecular networks. Finally, developing technologies and computational challenges associated with the data analyses are highlighted, and an outlook on the questions not previously addressed is provided. These aand size . Interesand size . By meas be ~10% . These r1). Upon defined hormonal induction 3T3-L1 cells can be induced to undergo adipogenesis to a point where nearly all cells are filled with lipid droplets and can respond to physiological signals (e.g. glucose uptake upon insulin treatment or cAMP activation and lipolysis via β-adrenergic stimuli). Other mouse cell lines are also suitable for modeling adipogenesis in vitro and by the availability of sequencing data on many species, omics technologies sparked the interest to perform a system-wide analysis on the biological system of interest. Multiple variables can be measured in parallel and on different molecular levels by using technologies such as transcriptomics (mRNA levels), genome-wide location analysis (DNA-protein interactions), proteomics (protein expression levels), epigenomics (e.g. histone modifications) and metabolomics .This paper examines the results of large-scale studies on adipogenesis using high-throughput technologies. Specifically, it provides an overview of studies employing microarrays for gene expression profiling and studies using gel based and non-gel based proteomics as well as a chromatin immunoprecipitation followed by microarray analysis (ChIP-chip) or sequencing (ChIP-seq) for the identification of target genes of transcription factors. Due to the maturity of the technology, the bulk of the available data was generated using microarrays. Therefore these data sets were not only reviewed but underwent meta analysis.in vitro adipocyte differentiation in different cell models and organisms as summarized in Table 1. These studies used the most prominent model (the 3T3-L1 cell line) and three different array technologies: spotted arrays, commercial oligo-nucleotide microarrays, and spotted cDNA arrays. Guo and Liao [1). Moreover, the effects of different components of the differentiation cocktail on gene expression were addressed, as was the question of which genes are affected by adding Pparg activators, like Rosiglitazone, to identify potential target genes for Pparg. cDNA microarrays were used to study the whole differentiation process not only to discover novel molecular players but also to obtain a global view on biological processes and molecular networks during adipogenesis [Large- scale gene expression profiling is a discovery-driven approach used to identify candidate genes, which are then subjected to further in-depth functional studies. Moreover, this technology can be utilized to characterize molecular effects in silencing, knock-out or over- expression strategies of these candidate genes in cell models, tissues or organisms. A number of expression profiling studies -36 usingand Liao used a sogenesis . While togenesis , in MEFsogenesis .1). In addition to the key transcription factors like Cebpa and Pparg, enzymes and other uncharacterized genes were identified. A compendium from some of the relevant datasets - discussed above - are provided by the Genomics Of Lipid-associated Disorder database (GOLD.db) [An important aspect of microarray analyses is the quality of data. Additional systematic biases or effects can be introduced for integrating gene expression data if the studies were performed in different laboratories using different platforms or even different species. An exhaustive analysis and comparison of commonly used microarray platforms by a multicenter consortium (MAQC) showed - contrary to earlier reports ,38 - accGOLD.db) .1). Another candidate from these microarray results is the zinc finger-containing transcription factor Egr2 (Krox20). The expression of Egr2 is activated very early after induction and stimulates adipogenesis at least in part through activating Cebpb by binding to its promoter [Many genes identified by expression profiling using microarrays and different cell models are potentially involved in the regulation of fat cell development. To discuss all candidates is beyond the scope of this article; it instead focuses on a handful of candidates, selected for their gene expression profiles and further studied in detail to gain novel insights into the molecular mechanisms of the fat cell development process . promoter . The could be identified as a novel regulator of adipogenesis and Pparg activity and as essential for the regulation of fat accretion . In thisIn summary, the advantages of using a microarray screening process to gain novel mechanistic insights in adipogenesis are three-fold. First, as described above, novel characterized candidate genes could be identified based on their expression profiles and confirmed by further functional studies. Second, also not characterized genes with modulated expression profile can be detected. The RIKEN mouse gene encyclopedia project is a systematic approach to determine the full coding potential of the mouse genome and involves collection and sequencing of full-length complementary DNAs and physical mapping of the corresponding genes to the mouse genome . The annThe maturity of the microarray technology and the focus on the delineation of the transcriptional program of adipogenesis resulted in >20 studies conducted using this approach. In contrast, there are only a handful of published studies using proteomic approaches for identifying proteins during the differentiation of 3T3-L1 adipocytes. This is partly due to the complexity of the proteome with estimated >1.000.000 individual species and partly due to the limitations of the available technologies. Neither gel-based nor non gel-based techniques can currently detect molecules at the required sensitivity range of several orders of magnitude. Hence, the published studies report only a fraction of the adipocyte proteome and secretome (entire complement of secreted proteins).Protein profiling during adipogenesis was performed with gel-based approaches using two-dimensional gel electrophoreses for separation and subsequent MALDI-TOF/MS (Matrix-assisted laser desorption/ionization – time of flight/mass spectrometry) for protein identification -70 as weet al: Pigment epithelium-derived factor (Serpinf1) secreted in preadipocytes, hippocampal cholinergic neurostimulating peptide (Pebp1), neutrophil gelatinase-associated lipocalin (Lcn2), and haptoglobin (Hp) in mature adipocytes. In another gel-based study using human cells, 170 individual proteins were detected [It has become evident in recent years that fat tissue is an organ secreting large number of molecules including signaling metabolites, chemokines, and hormones. Two recent studies ,73 addreChromatin immunoprecipitation (ChIP) is a method for assessing direct DNA-protein interaction between transcription factors and their respective binding sites . Immunopet al. [bona fide target genes and three novel target genes - were confirmed as activated by Pparg by means of luciferase assays in NIH 3T3 cells [Up to date five studies have been published that employ ChIP-chip ,85, ChIPet al. , integraT3 cells .et al. [A more comprehensive and unbiased approach is the use of whole-genome tiling arrays as reported by Lefterova et al. . Mature et al. [Simultaneously, a ChIP-seq study on Pparg and Rxra binding during 3T3-L1 adipogenesis was published . At day et al. . Howeveret al. . Another2.Another study was employing ChIP followed by pair end-tagging (PET) sequencing technology to identify 7821 Pparg and Rxr binding sites . Combiniet al. [Finally, Wakabayashi et al. arrived et al. used the example of the Resistin promoter and showed functional relevance of a region that is ~8.8kb upstream of the transcription start site and contains three Cebp and one Pparg binding sites [One pressing question emerging from these and other genome-wide location studies is, if and how binding sites that are far away from 5’ ends of genes can confer transcriptional activation. In an elegant study Tomura ng sites . Still iThese genome-wide location studies are of great interest and provide a high-confidence part list of the adipogenic process. Unfortunately, a direct comparison of these studies is not possible due to the different protocols, antibodies, platforms, and technologies used and because of non-standardized bioinformatics analyses.2), and a chemical biology approach.In addition to the described omics technologies, three other medium-scale methods were employed to characterize the process of fat cell development and to identify new candidates in this process: RNAi-screens, DNase I hypersensitivity as a read-out. By minituarizing the procedure it was possible to perform 30-50 gene silencings per week . As repocis- and trans-acting factors. The principle of DNase I hypersensitivity assays is that regulatory genomic elements are more accessible to digestion by nucleases than to sites of inactive chromatin [cis elements. Finally, some Irfs were shown to be potent inhibitors of adipogenesis [Another “top-down” approach for identifying as yet unknown players in adipogenesis was the use of high-throughput DNase I hypersensitivity analysis in conjunction with a computational strategy to identify differentiation-dependent hromatin . The dighromatin . One of ogenesis . Anotherogenesis . Both, tTo this end, endeavors are underway to take DNase I hypersensitivity assays to the genome-wide level by combining this technique with hybridization to tiling arrays ,99 or wivia a mechanism that involve the inhibition of the Wnt signaling pathway [In a chemical biology approach over 500 compounds from a small-molecule library (BIOMOL) were screened for activator and repressor activities using a 3T3-F442A reporter cell line, that stably expressed luciferase under the control of the adipocyte differentiation-dependent aP2 promoter . Besides pathway . A strucFollowing data generation in omics studies, data preprocessing and normalization is required to extract the data points above the noise level and to submit these data to statistical analyses for the identification of differentially expressed or modulated genes/proteins across samples or experiments. Once the candidate genes are identified, major efforts are directed towards functional validation . The stade novo functional annotation can be performed on a sequence segment/domain-wise basis. For this purpose several prediction tools need to be integrated and the results can be mapped subsequently onto known pathways, possible cellular roles, and subcellular localizations [In the case of uncharacterized genes, izations . Using tizations but alsoExperimental studies using microarrays and proteomics technologies to investigate adipogenesis identified a large and confident set of candidate molecules and putative drug targets in adipocytes. A fraction of these were subsequently characterized in functional studies and not only provided novel mechanistic insights, but also pinpointed target molecules for therapeutic intervention. For example, a recent microarray profiling study identified and validated adipogenic factors including Nr1h3 and phospholipid transfer protein (Pltp) as well as candidates for the delicate balance between adipocytes and osteoblasts in bone marrow . One of Omics technologies enabled for the first time a comprehensive assessment of the various molecular species in a cell and sparked a number of studies. The choice of a specific technology to address certain biological questions has to be weighted depending on several technological, scientific, and economic parameters. Currently, microarrays are widely used due to the maturity of the technology, robustness of the instruments, the relative inexpensiveness, the inherent sensitivity, and the availability of bioinformatics solutions to manage and analyze the data. In other studies, measurement of RNA levels might not be sufficient and proteomics experiments may be required. In contrast to microarrays, the proteomics technologies (MALDI-TOF or LC-MS/MS) are not as sensitive, less complete (only a fraction of the proteome is detectable), and generate a wealth of data, which is difficult to manage and analyze. Hence, currently only a handful of labs are able to apply high-throughput proteomics technologies and deal with the data.2) that are relevant for adipogenesis were not detected by any (e.g. Klf15) or only by some (e.g. Pnpla2) of the presented studies. This demonstrates that integration of several datasets and meta-analysis is instrumental. Another issue is the consistency or inconsistency of gene expression data. The confidence of the selected candidates for further functional studies is increasing if there are consistent results over several studies. This applies even more to a situation, where the analysis is based on studies from different platforms, technologies or omics-data. For instance haptoglobin (Hp) was differentially expressed in adipocytes versus preadipocytes [Large-scale experiments are prone to low or absent quantitative measurements of molecules. For the identification of enriched or differentially regulated biological processes a moderate number of spurious detections is tolerable. For example based on the gene expression profiles from several microarray studies, candidate genes shown in Fig. treatments or environmental signals. This will ultimately lead to systems biology, an emerging interdisciplinary study field that focuses on the complex interactions in biological systems . One goaAll afore mentioned fields are under constant development, inevitably spawning major breakthroughs that make systems biology and its applications more and more palpable. As an example, next-generation sequencing technologies - also known as high-throughput sequencing, deep sequencing or third generation sequencing (available platforms: Solexa (Illumina), 454 (Roche) and SOLiD (ABI)) - are about to shift omics strategies that rely on hybridization on microarrays to sequencing of the molecule under question ,112. In In summary, omics technologies generated plethora of data and provided novel mechanistic insights into adipogenesis which can be ultimately exploited for developing novel drugs for the treatment of obesity. It became also evident that we are only at the beginning of drawing the complete picture of the complex cellular process of fat cell commitment and differentiation, and that further integrative omics-approaches will be necessary to elucidate the molecular network controlling the cell fate. |
In the present study we determined the performance interrelations of ten different tasks that involved the processing of temporal intervals in the subsecond range, using multidimensional analyses. Twenty human subjects executed the following explicit timing tasks: interval categorization and discrimination , and single and multiple interval tapping (production tasks). In addition, the subjects performed a continuous circle-drawing task that has been considered an implicit timing paradigm, since time is an emergent property of the produced spatial trajectory. All tasks could be also classified as single or multiple interval paradigms. Auditory or visual markers were used to define the intervals. Performance variability, a measure that reflects the temporal and non-temporal processes for each task, was used to construct a dissimilarity matrix that quantifies the distances between pairs of tasks. Hierarchical clustering and multidimensional scaling were carried out on the dissimilarity matrix, and the results showed a prominent segregation of explicit and implicit timing tasks, and a clear grouping between single and multiple interval paradigms. In contrast, other variables such as the marker modality were not as crucial to explain the performance between tasks. Thus, using this methodology we revealed a probable functional arrangement of neural systems engaged during different timing behaviors. The quantification of the passage of time is a ubiquitous and crucial phenomenon in a large repertoire of behaviors. In the hundred of milliseconds range, for example, interval timing is a complex process that is not linked exclusively to a specific sensory modality or motor behavior Now, psychologists have used different analytical tools, other than psychometric techniques, to study complex perceptual or cognitive processes. For example, without any quantitative information about the physical properties of colors, natural visual scenes, or speech sounds, researchers have learned about how humans process these stimuli using the analysis of ratings of perceived dissimilarity, values by which the stimuli are actually distinguished from each other. These dissimilarities are used in analyses, such as hierarchical clustering and multidimensional scaling (MDS), in order to reveal the most relevant physical dimensions of complex stimuli The variability of temporal performance of twenty subjects was measured in ten different timing tasks that cover different aspects of behavior. First, these tasks can be grouped in explicit and implicit (circle drawing) timing tasks. In addition, we included three motor , and two perceptual paradigms that, in fact, can also be subdivided into single or multiple interval tasks. The tasks included time intervals that were defined by auditory (A) or visual (V) markers . It is v = 28.79, p<0.0001), the number of timed intervals = 52.131, p<0.0001), the perception/production = 169.64, p<0.0001), and modality = 26.2, p<0.0001). Thus, as depicted in An analysis of variance (ANOVA) was performed, using the performance variability as dependent variable and the implicit/explicit, the number of timed intervals, the perception/production, and modality parameters as factors. The results showed, significant main effects for all the factors as follows: implicit/explicit = 13.7, p<0.0001). The implicit/explicit = 0.093, p = 0.761), the perception/production = 2.47, p = 0.116), and the modality = 0.02, p = 0.888) did not showed significant effects. These properties are evident in It is important to mention that the performance differences between the explicit timing tasks have been reported in detail elsewhere We used hierarchical clustering with the purpose of classify our tasks in accordance with the distances given in the dissimilarity matrix of The individual dendrograms for the auditory and visual stimuli, shown in 2 was 0.902 subjects, mean (SD) age of 26.5 (2.5) years, (range: 23–32 years) participated in this study. Additional details about the temporal performance of twelve of the participating subjects in the explicit timing tasks are presented in a preceding paper Subjects were seated comfortably on a chair facing a computer monitor (Dell Optiplex 19”) in a quiet experimental room and tapped on a push-button during the production tasks (see below). In addition, during the perceptual tasks subjects were asked to push a key on the computer keyboard to reflect their decisions. Finally, during the circle drawing task the subjects operated a joystick to control a feedback cursor on the computer screen. The subjects could not see their hand during tapping or circle drawing. The stimulus presentation and collection of the behavioral responses were controlled by a custom-made Visual Basic program on a PC computer. Auditory stimuli were presented through noise-canceling headphones , and the sampling rate of the push-button and the joystick was 200 Hz.The subjects were trained first to press the n-key on the keyboard after the presentation of an extremely short interval, or to press the m-key after the presentation an extremely long interval. At least 20 trials (short/long) were performed in this training phase. Categorization feedback was provided during the training phase, with the word ‘correct’ or ‘incorrect’ on the screen. Once the subject learned to associate the short and long intervals with the response on the ‘n’ and ‘m’ key, respectively, intermediate intervals were also presented. Thus, the subject was required to push one of the keys to indicate his/her categorical decision for eight intervals using acquired category boundaries and an implicit middle base interval set during the training period . The intThe stimuli were tones or visual stimuli in the form of a green square (4 cm side), presented in the center of a computer screen for 33 ms. The frame-rate of the video board (60 Hz) was accurately calibrated, and the duration of visual presentations was controlled precisely in terms of the number of frames. Eight intervals were used for each of the five different implicit intervals . For the 350 ms II the intervals were 233, 283, 316, 333, 366, 383, 416, and 466. For 450 ms II the intervals were 299, 366, 416, 433, 466, 483, 533, and 599. For the 650 ms II the intervals were 433, 533, 583, 633, 666, 699, 766, and 866. For 850 ms II the intervals were 566, 666, 783, 816, 883, 916, 1033, and 1133. Finally, for the 1000 ms II the intervals were 699, 816, 933, 966, 1033, 1066, 1183, and 1299. These intervals were carefully chosen to maximize the quality of the threshold boundaries. In all cases, the first four were considered short intervals while the last four were long intervals. Thus, one repetition of the task for each implicit middle base interval included the categorization of the eight intervals. The intervals were presented pseudorandomly for each base interval, and ten repetitions were collected for one implicit middle base interval before moving to the next interval.p and that at 0.25p. Finally, the point of subjective equality was considered the estimated interval or viewed six visual stimuli . The first five created the four isochronous standard intervals. The sixth one produced the comparison interval that was either shorter or longer than the standard . Again, The intervals used in the categorization task were also used in this task as comparison for each of the five different standard intervals . One repetition of the task for each standard interval included the discrimination of the eight intervals, and 8 repetitions were collected. In addition, in 20% of the trials the standard and comparison intervals were chosen at random within the range of 330 ms to 1100 ms. This was done with the purpose of maintaining the subject's attention to both interval durations across all trials. Finally, the comparison intervals were presented pseudorandomly within each standard interval, and the order between standard intervals was chosen randomly.The SD was calculated in the same fashion as in the categorization task.For each interval there was a training and an execution period . In the The stimuli were tones or visual stimuli in the form of a green square (4 cm side) presented in the center of a computer screen for 33 ms. The interval durations were 350, 450, 550, 650, 850, or 1000 ms. Ten trials during the execution period were collected for a particular interval duration before changing to another one. The intervals were chosen pseudorandomly.Subjects produced tapping movements on a push-button device synchronized to a sensory stimulus and then were asked to continue tapping with the same interval without sensory stimulus . At the The same stimuli and interval durations as for the single interval tapping were used. The intervals were chosen pseudorandomly, and ten repetitions were collected for each interval.The subjects operated a joystick, a vertical rod placed in front of the subject at midsagittal level that controlled a feedback cursor, which was displayed in the monitor as a circle of 0.55 cm in diameter. At the beginning of the trial, the subjects had to place the cursor within a white circle of 1 cm diameter (“start window”). Then, the stimuli were presented with a constant interval, and the subjects were required to draw a circle with the cursor, following a circular path of 5 cm diameter, during that interval . Thus, tThe same stimuli and interval durations as for multiple interval tapping were used. The intervals were chosen pseudorandomly and eight repetitions for each interval were collected.We defined the start of a circle drawing as the point of maximum displacement in the y-dimension . We usedThe first twelve subjects performed tasks 1 to 4 in random order in four sessions, followed by the circle drawing in a fifth session. The remaining eight subjects performed the five tasks in random order in the five sessions. At least eight repetitions were collected for each condition and task. Before data collection, practice trials were given in the five tasks until the subjects acknowledged that they understood the tasks and were comfortable with their performance.1p and 4p correspond to the maximum and minimum values of y, y is the probability of long interval categorization, 2p is the estimated slope, and 3p corresponds to the value of x at half of the maximum value of y. The percentage of variance explained (2R) was greater than 90% in all the fittings.This regression was used for the psychometric data of tasks 1 and 2, and is given by:We computed reliability values (varying from zero to one) for the produced intervals in the single and multiple interval tapping, and circle drawing tasks, using the correlation coefficient from odd and even trials of the same subject and interval. The SPSS statistical package was used for this purpose.We performed hierarchical clustering analyses In order to determine the significance of each of the tree branches a bootst2. The latter is the proportion of variance of the scaled data (disparities), which is accounted for by their corresponding distances. The SPSS statistical package was used for all the statistical analyses. It is important to note that two assumptions are made with the MDS model: (1) that the appropriate metric for the similarity space between timing tasks is Euclidean and (2) that each set of individual subject data included in the analysis can be modeled by linear stretching of the centroid configuration, as specified by the individual subject weights. If these assumptions hold true, one expects low stress values for the overall MDS solution. In fact, Monte Carlo studies suggest that stress values below 0.2 are indicative of an output configuration with a good fit to the similarity data The MDS was also performed on the 9×9 dissimilarity matrix, with an ordinal scale was larger than 1/5 of the total length of that axis. For example, taking the data of An additional set of analyses was carried out with the purpose of determine the representation of different MDS superordinate dimensions or axes throughout subpopulations of the studied subjects, as follows. First, the 9×9 dissimilarity matrix for twelve of the twenty subjects was computed for all the possible permutations: |
Warfarin is an oral anticoagulant that is widely prescribed to prevent thromboembolic events in persons at increased risk. The optimal dose is difficult to establish because it can vary 10-fold among individuals due to clinical and demographic factors. Testing for variants of the vitamin K epoxide reductase complex 1 (VKORC1) and cytochrome P450 2C9 (CYP2C9) genes has been proposed for use in guiding the initial dose of warfarin, thus achieving optimal dosing more quickly and with lower risk of bleeding. Pharmacogenetic testing to guide warfarin dose selection for individuals at risk of a thromboembolic event with the goal of shortening the time required to achieve a stable, effective dose and minimizing the risk of adverse effects.VKORC1 and CYP2C9.Analysis of multiple single nucleotide polymorphisms (SNPs) in Over 31 million warfarin prescriptions were dispensed in 2004. Bleeding from warfarin use is a common adverse event and can cause substantial morbidity and mortality.Systematic evidence reviews Rapid ACCE review Recommendations by independent group* None identifiedGuidelines by professional group 2008 American College of Medical Genetics (ACMG) policy statement: "There is insufficient evidence, atCYP2C9 and VKORC1 testing in warfarin-naive patients." this time, to recommend for or against routine 2008 American College of Chest Physicians guideline statement: "We suggest against pharmacogeneitc-based dosing until randomized data indicate that it is beneficial."Some additional guidelines and recommendations can be found at Centers for Medicare & Medicaid Services Decision Memo for Pharmacogenomic Testing for Warfarin Response (CAG-00400N)(dated 8/3/2009): http://www.cms.gov/mcd/viewdecisionmemo.asp?from2=viewdecisionmemo.asp&id=224* independent groups include the US Preventive Services Task Force (USPSTF) and Evaluation of Genomic Applications in Practice and Prevention (EGAPP) Working Group.Analytic Validity:Based on findings from a ACCE evidence review and ACMG policy statement: Limited data on analytic validity are available from laboratories performing these tests.CYP2C9 alleles.High analytic sensitivity and specificity is expected for testing of common VKORC1 alleles.Few data are available for evaluation on analytic sensitivity and specificity of testing for http://www.cap.org/apps/docs/proficiency_testing/surveys_catalog/2010_surveys_catalog.pdf#page=214College of American Pathology (CAP)/American College of Medical Genetics proficiency testing program for warfarin pharmacogenetic testing may improve access to analytic validity data.Test accuracy and reliability in identifying alleles at multiple SNPs . Clinical Validity:Test accuracy and reliability in predicting appropriate warfarin dose . CYP2C9 alleles to warfarin dose.Published studies have examined the relationship of HuGE Navigator: query "CYP2C9warfarin and "VKORC1 alleles to warfarin dose.Published studies have examined the relationship of HuGE Navigator: query "VKORC1warfarin and "The ACCE review and ACMG guideline reported that there is evidence that CYP2C9 and VKORC1 variants are correlated with the stable warfarin dose. There is limited evidence for an association between CYP2C9 and severe bleeding events, and an absence of evidence for bleeding events associated with VKORC1.Recent additions to the literature: A study designed to compare a clinical algorithm versus a pharmacogenetic algorithm using INR values (day 4 or 5 of treatment), clinical factors and genotype to predict warfarin dose. In the derivation set (N=969), the clinical algorithm had an coefficient of determination R(2) of 48% and the pharmacogenetic algorithm had an R(2) of 63% in predicting warfarin dose. In independent validation sets, the clinical algorithm had an R(2) of 26-43% and the pharmacogenetic algorithm had an R(2) of 42-58% in predicting warfarin dose.A retrospective cohort study designed to examine the accuracy of pharmacogenetic warfarin dosing algorithms in predicting warfarin dose. Data from 71 adult patients at an outpatient anticoagulation clinic on a stable, therapeutic warfarin dose were included in the analysis. Six pharmacogenetic warfarin dosing algorithms and a 5 mg fixed dose approach were evaluated. The algorithms published by Gage et al. 2008 and the IWPC 2009 were the most accurate in predicting warfarin dose in the study population.A study designed to compare the International Warfarin Pharmacogenetics Consoritum (IWPC) algorithm versus a clinical algorithm in cohort of Japanese patients (n=200). The purpose was to determine the percentage of Japanese patients for whom the predicted dose deviated by less than 7mg/week from the actual dose. The IWPC algorithm identified a larger percentage of patients to achieve the target INR than did the clinical algorithm.VKORC1 SNPs and haplotypes on warfarin dose prediction in a cohort of Asians (n=1103), blacks (n=670), and whites (n=3113).A study by the International Warfarin Pharmacogenetics Consortium reported a comprehensive assessment of the influence of six VKORC1 SNPS and haplotypes did not further improve warfarin dose prediction. VKORC1-1639G>A and 1173C>T individually explained the greatest variance in warfarin dose across the three racial groups. Including additional VKORC1 explained greater variability in warfarin dose among whites than in Asians or blacks, a finding explained largely by race-specific differences in the frequency of the -1639 A and 1173T alleles. CYP2C9 and VKORC1 genotypes on rate of International Normalized Ratio (INR) increase, anticoagulation maintenance, risk of over anticoagulation, and change in dose over 30 days.VKORC1 variant genotype (with/without the CYP2C9 variant genotype) was associated with higher risk of over anti-coagulation in European Americans but not African Americans. The CYP2C9 or VKORC1 genotype. The risk of minor hemorrhage was not influenced by either CYP2C9 and VKORC1 genotypes explained 6.3% of the variance in dose change. Over the first 30 days of therapy, A study designed to examine the effect of The International Warfarin Pharmacogenetics Consortium reported that an algorithm based on genetic and clinical data performed better than a purely clinical algorithm or a fixed-dose approach in estimating the appropriate initial dose of warfarin.CYP2C9 and VKORC1 along with clinical factors improved accuracy and efficiency of warfarin dose when compared with an empirical protocol; however, there was no difference in the primary endpoint, the proportion of out-of-range clotting times.Results of a randomized clinical trial suggested that an algorithm including Clinical Utility: Net benefit of test in improving health outcomes. CYP2C9 and VKORC1 alleles on health outcomes in persons treated with warfarin have not been conducted.The ACCE review reported controlled trials that evaluate the net effect of testing for Recent additions to the literature: A national, prospective comparative effectiveness study was designed to examine the 6-month incidence of hospitalization (event-free time) in patients receiving warfarin genotyping (n=896) compared to a matched historical control group . To evaluate possible temporal changes in general clinical practice, the researchers compared the hospitalization rates for two external control groups .Adjusted hospitalization rates based on the intention-to-treat analysis showed that the genotyped group had a 31% lower rate of all-cause hospitalizations and a 28% lower rate of hospitalizations for bleeding or thromboembolism compared to the matched historical control group during the 6 month follow up period. There were no significant differences in the adjusted hospitalization rates between the two external control groups.A per-protocol analysis was conducted in which only events occurring after genotyping were counted for patients in the genotyped group. Adjusted hospitalization rates based on the per-protocol analysis showed that the genotyped group had a 33% lower rate of all-cause hospitalizations and a 43% lower rate of hospitalizations for bleeding or thromboembolism compared to the matched historical control group during the 6 month follow up period. There were no significant differences in the adjusted hospitalization rates between the two external control groups. A study designed to compare gene based warfarin dosing versus standard of care practices in an orthopedic surgery population. Adults (n=229) undergoing elective total hip and knee arthroplasty and receiving warfarin under the direction of a dedicated anticoagulation services team were enrolled. The primary endpoint was the reduction in the incidence of adverse events; additional endpoints included time to first therapeutic International Normalized Ratio (INR), time to first supratherapeutic INR; and the percent of INR determinations that fell below, within or above the therapeutic range. Endpoints did not achieve statistical significance.CYP2C9*2, CYP2C9*3, and VKORC1-1639 polymorphisms were evaluated in two independent datasets . Four published dosing algorithms and a prediction model incorporating the The four pharmacogenetic-based dosing algorithms performed similarly in the small, white-only dataset and the large, ethnically diverse dataset. The International Warfarin Pharmacogenetics Consortium algorithm performed best overall for the two datasets combined when comparing the percent of patients whose predicted dose was within 20% of the actual dose. A study of patients with nonvalvular atrial fibrillation examining the cost-effectiveness of genotype guided dosing compared to standard of care for initiating warfarin treatment. Study design was Markov state transition decision model, and data sources included MEDLINE searches and bibliographies from relevant articles. The outcome measures were quality-adjusted life years (QALYs) and costs in US dollars. The authors concluded that based on current data and cost of testing, there is a 10% chance that genotype guided dosing is likely to be cost effective for nonvalvular artial fibrillation patients.See CMS decision memo. The Center for Medicare and Medicaid Services (CMS) does not generally reimburse costs, but it does provide coverage for individuals enrolled in appropriate clinical trials designed to examine clinical utility of genetic testing for Warfarin dosing. U.S, Food and Drug Administration: Table of Valid Genomic Biomarkers in the Context of Approved Drug Labels; Search FDA 510(k) database ClinicalTrials.gov: Warfarin and CYP2C9, Warfarin and VKCORC1 PharmGKB:warfarin, International Warfarin Pharmacogenetics ConsortiumLast updated: April 12, 2010 |
Henoch-Schönlein purpura is a common immunoglobulin A-mediated vasculitic syndrome in children, characterized by purpuric rash, arthritis and abdominal pain. Renal involvement, manifested by the presence of hematuria and/or proteinuria, is also frequently seen. In most cases, patients with this disease achieve complete recovery, but some progress to renal impairment. Gastro-intestinal manifestations are present in two-thirds of affected patients and range from vomiting, diarrhea, and peri-umbilical pain to serious complications such as intussusception and gastrointestinal hemorrhage.We report the case of a 7-year-old Caucasian girl who presented with abdominal pain, labial swelling, and a large abdominal ecchymosis two weeks after having been diagnosed with Henoch-Schönlein purpura. A computed tomography scan revealed abdominal wall edema extending to the groin, without any intra-abdominal pathology. She was successfully treated with intravenous steroids.Circumferential anterior abdominal wall edema and labial edema have never been reported previously, to the best of our knowledge, as a complication of Henoch-Schönlein purpura. These findings further contribute to the wide spectrum of manifestations of this disorder in the literature, aiding in its recognition and management. Henoch-Schönlein purpura (HSP) is an IgA-mediated vasculitis that presents with the common tetrad of abdominal pain, arthritis, purpuric rash and renal involvement. It is usually a benign disease of childhood, typically affecting children between the ages of four and seven years, who achieve complete recovery in most cases. HSP is often preceded by an upper respiratory tract infection, with Group A beta-hemolytic streptococcus responsible for up to 50% of the occurrences .The diagnostic criteria of the American College of Rheumatology for HSP are the following: palpable purpura; patient is aged 20 years or above; acute abdominal pain; and biopsy showed granulocytes in the walls of small arterioles or venules [The presence of two or more of these criteria has a sensitivity and specificity of 87.1% and 87.7%, respectively, for the diagnosis of HSP. A subsequent review of the classification of childhood vasculitides was carried out in 2005 and the diagnostic criteria modified . These nPalpable purpura (mandatory criterion) in the presence of at least one of the following four features: Diffuse abdominal pain; any biopsy showing predominant IgA deposition; arthritis or arthralgia; renal involvement (any hematuria and/or proteinuria).Gastrointestinal manifestations seen with HSP have been well described, and vary in their severity. In a study of 100 patients with HSP, Saulsbury reported that 63% of patients complained of abdominal pain . IntussuUltrasound is typically the modality of choice for investigation of abdominal pain associated with HSP, and can detect mural thickness and hematoma, ileus, peritoneal fluid and intussusception .et al. in 2007 [The treatment of HSP remains mainly supportive, as the acute symptoms resolve spontaneously in the majority of patients. For more severe cases with serious complications of the disease, treatment commonly includes corticosteroids, immunosuppressive drugs, and plasmapheresis . The use in 2007 .A previously healthy 7-year-old Caucasian girl was admitted to our hospital with a history of abdominal pain, labial swelling and a large ecchymosis extending from the left subcostal area to the left lower quadrant. Two weeks before being admitted to the hospital, she experienced symptoms of an upper respiratory infection followed by joint discomfort, peripheral edema and a palpable, purpuric rash. She presented to a smaller community hospital, where the additional findings of hypertension and a Group A beta-hemolytic streptococcus-positive throat swab were discovered by a consulting pediatrician. She was diagnosed with Henoch-Schönlein purpura (HSP) and treated with two weeks of Penicillin V for her tonsillitis. Her symptoms improved, but over the course of the next six days, she developed increasing abdominal pain and "distention". She also experienced significant pain in her genital area with associated labial swelling. She was transferred to our institution, a tertiary care Pediatric Center, for further evaluation. There was no history of abdominal trauma.On admission, she was found to be hypertensive, with a blood pressure just above the 90th percentile for age and height. She had an exudative plaque on the left tonsil, but a throat swab was negative. Her abdomen revealed a large ecchymosis, 10 cm in diameter over the left quadrant, with significant edema/swelling extending from the left flank to the labia majora Figure , 3. No iThe reported case describes circumferential anterior abdominal wall edema and labial edema as a complication of HSP. Gastrointestinal manifestations of HSP are common. However, they usually result from edema and ulceration of the bowel wall, leading to pain and hemorrhage. Although only a minority of patients with HSP are investigated with a CT scan, findings usually include multifocal bowel wall thickening with skip areas, mesenteric edema, vascular engorgement and non-specific lymphadenopathy . Our patGenital involvement in HSP has been previously documented in males, and consisted of orchitis and scrotal swelling found in nine percent of boys in Saulsbury's study . There wSimilar to the responses described in several other reports, our patient had significant improvement within hours of initiation of steroid treatment and achieved almost complete resolution of symptoms within three days.This case presents an occurrence of abdominal wall and labial edema as a complication associated with HSP that has not been previously reported. The symptoms resolved promptly upon treatment with steroids. These new findings are of interest, as they further contribute to the wide spectrum of manifestations of HSP already described in the literature, aiding in the recognition and management of this disorder.CT: Computed tomography; HSP: Henoch-Schönlein purpura; kg: Kilograms; mg: Milligrams.Written informed consent was obtained from the parent of our patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.The authors declare that they have no competing interests.RH and RGS conceived of the project and participated in its design. MR and RH helped draft the manuscript. DS assisted with the interpretation of radiological data. All authors read and approved the final manuscript. |
Classically, HLA-DR expressed on antigen presenting cells (APC) initiates lymphocyte activation via presentation of peptides to TCR bearing CD4+ T-Cells. Here we demonstrate that HLA-DR alpha 2 domain (sHLA-DRα2) also induces negative signals by engaging TIRC7 on lymphocytes. This interaction inhibits proliferation and induces apoptosis in CD4+ and CD8+ T-cells via activation of the intrinsic pathway. Proliferation inhibition is associated with SHP-1 recruitment by TIRC7, decreased phosphorylation of STAT4, TCR-ζ chain & ZAP70, and inhibition of IFN-γ and FasL expression. HLA-DRα2 and TIRC7 co-localize at the APC-T cell interaction site. Triggering HLA-DR - TIRC7 pathway demonstrates that sHLA-DRα2 treatment inhibits proinflammatory-inflammatory cytokine expression in APC & T cells after lipopolysaccaride (LPS) stimulation in vitro and induces apoptosis in vivo. These results suggest a novel antiproliferative role for HLA-DR mediated via TIRC7, revise the notion of an exclusive stimulatory interaction of HLA-DR with CD4+ T cells and highlights a novel physiologically relevant regulatory pathway. TIRC7 (TCIRG1) is a seven transmembrane protein induced early after allo-activation of human lymphocytes We extend this view by providing evidence for an important novel negative regulatory role of HLA-DR executed via binding with its non-polymorphic alpha 2 domain to TIRC7, a negative regulator of immune activation expressed on activated lymphocytes. Binding of HLA-DR alpha 2 to TIRC7 delivers antiproliferative signals to lymphocytes which is not solely restricted to CD4+ cells. Induction of the HLA-DR alpha 2 - TIRC7 pathway leads to activation of the intrinsic apoptotic pathway resulting in apoptosis of CD4+ and CD8+ lymphocytes. The downregulatory mechanism of the immune response is associated with SHP-1 recruitment and include the inhibition IFN-γ expression, phosphorylation of STAT4, TCR-ζ chain, ZAP70 and expression of FasL in T cells. Ligation of TIRC7 using soluble HLA-DRα2 (sHLA-DRα2) causes apoptosis in lymphocytes via activation of caspase 9 and 7. TIRC7 and HLA-DR are co-localized at the site of T cell - APC interaction. Accordingly, targeting of TIRC7 with sHLA-DRα2 controls proinflammatory cytokine release in APC and T cells in vitro. Physiological relevance of TIRC7 and HLA-DR α2 binding is shown in acute inflammatory setting in vivo after LPS. Treatment of mice with sHLA-DRα2 inhibits APC and T cell cytokine expression and induces apoptosis in vivo underlining the physiological importance of TIRC7-HLA-DR alpha 2 binding. Notably, the modulation of the HLA-DR alpha 2 - TIRC7 pathway in vivo allows to reduce significantly the inflammatory response and cytokine release induced by APC-T cell interaction during immune activation. Thus, our results demonstrate that binding of HLA-DR alpha 2 to TIRC7 at the APC-T cell interaction side provides negative signalling events during immune activation leading to downregulation of the immune response.To investigate the ligand(s) interacting with TIRC7 we established a yeast two-hybrid screen using a cDNA library of allo-activated human peripheral blood lymphocytes (PBL). Constructs of the N-terminal, C-terminal sequence stretch, and large extracellular loop of TIRC7 were fused to a Gal4-binding domain and used as bait. While there were no interactions found with the N-terminal or C-terminal domains of TIRC7, a clone interacting with the large extracellular loop of TIRC7 was identified which contained the sequence of human HLA-DR alpha 2 . This bimyc-tagged expression vector at the extracellular carboxy terminus The ability of HLA-DR alpha 2 to interact with TIRC7 was further analysed in binding studies using a soluble HLA-DR alpha 2 fusion protein consisting of the entire human HLA-DR alpha 2 domain linked to an IgG1 Fc protein and expressed in COS7 cells. The ability of sHLA-DRα2 to bind to TIRC7 expressed on the cell membrane was tested in COS7 cells which were transiently transfected with a TIRC7 cDNA fused to a To examine whether interaction of HLA-DR alpha 2 and TIRC7 results in modulation of cellular responses upon cell activation we studied the effect of sHLA-DRα2 on cytokine expression in PBL activated for 48h with PHA. Incubation of lymphocytes with sHLA-DRα2 resulted in significant inhibition of IFN-γ . In contTo further examine cellular responses induced by the interaction of HLA-DR alpha 2 and TIRC7, we studied the effect of sHLA-DRα2 on proliferation of human lymphocytes stimulated by PHA, anti-CD3/CD28, and alloactivation , respectively. As determined by BrdU incorporation, incubation of lymphocytes with sHLA-DRα2 resulted in a concentration-dependent inhibition of proliferation in these proliferation assays . To demoIn addition to the induction of anergy and inhibition of proliferative response, cell cycle arrest as well as apoptosis are further important mechanisms to control the activation of lymphocytes It is well known that HLA-DR molecules interact with CD4 + T cells. Yet from the above results we concluded that HLA-DR protein, especially the alpha 2 domain may induce apoptosis also in CD8+ cells. To examine this hypothesis CD4+ and CD8+ cells were separated by magnetic beads and stimulated 72 h by anti-CD3/CD28 antibodies in the presence and absence of sHLA-DR α2. The results illustrate that compared with non-treated controls sHLA-DRα2 binding leads to induction of apoptosis in both, CD4+ (51%) and CD8+ (54%) cells .Since interaction of HLA-DR especially with CD8+ T cells has not been described so far, we analyzed the HLA-DRα2 binding to CD8+ and CD4+ T cells. Confocal microscopy illustrates that sHLA-DRα2 exhibits a similar binding pattern on CD4+ (30–40%) and CD8+ (40–50%) cells as was oProteins central to apoptosis are members of the caspase family which can be divided into initiator (caspase 8 and 9) and effector (caspase 7 and 3) caspases These results are in agreement with a down-regulatory effect of TIRC7 on ZAP70 activity, since ZAP70 was shown to be essential for the regulation of FasL expression on the surface of activated T cells Upon activation of T lymphocytes both, HLA proteins Functional importance of T cell activation through crosslinking with MHC class II molecules bearing APC is the induction of IL-12 expression which leads to an increased IFN-γ expression in T cells Lipopolysaccaride application in mice is characterized by rapid activation of APC which induces IL-12, endoxinemia and enhanced cytokine induction such as IFN-γ. Of particular relevance are previous studies in which in vivo neutralization of IFN-γ prevented lethal hypersensitivity reactions to LPS and reduced IFN-γ-dependent lethality Due to immediate activation of APC and T cells, we utilized the LPS induction model in mice to prove the physiological relevance of the sHLA-DRα2 targeting of TIRC7 in vivo. First, cross-reactivity studies were performed using mouse splenocytes and demonstrated that human sHLA-DRα2 specifically binds to TIRC7 in mice as shown in microscopic analysis whereas control Fc did not exhibit any binding . ImmediaThe beta-2 domain of the conserved HLA-DR alpha molecule encoded by the HLA-DRA1 locus interacts with the CD4 molecule in human lymphocytes Several conclusions can be drawn from our work. The first novel aspect of the work presented here is the identification of the interaction between HLA-DRα2 and TIRC7, and the demonstration of functional relevance of this binding. Soluble HLA-DRα2 delivers distinct and selective signals via inhibition of IFN-γ, but not IL10 response, strong inhibition of proliferation and induction of apoptosis. The inhibitory effect observed in the lymphocyte cultures is solely due to binding between HLA-DR alpha 2 and TIRC7 as the specific anti-TIRC7 mAb prevents the inhibition of immune activation.The second novel aspect of our work relates to the finding that the HLA-DR protein, beyond its well-known role in initiating lymphocyte activation by presenting peptides to the TCR is also The third aspect of this work relates to the finding that the strong antiproliferative response triggered by TIRC7 ligation is induced on at least two levels of interference. On the one hand, the antiproliferative effect is induced by dephosphorylation of early signaling molecules such as TCR-ζ and ZAP70 which is associated with down-regulation of FasL. This result is in accordance with the fast upregulation of TIRC7 at the cell membrane upon lymphocyte activation and the clustering of the molecule at the cell – cell adhesion site The fourth aspect of our work relates to the observation that binding between HLA-DRα2 and TIRC7 is functional in T cells and APC. Crosslinking of TIRC7 with HLA-DRα2 in T cells and macrophages demonstrates that TIRC7-HLA-DR interaction mediated signals control the expression of proinflammatory cytokines such as IL-12 which naturally potentiates inflammation via the induction of IFN-γ expression. The data obtained from the LPS induction in vivo demonstrate that the anti-inflammatory and apoptotic mode of action of sHLA-DRα2 is physiologically relevant. The reduction of cytokines such as IL-6, Rantes and IFN-γ in cells obtained from mice treated with HLA-DRα2 indicates that TIRC7 targeting might be potentially translated into clinical use to prevent acute inflammatory response.The clinical data and cytokine expression results obtained from acute inflammatory disease, LPS induction, in mice demonstrate that treatment with sHLA-DRα2 can control inflammatory conditions supporting the anti-inflammatory mode of action of the protein. Accordingly, a substitution of the signal to modulate TIRC7 pathway using sHLA-DRα2 might lead to a therapeutic approach unifying both, T cell and APC therapeutic targeting as TIRC7 is expressed in 30% of all lymphocytes.In summary, this work provides novel data for the interaction between HLA-DR alpha 2 and TIRC7 and the functional relevance of this binding in lymphocytes in vitro and in vivo after immune activation. For the first time, it is here reported that the HLA-DR molecule, which is classically described to initiate the cellular immune response also mediates inhibitory signals and apoptosis via binding to TIRC7 in lymphocytes, thereby modulating the decisive first phase of the immune response . This woFor bait construction, DNA fragments of TIRC7 containing the N-terminus (aa 1-173), large extracellular domain (aa 438-512) and C-terminus (aa 586-614) were amplified by PCR and cloned into the pBD-GAL4 Cam vector, thereby generating an in-frame fusion with the GAL4-DNA binding domain. A human PBL cDNA library was constructed using HybriZAP 2.1 Two-Hybrid cDNA Library Kit (Stratagene). Standard yeast techniques were used to manipulate strains. To confirm the observed interaction the obtained plasmids were tested in MATCHMAKER GAL4-Two-Hybrid System3 (Clontech).Lysates from allo-activated PBL and Jurkat cells were incubated with anti-TIRC7 mAb (20 µg) and mouse IgG as control followed by Western blot analysis using anti-HLA-DR mAb or anti-TIRC7 mAb. To analyze phosphorylation of STAT proteins, alloactivated PBL were incubated with 50 µg sHLA-DR α2 for 4 h. Lysates were subjected to Western blot analysis using mAb against either anti-phospho-STAT4 (Ser 721) or or STAT4 or STAT6 . To analyze phosphorylation of TCR-ζ (Santa Cruz) and ZAP70 PBL were stimulated with with 100 U/ml IL-2 for 18 h. Western blots were performed by incubation with a mouse anti-human p-TCR-ζ antibody or p-ZAP70. An anti-mouse POD antibody was used for final analysis in an ECL detection system. For immunoprecipitation studies with SHP1, lysates were incubated for 6h at 4°C with anti-TIRC7 mAb (20 µg), in the presence of followed by incubation with protein-A/protein-G Sepharose beads overnight, at 4°C. Immunoprecipitates were analyzed by immunoblotting with anti-TIRC7 mAb or anti-SHP1 diluted of 1∶200 in 5% milk/PBS and were subjected to chemiluminescent detection (Amersham Pharmacia). For caspase assays PBL were seeded at a density of 1,5×10E7 cells. sHLA-DR α2 or control protein were added at a concentration of 50 µg/ml. Cells were incubated for 6 h, harvested, washed and frozen in liquid nitrogen. Cell lysis was performed with 50 mM Pipes-HCl, pH 6,5, 2 mM EDTA, 0,1% CHAPS, 10 mM NaF, 5 mM DTT and protease inhibitors. Supernatants were boiled with Laemmli-buffer and subjected to SDS-PAGE. Gels were blotted onto PVDF membranes and analysed using specific antibodies .2, at 37°C in the presence of sHLA-DR α2 or control protein, respectively, at a concentration ranging between 50–150 µg/ml. For alloactivation, mixed lymphocytes culture reaction was performed using donor cells which were inactivated and incubated with equal cell number of recipient lymphocytes for 72 h at 5% CO2, at 37°C. These cultures were incubated with either with sHLA-DR α2 or control protein at a concentration of 50 and 100 µg/ml. The proliferation rate of PBL was determined by FACS analysis. For proliferation assays, various human T- and B- cell lines were incubated for 48 h at 37°C, 5% CO2, in the presence of chimeric anti-TIRC7 mAb or control mAb (50 µg/ml), labelled with 10 µl/well BrdU labelling solution and incubated for 16 h at 37°C. Cell Proliferation ELISA BrdU-Kit (Roche Diagnostics GmbH) was used. The measurement of the samples was performed 10–30 minutes after substrate addition at 370 nm (reference wavelength: 492 nm) in an ELISA reader. For detection of apoptosis detection, human PBL or cell lines were stained with 7-AAD for 20 minutes at RT. Samples were measured and analyzed by flow cytometry.For proliferation assay, PBL were obtained from healthy volunteers after written and informed consent had been obtained. PBL were isolated according to the Ficoll-Paque density centrifugation protocol. PBL were labeled by incubation with CFSE (Carboxyfluorescein succinimidyl ester). The CFSE-labeled PBL were stimulated with PHA or anti-CD3/CD28 mAb (10 µg/ml) and incubated for 3 days at 5% CO2, at 37°C for 48 h in the presence of sHLA-DRα2 and control protein, respectively. IFN-γ or IL-10 was quantified in supernatants of PHA stimulated cells. Samples were run in triplicates on 96-well microtiter plates. Cytokine level was determined using the Cytoscreen® ELISA Kit (Biosource).PBL of human healthy donors isolated according to the Ficoll-Paque density centrifugation protocol were incubated with 1 µg/ml PHA (Sigma) in 5% CO5 cells/well) were incubated with 50 µg/ml soluble HLA-DR alpha 2 or control protein. After 72 h or 5 h of incubation the cells were washed with FACS-buffer and stained with 2,5 µl FAS-L-PE or caspase 7 (BD Biosciences) or mIgG-PE as control for 30 min at RT. Immunofluorescence analysis were performed using standard protocols. All images were taken using LSM 510 confocal laser microscope (ZEISS).Splenocytes from wild type (WT) and TIRC7(-/-) mice were isolated with a cell strainer and transferred to 15 ml tubes. Cells were stimulated with 4 µg/ml ConA (Sigma) for 14–16 h and permeabilized with Perm-solution2 (BD biosciences) and Fc-blocked for 30 min at 4°C. After incubation with 8 µg/ml HLA-DR Fc or control protein for 30 min, cells were secondary stained with anti-human Cy3 (Sigma) (1∶250) and analyzed via FACS Calibur (BD Biosciences). Isolated human PBL (5×10myc fusion protein myc fusion protein using Fugene6 Transfection Reagent (Roche). For HLA-DR alpha 2 expression in mammalian expression system the HLA-DR alpha 2 domain was fused to IgG1-Fc fragment. COS7 cells were transiently transfected with vector and after 96 h the fusion protein was purified by Sepharose A column from cell culture supernatants.TIRC7-5 copies of 18S-rRNA.PML were separated from buffy coats of healthy donors by centrifugation on a Ficoll-Paque density gradient and monocytes were purified by adherence. After 14 days, we stimulated monocytes with 5 µg/ml LPS and 200 u/ml IL-4 and incubated them with 50 µg/ml HLA-DR-Fc or control for 2 days. RNA was extracted using RNeasy Mini Kit (Qiagen). cDNA was synthesized from mRNA with random hexamers and TaqMan reverse transcriptase (Applied Biosystems). Reactions use specific primers and Sybr Green PCR Master Mix (Applied Biosystems) or specific probes , detected by use of an ABI Prism 7300 Sequence Detection System (Applied Biosystems). To standardize results, we expressed them as the number of target gene copies per 10Balb/C mice (10–14 weeks old) were induced intraperitoneally with 50 µg LPS on day 0. Immediately afterwards 14 mice were treated intraperitoneally with either sHLA-DR α2-Fc (200 µg in PBS) or human Fc as control (200 µg in PBS), respectively. After 24 h, spleens were removed for further cytokine analysis via FACS. |
LOXL1 (lysyl oxidase-like 1) polymorphisms are associated with pseudoexfoliation glaucoma (XFG) in a United States (U.S.) Caucasian patient population.To identify if recently described LOXL1 in Caucasian individuals. The coding region of exon 1 that includes the previously associated SNP, rs1048661, was sequenced. Allele and genotype frequencies were compared between cases and unrelated controls.Individuals with XFG were identified using standard clinical examination techniques. TaqMan allelic discrimination assays were used to genotype 13 single nucleotide polymorphisms (SNPs) that tag rs1048661, rs2165241, and rs3825942) in our independent XFG population . The risk alleles at these three and several other intragenic SNPs are part of an extended XFG-associated LOXL1 haplotype with a frequency of 32.0% in XFG patients and 21.6% in controls.Fifty affected individuals and 235 control individuals were recruited into this study. We replicated the previously reported association of three SNPs (LOXL1 and XFG in a United States patient population and have confirmed the strong association previously reported for Icelandic and Swedish samples. However, due to the high frequency of risk alleles in non-XFG individuals, this association should not form the basis of a diagnostic test for XFG. It is likely that additional genetic or environmental factors modulate the penetrance of LOXL1 susceptibility alleles.We have performed an analysis of Pseudoexfoliation syndrome (XFS) was initially described by Lindberg in 1917 . It is aBoth Lindberg and VogtLOXL1). They identified one intronic SNP (rs2165241) and two nonsynonymous coding SNPs (rs3825942 and rs1048661) with significant disease association in Icelandic and Swedish individuals. This association was recently replicated in both the midwestern United States [Recently, Thorleifsson et al. performed States and Austc SNP rs25241 and LOXL1 belongs to the “LOX” family of extracellular enzymes that have multiple functions including the cross-linking of collagen and elastin by oxidatively deaminating lysine residues. Since XFS deposits are associated with the extracellular and basement membrane regions, the LOX genes are legitimate functional candidates to be involved with XFG pathogenesis [ogenesis . There aogenesis as well ogenesis .This study adhered to the tenets of the Declaration of Helsinki. The research protocol was approved by the Duke University Institutional Review Board, and all patients consented to participating in the study. All patients were examined by board certified glaucoma specialists.Pseudoexfoliation changes were identified as the presence of a central disk of XFS material, a clear annular zone , or flakes of XFS material on the lens surface, iris, or corneal endothelium in either eye. Patients were excluded if there was a history of exposure to intense infrared light, for example, glassblowing is associated with true exfoliation of the lens capsule rather than XFS. XFG was diagnosed when patients possessed the above XFS characteristics and at least two of the following criteria: A) documented intraocular pressure (IOP) ≥22 mmHg in either eye; B) glaucomatous optic nerve cupping defined as a cup to disc ratio >0.7 in either eye, notching of the neuroretinal rim, or an asymmetric cup to disc ratio >0.2; and/or C) glaucomatous visual field loss consistent with the optic nerve appearance. Glaucoma suspects were excluded from this study. All cases and controls were Caucasian. Controls were individuals of similar age as the patients without any evidence of pseudoexfoliation deposits on intraocular tissues. Their IOPs were in the normal range (<21 mmHg) with normal-appearing optic nerves.2 threshold of 0.8, based on genotype data generated by the HapMap project. In addition to tagging SNPs, we also genotyped the three specific SNPs implicated by the previous study of XFG patients and controls [LOXL1 gene structure and relative locations of SNPs used in this study. TaqMan allelic discrimination assays were performed for all SNPs per standard protocols from the manufacturer . Two Centre d'Étude du Polymorphisme Humain (CEPH) standards were included in each 96-well plate for quality-control (QC), and samples from six individuals were duplicated across all plates with the laboratory technicians blinded to their identities. Genotype submission to the analysis database required matching QC genotypes within and across plates and at least 95% genotyping efficiency.Blood samples were obtained from each individual via peripheral venipuncture, and genomic DNA was isolated using standard techniques . Tagging SNPs for Caucasian individuals were selected using Tagger in Haploview 3.32 with a pairwise rcontrols . See Figrs1048661, was sequenced because a TaqMan assay could not be designed. All sequencing was performed using an ABI 3730 capillary sequencer (Applied BioSystems).All sequencing was performed using appropriately selected primers and conditions optimized in a standard fashion. The coding region of exon 1 that included the SNP, Genotype frequencies of XFG cases and controls were compared by logistic regression with adjustment for age and sex using SAS software . Analysis of Hardy–Weinberg equilibrium (HWE) was performed separately for cases and controls using GDA software . As in t2) between each genotyped SNP and the previously implicated XFG susceptibility marker, rs3825942 (G153D). We confirmed the previously reported association between XFG and rs2165241 (p=0.001), rs1048661 (p=0.02), and rs3825942 (p=0.02). Due to inter-marker LD, several other intragenic SNPs also showed evidence of association at p≤0.02. The haplotype analysis of SNPs, rs1048661 and rs3825942, confirmed that only three of the four possible haplotypes were observed in our sample (D’=1); the haplotype formed by the two protective alleles was not detected. However, the frequency of the high-risk haplotype in our population was lower than in the Icelandic and Swedish populations . A haplotype analysis of all 12 SNPs with minor allele frequency (MAF)>5% confirmed that all individually associated SNPs but relatively low r2 values and controls were Caucasian. The mean age of diagnosis was 74.0 years in patients; the age at recruitment was 64.9 (SD 11.6) years for the controls. All SNPs were in HWE in cases (p>0.05) and controls (p>0.05). 2 values due to drs1048661 (R141L) and rs3825942 (G153D), were analyzed for their ability to predict affection status. The rs1048661 SNP demonstrated a 95.7% sensitivity but only 13% specificity as a diagnostic test for XFG. The rs3825942 SNP demonstrated a 100% sensitivity but only 3.1% specificity .The two coding SNPs, LOXL1 sequence variants, two of which were nonsynonymous coding SNPs. With this study, we have replicated these associations in a U.S. population of XFG patients and controls.Thorleifsson et al. recentlyrs1048661 and rs3825942 SNPs individually have high sensitivity, their specificity is very poor due to their high prevalence in individuals without XFG. This same high prevalence of LOXL1 risk alleles has been reported in all populations examined to date: Nordic [LOXL1 sequence variants. Further investigation of the complex etiology of XFG is warranted.However, we demonstrate that these associations are not strong enough to justify a diagnostic test for XFG. While the : Nordic , midwest: Nordic , and Aus: Nordic . This su |
We hypothesized that expression of specific genes in granulosa cells may be correlated with the developmental competence of the oocyte.Ovarian follicle development is a complex process. Paracrine interactions between somatic and germ cells are critical for normal follicular development and oocyte maturation. Studies have suggested that the health and function of the granulosa and cumulus cells may be reflective of the health status of the enclosed oocyte. The objective of the present study is to assess, using an Immature rats were injected with eCG and 24 h thereafter with anti-eCG antibody to induce follicular atresia or with pre-immune serum to stimulate follicle development. A high percentage of oocytes from eCG/pre-immune serum group developed to term after embryo transfer compared to those from eCG/anti-eCG . Gene expression profiles of mural granulosa cells from the above oocyte-collected follicles were assessed by Affymetrix rat whole genome array.Lox) and nerve growth factor receptor associated protein 1 (Ngfrap1), which are important in the regulation of protein-lysine 6-oxidase activity, and in apoptosis induction, respectively. The down-regulated genes included glycoprotein-4-beta galactosyltransferase 2 (Ggbt2), which is involved in the regulation of extracellular matrix organization and biogenesis.The result showed that twelve genes were up-regulated, while one gene was down-regulated more than 1.5 folds in the NDC group compared with those in the PDC group. Gene ontology classification showed that the up-regulated genes included lysyl oxidase (The data in the present study demonstrate a close association between specific gene expression in mural granulosa cells and the developmental competence of oocytes. This finding suggests that the most differentially expressed gene, lysyl oxidase, may be a candidate biomarker of oocyte health and useful for the selection of good quality oocytes for assisted reproduction. KitL-1 and KitL-2 in granulosa cells from rat early antral follicles, KitL-1 expression can be promoted by BMP15 in vitro ) were used to produce anti-eCG antisera as described previously . Antibodin vitro fertilization or kept at -80°C until the assessment of gene expression, as described hereafter.Eight immature rats were injected with eCG and 24 h thereafter with either pre-immune serum or anti-eCG antibody . Twenty-four hours later, hCG was administered. Cumulus-oocyte complexes (COCs) and mural granulosa cells collected by follicle puncture 13 h after hCG were respectively subjected to 6cells/ml) were pre-incubated in insemination media (400 μl of IVF-30 supplemented with 30 mM NaCl) for 5 to 7 h at 37°C in 5% CO2 in air. COCs were then carefully transferred into the suspension drops and incubated for 12 h. The oocytes were transferred into 100 μl of culture medium and freed from surrounding cumulus cells. The denuded oocytes were considered fertilized if they exhibited the presence of pronuclei with sperm tail(s) in the vitellus.To assess the developmental competence of oocytes which were morphologically indistinguishable in both groups, COCs were inseminated in vitro and the fertilized oocytes were transferred into pseudo-pregnant rats as described previously . BrieflyTo assess the developmental competence in vivo of embryos fertilized in vitro, nine to ten embryos at the 1-cell stage were transferred to the oviducts of each pseudo-pregnant recipient at Day 1. Vaginal smear of recipients was examined on days 1 and 4 as well as days 12-14 after transfer to confirm successful induction of pseudo-pregnancy and signs of pregnancy, respectively. All recipients were sacrificed by day 24 of pregnancy regardless of delivering offspring, and their uterine horns were examined for implantation sites. The number of young was counted on the day of parturition.Total RNAs from mural granulosa cells collected from ovarian follicles were extracted using RNeasy Mini kit according to manufacturer's instructions and DNA contamination was removed by DNase I digestion . All total RNA specimens were quantified and checked for quality with a Bioanalyzer 2100 system before further manipulation.2O and 6 μL of 5× fragmentation buffer (Affymetrix). The fragmented cRNA was made into hybridization cocktail and was hybridized to an Affymetrix Rat 230.2 array. Washing and staining of the arrays with phycoerythrin-conjugated streptavidin was completed in a Fluidics Station 450 (Affymetrix). The arrays were then scanned using a confocal laser GeneChip Scanner 3000 and GeneChip Operating Software (Affymetrix).A total of 4 NDC and 4 PDC samples were used, thus requiring a total of 8 GeneChips. The GeneChip hybridization and image acquisition were performed at the Ontario Genome Center. Briefly, two rounds of amplification were carried out to successfully generate sufficient labeled cRNA for microarray analysis from 100 ng of total RNA. For first round synthesis of double-stranded cDNA, total RNA was reverse transcribed using the Two-Cycle cDNA Synthesis kit (Affymetrix) and oligo (dT) 24-T7 (5'-GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG-3') primer followed by amplification with the MEGAscript T7 kit . After cleanup of the cRNA with a GeneChip Sample Cleanup Module IVT Column (Affymetrix), a second-round double-stranded cDNA was produced using the IVT Labeling kit (Affymetrix). A 15 μg-aliquot of labeled product was fragmented by heat and ion-mediated hydrolysis in 24 μL Hhttp://www.bioconductor.org, which uses a robust average of log2-transformed background-corrected perfect match probe signal intensities combined with a quantile normalization method [th percentile of all the absent call signals of the entire dataset was set. All the remaining probe sets whose expression values were consistently below this value were removed in each sample [http://david.abcc.ncifcrf.gov/[Gene expression patterns were determined using Affymetrix Genechip Arrays Rat 230.2. Prior to any statistical analysis, raw data were normalized and compared using RMA (robust multichip average) method from the BioConductor package n method ,25. The n method . Normalih sample . To extrh sample . Gene Onfcrf.gov/.Reproducibility between experiments was assessed by calculating the pairwise concordance of presence calls, which was 92.1-97.9%, and by computing the pairwise Adjusted Coefficient of Determination of log-transformed signal intensities (average of 0.952). High correlation of array signals was observed between rat samples within the groups with oocytes showing normal and poor developmental competence (Data not shown).Lox), glycoprotein-4-beta-galactosyltransferase 2 , nerve growth factor receptor associated protein 1 (Ngfrap1), protein disulfide isomerase-associated 5 and 6 (Pdia5 and Pdia6), myeloid ecotropic viral integration site 1 homolog (Meis1), CD83 antigen, lysozyme (Lyz), trinucleotide repeat containing 6 (Tnrc6), interleukin 13 receptor alpha 1 (Il13ra1). Real-time quantitative PCR analyses for those genes were performed using a LightCycler 2.0 System (Roche Diagnostic Corporation) and a QuantiTect SYBR Green PCR kit . The thermal cycling conditions were comprised of an initial denaturation step at 95°C (15 min) and 40 cycles at 95°C (15 sec), 58°C (20 sec) and 72°C (30 sec). The primer sequence for each gene, their PCR product size, primer location on rat chromosome, and GeneBank access numbers were shown in Table -ΔΔCt method) was performed by the following formula: 1) Calculate crossing point change of NDC relative to housekeeping gene 18S, ΔCt (NDC) = Ct -Ct ; 2) Calculate crossing point change of PDC relative to housekeeping gene 18S, ΔCt (PDC) = Ct (target gene PDC) - Ct; 3) Calculate the difference of these changes between NDC and PDC group, ΔΔCt = ΔCt(NDC)-ΔCt(PDC); 4) finally calculate RER = 2-ΔΔCt. Fold changes by real-time qPCR in Table In order to validate the results of microarray, real time RT-PCR analysis was performed on all 8 samples. Briefly, 0.4 μg of total RNAs extracted from mural granulosa cells of each rat ovarian follicles were reverse transcribed in a final volume of 40 μl solution containing First-Strand Buffer, dNTPs, dithiothreitol (DTT), RevertAid Enzyme (Fermentas), and Random Decamer Primers . Ten representative genes whose expression levels were remarkably changed in microarray (see Table Data in Table Treatment of eCG-primed rats with low dose of anti-eCG antiserum (1:400 dilution) failed to significantly decrease paired ovarian weight and fertilization rates when compared with those in eCG plus pre-immune serum-treated group , while those involved in the control of protein phosphorylation and signal transduction were Lox, Pdia5 and Pdia6, golgi autoantigen and cell division cycle 2-like 5. The genes having a role in microtubule cytoskeleton organization and movement include CD83 antigen, Tnrc6, Goliath, vesicle-associated membrane protein 8 than that in poor oocyte developmental competence group, consistently in both gene microarray and quantitative RT-PCR analyses. The fold change from microarray and that from RT-PCR exhibit excellent concordance, with Pearson correlation equal to 0.94 (p < 0.0001). However, only Lox was statistically significantly different between the two groups , extracted RNA and prepared manuscript. HX analyzed gene array data and was assisted by XX. MC performed real-time RT-PCR. MAS assisted in experimental design. BKT involved in designing this study and developing the manuscript. All authors have read and approved the final manuscript.http://www.ohri.ca/oocyte funded under the Healthy Gametes and Great Embryos Strategic Initiative of the Canadian Institutes of Health Research (CIHR) Institute of Human Development, Child and Youth Health (IHDCYH), grant number HGG62293. J.Y.J. and M.C. are recipients of CIHR-STIRRHS Postdoctoral Fellowships.This work was supported in part by a grant from the Canadian Institutes of Health Research (MOP-10369) and by the World Class University (WCU) program (R31-10056) through the National Research Foundation of Korea funded by the Ministry of Education, Science and Technology. In addition, the studies described were part of the Program on Oocyte Health |
Bacillus Calmette-Guérin is used as a treatment method in superficial bladder cancer. While it is generally well tolerated, serious side effects may develop. Granulomatous hepatitis cases have been previously reported; however, only one case with tuberculous peritonitis exists in the current literature. We hereby present two cases, one of which is the second tubercular peritonitis case following Bacillus Calmette-Guérin treatment to be reported, and the other a case with granulomatous hepatitis. Complete cure was achieved in both cases with specific therapy. In the patient who developed peritonitis, intravesical Bacillus Calmette-Guérin therapy was recommenced after antituberculosis treatment, and completed without further complications.Intravesical administration of Bacillus Calmette-Guérin (BCG) was introduced to intravesical use in high-risk superficial bladder cancer by Morales et al. in 1976 [et al. described a 3% and Lamm et al. around 0.7% incidence of BCG-related granulomatous hepatitis [ in 1976 . Local s in 1976 . Various in 1976 , hemolyt in 1976 ,6, isola in 1976 ,9, perit in 1976 , pancyto in 1976 , and dif in 1976 have alsepatitis . There eepatitis and onlyepatitis . To the 125: 625 IU/ml (N: <35). Viral markers and autoantibodies were negative. Examination of the ascites fluid showed predominantly lymphocytes and benign mesothelial cells, with an absence of atypical cells. Glucose content was 88 mg/dl, total protein was 5.3 g/dl and albumin was 2.4 g/dl. Bacteria or acid-resistant bacilli were absent in microbiological investigation; culture and PCR assessments were negative. Adenosine deaminase (ADA) was 180 IU/L (N: 0–40). There was no pathology in the abdominal ultrasonography aside from the liver being at the upper limit of physiologically normal dimensions. Presence of BCG treatment history, >80% lymphocyte in ascites fluid, ADA> 70 IU/L and high CA-125 levels and exclusion of other possible conditions for differential diagnosis by further examinations led us to begin anti-TB treatment without delay due to the lack of any other explanation for the findings.A 35-years-old female patient of bladder cancer was admitted to the hospital for the second intravesical BCG administration 15 days after the first dose. She had had sudden-onset abdominal distention and pain for the last two days. The second dose of BCG to had already been postponed for a week previously due to presence of hematuria. The hematuria was considered to be secondary to the tumor since there was no biopsy or surgical intervention history in the last 30 days as well as no finding of an infection. Transurethral bladder tumor resection and biopsy were performed 1 month before. Medical history did not reveal previous TB, liver disease, or drug use. The only finding upon physical examination was extensive ascites. Laboratory tests showed aspartate aminotransferase (AST) 49 U/L : 5–34), alanine aminotransferase (ALT) 57 IU/L (N: 0–55), GGT: 105 (N: 9–64) IU/L, sedimentation 42 mm/h, CRP: 12 mg/dL (N: 0–5), and CA-125 was 161 U/ml on day 15. At month three, physical examination findings and all laboratory parameters were within normal limits. Ten months after the discontinuation of therapy, BCG administration was completed to 6 doses, and there was no pathology at follow-up 2 years later.The patient was placed under treatment with three-agent therapy for two months and dual-agent therapy for seven months. Totally the anti-TB treatment was maintained for 9 months. AST, ALT, GGT returned to normal levels; CA-This 46-year old male patient presented with complaints of fatigue, fever and nausea following the fifth dose of intravesical BCG administration. Medical history revealed no liver disease or drug use. Pathological physical examination findings were fever (38.4°C), hypotension (85/60 mmHg), and hepatomegaly (4 cm). Laboratory tests revealed CRP: 20 mg/dL, sedimentation: 79 mm/h, AST: 137 U/L, ALT: 121 IU/L, GGT: 245 IU/L. Autoantibodies, viral markers, hemogram, and other parameters were normal. Blood culture, urine culture and PCR were negative. Liver biopsy histology showed noncaseating granulomatous hepatitis with Langhans giant cells; acid-fast bacilli stain was negative and specifity (100%) were very high in previous studies [125 levels in patients with TB peritonitis are as high as ovarian cancers associated with peritoneal infiltration. Serum CA-125 levels fall between normal ranges after treatment and considered as a useful marker in the diagnosis and follow-up of patients with TB peritonitis [The clinical symptoms of an ordinary TB peritonitis comprise 95% abdominal pain, 92% ascites and 82% abdominal distention, and culture tests are usually negative. Only three of 39 cases with TB peritonitis in the absence of BCG administration were culture-positive . The cul studies ,24. Seruitonitis . The diaitonitis . TB periitonitis and theritonitis . In the itonitis . In our et al. reported the incidence of serious side effects as 3%. Asymptomatic granulomas may emerge 4 to 40 months after BCG administration, while symptomatic hepatitis becomes apparent in the first few months. In the study by Steg et al., four cases with BCG-related hepatitis were detected after several administrations, but one case was discovered 6 months after the completion of a two-year maintenance therapy [et al. detected mycobacterial DNA in the liver tissue of a case with granulomatous hepatitis for the first time [The incidence of BCG-related granulomatous hepatitis was 0.7% in a large series consisting of 2602 patients . A later therapy . Liver b therapy . Leebeekrst time . Howeverrst time . Similarrst time ,30,33.M. bovis are resistant [The development of BCG-related granulomatous hepatitis is alleged to be a hypersensitivity reaction to the protein fraction of BCG . Granuloesistant . While sesistant . On the esistant ,37.Even in the absence of traumatic administration, patients should be monitored for side effects during BCG treatment. Liver function tests must be monitored during BCG treatment. BCG-related granulomatous hepatitis should be considered in cases of abnormal liver function tests and persistent fever following BCG therapy. In cases with an appropriate clinical presentation, negative culture tests should not be a cause for treatment delay. It should be remembered that early treatment improves the chance of success.ALT: alanine aminotransferase; AST: aspartate aminotransferase; BCG: Bacillus Calmette-Guérin; H&E: haematoxylin and eosin; TB: tuberculosis; ADA: adenosine deaminase.The authors declare that they have no competing interests.AS planned and coordinated the study, and prepared manuscript; ATI was involved in data entry; HP, NY and AC were involved in literature search; SÖ prepared and stained specimens, and evaluated specimens; AIT was involved in urological treatment and follow-up of the patient. All authors read and approved the final manuscript. |
The octahedrally coordinated CoII atoms are bridged by two chelating acetylacetonate (acac) ligands and two more electron-poor 1,1,1,5,5,5-hexafluoropentane-2,4-dionato (hfac) ligands are bonded terminally in a solely chelating manner. The coordinated water molecules form intermolecular O—H⋯O hydrogen bonds with electron-rich acac O atoms of neighboring molecules, leading to strings of molecules along the a axis.The title complex, [Co DOI: 10.1107/S1600536809044389/lx2118Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials: |
The majority of the identified sequences are 21 or 22 nucleotides in length. Despite the range of sequence lengths for different miRNAs, individual miRNAs were thought to have a specific sequence of a particular length. A recent report describing a longer variant of a previously identified miRNA in Arabidopsis thaliana prompted this investigation for variations in the length of other miRNAs.Micro(mi)RNAs are short RNA sequences, ranging from 16 to 35 nucleotides (miRBase; A. thaliana miRNAs recorded in miRBase V.14 have stable miRNA isoforms that are one or two nucleotides longer than their respective recorded miRNA. Further, we demonstrate that miRNA isoforms are co-expressed and often show differential argonaute complex association. We postulate that these extensions are caused by differential cleavage of the parent precursor miRNA.In this paper, we demonstrate that a fifth of annotated A. thaliana miRNAs reveals that miRNA length isoforms are relatively common. This finding not only has implications for miRBase and miRNA annotation, but also extends to miRNA validation experiments and miRNA localization studies. Further, we predict that miRNA isoforms are present in other plant species also.Our systematic analysis of Micro(mi)RNAs are important for gene regulation and for Arabidopsis thaliana, in which ath-MIR168 is processed as miRNAs of 21 and 22 nucleotides in length from its two genomic loci. Vaucheret demonstrated that reducing the amount of 21 nt miRNA greatly reduces homeostasis and leads to developmental defects of the plant, especially in environmentally challenging conditions [http://www.mirbase.org/ are between 16 and 35 nucleotides in length [A. thaliana, of which 7%, 79%, 11% and 3% are 20, 21, 22 and 24 nt in length, respectively. The reason and function for this heterogeneity is unclear and we are unaware of any systematic investigation into non-uniform length distributions of individual miRNAs. Each annotated miRNA in miRBase is a single defined sequence, and there are no details on the possibility of variable sequence length. Sequence length variation may have been overlooked previously, as small variations in the sequence length might not have been thought to alter the function of individual miRNAs, as they are directed to their targets by base pairing.The biological significance of sequence length heterogeneity has been recently identified for a mature miRNA in nditions . In genen length . In miRBA. thaliana, in which the identity of the first 5' nucleotide of the miRNA is the major determinant for AGO protein association [A. thaliana AGO complexes [Recent reports show however, that alterations in miRNA length can potentially lead to dramatic effects on miRNA function in organisms such as ociation ,14. Sequomplexes ,14,15. Oomplexes -19, wheromplexes ,21.A. thaliana small RNA datasets collected by pyrophosphate and Solexa/Iillumina http://www.illumina.com sequencing techniques. The approach of analyzing small RNA sequencing datasets has previously proven successful for the identification of post-transcriptional modifications in small RNAs [A. thaliana (miRBase V.14) for 5' extensions of one to three nucleotides based on nucleotides present in the pre-miRNA hairpin.To investigate the frequency with which additional nucleotides on the 5' ends of miRNAs are observed, we queried several published all RNAs -25. UsinThe datasets investigated were from three small RNA sequencing studies including a small RNA transcriptome that responds to changing phosphate levels , an RNA in silico northern blot analysis, we queried each dataset mentioned above with each miRNA sequence for A. thaliana listed in miRBase V.14. In addition to the recorded mature miRNA sequence, we extended each mature miRNA at the 5' by 1, 2 and three nucleotide(s) according to the hairpin sequence of the miRNA. To our surprise, numerous miRNAs encompass a 5' single nucleotide extension (SNE) compared with the recorded mature miRNA; for example, ath-MIR156h. The SNE of ath-MIR156h is an additional 5' uridine/uracil (U) that is not reported in the annotated mature miRNA sequence [For our sequence ,28,29, bA. thaliana miRNAs predicts that ath-MIR156h should be mostly present in AGO1-RISC complexes, as the miRNA possesses a 5' U nucleotide. As predicted, over half of ath-MIR156h miRNAs reside in AGO1 complexes (54%), whereas the remainder are split into AGO5 (31%) and AGO4 (15%) effector complexes. No association with AGO2 was found. However, in addition to a 10-fold increased frequency of detection, ath-MIR156h+1 was detected almost exclusively in AGO5 complexes (84.1%), with few sequences detected in AGO1 (8%) and AGO4 (7%) datasets . Conversely, there was a negligible occurrence of the +1 miRNA. There are two possible explanations for this exclusive occurrence of ath-MIR775 and ath-MIR775+2. Cleavage events generating the mature miRNAs might generate the two variable length miRNAs forms (0 and +2) exclusively. Alternatively, all three lengths might be generated, but with only the 0 and +2 forms being stabilized and protected from degradation.Analysis of the AGO associations of ath-MIR775 and ath-MIR755+2 revealed a difference in the identity of preferential AGO association. In more than 95% of results, the ath-MIR775 sequence was found to be associated with AGO1, whereas the ath-MIR775+2 variant was associated with AGO5 in nearly 70% of cases form of ath-miR168 [In addition to our presented h-miR168 . In addih-miR168 .A. thaliana. Our results expand the previous genetic evidence of variability in miRNA sequence length [A. thaliana have additional nucleotide(s) on their 5' ends. These 5' extended miRNAs are not simply misannotated, as both longer and shorter forms of the miRNAs co-exist. Additionally, we provide evidence that the 5' end variations can result in changes in the type of AGOs with which these miRNA isoforms preferentially associate. Differences in AGO associations suggest alterations in the biological functioning of the different observed forms of these miRNAs. These variable length miRNAs could essentially be considered miRNA isoforms and should be included in any annotation of miRNAs.We have presented evidence arising from several small RNA sequencing experiments that supports the co-existence of mature miRNAs and their 5' extended forms in e length by reveahttp://www.bioinformatics.org/ebbie. The output file in FASTA format was used for an in silico northern blot, which probed all computer-generated small RNA sequences in various datasets (GEO:GSE17741 [Ebbie-(mis)match-AGO v1 [Ebbie-(mis)match-AGO v2. Computation was performed on an IBM system .A Perl script mapped each mature miRNA to their respective hairpin, recorded the hairpin sequence, then appended one, two or three nucleotide(s) to the 5' of the mature miRNA. For miRNA, the Perl script recorded five sequences: hairpin, mature miRNA, +1 miRNA, +2 miRNA and +3 miRNA. All * sequences were ignored and not used for analysis. Scripts are available online under GPLV.2 GSE17741 , GEO:GSEGSE17741 and ath-GSE17741 ) using ah-AGO v1 script. h-AGO v1 using EbThe authors declare that they have no competing interests.HAE designed experiments and analyzed data. AF wrote the Perl scripts. HAE and RPF wrote the manuscript. All authors read and approved the final manuscript.Validation of computer-generated miRNA isoforms. An in silico northern blot was performed of all computer-generated miRNA isoforms by scanning seven different datasets for the expression of each in silico miRNA isoform.Click here for fileValidated miRNA isoforms and their AGO association. All validated miRNA isoforms from Additional file Click here for file |
In those patients who received sequential immunotherapy, each cycle of chemotherapy was followed by outpatient s.c. IL-2 and s.c. IFN-α . The overall response rate of patients treated with the combination of chemotherapy and IL-2/IFN-α was 34.3% with seven complete responses (10.9%) and 15 partial responses (23.4%). In patients treated with chemotherapy, only, the overall response rate was 29.9% with eight complete responses (13.3%) and 10 partial responses (16.6%). There was no significant difference in median progression free survival (0 months vs 4 months) and in median overall survival (12 months vs 13 months) for combined chemoimmunotherapy and for chemotherapy, respectively.The purpose of this randomized trial was to evaluate the efficacy of combination chemoimmunotherapy compared with chemotherapy alone. A total of 124 patients were randomized to receive intravenous cisplatin 86, 179–184. DOI: 10.1038/sj/bjc/6600043www.bjcancer.comThe Cancer Research Campaign© 2002 Metastatic melanoma responds poorly to the currently available chemotherapeutic agents and, until today, no standard treatment has been established. Most single agent chemotherapeutics provide only low response rates. Dacarbazine (DTIC), the most active single agent in the treatment of melanoma, can be expected to yield a response rate of about 20% . Even thRecently, several trials have investigated the combination of various cytotoxic agents with IL-2 and IFN-α. While primarily in phase II studies several authors claimed a clear advantage of this chemoimmunotherapy over chemotherapy alone , carmustine , dacarbacine and oral tamoxifen in combination with (n=64) or without (n=60) subcutaneous IL-2 and IFN-α. In those patients, who were randomized to receive chemoimmunotherapy, each cycle of chemotherapy was followed by outpatient immunotherapy with combined IL-2 and IFN-α ; randomization was performed centrally. Five week treatment cycles were repeated unless progression of disease occurred. Re-evaluation of the patients' tumour status was performed between treatment cycles. Patients received an average of 2.7 and 1.9 treatment cycles.All patients received a chemotherapy regimen comprising cisplatin criteria with regular re-evaluation intervals every 8 weeks; all repeated scans were reported to the data center: complete response – disappearance of all signs of disease for a minimum of 8 weeks; partial response – 50% or more reduction in the sum of products of the greatest perpendicular diameters of measurable lesions, no increase in lesion size and no new lesions; stable disease – less than a partial response with no disease progression for at least 8 weeks; progressive disease – 25% or more increase in sum of products in the longest perpendicular diameters of measurable lesions or the development of new lesions. Duration of response was measured from the initial date of response. Two patients were randomized, but did not receive therapy and were evaluated as progressive disease patients. Treatment efficacy was assessed on intent-to-treat basis.Survival was measured from start of therapy to date of death or to the last known date to be alive. The statistical end points in our analysis were (1) objective response and (2) overall and progression free survival of patients. The progression free survival after 1 year was assumed to be 40% (chemoimmunotherapy) and 20% (chemotherapy), respectively. The intention was to find a chemoimmunotherapy induced progression free survival benefit over chemotherapy alone at 20% with a probability of 95% (α=0.05) and a sample power of 1-ß=0.80. Based on this assumption an intended patient accrual of 64 patients per therapy arm was required in case of a statistically significant survival benefit after combined chemoimmunotherapy. The probability of overall survival was plotted over time according to the method of Kaplan and Meier. Statistical significance was assessed using the Log Rank, Tarone Ware and the Breslow test; SPSS software was employed.n=64) or chemotherapy alone (n=60) . PatientResponse to therapy was evaluated according to World Health Organization (WHO) criteria with regular reevaluation intervals every 8 weeks.Seven patients (10.9%) treated with chemoimmunotherapy achieved a complete response and 15 patients (23.4%) had a partial remission with eight patients (13.3%) achieving a complete response and 10 patients (16.6%) a partial remission . There was no significant difference in median overall survival for combined chemoimmunotherapy (12 months) and for chemotherapy (13 months), respectively , while in the chemotherapy group a median survival of 24 months was achieved (data not shown).P<0.0001) difference in overall survival for all patients with liver metastases with a median survival of 9 months (chemoimmunotherapy) and 8 months (chemotherapy) as opposed to patients without liver metastases with a median survival of 20 months (chemoimmunotherapy) and 17 months (chemotherapy), respectively for all patients entered into the study. There was no significant difference in median progression free survival between patients treated with chemoimmunotherapy or with chemotherapy and 5 months in patients without liver metastases (data not shown).Chemotherapy led to significant haematotoxicity with WHO grade IV thrombocytopenia in 25% and leukopenia in approximately 26% of treatment cycles, respectively. Immunotherapy related side effects included WHO grade III and IV malaise in 21%, anorexia in 21%, chills in 8%, diarrhoea in 5% and fevers in less than 25% of treatment cycles, respectively (data not shown).Overall, no life threatening toxicities were observed, and no toxic deaths occurred. Generally, immunotherapy could be administered in the outpatient setting. Chemotherapy required inpatient stays of 4 days per cycle.In the present prospective randomized trial we reported the results of 124 patients with progressive metastatic melanoma who received a combined chemoimmunotherapy or a chemotherapy alone. We observed an overall objective response in 34.3% of patients treated with the combined chemoimmunotherapy which is comparable with earlier trials achieving response rates between 23% to 64% and chemotherapy (median 13 months), respectively, which is also supported by recent results of other cytokine based therapy regimens (The discrepancy in the effect of cytokines in metastatic melanoma therapies might be best explained by the following uncontrolled variables: (A) patient selection and clinical/biological risk; (B) variations in the rIL-2 based regimen ; and (C) different standards of patient care . In fact, previous reports have repeatedly shown that overall survival is higly risk-dependent long term (>48 months) surviving patients in the chemoimmunotherapy combination, only. Similar results were reported when comparing dacarbazine/INF- with or without IL-2. Since cytokines in chemotherapies also alter the toxicity profile (While median duration of objective responses appeared to be prolonged in patients receiving chemotherapy only, overall survival analysis yielded few ( |
Heme oxygenase-1 (HO-1) catalizes heme degradation, and is considered one of the most sensitive indicators of cellular stress. Previous work in human fibroblasts has shown that HO-1 expression is induced by NO, and that transcriptional induction is only partially responsible; instead, the HO-1 mRNA half-life is substantially increased in response to NO. The mechanism of this stabilization remains unknown.2, NaAsO2 or H2O2 increased the half-life only up to 5 h. Although poly(A) tail shortening can be rate-limiting in mRNA degradation, the HO-1 mRNA deadenylation rate in NO-treated cells was ~65% of that in untreated controls. In untreated cells, HO-1 poly(A) removal proceeded until 30–50 nt remained, followed by rapid mRNA decay. In NO-treated cells, HO-1 deadenylation stopped with the mRNA retaining poly(A) tails 30–50 nt long. We hypothesize that NO treatment stops poly(A) tail shortening at the critical 30- to 50-nt length. This is not a general mechanism for the post-transcriptional regulation of HO-1 mRNA. Methyl methane sulfonate also stabilized HO-1 mRNA, but that was associated with an 8-fold decrease in the deadenylation rate compared to that of untreated cells. Another HO-1 inducer, CdCl2, caused a strong increase in the mRNA level without affecting the HO-1 mRNA half-life.In NIH3T3 murine fibroblasts, NO exposure increased the half-life of the HO-1 transcript from ~1.6 h to 11 h, while treatments with CdClThe regulation of HO-1 mRNA levels in response to cellular stress can be induced by transcriptional and different post-transcriptional events that act independently, and vary depending on the stress inducer. While NO appears to stabilize HO-1 mRNA by preventing the final steps of deadenylation, methyl methane sulfonate achieves stabilization through the regulation of earlier stages of deadenylation. BD mentored this work, and participated in its design and coordination, and final revisions of the manuscript. Both authors read and approved the final manuscript.HO-1 mRNA stabilization and loss of cell proliferation in response to GSNO. A. NIH3T3 cells were treated with increasing concentrations of GSNO for 6 h, followed by the addition of AD and monitoring the concentrations of HO-1 mRNA at the indicated times. The graph shows the fitted decay lines calculated from two independent experiments. Data points show the mean and standard errors. B. The same doses as for panel A were used to determine the effect of GSNO on cell viability, expressed as percentage of trypan blue-negative cells, compared to 100% at time 0 h for untreated controls. The graph shows the mean and standard error of two independent experiments.Click here for fileMapping the transcription start site of HO-1. A. NIH3T3 cells were treated as controls or with 0.5 mM SPER/NO for 1 h. Total RNA was extracted and used as a template for a primer extension reaction using primer m6, as described in the Methods section. Products were separated by denaturing polyacrylamide electrophoresis and detected by northern blotting. The site of transcription initiation is indicated by an arrow. Chain termination DNA sequencing reactions with primer m6 were electrophoresed in parallel with the primer extension products to identify their size (left 4 lanes). B. The transcript sequence corresponds to the brackets in panel A. The transcription start site is indicated with an asterisk (*).Click here for file>30) HO-1 mRNA from NO-treated cellsRecovery of polyadenylated were subjected to RNase H treatment in the absence or presence of oligo(dT), which generates fully deadenylated HO-1 mRNA. RNA from these reactions was affinity purified on oligo(dT) Sepharose from the MicroPoly(A)Purist kit . Polyadenylated and deadenylated samples were recovered before and after purification, and products were analyzed by northern blotting. B. NIH3T3 cells were treated as controls or with SPER/NO for 1 h. Total RNA (40 μg from controls and 10 μg from NO-treated samples) was affinity purified using oligo(dT) Sepharose. Recovered samples were analyzed by northern blotting using the full-length HO-1 cDNA as a probe, or a GAPDH probe to normalize for loading differences. Results are representative of two independent experiments.Click here for file |
In contrast, highly selective thresholds (p < 10− 4 to 10− 6) yielded the lowest consistency values with less than 25% overlap of the voxels active in both scans. In other words, intra-subject variability was surprisingly high, with between one third and three quarters of the voxels in a given fROI not corresponding to those activated in the main task. This level of variability stands in striking contrast to the consistency seen in retinotopically-defined areas and has important implications for designing robust but efficient functional localiser scans.A critical assumption underlying the use of functional localiser scans is that the voxels identified as the functional region-of-interest (fROI) are essentially the same as those activated by the main experimental manipulation. Intra-subject variability in the location of the fROI violates this assumption, reducing the sensitivity of the analysis and biasing the results. Here we investigated consistency and variability in fROIs in a set of 45 volunteers. They performed two functional localiser scans to identify word- and object-sensitive regions of ventral and lateral occipito-temporal cortex, respectively. In the main analyses, fROIs were defined as the category-selective voxels in each region and consistency was measured as the spatial overlap between scans. Consistency was greatest when minimally selective thresholds were used to define “active” voxels ( In choosing a localizer to define an ROI, the researcher is making an ontological assumption that this localizer contrast picks out a meaningful functional unit in the brain . Like other ontological assumptions in science, the utility of a particular functionally defined ROI is determined by the consistency of the data that emerge from it and the richness of the theoretical progress those data support.Increasingly, functional neuroimaging studies are moving away from traditional brain mapping studies designed to identify the cortical topography of a function (Ψ) and towards designs that investigate the response properties of specific neuroanatomical regions. This approach requires a robust method for identifying the region under investigation, however, macro-anatomic landmarks are not especially good predictors of functionally homogenous cortical fields . The earAlthough there is some debate regarding the most efficient method for doing this , relativt-value across runs. They did not, however, report the consistency of the activation itself, which is important because most studies that use functional data to identify a region-of-interest define it based on the cluster of voxels within a given anatomical area activated by a particular contrast , scenes in the parahippocampal place area (PPA), and body parts in the extrastriate body area (EBA) . They focontrast . One stucontrast , suggestn = 45). To empirically evaluate the assumption that functional localisation of category-sensitive cortical regions is robust and consistent, we calculated three different measures of consistency between two functional localiser runs: (1) the distance between peak voxels in the two runs; (2) the amount of spatial overlap in activations and (3) the amount of overlap in contiguously activated voxels within a spherical ROI centred on the peak voxel. The results illustrate considerable within-subject variability in the localisation of the two fROIs and call into question the validity of a key assumption underlying typical functional localiser scans.Here we had the opportunity to evaluate consistency and variability associated with functionally localising reading- and object-sensitive areas of left occipito-temporal cortex (OTC). As part of an on-going series of TMS studies, we used fMRI to localise a region of the ventral OTC associated with visual word recognition and a la45 healthy, monolingual English speakers participated in an fMRI study as part of a neuro-navigated TMS study . Their aIn order to investigate intra- and inter-subject consistency for reading and object sensitivity in ventral and lateral OTC respectively, a one-back task was used with four categories of visual stimuli: written words, pictures of common objects, scrambled pictures of the same objects, and consonant letter strings . Subjectn = 168) were obtained from the MRC psycholinguistic database for anatomically localising activations in individuals.Whole-brain imaging was performed on a Siemens 1.5 T MR scanner at the Birkbeck-UCL Neuroimaging (BUCNI) Centre in London. The functional data were acquired with a gradient-echo EPI sequence giving a notional resolution of 3 × 3 × 3 mm. Each run consisted of 164 volumes and as a result, the two runs together took 16.4 min. In addition, a high-resolution anatomical scan was acquired . To allow for T1 equilibrium, the initial two images of each run were discarded. The data were then realigned to remove small head movements , and medial parts of the inferior temporal gyrus (ITG) — areas consistently activated by visual word recognition tasks . The starm area” , althougrm area” . The latrm area” . The stalgorithm .n = 39) were analysed using signal detection theory as hits and false alarms. The mean hit rate was 0.791 and the false alarm rate was 0.011, indicating that participants performed the task adequately = 77.9, p < 0.0001) indicated that detecting repetitions of scrambled objects was most difficult, but there was no difference between words or objects (t(38) = 0.05, p = 0.961). Importantly, neither the main effect of Run = 0.494, p = 0.486) nor the Category × Run interaction = 1.665, p = 0.179) was significant, indicating that participants' performance did not significantly change from the first to the second run. The same pattern was present in the reaction times to correct detections (i.e. “hits”). Again, there was a main effect of Category = 5.4, p = 0.002) but no main effect of Run = 0.09, p = 0.765) and no Category × Run interaction = 1.169, p = 0.325). In other words, there was no behavioural evidence for task learning that might confound the activation patterns across runs.Behavioural data from six subjects were lost due to a problem recording button press responses while in the scanner. The data from the remaining subjects (tely see . In additely see . These wZ = 7.7), extending both medially onto the convexity of the posterior fusiform gyrus and laterally onto the inferior temporal gyrus. To visualize this activation, the group results were projected onto an inflated surface of an “average” brain (i.e. Freesurfer's fsaverage subject) to illustrate that activation was not limited to the ventral surface but also present inside the occipito-temporal sulcus , although once again, there was a comparable activation for words . Note that the sharp demarcations between gyri and sulci do not accurately reflect the anatomical variability present in the group; instead the figure illustrates the spatial distribution of peaks relative to a single “average” brain. Consequently, the specific anatomical location of each peak was assessed relative to that individual's structural scan in standard space. The greatest consistency is in the medial-lateral direction, with the majority of peaks (n = 20) falling within the occipito-temporal sulcus. Another 18 were located on the crest of the posterior fusiform gyrus and 7 were in on the crest of the inferior temporal gyrus. In contrast, the largest variation was in the rostro-caudal direction while the variation in z-axis is mostly due to the depth of the OTS. On average, the Euclidean distance from an individual subject's peak to the group peak was 15 mm (± 5 mm).To assess how closely activation from individuals matched the group results, their peak responses for words and objects were compared to the group results. For words, all 45 participants showed a peak response within ventral OTC with a iderably . The lefZ-scores of 2.7 or higher and these are illustrated in the right panel of n = 26) and the remaining ones were located in posterior fusiform cortex (n = 19). Unlike the reading peaks, these were spread more evenly around group peak and on average, the Euclidean distance from an individual subject's peak to the group peak was 9 mm (± 3 mm).There was slightly less variability in the peak coordinates for objects within lateral OTC. Once again, all 45 participants showed a clear peak in the ROI with n = 17; objects: n = 11) however many subjects had peaks more than 4 voxels (> 12 mm) apart . The coordinates of the peak depend on many factors, however, and only one is the size of the underlying neurophysiological response. Therefore, peak locations are highly susceptible to random fluctuations of commonly activated voxels to the total number of activated voxels in two runs, i and j:Vij is the number of voxels within the ROI which were active in both runs i and j; and Vi and Vj are the number of voxels within the ROI that were active in runs i and j, respectively. A value of 1.0 indicates identical sets of voxels while 0.0 represents completely disjoint sets. This definition, however, treats voxels as “active” or not based on an essentially arbitrary threshold. To avoid conditioning the results by an arbitrary choice, five thresholds were used spanning a typical range: i) Z > 1.64 (p < 0.05 uncorrected), ii) Z > 2.3 (p < 0.01 uncorrected) iii) Z > 3.09 (p < 0.001 uncorrected), and iv) Z > 4.0, and v) Z > 5.0 . Mean (± SEM) consistency ratios were similar in both ventral and lateral OTC regions with the highest values (0.64 ± 0.03 and 0.60 ± 0.04) for the lowest statistical threshold the mean consistency scores were 0.30 ± 0.05 and 0.21 ± 0.05, respectively. In addition, higher thresholds meant fewer subjects with significantly activated voxels. For instance, at the most conservative threshold it was impossible to identify an fROI for words or objects in 8 and 18 (out of 45) participants, respectively. In sum, overlap scores were surprisingly low with more conservative statistical thresholds yielding even less overlap and fewer subjects in which an fROI could be defined.The most common method for defining an fROI is based on the volume of activated voxels within a particular region . Consequhreshold A. RaisinRij) was 0.50 (SEM = 0.05) and for the contrast [objects > scrambled], the mean Rij was 0.45 (SEM = 0.05). Increasing the threshold to Z > 5 reduced the overlap to 0.27 ± 0.05 for words and 0.21 ± 0.06 for objects and precluded identifying an fROI in 8 and 18 of the participants.Finally, it is possible to combine peak and volume measures to define an fROI as the set of active voxels that are contiguous with the peak activation . This apwithin subjects. The current findings suggest that this consistency was surprisingly poor, regardless of the specific method used to evaluate consistency:1.Peak voxels. Roughly 33% of our participants had peaks at essentially the same location in both localiser runs whereas another 27% had peaks that were at least 12 mm apart. The remainder fell within those two extremes. In other words, for one quarter of the subjects tested here, an fROI based on the peak voxel response may not even overlap with the activation seen in the main experimental task.2.Spatial overlap. The most commonly used method for defining an fROI is to select the voxels within a region activated by a given contrast. Clearly this depends critically on the definition of “active voxels” and this varies from study to study. Over a wide range of activation thresholds (p < 0.05 to p < 10− 6), consistency scores were surprisingly low, ranging from 64% to 21%, respectively. The most lenient definition of “active” voxels produced the greatest consistency across runs, but even so, roughly one third of the data from the fROI are coming from noisy or unreliable voxels. Equally problematic is the fact that lenient statistical thresholds lead to only minimal category-selectivity in the ROI (p < 10− 3 to 10− 6) are more common but yield very low consistency values, with less than half of the voxels present in both runs. As a result, the majority of the data being investigated comes from unreliable voxels. the ROI . Conserv3.Peak plus spatial extent. In theory, combining the first two methods has the advantage that small displacements of the peak voxel do not necessarily change the fROI, assuming they fall within a common cluster of active voxels. In practice, the results were qualitatively and quantitatively similar to the previous method because of the small numbers of active voxels common to both runs.The aim of this study was to evaluate the consistency associated with functionally localising reading- and object-sensitive areas of left occipito-temporal cortex. At the group level, the current results closely match previous reports with peak activations located in the posterior occipito-temporal sulcus for written words and in tF = 229.3, p < 0.001; objects: F = 192.9, p < 0.001). but there was no main effect of Run < 0.1, p = 0.936; objects F = 1.2, p = 0.287) and no Run × Threshold interaction = 0.3, p = 0.896; objects: F = 0.8, p = 0.520). In other words, task learning did not appear to significantly contribute to the relatively low consistency between runs.One potential explanation for the low levels of overlap between runs is that participants may acclimate to the task and therefore show less activation in their second run. There was, however, no evidence of task learning in the behavioural data. This was also true for the imaging data where we analysed the number of active voxels per contrast with Run and Threshold as independent factors. Predictably there was a main effect of Threshold on the number of active voxels for both contrasts . One striking difference between retinotopic vs. category-sensitive localisers is the amount of data typically collected. Studies of retinotopy often collect an order of magnitude more data see . For insIn short, these findings call into question the reliability of functional localisers to identify a meaningful and consistent set of category-sensitive voxels. One of the prime motivations for using functional localisers is to maximize sensitivity by explicitly accounting for inter-subject variability in the location of a functionally defined region . Our resFinally, our results also have important implications for TMS studies. There are several options when choosing a method for targeting stimulation, including using fMRI-based neuro-navigation, using standard space coordinates from published imaging studies, or using heuristic methods such as the 10–20 system. Recent empirical studies have shown that although all three methods work, the latter two are sub-optimal, requiring higher stimulation intensities and/or larger numbers of subjects . This isThe current findings demonstrate surprisingly low intra-subject consistency when functionally localising word- and object-sensitive regions of occipito-temporal cortex but also highlight considerations for designing and reporting studies using functional localisers. The most obvious is simply optimising data collection wherever possible. Collecting larger quantities of localiser data, reducing sources of variability , and opt |
Antenatal education (AE) started more than 30 years ago with the purpose of decreasing pain during childbirth. Epidural anaesthesia has achieved this objective, and the value of AE is therefore currently questioned. This article describes the protocol and process of a study designed to assess AE results today.A prospective study was designed in which a cohort of 616 nulliparous pregnant women attending midwife offices of the Basque Health Service were followed for 13 months. Three exposure groups were considered based on the number of AE sessions attended: (a) women attending no session, (b) women attending 1 to 4, and (c) women attending 5 or more sessions. Sociodemographic, personality, and outcome variables related to childbirth and breastfeeding were measured.It was expected 40% of pregnant women not to have participated in any AE session. However, 93% had attended at least one session. This low exposure variability decreased statistical power of the study as compared to the initially planned power. Despite this, there was a greater than 80% power for detecting as significant differences between exposure groups of, for instance, 10% in continuation of breastfeeding at one and a half months and in visits for false labour. Women attending more sessions were seen to have a mean higher age and educational level, and to belong to a higher socioeconomic group (p < 0.01). Follow-up was completed in 99% of participants.Adequate prior estimation of variability in the exposure under study is essential for designing cohort studies. Sociodemographic characteristics may play a confounding role in studies assessing AE and should be controlled in design and analyses. Quality control during the study process and continued collaboration from both public system midwives and eligible pregnant women resulted in a negligible loss rate. There are currently serious doubts about the value of antenatal education (AE) in childbirth outcome and start of breastfeeding ,2. The cAE is associated to shorter dilation and expulsion periods -6, a decThe purpose of this research protocol was to assess the effect of attendance to AE sessions on childbirth outcome and on the start and continuation of breastfeeding during the first year.This research project will promote understanding of the effect of AE within the current reference context and will allow for improving AE by adapting it to the current needs of pregnant women.A prospective, observational, longitudinal study was designed to follow up a cohort of pregnant women from the Biscay health area attending midwife offices of the public Basque Health Service/Osakidetza, in order to assess the effect of AE exposure on childbirth and breastfeeding. The project was approved by the Committee for Primary Care Research of the Basque Health Service/Osakidetza.Thirty-four centres, 65% of those having primary care midwives within the Basque Health Service/Osakidetza, collaborated in the project. All four districts of the Biscay health area were represented.AE is given in all collaborating primary care centres. This consists of at least 8 sessions where breathing techniques, pushing, and relaxation are practised, and different topics such as labour and delivery, postpartum period, newborn care, and breastfeeding are addressed. This study assumes that, in our area, AE sessions are relatively similar in terms of structure, duration, topics, and body work practised, while recognising that every healthcare professional may make use of his/her specific knowledge and pay special interest to any particular aspect.The two hospitals of the public Basque Health Service having a delivery area collaborated in the study.All nulliparous pregnant women from the Biscay health area aged 18 to 42 years who attended the office of a primary care midwife from week 36 of pregnancy and who did not meet any exclusion criterion women attending no session, (B) women attending 1 to 4 sessions, and (B) women attending 5 or more sessions. Sixty percent of nulliparous pregnant women were expected to attend any AE session, and no AE exposure was expected in the remaining 40%.Potential confounding variables recorded included age, sociodemographic characteristics such as social class, educational level and nationality , and womOutcome variables related to objective childbirth aspects that were measured included: (1) number of visits for false labour (visits to the emergency room in a latent labour stage not leading to admission for labour), (2) duration of dilation stage in minutes, (3) duration of expulsion stage in minutes, (4) cervical dilation in centimetres at the time epidural anaesthesia is administered, (5) type of delivery , (6) presence of episiotomy and/or tear and grade , (7) sexSubjective childbirth variables measured included: (10) degree of anxiety according to the Hospital Anxiety and Depression Scale (HAD) , and (11Breastfeeding variables measured included: (12) early start (within 2 hours of childbirth) and (13) continuation of breastfeeding, either alone or combined with other feeding, at one and a half, three, six, nine, and 12 months of life. Early start of breastfeeding was recorded by hospital midwives and continuation of breastfeeding was recorded through telephone surveys conducted from the Primary Care Research Unit.The estimated sample size was 657 women. Assuming that 40% of these women did not attend AE, this size provided a statistical power greater than 95% for detecting as significant 15% differences in false labour, anaesthesia in latent stage, instrumental deliveries and breastfeeding after one and a half months, and 20% differences in anxiety and episiotomy, and for detecting equivalence in the duration of the dilation and expulsion periods. Alpha error level is less than 5%.The basic analysis will involve the calculation and comparison of proportion of dichotomous outcomes and averages of quantitative results among the cohorts exposed to different levels of AE. Both relative and absolute measures of association with 95% confidence intervals will be calculated and tested by chi-square and t tests The exposure groups will also be compared to detect unbalances with respect to potential confounding variables and characteristics that could be associated with the outcomes under study. To control for the eventual confounding effect of those characteristics, stratified analyses and multivariate statistical models will be used. These models will be linear for continuous outcomes an logistic for dichotomous ones. These same models will be extended to mixed effects models in which the midwife will be included as a random effect to take into consideration the hyerarchical structure of data (pregnant women clustered in the practice of each midwife) and to estimate the particular effect of each of them on the results. To analyse time to discontinuation of breastfeeding, Cox proportional hazards models will be adjusted. All analyses will be performed using EpiInfo (Centers for Disease Control and Prevention -CDC- V. 3.3.2 2005) and SAS softwares.The number of eligible women who refused to participate in the study was very low according to midwives in charge of recruitment, but was not recorded. As shown by the study flowchart Figure , 641 womForty percent of pregnant women were expected not to have participated in any AE session. However, the proportion of pregnant women who did not attend AE did not exceed 7.3% of participants despite prolongation of the recruitment period from 4 to 8 months, while 92.6% of nulliparous pregnant women attended AE. This low exposure variability decreased statistical power of the study as compared to the initially planned power. Despite this, there was a greater than 80% power for detecting as significant differences between exposure groups, as shown in Table Mean age of participants was 31.3 years, virtually all of them are Spanish in nationality (94.3%), and a great majority have a secondary school or university educational level (n = 510). With regard to comparability of exposure groups, sociodemographic characteristics of pregnant women are seen to differ depending on grade of AE exposure. Thus, women attending more sessions (group C) are older (p < 0.01), have a higher educational level (p < 0.01) and socioeconomic level (p < 0.01), and are Spanish in a greater proportion. As to personality characteristics, pregnant women in all three groups are similar in all personality scales weekly recruitment rate: 2 women per week each midwife(b) percent losses during the process: less than 7%(c) proportion of inadequately completed forms: less than 2%When designing cohort studies such as the one reported here, it is very important to adequately anticipate the expected variability in the exposure under study. In this case, the expected variability when the study was designed was greater than the actual variability. As noted above, 40% of pregnant women were not expected to attend AE, but only 7% did not actually attend AE. Study restriction to nulliparous pregnant women markedly decreased the possibility of recruiting women who do not attend AE because of the high demand for this activity among first time mothers. However, such restriction allowed for more clearly delineating the effect of AE by removing the effect of prior birth experiences and antenatal education. This imbalanced variability in AE exposure is a disadvantage also found by other European studies . In our Sociodemographic characteristics of participants were different in the three comparison groups A, B, and C. This suggests a potential confounding role of such characteristics, as they may influence both attendance to AE sessions and the outcome of birth and breastfeeding. These data allow for stating that consideration of sociodemographic characteristics of participants was a good decision, and that they should be controlled in the design and analysis of studies assessing AE.The low loss rate – follow-up was completed in 99% of participants – was made possible by a comprehensive quality control of the whole process. The conduct of the study within the public healthcare system, used in Spain by the vast majority of the population, allowed for a reliable monitoring of pregnant women during pregnancy and the childbirth process, and for use of a preestablished internal communication network between the centres. Both these conditions greatly facilitated follow-up and control of the whole study process, resulting in a negligible loss rate.The authors declare that they have no competing interests.CPP and IAP conceived the idea for the study and they are the guarantors of the article. CPP, IAP, and GG led on the design of the study and obtained financial support. GG supervised field work, data management and statistical analysis. GRFG, IOH contributed to the development of the study protocol and acquired data related to delivery. IAP, ABH and JPG were responsible for the data management, quality control of the study process and contributed to data analysis. GMG and MUP contributed to the development of the study protocol and provided important advice regarding the measurement of personality and breastfeeding, respectively. All authors were responsible for the drafting of this paper, revised critically the article and approved the final version submitted to BMC Nursing.The pre-publication history for this paper can be accessed here: |
A rise in obesity, poor-quality diets, and low physical activity has led to a dramatic increase in the number of Americans with metabolic syndrome and diabetes. Our objective was to determine the effect of a short-term, multifaceted wellness program carried out in a church setting on weight, metabolic syndrome, and self-reported wellness.Forty-one overweight or obese adults in a church congregation provided fasting blood samples and answered a wellness questionnaire before and after completing an 8-week diet and exercise program. We also measured weight, body fat, body mass index, and waist and hip circumference.The intervention decreased weight, body fat, and central adiposity; improved indexes of metabolic syndrome; and increased self-reported wellness.A multifaceted wellness intervention that emphasizes diet and exercise can rapidly influence weight, insulin resistance, metabolic syndrome, and self-reported wellness. During the past 4 decades, the prevalence of obesity in the United States has increased dramatically. If these trends continue, 83% of adults will be overweight or obese by 2030 . ObesityNutrition and physical activity are key lifestyle factors that affect the incidence of obesity, metabolic syndrome, and other diseases. Even modest weight loss improves dyslipidemia, insulin resistance, and estimated 10-year cardiovascular disease risk -7. MilliBecause wellness programs can reduce the cost of health care and generate a substantial return on investment . Pregnant women were excluded because the program involved caloric restriction and moderate to vigorous exercise. Pregnancy was the only exclusion criterion; all other congregants who received permission from their primary care physician and provided written informed consent were allowed to participate. This study was conducted according to approved human studies guidelines and was approved by the institutional review board of Wake Forest University Health Sciences.2) and 46 of whom were overweight or obese (BMI ≥25 kg/m2). Healthy-weight participants did not restrict calories and were excluded from analysis; of the overweight or obese participants, 5 did not participate in the entire intervention and were also excluded from analysis.A total of 59 participants began the program, 13 of whom were healthy weight that described the dietary and exercise recommendations of the program. Participants also attended 2 weekly educational programs in which the scientific rationale behind the recommendations was explained. The dietary recommendations had 5 components:Calorie reduction. Overweight and obese participants were told to reduce calorie intake by 20% from their individual baseline as determined by a predictive equation for resting energy expenditure for the Increased fiber intake. A daily fiber intake of 16 g per 1,000 kcal consumed and a 70:30 insoluble-to-soluble fiber ratio was recommended.trans-resveratrol, anthocyanins, and ellagic acids and green teas high in catechins were recommended. In the final 4 weeks, participants were allowed red wine (4-6 glasses/wk) and dark chocolate (43-99 g/d).Increased polyphenol intake. Fruits and vegetables high in Increased intake of long-chain omega-3 fatty acids. Fatty fish and fish oil supplements were recommended .Increased intake of short-chain omega-6 fatty acids. Borage oil supplements were recommended . These doses and ratios of omega-3 and omega-6 fatty acids were previously determined in our laboratory .Participants were provided with heart rate monitors and were encouraged to exercise at least 30 minutes per day at an appropriate level (50%-75% of maximum heart rate for age during weeks 1-3 and 70%-85% of maximum heart rate for age thereafter). Participants were told to dedicate 3 days per week to aerobic exercise and 2 days for circuit training, which consisted of aerobic warm-up and cool-down combined with weight training designed to work 8 to 10 muscle groups. The intensity of the recommended exercise increased from mostly light at the beginning of the intervention to mostly vigorous by the end. Instructions for specific aerobic workouts and circuit training were described in the program handout. Participants received instruction in performing each exercise at a level appropriate to his or her fitness level during the first weekly exercise session at the church. They were encouraged to purchase resistance bands and hand weights for use in their exercise routines. Exercise was undertaken independently and once weekly at the church.Participants met weekly for body measurements, group exercise sessions at the church, dietary counseling, and group support. This church group took a faith-based approach to mutual support, encouragement, prayer, and striving to make their bodies healthy. Participants kept logs of their food intake and exercise to facilitate lifestyle changes and accountability.At the beginning of the intervention, we collected baseline urine, fasting blood samples, anthropomorphic measurements , blood pressure, and resting heart rate. Thereafter, body fat and BMI were measured at weeks 1, 4, and 8. At the end of the 8-week intervention, all fasting samples and measurements were obtained again. Follow-up anthropomorphic measurements were obtained 5 and 10 weeks after the intervention. In addition to anthropomorphic measurements, 6 surrogate markers of insulin resistance and diabetes — fasting insulin, fasting glucose, homeostatic model assessment of insulin resistance (HOMA) , hemogloThroughout the study, the same person performed waist and hip measurements. Weight, body fat, and BMI were measured by using a Tanita BF-350 body fat scale . The North Carolina Baptist Hospital Clinical Laboratories measured complete blood counts and differentials. Serum was separated, aliquoted, and frozen until used to measure levels of lipid, glucose, and other metabolites according to standard clinical laboratory methods or previously published methods .At baseline and week 8, participants completed a wellness questionnaire, a modified self-rated health and wellness survey designedt tests to assess changes in continuous variables. We used analysis of variance to determine whether the changes differed by sex. We used an exact McNemar test to assess changes in dichotomous variables . All analyses were conducted by using SAS version 9.1 . We considered P values less than .05 to be significant.We used paired Of 46 overweight or obese participants who began the program, 41 (27 women and 14 men) completed it. Participants' mean age was 53 years , and all participants were white with the exception of 1 female African American participant. At baseline, all participants exceeded the healthy cutoff value for percentage of body fat (≤31% for women and ≤21% for men); 17 women and 13 men also exceeded the healthy cutoff value for waist-to-hip ratio (≤0.8 for women and ≤0.9 for men). Eighteen participants completed a medical history, and of these, 12 reported immunologic conditions , 8 reported cardiovascular disease (such as high blood pressure or history of heart attack), 5 reported high cholesterol, and 2 reported diabetes.During the 8-week intervention, men lost an average of 5.9 kg (13.1 lb) and women lost an average of 4.8 kg (10.5 lb), which is approximately a 6% decrease in body weight for both men and women . After tSimilarly, body fat and BMI decreased in both men and women during the 8 weeks of the program. In women, these trends continued during the 10-week follow-up. In men, body fat remained stable during the follow-up period, but BMI began to increase after 5 weeks . Waist cTwenty-seven participants turned in complete wellness questionnaires at both baseline and 8 weeks. Participants reported significant improvements in most domains .P = .02) and men . At baseline, 18 of 41 participants were classified as having metabolic syndrome (10 women and 8 men). After the intervention, that number had decreased to 10 (6 women and 4 men) (P < .001).After the intervention, waist circumference, a measure of central adiposity, was significantly decreased in women and men, and systolic blood pressure was significantly decreased in men . Most otAlthough fasting glucose levels did not change , all othThis multifaceted intervention significantly improved the conditions that define metabolic syndrome and reduced the number of participants who had metabolic syndrome. We also found improvements in several measures of insulin resistance. These observations suggest that a multifaceted approach to wellness that incorporates nutrition education and exercise in a supportive, faith-based environment can promote healthy lifestyle changes in overweight and obese adults.Our findings contrast with results of several commercial weight loss programs, which have high attrition rates, rapid weight regain, and poor adherence . More thSignificant changes in indexes of metabolic syndrome and insulin resistance were achieved in a short time and in participants who lost only 6% to 8% of their original body weight and 9% to 13% of their original fat mass. This finding suggests that decreased fat mass is not the only factor responsible for the decreased insulin resistance. Whether the changes in metabolic syndrome were associated with those in insulin resistance is not clear. A recent study showed that metabolic syndrome is a significant predictor of diabetes, increasing the risk by a factor of 3.5 to 5.2 ; this asOur intervention incorporated several dietary and exercise strategies. Consequently, determining the precise mechanisms responsible for the improvements is difficult. Several studies have found that exercise independently decreases glucose levels and risk of type 2 diabetes ,20, and The specific dietary recommendations in this study likely contributed to the observed improvements. A high-fiber diet, as recommended in this study, improves glycemic control ,23, and This study has several limitations. First, the program was conducted at only 1 church, so the results cannot be generalized and the program may not be feasible in other settings. The efficacy of the program should be evaluated in groups that differ in age and ethnic and racial composition. Second, because of the multifaceted nature of the intervention, we cannot elucidate specific aspects that affected insulin resistance or metabolic syndrome. Third, physical and emotional wellness were assessed by self-report; however, self-perception of wellness is a complex sum of individual health values and social and environmental influences , all of In conclusion, we found that a multifaceted, church-based wellness program that emphasizes education, a healthy diet, weight loss, physical activity, weekly coaching, and accountability can rapidly (within 8 weeks) decrease insulin resistance and risk of metabolic syndrome. |
In this paper we describe the enantioselective synthesis of indolizidine and quinolizidine analogues of bicyclic amphibian alkaloids epi-indolizidine 209B has been extended to the laevorotatory enantiomer, (−)-9. Attempts to adapt the synthetic route in order to obtain quinolizidine analogues revealed that a key piperidinylidene-containing enaminone intermediate (+)-28 was less tractable than its pyrrolidinylidene counterpart, thereby necessitating modifications that included timing changes and additional protection–deprotection steps. A successful synthesis of [-4-pentyloctahydro-2H-quinolizin-1-yl]methanol (−)-41 from the chiral amine tert-butyl (3R)-3-{benzyl[(1R)-1-phenylethyl]amino}octanoate (+)-14 was achieved in 14 steps and an overall yield of 20.4%.Our previously reported synthesis of racemic 8-cis-5,8-disubstituted indolizidines and cis-1,4-disubstituted quinolizidines, as well as the naturally occurring trans-disubstituted alkaloids.The methodology reported in this article was successfully applied to the enantioselective synthesis of the title compounds. It paves the way for the total synthesis of a range of In the latter group, it appears that most of the well-characterised alkaloids have a 1,4-trans disposition of the substituents; the only alkaloid in which the substituents are unambiguously cis is (−)-quinolizidine 207I 4. Comparatively few syntheses of quinolizidine 207I, 217A and related compounds have been reported [The astonishingly diverse range of alkaloids isolated from the skins of amphibians includes numerous 1-azabicyclic systems belonging to the indolizidine (1-azabicyclo4.3.0]nonane), quinolizidine (1-azabicyclo[4.4.0]decane) and lehmizidine (1-azabicyclo[5.3.0]decane) classes . The fir.0nonane)5 and 6 as key intermediates in the synthesis of alkaloids and other nitrogen-containing heterocycles octanoate (+)-25 in 98% yield -27 in 92% yield. Eschenmoser sulfide contraction was then effected by first treating the thiolactam with ethyl bromoacetate, after which reaction of the resulting S-alkylated intermediate with triethyl phosphite and triethylamine in acetonitrile gave the vinylogous urethane (+)-28 in 75% yield.Extending the route illustrated in ior work , with 5-ior work –28. This8% yield . However17 survived reduction with lithium aluminium hydride, leaving only the saturated ester to be reduced. With the six-membered analogue 28, the enaminone unit was far more susceptible to reduction, and despite many attempts to modify conditions, over-reduction led to a plethora of basic products that could neither be separated nor properly characterised. Although the desired alcohol (+)-29 containing an intact enaminone system could be isolated on occasion, the best yield obtained was 29% when the reaction was not allowed to go to completion. Thus a change of strategy was required to produce 29, the pivotal intermediate from which the quinolizidine nucleus needs to be constructed.At this stage, however, our fears of the discrepant behaviour of five- and six-membered enaminones proved to be all too well founded. In the indolizidine series, the robust enaminone tert-butyl ester clearly needed to be performed at an early stage of the synthesis before the introduction of other incompatible functional groups . The only feasible option was to go back to the chiral amine (+)-14, reduction of which with lithium aluminium hydride gave the unstable amino alcohol (+)-30 in 97% yield as long as the amine was added slowly to a stirred suspension of the hydride in diethyl ether (tert-butyl(dimethyl)silyl ether (−)-31 (99%) before hydrogenolysis of the benzyl groups over Pearlman's catalyst in glacial acetic acid gave the free amine (−)-32 in quantitative yield. Treatment with 5-bromopentanoyl chloride as described above afforded the unstable bromoamide 33 as an orange oil in 89% yield. In this case, cyclisation of the crude intermediate to the lactam (+)-34 was most successfully effected by adding potassium tert-butoxide to a solution of the bromoamide in dry tetrahydrofuran at room temperature, a yield of 81% being obtained by keeping the reaction time short (25 min). To our dismay, however, the attempted thionation of 34 with Lawesson's reagent under a variety of conditions was uniformly unsuccessful, apparently because the silyl ether failed to survive the reaction conditions.The reduction of the yl ether . If the 34 with aqueous hydrofluoric acid to give the free alcohol (+)-35 was followed by acetylation with acetic anhydride in pyridine -37 in 94% yield. Finally, reaction with ethyl bromoacetate followed by treatment with triphenylphosphine and triethylamine in acetonitrile give the vinylogous urethane (+)-38 in 80% yield. Hydrolysis of the acetate with potassium carbonate in methanol then afforded the pivotal alcohol (+)-29 (70%). The scene was now set for cyclisation to the quinolizidine system. Immediate conversion of the unstable free alcohol into the corresponding iodide with iodine, triphenylphosphine and imidazole in a mixture of toluene and acetonitrile [H-quinolizine-1-carboxylate (−)-39 in 70% yield.Inelegant though it was, we were forced at this stage to change protecting groups on the alcohol. Fortunately, the drop in yield was not too serious when desilylation of pyridine . The lac39 needs to be reduced stereoselectively. Based on our previous success with the indolizidine analogue 19, we opted for catalytic hydrogenation, which is expected to produce not only a cis-relationship between C-1 and C-9a, but also a cis-relationship between C-4 and C-9a. The developing chair conformation of the six-membered ring in the transition state should result in an equatorial preference for the pentyl side chain, which in turn should bias the approach of the reductant towards the more remote face of the double bond. Gratifyingly, hydrogenation of intermediate 39 over platinum oxide catalyst in ethanol at a pressure of five atmospheres produced the quinolizidine (−)-40 as a single diastereomer in 97% yield. The diastereoselectivity is manifestly better than in the indolizidine case. Support for the cis-relationship of the hydrogen atoms at positions C-4 and C-9a and the trans-ring junction in the product was once again provided by Bohlmann bands in the FTIR spectrum at ca. 2790 cm−1. However, further confirmation of the relative stereochemistry by consideration of the 1H NMR spectrum was not feasible because overlap of signals prevented the extraction of coupling constants for 1-H and 9a-H.In order to introduce the remaining stereogenic centres of the target system, the alkene bond of the bicyclic vinylogous urethane -41 was accomplished in moderate yield (65%) with lithium aluminium hydride. Again, coupling constants could not be determined for 1-H and 9a-H. In this case, however, there is good precedent for assigning the relative stereochemistry of the hydroxymethyl substituent at C-1 on the basis of 13C chemical shifts. For example, the chemical shift of C-1 in lupinine 12, which possesses an axial hydroxymethyl substituent, is 38.8 ppm; whereas the corresponding chemical shift in epilupinine 13, the equatorial hydroxymethyl epimer, is 43.8 ppm [ca 10 ppm) [41 is consistent with an axial disposition of the C-1 substituent, and thus with the expected cis-hydrogenation of 39.Finally, reduction of the ester to the primary alcohol (−)43.8 ppm . The che43.8 ppm . A simil 10 ppm) . In the S,4R,9aS)-4-pentyloctahydro-2H-quinolizine 42, the ring homologue of 8-epi-indolizidine 209B, this target eluded us. Attempts to reduce the corresponding methanesulfonate of 41 with Raney nickel in boiling ethanol gave ambiguous results no matter how we modified the reaction conditions.While it would have been desirable to conclude this investigation by preparing . In addition, alkyl homologues at C-1 should be accessible; one could, for example, replace the alcohol by a leaving group that can be displaced by organometallic reagents (e.g. cuprates) of appropriate chain length. Substituents at C-4 can also be varied by choosing appropriate analogues of the chiral amine 14, which should also be available in both enantiomeric forms by the Davies procedure [trans-orientation by base-catalysed epimerisation of a carbonyl substituent adjacent to the bridgehead position (cfFew approaches to 1,4-o expect –16 was arocedure . Finallyition cf, it shouFile 1Analogues of amphibian alkaloids - Full experimental details. The Supporting Information File contains detailed experimental procedures and full characterisation data for all new compounds prepared during the synthesis of the two title compounds. |
Notophthalmus viridescens Prod1 is a cell-surface molecule of the three-finger protein (TFP) superfamily involved in the specification of newt limb PD identity. The TFP superfamily is a highly diverse group of metazoan proteins that includes snake venom toxins, mammalian transmembrane receptors and miscellaneous signaling molecules.Following the amputation of a limb, newts and salamanders have the capability to regenerate the lost tissues via a complex process that takes place at the site of injury. Initially these cells undergo dedifferentiation to a state competent to regenerate the missing limb structures. Crucially, dedifferentiated cells have memory of their level of origin along the proximodistal (PD) axis of the limb, a property known as positional identity. N. viridescens Prod1 in sequence data for the salamander Ambystoma tigrinum.With the aim of identifying potential orthologs of Prod1, we have solved its 3D structure and compared it to other known TFPs using phylogenetic techniques. The analysis shows that TFP 3D structures group in different categories according to function. Prod1 clusters with other cell surface protein TFP domains including the complement regulator CD59 and the C-terminal domain of urokinase-type plasminogen activator. To infer orthology, a structure-based multiple sequence alignment of representative TFP family members was built and analyzed by phylogenetic methods. Prod1 has been proposed to be the salamander CD59 but our analysis fails to support this association. Prod1 is not a good match for any of the TFP families present in mammals and this result was further supported by the identification of the putative orthologs of both CD59 and The available data suggest that Prod1, and thereby its role in encoding PD identity, is restricted to salamanders. The lack of comparable limb-regenerative capability in other adult vertebrates could be correlated with the absence of the Prod1 gene. Notophthalmus viridescensRegeneration of damaged or missing body parts in adulthood is fairly widespread in invertebrate animals, but relatively rare in vertebrates. The most extensive regenerative ability among adult vertebrates is found among various species of salamanders, the urodele amphibians, which are able to replace a variety of structures including the limbs, tail, jaws and spinal cord. One important step in urodele regeneration appears to be the ability to create stem cell-like progenitor cells from already differentiated cells, a process known as dedifferentiation. The process of regeneration in urodele limbs has been particularly well-characterized: upon amputation, epidermal cells migrate to cover the wound, and subsequently cells under the epidermis revert to mesenchymal stem cells and form a mound at the end of the stump called a blastema It is not understood why most adult vertebrates are unable to regenerate. This could reflect either the absence of certain gene products, or alternatively the failure of those genes to act in an appropriate way following injury. The present-day understanding of regenerative mechanisms is only partial, but in general the genes that have been implicated belong to families that are widespread rather than being found only in taxa that are able to regenerate The Prod1 amino acid sequence codes for a secreted single-domain protein of the urokinase-type plasminogen activator receptor (uPAR)/Ly-6/CD59/snake toxin superfamily Escherichia coli as insoluble aggregates that were solubilized, purified, reduced and folded in vitro. In vitro-folded Prod1 was found to possess good solubility and stability and to yield high quality NMR spectra , n is the β-sheet number, p is the strand number within the β-sheet, and i−j the constituent residue range. In comparison to other TFPs, the 12-residue-long α-helix comprising the connection between strands β5 and β6 is the most distinctive feature of Prod1.Prod1 has the slight concave disc shape characteristic of other TFP domains . The sigThe canonical TFP domain has 10 disulfide-bonded cysteines arranged in the pattern C1-C5, C2-C3, C4-C6, C7-C8 and C9-C10 and – using this same labeling of positions with respect to the canonical cysteines – with the residues at positions C5+1 (Leu43), C5+2 (Phe44), C6−2 (Gln53) and C6−1 (Glu54). Other conserved contacts, which in some TFP structures have a hydrophobic character and in others are charge-pair interactions, are between the side chains of residues at positions C1−1 and C10−2 (Lys21 and Asp81 in Prod1); C1+1 and C6−2 (Phe23 and Gln53) ; C1+1 and C10−1 (Phe23 and Leu82); C4−3 and C10−1 ; C5+1 and C6+1 (Leu43 and Ile52); C5+1 and C8−2 (Leu43 and Ala75); C5+2 and C6−2 (Phe44 and Gln53); C5+3 and C8−2 ; C5+3 and C8−4 . TFP domEstablishing the relationship of Prod1 to other members of the TFP superfamily should aid the identification of orthologous molecules, and also point to residues that mediate intermolecular interactions and provide an insight into possible modes of action. Most often, molecular phylogeny is based upon the analysis of alignments of nucleotide or amino acid sequences. However, the construction of a well-supported protein sequence-based phylogenetic relationship of the TFP superfamily encounters particular challenges: (1) the multiple sequence alignment has many ambiguous regions due to the low overall sequence identity between the members (as low as 20%); and (2) the resolving power of the analysis is compromised by the short sequence length of the domain and the presence of sites that have accumulated multiple residue substitutions, insertions and deletions so as to obscure the phylogenetic signal, a phenomenon known as substitutional or mutational saturation In the Pfam database There is no unique method for measuring the degree of similarity between macromolecular structures. The traditional method of comparing structures as rigid bodies is usually not suitable for comparison between distantly-related structures, such as members of a superfamily, where relative reorientation of the conserved secondary structure features is commonplace. Nevertheless, a variety of scoring methods that do allow for flexibility are available, some of which use the explicit atomic coordinates such as FATCAT We located 61 TFP domain 3D structures with non-identical sequences from the PDB see and usedThe phylogenetic tree shows a primary split between snake venom and receptor-like proteins that can also be seen in the network. The snake-venom proteins are in turn clustered, mainly according to function, in seven groups: type I α-neurotoxins, type II α-neurotoxins, cytotoxins, neurotoxins from Colubridae snakes, acetylcholinesterase inhibitors, muscarinic neurotoxins and candoxin-like proteins. The receptor-like cluster contains four well-supported groups: the TFP domains of the type I receptors of TGF-β like proteins; the TFP domains of the type II receptors of TGF-β like proteins, the C-terminal domain of uPAR and CD59; and a clade of two snake venom proteins comprising the weak platelet aggregation inhibitor γ-bungarotoxin (1MR6) In our structure-based phylogenetic calculations, Prod1 was consistently located in the receptor-like cluster, although it was not found within any of the sub-groups we have just described. Among the cluster members, the most similar structure to Prod1 is CD59 with a PPM score of 62.98. However, this best match is not reciprocal as the PPM score between CD59 and the third domain of uPAR (2FD6-3) is 75.96; Prod1 ranks only fifth among the PPM scores for CD59. Similarity between Prod1 and CD59 is mainly due to the conformation and length of the insertion between β4 and β5, as they both have α-helices in this region and share the position of C7 in the structure. The absence of the C2-C3 bond in Prod1 does not result in significant structural differences compared to the corresponding region in CD59. Although a member of the extracellular receptor cluster by this analysis, Prod1 also shows substantial similarity to members of the muscarinic toxin group. Muscarinic toxin 2 (MT2) is the second best hit to Prod1 with a PPM score of 61.77; the resemblance of Prod1 to the muscarinic toxic group was observed using all of the assessed scoring systems.There is one pair of known orthologous structures in the dataset: the TFP domain of the TGF-β receptor type 2 of human (1M9Z) and chicken (1KS6). The PPM score between these two 3D structures is 133.71, clearly much higher than the PPM score of 62.98 for Prod1 and CD59. This result indicates that the structure-based phylogenetic approach does not support that Prod1 and CD59 are orthologs. Having arrived at this conclusion using structural data, we resorted to the incorporation of the more abundant TFP sequence data into the analysis in order to gain further insight into the position of Prod1 within the TFP superfamily and to probe further for the existence of a mammalian ortholog.To the best of our knowledge, a phylogenetic analysis of the TFP superfamily has not been reported previously. This is most likely due to the difficulty of comparing novel sequences to known TFP members given the low sequence similarity and wide functional diversity. Due to the short length and high variability of the sequences, the TFP superfamily is not an ideal candidate for sequence-based phylogenetic analyses, but the wealth of information that it could provide justifies the exercise, as long as measures are taken to minimize potential error and the relevant caveats are taken into account. As the reliability of the phylogeny output is strongly dependent upon the quality of the starting multiple sequence alignment, and the use of constraints derived from structural data has been shown to increase the accuracy of sequence alignments Ambystoma tigrinum. In common with N. viridescens, the newt in which Prod1 was found, A. tigrinum belongs to the suborder of the advanced salamanders . Human CD59 and TC00268 share 38% amino acid sequence identity. The sequence identity between Prod1 and TC00268 is only 24%, similar to the 22% identity between human CD59 and Prod1. Furthermore, all sequences in the CD59 clade have the five canonical TFP disulfides, while Prod1 has only four. TC00268 was found in the Ambystoma expressed sequence tag (EST) database A. tigrinum sequence (TC06378) that was consistently recovered in a clade with Prod1. TC06378 and Prod1 show 56% amino acid sequence identity sequence was found to cluster with Prod1 and TC06378.A critically important outcome of the structure-based sequence phylogenetic reconstitution is the determination that, consistent with our analysis based upon TFP structures alone, Prod1 is not the ortholog of CD59. Thus CD59 clade was recovered in both the maximum likelihood and Bayesian phylogenies and the network shows that this grouping is well supported by the data. The CD59 clade contains sequences from fish, birds, reptiles, amphibians, marsupials and placentals, including the sequence TC00268 obtained from the tiger salamander, identity . These oThe establishment of a confident molecular phylogenetic tree of the TFP superfamily is not straightforward due the small size of the domain, mutational saturation and the abundance of insertions and deletions. To overcome this difficulty, we constructed a phylogeny of the available TFP 3D structures using structural similarity scores. This allowed us to confidently place the structure of Prod1 close to the TFP domains of other cell-surface receptors and away from the snake toxins. In order to examine the kinship of Prod1 in more detail we computed a sequence-based phylogeny using a structure-based sequence alignment. The consistent outcome of various phylogenetic methods based upon this alignment shows that Prod1 arises in a clade comprising only non-mammalian proteins. It is possible, due to the relatively low resolution of the trees, that the relationship between Prod1 and any mammalian orthologs is currently beyond the detection limit. However if the pattern of the present analysis holds up in the face of ever-expanding sequence depositions, then our results have the important implication that the coding of proximodistal identity in adult vertebrate limb regeneration via Prod1 is specific to Salamandroidea. Moreover we have shown that Prod1 is not the functional homologue of mammalian CD59, as was previously supposed The conclusions that we have derived from sequence-structure bioinformatic analysis of Prod1 and its relationship to the TFP superfamily are necessarily limited by the absence of the complete sequence of a urodele genome. Our assessment that Prod1 is not found in mammals would have to be corroborated by the analysis of the relevant syntenic regions. Unfortunately, such corroboration would be confounded by the litany of mechanisms that allow for rearrangement of chromosomal DNA over evolutionary time. Arguably the best way to test functional orthology is by genetic or biochemical tests of Prod1 and candidate Prod1 orthologs in cells of relevant origin, a goal towards which we and our colleagues are expending significant effort.N. viridescensRecently a protein that appears to interact with Prod1 was identified in E. coli BL21(DE3) Gold (Stratagene) cells were grown in PG medium 15NH4Cl and/or 13C glucose for isotope-labeled samples. Protein expression at 37°C (300 rpm) was induced by addition of IPTG to 1 mM and continued for 12 hours. Cells were harvested and lysed by sonication, the recovered pellet resuspended in 0.1 M potassium phosphate, 10 mM Tris-HCl, 6 M guanidinium chloride (GdmCl) pH 8.0. The supernatant was purified by gravity-flow IMAC and the eluant concentrated to ∼5 ml. Solid DTT was added to 0.1 M, the pH adjusted to pH 8.5, and the solution was incubated for 2 hrs at RT. Size-exclusion chromatography was performed on a Superdex 75 column equilibrated with a pH 4.5 buffer of 0.1 M potassium phosphate, 10 mM Tris-HCl and 6 M GdmCl. Fractions corresponding to the protein monomer were pooled and concentrated. In vitro folding was performed at room temperature by rapid dilution into 0.1 M Tris-HCl pH 9 buffer with 5 mM cysteine and 0.5 mM cystine. The mixture was gently stirred for 48 hours, concentrated and loaded onto Superdex 75 equilibrated in 0.05 M potassium phosphate buffer pH 6.0, 0.2 M NaCl, 1 mM EDTA, 0.1% NaN3. Eluate fractions containing the Prod1 monomer were pooled and concentrated. All concentration steps were carried out by centrifugal ultrafiltration .The DNA sequence encoding residues 19 to 88 of Prod1 was amplified by PCR from full-length Prod1 15N- and 13C-edited NOESY-HSQC spectra. Cross peaks were assigned manually, grouped into four categories according to their relative peak intensities which correspond to interproton distance restraint limits of 1.8–2.5 Å (strong), 1.8–3.0 Å (medium), 1.8–3.5 Å (weak) and 1.8–5.0 Å (very weak). For NOEs involving methyl groups, 0.5 Å was added to the distance upper limit. Only NOEs deriving from unambiguously assigned cross peaks were used in the calculations. Backbone ϕ and ψ torsion angle restraints were derived from the pattern of 1Hα, 13Cα, 13Cβ, 13C' and 15NH chemical shifts according to the program TALOS NMR spectra were acquired at 298 K at 500, 600 or 800 MHz. Sequence-specific and side chain resonance assignments were obtained using standard nD triple resonance methods. All spectra were processed using NMRpipe AB) we used the formula DAB = SAA+SBB−2*SAB, where S is the similarity score, this guarantees that the self-distance is zero, and all distances are positive. Phylip-like distance matrices were created with in-house Perl scripts. Neighbornet networks were calculated from the matrices by SplitsTree4 Solved 3D structures of TFP domains were located using the advanced search of the PDB website, searching for structures with the SCOP fold snake toxin-like (57301) or CATH topology CD59 (2.3.60). Fifty-nine none-identical sequences are retrieved, one of them (1QM7) is a chimeric protein, and was removed. To find non-annotated entries the structure of Prod1 was submitted to the FATCAT server to search against the PDB of Nov. 25, 2008, the only new structure found was the muscarinic toxin MT7 (PDB code: 2VLW). The structure of the ectodomain of the type II BMP receptor (2HLQ) and uPAR (2FD6) were not retrieved by these methods, but were also included in the analysis, in the case of uPAR as three independent domains. All the atomic coordinates were obtained from the PDB and trimmed to comprise only the nominal TFP domain. We computed pairwise structure superpositions to obtain a series of similarity scores using default parameters with ASH http://pir.georgetown.edu/pirwww/search/pattern.shtml) and also ScanProsite at the ExPASy server. The sequence pattern used was C-x-C-x-C-x-C-x-C-x-C-C-x(4)-C-N; the matching sequences, as well as the TFP sequences found in the venom gland of the Bushmaster snake Ambystoma EST database Vertebrate sequences in UniprotKB were mined using the pattern search tool at the PIR website spectrum of Prod1 at 298 K and pH 6.0.(0.27 MB TIF)Click here for additional data file.Figure S2Neighbor-net network of TFP 3D structures calculated using the matrix of pairwise distances computed by the phenotypic plasticity method (PPM). The structure-based phylogenetic groupings are circled and highlighted by different colors. The arrows signal the split that separates the snake toxin cluster from the receptor cluster on which Prod1 is located.(0.95 MB TIF)Click here for additional data file.Figure S33D structure-based cladogram of TFP domains. The trees were computed with BioNJ using a matrix of pairwise distances calculated using DALI similarity scores. PDB codes in bold correspond to the structure depicted in ribbon representation; PDB codes in white correspond to structures whose classification differs from that in the tree computed using PPM scores (0.99 MB TIF)Click here for additional data file.Figure S43D structure-based cladogram of TFP domains. The trees were computed with BioNJ using a matrix of pairwise distances calculated using FATCAT similarity scores. PDB codes in bold correspond to the structure depicted in ribbon representation; PDB codes in white correspond to structures whose classification differs from that in the tree computed using PPM scores (0.98 MB TIF)Click here for additional data file.Figure S53D structure-based cladogram of TFP domains. The trees were computed with BioNJ using a matrix of pairwise distances calculated using ASH similarity scores. PDB codes in bold correspond to the structure depicted in ribbon representation; PDB codes in white correspond to structures whose classification differs from that in the tree computed using PPM scores (0.99 MB TIF)Click here for additional data file.Figure S6Neighbor-net network of representative TFP sequences calculated using maximum-likelihood distances estimated using the WAG+4G+I model. The sequence-based phylogenetic groupings are labeled, roman numerals refer to groups that do not have any previously-characterised members. For the description of the sequences in each grouping see (4.19 MB TIF)Click here for additional data file.Figure S7Notophthalmus viridescens) and from tiger salamander (Ambystoma tigrinum) and selected CD59 orthologs. Glycines are colored in orange, prolines in yellow and cysteines in pink; other positions are colored according to conservation of chemical properties: hydrophobic in blue, aromatic in cyan, polar negative in purple, polar positive in red, and polar neutral in green.Multiple alignment of the sequences of Prod1 from eastern newt ((2.85 MB TIF)Click here for additional data file.Table S1AB = SAA+SBB−2*SAB, where S is the similarity score calculated by the phenotypic plasticity method (PPM).Pairwise structure distances for the representative set of TFP domain 3D structures used in the structure-based phylogenetic analysis. The distance (D) between any given structures A and B was calculated using the formula D(0.04 MB XLS)Click here for additional data file.Table S2Groupings, accession numbers and descriptions of the sequences found in the phylogenetic tree depicted in (0.04 MB XLS)Click here for additional data file.Table S3Groupings, accession numbers, and descriptions of the sequences found in the phylogenetic tree depicted in (0.04 MB XLS)Click here for additional data file. |
The application of mobile computing and communication technology is rapidly expanding in the fields of health care and public health. This systematic review will summarise the evidence for the effectiveness of mobile technology interventions for improving health and health service outcomes around the world.To be included in the review interventions must aim to improve or promote health or health service use and quality, employing any mobile computing and communication technology. This includes: (1) interventions designed to improve diagnosis, investigation, treatment, monitoring and management of disease; (2) interventions to deliver treatment or disease management programmes to patients, health promotion interventions, and interventions designed to improve treatment compliance; and (3) interventions to improve health care processes e.g. appointment attendance, result notification, vaccination reminders.A comprehensive, electronic search strategy will be used to identify controlled studies, published since 1990, and indexed in MEDLINE, EMBASE, PsycINFO, Global Health, Web of Science, the Cochrane Library, or the UK NHS Health Technology Assessment database. The search strategy will include terms (and synonyms) for the following mobile electronic devices (MEDs) and a range of compatible media: mobile phone; personal digital assistant (PDA); handheld computer (e.g. tablet PC); PDA phone ; Smartphone; enterprise digital assistant; portable media player (i.e. MP3 or MP4 player); handheld video game console. No terms for health or health service outcomes will be included, to ensure that all applications of mobile technology in public health and health services are identified. Bibliographies of primary studies and review articles meeting the inclusion criteria will be searched manually to identify further eligible studies. Data on objective and self-reported outcomes and study quality will be independently extracted by two review authors. Where there are sufficient numbers of similar interventions, we will calculate and report pooled risk ratios or standardised mean differences using meta-analysis.This systematic review will provide recommendations on the use of mobile computing and communication technology in health care and public health and will guide future work on intervention development and primary research in this field. M-health, the use of mobile computing and communication technologies in health care and public health, is a rapidly expanding area of research and practice. M-health programmes and interventions use mobile electronic devices (MEDs), such as personal digital assistants (PDAs) and mobile phones, for a range of functions from clinical decision support systems and data collection tools for healthcare professionals,2, to suCurrent documented M-health interventions and programmes include: mobile phone text messaging to support management of diabetes, hypertension, asthma, eating disorders and HIV treatment-7; mobilMobile communication technology is the fastest growing sector of the communications industry in low income countries,18. In tMobile technologies have a number of key features that give them an advantage over other information and communication technologies in particular activities within health care and public health. Firstly, many MEDs have wireless cellular communication capability, providing the potential for continuous, interactive communication from any location e.g. telephone calls, text and multimedia messaging and also internet access via Wireless Application Protocol (WAP) or mobile broadband internet. Secondly, the devices are portable because of their small size, low weight and rechargeable, long-life battery power. Finally, many MEDs have sufficient computing power to support multimedia software applications. The combination of these features varies between specific devices and their relative importance will change with the health activity in which they are used. However, with advances in technology development, single devices increasingly possess many or all of these functions.Existing systematic reviews of M-health interventions, and recently published protocols-26, focuThe objectives of this review are to: (1) describe the uses of mobile computing and communication technologies by patients, healthcare professionals and the general public in the context of health service and public health interventions that have been evaluated in controlled studies; (2) assess the effectiveness of mobile technologies for improving health and health service outcomes in high, middle and low income countries; and (3) describe the acceptability of mobile technologies to patients, healthcare professionals and the general public, in the context of health service and health promotion interventions.For the purposes of this review, MEDs will be defined as devices which either have interactive wireless cellular communication capability and/or those which run software applications and are highly portable. We will therefore include interventions using: mobile phones; personal digital assistants (PDA) and PDA phones ; Smartphones (e.g. the iphone); Enterprise digital assistants (EDA); portable media players ; handheld video-game consoles (e.g. Playstation Portable (PSP), Nintendo DS); handheld and ultra-portable computers such as tablet PCs (e.g. the ipad) and Smartbooks. A summary of the functions available with each of these devices is provided in Table Interventions must aim to improve or promote health or health service use and quality, employing any MED. This includes: (1) interventions designed to improve diagnosis, investigation, treatment, monitoring and management of disease; (2) interventions to deliver treatment or disease management programmes to patients, health promotion interventions, and interventions designed to improve treatment compliance; and (3) interventions to improve health care processes e.g. appointment attendance, result notification, vaccination reminders. We will therefore include:- Any intervention delivered using an MED owned or directly used by a patient or lay person;- Any clinical or practice aid delivered using an MED owned or directly used by a healthcare professional;- Any data collection or storage for the purposes of healthcare or health research using an MED.We anticipate that interventions will aim to address one of the health domains shown in Figure Studies must have used a controlled design to evaluate an MED intervention. We will include both randomised controlled trials and studies with non-random treatment group allocation. Previous reviews have highlighted the difficulty in assessing the impact of MED on health outcomes when the MED is used as an adjunct to other interventions and services e.g. text messaging in addition to clinician appointments for managing hypertension. We will- Interventions delivered via a single MED to the treatment group , where the control group receives no MED intervention;- Multi-MED interventions where the treatment group receives one or more interventions delivered through multiple MED, but no interventions through other (non-MED) modes and the control group receives no MED interventions;- Mixed MED and non-MED interventions where the treatment and control group both receive all non-MED components of the intervention and the MED intervention is delivered only to the treatment group, e.g. SMS plus group counselling for smoking cessation in the treatment group and the control group receives group counselling only;- Interventions delivered by different MED e.g. iphone vs. regular mobile phone;- The features and components of interventions delivered on a particular MED, such as the intensity, personalisation, content, duration and timing of an intervention, and the degree of software or other component customisation.We will exclude studies evaluating:- Mixed MED and non-MED interventions where the treatment and control group both receive the MED component;- Interventions where there are other treatment differences between the treatment and control groups besides the delivery of the MED component(s).There will be no limits on study participants in terms of age, gender, ethnicity, morbidities or staff role and occupation . There will be no limits on study setting and we will include studies at all levels of healthcare setting and those conducted in the community.All outcome measures reported in studies meeting the inclusion criteria will be extracted, both objective and self-reported measures. User-acceptability will be assessed as a self-reported outcome for all intervention types. We will also seek data on unintended adverse consequences of the interventions and process outcomes (e.g. repetitive strain injury or involvement in road traffic accidents).Primary outcome measures will include any objective measure of health, or health service delivery or use. These may include biologically confirmed smoking cessation or mean change in body mass index, blood pressure, blood lipids or blood glucose levels. Secondary outcome measures will include: cognitive outcomes relating to knowledge, motivation, self-efficacy and intention; self-reported outcomes related to health behaviours (e.g. number of cigarettes smoked), chronic disease management, health service delivery or use. Examples of outcome measures for each health domain in Figure We will use a three-part search strategy to identify studies meeting the inclusion criteria above that have been published since 1990: (1) we will search electronic bibliographic databases for published work, using a comprehensive search strategy for mobile technology interventions; (2) we will search trial registers for ongoing and recently completed trials; (3) we will search the reference lists of primary studies included in the review and the reference lists of relevant, previously published reviews.The following electronic bibliographic databases will be searched: MEDLINE, EMBASE, PsycINFO, Global Health, The Cochrane Library , Cochrane Methodology Register), NHS Health Technology Assessment Database, and Web of Science . The search strategy will include only terms relating to or describing mobile technologies because we will include all types of intervention and health or health service outcomes meeting the inclusion criteria described above. The search strategy for MEDLINE is shown in Additional File We will include data from dissertations that meet the inclusion criteria, where these are indexed in the above databases and retrieved in our search. We will not be retrieving or including any unpublished data.Ongoing, recently completed and unpublished clinical trials meeting the inclusion criteria described above will be identified from the following research registers: National Institutes of Health clinical trials registry (US); National Institute for Health Research Clinical Research Network Portfolio Database (UK); National Research Register Projects Database Archive (UK); and Current Controlled Trials .Titles and abstracts of studies retrieved using the search strategy and those from additional sources will be screened independently by two review authors to identify studies that potentially meet the inclusion criteria outlined above. The full text of these potentially eligible studies will be retrieved and independently assessed for eligibility by two review authors. Any disagreement between the two review authors over the eligibility of particular studies will be resolved through discussion with a third review author.A standardised, pre-piloted form will be used to extract data from the included studies for assessment of study quality and evidence synthesis. Extracted information will include: study setting (including country); study population and participant demographics and baseline characteristics; MED used; details of the intervention and control conditions; study methodology; recruitment and study completion rates; outcomes and times of measurement; indicators of acceptability to users; suggested mechanisms of intervention action; information for assessment of the risk of bias (see below). Two review authors will independently extract data, discrepancies will be identified and resolved through discussion (with a third author where necessary). Missing data will be requested from study authors via email.Two review authors will independently assess the risk of bias in included studies by considering the following characteristics, as recommended by the International Cochrane Collaboration:- Randomisation sequence generation: was the allocation sequence (used to assign participants to the treatment and control groups) adequately generated? - Treatment allocation concealment: was the allocated treatment adequately concealed from study participants and clinicians and other healthcare or research staff at the enrolment stage?- Blinding: were the personnel assessing outcomes and analysing data sufficiently blinded to the intervention allocation throughout the trial?- Completeness of outcome data: were participant exclusions, attrition and incomplete outcome data adequately addressed in the published report?- Selective outcome reporting: is there evidence of selective outcome reporting and might this have affected the study results?- Other sources of bias: was the trial apparently free of any other problems that could produce a high risk of bias?Disagreements between the review authors over the risk of bias in particular studies will be resolved by discussion, with involvement of a third review author where necessary. The level of risk of bias in each of these domains will be presented separately for each study in tables in the final review publication.We will provide a narrative synthesis of the findings from the included studies. We will structure the narrative synthesis by describing the studies according to the following characteristics:- The type of intervention e.g. individual behaviour change, chronic disease self-management, clinic appointment reminders or clinical diagnostic aid ;- The type of outcome e.g. smoking cessation or weight loss;- Intervention content - features of the MED employed , intervention components such as reminders, feedback or peer support, intensity, duration, personalisation and theoretical basis (if stated).We will provide summaries of intervention effects for each study by calculating risk ratios (for dichotomous outcomes) or standardised mean differences (for continuous outcomes) from the data presented in the published studies or obtained from study authors.2 test and the I2 statistic. We will consider an I2 value greater than 50% indicative of substantial heterogeneity. We will conduct sensitivity analyses based on study quality in order to investigate possible sources of heterogeneity). We will use stratified meta-analyses to explore heterogeneity in effect estimates according to: study quality ; study populations ; the logistics of intervention provision ; and intervention content (information only versus explicit use of behaviour change theories and techniques for behaviour change interventions). We will assess evidence of publication bias using Egger's weighted regression method for continuous outcomes and Begg's rank correlation test for dichotomous outcomes.We anticipate that there will be limited scope for meta-analysis because of the range of different outcomes measured across the reasonably small number of existing mobile technology intervention trials. However, where studies have used the same type of intervention and MED, with the same outcome measure, we will use Stata v11.0 to pool This systematic review of M-health interventions will provide a detailed summary of the evidence for the effectiveness of mobile computing and communication technologies to improve a broad range of health and health service outcomes.The authors declare that they have no competing interests.PE and CF initiated and designed the study. LF, VP and LG participated in study design. GP participated in study design and drafted the manuscript. All authors read and approved the final manuscript.MEDLINE (Ovid) search strategy. Search terms used to identify studies of interventions using mobile computing and communication technologies in MEDLINE (Ovid).Click here for file |
However, frequent inversions associated with palindromic sequences within this region have been found in multiple lineages of Angiosperms and may complicate its use as a barcode, especially if they occur within species.The chloroplast trnH-psbA region for DNA barcoding efforts. We report polymorphic inversions within six species of Gentianaceae, all narrowly circumscribed morphologically: Gentiana algida, Gentiana fremontii, Gentianopsis crinita, Gentianopsis thermalis, Gentianopsis macrantha and Frasera speciosa. We analyze these sequences together with those from 15 other species of Gentianaceae and show that typical simple methods of sequence alignment can lead to misassignment of conspecifics and incorrect assessment of relationships.Here, we evaluate the implications of intraspecific inversions in the trnH-psbA region, if not recognized and aligned appropriately, may lead to large overestimates of the number of substitution events separating closely related lineages and to uniting more distantly related taxa that share the same form of the inversion. Thus, alignment of the trnH-psbA spacer region will need careful attention if it is used as a marker for DNA barcoding.Frequent inversions in the However, the Consortium recognized that these two genes may need to be supplemented by additional loci to discriminate among closely related species; the trnH-psbA region remains the leading candidate as a source of additional data trnH-psbA that has been overlooked in the plant barcode literature: frequent inversions in a region of trnH-psbA that is flanked by inverted repeats. Although inversions in trnH-psbA have been noted previously [e.g., intraspecific inversions in this region, in six species of Gentianaceae. Since barcoding efforts focus on identification of species, we hypothesize that such intraspecific polymorphisms will be especially problematic for this research program, if the inversions are not detected and accommodated appropriately in alignments.DNA barcoding, the use of short, standardized orthologous DNA sequences to identify species, promises a rapid and efficient method to explore the dimensions of biodiversity. The mitochondrial CO1 gene appears to have wide utility in discriminating among animal lineages ly e.g., , we repotrnH-psbA region shows many of the features deemed desirable in a barcode, including short length (often <500bp), suspected ubiquity in plants, high interspecific sequence divergence, and universal flanking primers that allow for easy amplification and sequencing from both high molecular weight and degraded DNA trnH-psbA does not amplify well, or amplifies as multiple bands trnH-psbA is not sufficiently variable to distinguish among closely related species [e.g. In many plant lineages, the ies e.g. and in otrnH-psbA is often easy to amplify and sequence, even from degraded samples, and shows high levels of interspecific and intraspecific sequence variation. However, one source of intraspecific variation that may prove problematic for DNA barcoding is the presence of different configurations of a 25–27bp inversion associated with inverted repeats. Here we report six examples of such inversions within species of Gentianaceae that are narrowly defined morphologically. This intraspecific variation, combined with the generally short length of the trnH-psbA region, suggests that typical methods of alignment of these sequences could result in misassignment of conspecific sequences that show different forms of the inversion.In our studies within Gentianaceae, trnH-psbA, Sang et al. Paeonia. Other studies have found small inversions in several other non-coding chloroplast sequences, usually associated with flanking inverted repeats, or palindromic sequences In a paper exploring the phylogenetic utility of trnH-psbA on the ability of this marker to identify species. We align and analyze sequences from six polymorphic species together with sequences from 15 other species of Gentianaceae. We use sets of analyses, employing different methods typically used in barcoding, on two alternative alignments of the inversion region. In the first, we use unaltered (“raw”) sequence data in which different taxa exhibit either one or the other of the two different inversion configurations. In the second, we invert the sequence of the loop region for 19 taxa, by removing and replacing one form of the inversion with the reverse complement of its sequence, to maximize sequence homology across the inversion region. By analyzing the phylogenetic trees and sequence divergences of these two alternative alignments, we test the hypothesis that distantly related sequences with the same configuration of the inversion may cluster more closely than conspecific sequences with different forms of the inversion. This result would indicate a risk of incorrect species identification when trnH-psbA is employed in DNA barcoding.Here, we explore potential effects of intraspecific inversions in trnH-psbA sequences from each of six species of Gentianaceae, primarily North American, that were found to be polymorphic for the inversion region. These include two species from subtribe Gentianinae and four from subtribe Swertiinae . We aligned these sequences with sequences from 15 other North American species of Gentianaceae that were chosen specifically to reflect different scenarios that may be encountered in barcoding studies. Our final dataset thus included some taxa with very dense sampling and some taxa with sparse sampling . In this manner, we hoped to reveal situations in which intraspecific inversions may cause problems for DNA barcoding, rather than to test the monophyly of species that are polymorphic for the inversion region. Voucher information, as well as the configuration seen in the inversion region, is given in Our dataset began with 3–4 trnH-psbA spacer using primers trnHf Total genomic DNA was extracted from leaf material that was dried in silica gel or from herbarium specimens, using a 6% PVP method Before alignment, primer sequences were removed from both ends of the sequences, so that all sequences begin and end at homologous sites. We then constructed two data matrices on which to perform alignments: Matrix 1 in which all sequences reflecting the raw sequence data and exhibiting two different forms of the inversion region (the “raw sequence” matrix); and Matrix 2 with the inversion replaced with the reverse complement of its sequence for 19 sequences, such that sequence homology was maximized across the inversion region (the “uniform inversion” matrix).trnH-psbA, sequences were poorly aligned across species in the 5′ half. We subsequently manually edited the alignments by realigning the first 45 bp of short sequences (“edited” matrices).Both matrices were aligned using default settings in ClustalX We performed neighbor-joining (NJ), UPGMA, and maximum parsimony (MP) analyses on all matrices, following previously published barcoding studies e.g., , using PFollowing previous barcoding studies, the number of variable sites within species, maximum intraspecific uncorrected p-distance, and minimum interspecific uncorrected p-distance were calculated for the six species that are polymorphic for the inversion region, using alignments based on both the raw sequence matrix and the uniform inversion matrix. The minimum interspecific distances were calculated by comparing sequences of the species of interest to sequences of all remaining species in the dataset. Characters that include insertions and deletions for any of the conspecific sequences were noted but excluded from these calculations.trnH-psbA region amplified easily from all samples included in this study. Lengths of sequences range from 214 (Gentiana douglasiana) to 489 (Frasera puberulenta). In most of the taxa included, the loop region is at least 27bp and two species of Gentianopsis (G. macrantha and G. lanceolata), all less than 300bp, resulted in the misalignment of their first 40–45 bp relative to the remaining sequences, despite high conservation of sequence. We refer to the original ClustalX alignments as “unedited” in the ClustalX resulted in alignments for both matrices that appeared less than ideal for phylogenetic analyses. The short lengths of sequences of four species of Analyses using different methods resulted in different trees for the edited vs. unedited alignments; the trees differed in relationships among individuals, species and genera. In the remaining discussion, we focus primarily on relationships among conspecific sequences and how they differ due to treatment of the inversion region. Only the results of NJ analyses on the unedited alignments are shown in Gentiana, placed in subtribe Gentianinae, formed a second group. Within Gentiana, the species corresponding to Gentiana section Chondrophyllae consistently clustered together. Within Swertiinae, the sequences of Gentianopsis clustered together.All analyses of the raw sequence matrices, with both edited and unedited alignments, resulted in trees showing deep relationships consistent with our understanding of the phylogeny of these taxa Gentianopsis, one of the three sequences of G. crinita consistently clustered with two of the four sequences of G. thermalis , and one of the three sequences of G. macrantha consistently appeared more closely related to G. lanceolata (both with the B form of the inversion). Within Gentiana, sequences of G. fremontii with the B form always appeared more closely related to sequences from G. prostrata and G. nutans, also with the B form, than with conspecific sequences.In five of the six species polymorphic for the inversion region, conspecific sequences did not cluster together in any analysis of the raw sequence matrix e.g., . Within Frasera speciosa never clustered together; however, relationships of the sequences with the two conformations varied in the results of the different analyses. The two sequences with the A form of the inversion either clustered with sequences from congeners F. puberulenta, F. albicaulis, and F. montana . Relationships of F. speciosa sequences with the B form of the inversion also varied, clustering with Lomatogonium and Swertia (NJ trees), forming a basal lineage of a combined Frasera group (UPGMA trees), or forming a basal lineage of a combined clade including other Frasera, Lomatogonium and Swertia (MP trees).In all analyses of the raw sequence matrices, the four sequences of Gentiana algida consistently clustered together in all analyses of the raw sequence matrix despite their polymorphic inversion region. This species is the only representative of Gentiana section Frigidae in this study.In contrast to the five other species, the three sequences of Gentianopsis crinita, Gentianopsis thermalis, Gentiana algida, and Gentiana fremontii, consistently clustered together, in line with our understanding of species limits within these taxa based on morphology, geography, and other genetic markers. The three trnH-psbA sequences of Gentianopsis macrantha are identical to each other, once the inversion region of sequences with the A form was replaced with the reverse complements, and also identical to the sequence of Gentianopsis lanceolata. Other markers may distinguish these species .Analyses of the uniform inversion matrix consistently showed close relationships among conspecific sequences in five of the six species polymorphic for the inversion region e.g., . In all Frasera grouped together; however, relationships among the four sequences of F. speciosa differed in trees from different analyses. All F. speciosa sequences formed a clade in MP trees of the unedited alignment and clustered together in UPGMA trees. In NJ trees, two individuals of F. speciosa clustered with the sequence of F. caroliniensis. In the MP strict consensus from analysis of the edited alignment, relationships among the F. speciosa sequences were unresolved.In all trees, all sequences of trnH-psbA, with original configurations of the inversion, ranged from 17 to 25, or 3.8–9.7% of the total length of trnH-psbA is more than twice the distance between the Wyoming G. thermalis and a specimen of Gentianopsis holopetala (0.00937). This patrnH-psbA, DNA barcoding may be more likely to fail in distinguishing among closely related species, if the inversion is not recognized and realigned so that all sequences have the same configuration of the inversion. For example, sequences of Gentianopsis crinita and G. thermalis with the same configuration of the inversion only differ by five substitutions (excluding indels) that are all located outside the inversion region of the total length of n region . Conversnversion . If suchtrnH-psbA region are not unique to Gentianaceae. Interspecific inversions have been identified widely in Angiosperms trnH-psbA region within the chloroplast genome. They have been found in rpl16psbC-trnStrnL-trnFatpB-rbcLInversions in the intraspecific inversions might be problematic for barcoding, but did not test this hypothesis with empirical data. Prior to this paper, intraspecific inversions have rarely been reported but are not unknown. Two studies have previously documented intraspecific inversions in trnH-psbA, including a 30bp inversion in two species of SileneMagnolia macrophyllatrnL-trnF spacer region, another commonly used phylogenetic marker that has also been proposed for DNA barcoding Jasminum eleganstrnH-psbA inversions within a plant family.Some authors Gentianopsis (“fringed gentians”) have proven challenging to distinguish morphologically, as shown by the frequent misidentifications in herbaria and databases. Thus, the concept of using DNA sequence data to identify species is appealing. We have successfully employed trnH-psbA and other markers to identify tiny rosettes, lacking key floral characters, to species (unpubl. data). However, our ability to do so rests on pre-existing densely-sampled phylogenies that allowed us to identify lineages. These in turn rely on our taxonomic and morphological expertise that enabled us to infer how lineages correspond to species limits. Our strategy of sampling within species to clarify intra- and interspecific variation led to the discovery of intraspecific inversions in trnH-psbA.Although many species of Gentianaceae are conspicuous and well-known wildflowers, some are cryptic, especially when vegetative. Even when flowering, species of trnH-psbA may serve as a useful caution: algorithms that screen for structural mutations, including inversions as well as insertions and deletions, may need to be incorporated into the bioinformatic toolkit to be used in DNA barcoding generally, for all markers.The suggestion that DNA barcoding could be performed by non-professionals, or automated e.g., , is appeFrasera speciosa that share the same inversion form also share two unique substitutions and two indels, of 9bp and 26bp, suggesting that their shared configuration of the inversion may reflect shared history. Omitting regions subject to inversion from analyses may also result in the loss of informative substitutions within the inversion region that may serve to distinguish among closely related species Click here for additional data file. |
In systems biology, and many other areas of research, there is a need for the interoperability of tools and data sources that were not originally designed to be integrated. Due to the interdisciplinary nature of systems biology, and its association with high throughput experimental platforms, there is an additional need to continually integrate new technologies. As scientists work in isolated groups, integration with other groups is rarely a consideration when building the required software tools.We illustrate an approach, through the discussion of a purpose built software architecture, which allows disparate groups to reuse tools and access data sources in a common manner. The architecture allows for: the rapid development of distributed applications; interoperability, so it can be used by a wide variety of developers and computational biologists; development using standard tools, so that it is easy to maintain and does not require a large development effort; extensibility, so that new technologies and data types can be incorporated; and non intrusive development, insofar as researchers need not to adhere to a pre-existing object model.By using a relatively simple integration strategy, based upon a common identity system and dynamically discovered interoperable services, a light-weight software architecture can become the focal point through which scientists can both get access to and analyse the plethora of experimentally derived data. Within the life sciences we continually see a steady increase in the volume and complexity of data being generated by experiments. The management of this data requires rapid development of high quality integration and analysis tools. This paper discusses a software architecture designed to fulfil this need by providing a mechanism for the structured integration of data, and analysis tools, in an extensible and straightforward manner.Systems biology has the same data management requirements as many other fields of science, but due to its interdisciplinary nature and strong association with high throughput techniques these needs are more apparent. These requirements are to allow for: the rapid introduction of new data sources derived from new and emerging technologies; the interoperability between analysis tools written in a variety of different languages; a means to integrate data sources to support data mining and searching operations; and the ability to directly access the experimental data and associated metadata. Designs based on enterprise systems can provide solutions to these problems within an organisation, but they have to be tailored to suit the specific needs of researchers.Life science research enterprise data integration and process management systems have evolved over the last 15 years, effectively since the creation of open interoperable object based communications (e.g. CORBA). This evolution has been from single database based solutions through to open, distributed, interoperable data management solutions. This has been driven by demands for rapid development, high levels of interoperability and increases in data volume and complexity.The development of data management systems to support the life sciences has undergone a number of fundamental changes in the last decade , DBMS became popular as they provided a means to develop solutions that could: keep pace with the rapid advances in research; were scalable, robust and easy to develop; and were interoperable. These are now widely used as a basis for integration . The advantages of these approaches are based on their lightweight specifications and ease of implementation (e.g. DAS). Newer programming constructs, such as AOP, dramatically reduce the complexity of code of Web Services, and partly accounts for their widespread adoption . One of the challenges associated with Web Service architectures is their lack of semantics. In response, ontology-based solutions were developed (e.g. S-BioMoby), although these largely depended on slowly evolving globally accepted ontologies. Designs using distributed runtime type checking and type mapping are now emerging , as thesThere is a natural progression with these systems, as they generally follow the traditional approaches to software designs that are prevalent at the time (e.g. MDA). This means that the designs have an inherent underlying "predilection for the pedestrian". However, with each stage the flexibility of the designs increases. This means that with directed effort it is now feasible to extend the currently available enterprise technologies to provide adaptive systems that are able to satisfy the unique nature of systems biology based scientific research. Such an approach, however, requires a new type of thinking both in terms of distributed systems and algorithm development. The traditional approaches that are currently being developed are designed to work with "finished" data, not research information. In such static views, reuse is generally based upon the development of a standardised interface, followed by adoption or implementation of the required components. This style of architecture works well within publishing scenarios, where information is to be made available across the internet as a community resource. When working within a research project, typically within an intranet, where new technologies and ideas are continually being developed, these static publishing approaches (even including semantic web and grid based technologies) are not appropriate. Instead, a flexible analysis and access system is required that allows for the rapid introduction and integration of many types of data.This paper is technical in nature, and is designed to be of use to both software developers working within research environments and for their project managers. The results section gives an overview of why the system was developed, and describes the architecture. The discussion section outlines further areas where we feel work needs to be focused. The final section gives our conclusions about why systems similar to the one described herein are needed. A glossary of terms is then given at the end of the document.3 (or I-cubed). I3 is a light-weight service orientated architecture which is designed to integrate disparate data sources and tools without the need for significant reimplementation or modification. The system is designed to ensure that people can always get access to experiment information, without the imposition of specific formats or language restrictions. The system utilises a number of common and open standards to: provide a high of interoperability with third party solutions; ensure that the code can be easily maintained; and minimise the cost of development.This paper discusses the requirements and design of the ISB Informatics Infrastructure, which is abbreviated as IThe system was designed to support communities of largely independent research groups who have a desire to ensure that their data (and tools) can be easily shared. An organisation should consider adopting this architecture, or a similar mechanism, if the following are required:The approach we propose allows for tools to be integrated "as-is", without the requirement for recoding (e.g. glass box or black box integration). If it is difficult, or undesirable, to impose a high level standardisation with an organisation then such a non-intrusive development scheme will be useful.The system is designed to support a community which uses a diverse mixture of environments , programming languages and applications by providing interoperability between both data access and analysis tools.The software architecture, we have built, is designed to work within research environments where the needs of the scientists are continually changing. The system can be rapidly adapted to integrate new experiment technologies, analysis mechanisms and data sources.3 integration is designed to be "as is", meaning that wrappers (or proxies) must be implemented for each nonstandard component that is to be integrated. For standardised components generic wrappers have been developed (e.g. for JCR). The proxy systems provide the minimal descriptions of the data sources or analysis tools that are required to ensure a level of integration. For data sources the proxies must be able to map to and from a global identity scheme, so that both the data (and associated metadata) can be uniquely referenced and retrieved. Analysis tools are made available as SOAP based Web Services, with the interfaces they offer and a taxonomy defined description being published on a central registry.The IThis section firstly introduces the design principles we used when building the system, these were based on experiences in delivering a system that works within a multidisciplinary research organisation. The architecture of the system is then described, with an example use case and a discussion of the shortcomings of the system.The design rationale behind the software architecture, discussed herein, has been driven by the requirements of scientists and the types of data that they generate. The architecture needed to be flexible enough to integrate research data gathered using a varied collection of technologies and platforms, including: microfluidics based cell growth analysis involving both FACS and specially built LabView controlled 'lab on a chip' platforms; proteomics mass spectrometry results generated via the Trans-Proteomics Pipeline (TPP) , which wFlexibility is essential as the needs are research driven, so it is rarely possible to foresee the use to which data from these and future technologies will be applied. The results of these technologies have to be made available to a varied user community including: software engineers, who require programmatic access in a variety of different languages; computational biologists, who require that the results be available in a structured format for data mining and integration; and bench scientists who desire direct access to the data through a variety of tools and analyses. Therefore, the developed architecture had to be able to support a growing number of different experimental technologies and provide for a means to flexibly deliver the required data and analysis tools to a variety of environments.To ensure that the architecture would be suitable for our needs, its design was driven by the following axioms:At the cutting edge of scientific research there is a continual requirement for the introduction of new data sources, data analysis mechanisms, and changes in project focus. These requirements mean that there is minimal regard for formal design and data modelling. To ensure the expediency of software, it is typically continually being produced through rapid development in an isolated and non-formally designed manner . This lack of structured design is part of a growing global trend . This trtransportation of object graphs towards the retrieval of related documents. The distinction between documents and objects is subtle, albeit important: objects are for programs, whilst documents are for people. An object is by its very essence a "black box" which contains domain and platform specific information. Objects must be explicitly translated between languages, and must be serialized for transmission through an object protocol . Documents are open and readable, and so lend themselves more easily towards the social aspects of a distributed system. With a document centric approach the interactions are more natural and flexible: the document can be saved and retrieved from a file system using standard desktop tools; the information can be retrieved through numerous media, for example through a web page or from an email received from a colleague; and documents can be directly browsed and their contents edited. This shift in thinking has been driven by changes in technology, in essence: we now have the desktop computing power required to deal with operations associated with handling and transforming large numbers of documents. The detachment of documents from the underlying storage does present a challenge when supporting collaborative operations, as generally concurrent and transactional control strategies have to be implemented that work within a stateless environment.Over the last decade, in distributed computing, there has been a shift in philosophy from thinking in terms of the As discussed above, the architectural decisions made for systems biology based research enterprises are driven by the need for functionality and rapid development rather than shared data models and unit tests. The traditional top-down approach to design is rarely used, with a bottom-up approach being prevalent and arguably preferred . In the de novo solutions, which is a waste of resources and funding, and typically leads to a sub standard and non maintained solution. By using and expanding available computing technologies, the community can also gain an understanding as to their limitations and what is required to ensure that they can become more appropriate for research.The risk with any research lead computing project is that the novelty of the software can become more important than the production of innovative functionality required to meet the demands of science. By focusing on innovating through using and extending existing solutions, the best use of the available computing technologies can be made. In the past a number of high profile "omics" integration projects have initially ignored the current mainstream software architecture and standardisation efforts. Within a few years these larger projects have aligned themselves back with the mainstream. An example of such adoption is the migration to standard technologies such as Web Services and Hibernate by later versions of the caCORE infrastructure. The reason for this realignment is that these large scale projects have found themselves attempting to implement solutions which are clones of already existing well maintained generic systems. These projects have gone on to innovate, but they have done so by building on top of existing standards and solutions. When building systems it is essential to reuse the best tools from other application areas as this ensures a high return on investment. This high return results directly from not continually developing These axioms led us to develop the solution described in the next section, which: is based on distributed documents, allows for a high level of interoperability and multiple integration mechanisms; uses third party components, so that there is a high level of standardisation and the development costs are kept low; and does not impose a rigid highly formal software structure, thus allowing the scientists to keep the flexibility they required to undertake research.3 is a modular, service-oriented, research enterprise architecture which is capable of integrating emerging technologies . However, formally defined domain specific data models and services (top-down) are provided through a number of services and formal definitions.The IThis architecture is designed to be flexible, interoperable and light weight, while enabling the rapid development of new solutions and integration of new technologies.The solution discussed in this paper uses two approaches for providing the desired middle-out functionality:• A central registry is used to define the functionality of distributed data analysis services. The data analysis architecture is based around Web Services, with an ontology describing the Web Service being stored in a registry service, so that resources can be reasoned over and discovered at run time. A central registry service is used to store information about a set of individual services, including: data about the functionality of the service; and the group which offers the services. This means that the formal top-down descriptions are detached from the underlying bottom-up services. These descriptions are standardised through the use of a taxonomy, which describes the analysis methods and the data that the registered services provide. This "separation of concerns" means that the services can be written easily and the definitions can be updated independently of the individual services. Such approaches do have limitations in terms of complexity of data/algorithms that can be described, and do require good coordination to function. A number of alternative specifications which follow this pattern have been proposed .• A unifying identity based system is used for data access. The data access uses URNs, which are encoded as Life Science Identifiers (LSIDs) , to provAlternative middle-out solutions are becoming available. In particular, the semantic web (Web 3.0) provides a means to develop middle-out solutions, with each service being closely coupled with a formalised description. The semantic web offers a range of technologies which are useful (e.g. OWL for definitions and SPARQL for access/querying), although this work is still ongoing. The advantage of the Web 3.0 approach is that data and semantics can be served out using the same mechanism.3 does not directly impose a structured data model on clients, the system uses a standardised ID mechanism coupled with the use of 'meta models' and service ontologies. This means that to integrate new data sources "proxy components" must be constructed which can provide mappings between underlying domain specific identities and the universal identity system. In this way, all data items (and their associated metadata) are uniquely identifiable and can be directly retrievable. To ensure a high level of interoperability, the integrated tools are made available through SOAP based Web Services. All the tools and data sources are registered with a central registry system, so that they can be discovered at runtime.The IThe key features of the system are:literal documents coupled with a well defined interface (e.g. SOAP 1.2 with WSDL1.1+) means that clients and servers from the major languages can now interoperate in a stateless manner. The WS-* standards are a move towards a level of interoperability which will provide the features that are necessary to support a true enterprise application. By providing a high level of interoperability, researchers can develop algorithms in the way they prefer.The system is designed to be interoperable between the target programming environments . Interoperability tests were developed for each of these languages, and the services within the system adhere to a subset of the WSDL1.1 document/literal standard. These provide a collection of standards for making remote method calls to retrieve and analyse information. In brief, the salient Web Service related technologies are: SOAP which provides the means for transporting documents to and from a Web Service; the WSDL which defines the interface for the Web Service; and the UDDI registry which stores information about the location and features of the Web Service. These technologies have undergone a number of evolutions, and with the adoption of the WS-I basic profile there is now true interoperability between Web Services. The use of standard rd party code for the generation of LSID services and development of Java based Web Services from skeleton code (using Axis 2 from Apache); and the rapid development of R-based Web Services . Rapid integration for the client is supported as developers only need to know how to access their data and are not required to adhere to a pre-specified object model.An identified problem with SOAs is that their lack of formalisation means that their adoption within an organisation is problematic. The problems that arise are due to the fact that people can use the services without having to integrate their code. This means that widespread adoption of the architecture requires political persuasion, as well as technical argument. To encourage adoption rapid application development (RAD) is needed. RAD requires both rapid integration of services by clients and rapid deployment of services into the architecture. The architecture supports rapid deployment of services by: the use of 3The system is designed to be non-intrusive, so that different groups can use their own object models and data formats. As there is no overriding object model, developers can integrate with the architecture in a post-hoc manner. Fundamental to such non-intrusive development is the use of a hierarchical identity system, which can be used in the 'bottom-up' style of SOAs that arise within the research enterprise. By using such an identity system, each group can develop their own sets of identity assignment and resolution services, which can be integrated with external resources. We have used the hierarchical naming system LSIDs, which provide a unique ID system based on URNs, where a unique identifier is sent to a server which dynamically resolves it to a data document and metadata. The metadata is encoded as Resource Description Framework (RDF) documents. As the identifiers themselves are resolved, the client can always drill down to the experiment information without having to conform to a specific object model or data format.rd party applications . Such use of 3rd party tools means that both the development and maintenance costs are considerably less than with de novo development. The system is designed to be dynamically extensible, so that new services can be integrated using standard protocols and tools.Wherever possible we have used common data and computing standards. This means that we benefit from using the best of 3Central to the system is a registry service, which can be reasoned over to discover the required service(s) at run time. While Semantic Web technologies are not yet mainstream, aspects of their behaviour can still be used within any distributed environment. We have defined ontologies to describe both the data and the services that produce them. The service ontology is three-faceted, and describes different aspects of the services: an administrative ontology is used to define behaviour associated with maintenance and versioning of the service; a functional ontology is used to provide a high level description of the group who control the service and the function to which it is applied; and a descriptive ontology allows for the development of textual tags. The service description is stored in the registry, so that it is detached from the service itself.3 to support a number of active research areas at the ISB, including genomics, microfluidics and imaging. An illustrative scientific application which has been built using this architecture is given in the example high throughput imaging section below. Further information about technologies and usage are given on the associated web site [We have used Iweb site .We have applied the infrastructure in a number of core areas at the ISB. In particular we have used the system to develop: high throughput technology data repositories and distributed analysis systems .3 is in the development of software for the automatic analysis of high throughput cellular imaging , and information about the type of data/area within which the services function.All middle-out solutions have limitations, as they attempt to overlay structure on ad-hoc and unstructured services. Generally middle-out solutions sacrifice richness of functionality to provide flexible systems. The requirement for interoperability and the reliance on standardised solutions result in a number of disadvantages with the adoption of the architecture discussed in this paper. The major drawbacks to such a loosely coupled middle-out solution are:current thread mapping system, are not applicable to the protocol independent document based interoperability mechanism used within our system. As the method calls are inherently stateless, custom engineering or a stateful specification are required to introduce state within the system. With the convergence of the relevant standard implementations (e.g. WS-RF family) this problem can be addressed, although true interoperability will require further maturation of this family of technologies.The main mechanisms for associating state information, through external service(s) or use of a The system relies on the underlying protocol to provide security (e.g. SSL session based), which means that fine level security based on an access control list (ACL), or similar, is not available. As with state behaviour, there are a number of standards that will provide this functionality in the future, but no truly interoperable implementations are currently available.There is no simple mechanism to support resource locking or leasing. This lack of distributed transaction (e.g. two phase) behaviour will cause problems with multi-step analyses, typically through the occurrence of lost updates. Again, while this problem arises due to the lack of current thread identity or explicit token transference, there are solutions based on either custom engineering or arising standards efforts.Top-down defined behaviour, typically in the form of workflows, is an essential part of scientific analysis. Such process-oriented architectures generally require top-down design, as failsafe behaviour is generally essential. While the architecture does not directly support this type of processing, workflow systems could be overlaid on the services to provide process-oriented views (e.g. through BPEL scripts). While such scripting will allow for distributed processing, there is still a disadvantage with using the architecture for high demand large scale processing, where the most efficient solution is to move the analysis to the data (and not vice-versa).showstoppers, it is important to recognise that such ad-hoc service oriented architectures have limitations. These limitations can be overcome, but they require custom engineering which is strongly dependent on the individual enterprise.While none of these disadvantages are It is no surprise that the evolution of enterprise software for the life sciences closely follows technological and methodological trends. There is an implicit understanding that there exists a commonality between all enterprise systems, in terms of the underlying design. It is assumed that information and processes are the same no matter what the domain. Unfortunately, this perceived commonality is a fallacy when applied to the life sciences. Software is only part of the solution and the way in which people work and interact is equally important and cannot always be captured using simplistic requirements gathering methodologies. In complex computing endeavours, the social demands go beyond those usually considered in more traditional "factory software" design and development.There is no such thing as the quintessential scientific research project, as every one is unique. These differences arise as each investigator and investigation studies the unknown, which means that the rationalization, which is typically needed for the design of expedient software utilities, is missing. However, it is possible to develop a level of rationalization about such studies using abstractions which describe different facets of the data and process . The majority of "off the shelf" scientific information integration systems are generally targeted towards the end results of research, rather than aiding in the progression of scientific understanding. To support the needs of research driven science, architectures need to be provided which can be adapted to new usage and have a low maintenance cost. This flexibility requires working at a level of abstraction that is atypical for most software projects. To build systems which others can readily use we need to focus on the fundamentals of content and identity, rather than solely attempting to model biological entities. Fortunately, there are a number of existing technologies which can be used as the foundations for such endeavours .Some of the development effort in a research environment is for one-off applications, while other projects are geared towards more general usage. With general usage software, even if it is well written with good interfaces, the chances of the code surviving much past the end of the research funding is small. The problem is largely one of adoption and usage; unless there is a demand for the code and it can easily be adapted for new usage, it is impractical for other groups to adopt it. This is not a new phenomenon in software engineering . That stWe recognise that the need for a "systems biology enterprise" is to develop an architecture that provides tools for manipulating data, without necessarily understanding all aspects of the contents. While information is an abstract concept, it is possible to formalise how we deal with it within the enterprise. This formalisation, in a service oriented architecture, takes the form of generic cross-cutting services which can be used in a large number of varied applications. The Object Management Group (OMG), and other standards bodies, have outlined the functionality of such services, including: relationship service, which can dynamically provide relations between documents; a synonym service to find documents of terms that identify the same concept; a query service to search through collections; a registry service to host information about other services; and a lexical service to allow for a common ontology to be used across different applications. While implementations of these services exist, few are generic or mature enough to be readily available. We feel that the development and maintenance of such horizontal services will be of benefit to the systems biology community, and so a large proportion of our future work will be in this area.3. Additionally, the adoption of technologies that will allow for the overlay of top-down functionality on a standardised SOA can provide the required functionality. In particular, the Business Process Execution Language (BPEL) and associated graphical tools offer an attractive and low cost mechanism to provide a means for the rapid development of top-down workflows.There will always be a need for structured top-down formalised analysis of scientific information. To allow for such an analysis, middle-out architectures, which marry the benefits of bottom-up and top-down, are an ideal solution. Such middle-out architectures can be achieved through the use of structured documents, as we have used in IDynamic discovery of information is essential in all data driven domains. The use of formalised methods to ensure the resolution of individual data items, and relationships between these data items, is essential. As systems biology is largely data driven, we advocate the adoption of a dynamic hierarchical identity system (e.g. URNs encoded as LSID or similar). A hierarchical identity system allows each group, with an organisation, to use their own namespace and ensures that that no matter what format the data is in, or the delivery systems that is used, it is always possible to resolve back to the original experimental results. We also use structured documents (RDF) to describe metadata, these can also be used to capture a wide range of relationship types. The modelling of these relationships typically evolved past the traditional composition (part of), aggregation (has a) and generalisation (is a) relationships towards operational relationships which support a richer semantics based on both our scientific understanding and the data provenance. Any data resolution system will be expected to understand data provenance information including: history information to allow for the discovery of different versions of documents; view information to allow for the discovery of context dependent transformed documents; and query information to allow for the dynamic discovery of related documents. At present there are no readily available implementations of an identity scheme that support all the required functionality.ad hoc manner. This trend is even more apparent at the cutting edge of scientific research in systems biology, where there is a continual requirement for the introduction of new data sources, data analysis mechanisms, and changes in project focus, which means that formal design and data modelling are minimal. Within the scientific community there exists a rich and varied user base, some develop software and some require a reliable analysis system. The development community ranges both in terms of software experience and the languages they use. This paper perpetuates the view that the successful development of an architecture to support such research requires a different strategy to that of mainstream enterprise systems. The adoption of grid systems or Service Oriented Architectures are only a first step towards the next generation of enterprise systems that will be of use to the scientific community. We feel that due to the rapidly evolving requirements of biological research, when compared to that of rigorous software development, the next generation of software architectures will be required to support bottom-up integration. This means that architectures will have to work at a higher level of abstraction, so that they can be used to integrate data and tools without the need for costly reimplementation. The core of such integration will be operations using a rich identity driven data system coupled with domain specific descriptions.The coupling of rapid development and rapid deployment (e.g. through Web Services) means that it is now relatively easy for disparate groups, both within the enterprise or throughout the Internet, to share information in an The development of integration strategies for systems biology is problematic due to both the nature of science and the organisation of scientists. It is typical that the means to which a specific technology will be used, and the methods used to analyse the resulting data, is unknown at software design time. Scientific understanding evolves, and so too does the work that is undertaken. A software architecture that is designed to aid in such endeavours has to be designed to support such evolution, meaning that traditional approaches to development can rarely be applied. As we do not know how the data will be used or analysed, a flexible solution, like the one discussed in this paper, is needed. In the future, we can expect a growth in the requirement for such unstructured development. Thus, the supporting integration systems will need to provide for the flexible post-hoc integration of black box components as a fundamental design principle.Related downloads and documentation can be found at the ISB informatics group page: BPEL. The business process execution language is a specification designed to support the high level orchestration of web services. The heart of the BPEL specification is the scripting language which defines how services and data produced by them are linked together. This specification is rich enough to allow for most workflows and defines both how method invocations and data are linked and the how web services should be coordinated . The specification also defines extensions to the WSDL which can be used to specify links between services . A number of implementations are available, including those that run under JBOSS [er JBOSS and ODE er JBOSS . InformaCORBA. The Common Object Request Broker Architecture supports interoperability between distributed processes (applications). Central to the architecture is an ORB (object request broker) which both marshals data and controls compartmentalisation of between the different processes. The specification was defined by the OMG, and ORBS are available for most platforms.DAS. The Distributed Annotation System [n System defines DBMS. A database management system is the environment in which database instances exists. A DBMS provides a unified framework which can be used to control the physical (tablespaces), conceptual and external (views) of databases.DCOM. Provides for a means to make distributed calls between COM (Component Object Model) objects. Thread compartmentalisation and marshalling (using low level XML interchange) is handled automatically. For application developers this has largely been superseded by .NET Remoting.EJB. An Enterprise Java Bean (EJB) is a server side component that lives inside an EJB Container. There are different types of EJBs, and each has a different purpose: an entity bean which serves as a data cache from an underlying data store, this is used for transformation and data integration logic; a session bean which is typically used to hold application logic which communicates with information stored within entity beans; a stateless session bean which typically represent simple stateless logic and generally act as end points for high level services; and a message bean which is used to pass message between the other beans. The EJB 3.0 standard (2006) represented a major change as the complexities of developing EJBs was inhibitive for most projects, so a simplified process of building EJBs was outlined . Full details are available from Sun [from Sun .EJB Container. The EJB container controls the life cycle of the bean, facilitates access to core services and manages server-based resources. The services that are available through a EJB Container provide: security management, including method level and ACL; transaction management; including 2 phase/distributed commits; life cycle management, including pooling of bean instances and swapping beans in/out (persisting) of memory for resource management; naming/directory management, typically through JNDI; persistence management; using ORM tools such as hibernate; remote access management, so that the bean can be accessed via RMI-IIOP/CORBA and Web Services; and a number of utility services . A widely used, and free, container is JBOSS [is JBOSS .I3C. The I3C was a short lived commercially led organisation established to standardise aspects of life science informatics. The organisation was led by Oracle, Sun and IBM. The I3C did promote the use of LSIDs, which have been adopted by the OMG.IDL. The Interface Definition Language formalises the remote interfaces that can be accessed through CORBA. IDL has evolved considerably, with the advent of pass-by-value and components (facets). A WSDL serves the same type of purpose for Web Services.JCR. The Java Content Repository is a specific Java Standard (JSR-170) for defining the interface to a content repository. A content repository is a flexible system that is typically customised for a specific usage, when customised it is referred to as a Content Management System (CMS). A number of implementations are available, including Jackrabbit which is licensed through Apache [h Apache .LSID. The Life Science Identifier standard [standard providesstandard .LSR. The Life Science Research group of the OMG [ the OMG defines MDA. A Model Driven Architecture is one where the model underlying the system is defined in a language independent way, and the corresponding services/classes are automatically pushed out from that model. Typically the model is defined in UML and them XMI is used to automatically generate stubs/skeletons which can be used to provide implementations of the model.MIDL. The Microsoft Interface Definition Language serves a similar purpose to IDL, but is generally based on specifying the remote procedure call interface which is used between COM components..NET Remoting. The .NET framework provides a mechanism for making remote calls called Remoting. Remoting includes many useful features for the development of distributed systems, these include: life cycle management, so that distributed behaviour/GC and leasing can be controlled; protocol support for binary socket based communication and other streams; and specification of the behaviour of a remote service/object (e.g. singleton).ODBC/OLEDB. The Open Database Base Connectivity is a definition of the interface presented by a DBMS. The ODBC specification is well established and bridges with other technologies (including JDBC). The OLEDB is an extension to the ODBC offer richer functionality.OMG. The Object Management Group [nt Group is an opnt Group ) standarOWL. The Web Ontology Language is an RDF description of an underlying data resource. The ontology describes the data items produced through a web service as well as the relationships between them. Details are available from the W3C [ the W3C .RDF. The Resource Description Framework is a W3C (WWW consortium) standard for describing resources available on the Web. RDF forms the basis of formalised descriptions of services (e.g. OWL) and can be used in conjunction with extensible metadata descriptions (e.g. Dublin core [lin core ). RDF colin core .REST. Representational State Transfer (REST) [r (REST) can be cRMI. Remote Method Innovation is a Java-to-Java solution for communication between distributed Java threads/applications. RMI uses a number of abstraction layers (remote reference layer/RRL and transport layer), this has a number of advantages including the fact that different underlying protocols can be used to actually provide the communication (e.g. IIOP). Marshalling is done through serialization, leasing is available, and distributed GC is supported. RMI is a convenient, but not interoperable, protocol.SOA. A Service Oriented Architecture is one which consists of loosely coupled federated services. There is typically little linkage between these services, and they are generally discovered dynamically using a registry system or similar. SOAs have grown in popularity within many enterprises, as they provide a practical mechanism for disparate groups to share information/processes.SOAP. SOAP is a protocol for making requests on remote services to return structured data. It is designed to use a any high level protocol that supports the sending of information, and is primarily used with HTTP. Much like CORBA, interoperability is the big draw of SOAP, and (unlike CORBA) SOAP has the advantage of being simple to develop and test. The original stateless nature of SOAP limited it usage, however with the advent of WS-RF (and other standards) SOAP is maturing into a general purpose object protocol. More information about SOAP specifications is available from the W3C [ the W3C .SPARQL. The SPARQL Protocol and RDF Query Language is designed to allow for the querying and retrieval of documents across multiple unstructured data stores. The power of the system is the distributed RDF documents (or other data stores) remain unchanged, but queries can be run across them – and so it fits well with a "bottom-up" approach. Such a unified approach to accessing information is required to make the semantic web (Web 3.0) a reality, and there do already exist some implementations (e.g. Virtuoso [Virtuoso ). More iVirtuoso .UDDI. Universal Description Discovery and Integration is a WSDL (therefore interoperable) defined registry/dictionary system. UDDI 2.0 is the currently used version, and it supports the registration and querying of Web Services using specific mappings. OASIS [s. OASIS have dets. OASIS .URN. A Uniform Resource Name is a type of URI (Uniform Resource Identifier). It is the logical counterpart to a URL, in that it provides the name of a resource rather than the exact location of a resource. A number of URN implementations are available, including LSIDs.Web Services. A Web Service is a server which performs request/response operations and works using documents. A request is sent (either as a well formed document or using http encoding), and a well formed document is returned. The term Web Service originates from the fact the web based protocols are generally used to provide the communications.WS-*. The WS-* are a series of specifications for adding functionality to SOAP. These extensions provide new functionality such as security, messaging, binary object attachment and state. These extensions generally involve the addition of information to the SOAP message (within the envelope). State information can be maintained between SOAP calls through the use of resource frameworks (e.g. WS-RF). OASIS [). OASIS keep a lWSDL. The Web Service Description Language provides a means to specify the interface exposed by a SOAP Web Service. The WSDL document can be automatically retrieved, and tools can be use to generate convenience classes for specific languages, so that no XML parsing code needs to be written by the developer. When writing a WSDL a number of standards (e.g. WS-I) are available to ensure interoperability, typically though the use of profiles with literal/document "styles". The W3C have details of the standard [standard .JB designed the system, managed the development team, and drafted the manuscript. SK worked on the high throughput imaging system, worked on key services and contributed to the manuscript. CC contributed to the manuscript, provided implementations, and standardised the metadata for the services. IS instigated and guided the project. All authors read and approved the manuscript. |
The Ambiguous Restraints for Iterative Assignment (ARIA) approach is widely used for NMR structure determination. It is based on simultaneously calculating structures and assigning NOE through an iterative protocol. The final solution consists of a set of conformers and a list of most probable assignments for the input NOE peak list.ARIA was extended with a series of graphical tools to facilitate a detailed analysis of the intermediate and final results of the ARIA protocol. These additional features provide (i) an interactive contact map, serving as a tool for the analysis of assignments, and (ii) graphical representations of structure quality scores and restraint statistics. The interactive contact map between residues can be clicked to obtain information about the restraints and their contributions. Profiles of quality scores are plotted along the protein sequence, and contact maps provide information of the agreement with the data on a residue pair level.. The Web site also contains an installation guide, a user manual and example calculations.The graphical tools and outputs described here significantly extend the validation and analysis possibilities of NOE assignments given by ARIA as well as the analysis of the quality of the final structure ensemble. These tools are included in the latest version of ARIA, which is available at The calculation of an NMR (Nuclear Magnetic Resonance) structure is most often realised in parallel with the assignment of NOEs (Nuclear Overhauser Effect). This task can be automatically performed in the software ARIA (Ambiguous Restraints for Iterative Assignment) ,2. The AIn the first iteration, all assignments that are consistent with the chemical shift assignment are applied to the structure. In each iteration, the current set of restraints is used to generate a structure ensemble. Statistics are performed after each iteration on each possible assignment and on how often each restraint is violated as a whole. The least likely assignment possibilities, and systematically violated restraints are removed. This results in a restraint list with fewer possibilities per restraint, and where the restraints that most likely correspond to noise peaks are removed. After the last iteration, the best energy structures are refined using a short molecular dynamics run in water .The current state of the protocol including ambiguous assignments and distance violations is summarised in several report files located in each iteration directory. Analysing such text files is difficult since they contain a large number of data. ARIA was thus extended to allow the generation of an interactive contact map, which provides a detailed analysis of the restraints and restraint contributions.Analysing the quality of NMR structure is a key step into the validation of an ARIA calculation. In that respect, it was recently shown that proARIA is written in the programming language Python. The version 2.2 of ARIA now also supports the Python extensions package Numpy for compIn each iteration, the current assignments are stored in the form of a binary file that can be analysed afterwards. An additional section in the GUI provides a way to read back the assignments and display them as a clickable contact map. This map is defined as a Tk canvas widget and each pixel is clickable to present additional information about this particular contact. A pop-up window displays the corresponding assignments in tables that can be exported as text files. The peak map can be saved in Postscript format.Postscript files describing RMS (Root Mean Square) differences from distance bounds and individual WHATIF scores along the sequence are automatically created at the end of each iteration or after the final structure analysis. The graphics are plotted with the matplotlib plotting library interfaced with Python. Quality and RMS profiles data are also stored in formatted text files for further use.For each ARIA iteration, the interactive peak map displays the pairs of residues involved in one or more assignment possibilities. Such maps can be generated from the current state of the assignment with three classes of restraints: (i) all restraints, (ii) ambiguous restraints and (iii) unambiguous restraints.i, j) on the map of these restraints. Multiple pixel selection is possible.Clicking on a pixel located at the position the restraints, through the RMS of deviations from the distance bounds, and (ii) the structure quality, through the WHATIF scores, The contact map displays the sum of the RMS deviations Figure per resiAn essential part in the validation of an ARIA calculation is the analysis of the quality of the NMR structures. Classically, the overall number of violations or the RMS deviations in addition to global WHATIF scores of the whole molecule are used to assess the quality of a structure. In the light of recent investigations , it is cThe graphical tools described here represent a significative extension of the possibilities to analyse NOE assignments and the quality of the solution given by ARIA. The tools were developed to allow an analysis at the residue level in an interactive way, which is critical for the assessment of the solution and the detection of errors.Project name: ARIA 2.2Project home page: Operating system(s): Linux, Mac OS X, SGIProgramming language: PythonOther requirements: Numpy, Tcl/Tk, ScientificPythonLicense: no license required.BB implemented the graphical tools of ARIA 2 and helped to draft the manuscript. AB participated in programming the tools. MN conceived ARIA, WR and MH implemented the version 2 of the program. TEM drafted the manuscript. All authors read and approved the final manuscript. |
N-1 regioselective Michael-type addition of 5-substituted uracils to (2-hydroxyethyl) acrylate is presented. The reactions were performed in polar aprotic solvents and with avoidance of polymerization of acrylic substrate. The obtained adducts may serve as versatile substrates for further functionalization, e.g. into (3-uracil-1-yl)propanoic acids or transformations, with participation of hydroxyl group, into ester-conjugated acyclic nucleosides. S)-3-hydroxy-2-phosphonomethoxypropyl cytosine, is an acyclonucleoside that possesses broad-spectrum activity against numerous DNA-viruses.-ethyl ester (4) .N-methylmorpholine as a co-catalyst. See 1H and 13C NMR spectroscopy. See The reaction was performed in THF at room temperature, in the presence of 4--4-methylmorpholinium chloride (DMT-MM) which is a frequently used condensing agent. The condN-1 alkylation of uracil rings using Michael-type addition has been elaborated. The complete regioselectivity has been attained in the presence of TEA as base. The tendency for polymerization of HEA has been successfully prevented. The application of the obtained adducts in further synthesis has been demonstrated.In summary, a simple and efficient method of File 1Experimental. The data provides procedures, physical properties and 1H and 13C NMR spectra of all newly synthesized compounds. |
The theme of the conference was “Advanced Technology of Radiation Medicine and Medical Physics Practice”. About 650 delegates from India and abroad, including 120 radiological / medical physics students from different universities of India participated in the conference. ICMP-2008 was inaugurated by Dr. Anil Kakodkar, Chairman, Atomic Energy Commission and Secretary to the Government of India, Department of Atomic Energy (DAE). While delivering the inaugural address, Dr. Anil Kakodkar summarized the importance of ionizing radiation in daily life, and the contributions of DAE / BARC toward the cancer control program of the country. He also stated that a sufficient number of trained technical manpower for safe medical applications of ionizing radiation is available in the country. However, there is a need to take the advanced technology equipment to the rural sector, improve the working conditions at rural medical institutions and remunerate the technically trained people adequately. In addition, he emphasised the need to restructure the training modules so that the trained manpower could efficiently use the advanced technology equipment for its intended applications. Shri S. K. Sharma, Chairman, Atomic Energy Regulatory Board (AERB) presided over the inaugural function and released the Souvenir and Book of Abstracts. In the presidential address, Shri S. K. Sharma highlighted the role of AERB in ensuring the safety and security of radiation sources. He also stated that though the radiation safety record in medical applications of ionizing radiation is very good we must be cautious while using advanced technology equipment for radiodiagnosis and treatment. Prof. Bhudatt Paliwal, Director of Medical Physics, Department of Human Oncology and Medical Physics, University of Wisconsin, Madison, USA, presented the keynote address where he described in detail the dosimetry problems associated with organ movements during intensity modulated radiotherapy (IMRT). The keynote address highlighted the feasibility of real-time motion tracking methodology during the delivery of IMRT. Dr. Anil Kakodkar felicitated five Ex-BARC scientists for their contribution to AMPI (See Annexure-1 for their brief bio-data).The International Conference on Medical Physics (ICMP-2008) and the 29One hundred eighty five papers, including the AMPI Ramaiah Naidu Memorial Oration, 29 invited, 35 oral and 120 poster papers were presented during the conference. Shri P. S. Viswantahan, Former Head, Department of Medical Physics, Tata Memorial Hospital, Mumbai, delivered the seventeenth AMPI Ramaiah Naidu Memorial Oration (RNMO). The RNMO award is bestowed on an eminent personality who has a long working experience in the field of medical physics with a good track record of academics, research, and clinical practice. The title of his deliberation was “Medical Physics in India: History, Development, and Activities”. During his talk he described in detail the early days (1943) and the current medical physics activities in the country, including commercially available technology and indigenous developments. He also listed the future directions to deal with hi-tech equipment and emphasized the need for harmonization in medical physics training modules. The key feature of ICMP-2008 was the AMPI-AROI (Association of Radiation Oncologists of India) joint scientific meeting on November 28, 2008, at Nehru Centre, Worli, Mumbai. The joint meeting was the first of its kind, which could be assumed to be the defining moment in the history of medical applications of ionizing radiation in India. Both the clinical and physical aspects of recent radiation oncology, such as, IMRT, IGRT, precision radiotherapy by Cyber Knife, adapted Telecobalt machines and Proton accelerators, Image guided brachytherapy, and indigenous development of radiotherapy technology were presented during the joint meeting. The joint meeting was useful for radiation oncologists, for improving their understanding of medical physics and the technological aspects of recent radiotherapy, while it was equally beneficial for medical physicists to understand the clinical requirements and associated complexities when implementing hi-tech radiotherapy. Panel discussion on “Newer Technologies: Promises and Pitfalls” witnessed the active participation of a large number of medical physicists and radiation oncologists. It was concluded during the discussion that technology is available for high precision radiotherapy and dose escalation, but it should be used discriminately as a majority of cancers require palliative treatment by conventional techniques.The scientific deliberations of ICMP-2008 covered the whole spectrum of medical radiation physics: Radiation Therapy Physics and Devices; Medical Imaging Physics and Devices; Radiation Dosimetry and Standards; Radiation Physics; Radiation Biology; Time Dose Models; Commissioning, Quality Assurance, and Audits; Clinical Aspects of Radiation Oncology; Clinical Aspects of Medical Imaging; Computational Tools in Medical Physics; Education and Training in Medical Physics; and Radiation Protection and Safety. Presentations on recent developments in the technology of radiation medicine and methodology of imaging and radiation therapy were the special attractions. The oral and poster presentations were evaluated for the best Oral and Poster articles. At the end of the conference “Improvement of ImatriXX in terms of spatial resolution and large field acquisition for patient specific IMRT verification” by Arun S. Oinam, Lakhwant Singh, Pradeep Goswami, Anup Bhardwaj, B. S. Rana, S. C. Sharma, from the Radiotherapy Department, Postgraduate Institute of Medical Education and Research, Chandigarh, India, and “Dosimetry of in-house designed circular cone for stereotactic treatment using MVCBCT” by Kamlesh Kumar Gupta, V. K. Sathiyanarayanan, Janhavi R. Bhangle, R. Vaitheeswaran, from the Department of Radiation Oncology, Ruby Hall Clinic, Pune, India were declared the best Oral and Poster papers respectively.The overwhelming participation of trades dealing with medical radiation equipment, dosimetry systems, phantoms, computerized treatment planning systems, and treatment accessories was the other attraction of ICMP-2008. A number of recent technological equipments and dosimetry systems (2-D array with high resolution), phantoms (Dynamic phantoms to simulate organ movements), patient immobilization devices (SBRT immobilization systems), and other related products were demonstrated in 32 stalls arranged near the conference venue.In summary, the conference deliberations were useful for radiation scientists, medical physicists, radiation oncologists, radiologists, radiobiologists, dosimetrists, and radiation technologists. |
Vomiting is commonly encountered in clinical medicine. When organic gastrointestinal, metabolic, and brain diseases are ruled out, many cases are considered to be functional. We experienced an adult patient with epilepsy whose main symptom was vomiting. Biopsychosocial approaches were needed to control the symptoms.A 26-year-old female with a 10-year history of persistent vomiting was found to have temporal lobe epilepsy (TLE). Throughout this time, during which the vomiting had become part of a vicious cycle, her epilepsy was poorly controlled by medication. Biopsychosocial approaches were employed successfully and the patient subsequently undertook training to become a home-helper, started a job, and was able to leave her parents' house and live independently. All of her symptoms resolved after she became self-sufficient.Vomiting without impaired consciousness is seldom considered to be a manifestation of epilepsy. Difficulty in recording an electroencephalogram (EEG) because of the presence of persistent vomiting delayed the diagnosis. The improvement of symptoms was thought to have been due to the patient's emotional stabilization and physical improvement, which may have stabilized the limbic system.When an illness persists for many years and conditioning and a vicious cycle occur secondarily, systematic biopsychosocial approaches are needed in addition to general treatment. Also, secondary symptoms make the diagnosis more difficult when efforts at treatment are ineffective. There are many medical causes of vomiting. If the patient is a young adult who has not suffered an injury, does not have an abnormality determined by brain CT or biochemical examinations, and has not experienced convulsions or episodes of loss of awareness, most doctors consider vomiting to be related to a gastrointestinal disorder. If all gastrointestinal organic diseases are ruled out, in many cases the condition is considered to be functional.Ictal vomiting is usually considered to be a rare clinical manifestation during seizures originating from the temporal lobes ,2. VomitWe treated to an adult patient with persistent episodes of vomiting lasting for several days. The patient's vomiting was not accompanied by impaired consciousness, and the diagnosis of epilepsy was only made 10 years after the vomiting was first reported. During that period, a vicious cycle involving the patient's symptoms and family relationships occurred secondarily, and biopsychosocial approaches to treatment were required. The elements involved in this case are relevant to the importance of systematic biopsychosocial therapy and the difficulty in diagnosing the cause of vomiting in some patients.The patient was a 26-year-old female with a 10-year history of vomiting. She had been hospitalized and had required intravenous hydration more than 30 times for that condition. Vomiting usually started with mild left abdominal pain, and did not subside even when the stomach contents had been emptied resulting in "dry heaves". Episodes usually persisted for several days. Throughout the vomiting episodes, her consciousness was clear. Antiemetic, antianxiety, and anticonvulsant drugs were not effective. When she was 25 years old, she first came to our psychosomatic medicine department where she received medical and behavioral treatments for what was diagnosed as cyclic vomiting syndrome (CVS) ; howeverThe patient's height was 165 cm and body weight was 55 kg. Her past and family medical history was noncontributory. The results of physical and neurological examinations, esophageal-gastrointestinal endoscopy, and routine biochemical examinations were all normal. She had not experienced external injuries, convulsion, loss of awareness, or migraine headaches. Electroencephalograms (EEGs) were recorded from 19 electrodes with A1+A2 as the recording reference. The patient kept both eyes closed during the recording. The recording was done approximately 500 times. On EEGs performed at high amplitude, 5~6 Hz waves and slow waves (Figure During one hospital stay, the patient complained that she could not speak smoothly, had cramping of the tongue, and clenched her teeth against her will. These symptoms subsided naturally within a few hours. After this episode, we learned that she had experienced such cramping twice previously. We considered this to be a symptom of automatism. Although consciousness was not impaired and haloperidol was not effective in stopping the vomiting, epilepsy was cited as a possible diagnosis. After recording EEGs several times, a high amplitude slow wave was obtained while the patient was awake, which correlated with the vomiting Figure . When shOn first consulting with this patient, we suspected that her illness had a complex etiology and that both psychological and medical approaches to treatment would be required. We reasoned that a psychological problem might be a trigger for her episodes of epilepsy. The patient's family and previous doctors had told her that her illness was caused by mental weakness. She had not attended college nor had she ever been employed, and as a result she had no hope for her future. She was in despair over her health, gave up being understood by others, and would not confide in others. She unconsciously needed the symptoms to escape from reality. We used both physical and psychological approaches in her treatment, involving relaxation techniques, breathing exercises, drawing pictures and counseling. She slowly started to discuss the family situation that had begun in childhood and had continued to the present. She said that her mother often disagreed with what she wanted to do and she began to think that it was no use thinking for herself. Her life at that time was filled with a sense of "abandonment". After she made a friend in the hospital and opened her heart to others, she began to speak tearfully in the therapeutic sessions. She said that she was aware that her symptoms had not been due to a physical problem but rather a mental one, and she expressed the feeling that she would be better off living away from her family. As a child she had been well behaved, and her mother paid little attention to her because she was busy caring for her elder sister, who easily got colds and became tired. When her elder sister entered college and was seldom at home, the mother began nagging the patient to do certain things and was overprotective of her. After several therapeutic sessions, her attitude was more positive. To support her "to do things on her own", we intervened with the family, who were of the opinion that "the patient with the illness was wrong". We tried to encourage the patient to become independent and to separate from the family, and we asked the father and sister to assist in that effort. We complimented the patient's mother for her efforts in caring for her daughter. When she left the hospital, she no longer felt "abandonment" but instead was committed to "live her own life by herself".After she left the hospital, she had some ictal vomiting when excessively stressed. We listened to her with empathy and acceptance, supported her both mentally and physically, and assisted her in establishing independence. Her symptoms markedly improved when she obtained job training as a home-helper and subsequently found employment. When she began to live alone and support herself, all of her symptoms disappeared Figure . Within We reasoned that the patient, who had had epileptogenesis from an early age, fell ill when her mother began to interfere with her life and overprotect her. The stress resulting from this situation was the likely trigger and modulator of her epileptic seizures. Because of her illness, she had little connection with society and her relationship with her mother had deteriorated greatly. As a child, she was considered to be "a good girl" and her mother gave more attention to her elder sister. When she fell ill, she might have had ambivalent feelings of joy over the mother's concern and rebellion against her mother's interference, and she may have then somaticized her ambivalence. As her mother often ignored her since childhood, she had fallen into an escape behavior pattern and retreated into illness when faced with stressors. As a behavioral pattern for avoiding problems, she was gradually conditioned to exhibit vomiting when she was overly stressed, and she then developed repeated episodes of vomiting. In addition, the uncontrolled vomiting from her epilepsy that occurred in the absence of stress increased her feelings of helplessness. If the vomiting were solely a psychological symptom, she might have more easily controlled and understood it. Such feelings of lack of control became an additional trigger for her epilepsy: A vicious cycle was formed. When the vomiting began, the epilepsy may have been at the core. However, after about 10 years, the vomiting had become part of a vicious cycle, and her epilepsy was poorly controlled by medication alone. Integrated treatments that involved nurturing her immature personality mentally and socially and supporting the growth of all family members who were in the vicious cycle were needed. After the diagnosis of TLE and use of medication, the patient's EEG results improved but vomiting still occurred in the presence of stress. All symptoms resolved when she became independent through our support, though the spike and wave complexes remained with drowsiness.The improvement of symptoms was thought to be due to the patient's emotional stabilization and physical improvement, involving sleep, nutrition and physical activity, which may have stabilized the limbic system. The end result was that the epileptic threshold was raised and it was possible to control the patient's symptoms without medication.Since components of the limbic system mediate emotional experiences, and memory and behavioral responses, patients with epileptic disturbances in these structures might be particularly vulnerable to the triggering of seizures by certain stimuli that evoke emotional responses . RecentlThis case was not typical TLE, because the main symptom was persistent vomiting, and the vomiting continued for several days. This made the diagnosis more difficult. Another difficulty in this patient was performing an EEG in the presence of severe vomiting, which also delayed the diagnosis.Gastrointestinal symptoms that continue for several hours have been noted previously in patients with TLE. Yukselen reportedThis case would have fulfilled the criteria of CVS if the diagnosis of epilepsy had not been made. Although the etiology is not clearly known, there may be specific subgroups of CVS that have different etiologies, such as migraine, metabolic, neuroendocrine, and gastrointestinal mechanisms . In otheWe reported a patient with TLE whose main symptom was persistent vomiting. This case suggests that there may be other illnesses of unknown etiology that are associated with EEG abnormalities. Also, when an illness is persistent, conditioning and a vicious cycle occur as secondary phenomena. At this stage, systematic biopsychosocial approaches are needed in addition to general treatment of the core disease. Also, the conditioning and vicious cycle that occur secondary to the primary disease make the diagnosis more difficult.Written informed consent was obtained from the patient for publication of this case report and the accompanying images. A copy of the written consent is available for review from the Editor-in-Chief of this journal.Hiromi Mutsuura carried out the medical treatment and drafted the manuscript. Mikihiko Fukunaga, Kenji Kanbara and Yoshihide Nakai helped to draft portions of the manuscript pertaining to biopsychosocial approaches. Takami Yagyu made the diagnosis of this case, carried out the EEG interpretation and assisted with portions of the manuscript concerning epilepsy. Kazumi Yamamoto, Kana Kitamura and Ikumi Ban provided advice for the preparation of this case and English language assistance.All authors read and approved the final manuscript. |
However, many households do not have enough nets to cover everyone, and the nets available vary in physical condition and insecticide treatment status. Since 2004, the Government of Tanzania has been implementing the Tanzania National Voucher Scheme (TNVS), which distributes vouchers for ITNs through antenatal clinics to target pregnant women and their infants. This analysis aimed to determine the following: (1) coverage patterns of bed nets Data from the 2006 TNVS household survey were analysed to assess within-household distribution of net use. The associations between net characteristics and net user were also evaluated. Multivariate analysis was applied to the relationship between the number of holes per net and user characteristics while adjusting for confounders.In households with a net:person ratio better than 1:4 (one net for every four household members), more than 80% of the people in such households reported using a net the previous night. ITNs were most likely to be used by infants, young children (1-4 y), and women of childbearing age; they were least likely to be used by older women (≥50 y), older children (5-14 y), and adult men. The nets used by infants and women of childbearing age were in better-than-average physical condition; the nets used by older women and older children were in worse-than-average condition; while young children and adult men used nets in intermediate (average) condition. When adjusted for confounders, the nets used by young and older children had more holes than nets used by infants.Infants and other vulnerable groups were most likely to sleep under the most protective nets. Nevertheless, more communication efforts are needed to increase use of intact ITNs within households for children. Further research is necessary to fully understand motivations influencing within-household net distribution. Malaria poses a serious threat to pregnant women, infants, and children ,2, and tBecause nets are supplied by local NGOs and commercial distribution systems as well as national programmes, the population of nets in a community at any one time is likely to be composed of nets of a wide range of ages, sources, and qualities. We focus here on the processes that are expected to reduce the effectiveness of nets with age. First, in the case of ITNs, there is a gradual loss of insecticide over time, reducing their protective effect. Second, as a result of wear and tear, nets will accumulate holes. Although recent studies have started to focus on the rate at which holes appear, almost nothing is known about the factors that might influence this process. Overall, the available evidence suggests the existence of wide variation, between households and between countries, in the rate at which protection is lost through wear and tear, and presumably therefore in the epidemiological protection given by the net .People also differ in their vulnerability to the effects of malaria. Pregnant women, particularly primagravidae, are recognised to be at high risk with malaria in pregnancy associated with both more serious illness among the women themselves and with low birth weight ,9. MortaSince many existing nets are untreated , an additional concern is exposure to the so-called "diversion effect," whereby mosquitoes can be diverted within a room from one person using an untreated net to an unprotected person. However, if the net is treated, there is evidence that the "diversion effect" does not occur because the insecticide offers some protection to non-net-users sleeping nearby . Thus, dwithin households in terms of net condition and treatment status has not been examined. More specifically, these questions concern the concept of vertical equity, which exists if those with greater health needs are treated preferentially [In effect, these are questions about within-family equity. Previous studies have investigated the equity of net coverage in terms of differences in household ownership or individual use, by linking these to socioeconomic status -15. Howeentially ,17. The Plasmodium falciparum and the main vectors are Anopheles gambiae and Anopheles funestus, with peak malaria transmission occurring during the rainy seasons between November and May.The data used for this analysis come from the 2006 round of the household survey undertaken as part of the monitoring and evaluation of the Tanzania National Voucher Scheme (TNVS). Malaria is prevalent in all districts of Tanzania. The predominant parasite is Hati Punguzo) in all 21 regions of the mainland to distribute ITNs through antenatal clinics (ANC), targeting pregnant women and their newborn infants. The roll-out of this programme was completed nationwide by May 2006. From 2005 to 2008, a research team from the London School of Hygiene & Tropical Medicine and the Ifakara Health Institute was contracted to evaluate the TNVS [Commencing in October 2004, the National Malaria Control Programme (NMCP) of the Government of Tanzania implemented the TNVS according to their index value. A full description of the methods for the socioeconomic evaluation has been published . The datNet insecticide treatment status was classified as follows: any net (untreated or treated nets), untreated, expired treatment (net that was treated 12 or more months before use), and ITN (net that was treated less than 12 months before use). Household net coverage was classified as complete, partial, or zero, according to whether all, some, or none of the household members slept under a net. This was repeated for both "any nets" and ITNs amongst five levels of socioeconomic status.Finally, to determine the person-to-net ratio necessary to obtain complete coverage by nets within net-owning households with at least one infant or young child under age five, the percentage of people sleeping under a net was calculated together with the person-to-net ratio (number of people/number of nets) in that household.In order to determine the vertical equity of net distribution within households, individuals were divided into seven categories of "person-type" by gender and age: infants (<1 year), young children (1-4 years), older children (5-14 years), adult males (≥15 years), adult non-pregnant females (15-49 years), adult pregnant females (15-49 years), and older females (≥50 years).These person-types were cross-tabulated with the following variables which may have influenced who was sleeping under a net: number of net holes, net age, insecticide treatment status, and whether a voucher was used to obtain the net. The relationship between person-type and net treatment status was also assessed specifically in households with at least one untreated net, at least one ITN, and at least one infant or young child under five years old.In the survey, holes were classified into head-sized holes, hand-sized holes, and finger-sized holes, and then counted. To aggregate these into an overall hole index, we used the ratio between the observed numbers of holes of different sizes (relative to the number of finger-sized holes), on the assumption that this was a reasonable proxy for the relative rate at which the different classes of holes accumulate in domestic use. Among those nets in which a complete count of holes was made, there were 3.0 times as many finger-sized holes as hand-sized holes, and 12.9 times as many finger-sized holes as head-sized holes. The hole index for each net was calculated as (number of finger-sized holes + 3 × number of hand-sized holes + 12.9 × number of head-sized holes). Nets that were recorded as having "more than ten" holes were assumed to have 11 holes. Nets that were recorded as having "too many holes to count" were assumed to have an index of 44 finger-sized holes, which was the average number of holes per net in the top 10% of nets when the nets with complete counts were ranked by their hole index.Additionally, a net age recorded in the survey as "greater than three years" was conservatively assigned a value of 3.5 years.A multivariate analysis was also undertaken to assess vertical equity in the use of nets in good physical condition within households. The dependent variable was the calibrated number of holes per net as calculated by the hole index. The main independent variable of interest was person-type. Variables that could be possible confounders for the relationship between person-type and hole index were as follows: net age, treatment status , net size , number of sleepers under the same net, number of birds (chickens or ducks) owned by the household, roof type , net source, whether or not a voucher was used, the socioeconomic status, the person-to-net ratio in the household, and the type of residence . Domestic birds were included because they sometimes search for fallen insects inside houses and may damage nets; rodents were included because they are known to bite out pieces of netting for nesting material.The relationship between these potential confounders with the hole index was first assessed by calculating the mean hole index per net and testing for difference in means among the categories of each potential confounder. Next the hole index was categorized into the following: 0 holes, 1-3 holes, 4-8 holes, 9-25 holes, and more than 26 holes. This measure of the hole index by categories was cross-tabulated with all potential confounders, and a Chi-squared test for heterogeneity was used to determine which variables were associated with the hole index. Person-type was then cross-tabulated with the potential confounders while performing a Chi-squared test to determine which variables were associated with person-type. Variables that showed evidence of association with the hole index and person-type were deduced to be confounders and retained in the final model.We used a negative binomial model for the multivariate analysis because of evidence of overdispersion of the hole index (the variance exceeded the mean). The strength of confounders identified in the bivariate analysis was reconfirmed, and a Poisson regression model was also fitted for comparison (results not shown).The survey covered 6,260 households containing 30,273 people and 6,939 nets. The percentage of households with zero, partial, and complete coverage by any net was determined. In 58% of households, all household members did not use any net (zero coverage). Only 22% of households were completely covered by nets of one kind or another; while a similar number of households were partially covered . In an even larger proportion of households (78%), no one was using an ITN (zero ITN coverage). A smaller number of households were found to be partially covered by ITNs , and an even lower number were completely covered .The poorest households had much lower coverage, compared with the least poor, in terms of both "partial coverage" and "complete coverage." For "any nets," 8% of the poorest quintile had complete coverage compared with 46% of the least poor. For ITNs, 2% of the poorest quintile had complete coverage compared with 20% of the least poor.By calculating the percentage of people sleeping under any net in relation to the household person-to-net ratio within net-owning households with at least one infant or young child under age five, an estimate of the person-to-net ratio needed to ensure complete coverage (every person sleeps under a net) was determined. At least 90% coverage was seen in households with less than 2.5 people per net, while at least 80% coverage was seen in households with less than four people per net Figure . HoweverAmong all those who slept under any net, 42% of individuals slept under nets with no holes. Infants were most likely to sleep under an intact net (54%) in comparison to other person-types. On average, infants slept under nets with the fewest holes (mean hole index = 5.5 holes per net); while older children (mean hole index = 13.0 holes per net) and older females (mean hole index = 15.0 holes per net) slept under nets with the most holes. Young children (mean hole index = 10.2 holes per net) and all older person-types slept under nets with more holes than infants ; while older children (mean 1.7 years) and older females (mean 2.1 years) used the oldest nets Figure . Of thosAmong households with at least one untreated net, at least one ITN, and at least one infant or young child, the evidence suggests that infants (87%) and young children (77%) were most likely to be using an ITN; whereas older females 40%) and older children (48%) were least likely to be using an ITN . Among nets that were obtained by a TNVS voucher, the majority of these nets were shared by a mix of target and non-target groups (86%). Only 12% of nets purchased by vouchers were used exclusively by non-target groups.Net age, net size, number of sleepers under the same net, treatment status, net source, whether the net was purchased using a voucher, and socioeconomic status of the household were strongly associated with both the number of holes per net and person-type (p < 0.05). This association was reconfirmed by fitting each individual confounder and the hole index into a negative binomial regression while adjusting for person-type.Before adjusting for confounders, all incidence rate ratios for each person-type were greater than 1, suggesting all person-types slept under a net with a greater hole index value than infants. Because of overlapping confidence intervals, the evidence does not suggest a significant difference in hole index value between the person-type categories other than infants.After controlling for all confounders, the multivariate regression analysis most strongly suggests there were more holes per net in nets used by young and older children in comparison to nets used by infants. For young children, the mean hole index value was 1.3 times greater in comparison to nets used by infants. Similarly, older children slept under a bed net with 1.3 times the hole index value compared to infants. The data weakly suggest the hole index value was 1.3 times more per bed net for older women. The data also weakly indicate the hole index value was 1.2 times more per bed net for adult males and non-pregnant females . However, there was no evidence that there was a greater hole index value per net (p = 0.481) for nets used by pregnant women compared with nets used by infants products or greater treatment of conventional polyester nets with longer-lasting insecticide (insecticide plus binder). If more nets are treated and remain effective for a longer period of time, risks associated with the "diversion effect" could be decreased across all socioeconomic groups, especially among the poorest households who are least likely to use ITNs. The newly introduced LLIN voucher should help to increase the share of treated net use.Among net-owning households with at least one infant or young child under age five, at least 80% coverage was achieved in households with at least one net for every four people. Because of the tendency for household members to share a net and the additional protection provided by ITNs to non-net-users in the same household, determining the specific person-to-net ratio within households could be useful in assessing household coverage by nets or ITNs as more distribution systems aim to achieve universal coverage.Because infants were most likely to use new, intact ITNs, vertical equity, in which household members at highest risk receive the best protection, was observed for infants. This finding is similar to that seen in Netmark surveys among households with at least one net and one child under age five, which also found that infants used nets more than all other person-types in Nigeria, Zambia, Mozambique, and Mali -25. ThesHowever, more worrying is the use of nets with more holes by young children, who are also at considerable malaria risk. With adjustment for all confounders, the evidence suggested young and older children were sleeping under nets with more holes than infants, which is consistent with the relative vulnerability of these age groups to malaria. Among older person-types, there were no significant differences between the mean hole indices.In households with at least one untreated net, at least one ITN, and at least one infant or young child, the probability of using an ITN was highest among infants, followed by young children and women of reproductive age, then adult males and older children, and least among older women. In other words, the rank order of priority for ITN use among person-types broadly matched their relative vulnerability to malaria.Older children were using nets in worse-than-average condition in terms of number of holes and age and were less likely to use a net or ITN in households with at least one untreated net, at least one ITN, and at least one infant or young child. This decreased likelihood for older children to use protective nets may be a result of insufficient nets within the household.Whether treated or untreated, intact nets still offer some protective benefit against mosquitoes in comparison to no nets at all . In a prNevertheless, better protection is provided to the user when there are fewer holes in the net. ITN programmes in Tanzania such as the TNVS have succeeded in covering infants, who were most likely to sleep under an intact net. Young children are expected to benefit from the free "catch-up" net campaign, which started in 2008, targeting all children under five years old.The data suggest that the TNVS malaria control programme has been effective in reaching infants by targeting pregnant women. Recent programme developments, including the completion of a national distribution of free LLINs to all children under five will have gone some way towards raising ITN coverage in this group. A universal coverage campaign, targeting all "sleeping places" in every household in the country with LLINs, will begin in late 2010. In order to encourage a further increase and improvement in the use of ITNs, information, education, and communication (IEC) campaigns should also address the issue of increasing vertical equity of net use within households by net condition and treatment status.However, using an IEC campaign alone or making LLINs more affordable is not sufficient to change human behaviour. It is also important to understand the context behind decision-making within households . For exaTwo main findings emerge from this analysis of the 2006 TNVS survey data. First, small decreases in the household person-to-net ratio resulted in proportionately large increases in within-household net coverage levels, reducing chances for the "diversion effect." Greater than 80% coverage of individuals within households was achieved with a person-to-net ratio of less than four. Second, infants were more likely to use intact ITNs than any other household member. Both young and older children used nets that had more holes than those used by infants. More generally, this study suggests that the more vulnerable-to-malaria members of the family are given priority for use of the most protective nets in the household, and thus, vertical equity was achieved. However, overall coverage remains unacceptably low, and too many households are forced to make difficult decisions about who should sleep without the protection of an effective net.In addition to the TNVS, the U5 campaign was launched in 2008 to provide LLINs to all children under age five in Tanzania, which will help to improve overall coverage as well as equity. While it is necessary to increase the number of ITNs per household, it is also important to understand how decisions about who sleeps under which net are made within households. Ensuring that household behaviour supports the same goals as those of malaria control programmes to increase the use of intact ITNs by the most biologically vulnerable will allow malaria control interventions to be more effective in protecting the lives of pregnant women, infants, and young children.The authors declare that they have no competing interests.AT carried out the analysis and interpretation of the data and drafted the paper. KH and JL critically revised the paper. JL contributed his expertise on malaria and insecticide-treated nets and gave guidance for the analysis of the data. KH as principal investigator for the Monitoring and Evaluation of the Tanzania National Voucher Scheme provided the data, the idea for this project as well as advice and support. All authors read and approved the final manuscript for publication. |
Point of care testing (PoCT) may be a useful adjunct in the management of chronic conditions in general practice (GP). The provision of pathology test results at the time of the consultation could lead to enhanced clinical management, better health outcomes, greater convenience and satisfaction for patients and general practitioners (GPs), and savings in costs and time. It could also result in inappropriate testing, increased consultations and poor health outcomes resulting from inaccurate results. Currently there are very few randomised controlled trials (RCTs) in GP that have investigated these aspects of PoCT.The Point of Care Testing in General Practice Trial was an Australian Government funded multi-centre, cluster randomised controlled trial to determine the safety, clinical effectiveness, cost effectiveness and satisfaction of PoCT in a GP setting.The PoCT Trial covered an 18 month period with the intervention consisting of the use of PoCT for seven tests used in the management of patients with diabetes, hyperlipidaemia and patients on anticoagulant therapy. The primary outcome measure was the proportion of patients within target range, a measure of therapeutic control. In addition, the PoCT Trial investigated the safety of PoCT, impact of PoCT on patient compliance to medication, stakeholder satisfaction, cost effectiveness of PoCT versus laboratory testing, and influence of geographic location.The paper provides an overview of the Trial Design, the rationale for the research methodology chosen and how the Trial was implemented in a GP environment. The evaluation protocol and data collection processes took into account the large number of patients, the broad range of practice types distributed over a large geographic area, and the inclusion of pathology test results from multiple pathology laboratories.The evaluation protocol developed reflects the complexity of the Trial setting, the Trial Design and the approach taken within the funding provided. The PoCT Trial is regarded as a pragmatic RCT, evaluating the effectiveness of implementing PoCT in GP and every effort was made to ensure that, in these circumstances, internal and external validity was maintained.12612605000272695 Point of care testing (PoCT) has been used for many years and is increasingly being utilised in the Australian general practice (GP) setting. PoCT is defined as any test that is performed at the time at which the test result enables a clinical decision to be made and an action taken that leads to an improved health outcome . PoCT haThe literature suggests that there is a lack of evidence for several of these benefits, particularly those relating to clinical outcomes. Reduction in referrals, and earlier and more rationalised treatment has been reported in a study involving PoCT but chanA primary concern relating to PoCT is quality management. For PoCT to be introduced into the GP environment, it is important that it is proven to be accurate and reliable . This rePoCT in GP will only be effective if the results obtained from the testing devices are comparable with laboratory results ,13. A nuWhile a large number of studies have been undertaken on the use of PoCT in the primary care setting, few studies have undertaken an economic analysis of PoCT . Hobbs eThe attitudes of key stakeholders and their satisfaction with PoCT form an important part of the assessment of introducing PoCT into GP. These stakeholders include patients, GPs, practice staff and pathology laboratories. PoCT may lead to greater convenience for GPs and patients but result in greater costs and require organisational changes that may reduce stakeholder satisfaction. There is conflicting research in this area. Hilton et al's study onWhile a number of studies have been undertaken on the cost effectiveness, clinical effectiveness, safety or satisfaction with PoCT, there have been no randomised controlled trials (RCTs) that evaluate all these outcomes in the GP setting. The PoCT Trial was implemented to address this gap.The PoCT Trial is a cluster randomised controlled trial to evaluate the intervention of PoCT on the management of patients with either diabetes, hyperlipidaemia or on anticoagulant therapy. A clustered design was chosen to avoid treatment group contamination and for administrative convenience. The Trial commenced in September 2005 and continued for 18 months across 58 general practices based in urban, rural and remote locations across three states in Australia.The Trial Design was developed in partnership with the PoCT Steering Group, a working group of the Quality Use of Pathology Committee PoCT Implementation Subcommittee of the Australian Government . The oriThe PoCT Trial involved collaboration between three organisations who administered different aspects of the Trial. Trial Management and Evaluation was undertaken by the Disciplines of General Practice and Public Health at the University of Adelaide. The provision of devices, device operator training and QC was undertaken by the Community Point-of-Care Services Unit, Flinders University Rural Clinical School (Device Group) and the external QA program was provided by the RCPA Quality Assurance Program Pty Ltd (QAP).The primary research question of the Trial was:Should PoCT in GP be implemented by the Australian Government?The Trial evaluated seven key questions:1. Is it safe to perform PoCT in a GP setting?2. Is the clinical effectiveness of PoCT the same or better than the same tests using pathology laboratory testing?3. Is it the same or more cost effective to perform PoCT compared with pathology laboratory testing?4. Are patients and other stakeholders more satisfied with PoCT than with pathology laboratory testing?5. Are there differences between urban, rural and remote geographic regions in the treatment effects being measured?6. Would the regulatory environment used for the Trial meet the needs of all the stakeholders if PoCT were to be made more generally available?7. What would the appropriate MBS fees be for the PoC tests selected in the Trial?This paper focuses on the evaluation protocol and methods developed to investigate the first five research questions.A number of hypotheses were developed in order to answer each of these questions and are shown in Table The PoCT Trial had two phases, Phase I lasting six months and Phase II lasting twelve months. In Phase I, patients in practices in the intervention group had pathology testing performed both by the pathology laboratory in the usual manner and by PoCT in the practice. The control group undertook testing by the pathology laboratory.In Phase II, intervention group patients were tested using only PoCT at the practice, although pathology laboratory testing could be performed at any time at the request of the general practitioner, while control group patients continued to be tested by the pathology laboratory as usual.The Australian Medicare Program aims to provide equitable access to medical and hospital services for all Australian residents. The Department of Health and Ageing (the Department) has policy responsibility for Medicare, with Medicare Australia being responsible for Medicare administration and the payment of Medicare benefits, which are detailed in the Medicare Benefits Schedule (MBS). The Medical Services Advisory Committee (MSAC) advises the Department on the strength of evidence relating to the safety, clinical effectiveness and cost effectiveness of new and emerging medical services and technologies, and under what circumstances listing on the MBS should be supported.To enable the payment of Medicare benefits for pathology services, pathology testing must be undertaken by a pathology laboratory that is accredited to provide a particular service. Pathology collection centres must be approved to enable the payment of Medicare benefits for services performed on specimens collected. Patients can either attend an approved collection centre or can have their blood, urine or other samples taken by or on behalf of the general practitioner referring them for the service. The specimen is then delivered to the pathology laboratory for testing. For patients in rural and remote locations, transportation time is critical and turnaround time for results can be longer than in urban settings, with a possible impact on patient management.Currently in Australia only a small number of point of care tests, such as pregnancy tests, are funded through the MBS for GP. To claim a broader range of pathology tests a practice must be a Category M (GP) Accredited Pathology Laboratory. This requires that they participate, at a cost, in the inspection and accreditation process implemented by the National Association of Testing Authorities. It has been suggested that the costs associated with accreditation and annual registration currently make it prohibitive for GP to participate, resulting in very few such practices existing in Australia . The outThe Trial aimed to recruit 60 practices across three geographic locations in South Australia, New South Wales and Victoria. Node support officers (NSOs) were employed across the three geographic regions with the aim of recruiting 20 practices each. Divisions of GP were engaged to assist in the recruitment process. Once a general practitioner or practice had expressed an interest in being involved in the Trial, further information was sought in the form of a practice checklist. Those who met the eligibility criteria and signed on to participate were included in the randomisation.All practices were required to recruit a minimum of 30 patients on anticoagulant therapy, 35 with diabetes and 50 with hyperlipidaemia. Patients were initially recruited in the first three months of the Trial. Patients needed to have established and stabilised diabetes, and/or hyperlipidaemia, and/or be taking anticoagulant medicine such as warfarin. The inclusion and exclusion criteria for practices and patients are provided in Table All GPs from each practice involved in the Trial were invited to participate. Those interested in participating were required to sign a consent form, to sign a letter of agreement which outlined the terms and conditions of their participation in the Trial and were asked to provide proof of their current Medical Malpractice Insurance.Participating practices were required to provide contact details for all associated pathology providers. The Trial Management team encouraged these pathology providers to participate in the Trial and developed appropriate links for data transfer where possible to reduce the burden on practices.Practices randomised to the intervention group were required to nominate at least one staff member, preferably a practice nurse, to undertake training in use of the PoCT devices and the Trial protocol.Practices were randomly allocated to the intervention or control arm in the ratio 1:1. Randomisation was stratified by geographic area and used randomly permuted blocks of size 2, 4 and 6. The random allocation sequence was generated using ralloc.ado version 3.2.5 in Stata 9.0.Practice allocation to treatment group was performed by central randomisation by phone/email after consent was obtained. The recruiters did not know the random allocation sequence. Once randomisation had been undertaken, all the patients recruited for the practice were then deemed intervention or control depending on which arm of the Trial each practice was allocated.Due to the type of intervention, neither participants nor project staff were blinded to the treatment allocation.Patients recruited in the intervention group had their pathology testing for either HbA1c, microalbumin, lipids ) or INR using PoCT devices by their practice for 18 months. Patients in the control practices had these same tests undertaken using their usual care – the pathology laboratory.The practices in the intervention group were provided with three PoCT devices – DCA 2000, CoaguChek S and Cholestech LDX. The selection of devices was based on non-analytical and analytical criteria prior to the commencement of the PoCT Trial. Group training sessions were held over two days for the practice staff who would use the devices (known as device operators) and follow-up sessions were provided 12 months later. Training incorporated an introduction to PoCT, quality management, accuracy and precision of results and training in the use of each device. At the end of their training, their competency was assessed by the Device Group.The practices were required to perform internal QC and QA testing designed for the PoCT Trial practices. The practices also participated in an accreditation process. The accreditation process and training was based on the Interim Standards for Point of Care Testing in General Practice: Incorporating the Trial Guidelines developed by the Australian Government .Data were collected at various points throughout the PoCT Trial to answer the five key research questions reporting.Internal QC for the intervention practices was assessed using QC materials comprising two levels of HbA1c, microalbumin and lipids and one level for INR. Device operators forwarded their results to the Device Group for analysis. This was initially undertaken fortnightly and after three months undertaken monthly for the remainder of the Trial. Practices received a feedback report every three months reporting their precision expressed as a coefficient of variation.The QAP provided an external assessment of the PoCT device performance and a comparison with all practices in the Trial. Intervention practices were provided with an external QA kit for each test every six months during the Trial. The kit contained samples which needed to be tested every fortnight by the device operators. Practices forwarded results by mail or via the QAP website to QAP Pty Ltd and acceptable limits of good performance were determined. At the end of each testing cycle, practices were provided with a summary of their performance (precision and accuracy) over the previous six months and a comparison with other participating sites.The number and types of SAEs were recorded throughout the length of the PoCT Trial. Events occurring up to one month after completion of Phase II were also recorded for patients on anticoagulant therapy. The number of SAEs reported in patients per person-year was calculated, as well as the proportion of patients experiencing one or more SAEs.To determine the clinical effectiveness of PoCT compared with pathology laboratory testing, the PoCT Trial focused on therapeutic control and impact on patient care.To measure therapeutic control, two outcomes were considered: firstly, the proportion of patients within target range and secondly the proportion of tests within target range for each type of test. The former was the primary outcome measure for the Trial. The target ranges used for the seven tests were based on clinical guidelines and are defined in Table To measure the impact of PoCT on patient care, a number of outcome measures were determined. These included: number of general practitioner visits per person-year; patient compliance with disease management; pharmaceutical prescribing; and process of care actions undertaken by the general practitioner following a pathology test.Pathology results provided by PoCT at the time of a consultation provide GPs with an opportunity to discuss the test results with their patients immediately and implement any changes to improve the management of their condition. Measuring the number of general practitioner visits per person-year for patients in the PoCT Trial will determine if PoCT leads to more or fewer visits. Some research indicates that PoCT results in increased testing , while oIt has been widely reported in the literature that non-compliance to medication is substantial with an estimated 30–40% of patients failing to take medications as prescribed . It is wMedication compliance was measured using the Medication Adherence Reporting Scale (MARS-5). The MARS-5 is a five-item scale asking participants to indicate the frequency with which they engage in each of five components of non-compliant behaviour e.g. altering the dose or forgetting to take a dose. Since 1996, the MARS-5 has been used in studies across a variety of illnesses and in several countries -36 The MPatients were also asked to comment about their beliefs and attitudes towards medicines in general and medicines prescribed for their condition. Past research has shown that levels of medication compliance are associated with patient beliefs about the necessity of taking medication .In order to assess the impact of PoCT on general practitioner management of the patient, the PoCT Trial measured the processes of care associated with each pathology test. The availability of a test result during the consultation should assist the general practitioner to treat and manage patients with the three conditions of interest . Grieve PoCT has the potential to improve patient compliance with medication and result in more appropriate and timely prescribing by GPs . To asseTo determine the cost effectiveness of PoCT versus pathology laboratory testing, comparative cost analysis and cost effectiveness analysis were undertaken, taking a societal perspective. Costs included in the analysis were establishment costs (equipment and training), consumable and maintenance costs, QC and QA costs, accreditation costs, costs associated with the practice consultation, testing costs, patient costs and downstream costs.Cost data were collected from a number of sources. These included: MBS service claims by participating GPs; general practitioner and device operator time through a time and motion study; patient borne costs collected as part of the baseline and satisfaction questionnaires; industry sources for costs related to PoCT devices, allied health and specialist services from the Medicare Australia database; and hospitalisations from the CNA.Cost effectiveness was measured using the incremental cost effectiveness ratio. The intermediate outcome indicator for each type of test was the proportion of patients who are maintained within the normal clinical range for that blood level based on the last test result collected during the Trial (adequate control).The PoCT Trial assessed the satisfaction of patients, GPs, device operators and pathology providers with PoCT, and compared this with patient, GPs and pathology provider satisfaction with usual pathology testing.Attitudinal questions were administered at baseline (baseline questionnaires) and at the end of the Trial (satisfaction questionnaires) to patients, GPs, device operators and pathology providers. Questions covered areas such as preference, convenience, collection of blood, impact on management of conditions, impact of PoCT on the practice and difficulty in the use of PoCT devices.Additional data relating to satisfaction were also collected through the satisfaction questionnaires. For the intervention group these covered the areas of comparative quality of the process . The control group were asked to rate their satisfaction in the same areas as the intervention group, but as it related to pathology laboratories.For GPs and device operators, the satisfaction questionnaire focused on their preference, attitude and stated behaviour around pathology testing. Those in the intervention group had a number of additional questions relating specifically to PoCT. Topics covered in the general practitioner and device operator questionnaires included: training; self assessed competence; accreditation method; equipment; suitability of PoCT within the consultation; perceived impact on patient health outcomes; convenience and efficiency to the practice; and payment and impact on interaction with pathology providers. Pathology provider attitudes to PoCT were also obtained, covering areas such as analytical quality, accreditation, laboratory involvement and impact on laboratory testing. For all the satisfaction questionnaires, questions were either designed specifically for the Trial or were taken from other studies ,23,43,44The PoCT Trial sought to determine if there were differences between urban, rural and remote geographic regions in the areas of safety, clinical effectiveness and stakeholder satisfaction.The Data Management and Analysis Centre (DMAC) of the Discipline of Public Health at the University of Adelaide was contracted to design and implement the IT systems for the PoCT Trial. This system was comprised of a Management Information System (MIS) and a data entry system. The MIS was web-based and enabled the collection and dissemination of Trial Management information. The database into which management information was collected could also be accessed by Trial Management and Evaluation staff to produce reports as required. Access to the Trial IT systems required logins and passwords and all staff received training in its use. Data entry was performed by specialised data entry staff in DMAC following PoCT Trial standard operating procedures.While the PoCT Trial was deemed low-risk, a Safety Subcommittee was established to monitor SAEs and incidents throughout its length, and to develop stopping rules. Practices, using a SAE Reporting Form, were required to report any SAEs for recruited patients. The SAEs were categorised as death, life threatening, permanent or significant disability or incapacity, hospitalisation, newly diagnosed cancer or other important medical event. Each SAE was initially assessed by the Trial Manager to determine the likelihood of the event resulting from involvement in the PoCT Trial before being submitted to the Safety Subcommittee for final assessment. In addition, any Trial related incident was also required to be reported to the Trial Manager for assessment using an Incident Reporting Form. Incidents could be patient, device operator, device or QC/QA related.Throughout the PoCT Trial, all participants had access to the three organisations administering the Trial via a free-call telephone number.Non-inferiority tests were planned for hypotheses relating to safety and clinical effectiveness. Comparative tests were used for hypotheses relating to cost effectiveness and satisfaction. Analyses were performed on an intention to treat basis and took into account clustering at the practice level, as well as the patient/general practitioner/device operator level where appropriate, using mixed effects models or generalised estimating equations. The level of analysis varied depending on the hypothesis depended on the type of test. For tests relating to diabetes , adjustment was planned for time since diagnosis of diabetes, Aboriginal or Torres Strait Islander (ATSI), use of dietary control, prescription tablets and insulin for treating diabetes, and Body Mass Index (BMI). For HbA1c, adjustment was also planned for baseline HbA1c result. For lipids tests , adjustment was planned for known heart disease, diabetes, ATSI, socio-economic status, smoking status and baseline test result. For INR, adjustment was planned for BMI, multiple co-morbidities and baseline INR result. Analyses were adjusted for all planned confounders with the exception of ATSI, due to the small number of such patients in the Trial.The form and extent of the missing data on both outcomes and potential confounders was considered separately for each analysis. Where there was evidence to suggest the missing data were not missing completely at random, 10 completed data sets were generated for analysis using multiple imputation .The primary outcome on which the sample size was based was the proportion of patients with test results within target range, a measure of clinical effectiveness. It was considered that PoCT would be non-inferior to pathology laboratory testing if the true difference in the proportion of patients with test results within target range (intervention minus control) was no less than -0.07. This non-inferiority margin was chosen as a compromise between clinical significance and the feasibility of recruitment.Sample size calculations were performed separately for each type of test. Where multiple tests are performed for the same condition , the largest of the estimated sample sizes was used.Based on information obtained from a pathology laboratory, the proportion of control patients with pathology results within the target range was assumed to be 0.12, 0.81, 0.77 and 0.53 for total cholesterol, HDL-C, triglycerides and HbA1c respectively. Since no suitable information was available for INR or microalbuminuria, the proportion of control patients with pathology results within the target range was assumed to be 0.5 for each of these tests to give the largest sample size. The difference in the proportion of patients with test results within target range was assumed to be zero.A design effect of 2 was suggested in the original Trial Design to allow for correlation between observations arising from the same cluster. The Trial Evaluators investigated design effects in the Second Australian National Blood Pressure Study (ANBP2) which suUsing a one-sided, normal-approximation, non-inferiority test of two proportions, a type 1 error probability of 0.05, 80% power and assuming a design effect of 2, the number of patients required per group was 1262, 894 and 1262 for anticoagulant therapy, hyperlipidaemia and diabetes respectively.The PoCT Trial was approved by five relevant independent Australian Human Research Ethics Committees. The Trial is registered with the Australian Clinical Trial Registry, Number 12612605000272695 .Sixty-six practices expressed an interest in being involved in the PoCT Trial. Of these, 58 met the selection criteria and signed on to participate. Practices were then randomised resulting in 26 practices in the control group and 32 practices in the intervention group. A total of 5234 patients (2034 in the control group and 3200 in the intervention group) were recruited through these practices.The clusters and participants progress throughout the Trial is provided in a CONSORT diagram Figure 48]..48].A baseline questionnaire was sent to patients following consent and a response rate of 94.1% was achieved. Of the 4968 patients included in the analyses, 1967 had diabetes, 3819 had hyperlipidaemia and 944 were on anticoagulant therapy . The characteristics of these patients were similar by treatment group and geographic location. Overall the patients tended to be older (reflecting the conditions of interest). The median age for patients on anticoagulant therapy was slightly higher than for the Trial participants overall, almost half of them reported having multiple co-morbidities and a large proportion were either overweight or obese. Patients with diabetes were primarily diet and/or tablet controlled, had been diagnosed for more than 5 years and a majority were either overweight or obese. For those with hyperlipidaemia, over a third reported having heart disease, and over a third indicated they had diabetes and understanding the importance of quality data collection. Also the original and adapted Trial Design allowed practices to implement the intervention in the ways that suited their practices. As a result, practices could either incorporate the PoCT devices into existing or new mini clinics or, more commonly, as part of the consultation process.The PoCT Trial included patients with one or more of three conditions. This meant that any outcome measure needed to be suitable for all these conditions, rather than the most appropriate outcome for a particular condition. For example, one of the most validated methods of determining good management of anticoagulant therapy is measuring a patient's time in range. However, while this is relevant for patients on warfarin therapy, it is not a suitable measure for diabetes or lipids management. Thus, the percentage of patients and test results within target range were selected as alternative measures of clinical effectiveness as these were applicable for all three conditions. Patients also formed the largest participant group in the Trial; therefore data collection processes needed to be manageable for more than 4500 patients. Taking into account these issues, the approach taken by the PoCT Trial to collect patient data was through a series of questionnaires. This was the most efficient method of data collection and the high response rate achieved for the baseline patient questionnaire indicates that patients found this approach acceptable. Similarly the list of SAEs reported had to cover a broad range of possibilities, rather than be condition specific.At the pathology provider level, the practices participating in the PoCT Trial utilised 23 different laboratories, representing 10 parent pathology companies, with each practice utilising on average 1.5 pathology laboratories. Pathology results were required for several of the hypotheses. Each pathology company used different testing reagents and different electronic record systems and considerable work was required to capture these data in a format that could be used for the Trial.The approach taken by the Trial Evaluation group was to minimise the data collection undertaken by the GPs and practices and where it was necessary for them to collect data, incorporate this as much as possible into their everyday practice. An example was the development of the PoCT request/result form for the intervention practices. This provided the practice with documentation of the test request and result using the PoCT devices, but the duplicate form was used by the Trial as a record of test results. This form was also provided to the practices in an electronic format that could be included in their electronic medical record systems.The PoCT Trial retained 84.5% of practices and 86.1% of patients. These high retention rates are likely to reflect the interest by GPs and patients in PoCT and the effort made by the researchers to minimise the impact on both the practices and patients. Various support strategies known to improve recruitment and compliance were impUnfortunately, the PoCT Trial was not able to recruit sufficient patients in two of the three conditions to obtain desired power. The Trial Design required the recruitment of practices in three geographic locations – urban, rural and remote. However, the original Trial Design did not consider the possibility that practices in rural or remote locations would not have sufficient patient population to meet the required sample size and hence the adapted Trial Design allowed practices to be recruited knowing that they could not meet the minimum requirement of patients.With any trial, ensuring adherence to the evaluation and treatment protocol by participants is difficult, although this is of less importance in a pragmatic RCT . This diTo maximise time the CNA of patient records was undertaken for only a sample of patients. The descriptive analysis suggests that the sample of patients was representative of the entire patient population of the PoCT Trial in terms of baseline characteristics and hence, results based on analysis of CNA data are applicable to all Trial patients.The PoCT Trial is one of the largest and most comprehensive RCTs to evaluate the impact of PoCT in a GP setting. There are few RCTs in this area and none have investigated all the areas covered in this Trial or at the scale of this Trial either in terms of the number of practices, the number of patients or the number of pathology tests included ,28,51-53The authors declare that they have no competing interests.CL and JB obtained funding for the Trial Management and Evaluation. CL, AG, TB and BG drafted the Trial Management and Evaluation protocols. LY, PR and KW drafted the statistical analysis plan. JB, PR, LY, KW, JG and MS critically reviewed and revised the evaluation protocol. JG obtained funding and designed the protocol for the provision of QA testing. MS obtained funding and designed the protocol for the provision of QC testing. All authors read and approved the final manuscript.Schedule of data collection activities throughout the PoCT Trial.Click here for fileComparison of patient baseline characteristics by condition.Click here for file |
HOX genes in the survival and proliferation of ovarian cancer cells. These are a family of homeodomain-containing transcription factors that determine cell and tissue identity in the early embryo, and have an anti-apoptotic role in a number of malignancies including lung and renal cancer.Ovarian cancer still has a relatively poor prognosis due to the frequent occurrence of drug resistance, making the identification of new therapeutic targets an important goal. We have studied the role of We used QPCR to determine HOX gene expression in normal ovary and in the ovarian cancer cell lines SK-OV3 and OV-90. We used a short peptide, HXR9, to disrupt the formation of HOX/PBX dimers and alter transcriptional regulation by HOX proteins.HOX gene family. Disrupting the interaction between HOX proteins and their co-factor PBX induces apoptosis in SK-OV3 cells and retards tumour growth in vivo.In this study we show that the ovarian cancer derived line SK-OV3, but not OV-90, exhibits highly dysregulated expression of members of the HOX/PBX binding is a potential target in ovarian cancer Ovarian cancer is a relatively uncommon malignancy, accounting for 4% of all cancers in the western world and 5% of all cancer deaths in women, but the mortality from this disease has improved little in the last 30 years . DetectiHOX genes, a family of homeodomain-containing transcription factors that define the identity of cells and tissues during early development [HOX genes in mammals, divided into four groups (A-D) in tightly linked clusters on different chromosomes [HOX genes have distinct functions in specific contexts, many others have overlapping or redundant functions during early development [HOX genes have a potent anti-apoptotic function. This redundancy in HOX function is based in part upon the binding of similar DNA sequences, and also on the interaction of HOX proteins with a common set of co-factors including PBX. PBX modifies the DNA binding specificity of HOX proteins, influences the regulation of transcription, and is required for many aspects of HOX function [In a similar manner to other cancers, ovarian cancers are known to over express a number of genes involved in early development. These include the elopment . There aomosomes . Whilst elopment , in haemelopment , and in elopment and renaelopment , where tfunction .HOX gene expression have also been observed in ovarian cancer [HOXA9, HOXA10 or HOXA11 results in a serous, endometrioid-like or mucinous-like phenotype respectively [HOX genes have been shown to influence the ability of ovarian cancer cells to invade other tissues [HOX genes have an anti-apoptotic effect in ovarian cancer. We show that HOX expression in the ovarian cancer cell line SK-OV3 is highly dysregulated compared to normal ovarian tissue. Furthermore, interfering with HOX function using the PBX-binding peptide HXR9 [in vitro and in vivo.Changes in n cancer -11. Overide HXR9 triggers2 incubator.The human ovarian adenocarcinoma-derived cell lines SK-OV3 and OV-90 were obtained from the American Type Culture Collection . The cells were cultured in McCoy's 5A modified medium supplemented with 10% (v/v) heat-inactivated foetal bovine serum and 1% penicillin /streptomycin (10 mg/ml) (Sigma). Cell cultures were maintained at 37°C in a humidified, 5% CO® Plus Mini Kit according to the manufacturer's instructions. cDNA was synthesised from RNA using the Cloned AMV First Strand Synthesis Kit (Invitrogen) following the manufacturer's protocol. Semi-quantitative RT-PCR was performed using the Stratagene MX3005P Real Time PCR machine and SYBR® Green JumpStart™ Taq ReadyMix™ (Sigma). Oligonucleotide primers were designed to facilitate the unique amplification of β-actin, c-Fos and each HOX gene. Relative expression was calculated using the Livak comparative Ct method (2-ΔΔCt) [Total RNA from normal human ovary tissue was purchased from Applied Biosystems . RNA was isolated from SK-OV3 and OV-90 cells using the RNeasy(2-ΔΔCt) .5 cells/ml and incubated for 24 hours. Cells were treated overnight with the active peptide HXR9 or the control peptide CXR9 at a range of dilutions. The IC50 of the cells was determined by plotting a dose-response curve. To detect morphological changes consistent with apoptosis, cells were harvested by incubating in trypsin-EDTA (Sigma) at 37°C until detached and dissociated. Apoptotic cells were identified using a Beckman Coulter Epics XL flow cytometer and the Annexin V-PE apoptosis detection kit (BD Pharmingen).Cell viability was measured via the MTS assay according to the manufacturer's instructions. Briefly, cells were plated in a 96-well plate at a concentration of 1 × 105 cells/ml and incubated at 37°C for 24 hours. Cells were treated overnight with HXR9 (120 μM) or CXR9 (120 μM). The cells were washed twice with PBS, visualised using a Nikon Eclipse TE100 inverted microscope and images recorded using a Nikon DS-L camera and capture software .For phase contrast micrographs, cells were plated into 60 mm tissue culture dishes at a concentration of 1 × 105 cells and incubated as previously described. The cultures were treated with HXR9-FITC conjugate (30 μM) for 1 hour. The cells were fixed with 10% formalin in neutral-buffered saline (Sigma). Cells were visualised using a Nikon Eclipse TE 2000-S fluorescent microscope and images recorded using a DMX 1200F camera and NIS Elements capture software (Nikon Instruments).For fluorescent images of HXR9 localisation, 35 mm culture dishes were seeded with 2 × 104 cells/ml on 60 mm tissue culture dishes and were incubated at 37°C. When cells approached 75% confluence, cultures were treated overnight with HXR9 (120 μM) or CXR9 (120 μM). Lysates were prepared with RIPA buffer containing protease and phosphatase inhibitor cocktails and EDTA . The protein concentration was quantified using the bicinchoninic acid assay (Perbio) according to the manufacturer's instructions. Proteins were resolved by 10% SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membrane. Anti-PARP antibody was used to detect both cleaved and full-length PARP. To visualise proteins, the ECL Western blotting detection system was used.SK-OV3 cells were seeded at a concentration of 4 × 10ad libitum.All animal experiments were conducted in accordance with the United Kingdom Co-ordinating Committee on Cancer Research (UKCCCR) guidelines for the Welfare of Animals in Experimental Neoplasia and appr6 SK-OV3 cells in culture media (100 μl). Once tumours reached volumes of approximately 100 mm3, mice received an initial dose of 100 mg/Kg CXR9 or HXR9 intravenously, with subsequent dosing of 10 mg/Kg twice weekly. Each treatment group contained 10 mice. The mice were monitored carefully for signs of distress, including behavioural changes and weight loss.Athymic nude mice were inoculated subcutaneously with a suspension of 2.5 × 10An additional 10 mice were included in each treatment group to allow the amount of HXR9 peptide in tumours to be assessed. Tumours were excised from three mice at 3, 12 and 24 hours after iv administration of 100 mg/Kg HXR9. Total cellular protein was extracted and 10 μg were dot blotted on nitrocellulose membrane and probed with a rabbit polyclonal anti-HXR9 antibody. Quantification was achieved using a standard series of HXR9 dilutions.t tests (p < 0.05), or the Mann-Whitney test for mouse tumour modelling experiments. For the analysis of the QPCR for HOX gene expression the Bonferroni correction was applied to account for multiple comparisons. There are 39 HOX genes thus the limit for a significant result is p < 0.0013.Data are given as means ± SEM of at least three independent experiments. Significant effects were determined by 2-tailed Student's HOX genes in ovarian tumours but to date this had not been done in a comprehensive manner, looking at all 39 members of this family. Thus, we measured the relative expression of HOX genes in normal ovarian tissue and in the derived cell lines SK-OV3 and OV-90 using semi-quantitative PCR but few cells were found to be in the early apoptotic or necrotic state have previously been shown to be upregulated in other cancers, including HOXA13 [HOXB5 [HOXB9 [HOXD9 [It is becoming increasingly apparent that gnancies -17 inclugnancies , prostatgnancies ,20, lunggnancies and ovargnancies -11 , greatly sensitising prostate cancer cells to TRAIL-induced apoptosis [The role of onserved . They mapoptosis . Recent poptosis ,28.HOX genes are independent of the targets of current chemotherapeutics (as far as this can be known), and hence targeting the HOX/PBX interaction is a potential alternative or addition to current therapeutics when drug resistance develops.Novel targets are needed in ovarian cancer therapy as the long term survival of patients is poor despite the trial of numerous chemotherapeutic regimes including the current standard of care, carboplatin/paclitaxel ,29. The The authors declare that they have no competing interests.All authors have read and approved the final manuscript. The authors made the following contributions to this work: LP conducted lab based experimental work, KJH was involved in experimental design and critique, AM was in charge of sample acquisition and critique, HSP helped to write the manuscript and RM was involved in experimental design and also wrote the manuscript. All authors read and approved the final paper.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/10/89/prepub |
Breast-feeding may affect the risk of developing allergy during childhood and may also cause exposure to immunotoxicants, such as polychlorinated biphenyls (PCBs), which are of concern as marine pollutants in the Faroe Islands and the Arctic region.The objective was to assess whether sensitization and development of allergic disease is associated with duration of breast-feeding and prenatal or postnatal exposures to PCBs and methylmercury.A cohort of 656 singleton births was formed in the Faroe Islands during 1999–2001. Duration of breast-feeding and history of asthma and atopic dermatitis were recorded at clinical examinations at 5 and 7 years of age. PCB and mercury concentrations were determined in blood samples obtained at parturition and at follow-up. Serum from 464 children (71%) at 7 years of age was analyzed for total immunoglobulin E (IgE) and grass-specific IgE.The total IgE concentration in serum at 7 years of age was positively associated both with the concomitant serum PCB concentration and with the duration of breast-feeding. However, the effect only of the latter was substantially attenuated in a multivariate analysis. A raised grass-specific IgE concentration compatible with sensitization was positively associated with the duration of breast-feeding and inversely associated with prenatal methylmercury exposure. However, a history of asthma or atopic dermatitis was not associated with the duration of breast-feeding, although children with atopic dermatitis had lower prenatal PCB exposures than did nonallergic children.These findings suggest that developmental exposure to immunotoxicants may both increase and decrease the risk of allergic disease and that associations between breast-feeding and subsequent allergic disease in children may, at least in part, reflect lactational exposure to immunotoxic food contaminants. Exposures to marine contaminants are of much concern to populations that rely on seafood for their livelihood. Among main contaminants resulting in increased exposures, methylmercury and polychlorinated biphenyls (PCBs) share immunotoxic potentials . Immunotp-dioxin (TCDD) , an immun (TCDD) . Becausen (TCDD) . Howevern (TCDD) .Exposures to PCBs, methylmercury, and related substances are increased in the Arctic region , especiaWe carried out a prospective study of a birth cohort in the Faroe Islands, a North Atlantic fishing community with increased average dietary exposures to methylmercury and PCBs from pilot whale meat and blubber . ExtendeIn the Faroe Islands, a birth cohort was formed from consecutive spontaneous births during 1999–2001 . InformeDetailed follow-up examinations were scheduled for the whole cohort at approximately 5 and 7 years of age. They included physical examination, blood sampling, and a maternal interview on the child’s current health and past medical history, including duration of breast-feeding . Occurrence of asthma and atopic dermatitis at the follow-up examinations was determined by a single pediatrician, who examined all the cohort children and interviewed the mother. Parental smoking at home and child care attendance were recorded, but family history was not explored because the focus of the study was on environmental chemical exposures.n = 29), the child did not want to participate this time (n = 28), current residence abroad (n = 13), deceased child (n = 3), and miscellaneous (n = 3). For 67 of the children examined, a blood sample was not obtained, and in 49 cases insufficient serum was available. Overall, IgE results and clinical data were available for 464 cohort children .The present report is based on the cohort members who were examined at 7 years of age and provided a blood sample sufficient for IgE and contaminant analyses. For the 76 cohort children who did not participate in the 7-year examination, the main reasons were decision to leave the follow-up study , missing serum data (n = 152) were calculated from the milk result using the average ratio (1.13) between the two.Serum analyses were conducted by gas chromatography with electron capture detection at the University of Southern Denmark . Milk anr = 0.84 both at birth and 7 years of age). When blood results were missing , the average ratio between the two was used to estimate the blood concentration.Mercury concentrations in whole blood and hair were measured by atomic absorption technique . Hair anPhleum pratense, allergen code g6) were determined by the ImmunoCAP system according to the manufacturer’s instructions. For the latter assay, allergen-specific units exceeding 0.35 kUA/L indicated sensitization. Grass pollen is ubiquitous and seems to be the most frequent sensitizing allergen in both Greenland and Iceland , low birth weight , maternal age, parity, maternal fish intake and smoking during pregnancy, parental smoking at home, daycare attendance, and the child’s body mass index—was then included in the model to ascertain whether they materially affected (> 10%) estimated effects of immunotoxicant exposure. For grass-specific IgE concentration and the duration of breast-feeding, which deviated from normal distribution also after transformations, Spearman’s nonparametric correlation coefficients and logistic regressions were applied. Statistical significance was assumed when p < 0.05 (two-sided). For all calculations, SPSS version 15 was applied.Exposure parameters and total IgE concentrations were log-transformed to obtain normally distributed residuals with a homogeneous variance. Results were therefore expressed as geometric means and the interquartile range (25th to 75th percentiles). Comparisons were performed with independent-sample r < 0.2), but the p-values suggest that some of the associations could not be ascribed to chance. The highly significant positive correlations with the serum PCB concentration at 5 and 7 years of age suggested that a doubling in PCB was associated with an increase in total IgE of about 18%. We found a weaker tendency in the same direction for methylmercury exposure, but in this case only for prenatal exposure. Duration of breast-feeding also showed a positive association with IgE: Each month of exclusive breast-feeding was associated with an average increase of total IgE of 12%. However, when adjusted for serum PCB at 7 years of age in a multiple regression analysis, the increase in IgE for each month of breast-feeding decreased to 6% (p = 0.13) (p = 0.02). Maternal fish intake during pregnancy, as a measure of prenatal exposure to n-3 fatty acids, was not associated with the child’s total IgE concentration (p = 0.28). Other covariates did not materially affect these associations. = 0.13) ; the regrs = −0.17; p < 0.001). We observed a tendency in the opposite direction regarding the total duration of breast-feeding . Mutual adjustment in a logistic regression analysis suggested that both factors were independently associated with grass-specific IgE.PCB exposure variables in cohort members with measurable grass-specific IgE > 0.35 kUA/L, consistent with allergic sensitization, did not differ from those observed in subjects with low or nondetectable concentrations . HoweverNine of the 464 children had a history of both asthma and atopic dermatitis; 26 had asthma only, and 51 had atopic dermatitis only. Total IgE concentrations and proportions of children with grass-specific IgE > 0.35 kUA/L at 7 years of age were increased in children with asthma or atopic eczema relative to nonallergic children . Of the The strength of the present study is that a population-based birth cohort was followed prospectively with repeated assessment of exposures to marine contaminants for comparison with the allergy and sensitization status up to 7 years of age. Compared with other populations, average exposures to both PCBs and methylmercury were high and ranges of exposures were wide, thereby adding statistical power to the study. Almost 90% of the children participated in the examinations at 5 and/or 7 years of age, and we obtained IgE data at age 7 years from 71%.As a main finding, serum PCB concentrations at 7 years of age were positively associated with total IgE concentrations. We observed a similar tendency for the prenatal methylmercury exposure, although this correlation could be due to chance. Longer duration of breast-feeding also appeared to predict a higher IgE concentration at 7 of age, but adjustment for the effect of PCB exposure reduced this association so that a chance finding could not be ruled out. For the grass-specific IgE concentration, the duration of breast-feeding again showed a positive correlation, now without a concomitant association with PCB. In addition, we observed an inverse association between grass-specific IgE levels and prenatal methylmercury exposure. Regarding clinical diagnoses, prenatal PCB exposures were inversely associated with a history of atopic dermatitis but showed a weak positive association with asthma. These diverse findings suggest that mechanisms for immunotoxicant effects for total and grass-specific IgE differ from those for asthma and atopic dermatitis.Phleum pretense) as an important marker of sensitization, because grass pollen is ubiquitous and has previously been demonstrated to be the most common allergen in other North Atlantic environments , 2010. ARegarding other seafood constituents, maternal n-3 fatty acid intake from fatty fish is thought to affect the development of her child’s immune system . In the The observed associations with developmental exposures to suspected immunotoxicants must be evaluated in light of the increased vulnerability of the developing immune system . BecauseAlthough breast-feeding appeared to be positively associated with the total IgE concentration, the adjustment for PCB exposure attenuated this association to a nonsignificant level. The possible impact of lactational immunotoxicant exposure, as reflected by the postnatal serum PCB concentrations in the present study, would suggest that associations between breast-feeding and serum IgE concentrations in children could, at least in part, be due to immunotoxic food contaminants transferred via human milk.Current evidence is equivocal concerning the effect of breast-feeding on the child’s total serum IgE concentration. A prospective study in the United States found lower IgE concentrations at 8 years of age in breast-fed children, but only if the mother did not have an increased IgE level herself . FurtherBreast-feeding has often been considered a preventive factor in regard to allergy development, although some studies have suggested that breast-feeding may instead cause an increased risk . Also, aThe associations of PCB and methylmercury exposures with indicators of allergy and allergic disease may involve both stimulation and inhibition of immune system functions. Based on the exposure assessments at three or four occasions, prenatal and postnatal exposures seem to have different effects. For methylmercury, we observed exposure-associated effects only in relation to prenatal exposures, and the much lower postnatal exposures did not reveal any clear associations. However, PCB and methylmercury may well target different components of the immune system, and their effects would also depend on the stage of development. Ideally, immune system dysfunction should therefore not be assessed by means of a single or a few parameters nor at one stage of development only.Our results may not necessarily be at odds with the “hygiene” hypothesis, which has been expressed in different terms regarding allergy and other diseases . Rather,Developmental immunotoxicity may predispose children to common diseases of increasing prevalence, such as childhood asthma and allergic diseases, and is therefore important from a public health perspective. Thus, our findings support the need for screening studies to identify immunotoxicants . In this |
A central task in contemporary biosciences is the identification of biological processes showing response in genome-wide differential gene expression experiments. Two types of analysis are common. Either, one generates an ordered list based on the differential expression values of the probed genes and examines the tail areas of the list for over-representation of various functional classes. Alternatively, one monitors the average differential expression level of genes belonging to a given functional class. So far these two types of method have not been combined.We introduce a scoring function, Gene Set Z-score (GSZ), for the analysis of functional class over-representation that combines two previous analysis methods. GSZ encompasses popular functions such as correlation, hypergeometric test, Max-Mean and Random Sets as limiting cases. GSZ is stable against changes in class size as well as across different positions of the analysed gene list in tests with randomized data. GSZ shows the best overall performance in a detailed comparison to popular functions using artificial data. Likewise, GSZ stands out in a cross-validation of methods using split real data. A comparison of empirical p-values further shows a strong difference in favour of GSZ, which clearly reports better p-values for top classes than the other methods. Furthermore, GSZ detects relevant biological themes that are missed by the other methods. These observations also hold when comparing GSZ with popular program packages.http://ekhidna.biocenter.helsinki.fi/users/petri/public/GSZ/GSZscore.html.GSZ and improved versions of earlier methods are a useful contribution to the analysis of differential gene expression. The methods and supplementary material are available from the website Ordered Gene List, OGL, by sorting it according to gene regulation. The upper end of the OGL represents the strongest up-regulation and the lower end the strongest down-regulation in the pathological sample. The middle area of the list represents genes with insignificant regulation. Similar gene lists can also be generated with various other data sources, like sequence similarity searches, high throughput screening of gene knock-outs, or protein expression arrays.The analysis of differential gene expression between two sample types, such as pathological and healthy tissues, is one of the cornerstones of the modern biomedical science. Here typically the up or down-regulation of each gene in the pathological samples is measured. The obtained expression data can be considered as Originally, the analysis of differential expression focused on the few genes with the most extreme up or down regulation between the samples. This is sensitive to potential measurement errors, and prone to produce false positive findings, such as genes reacting to any sample handling. Furthermore, it cannot detect biological processes showing consistent but weak regulation between the two datasets. A central improvement was to carry out the analysis using pre-defined gene classes or gene sets, such as functional classifications -3. The pSignal summary methods take the whole gene list into account and calculate a mean or median based score for all the member genes of the class [Ranked list based methods [class level scoring functions.Although the utilization of the gene annotation classes moves the focus away from the actual single gene level to the more robust biological process level, it is strongly dependent on the definition of the used threshold. This has motivated many authors to propose threshold free gene set analysis methods using each function itself to select the positive classes from the other half and (ii) by combining the results of all the methods from the other half and using this same set for all methods. Both tests were repeated with different number of positive classes. In addition, we further confirm our results by monitoring the correlation between the test and control results. GSZ constantly shows the best performance over different test situations, whereas the performance of other functions varies between the test situations.Next, we do repetitive testing of class scoring functions on real data set. As the correct positive and negative classes are not known in real data, we used the evaluated functions to predict them. We used We further evaluate the analyzed class scoring functions by generating large set of randomizations. Two very different datasets were used here. We monitored the magnitude of different empirical p-values, in order to see the risk of potential false positive findings for each function. Results showed the best performance for GSZ with small difference on one dataset and with very clear difference on the other dataset. We point out that all the observed differences in numerical data evaluations resulted from the class scoring functions, establishing GSZ-score as outstanding in this group. In addition, real data analysis shows weak performance by some of the popular scoring functions. This is, to our knowledge, one of the most detailed numerical evaluations of class scoring functions on real datasets.We also carried out a detailed biological evaluation of scoring functions. This was done by ordering GO classes with empirical p-values and monitoring top GO classes. Next, we defined biologically relevant classes for both datasets and analyzed how different methods were able to find them. GSZ-score clearly shows outstanding performance in finding the important biological themes on both datasets. Again some of the competing scoring functions evidently show weak performance on one or both of the datasets. Results were further analyzed by monitoring GO classes with largest pairwise difference between the GSZ-score and competing scoring function. Classes where GSZ-score outperformed others showed stronger differences in p-values and were clearly linked to the research setup.We also performed a comparison with some of the most widely used software packages in this research topic. This analysis is more difficult to evaluate due to the other potential sources of differences between software packages. However, this ensures that we evaluate the state of the art implementations of class scoring functions. We concentrate here on the evaluation of the reported list of GO classes, and mostly omit the reported p-values. GSZ again showed best performance on two tested datasets, when evaluated with biologically relevant classes.differential expression tests and their scores as differential expression test scores for clarity. The obtained gene list is then sorted using the selected score. In the next step, gene classes, one at the time, are taken to the analysis and the gene list is analyzed using either rank based methods or signal summary methods. We call these tests class scoring functions and their results class expression scores. Our aim is to improve the existing class scoring functions. For more information on this topic see earlier publications [A typical pipeline for gene set analysis starts by looking at the differences in the gene's behaviour in the two datasets, like in treatment and control. This can be done, for example, by calculating a score based on the difference between the mean expression values, like t-test score, with standard t-test or its variations ,18. We cications ,10,11,13We start with a ranked list based analysis, where a threshold is placed repetitively in between every consecutive pair of genes in the ordered list. The obtained subset is then used to calculate a selected statistical score. This test score can be a difference between two empirical cumulative distributions like in Kolmogorov-Smirnov statistics or a logM denote the total number of genes, and let Xi, i = 1,..., M, denote the differential expression test score for the ith gene. Furthermore, let SN be a subset of N genes from the upper end of the OGL . We use a simple function:We propose to improve these tests by taking the differential expression scores into account. Let pos) and non-members of a gene class , among the N genes with the highest differential expression test scores. This will then be calculated separately with each threshold position N, and analogously for the lower part of the OGL. To simplify the notation, the subset SN will be kept implicit in our notation by dropping the subscript N in the sequel. A similar but more complex idea has been proposed in the article that motivated this research [This denotes a difference between the sums of scores for members . Howeve• Z-score normalization is easier to perform for the plain difference.• The obtained Gene Set Z-score (GSZ-score) includes other popular methods as limiting cases (discussed below).• The resulting score is only affected by differential expression test score values within the selected subset, whereas in the equation in , the who• As a more theoretical benefit, the obtained GSZ-score treats both class members and class non-members similarly. So the results stay identical if we flip the class member and class non-member classifications.The selection of the starting equation 1 is still somewhat an open issue and our main emphasis is rather on the Z-score normalization for gene set presented later. The similarities with other class scoring functions are discussed more in detail in the supplementary text S2 [see additional file E(Diff)) and variance (D2(Diff)) for the eq. 1 under the null hypothesis, that the class members and non-members are distributed randomly across the list. This allows us to use a Z-score normalization with equation:The raw difference is an unusable statistic due to the biases caused by different sizes of classes, different sizes of subsets, and different variances of the scores in different subsets. However, these can be corrected by calculating estimates for the expected value = 2E(X)E(N) - ME(X) andwhere N is the number of positive genes in the subset, M is the size of the subset, E(N) is the mean and D2(N) is the variance of the hypergeometric distribution of the number of positive genes N for the analyzed subset. D2(X) and E(X) are the variance and the mean of the differential expression test scores for the subset. The derivation of E(Diff) and D2(Diff) is shown in Methods. As a further improvement to our GSZ-score we consider a regularized version:where prior variance k to the variance estimate inside the square root. This was done due to the too unstable behaviour with small subsets . We also take the median of the variance estimates, obtained with the class of size 10 across the whole gene list, and multiply it with a weight, w1 (0 ≤ w1 ≤ 1). Next the weighted variance medians are summed to obtain a value for k. Class size of 10 is used here as a reference class size, penalizing especially classes smaller than 10. This class size selection is 'ad hoc', but it has performed well in our analysis. We tested 12 different combinations for these two weights, with artificial data, and selected the best performing parameter values for real dataset analysis. The calculated GSZ-scores form a profile of score values over the OGL obtained from each cut-off position, including also the values corresponding to the whole gene list as a subset. From the obtained scores we select the maximum value similarly to earlier works [This is otherwise similar to eq. (2) but we add a er works ,11,13. Orow randomization the gene classifications associated with dataset rows are randomized, and in column classifications the sample labels associated with data columns are randomized. The aim was to see what type of biases the methods show as the GO class size varies, or as the threshold moves through the gene list. These results are shown in the supplementary text S1 [see additional file k significantly stabilizes the GSZ-score, with a group of tested parameter values for the k obtaining equally good results , thrIn addition, we show in supplementary text S1 [see additional file Case 1: The whole gene class shows a similar type of regulation, either up or down. Nevertheless, the complication in this simple case is that the signal for the gene class can be quite diffuse with larger STD, depending on the different measurement efficiencies for various RNAs. Case 2: only a subset of the gene class shows signal (up- or down-regulation) like in case 1. Potential explanations are: Only a subset of the gene class requires regulation or the gene class includes false positive genes that are not really members of the gene class. Case 3: Gene class shows both up and down-regulation at the same time. Here gene class can comprise differently behaving subclasses or the members can be from a pathway with activities that either increase or decrease the activity of the pathway.Next, we evaluate the class level scoring functions on very large set of various artificial datasets. We currently lack complete knowledge on what can be considered as a positive signal for a differentially expressed gene class. However, we propose a few signal types that can be intuitively justified. Here we have used an artificial data generation similar to previous work ,10. TestFirst, the analysis was carried out with various gene class sizes, testing each class size separately. Thus, the compared results for positive and negative cases are obtained with the same gene class size. Next, the results for different class sizes and signal types are combined. This measures the performance of the method in the case where the various gene class sizes are separately normalized with mean and standard deviation estimates obtained from randomized data. This is currently the standard procedure of most programs. In another option, the positive and negative results for different class sizes are pooled and the separation is monitored within the pooled data. This measures the stability of the functions when the gene class size varies. This corresponds to the performance of the method without any class specific normalization with randomized data (proposed for example with iGA ).In each testing situation with each parameter setting for positive datasets we generate 200 positive datasets and 600 negative datasets. Next, we calculate the test scores with each of these datasets. We used Area Under receiver-operating characteristics Curve (AUC) as a measure of separation. This was considered better than the analysis of power , as powei and j specify methods that are compared and l = 1, 2.. R refers to dataset, obtained with specific parameter values. Score A represents the mean of differences of AUC scores for two methods across all the datasets in the testing situation, whereas score B represents which of the methods, i or j, was more frequently better. We generated with both of these scores a difference matrix representing all the method pairs. Next the average for each method i was taken, by letting j go over all the methods. Now we have two measures for the tested method: One corresponds to average of difference to other methods and the other corresponds to frequency of better performance than with other methods. Results for these two scores are shown in table where The results show the best overall performance for GSZ-scores. The only exception to the rule is the better performance of iGA in the testing with simultaneous up and down-regulation with fixed class size. Even there GSZ-scores showed good performance in a larger subset of the datasets (shown by the score B). This discrepancy of two measures proposes that we frequently see slightly better performance from GSZ-score and a small subset where iGA clearly surpasses GSZ-scores. Subsequent analysis links this to datasets showing signal around 1 STD dataset , due thegold standard) are not known. Therefore we used the methods themselves to estimate the positive classes. This can omit some positive classes that none of the methods can discover and equally report some negative classes as positive. Nevertheless, we are not aware of any other realistic solutions for selecting positive GO classes, and minor errors should not corrupt our results. We also presume that the GO classes form a smooth transition with strongly positive GO classes at one end and strongly negative GO classes at the other end rather than a sharp binary classification to positive and negative classes. We therefore decided to use a varying rank threshold, selecting q best classes from each method as positive . This aWe chose the AUC score to see how well the sorted list of GO classes separates different selected positive and negative classes. These results were also further confirmed with overall rank correlation between the ordered gold standard GO class list and ranked GO list from the evaluated method. Two methods have different aims: AUC with varying rank threshold focuses on most positive GO classes in control set, whereas the rank correlation monitors the overall correlation between the test and control set. Resulting evaluations are based on rank rather than the actual score values obtained for different methods. This was considered to be beneficial as different methods can be expected to follow different distributions, and including the actual score values would therefore put methods in unequal position. Only case where also the actual signal scores were used was the comparison of method with itself using pearson correlation Method itself is used to define k best GO classes from one half of the dataset. Next the method is run using the other half of the dataset to see how well it can predict its outcome from the correlating dataset. ii) All methods are allowed to select k best GO classes as positive GO classes using one half of the dataset. Next, each method is run on the other half of the data and it is tested how well they can predict the combined positive outcome of all the methods from the correlating dataset. Results from both cases were analyzed using AUC with varying rank threshold and also with standard correlations.The evaluation was done in two ways: i), we use each method itself to define gold standard from the separate data, selecting the method that is most robust to the variances between the biologically replicated datasets. Furthermore, as each method is tested against its own results, the occurrence or lack of correlation with other scoring functions does not affect the evaluation. However, this could favour methods that have biased selection, like a preference of large classes. Neither does it penalize methods that miss GO classes that other methods are able to find. In case (ii), the combined results of all the methods from the separate data represents the same gold standard for all methods. Here method has to be robust to variances between the datasets, and also be able to predict combined positive classes coming from all the methods.These evaluations have different evaluation principles. In case (ii), but they stabilize at larger ranks, especially when rank threshold is between 10 and 20. This can be explained by the increasing size of the positive class set, used in the AUC scoring, which is potentially less sensitive to variations and errors in its definition.These analysis steps were done with four splits of the dataset (8 replicates). Results, averaged over all the replications, are shown in fig. i) GSZ-score shows best performance, with an even performance to t-test at the very first ranks. The detailed analysis of differences in replicates GSZ-score shows the best performance, and iGA is the close second best method. Their performances overlap in replicates across the top 10 ranks and after rank 20 GSZ-score consistently tops iGA in all replicates it slightly surpassed t-test but is clearly better than iGA and in case (ii) it slightly surpassed iGA but was obviously better than t-test. Furthermore, it consistently topped modKS in case (ii) and clearly showed better overall performance in case (i). It was also observed that KS test shows the undoubtedly weakest performance in both tests. For a novel method, like GSZ-score, it is also interesting to see which methods are most similar to it. This was analyzed with the whole ALL dataset, using rank correlation. Results are shown in table The overall performance of GSZ-score was best in these evaluations, as in case results correlate strongly, and we further show in supplementary text S1 [see additional file The actual p-value signals are represented as two separate results in the fig. Fig. p-value = 0 (6 classes), but also KS produces 5 classes. In addition, GSZ drops to the 2nd best after iGA around rank 10. This data proposes that GSZ is the best function across top ranks but it drops down later. These weaker ranks probably represent more random background signal.ALL dataset represents very strong biological signals. However, it is equally important to evaluate the scoring functions with expression data with weaker signal levels. Therefore, we replicated the p-value comparison with p53 dataset and reprWe also evaluate the biological relevance of the reported classes. This monitors the ability of scoring functions to report the relevant biological classes. We generated a sorted list of GO classes from each scoring function using the p-values from pooled data and class data in combination . As p53 data represents a small number of positive classes, we represent its results here in table P53 dataset compares cancer cell lines with a mutation in p53 transcription factor to the ones without mutations. Here the classes with link to programmed cell death (apoptosis) were considered as positive. Selected classes were further confirmed by looking their regulatory relationship with p53 from the GeneGo Inc. MetaCoreTM database for each GO class between GSZ-score and each of the other methods. This allows the analysis of the actual GO classes representing the strongest separation between the compared methods. Here, again, we monitor whether these classes are relevant to research setup and also the difference in the log.The outline of this analysis is represented in the supplementary text S1 [see additional file Also p-value differences are much smaller. There are also some interesting details in the comparisons:When comparing GSZ with T-test we observe large number of relevant GO classes with simultaneous up and down-regulation in ALL dataset. These were naturally missed by T-test, whereas GSZ was able to report them. Furthermore, we observed surprisingly weak performance of T-test on p53 dataset.The comparison with iGA showed many classes from ALL dataset that had a strong regulation. GSZ was able to report very strong p-values for them, whereas iGA did not notice them since it discards the expression values. This underlines that inclusion of differential gene expression scores benefits the test statistic. GSZ clearly reported from p53 dataset better p-values for 3 apoptosis classes.On ALL dataset modKS shows very strange behaviour, and it is clearly outperformed by GSZ. Our assumption is that weak performance of modKS is related to its sensitivity to outlier expression values in GO classes. This outlier sensitivity is further demonstrated by supplementary figures S1 and S2 [see additional file Standard KS showed weakest performance in these comparisons reporting mostly quite random GO classes.These results bring forth GSZ as an outstanding method, when evaluating the biological relevance of the reported classes. There was only one exception on this rule in the p53 dataset, where iGA and KS reported stronger signal on ARF protein signalling classes. These apoptosis classes were not reported as linked to p53 according to GeneGO. Also their average regulation was very small.We also compared our analysis pipeline with other actual software packages. This comparison is less clear to interpret, due to a large number of variables between different analysis pipelines. In addition, the programs report p-values post-processed in various ways. Therefore, the evaluation is focused on the order of the reported GO classes omitting the actual p-values. These obtained GO class lists are evaluated using the selected biologically positive classes again. We selected three software packages for comparison. These were Gene Set Enrichment Analysis package , SignalAll compared methods were run with the same set of GO classes, with no maximum size limit and the minimum size limit set to 3. Although these settings are sub-optimal for the biological analysis, they allow a thorough evaluation of the packages against the variations in the GO class size. All the methods were also tested with 1000 randomizations. Both these settings correspond to the parameters used with the GSZ analysis in function comparison.Two methods (GSEA and GSA) are one-sided tests, generating two separate outputs. However, we need a single GO class list for comparison with SP and GSZ-score. This was accomplished by combining the two GSEA output lists and sorting them using the absolute value of Normalized Enrichment Score (NES), used also to sort the result classes in the GSEA. With GSA we did a similar procedure, ordering in the first round with the normalized score and in the next round using the p-values. However, we also discuss the rankings in the separate lists. The following two chapters represent the results from two datasets.First we compare methods with ALL dataset. We used same biologically positive classes as in the earlier evaluation with the ALL dataset. The obtained results can be seen in the supplementary table S5 [see additional file There are also differences between the top three methods. GSZ, GSA, and SP all have only a few negative classes among top 20 classes. However, after the rank 20 their density drops in GSA and SP results. Indeed, there is only 7 negative classes among top 40 classes in GSZ-score results and one border case, whereas SP results have 17 negative classes and one border case, and GSA has 18 negative. This makes their error rate among these top classes over two times bigger and highlights GSZ again as the best method. A detailed analysis shows that SP misses totally positive classes with large variance signal and small mean signal . Likewise, GSA represents a quite small signal for some classes emphasized by SP and GSZ, like 'MHC class II protein complex' and 'antigen prosessing and presentation' classes.Next, we compared the methods with p53 dataset. Here, again, we select the programmed cell death (apoptosis) related GO classes as positive. Obtained results are shown in table SP reported one apoptosis related class at the rank 8, with empirical p-value = 0. This was the same class rated as first class by modKS, iGA and GSZ. It had actually the first rank in the column randomization of SP, proposing that it is here more useful than the combined ranking from two randomizations. Thus, SP performs quite nicely, but reports only one cell death related class among the top-50 classes, whereas GSZ was able to report 4 of them among top-15 classes. Furthermore, the standard ranking of SP was not optimal here.th and after our reordering with Z-scores its rank is improved to 2nd position. However, when the two GO class lists are pooled, the rank of the apoptosis class is only 6. Therefore, its performance seems to be weaker than GSZ.GSA generates separate lists for up and down regulated classes. Also, the outputs of GSA represent several GO classes with same p-values. Therefore, we generated new ordering for GO classes, separately for up-regulated, down-regulated and combined set of GO classes. One apoptosis related class is seen in the down-regulated set of GO classes with empirical p-value = 0. Its original rank was 5GSEA generates two lists, instead of one. We again combined them into a single list. The apoptosis related classes were in the list of down-regulated classes at the ranks 8, 14 and 24, and in the results of the pooled list at the ranks 9, 21 and 37. However, if we were to use the default GSEA FDR cutoff (0.25), none of these classes would have been reported. Also, all these apoptosis related classes were low in the result ranking. Therefore, the performance of the GSEA seems quite weak again.Altogether, both datasets point out to GSZ as best method for detecting biologically relevant classes. SP and GSA show quite equal second best performance. Furthermore, both datasets pinpoint GSEA as the apparently the weakest method.GSZ reported 4 apoptosis related classes from p53 data: Release of cytochrome c from mitochondria, apoptotic mitochondrial changes, induction of apoptosis by intracellular signal and caspase activation via cytochrome c. What these classes represent is some of the key steps for programmed cell death: intracellular apoptotic signalling to mitochondria, removal of cytochrome c and its later complex formation with caspase. In addition, other methods (iGA and KS) highlight the ARF protein signal transduction. This group plays a relevant role in apoptotic signalling, although it shows here only very weak regulation. This suggests that a combination of two or three scoring functions could actually highlight all the possibly relevant biological signals in the dataset.ALL dataset showed classes representing simultaneous up and down-regulation, such as immunological synapse, positive thymic t cell selection and lymphocyte activation. Key trends here seem to be: Cell surface receptor signalling that activates immune response and developmental steps of T cells in thymus. Both these processes are central to immune processes. GSZ is able to recognize in particular the immunological synapse, a communication method between B cells and T cells. Note that part of the immunological synapse is expressed in T cell and part in B cell and it is complete when two cells interact with each other. These relevant immunological processes could not be observed from this dataset by methods that monitor only the mean expression of the GO class. Here t-test and SP missed them. Only GSZ and iGA performed satisfactorily on these classes. Also GSA from program comparison was able to detect a fraction of these.ALL dataset also represented GO classes with strong mean up or down-regulation. These classes link to T cell receptor complex, antigen processing via MHC class II protein complex, and to MHC class II protein complex. What is paradoxical is that some methods did not give good scores to these classes. Especially iGA and KS performed weakly with these. This was probably due to the limitation of the analysis only to the order of the genes. Only GSZ and t-test in the comparison of scoring functions reported good scores for these classes. Also SP gave very strong signals to these classes. Surprisingly, GSA obtained less strong results on some of these classes (MHC class II protein complex and antigen processing related classes). Altogether, these results point that across different biologically relevant signals GSZ shows better performance compared to the other, competing algorithms and programs.Current work proposes a novel class scoring function for threshold free gene set analysis. The function is a Z-score that is shown to have similarities to hypergeometric function and to correlation analysis steps, and treat the functions in a consistent manner. This potentially weakens the performance of modKS, for which the original article reportedMost earlier publications focus only on one of the two potential null permutations. We propose a separate normalization with row and column randomizations of a dataset, and the selection of the less significant outcome as the result. This represents a pessimistic but also intuitive perspective, where the more likely null model is allowed to explain the observed results. As a drawback, the obtained p-value will naturally be conservatively biased. Nevertheless, our permutation evaluations show that GSZ is stable under row randomizations that are associated with many genes. Fortunately, the current remapping projects (see for example ) aim to 10>70). Note that iGA represents a variation of the standard threshold based hypergeometric analysis, and these results suggest that one might need similar column randomization also with those methods [Randomizations play critical role in analysis . The usa) classes where T-test fails due to the heterogeneous regulation, b) classes where iGA represents weak signal although the class represents a clear regulation, c) strongly regulated classes where modKS fails totally. P53 dataset gave also similar results. Overall, our work represents one of the most detailed evaluations of GO analysis methods with artificial and real data, and we hope to inspire the field to implement similar detailed and comprehensive evaluations in GO analysis method comparisons.Real data was evaluated even further by generating a 1000 row and column randomizations, and looking at the actual p-values. We focused on the top 100-classes from ALL dataset where GSZ-score clearly represented a larger signal with 250 - 7100 times better signal for strongest class, and consistently over ten times better p-values for top ranks. Obtained results were further analyzed by looking at the biologically positive classes. Analysis showed that GSZ-score results show largest number of biologically relevant classes among their top ranks. Scoring functions were further compared using the pair-wise differences of the GO-class p-values. These differences from ALL dataset highlight The combination of artificial and real data analysis revealed some exciting insights. KS test had the third best performance in the artificial datasets, but with real data it showed the undisputedly weakest performance. This seems to confirm the hypothesis that the signal area where KS shows its best performance in artificial data see fig. and 2 isk, which corrects for signal when the subset from gene list is small. However, our artificial data evaluation shows set of parameter values that represent equally optimal performance . These are used to add prior variance to calculus. Similar method is regularly used in gene expression data analysis and in various areas of data mining . Yet the performance could potentially be improved with a more exact measure using an estimated cumulative distribution or Bayes Factor. In addition, the performance might be easily improved by using a larger number of score values from the calculated GSZ-score profile, obtained over the gene list, than just a single maximum value. A separate variation on this theme is the connection to max-mean statistic [The introduced GSZ-score could be further improved. One of its weaknesses is the requirement of the prior variance tatistic , which wWith increasing demand of gene list data analysis for gene expression, the introduced Gene Set Z-score function should represent a significant addition to analyst's tool palette. It represents a novel addition of signal-levels to ranked list analysis and gives reliable results.To calculate the estimates for the mean and variance, we have to note that the analysis situation can be modelled with a composition of two functions. The first one defines the probability for the observed number of class members in the analyzed subset. The second one defines the probability for obtaining the observed sum for the class members. The exact analysis with Bayes factors or using exact cumulative distribution to calculate p-values, would require the definition of a complex distribution with potentially too heavy calculations. Therefore, we prefer to use a Z-score with relatively simple estimates for mean and variance. Mean is simpler to derive from these two, and it is also required in the variance estimate. Thus we represent it here first. We start with the differencepos refers to positive genes (class members) and neg refers to negative (class non-members). We are dealing here with a sum of N values S = ΣnXn selected from the pool of X1, X2,..., XM values, which in turn is a subset of the total dataset (with size of L genes with K positive genes). The N = Npos is the number of positive genes included to our data subset (with M = Nneg + Npos). When the subset is randomly sampled from the total data pool, we do not know the N beforehand, but it can be expected to follow hypergeometric distribution, representing sample (without replacement) of size M from the pool of L genes including K genes classified as positive. Expected values for both terms in the eq. (8) can be defined using conditional probabilitiesHere E(S|N = i) = iE(X) is shown in supplementary text S1 [see additional file E(X) represents the expected value, or mean, of the data subset X1, X2,..., XM. Expected value for eq. 8 can be represented as:which is simply the probability weighted sum of expected values, conditional on the number of class members in the sum. Proof that the E(N), expected value for the test scores in the analyzed subset E(X) and the number of data points in the subset M. In practice we replace the E(X) with empirical mean calculated from the whole subset. This intuitive result is conditional on the selected data subset (M), on the size of the whole data pool (L) and on the number of positive genes in the whole pool (K). Estimate of the variance is somewhat harder to obtain. Here we start with the definition of variance for a single summation (S) in eq. (8).So the expected value is a simple function of expected value for hypergeometric distribution N we can express the expectation E(S2|N) as a sum of variance and the squared expectation.By fixing N values selected from the pool of X1, X2,.. XM values with variance D2(X) . Note that D2(S) = 0, when N = 0, N = M or if Xi = Xj for all values of i and j (resulting to D2(X) = 0). Derivation of D2(S|N), used in eq. 12 is represented in the supplementary text S1 [see additional file The first term in the latter equation represents the variance of the sum of E(N), D2(N)), the mean and the variance for the subset of the data (E(X), D2(X)) and the size of the data subset (M). The result stays same, whether we monitor the variance of sum for the negative or the positive data points. Equation is similar to the well known equation for the variance of the sum of N copies of identically independently distributed variables D2(Siid) = D2(X)E(N) + E(X)2D2(N). Here the difference is caused by various draws of Xi not being independent.This is simply an equation of the variance and the mean of hypergeometric distribution . A closer look reveals that this is simply a multiplication of two constants having no variance at all, no matter what outcome we observe in our test dataset.The equation (13) represented the variance of the first summation in the equation (12). For the whole variance of the eq. (8), we have to multiply eq. (12) with squared constant 2Therefore it does not affect our variance estimate. So the final score for a data subset analysis becomes:k added to the variance:In contrast to KS and modKS, when OGL is divided to two subsets, our score gives a different score for upper and lower subsets. Therefore, with eq. 14 it is required to consider separately the lower and upper end of the list. We took the largest absolute score from these two lists as the final outcome. Another modification to our score function was made due to the observed instabilities with small subset and class sizes. This is simply a prior variance Note that similar procedure is regularly used with t-test in the expression data analysis. Selection of the prior variance will be discussed in the results section.The BioConductor package , probe rALL: Acute Lymphatic Leukaemia; AUC: Area Under receiver-operating characteristics Curve; ECD: Empirical Cumulative Density function; EVD: Extreme Value Distribution function; GO: Gene Ontology; GEVD: Generalized Extreme Value Distribution function; GSA: Gene Set Analysis; GSEA: Gene Set Enrichment Analysis; IBMT: Intensity Based Modified T-test; iGA: iterative Group Analysis; KS: Kolmogorov-Smirnov test; LR: Likelihood Ratio; ML: Maximum Likelihood; modKS: modified Kolmogorov-Smirnov; OGL: Ordered Gene List; RMA: Robust Multi-array Average; SP: Signal Pathway.PT developed, implemented and tested the methods. PO proposed the research topic and contributed to the datasets and visualization. PM contributed additional mathematical proofs. LH supervised this research. PT, PO and LH evaluated results. All contributed to the writing of the manuscript. All authors read and approved the final manuscript.Supplementary text S1. This text shows in detail the stability of the GSZ-score and competing methods with randomized data, as the threshold moves through the gene list. In addition, the stability of the methods is monitored as a function of the GO class size. Text also highlights the false positive signals seen with column randomizations. Furthermore, the performance of the used normalization with randomized datasets is shown, and the normalized scores and the empirical p-values, obtained with row and column randomizations, are compared to each other. The text also represents the detailed comparison of pairwise differences in p-values for different scoring functions. In addition, most of the Methods are introduced here. Mathematical supplement shows the derivation of E(S|N) and D2(S|N), required for the derivation of the GSZ-score.Click here for fileSupplementary text S2. This text represents a mathematical comparison of the GSZ-score with hypergeometric Z-score, with correlation between the differential expression scores and GO classification, with max-mean score (by Efron & Tibshiriani) and with Random Sets scoring function by Newton et al.Click here for fileSupplementary figure S1: Stability of the GSZ-score as the threshold goes through the gene list. Distribution of the GSZ-score values as the threshold is moved along the gene list. Subset is smallest at the left and largest (the whole gene list) at the right end of the plot. Results are calculated using all the 4511 GO classes from diabetes dataset with randomized GO class matrix. Blue lines show seven percentiles at each position. For comparison, the red line shows minimum and maximum scores from the non-randomized diabetes dataset. Notice the good stability with the regularized GSZ-scores. Figure is discussed more in a more detail in the supplementary text S1 [see additional file Click here for fileSupplementary figure S2: Stability of KS and modKS as the threshold goes through the gene list. Behaviour of the KS test and the modKS test with the same randomized and positive dataset. Lines represent the same percentiles as in the supplementary figure S1 [see additional file Click here for fileSupplementary figure S3: Performance comparison in case (i) with each split analyzed separately. Performance of the methods in each split in case i. Figure represents the AUC score for each evaluated method as the rank limit of the positive GO classes is increased. Note that AUC is calculated here using the whole evaluated GO class list, and it is the size of the used positive GO class set that varies. Methods represented are GSZ-score: blue line with circles, t-test: green line with cross, KS test: red line with box, modKS test: cyan line with diamond, iGA: magenta line with x. Notice that although the signal levels vary between the replicates, the differences between the methods are stable. GSZ-score and t-test show equal performance among the smallest ranks, whereas the GSZ-score is clearly the best among the larger ranks. Other methods show weaker signal. Figure is zoomed to the upper signal area so that most of the curve for the KS is left outside.Click here for fileSupplementary figure S4: Performance comparison in case (ii) with each split analyzed separately. Performance of methods in each split in the case ii. The figure represents the AUC score for each evaluated method as the rank limit of the positive GO classes is increased. Methods are coloured identically to the earlier figure. Here, GSZ-score and iGA show the best performance at very top ranks, with GSZ-score slightly surpassing iGA. Note that performance of t-test and modKS varies considerably across the replicates. After rank 20 GSZ-score is constantly best in all the replicates.Click here for fileSupplementary table S1: Top 100 GO classes reported by each scoring function from p53 dataset. This table presents 100 best scoring classes for each scoring function from p53 dataset. Table shows class rank, two combined empirical log-p-values, mean of expression values of GO class genes, mean of absolute expression values for GO class genes, class size and class name. In addition, we show four different empirical log-p-values and 7 percentiles for the expression values of the class members. Empirical log-p-values are the ones used to calculate the combined log. Biologically relevant (positive) classes are shown in bold font and border cases are with underlined font. Results from each method is presented as a separate Excel worksheet. Furthermore, the first worksheet represents a summary of the results for each scoring function.Click here for fileSupplementary table S2: Top 100 GO classes reported by each scoring function from ALL dataset. This table presents 100 best scoring classes for each scoring function from ALL dataset. Columns are similar to the columns in supplementary table S1 [see additional file Click here for fileSupplementary table S3: GO classes showing largest pair-wise differences from ALL dataset. This table presents 50 GO classes with the strongest combined log differences in favour, as well as against the GSZ-score, in a pair-wise comparison with other scoring functions. Each comparison with each competing scoring function is on a separate sheet. Columns in the tables are identical with columns in tables supplementary table S1 and S2 [see additional files Click here for fileSupplementary table S4: GO classes showing largest pair-wise differences from p53 dataset. This table presents 50 GO classes with the strongest combined log differences in favour, as well as against the GSZ-score, in a pair-wise comparison with other scoring functions. Each comparison with each competing scoring function is on a separate sheet. Columns in the tables are identical with earlier tables.Click here for fileSupplementary table S5: Top GO classes from GSZ-score and compared program packages from ALL data. This table presents top classes obtained from GSA, SP, GSEA and GSZ-score. Summary of the results is on the first sheet. Separate sheets show each programs results with additional data. Furthermore, we represent two result sheets for scoring functions with one sided test . One presents the one sided test results and the other presents the combined results.Click here for fileSupplementary table S6: Top GO classes from GSZ-score and compared program packages from p53 data. This table presents top classes obtained from GSA, SP, GSEA and GSZ-score. Summary of the results is on the first sheet. Separate sheets show each programs results with additional data. Furthermore, we represent two result sheets for scoring functions with one sided test . One presents the one sided test results and the other presents the combined results.Click here for file |
Intravascular or intracardiac stenoses occur in many forms of congenital heart disease (CHD). Therefore, the implantation of stents has become an accepted interventional procedure for stenotic lesions in pediatric cardiology. Furthermore, stents are know to be used to exclude vessel aneurysm or to ensure patency of existing or newly created intracardiac communications. With the further refinement of the first generation of devices, a variety of “modern” stents with different design characteristics have evolved. Despite the tremendous technical improvement over the last 20 years, the “ideal stent” has not yet been developed. Therefore, the pediatric interventionalist has to decide which stent is suitable for each lesion. On this basis, currently available stents are discussed in regard to their advantages and disadvantages for common application in CHD. New concepts and designs developed to overcome some of the existing problems, like the failure of adaptation to somatic growth, are presented. Thus, in the future, biodegradable or growth stents might replace the currently used generation of stents. This might truly lead to widening indications for the use of stents in the treatment of CHD. Since the first description of an interventional procedure in the field of congenital heart disease (CHD) by Rashkind in 1966, which laAlthough intravascular stents still do not have the Food and Drug Authority (FDA) approval for use in congenital lesions and pediatric patients, since 1996, their use for congenital vascular lesions has been accepted as the standard of care by all centers and professional medical societies associated with the treatment of pediatric and CHD. This review will address some key questions in the common practice of the use of stents in the CHD population. Advantages and disadvantages of the different types of stents and stent designs currently used in CHD are presented. Furthermore, recent developments in stent technology intended to overcome some of the present problems in stent therapy that might expand the spectrum of indications for stenting are addressed. As this paper focuses on stent therapy within the heart and the central great vessels, the use of stents in peripheral arteries and veins is not discussed.Common indications for stent deployment in CHD include treatment of obstructive lesions of the (1) branch and peripheral pulmonary arteries, (2) systemic and pulmonary veins, (3) aorta and branches, (4) right ventricular outflow tract (RVOT) conduits, (5) maintenance of patency of the arterial duct in duct-dependent circulation, (6) maintaining patency of stenosed aortopulmonary collateral vessels or surgically created but obstructed shunts and (7) maintaining patency of intracardiac communications.Stents are classified on the basis of the material of which they are made, the target region, their configuration and their size. Additional features used in classifying them include coverage, special surface treatment and coatings and drug-eluting properties. But, the most common classification is based on their delivery mechanism: Balloon-expandable versus self-expandable stents.Balloon-expandable stents (BES) are mounted on balloons, positioned across the site of obstruction and are implanted by inflating the balloon. The size of the inflated balloon determines the expanded diameter of the stent. BES were introduced for the treatment of congenital heart lesions in 1987,5 with thDesirable features for an ideal stent design in pediatric cardiology are: (1) low stent profile combined with (2) high trackability and (3) flexibility to negotiate steep curves, (4) good radio-opacity and visibility for precise placement, (5) compatibility with magnetic resonance imaging (MRI) with no artifacts, (6) predictable expansion with minimal foreshortening, (7) sufficient radial strength, (8) low rigidity with no material fatigue over time, (9) full biocompatibility with resistance to thrombus formation and corrosion, (10) prevention of plaque protrusion, (11) avoidance of neointimal proliferation, (12) round and soft edges for avoidance of intimal damage, (13) possibility of redilation with patients' growth, (14) wide struts to maintain blood flow to jailed vessel branches and (15) retrievability and possibility of repositioning if needed. Obviously, there is no stent yet available that combines all of these requirements so that selecting the right stent for the appropriate condition is one of the most difficult challenges encountered by pediatric interventional cardiologist.Technically speaking, stent performance is related to the material characteristics, form, fabrication mode and geometry.The most widely used material for BES is still stainless steel, typically 316 L. It is particularly corrosion resistant and in its fully annealed condition, easily deformable. Alternative materials for BES used in CHD are platinum alloys , tantalum and cobalt alloys . Cobalt chromium alloys are very interesting for use in pediatric cardiology as they allow lower crimping profiles with high radial strength. Recently, biodegradable stents have been introduced that are composed of polymeric substances, magnesium or biocorrodible iron. This new class of stents is discussed in the section “New developments in stent design and future perspectives” at the end of this article.The vast majority of coronary and peripheral vascular stents are produced by laser cutting from tubing, the so-called slotted tube design. Intricate patterns can be produced using tube sizes from 0.5 mm diameter. BES are cut in crimped or near-crimped conditions, allowing a low profile. In slotted tube stents, those with the more conservative closed cell design need to be distinguished from those with the newer open cell design.The traditional closed cell design describes a sequential ring construction wherein bridging elements connect all internal infliction points of the structural members . This isThus, older Palmaz stents such as the Palmaz 8 series and others have been replaced by the Genesis series. The Genesis stents represent the latest evolutionary step of the Palmaz “biliary” stent series. They are similar to the Corinthian stent , except for the new sigmoidal hinge. This element adds greater flexibility without compromising radial strength. They are available as unmounted and pre-mounted, the latter for only the smaller diameters – paradoxically named Genesis Medium. The Genesis Medium stents can easily be dilated to 5–8 mm, but overdilation up to 12 mm is possible. Genesis Large are labeled as 5–10 mm, but may be dilatable to 12–15 mm. The Genesis XD can be dilated optimally to 10–12 mm but can easily be overexpanded to 18 mm. Some other commonly used stents with the closed cell design are listed in The primary advantage of the closed cell design is optimal scaffolding and a uniform surface, regardless of the degree of bending. However, these advantages result in a structure that is typically less flexible than with a similar open cell design.In open cell design, geometry does not connect consistently throughout the stent, forming incomplete and non-bridged cells. With expansion, the individual cells merge to form larger open areas; thus, there is no consistent shape of cells . Example6In contrast to stents with the slotted tube design, the Cheatham platinum (CP) stent has been developed using a welded tube. It is manufactured from a wire, which is bent and welded to a cylindrical meshwork, forming the stent. This leads to more adjustable flexibility and a wide range of size and length, but radial strength is usually less than the ones with slotted tubes.The most commonly used stent in pediatric cardiology is the CP stent, which is made from 90% platinum and 10% iridium. Each row of zigs is laser welded with the addition of gold soldering (since December 2002) at each welded spot to increase the total strength of the weld. The number of zigs affects the final diameter and the degree of shortening as well as the profile of the stent. While it is available in 6 and 8 rows, it is mostly used in the 8-zig configuration, as this shortens much less than the 6 zig at the equivalent diameters and can be dilated up to 28 mm (instead of 18 mm for 6 zig), with foreshortening of about 22–28%; however, dilatation to larger diameters is possible.[99CP stents are available in a covered version, with an outer polytetrafluoroethylene (PTFE) membrane. The covering is initially approximately 7 mm in diameter and will stretch over the range of diameters of expansion and will always be taut over the stent when expanded. To date, the covered CP stent is the most widely used covered stent in patients with CHD.11–26A very practice-orientated classification for the use of BES in CHD is based on the maximum expandable size of stents. It is important to note that, due to the lack of official recognition for use in pediatric and CHD patients, nearly all stent manufacturers test and label their stents with the maximum diameters for use in approved smaller diameter biliary system and peripheral vessels, rather than their true potential maximum diameter. Thus, stents can be categorized into four different sizes by their “true” maximal expandable size: Small (3–6 mm), medium (10–12 mm), large up to 18 mm) and extralarge (up to 25 mm).[ mm and eIn The large majority of balloons currently used for stent deployment are still adapted from the adult vascular angioplasty and “biliary” applications. These large- diameter single-balloon catheters tend to expand first at their ends and thereby evert the stent ends such that they protrude radially from the stent center. Deploying a stent in this orientation can cause injury to the vessel wall and may be a risk factor for the development of aneurysm or dissection. One of the most important developments in equipment for the delivery of large-diameter stents has been the Balloon-in-Balloon catheter, the first balloon specifically designed for stent delivery in the CHD population. These catheters have an inner balloon and a longer outer balloon that is double the diameter of the inner balloon. The BIB catheters are available in outer balloon sizes of 8–24 mm. The BIB catheters offer the important advantage of opening the stent more uniformly along its length but require a larger arterial sheath for introduction. With a stent hand crimped onto the balloon, it is necessary to upsize the long sheath by 1F, greater than is necessary for the BIB catheter alone. Therefore, with hand-mounted stents, BIB catheters with outer balloon diameters of 8–14 mm require a 9F sheath, 16 mm catheters a 10F sheath, 18–20 mm catheters an 11F sheath and 24 mm balloons a 12F sheath. Thus, while BIB catheters prevent stent flare and offer more precise control over stent placement, single-balloon catheters are still sometimes preferable in smaller patients to reduce risk of injury to the femoral artery at the access site.The development of ultra high pressure (UHP) balloons like the Conquest (5–12 mm diameter) and the Atlas may facilitate successful treatment of stent-associated stenoses that are resistant to conventional high-pressure dilation. These balloons, originally developed and approved for treatment of stenotic hemodialysis fistulas, contain For lesions resistant to conventional high-pressure angioplasty, evidenced by a persistent waist, cutting balloons may be used before stenting. A Cutting Balloon™ has three or four longitudinal microtome blades bonded to a non-compliant balloon. Folded between the material of the balloon, the blades are exposed when the balloon is slowly inflated, achieving a profile of 0.127 mm from the surface. Their microblades are intended to incise only the intima and part of the media in a vessel, resulting in a more controlled dissection of the vascular intima. On deflation, the balloons refold very smoothly and the blades recess back to their original configuration in the surface of the balloon. As they are only available in sizes up to 8 mm, this limits their use in larger vessels. Currently, they have been shown to be very effective in pulmonary branch artery stenosis,30 major 32Only a minority of BES suitable for CHD are pre-mounted, like the Genesis medium stent (Cordis) that is available on a Slalom™, OptaPro™ and Aviator™ Balloon (Cordis). The pre-mounting represents a unique incorporation of the stent into the wall of the balloon. This fixes the stent very securely on the balloon and allows delivery of the stents to very circuitous locations without the need for a long sheath and with no displacement during delivery – although using a short sheath access may not always be advantageous, as monitoring of placement with contrast medium injection is more difficult. Currently, most stents for CHD come unmounted and have to be hand crimped over the desired balloon, which also has its own advantages. This offers more flexibility, as stocking is easier because multiple stent–balloon combinations are possible. We sometimes use a customized crimping device to obtain a very low profile and tight stent/balloon assembly. Thus, it has been possible to deliver a Mega LD stent (EV3) on a 6 mm Powerflex P3™ (Cordis) balloon through a 6 Fr-long sheath .Materials for self-expanding stents should exhibit large elastic strains. The most widely used material is nitinol, a nickel-titanium alloy that can be recovered from elastic deformations of up to 10%. This unusually large elastic range, commonly known as superelasticity, is the result of a thermoelastic martensitic transformation. The limited elastic range of more conventional materials, such as stainless steel (Cook “Z Stent”) or certain cobalt-based alloys , offer limited design options. While the WallStent offers excellent wall coverage and flexibility, its shortcoming is its length change during deployment of up to 53.8%, making the newer design more supin vitro study.[Self-expandable stents, constrained within a covering delivery sheath, are delivered to the site of stenosis. Withdrawal of this sheath uncovers the stent, which then reassumes its original shape (the chosen diameter) to dilate the stenotic lesion. As these stents do not require a balloon for expansion, they can be delivered through a lower-profile delivery system. Compared with BES, they are more flexible and thus can be passed through very tortuous vessels and lesions, but have significantly lower radial strength. They are made from nitinol and are therefore fully MRI compatible. Because of the unique memory effect of nitinol, they show a delayed 10–20% additional expansion within the first month following implantation. This might partially compensate for the development of more neointimal hyperplasia than witro study.Traditionally, they have been used for peripheral vascular applications, where external compression can permanently deform a stainless steel stent, but not the nitinol thermoelastic stent. Their main disadvantage is that they cannot be further dilated to accommodate vessel growth. Therefore, use of this type of a stent in growing children is limited–37 unlesSelf-expandable stents currently used in CHD are listed in PA obstructions occur in both congenital and acquired disease and they are found as isolated or multiple lesions, discrete stenosis or diffuse hypoplasia. Genetic syndromes such as Williams or Allagille are associated with such obstructions. They may be part of simple or complex cardiac malformations, such as ventricular septal defect, pulmonary valve stenosis, tetralogy of Fallot (TOF), pulmonary atresia and others. The majority of the acquired lesions are remnants after surgical procedures in complex heart defects. Thus, stenoses may develop as a result of extensive scarring at a previous PA repair site or at the anastomosis between the PA and a conduit or along the aortopulmonary shunt. Sometimes stretching of vascular structures may contribute to formation of stenosis, as seen following the LeCompte maneuver for repair of d-TGA. Such examples indicate that the underlying etiology and thus the pathomechanism of the obstruction differ from case to case. Therefore, optimal therapeutic strategies, based on case characteristics, should be adapted. Universally accepted indications for intervention include symptoms, right ventricular systolic pressure of more than 50% of systemic systolic pressure, right ventricular dysfunction and significant differential pulmonary perfusion in unilateral stenosis. Non-invasive imaging, such as MRI or echocardiography, are usefThe disappointing results of surgical management of branch PA stenoses led to the introduction of balloon angioplasty in the early 1980s.40 With s4144414850Indications and use of stents for dealing with PA stenosis have increased in recent times. Stents are mainly used to deal with origin stenosis occurring naturally or after previous surgery, kinking or tenting of the branch PA, external compression of the branch PA, elastic recoil, intimal tear after balloon angioplasty and recanalization of totally occluded vessels. In infants with prior implantation of an RV–PA conduit, stenting is used as a bridge to delay conduit replacement. Although stents are commonly placed after previous balloon angioplasty, there are indications where primary stenting should be considered. These include long-segment stenoses, where balloon angioplasty shows unsatisfactory results, subatretThere are numerous published papers demonstrating excellent mid- and long-term results after st50575752The incidence of significant restenosis of single-vessel PA stents has been reported to be 1.5–7% in large pediatric series.5055 Two 505159Interventional treatment of bifurcating stenoses in the PA involving either the proximal branch or lobar branch vessels can be technically challenging. Standard balloon angioplasty alone is often inadequate and placement of stents is frequently required to relieve obstruction. In such bifurcating pulmonary stenoses, a simultaneous approach (simultaneous stent placement in two or more adjacent pulmonary arteries) is in our view mandatory and has been described previously.62 The adDistal PA stenoses are usually multiple and represent complex lesions that are not accessible to the surgeon. The smalFailure of a bioprosthetic right ventricle-to-pulmonary artery conduit has been well documented and may require repeat surgical conduit replacement. Pathomechanisms involved are external compression , calcification, kinking, development of fibrotic intimal peel and aneurysm. In addition, conduit diameters are limited and young patients may outgrow the diameters. Balloon dilatation of stenotic valves has shown poor results, with minimal extension of the life span of the conduit.66 Thus, 4767Potential complications with PA stent deployment occur in 4–5% and include stent migration (2.4%), stent malposition, intimal flap obstruction, jailing of side branches, stent fracture, dissection, aneurysm, vessel rupture, hemoptysis (1.5%), thrombosis of stent, ipsilateral pulmonary edema (1.5%) and death (1.5%). In a retBalloon dilation of aortic recoarctation (Re-CoA) was introduced in 1982 as treatment for post-operative restenosis after surgical repair with subsequent hypertension.–72 Intim7074741074881026768183878181838686818181818181818181819981et al. 2007; Riede, Schneider et al. 2007; Jhang, Chang et al. 2008; Wong, Yoo et al. 2008) or systemic administration of anti-proliferative drugs such as everolimus may theoretically overcome some of these problems,[In general, CoA redilatation demonstrates good intermediate follow-up results.94 Aneury868694problems, but no sproblems,In 1999, the first covered stent was used to treat coexistent CoA and aneurysm of the aorta in a young man. Aneurysm9111217182225Aneurysm formation may occur even after redilatation of a previously implanted uncovered stent; the sten88111191113171817182111182226915One obvious limitation of covered stents is their potential to cover side branch vessels during deployment, usually the subclavian artery ostium. Jailing of subclavian artery is usually well tolerated without functional deficit but an intact vertebrobasilar system should be documented to avoid subclavian steal.92 To cirAlthough covered stents are primarily used for CoA treatment, they might be applied to other vessels. Thus, the use of a covered 8-zig CP stent for treatment of post-operative RVOT has been reported Baffle l15et al. described an improvement to more than 90% of the “normal” adjacent aortic arch.[7With increasing experience in CoA stenting, the concept has been extended to the treatment of complex stenoses of the aortic arch and the descending aorta.17110 It 17ic arch.7Several conditions may lead to stenosis of systemic veins, including superior and inferior caval vein obstruction occurring after atrial switch operation or cardiac transplantation, uni- or bidirectional Glenn anastomosis and total cavopulmonary connection, correction of anomalous pulmonary venous connections and the presence of transvenous pacing electrodes or central venous catheters.–113 As b1437117119Pulmonary venous stenosis may be congenital or acquired after cardiac surgery. It is reported after repair of anomalous pulmonary venous return in about 10% of the patients. Suturele1321321355252132138For some complex congenital heart defects, an unrestrictive ASD is essential for adequate blood mixing at the atrial level or relief of right or left atrial hypertension to achieve an adequate cardiac output and/or systemic saturation. Transcatheter creation or enlargement of an ASD is usually achieved employing techniques including transeptal puncture or radiofrequency perforation (in the case of intact septum), balloon or blades septostomy and static balloon dilatation of the interatrial septum (IAS). However, due to the increased thickness of the IAS in infants beyond the neonatal period or in neonates with hypoplastic left heart syndrome, the use of those techniques may be ineffective to achieve and maintain an adequately sized communication. Therefore, atrial septal stent implantation has been successfully applied to promote a durable unrestrictive ASD.33141–145333233In duct-dependent CHD, ensuring patency of the arterial duct may be a life-saving procedure. Stenting the arterial duct in defects such as pulmonary atresia, right ventricular hypoplasia, critical pulmonary stenosis, TOF and other complex lesions with reduced pulmonary blood flow may avoid (emergency) surgical shunt. The concept of stenting the ductus arteriosus to increase pulmonary blood flow in cyanotic neonates began with the arrival of stents designed for coronary arteries in the early 1990s. Unfortun158In severe forms of TOF with PA hypoplasia, critical RVOT obstruction and the presence of MAPCAs major aortopulmonary collateral arteries (MAPCA), primary repair may not be possible. For such a two-staged repair, early surgical options include a central aortopulmonary anastomosis, a modified Blalock–Taussig anastomosis, an RV outflow patch or ductal stenting as discussed in the previous section. In selected cases, RVOT stent implantation may be another alternative to surgical palliative treatment in order to achieve sufficient oxygen delivery and to induce PA development through pulsatile flow.161 RVOT 57164Stenosis of aortopulmonary collateral arteries is common and frequently progressive in patients with unrepaired pulmonary atresia and ventricular septal defect, leading to severe hypoxemia and limitation of exercise capacity in up to 58–68% of the patients. Surgical31There are some recent developments in technology intended to overcome some of the disadvantages of currently used stents.As scaffolding is necessary to overcome late vessel remodeling only for a limited period – approximately the first 6 months following stent implantation – the concept of biodegradable stents has emerged. In addition to other advantages, this concept might solve one of the main problems in pediatric stenting – the adaption to growth. These systems should deliver a temporary longitudinal and radial straightening effect, offer better physiologic repair, allow reconstitution of local vascular compliance and should not restrict surgical or interventional revascularization thus allowing the possibility of growth and late positive remodeling. The ideal characteristics of a biodegradable stent have been defined as (1) sufficient radial strength to prevent vascular recoil, (2) minimal thrombotic and inflammatory response, (3) avoidance of intimal proliferation, (4) reabsorption of stent components within months, (5) no release of toxic products or embolic material during breakdown and (6) easy processing and sterilization. Based on these considerations, two different concepts have evolved: Absorbable polymer stents and absorbable metal stents.There are several polymeric degradable stents in development but just a few merit mention at this stage on the basis of clinical data. The BVS stent is made from poly-L-lactic acid (PLLA) and results from clinical trials were recently published.–172 WhilThe relative ease with which magnesium corrodes and its role as an essential element in the biological system makes it an excellent candidate for the biocorrosion concept. First data was published in 2003. As an al177in vitro experiments showed that ions released from iron stents might reduce the proliferation rate of vascular smooth muscle cells by influencing growth-related gene expression and could therefore play a beneficial role in antagonizing restenosis.[Limitations posed by biodegradable polymer and magnesium alloy stents, such as chronic inflammation and premature recoil, might be overcome by biocorrodible iron stents. The NOR-I Stent is a pure iron stent that has been implanted in an animal study, demonstrating low thrombogenicity, mild inflammatory response and no toxicity, no pronounced intimal hyperplasia and excellent patency, but a very slow degradation rate of several years.182 In adstenosis.All of the degradable technologies reviewed here have many specific challenges ahead of them, but, to date, common to all is the lack of clinical evidence demonstrating a clear advantage of this approach. Polymer systems face specific challenges in achieving adequate strength and resistance to recoil as well as a need to reduce degradation times. Magnesium systems appear to offer the most promise, with degradation times being closer to what may be required. Iron stents face big difficulties in terms of establishing that the degradation products would be acceptable.Another interesting approach to overcome the “growth” problem is the development of the so-called Growth Stent. It is ma184Electropolishing is the state-of-the-art finishing process for nitinol implants, such as stents. Several studies have shown that electropolished nitinol surfaces exhibit better corrosion resistance, biocompatibility and overall surface quality than surfaces finished by other methods.187 Thus,189Over the last 20 years, the usefulness of stents in patients with CHD has become well established. Stent implantation is now considered to be a safe and effective method in relieving a wide variety of pre- and post-operative vascular stenoses not amenable to pure balloon dilatation. Thus, stent therapy is now considered to be the standard and first-line treatment for CoA in adults or post-operative PA branch stenoses. The majority of stent applications are intended to provide a long-lasting cure or reasonable palliation to avoid high-risk repeat operation. Thus, stents may now be used to ensure patency of naturally occurring or artificially created intercirculatory communications. Because of a tremendous improvement in stent technology, the first-generation models like the original Palmaz stent have now been replaced by “modern” designs. But still the device that meets the requirements of an ideal stent for use in CHD patients remains to be developed. Thus, concepts for stent application in very small patients that allow adaptation for somatic growth until adulthood vessel size is reached are clearly needed. Another issue to be addressed is improvement of biocompatibility to avoid intimal hyperplasia and restenosis. Until these problems are solved, the crucial question in this interventional field still remains: Which stent(s) should we use for which lesion? To clarify these questions, anecdotal data are insufficient, underlying the clear need for large prospective trials to search for objective performance criteria. As the population with CHD is limited, independent objective multinational registries are needed. With these improvements, indications for stent treatment in CHD are likely to widen in the future. |
Neuroleptic malignant syndrome (NMS) is a rare, but sometimes fatal, adverse reaction to neuroleptics characterized principally by fever and rigor. The aim of this study was to prove the efficacy of different NMS treatment strategies, focusing on the efficacy of dantrolene.Altogether, 271 case reports were included. These cases were categorized into four treatment groups and compared to each other according to effectiveness of therapy within 24 hours, mortality, complete time of remission in days, effectiveness due to increase of dosage, relapse on the basis of decrease of dosage, and improvement of symptoms.p = 0.008). In a logistic regression with adjustment for age, gender, and severity code, no significant predictor of the treatment for the complete time of remission (dichotomized by median) could be found. However, if the premedication was a monotherapy with neuroleptics, the complete time of remission was significantly shorter with dantrolene monotherapy .Between the four treatment groups, the complete time of remission was significantly different (analysis of variance, F = 4.02; degrees of freedom = 3; The treatment of NMS with drugs that are combined with dantrolene is associated with a prolongation of clinical recovery. Furthermore, treatment of NMS with dantrolene as monotherapy seems to be associated with a higher overall mortality. Therefore, dantrolene does not seem to be the evidence-based treatment of choice in cases of NMS but might be useful if premedication consisted of a neuroleptic monotherapy. Neuroleptic malignant syndrome (NMS) is a rare, but sometimes fatal, adverse reaction to neuroleptics. It is characterized principally by fever and muscle rigidity. Furthermore, signs such as altered consciousness, autonomic instability, and laboratory findings such as elevated creatine phosphokinase (CPK), leukocytosis, raised liver enzymes, and low serum iron or potassium levels are also found . NMS Although the origin of NMS remains unknown, a reduction in dopaminergic activity in the brain, probably by dopamine D2-receptor blockade in the striatum and hypothalamus, is generally assumed as its cause ,5. NeverTherefore, a therapeutic approach inevitably seems to be through trial rather than evidence-based. It is generally agreed that it is of highest importance to identify the syndrome, suddenly withdraw the offending agent, and entertain supportive therapy as rehydration and restoring electrolyte balance. Because anticholinergics anticipate diaphoresis , they shTaking into account the low incidence rate of NMS, a randomized, controlled, and double-blinded prospective study did not seem to be feasible. Therefore, the aim of this study was to prove the efficacy of dantrolene therapy by a review of published cases and a complete review of the literature.For facility of data recall, databases such as PubMed were searched to obtain a list of more than 600 publications from the years 1968 to 2006. Inclusion criteria for our study were the mention of therapy, treatment, dantrolene, case report, review of literature, and NMS since 1980 in title or abstract. Exclusion criteria were the exclusive mention of risk factors, pathophysiology, incidences and biochemistry, differential diagnosis, or foreign-language articles except those in German or English.Altogether, 271 case reports including information on age, gender, diagnosis, and some data on therapy could be extracted. To avoid biases by multiply recorded case reports, case series were excluded as well. Information was registered as follows: year of publication, gender, age, diagnosis, triggering medications for NMS, dosages, time of incidence of NMS, fever, diaphoresis, pulse, rigidity, 'others' , CPK, leukocytosis, other laboratory parameters , time of withdrawal of the offending agent, dantrolene therapy (including dosage), adjuvant treatments such as cooling or others, course of illness, and time until complete recovery or death.Because the main focus of the present study was to evaluate the efficacy of dantrolene and other treatments of NMS, cases were divided according to their received therapy into four treatment groups Figure . The sevAfterward, six categories pertaining to efficacy of treatment of NMS were assessed as follows: effectiveness of therapy within 24 hours, mortality, complete time of remission in days, effectiveness due to increase of dosage, relapse on the basis of decrease of dosage, and improvement of symptoms.2 tests and parametric and nonparametric tests were calculated. The normal distribution of data was evaluated by the Kolmogorov-Smirnov test. All statistical tests were two-sided, and significance level was set at α = 0.05 or less. Data were analyzed using SPSS™ for Windows 11.0.1 .The complete time of remission was transformed by calculating the natural logarithm. To control for possible confounders, logistic models were performed in a second step. These models for the variables were adjusted for age, gender, and fever as a proxy measure for the severity of the NMS at baseline. Additionally, χp = 0.386).In summary, 271 case reports from 27 years (from 1980 to 2006) were included. Only 33.9% of the subjects included were female. The mean age of patients at the onset of NMS was 40.4 years (standard deviation 19.3). There was no significant difference in age between female and male patients . Interestingly, the short effectiveness of the dantrolene monotherapy was quite similar to other kinds of treatment, including bromocriptine, amantadine, or electroconvulsive therapy. Similar to the results of supportive therapy alone, the effectiveness of dantrolene including additive medication was weaker than in dantrolene as a monotherapy or other kinds of therapy regimens.Between treatment groups, significant differences in the effectiveness within 24 hours could be observed (χp = 0.008). After adjustment for multiple testing by the Bonferroni method, the complete time of remission was significantly shorter in only dantrolene monotherapy compared to dantrolene with additive medication (p = 0.012). In a logistic regression with adjustment for age, gender, and severity code, a significant predictor of the medicamentous treatment for the complete time of remission (dichotomized by median) could be found. In ascending order of elongated time of remission, the following odds ratios (ORs) were observed: 0.40 for dantrolene monotherapy, 0.81 (95% CI 0.40 to 1.66) for a mainly supportive therapy, 1.06 (95% CI 0.59 to 1.90) for 'other medication,' and 1.56 (95% CI 0.84 to 2.91) for dantrolene with additive medication.As shown in Figure In regard to prior medicamentous treatment in addition to neuroleptics, lithium was administered in 30 (11.1%) cases and antidepressants in 15 (5.5%) cases. Overall, 114 (42.1%) cases of NMS were caused by neuroleptic monotherapies, 21 (7.7%) cases were caused by atypical neuroleptics, 17 (6.3%) cases were caused by depot/intramuscular application, and 16 (5.9%) cases were caused otherwise . The remaining 96 (35.4%) cases were caused by other combination therapies (seven cases were described imprecisely in the case reports and were therefore excluded).p = 0.029). Depot neuroleptics were found to have the highest complete time of remission, which was significantly longer than after NMS through monotherapy of typical neuroleptics, even after Bonferroni correction for multiple testing (p = 0.015).Furthermore, a significant association of prior medication with the complete time of regression could be observed , whereas it was longer (if not significantly elongated) if premedication was comprised of a combination therapy of neuroleptics.In regard to the efficacy of dantrolene therapy, the history of medicamentous treatment prior to NMS was also relevant. If the premedication was a neuroleptic monotherapy, the complete time of remission was significantly shorter with a dantrolene monotherapy (t = -2.97; In regard to the efficacy of the dantrolene treatment, in our analysis the complete time of remission was prolonged by a combination with dantrolene treatment, and the mortality of a monotherapy was higher. Furthermore, the time of remission was not significantly shorter in a dantrolene monotherapy than in other therapy regimens including only supportive therapy. This has not been observed before; other studies ,16,19. dA possible limitation of the present study is that it is based on case reports and some case reports were fragmentary in respect to the information necessary for our purposes. From the age of patients to dosage specifications, there was a wide range of missing information. Furthermore, none of the analyzed case studies addressed a suitable scale for the assessment of rigidity. Also, the temporal sequence of symptoms of NMS was not described by the latitude of studies.The short time effectiveness within 24 hours was as effective in the dantrolene monotherapy group as in the group receiving different medication and was as ineffective in the dantrolene treatment group with additive medication as in the group of patients receiving supportive therapy alone. Nevertheless, in respect to the effectiveness due to increasing dosages, the relapse based on the decrease in dosage, or the improvement of symptoms such as fever and muscle rigidity, no obvious differences could be detected in our analysis.Due to the different severity grades of NMS at baseline, mortality alone, which was examined as a predictor of the benefit of various medical treatments , does noBased on the findings of our analysis, dantrolene does not seem to be the evidence-based treatment of choice in cases of NMS, which seems to be in accordance with some single-case reports ,20. NeveFurther investigations are still needed to discover both the etiopathology of NMS and its causal treatment. A promising approach might be the further exploration of possible central effects of dantrolene, which is still known as a peripheral muscle relaxant ,13.However, due to the low incidence of NMS, large prospective studies will be difficult to conduct, so further investigations will likely have to rely on case reports again. The success of such analyses most likely will depend on the accuracy, uniformity, and completeness of these reports.Pharmacological risk factors for the development of NMS include high neuroleptic dosage, high rate of dose increase, and parenteral administration . In regaIndependent of treatment options, it is still necessary to discontinue potentially contributing medication even before the diagnosis is definite . Dantrol• It is wise to discontinue contributing medication even before the diagnosis of NMS is definite.• No treatment regimen including dantrolene could be considered as evidence-based.ANOVA = analysis of variance; CI = confidence interval; CPK = creatine phosphokinase; df = degrees of freedom; NMS = neuroleptic malignant syndrome; OR = odds ratio.The authors declare that they have no competing interests.UR, JK, and SB made substantial contributions to the conception and design and to the analysis and interpretation of the data. CD made substantial contributions to the acquisition of data. TB, WS, and NT made substantial contributions to the interpretation of data. UR, CD, TB, and SB were involved in drafting the manuscript. WS, NT, and JK were involved in revising the manuscript critically for important intellectual content. All authors read and approved the final manuscript. |
Human cytomegalovirus (HCMV) US6 glycoprotein inhibits TAP function, resulting in down-regulation of MHC class I molecules at the cell surface. Cells lacking MHC class I molecules are susceptible to NK cell lysis. HCMV expresses UL18, a MHC class I homolog that functions as a surrogate to prevent host cell lysis. Despite a high level of sequence and structural homology between UL18 and MHC class I molecules, surface expression of MHC class I, but not UL18, is down regulated by US6. Here, we describe a mechanism of action by which HCMV UL18 avoids attack by the self-derived TAP inhibitor US6. UL18 abrogates US6 inhibition of ATP binding by TAP and, thereby, restores TAP-mediated peptide translocation. In addition, UL18 together with US6 interferes with the physical association between MHC class I molecules and TAP that is required for optimal peptide loading. Thus, regardless of the recovery of TAP function, surface expression of MHC class I molecules remains decreased. UL18 represents a unique immune evasion protein that has evolved to evade both the NK and the T cell immune responses. HCMV establishes a lifelong latent infection and causes serious disease in immunocompromised individuals. Cytotoxic T lymphocytes (CTL) and natural killer (NK) cells are the primary effectors for the immune defense against HCMV. However, HCMV has evolved to evade both the innate and adaptive cellular immunity to viral infection. HCMV US6 glycoprotein inhibits TAP function, resulting in down-regulation of MHC class I, while HCMV UL18 is an MHC class I homolog that functions as a surrogate to prevent host cell lysis. Despite significant sequence and structural homology between UL18 and MHC class I molecules, US6 down regulates surface expression of MHC class I, but not UL18. Here, we describe a mechanism by which UL18 circumvents the self-derived TAP inhibitor, US6. UL18 abrogates US6 inhibition of TAP-ATP binding and restores TAP-mediated peptide translocation, thereby making peptides available for the assembly and subsequent surface expression of UL18. Together UL18 and US6 inhibit binding of MHC class I to TAP, thus down regulating surface expression of MHC class I molecules. UL18 represents a unique immune evasion protein resistant to both the NK and T cell immune responses. Our data provide a molecular basis for persistent HCMV infection and will aid in the development of a therapeutic vaccine. CTLs recognize and lyse virus-infected cells through engagement of the T cell receptor with MHC class I molecules presenting viral antigens at the surface of infected cells Human cytomegalovirus (HCMV), a β-herpesvirus, is prevalent in human populations worldwide 2-microglobulin (β2m) to form a heterodimer. This heterodimer is recruited into the MHC class I peptide-loading complex, which consists of MHC class I, β2m, TAP, calreticulin, ERp57, tapasin, and protein disulfide isomerase Newly-synthesized MHC class I heavy chain associates with βWith selective pressure from the host immune response, HCMV has evolved several gene products which interfere with antigen presentation and eventual cell surface expression of MHC class I molecules. HCMV encodes four individual gene products of the unique short region protein (US): US2, US3, US6, and US11. Each protein is independently able to reduce class I surface expression 2m Although interference in antigen presentation and consequent MHC class I down-regulation on the cell surface might allow infected cells to evade virus-specific CTL, down-regulation of MHC class I molecules makes these cells susceptible to lysis by NK cells, which target cells lacking MHC class I molecules Here, we describe a novel mechanism of action for UL18 that may account for the specific down-regulation of one homolog and not the other. UL18 restores the peptide transport activity of TAP by inactivating US6. In addition, UL18 impairs optimal peptide binding by MHC class I molecules by interfering with the assembly of the peptide-loading complex. Hence, even though TAP function is recovered, the surface level of MHC class I molecules remains down regulated. Our data provide insight into how the viral MHC class I homolog UL18 has effectively evolved to evade both NK and CTL immune responses.We previously reported that unlike MHC class I expression, cell surface expression of HCMV UL18 is resistant to the self-derived TAP inhibitor US6 To date, the possible dependence of UL18 on TAP for surface expression has not been confirmed. To address this question, we assessed the effect of ICP47, the herpes simplex virus-derived TAP inhibitor The above data suggest that UL18 modulates the inhibitory action of US6 on TAP activity. To test this hypothesis, we directly measured TAP-dependent peptide transport in cells expressing either UL18 alone, both UL18 and US6, or both UL18 and ICP47. A significant reduction in peptide translocation was observed in cells expressing the US6 protein alone (HeLa-US6) and cells expressing ICP47 alone (HeLa-ICP47). Expression of only the UL18 protein did not affect peptide transport. Interestingly, upon ectopic expression of UL18 in HeLa-US6, peptide translocation into the ER lumen was markedly restored , suggestPeptide translocation by TAP occurs in two steps: peptide binding to TAP and peptide translocation involving ATP binding and hydrolysis How does UL18 specifically block the binding of US6 to TAP1 but not to TAP2? To address this question, we examined the interactions among MHC class I, TAP, and UL18 in UL18-expressing HeLa and HeLa-US6 cells. Coimmunoprecipitation and western blot analysis indicated that MHC class I molecules bind to both TAP1 and TAP2 irrespective of US6 were described previously HeLa cells were obtained from the American Type Culture Collection and cultured in DMEM supplemented with 10% FBS , 2 mM L-glutamine, 50 U/ml penicillin, and 50 µg/ml streptomycin. Human foreskin fibroblast (HFF) cells (passage 8–10) were grown in DMEM supplemented with 10% FBS under 5% CO2m in both assembled and nonassembled forms mAb 10C7 recognizing UL18 was purchased from the ATTC. K455 recognizes MHC class I heavy chain and βThe surface expression of UL18 and MHC class I molecules was determined by flow cytometry . Cells were washed twice with cold PBS containing 1% BSA and then incubated for 1 h at 4°C with either 10C7 for UL18 or W6/32 for MHC class I molecules. Normal mouse IgG was used as a negative control. The cells were washed twice with cold PBS containing 1% BSA and then stained with FITC-conjugated goat anti-mouse IgG for 40 min. A total of 10,000 gated events were collected by the FACSCalibur cytometer and analyzed with CellQuest software (BD Biosciences).For coimmunoprecipitation, cells were lysed in 1% digitonin in PBS supplemented with protease inhibitors. After preclearing, samples were incubated with the appropriate antibodies for 2 h at 4°C, before Protein G-Sepharose beads were added. Beads were washed four times with 0.1% digitonin, and bound proteins were eluted by boiling in SDS sample buffer. Proteins were separated by SDS-PAGE, transferred onto a nitrocellulose membrane, blocked with 5% skim milk in PBS with 0.1% Tween 20 for 2 h, and probed with the appropriate antibodies for 4 h. Membranes were washed three times in PBS with 0.1% Tween 20 and incubated with horseradish peroxidase-conjugated streptavidin (Pierce) for 1 h. The immunoblots were visualized with ECL detection reagent (Pierce).The peptide transport assay was performed as described |
Equation 7 is incorrect. See the correct equation here: |
However, the importance of the two enzymes for replication in quiescent cells, their possible synergy and roles in virulence have not been fully assessed.Low levels of uracil in DNA result from misincorporation of dUMP or cytosine deamination. Vaccinia virus (VACV), the prototype poxvirus, encodes two enzymes that can potentially reduce the amount of uracil in DNA. Deoxyuridine triphosphatase (dUTPase) hydrolyzes dUTP, generating dUMP for biosynthesis of thymidine nucleotides while decreasing the availability of dUTP for misincorporation; uracil DNA glycosylase (UNG) cleaves uracil N-glycosylic bonds in DNA initiating base excision repair. Studies with actively dividing cells showed that the VACV UNG protein is required for DNA replication but the UNG catalytic site is not, whereas the dUTPase gene can be deleted without impairing virus replication. Recombinant VACV with an UNG catalytic site mutation was attenuated VACV mutants lacking the gene encoding dUTPase or with catalytic site mutations in UNG and double UNG/dUTPase mutants were constructed. Replication of UNG and UNG/dUTPase mutants were slightly reduced compared to wild type or the dUTPase mutant in actively dividing cells. Viral DNA replication was reduced about one-third under these conditions. After high multiplicity infection of quiescent fibroblasts, yields of wild type and mutant viruses were decreased by 2-logs with relative differences similar to those observed in active fibroblasts. However, under low multiplicity multi-step growth conditions in quiescent fibroblasts, replication of the dUTPase/UNG mutant was delayed and 5-fold lower than that of either single mutant or parental virus. This difference was exacerbated by 1-day serial passages on quiescent fibroblasts, resulting in 2- to 3-logs lower titer of the double mutant compared to the parental and single mutant viruses. Each mutant was more attenuated than a revertant virus upon intranasal infection of mice.VACV UNG and dUTPase activities are more important for replication in quiescent cells, which have low levels of endogenous UNG and dUTPase, than in more metabolically active cells and the loss of both is more detrimental than either alone. Both UNG and dUTPase activities are required for full virulence in mice. Uracil, a major component of RNA, is a rare constituent of DNA due to misincorporation of dUMP from dUTP or the spontaneous deamination of cytosine residues . The preViruses that encode UNG or dUTPase include poxviruses, herpesviruses, African swine fever virus and some retroviruses . PoxviruHerpesviruses are large, DNA viruses that replicate in the nucleus and encode UNG and dUTPase as well as DNA polymerase -23. The Although retroviruses do not encode UNG, HIV-1 packages a cellular UNG that is essential for its life cycle -31. InteTaking together the results from a variety of systems, it seems that the requirements for virus-encoded UNG and dUTPase are greatest in quiescent cells , which hThe VACV D4R catalytic site mutant with Asp-68-Asn and His-181-Leu changes and containing an enhanced green fluorescent protein (GFP) reporter gene was previously constructed and shown to lack DNA glycosylase activity . This D4Our previous study showed that vd4 yielded slightly lower titers than WR in RK13 cells under one-step growth conditions and this correlated with slightly lower levels of DNA synthesis . Here, w32P-labeled VACV DNA probe. The kinetics of vd4 and vΔF2d4 DNA replication were virtually identical and the amounts of DNA were about one-third lower than VACV WR at 24 h per cell. At various times, infected cells were harvested and total DNA was isolated. Viral DNA accumulation was quantified by hybridization to a 4 h Fig. . In cont4 h Fig. .The relatively modest effect of the UNG and dUTPase mutations could be a consequence of the presence of the corresponding cellular enzymes in actively replicating cells. Therefore, we compared the replication of the mutated viruses in actively growing HFF propagated in 10% fetal bovine serum (FBS) or in stationary cells that had been incubated for 4 days in 0.2% FBS. Active and quiescent HFF were infected with WR or mutant viruses at a multiplicity of 5 and harvested at sequential times. As with BS-C-1 cells, vd4 and vΔF2d4 replicated to slightly lower titers than WR and vΔF2 in active HFF Fig. . In quiePhenotypic differences between mutant viruses can be more pronounced when cells are infected at a low multiplicity, in which virus spread is also assessed. Therefore, we infected HFF at a multiplicity of 0.001 and measured virus replication over a 6-day period. At one day after infection of active HFF, the relative titers were WR > vΔF2 > vd4 > vΔF2d4 Fig. . In eachVACV expresses a growth factor called VGF that is secreted from infected cells and is important for replication in resting cells . TherefoWe had previously reported that vd4 was attenuated compared to WR in a murine intranasal infection model . Here we4 to 106 PFU of each virus and loss of weight was followed for two weeks. All animals in the WR and revertant groups that had been infected with 105 or 106 PFU died or were terminated by day 6 because their weights dropped by 30% . The possibility of an increased mutation rate needs to be investigated.The intranasal mouse model has been extensively used to determine virulence of mutant VACV and morbidity and death results primarily from the respiratory infection -51. We rVACV recombinants with mutations in the catalytic site of UNG and/or a deletion of the dUTPase gene were constructed. In actively growing cells, the UNG mutant and the double mutant exhibited a slight reduction in replication, whereas replication of the single dUTPase deletion mutant was unimpaired. However, in quiescent human fibroblasts, which have low levels of endogenous UNG and dUTPase, replication of the double mutant was more severely inhibited than either of the single mutants. Expression of viral UNG and dUTPase were required for full virulence in mice.HFF were obtained from A. McBride . Monolayer cultures of HeLa S3, HFF and BS-C-1 cells were maintained in Eagle's minimal essential medium containing L-glutamine and 10% FBS. All experiments were performed with the WR strain of VACV (ATCC VR-1354) or with mutant viruses derived from this strain. The VACV D4R catalytic site mutant containing Asp-68-Asn and His-181-Leu changes was previously described . PlasmidThe PCR product was inserted into an EcoR I site upstream of the RFP gene. A segment of DNA containing F3L and 74 nucleotides of F2L using Accuprime pfx and primers 5'-AAAACTGCAGATGCTGCTTGGGTTAATATGCCGAGT-3' and 5'-CGCGGATCCTGCCTAGTAGGAGATTTAGCTCTGT-3' was amplified by PCR. The PCR product was inserted between BamH I and Pst I sites downstream of the RFP gene. The general procedures used for preparing and titrating the viral stocks were described previously .6 BS-C-1 cells were infected with WR or vd4 at a multiplicity of 0.05 PFU per cell for 1 h at 37°C. The infected cells were washed twice with Opti-MEM (Invitrogen) and transfected with 2 μg of pΔF2. After 5 h, the transfection mixture was replaced with EMEM/2.5% FBS, and the cells were harvested at 48 h in 0.5 ml of EMEM/2.5% FBS. Lysates were prepared by freezing and thawing the cells three times and sonicating them twice for 30 s. Recombinant viruses that expressed RFP (vΔF2) or both RFP and GFP (vΔF2d4) were plaque purified five times on BS-C-1 cells and their genetic purity was confirmed by PCR, Southern blotting, and sequencing.Approximately 10To construct recombinant vΔF2d4 (-FP) lacking both GFP and RFP genes, PCR products were made by overlapping PCR that had (i) F1 and F3 sequences but missing the F2L ORF and (ii) D4 and D5 sequences that maintained the catalytic site mutations mutations of D4. F1r: 5'-CCGCTCGAGCGGTTACACCCAACCCCTTGTTATCCATTAG-3', F1f: 5'-CTAACAGAGCTAAATCTCCTACTATCCAGAACTGGAAGAAGTACAATCTCTA-3', F3r: 5'-TTGTACTTCTTCCAGTTCTGGATAGTAGGAGATTTAGCTCTGTTAGTTTCC-3', F3f: 5'-CCCAAGCTTGGGATGCTGCTTGGGTTAATATGCCGAGTC-3', D4f: 5'-CCGCTCGAGCGGATGAATTCAGTGACTGTATCACACGCGCC-3', D4r: 5'-TTAGAACACAAGTTAAAATTTCACTAAAGGTTAATAAATAAACCCTTGAGCCCAATTTAT-3', D5f: 5'-CTTTAGTGAAATTTTAACTTGTGTTCTAAATGGATGCGGCTATTAGAGGTAATGATG-3', D5r: 5'-CCCAAGCTTGGGTTTCTCCTATATACGGCAGTGTCTATCG-3'. The procedure for making recombinants was the same as above, except vΔF2d4 was used to infect BS-C-1 cells and virus that lacked RFP was first selected (i.e. only green fluorescence) followed by virus that lacked RFP and GFP (no fluorescence).To construct a revertant that has wild type F2L and D4R sequences without RFP and GFP, PCR products were made that had (i) F1-F2-F3 sequences and (ii) D4-D5 sequences from WR. Primers F1r and F3f were used to amplify DNA from WR. Primers P1: 5'-CGAGTATGTGTGTGTGGTATAGATCC-3' and P2: 5'-CGGCAGTGTCTATCGATCTTGTTAGTG-3' were used to amplify DNA from WR. Virus was constructed as above using vΔF2d4 and virus that lacked RFP was first selected (i.e. only green fluorescence) followed by virus that lacked RFP and GFP (no fluorescence).For one step virus growth, confluent BS-C-1 or HFF in six-well plates were infected with 5 PFU of virus per cell and maintained at 37°C for 1 h. The innocula were removed, cells washed three times, and overlaid with 2 ml of EMEM/2.5% FBS. The cells were maintained at 37°C and harvested at various times after infection, collected by centrifugation, and resuspended in EMEM/2.5% FBS. The cells were disrupted by three cycles of freezing and thawing and two 30-s bursts of sonication. Virus yields were determined by titration on BS-C-1 cells.32P]dCTP . The blot was exposed to a phosphor screen, and data were acquired on a Storm PhosphorImager and quantified with ImageQuant software (Molecular Dynamics).Confluent BS-C-1 cells in six-well plates were infected with 5 PFU of virus per cell. The cells were collected by centrifugation, washed once with phosphate-buffered saline, and re-suspended in 0.3 ml of 1.5 M NaCl-0.15 M sodium citrate (pH 7.0)-1 M ammonium acetate. The cells were disrupted by three cycles of freezing and thawing. After dispersal by vortexing, duplicate 50 μl samples were spotted onto an Immobilon-Ny+ transfer membrane in a slot blot apparatus. The membrane was treated sequentially with 0.5 M NaOH-1 M Tris-HCl (pH 7.5) and 0.3 M NaCl-0.03 M sodium citrate (pH 7.0) and cross-linked by UV irradiation. The membrane was air dried, and viral DNA was detected by hybridization using a radiolabeled probe generated by random priming using VACV I7 gene nucleotide sequences, Random labeling kit and [α-HFF were seeded into 6 well tissue culture plates in EMEM/10% FBS. When monolayers were confluent, the culture medium was replaced with EMEM/0.2% FBS and maintained under these conditions for 96 h to induce quiescence. Following this treatment, HFF were infected with recombinant virus in EMEM/0.2% FBS. Alternatively, cells were propagated in EMEM/10% FBS and as soon as confluent the active cell monolayers were infected with recombinant virus in EMEM/2.5% FBS. At the indicated times post infection, infected monolayers were harvested and resuspended in EMEM/2.5% FBS. The cells were disrupted by three cycles of freezing and thawing and two 30-s bursts of sonication. Virus yields were determined by titration on BS-C-1 cells.8) were infected with 3 PFU of virus per cell and harvested three days after infection. Cells were re-suspended in 10 mM Tris (pH 9.0) and Dounce homogenized. The cytoplasm was separated from nuclei by low speed centrifugation and layered on a 36% sucrose cushion. After centrifugation at 13,500 rev/min in a SW 28.1 rotor for 80 min at 4°C, the viral pellet was suspended in 10 mM Tris (pH 9.0) and the virus titer determined by plaque assay. Groups (n = 5) of 6-week-old, female BALB/c mice were anesthetized and inoculated intranasally with 104-106 PFU of virus in 20 μl . Each mouse was weighed daily and animals that lost 30% of their original body weight were terminated according to a protocol approved by the NIAID Animal Care and Use Committee.Purified virus for animal studies were obtained as follows. HeLa cells using Prism .The authors declare that they have no competing interests.FDS participated in the design and coordination of the study, acquisition and analysis of data, and preparation of the manuscript. BM designed and coordinated the study, assisted in the data analyses and contributed to the preparation of the manuscript. |
Å b = 9.2803 (7) Å c = 23.0393 (16) Å V = 3148.3 (4) Å3 Z = 8 Kα radiationMo −1 μ = 0.08 mmT = 296 (2) K 0.32 × 0.18 × 0.11 mm Bruker APEXII CCD area-detector diffractometerAbsorption correction: none18754 measured reflections3885 independent reflectionsI > 2σ(I)1969 reflections with R int = 0.083 R[F 2 > 2σ(F 2)] = 0.050 wR(F 2) = 0.163 S = 0.92 3885 reflections190 parametersH-atom parameters constrainedmax = 0.25 e Å−3 Δρmin = −0.20 e Å−3 Δρ APEX2 used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008PLATON (Spek, 2003SHELXTL (Sheldrick, 2008Data collection: 10.1107/S1600536809001792/bt2850sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536809001792/bt2850Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials: |
Background. Asthma experienced during exercise and during the night is based on the presence of airway hyperresponsiveness (AHR). The aim of the present study was to examine whether AHR is a predictor of exercise-induced asthma (EIA) and nighttime symptoms. Material. We included 793 asthmatics subjects with symptoms and a positive asthma test. Results. Mean (SD) FEV1 was 93% (15), 71% had rhinitis, and 62% had atopy. Both EIA and nighttime symptoms were associated with AHR; however, when including other factors of importance in a multivariate analysis, logRDR was eliminated, whereas FEV1% pred (P < .001), smoking (P < .05), atopy (P < .001), sex (P < .001), and treatment (P < .01) were associated with having EIA while dyspnoea (P < .001), cough (P < .001), and eosinophils (P < .01) were associated with frequent night symptoms. The risk of having nighttime awakenings due to asthma was more than twofold higher among those with EIA symptoms than among those without symptoms (OR (CI95%) 2.77 (2.0–3.8) (P < .001)). In Conclusion. EIA and night symptoms are associated with AHR, but other factors of importance eliminated this close association. Night asthma is more closely associated with airway inflammation than AHR. Asthma severity and asthma control are often based on the presence and frequency of asthma symptoms, in particular respiratory symptoms such as exercise-induced asthma, limitation of physical activity, and frequency of night asthma symptoms. The revised version of the GINA guidelines from 2006 recommenPerception of respiratory symptoms may vary between individuals—some might feel minor changes more than others . Physican = 793) participating in two large asthma studies in our research unit were pooled in the present analysis [All asthmatic subjects variability ≥ 20%, or at least a 15% increase in forced expiratory volume in one second (FEV1) after administration of a bronchodilator (minimum 300 mL).All participants completed five self-administered questionnaires before clinical and physical tests. Subjects were asked about respiratory and allergic symptoms (within the preceding four weeks and at any time (ever asthma)), use of medication, hospital referrals, and GP or specialist visits. The questions asked about asthma at the interview were adapted from studies by the American Thoracic Society, Division of Lung Disease of the National Heart, Lung and Blood Institute . Asthma Mild intermittent: symptoms <once a week, nighttime symptoms <twice a month, FEV1 > 80% predicted. (2) Mild persistent: symptoms >once a week but <once a day, nighttime symptoms >twice a month, FEV1 > 80% predicted. (3) Moderate persistent: daily symptoms, nighttime symptoms > once a week or FEV1 60–80% predicted. (4) Severe: continuous daytime symptoms, frequent nighttime symptoms or FEV1< 60% predicted. Further, nighttime awakenings “0” (never), nighttime awakenings (NTA) ≤ 3 per month (mild), NTA 3-4 per month (mild persistent), NTA >4 per months and fewer than 2-3 per week (moderate), and NTA > 4 per week (severe). The severity of asthma was classified according to the 2004 GINA guidelines, based on symptom frequency only [2).Asthma severity was classified according to the GINA guidelines 1) ncy only , and ast ncy only1 >70% predicted. The dose resulting in a 20% fall in FEV1 (PD20) was calculated, and the ratio dose response (RDR) was calculated as the decline in FEV1 from inhaled saline divided by the highest dose of methacholine administered [1 was repeated 15 minutes after administration of 2 mg terbutaline in those with FEV1 < 70% or 15 minutes after the last inhalation of methacholine in those with either symptoms or a significant decrease in FEV1 .Spirometry was performed on a 7-L dry wedge spirometer in accordance with the ERS and the percentage of predicted normal values of FEV1 (FEV1%pred) and FVC (FVC%pred), and the FEV1/FVC ratio was calculated . Airway nistered . A const9/L).Lastly, all subjects underwent an allergen skin prick test with ten inhalant allergens in accordance with the EAACI guidelines , and bloAll data were entered in the database by one person and 10% of all patient data were then proofread. When this was done, quality control was conducted by an experienced researcher on all outliers within the entire number of variables. t-test). All included variables were examined in a univariate analysis with exercise-induced asthma or nighttime awakenings due to asthma as the dependent variable. In the event of a significant relationship, variables were entered in a linear regression analysis with backward elimination of all nonsignificant parameters after which a final regression analysis was performed. Lastly, an odds ratio analysis was applied in the case of dichotomy variables. A P-value <.05 was considered significant.The data were analyzed with the statistical pack 15.0 SPSS for Windows. Incidence rates were calculated for the entire group and differences were tested by Chi-squared analysis. Further, differences in mean (±SD) values between participants with and without respiratory symptoms were tested by parametric analysis (Student's P < .001).All 793 asthmatic subjects in the present survey were included based on respiratory symptoms and a positive test to methacholine provocation, inhaled beta-agonist or day-to-day variation in PEF . The fre9/L), or obstruction and severity of symptoms. The association between airway responsiveness and EIA symptoms was less close than that between airway responsiveness and nighttime awakenings due to asthma . Further, no significant association was found between rhinitis and severe EIA and nighttime awakenings ; atopic diseases was seldom seen in those with severe EIA or among those with severe night symptoms . Experience of severe EIA was frequently found among female participants , and nighttime awakenings were found equally frequently among those who had severe EIA . Lastly, those with severe EIA also had many nighttime awakenings ; those with many nighttime awakenings also experienced many symptoms of EIA .A univariate analysis including severity of EIA and nighβ−.16, P < .001), smoking , atopy , sex , and asthma treatment were found to be of significant consequence for development of EIA. Women reported persistent exercise symptoms more frequently than did men ; smokers had more EIA than nonsmokers ; BMI was of no importance. Asthmatic subjects with persistent exercise symptoms had lower lung function than those without symptoms , and treatment with inhaled steroid was more frequently used among those with persistent exercise symptoms .Concerning EIA, by including all variables in a multivariate analysis, logRDR was eliminated; whereas FEV1%pred , coughing , and EIA were of significant consequence. Furthermore, a higher level of eosinophils was associated with a higher level of nighttime awakenings . These findings showed that among those with frequent night symptoms, 64% experienced daily coughing, 31% had daily dyspnoea, and the eosinophil count increased from 0.22 109/L (no night symptoms) to 0.35 109/L (frequent night symptoms), . Including all variables in a multivariate analysis concerning nighttime awakenings showed that logRDR was eliminated as well; whereas frequency of shortness of breath during daytime (P < .001) of having nighttime awakenings due to asthma among those with EIA symptoms.The relative risk of having nighttime awakenings due to asthma was more than twofold higher among those with EIA symptoms than among those without EIA symptoms. In addition, the odds ratio (CI95%) was 2.77 (2.0–3.8) , positive skin prick test, high eosinophilic cell count, and many daily asthma symptoms—were included in the analysis of this large uniform cohort of persons with asthma, the study showed great diversity. EIA and nighttime awakenings due to asthma symptoms are symptoms of equal importance in the GINA guidelines when evaThese present findings indicate a close univariate association between EIA symptoms and AHR, which is in agreement with earlier findings of a close association between degree of EIA and AHR to inhaled agents , 26. HowThe asthmatic women frequently reported persistent exercise-induced symptoms; whereas nighttime awakenings in asthmatic participants in this large population were without sex association when interview by a specialist using a questionnaire-based interview with focus on the issue, as suggested by GINA guidelines . We founThose asthmatic subjects with severe nighttime awakenings seem to have more severe illness than those with EIA symptoms. Those with night symptoms had a high eosinophilic count; whereas the perception of exercise-induced symptoms had a cell count which was significantly lower. Those with nighttime awakenings due to asthma had a more severe degree of airway responsiveness than did those with exercise symptoms; moreover, those who had severe night awakening also had frequently signs of other asthma symptoms, such as dyspnoea and cough during daytime, all of which indicate that those with nighttime awakenings due to asthma might have severe airway inflammation and need treatment with inhaled steroid. These findings indicate that symptoms of EIA may be less related to inflammation, whereas nighttime awakenings are more closely related to airway inflammation. The higher eosinophilic count found among those with many night awakenings is of significant importance as the prognosis of asthmatic subjects with high level of eosinophilic cell count; many respiratory symptoms and severe AHR have been shown to be serious with a more severe and more variable asthmatic disease . NighttiBased on these findings and earlier findings in elite athletes , 24 the In conclusion, in this large group of asthmatic subjects we found that EIA symptoms and night symptoms were associated with AHR in a univariat analysis, but other factors seem of importance for the perception of EIA and night symptoms. Symptoms of EIA in a general population are, like EIA symptoms in elite athletes, not usable for the diagnosis of astma. Night asthma is more closely associated with airway inflammation, which verifies what we had expected. |
The objective of this study was to determine whether major depressive episodes (MDE) contribute to a lower rate of participation in three prevention activities: blood pressure checks, mammograms and Pap tests.The data source for this study was the Canadian National Population Health Survey (NPHS), a longitudinal study that started in 1994 and has subsequently re-interviewed its participants every two years. The NPHS included a short form version of the Composite International Diagnostic Interview (CIDI-SF) to assess past year MDE and also collected data on participation in preventive activities. Initially, we examined whether respondents with MDE in a particular year were less likely to participate in screening during that same year. In order to assess whether MDE negatively altered the pattern of participation, those successfully screened at the baseline interview in 1994 were identified and divided into cohorts depending on their MDE status. Proportional hazard models were used to quantify the effect of MDE on subsequent participation in screening.No effect of MDE on participation in the three preventive activities was identified either in the cross-sectional or longitudinal analysis. Adjustment for a set of relevant covariates did not alter this result.Whereas MDE might be expected to reduce the frequency of participation in screening activities, no evidence for this was found in the current analysis. Since people with MDE may contact the health system more frequently, this may offset any tendency of the illness itself to reduce participation in screening. The health belief model originated from Hochbaum's report on X-ray screening for tuberculosis . Modern One study conducted in a US primary care setting found no differences in the rate of mammography between women with hypertension and women diagnosed with depression . Kaida eOne study using a depressive symptom rating scale (rather than a diagnostic measure of major depression) found that high levels of depressive symptoms reduced mammography screening by a modest extent, but had no impact on Pap tests . AnotherOverall, there is surprisingly little available information about the possible role of depressive disorders as a barrier to participation in screening activities in community populations. The objective of this study was to evaluate the association between MDE and participation in screening activities in a Canadian population sample. We were interested in whether reduced participation in screening was associated with depressive episodes during years when episodes occurred, and also in whether MDE disrupts ongoing screening..The data source for this analysis was a Canadian study called the National Population Health Survey (NPHS). The NPHS is a longitudinal study based on a nationally representative community sample assembled by Statistics Canada in 1994/1995. Detailed information about NPHS methods may be found on the Statistics Canada Web page The target population for the NPHS consisted of household residents in the ten Canadian provinces, comprising 98% of the national population. Residents of institutions, homeless persons, people living on Indian Reserves, Crown Lands or Armed Forces Bases were excluded from the sampling frame. Some remote areas in Ontario and Quebec were also excluded. The NPHS employed a stratified two-stage sample design based on sampling frames developed in previous studies . A respondent was then randomly sampled from the selected dwellings. To correct for design effects resulting from clustering and stratification in the sampling procedure, Statistics Canada recommends a bootstrap procedure that uses a set of 500 replicate sampling weights that they calculate and supply to researchers for this purpose.The NPHS cohort has been interviewed every two years since the initiation of the study, in 1996, 1998, 2000, 2002 and 2004 . Available data therefore covered a ten year period between1994 and 2004. Response rates ranged from 92.8% in 1996 to 77.6% in 2004. Item non-response was generally less than 1% during follow-up. Refusal rates during follow-up ranged from 3.1% and 8.3% per cycle and between 1.7% and 5.9% per cycle were lost to follow-up because they could not be located. By the sixth cycle in 2004 , 1,680 of the original respondents were deceased, 144 had been institutionalized and 3,862 were classified as non-respondents due to loss to follow-up . An attrition analysis for the NPHS was reported by Beaudet et al. . AttritiThe NPHS is a general health survey with broad topical coverage: data concerning health status, health determinants and health care utilization are collected. Interviews are conducted using Computer Assisted Interviewing procedures and carried out by well-trained and experienced interviewers. In the baseline survey approximately 75% of the interviews were conducted in-person but in subsequent cycles approximately 95% of interviews were conducted over the phone. It is not possible to report the number of items in the interview since it contains skips (e.g. the depression module contained a skip if one of two symptoms required by the DSM-IV criteria were not present) and eligibility for some questions was age and/or sex specific. However, the NPHS interviews generally lasted less than one hour.The longitudinal cohort included 17,276 participants of any age, but the analyses reported here are restricted to relevant age and sex groups for each of the three preventive activities examined: blood pressure checks , mammography and pap tests . Two thousand twenty two children (age < 12) were excluded from the current analysis.The NPHS interview included the Composite International Diagnostic Interview Short Form (CIDI-SF) for MD, Three preventive health procedures have been measured in each cycle of the NPHS: blood pressure checks, mammography and Pap tests. Notably, these are procedures for which self-report data generally agree well with medically recorded information . King et. In the 1994 baseline NPHS interview, 84% of eligible respondents reported that they had ever had a Pap test, 60% reported ever having had a mammogram and 96% reported that they had ever had their blood pressure checked.NPHS items assessing preventive procedures were similar for each of the three procedures examined. In the case of blood pressure checks, the item was: "Now a few questions about your use of health care services. Have you ever had your blood pressure checked?" If the response was affirmative, this was followed by "When was the last time." Successful screening consisted of reporting each of the three procedures within the preceding year, approximately consistent with Canadian guidelines , see alsNow I would like to ask about certain chronic health conditions which you may have. We are interested in long-term conditions that have lasted, or are expected to last, 6 months or more and that have been diagnosed by a health professional." This was followed by a series of specific queries, for example, "Do you have high blood pressure?" The interview included such inquiries into 22 different chronic medical conditions.Variables considered potential confounders were included in models in order to determine whether adjustment for these variables altered the observed strength of association. Selection of variables to be included in the models was based on a judgment about which variables are associated with depression and could also plausibly act as independent determinants of participation in preventive activities. The list included age, sex, rural place of residence, education level, a diagnosis of hypertension, other chronic conditions, income, medication use and employment status. Younger age, female sex, low income and unemployed status are associated with MDE in the NPHS, for example, see analyses reported by Beaudet ,27. ChroWe initially examined the effect of MDE on participation in preventive behaviors using cross-sectional data collected at each of the NPHS interview cycles: 1994, 1996, 1998, 2000, 2002 and 2004. Next, we used proportional hazard models to examine whether MDE leads to discontinuation of screening activities. The models were fit as generalized linear models of the binomial family with a complementary log-log link function using a non-parametric approach. Jenkins outlinesCross-sectionally, there was no evidence that people with MDE fail to receive blood pressure checks more frequently than those without. In fact, in several cycles the frequency with which depressed respondents went unscreened was considerably lower than that of non-depressed respondents, see Table There were 4813 respondents who reported that they had their blood pressure checked in the year preceding the baseline interview. The prevalence of MDE in this group was 4.1% (95% CI 3.5 – 4.8), comparable to the overall prevalence of MDE. Of these, n = 348 reported two years later that they had not had a blood pressure check in the year preceding that interview. The incidence of entry into an unscreened state during this initial 2-years of NPHS follow-up was 8.3% (95% CI 3.0 – 13.6) in those with MDE and 9.0% (95% CI 7.9 – 10.2) in those without MDE at the 1994 interview. The high frequency of transition from screened to unscreened status during the 1994 to 1996 interval was not sustained during subsequent follow-up. The frequency diminished from 6.3% between in the 1996 to 1998 interval to 1.9% from in the 2002 to 2004 interval.The unadjusted hazard ratio representing the effect of MDE on the risk of transition to non-screened status was 0.84 (95% CI 0.5 – 1.4) and was not significantly different from the null value . In a proportional hazards model that included a variety of covariates it was found that reporting a diagnosis of high blood pressure greatly reduced the risk of discontinued screening . Other variables likely to be related to health care use were also associated with a reduced risk of discontinued screening: a diagnosis of any other chronic condition , female sex and age 66+ . All of these variables can be regarded as potential confounders since they are associated with the transition to non-screened status. However, an adjusted HR for MDE from a model including these variables resembled the unadjusted one, and did not provide evidence of an association , p = 0.74.Table There were 669 women who reported having a mammogram in the 12 months preceding the 1994 interview. Transition to unscreened status was defined as failure to report having a mammogram in the year preceding the next interview. This transition occurred at a frequency of 33.3% (95% CI between 1994 and 1996) and remained > 20% at each subsequent cycle. There was no evidence of an effect of age, as the frequency of discontinuation in the initial interval (1994 to 1996) was comparable in the 50–59 age category as in the 60–69 age category (36.3% 95% CI 28.6 – 43.9).The unadjusted HR was not significantly elevated: HR = 1.2 (95% CI 0.8 – 1.8), Wald test, p = 0.42. In proportional hazards modeling, the same set of covariates employed in the blood pressure checks analysis (see previous section) were included, except for sex. Also, receipt of hormone replacement therapy was included as a covariate in this part of the analysis. However, none of these variables significantly predicted discontinuation of annual mammograms and their inclusion, either individually or simultaneously, resulted in no substantial change in the HR for MDE. The adjusted HR was 0.8 (95% CI 0.4 – 1.6).Table There were n = 3,392 who reported having a Pap test during the year preceding the 1994 interview. By 1996, n = 902 reported not having been screened. The frequency of discontinuation in this initial follow-up period in those with MDE resembled that of respondents without MDE .The unadjusted HR over the entire follow-up interval was 1.3 (95% CI 0.9 – 1.4), which was not statistically significant . Inclusion of covariates did not alter the observed (lack of) association. Both age and oral contraceptive use were associated with discontinuation of screening. The HR for oral contraceptive use was 0.6, 95% CI 0.5 – 0.8). Contrary to the results reported by Kaida et al. , no inteThe analyses presented here failed to find evidence that MDE is an important determinant of participation in three preventive health care activities. These results are in some respects counter-intuitive since symptoms of depression would seem capable of interfering with participation in screening activities. However, there are a variety of possible explanations for these results. First, major depression is associated with a higher frequency of health care use (both for psychiatric and non-psychiatric services) ,42. ThisThere are several limitations of this study. First, whereas the NPHS assessed participation in three preventive activities, it was not possible to determine precisely whether the participation was for preventive purposes as opposed to treatment purposes. Another limitation is that the methods of measuring preventive activities in the NPHS did not necessarily align with levels of participation mandated by particular screening guidelines. For example, guidelines for the frequency of mammography depend on age and may include recommendations for annual or biannual screening, but only past year mammography was consistently available in the NPHS. In addition, the assessment of participation depended on self-report. Self report may be vulnerable to error either because procedures were forgotten, or because social desirability biases favor reported participation. Another issue concerns representativeness. The NPHS cohort derives from a general population sample but factors affecting continued participation during follow-up may have diminished its representativeness over time. Also, because the longitudinal components of the current analysis had the goal of clarifying temporal effects, prospective analyses were restricted to those respondents who were in the screened category at baseline. The prospective results therefore may represent an initially health-conscious group rather than in the population as a whole. Although the study included adjustment for potential confounding variables, the NPHS is a general health survey and the variables available for analysis were limited. In particular, direct measures of psychological variables relevant to screening behaviors, such as those identified by the health belief model would have been valuable to include in the analysis. The HRs for mammography and Pap tests were slightly elevated, although these elevations did not achieve statistical significance. Weak effects may exist and may not have been detected because of Type II error. They may have achieved statistical significance had the sample size been larger.The measure of MDE used in the study, the CIDI-SF, is a brief predictive interview. It is less detailed than lengthier versions of the CIDI interview, which may have led to measurement inaccuracy in some instances. If a substantial degree of misclassification did occur, this could lead to a dilution of effect. Non-differential misclassification bias, therefore, remains an alternative explanation for the largely negative findings reported here. A related observation concerns the precision of the estimates. Although no evidence of an effect of MDE on screening participation was found, some of the confidence intervals included a range of values that may nevertheless be of public health significance. As such, the results reported here cannot entirely exclude the possibility that MDE is a determinant of screening participation.If MDE were associated with diminished participation in preventive health care activities special efforts to increase or safeguard the participation of people who experience these episodes would be advisable. However, the current analysis found no evidence for diminished participation. Increased contact with the health system, which is associated with MDE, may offset any tendency of the illness itself to reduce participation in screening.The authors declare that they have no competing interests.SB, and ME are the authors of a Canadian Institutes of Health Research grant supporting the project. JVAW and DHL contributed to the writing of the grant and made substantial contributions to the analysis of data and preparation of a manuscript. SB wrote the first draft of the manuscript, which was revised with input from all authors.The pre-publication history for this paper can be accessed here: |
High mobility group box chromosomal protein 1 (HMGB1) is a nuclear protein that acts as a pro-inflammatory mediator following extracellular release. The protein is aberrantly expressed extracellularly in the settings of clinical and experimental synovitis. Therapy based on HMGB1 antagonists has shown encouraging results in experimental arthritis and warrants further scientific exploration using independent methods. In the present study we asked whether nuclear sequestration of HMGB1 preventing HMGB1 release would be beneficial for synovitis treatment.Oxaliplatin-based therapy was evaluated in collagen type II-induced arthritis in DBA/1 mice by clinical scoring and immunostaining of articular tissue. Oxaliplatin is an antineoplastic platinum-based compound that generates DNA adducts which tightly bind HMGB1. Secretion and intracellular location of HMGB1 were assessed by a novel HMGB1-specific ELISPOT assay and immunofluorescent staining.Intraperitoneal injections of oxaliplatin in early collagen type II-induced arthritis trapped HMGB1 with a distinct biphasic response pattern. Oxaliplatin therapy showed beneficial results for approximately 1 week. Microscopic evaluation of synovitis during this period showed strong nuclear HMGB1 staining in the oxaliplatin treated animals with much lower quantities of extracellular HMGB1 when compared to control treated animals. Furthermore, cellular infiltration, as well as cartilage and bone damage, were all reduced in the oxaliplatin treated group. A dramatic and as yet unexplained clinical relapse occurred later in the oxaliplatin exposed animals, which coincided with a massive synovial tissue expression of extracellular HMGB1 in all treated animals. This rebound-like reaction was also accompanied by a significantly increased incidence of arthritis in the oxaliplatin treated group. These results indicate a distinct temporal and spatial relationship between the clinical course of disease and the cellular localization of HMGB1. Beneficial effects were noted when extracellular HMGB1 expression was low, while severe inflammation coincided with substantial extracellular synovial HMGB1 expression.Therapeutic compounds like oxaliplatin and gold salts share a capacity to inhibit nuclear HMGB1 release and to ameliorate the course of synovial inflammation. These observations support the hypothesis that HMGB1 plays an important functional role in the pathogenesis of arthritis and may represent a novel target molecule for therapy. Major progress has been achieved during the last decade in the treatment of patients with several chronic inflammatory diseases using biological therapies targeting the cytokines tumor necrosis factor (TNF) or interleukin (IL)-1β. These advances warrant a search for additional endogenous target molecules in inflammatory cascades suitable for therapeutic intervention. The notion that high mobility group box 1 protein (HMGB1) may constitute one such candidate molecule forms the background for the present work.HMGB1 is a nuclear, non-histone DNA-binding protein with extranuclear roles as well. HMGB1 mediates multiple functions depending on localization and molecular context (reviewed in ). The prExtracellular HMGB1 may play a major role in the pathogenesis of synovitis, since it is a potent promotor of macrophage activation including induction of TNF as well as IL-1 synthesis and other pro-inflammatory mediators -15; ExtrHMGB1 localization in normal synovial tissue is almost exclusively restricted to the nuclear compartment. Cell membrane-expressed HMGB1 in tumors promotes local tissue invasion. It may also have a causal connection to pannus-induced structural damage, since HMGB1 is strongly displayed both at a protein and mRNA levels in this tissue in collagen-induced arthritis (CIA) . Intra-aPreventing extracellular HMGB1 release by intracellular sequestration provides a novel strategy to evaluate a functional role of HMGB1 in the pathogenesis of synovitis. It is well established that binding of HMGB1 to undamaged DNA is a rapid and transient process. HMGB1 constantly shuttles within the nucleus and between the nuclear and cytoplasmic compartments . In contDBA/1 mice, 18–22 g were obtained from Harlan Netherlands B.V. . Animals were housed in specific pathogen-free facilities at Karolinska University Hospital, Stockholm, Sweden. All experimental procedures were approved by the Stockholm North Ethical Committee, Sweden. The mice were housed five animals per cage, had free access to water and standard rodent chow. A 12-h light/dark cycle was maintained at all times.Collagen type II was prepared from bovine nasal cartilage and collagen emulsion was prepared as previously described -29. ArthThe first experiment was based on therapy with oxaliplatin diluted in sterile water (according to the manufacturer's instructions) to a concentration of 10 mg/kg administrated as a single injection given either intraperitoneally (IP) or intravenously (IV) on day 31 post-immunisation (PI). The animals were followed until day 40 PI. In the second treatment protocol, oxaliplatin (10 mg/kg) was administered IP on day 31 and 37 PI. Animals were followed until day 44 PI. The concentration of oxaliplatin in plasma has been reported to drop rapidly after distribution, reaching a peak concentration of 37 μM within 5 min after administration and declining to 5 μM after a few h. Oxaliplatin assessments after 24 h and 48 h demonstrated plasma levels of 2 μM and 1 μM, respectively . IntravePaws collected day 36 and 44 where fixed in Zamboni solution . Paws were dissected and decalcified as previously described . CryosecSections were stained with hematoxylin and Safranin O (0.1%). Cell infiltration was graded on a scale ranging from 0 (no infiltration) to 3 (severe inflamed joint). Cartilage destruction was scored on a scale from 0 to 3 ranging from no abnormalities to completely destroyed or destained cartilage. Bone erosion was graded on a scale from 0 to 3 .2-fragmented. The substrate diaminobenzidine was added to develop the slides. Sections were counterstained with Mayer's hematoxylin solution . Semi-quantitative assessment of the frequency of positively stained cells in the synovial tissue was graded using the following scale: 0, no positively stained cells; 1, <0.5% stained cells; 2, 0.5–5% stained cells; 3, 5–20% stained cells; 4, 20–50% stained cells; 5, >50% stained cells.In addition, serial sections were stained for HMGB1 as previously described . In shorin vitro for 96 h at 1 × 106 cells/ml, in the presence of OVA (10 μg/ml or 50 μg/ml), phosphate-buffered saline (PBS) or ConA (2 μg/ml) (Sigma Aldrich) oxaliplatin 0.6–5 μM. [3H]-thymidine 1 μCi/well, was added for the final 16 h of culture. [3H]-thymidine incorporation was measured as counts per min (cpm) in a Wallac Trillux 1450 microbeta counter. Cell viability was assessed at initiation and harvest of cultures and determined to be 87–100% using Trypan blue exclusion and Cytotoxicity Detection Kit (LDH) according to the manufacturer's instructions. There were no differences observed in viability between oxaliplatin treated cells and control cells.T-cell proliferation was performed as previously described . In shorMurine macrophage-like RAW 264.7 cells were cultured in DMEM or RPMI medium supplemented with 5–10% fetal calf serum (FCS), 100 U/ml Penicillin, 100 μg/ml Streptomycin, 2 mM L-glutamine and β-mercaptoethanol . At a confluence of 80–90%, cells were harvested by flushing with medium.4 cells/ml, incubated overnight. Cells were washed with PBS, new media and 0.5 μM oxaliplatin was added and stimulated with 10 μg/ml LPS L-6529 , 100 U/ml mouse rIFN-γ (Sigma) for 24 h. After incubation, cells were fixed with 2% paraformaldehyde. Cells were permeabilized in 0.1% Triton X-100 in PBS supplemented with 0.5% bovine serum albumen (BSA) and 0.15% glycine for 30 min. Cells were blocked in 20% normal goat serum in PBS containing 0.5% bovine serum albumin, 0.15% glycine for 40 min. Anti-HMGB1 antibody was added to cells and incubated at room temperature for 1 h. Goat anti-rabbit Alexa 488 and rhodamine–phalloidin was added for 1 h at room temperature. Cells were washed with 0.5% BSA and 0.15% glycine between all incubations steps, followed by a final wash in PBS. Nuclei were counterstained with Hoechst (0.01%). Cells were mounted using gelvatol -2000, 50 ml glycerol and 0.1% sodium azide to 100 ml PBS), then viewed with a confocal scanning fluorescence microscope .RAW 264.7 cells were plated in four-chambered cover slides , 5 × 10The Elispot assay was performed as previously described . RAW 264Data were analyzed for statistical significance using the Mann–Whitney U test for independent groups when comparing arthritis scores. Fisher's exact test was used to compare differences in arthritis incidence between the groups. A p value < 0.05 was considered statistically significant.n = 19) or IV (n = 20) with a single dose of oxaliplatin (10 mg/kg) or vehicle alone (n = 19). A total of 20% of the animals had already developed clinical signs of arthritis, when therapy was initiated. Progression of disease was evaluated by accumulated incidence and clinical scores until 41 days PI on day 31 PI, a second injection on day 37 PI and arthritis progression was followed until day 44 PI or vehicle alone and were killed on day 36 PI. Two out of eight oxaliplatin-treated mice (mean arthritis score 1) and five of the eight control mice (mean arthritis score of 4.8) had developed clinical disease on day 36 Figure . CellulaA pronounced aggravation was observed when HMGB1 staining was performed in articular tissue from four oxaliplatin treated animals killed on day 44 PI Figure . At thisWe performed additional experiments to further evaluate the effects mediated by oxaliplatin on the cellular localization of HMGB1 in cultured macrophages. Murine, macrophage-like RAW 264.7 cells were incubated with oxaliplatin 0.03–0.5 μM) and stimulated with LPS and IFN-γ. Co-culturing with oxaliplatin resulted in strong intranuclear retention of HMGB1 revealed by intracellular HMGB1 staining .in vitro studies indicated that antigen-driven T-lymphocyte proliferation was strongly inhibited by oxaliplatin. This is a significant finding, since induction of collagen type II-induced synovitis requires T cell help. It is presently unknown to what extent the impaired proliferative capacity of T cells is an HMGB1 dependent process. In any case, inhibiting extracellular HMGB1 release to combat synovitis remains a promising strategy. Future work on agents that can selectively regulate intracellular HMGB1 transport mechanisms will be needed to study this as a novel therapeutic possibility.The focus of this therapeutic intervention study is on HMGB1 biology, but it is equally feasible that the beneficial therapeutic effects mediated by oxaliplatin on synovitis can be partly explained by additional cellular mechanisms. For example, our Our study demonstrates a novel strategy of treatment of arthritis by nuclear sequestration of HMGB1 thereby preventing HMGB1 release. This finding may reveal an important functional role of HMGB1 in the pathogenesis of arthritis. The results also support a search for additional compounds preventing HMGB1 release selectively to treat inflammatory diseases.CIA = collagen-induced arthritis; HMGB1 = high mobility group box chromosomal protein 1; IFN = interferon; IL = interleukin; LN = lymph node; LPS = lipopolysaccharide; OVA = ovalbumin; RAGE = receptor for advanced glycation end products; TNF = tumor necrosis factor.The authors declare that they have no competing interests.in vivo studies, performed the T-cell proliferation, and the manuscript preparation. HW carried out the Elispot assays. KP carried out and analyzed the immunohistochemical studies. NI performed the immunocytochemistry assays. PS performed the statistical analysis. MS participated in the design of the study. MTL participated in the design of the study. HEH participated in the design of the study and manuscript preparation. UA participated in the design and coordination of the study and manuscript preparation. All authors read and approved the final manuscript.TÖ carried out the |
Plasmodium [Anopheles gambiae complex. This study aims to characterize the swarm structure and several environmental parameters associated with distribution of breeding swams and sites in the south of Benin.To reduce malaria transmission through vector control, alternative measures are necessary as transgenic mosquitoes are resistant to asmodium and sterasmodium . Both apAfter the survey in field, molecular analyses were done and productive breeding sites, breeding swarms and human habitations positions were integrated into a map using a geographic information system.An. gambiae s.l. has allowed the description of breeding swarms and sites characteristic of two species: An. gambiae M and An. melas (Figures The molecular identification of 510 males collected from 17 swarms and 680 females from larvae of Figures ,3 as wel Figures , 5. ThesAn. gambiae s.l. need to be conducted to produce a predictive model of swarm distribution to aid malaria eradication strategies based on the use of generalized method of moments and SIT.Further studies on the swarming and mating system of |
Metastases to the stomach from an extra-gastric neoplasm are an unusual event, identified in less than 2% of cancer patients at autopsy. The stomach may be involved by hematogenous spread from a distant primary , or by contiguous spread from an adjacent malignancy, such as the pancreas, esophagus and gallbladder. These latter sites may also involve the stomach via lymphatic or haematogenous spread. We present three cases of secondary gastric malignancy.The first is a 19-year-old male who received a diagnosis of testicular choriocarcinoma in September 2004. Metastatic malignancy was demonstrated in the stomach after partial gastrectomy was performed to control gastric hemorrhage.The second is a 75-year-old male, generally well, who was diagnosed with adenocarcinoma of the lung in September 2005. Poorly differentiated adenocarcinoma of the lung was demonstrated in a subsequent biopsy of "gastric polyps".The third is an 85-year-old man with no known history of malignancy who presented for evaluation of iron deficiency anemia by endoscopy in February 2006. Biopsies of the colonic and gastric mucosa demonstrated moderately differentiated invasive colonic adenocarcinoma with metastatic deposits in the stomach.While the accurate recognition of these lesions at endoscopy is fraught with difficulty, pathological awareness of such uncommon metastases in the gastric mucosa is essential for accurate diagnosis and optimal patient management. Primary gastric cancer is the second highest cause of global cancer mortality accounting for over 700,000 deaths annually . GastricSecondary gastric cancer however is a rare event and remains a challenging clinical problem ,7. The mThe clinical presentation of upper gastrointestinal bleeding as a manifestation of gastric metastases is unusual. Further, gastrointestinal bleeding due to secondary gastric choriocarcinoma is uncommon . MetastaA 19 year old male presented in September 2004 with a two month history of a left testicular mass. This individual was in good health, a non-smoker, and had no significant medical history. Left inguinal orchidectomy yielded a diagnosis of predominantly choriocarcinoma with a small focus of embryonal carcinoma. The lesion appeared confined to the testis with no apparent vascular or lymphatic invasion. A few weeks later the patient complained of blurry vision, fatigue and headache. Multiple brain metastases were identified by CT scans. Detailed imaging confirmed the presence of bilateral metastases to the lungs. He was aggressively treated with chemotherapy. One month later, the patient presented with melena and falling haemoglobin levels. Gastroscopy revealed mild pangastritis and evidence of prior gastric bleeding, with no obvious ulceration or masses. Shortly thereafter uncontrolled gastric hemorrhage necessitated a partial gastrectomy. Metastatic testicular choriocarcinoma was confirmed on histopathological examination of the resected stomach.Figure Figure Figure An 85-year-old male presented in February 2006 with a diagnosis of iron deficiency anemia. This individual had a history of hypertension, and had recently suffered a small lacunar infarct, but there was no known history of malignancy. On pan-endoscopic examination, a lesion was noted in the right colon at the junction of the cecum and ileocecal valve and on the lesser curvature of the stomach. Biopsy confirmed these lesions to represent moderately differentiated colonic adenocarcinoma, and colonic adenocarcinoma metastatic to the stomach, respectively.Figure Figure A 75 year-old male presented in September 2005 with a two-month history of weight loss. He had also noticed increasing breathlessness and cough over the past month and a half. He was generally well, took no routine prescription medication, and was a non-smoker. There was no known history of malignancy. On plain X-ray, a right sided lung lesion was noted, which proved to have an appearance suspicious for bronchogenic carcinoma on subsequent CT. Adenocarcinoma was confirmed by fine needle aspirate of the lesion and a pleural biopsy. As the patient also complained of significant epigastric and right upper quadrant pain, gastroscopy and biopsy of "gastric polyps" was undertaken. Dysplastic cells most in keeping with poorly differentiated metastatic adenocarcinoma of the lung were identified within the gastric lymphatics.A right-sided pleural biopsy as seen in figure Pathological examination of the endoscopic biopsy of the gastric polyp figure shows thThe involvement of the stomach by metastases is rare with the most common reported primaries include melanoma, and carcinomas of the breast and lung ,16. The Choriocarcinomas of the testis account for only 0.3% of testicular tumours , and gasAdenocarcinoma of the lung is now the most frequent form of lung carcinoma in the United States , most frColonic adenocarcinoma is the second most common cause of cancer mortality in North America . LymphatThe appearance of metastases to the stomach at endoscopy is variable. The appearance on imaging or gross inspection is generally not suggestive of the primary. Gastric involvement may be characterized by a single lesion in the gastric body or by multiple lesions ,10. OfteGastric metastases may be recognizable as abnormalities on gastroscopy; however as the morphology is variable there are no characteristic appearances that define metastatic disease . LikewisIn conclusion as pitfalls abound in the clinical presentation, diagnostic imaging and histopathology, it is essential to be acutely aware of both common and uncommon metastases to the stomach and to appropriately include these in the differential diagnosis of all gastric lesions for accurate diagnosis and optimal patient management.Written consent for research and publication was obtained from the patient or their relative.The consent forms are mailed to the editorial staff.The authors declare that they have no competing interests.RK is the corresponding, and first author of this manuscript. KS and JLS are undergraduate students who have contributed to the acquisition of data, analysis, and interpretation of data. JF is the postgraduate student who presented these three cases in part as a poster presentation at the Canadian Association of Pathologists' Annual Meeting in July 2006. RC and SCK have made substantial contributions to the conception and design of this manuscript. All authors read and approved the final manuscript. |
However, the precise mechanism of mobilization remains poorly defined. In this study, MSCs that expressed similar cell surface markers and exhibited multilineage differentiation potentials were isolated from various donors. Interestingly, different MSC isolates displayed differential migration ability toward human glioma cells. We hypothesized that distinct molecular signals may be involved in the varied tumor tropisms exhibited by different MSC isolates. To test this hypothesis, gene expression profiles of tumor-trophic MSCs were compared with those of non–tumor-trophic MSCs. Among the various differentially regulated genes, matrix metalloproteinase one (MMP1) gene expression and its protein activities were enhanced by 27-fold and 21-fold, respectively, in highly migrating MSCs compared with poorly migrating MSCs. By contrast, there was no change in the transcriptional levels of other MMPs. Functional inactivation of MMP1 abrogated the migratory potential of MSCs toward glioma-conditioned medium. Conversely, the nonmigratory phenotype of poorly migrating MSC could be rescued in the presence of either recombinant MMP1 or conditioned medium from the highly migrating MSCs. Ectopic expression of MMP1 in these poorly migrating cells also rendered the cells responsive to the signaling cues from the glioma cells in vivo. However, blocking the interaction of MMP1 and its cognate receptor PAR1 effectively diminished the migratory ability of MSCs. Taken together, this study provides, for the first time, supporting evidence that MMP1 is critically involved in the migration capacity of MSCs, acting through the MMP1/PAR1 axis. S Human mesenchymal stem cells (MSCs) are nonhematopoietic adult stem cells with multipotent capacities. The innate tropism of MSCs for tumors, combined with the fact that these cells can be expanded to a clinical scale production with ease, have prompted great interest in using MSCs to deliver antitumor agents to the tumor microenvironment. This is of particular importance to targeting tumor cells with invasive capacity such as glioma cells. However, the mechanism and factors responsible for the tumor tropism of MSCs remain fully elucidated.MSC migration has been postulated to be similar to hematopoietic stem cell (HSC) migration as both cell types reside in the bone marrow. One of the most widely recognized receptor/ligand pairs involved in HSC trafficking is the stromal cell derived factor-1 and its receptor, chemokine receptor four CXCR4), which are crucial for the homing and engraftment activities of HSC as well , which aThe signaling cues to mobilize MSCs appear to be dependent on the physiologic/pathologic status of the local environment. For example, the hepatocyte growth factor/c-met signaling pathway has been implicated in MSC mobilization and recruitment to damaged tissues ,10. UndeCellular migration is a complex process that involves the breakdown of extracellular matrix (ECM) detachment of cells from the basal membrane, migration of cells from original location, survival of cells during the migration process, intravasation into target tissue, and finally, interaction of the migrated cells with the target microenvironment . The degIn the present study, the functional role of MMP1 in the migratory activities of various MSC isolates was studied. Targeted knockdown of endogenous MMP1 was shown to inhibit the migration ability of MSCs in vitro. Conversely, exogenous expression of MMP1 in poorly migrating MSCs could reconstitute the tumor trophic abilities of these cells in vitro and in vivo. In addition, the disruption of interaction between MMP1 and PAR1 was found to severely impair the migration ability of MSCs. Taken together, our results showed, for the first time, the functional importance of the MMP1/PAR1 axis in modulating the migration of MSCs toward human glioma.The Institutional Review Board of National Cancer Center and Singapore General Hospital have approved this study. Isolation and characterization of MSCs was performed as previously described . Primaryhttp://www.invitrogen.com). Stealth negative control was used as control. In brief, all RNAis were transfected at a final concentration of 20 nM into 1 × 105 cells cultured in a six-well dish according to the manufacturer's protocol.RNAi transfection was performed using Lipofectamine RNAiMax -1 amplicon plasmid vector which contains the eGFP gene under the control of the viral immediate early promoter (IE4/5) was obtained from Dr. Y Saeki . The MMP1 gene was inserted into the 4) were cultured in a 24-well tissue culture insert with an 8 μm pore size membrane (BD Biosciences). Migration of MSCs across the membrane was subsequently determined by counting the number of propidium iodide-stained nuclei on the underside of the membrane under ×200 magnification. Full method is included in the supporting information Methods.A Modified Boyden chamber assay was used to investigate the in vitro migration of MSCs. MSCs (1 × 104), suspended in 5 μl of complete medium, were injected into the contralateral hemisphere of ΔGli36 human glioma cells-bearing (2 × 105) mice 7 days post-tumor implantation . Migration of MSCs from the site of injection was assessed 2 weeks post-MSC cells implantation. Quantification of migrated MSC was performed on single-cell suspension using flow cytometry. See supporting information Methods for detail. All animal experiments were performed according to the guidelines and protocols approved by the Institutional Animal Care and Use Committee at the Singapore General Hospital.MSCs (5 × 107 cells per milliliter) in culture medium containing 0.3% low melting point agarose and maintained at 37°C. Drops of cell suspensions of approximately 1.5–2 μl were applied to the center of the wells in a 24-well tissue culture dish. The dish was then placed on ice for 15 minutes to allow the agarose to solidify. The cell-laden agarose droplets were then slowly covered with 500 μl of either glioma-conditioned medium or fresh culture medium. Cell migration was measured daily for 2 days. Each sample was repeated in triplicate and the experiment was repeated twice. Migrated cells were visualized using wide-field microscopy with an inverted microscope , and images were acquired on a CCD color digital camera (DXM1200F) using image acquisition software .Cell migration was quantified by recording the number of cells migrated away from the agarose drops using a method described by Varani et al. . MSCs wehttp://www.affymetrix.com). cRNA labeling, hybridizations, washes, and scan steps were performed according to manufacturer's instructions (Affymetrix Inc.). Probe arrays were scanned using the Affymetrix Microarray Suite, and images were imported as CEL files into Partek Genomic Suite for analysis. Genes of interest were matched to those in the Affymetrix NetAffix Gene Ontology analysis system. The expression microarray has been submitted to the Gene Expression Omnibus database at http://www.ncbi.nlm.nih.gov/geo/. The accession number is GSE12098.The Affymetrix cDNA GeneChip Human Genome U133 Plus 2.0 Array which composed of 47,000 transcripts was used to identify factors that influence the migration of MSC. We compared the gene expression profiles of highly migratory MSCs and lowly migratory MSCs . A total of two independent hybridizations were performed using cells of either passage 4 or 5. Five microgram of total RNA was converted into double-stranded cDNA using a T7-(dT)24 primer containing T7 RNA polymerase promoter and Superscript II reverse transcriptase and MMP1 Biotrak activity assay system respectively, according to manufacturer's suggestions. See supporting information Methods for details.Real-time reverse transcriptase polymerase chain reaction (RT-PCR) was performed as described previously . Quantithttp://www.graphpad.com). Nonpaired parametric data were compared with Student's t-test; for in vivo quantitation of migrated MSCs, paired t-test was used. p values <.05 were considered statistically significant.Statistical analyses were performed using Prism 3.0 and activity was significantly higher (p = .004) in the highly migrating MSCs as compared with the poorly migrating MSCs. Taken together, these results show that the differential migratory abilities of MSCs are correlated, in part, to the functional expression of MMP1.To identify the molecular pathways involved in the differential migration activity of MSCs, gene expression profile between the highly migratory and poorly migratory MSCs were determined by cDNA microarray using Affymetrix GeneChip Human U133 Plus 2.0 Array. MSCs from the highly migrating and medium migrating group (MSC-1 and 9) were compared with those from the poorly migrating group (MSC-2 and 8). Using Partek software analysis, 239 genes were found to be upregulated by at least twofold in the highly migrating/medium migrating MSCs. Many of these genes that matched to those in the Affymetrix NetAffix Gene Ontology analysis system belong to chemokines, metalloproteinases, and cell adhesion molecules, as represented in supporting information MMP2, MMP9, and MT1-MMP have been shown to be essential for the invasive capacity of human MSCs . As suchTo further confirm the critical role of MMP1 in MSC migration, RNA interference assays were performed. Three MMP1-RNAi, namely, MMP1-RNAi-1, MMP1-RNAi-2, and MMP1-RNAi-3, that target different regions on the MMP1 transcript were synthesized. As shown in supporting information The role of MMP1 in the migration of MSC-1 toward human glioma was further investigated using Varani migration assay. MMP1-RNAi-MSC-1 cells showed an inhibited outward dissemination in the presence of glioma-CM, which was not observed in ctrl-RNAi-MSC-1 or fresh tissue culture medium Fig. A. These As MMP1 is a secreted protein, we next ask whether the conditioned medium derived from MSC-1 (MSC-1-CM) could provide the necessary components to induce migration of the poorly migrating MSCs (MSC-8 and MSC-2). Our results showed that MSC-1-CM could effectively rescue the poorly migratory phenotype of MSC-8 and MSC-2 in highly migrating MSCs in comparison with the poorly migrating MSCs. This was confirmed by the ∼10-fold to 1,000-fold higher level of MMP1 transcripts in the highly migratory MSCs compare with poorly migratory MSCs using real-time PCR. The differential mRNA expression of MMP1 was further supported by ELISA assay: MSCs with greater migratory activities were shown to secrete substantial amounts of MMP1 proteins into the culture supernatants , MMP2, MMP9, and MT1-MMP were reported to be players mediating the migration and invasion of MSCs in vitro ,31, upreRecently, Boire et al. reported that PAR1 is a MMP1 receptor that promote invasion and tumorigenesis of breast cancer cells in vitro and in vivo . Shi et In conclusion, we report that the migratory activity of MSCs toward glioma is mediated via the MMP1/PAR1 axis in vitro and in vivo. An adequate understanding of the tumor tropism of MSC bears important implication for effective cellular delivery of therapeutic agents for brain tumor therapy.Our results highlighted the critical role that MMP1 plays in the process of mobilizing MSCs toward human glioma cells. MSCs expressing low levels of MMP1 fail to response to signaling cues from human glioma cells even though other MMPs are present at levels similar to the highly migrating MSCs. Targeted knockdown of MMP1 or the inactivation of PAR1 that disrupt its association with MMP1 resulted in the lost of MSC migratory activities. Anti-PAR1 antibodies treated MSCs could not migrate even in the presence of exogenous MMP1, suggesting that both MMP1 levels and the specific interaction between MMP1 and PAR1 are important factors that determine the migratory abilities of MSCs. To our knowledge, this is the first comprehensive report on the involvement of MMP1 on the migration of MSCs via the activation of the PAR1 receptor.The authors indicate no potential conflicts of interest. |
The worldwide prevalence of diabetes mellitus has risen dramatically in the developing countries over the past two decades. Regular screening of adults is essential for early detection and care. There are limited studies on diabetes awareness and prevalence in rural communities. Hence this prevalence and knowledge assessment study was undertaken. Such data are extremely important to plan the public health policies with specific reference to implementation of National Diabetic Control Program.To study the prevalence and awareness of diabetes mellitus in rural areas.Cross-sectional, household study.A study on adults and elderly age group in Tamaka village was undertaken. Structured questionnaire was used to assess the knowledge of diabetes and capillary blood screening tests done to detect diabetes.SPSS - 11 software.Ten per cent of the 311 adults screened had hyperglycemia. Half of the interviewed population had some awareness about diabetes and its symptoms. But more than half (75%) of them were not aware of the long term effects of diabetes and diabetic care. The common perception about diet in diabetes was to avoid sweets, rice and fruits and to consume more ragi, millet and wheat chapattis. Diabetes in young adults is common. Relevant knowledge about diabetes is poor in rural population. Hence community level awareness programs have to be organized. Healthcare providers must be aware of community perceptions and practices. According to the World Health Organization (WHO) report, India today heads the world with over 32 million diabetic patients and this number is projected to increase to 79.4 million by the year 2030. Recent s3A cross-sectional household study on adults in Tamaka village, Kolar was conducted. A structured questionnaire was used to assess the knowledge of diabetes and capillary blood screening tests were done to detect the diabetes. Basic data regarding awareness, knowledge, traditional beliefs, treatment practices and other issues were included in the questionnaire. The data was analyzed using SPSS - 11 software.There were 31 cases of diabetes mellitus, 22 (71%) males and nine (29%) are females; prevalence of diabetes mellitus was 10%. Only 45% of respondents were aware of the risk factors for diabetes . Even amMajority (75%) of the participants were not aware of the long term effects of diabetes. The most common complications reported by the non-diabetics participants were eye problems (7.1%) followed by kidney disease (6.4%), foot problems (6.1%) and heart attacks (5.7%) . All othAll 31 patients with diabetes were under regular medication but only 54.8% of them exercised regularly; 87.1% of diabetics used footwear regularly. Monitoring of blood sugar was very poor (38.7%). Only (9.7%) of the patients visited doctors on a regular basis .The common perception about diet in diabetics was to avoid sweets (93.5%), rice and fatty foods (87%) and to consume more of ragi millet and wheat chapattis (90%) .et al. found 75.5% of whole population in Chennai aware of the conditions.[The major finding in this study was the lack of awareness of diabetes. Only 50.8% of the participants reported that they knew about a condition called diabetes. A study by Deepa Mohan nditions. Thereforet al. in Chennai observed that even among self-reported diabetic subjects, knowledge about diabetes including awareness of complications of diabetes was poor.[Knowledge about complications of diabetes was even poorer, only 26.8% of non-diabetics and 74.2% of diabetics were aware of the complications. Deepa Mohan was poor. This indwas poor.12 Similawas poor. Public awas poor. This is was poor.The questions related to risk factors for diabetes revealed that many misconceptions were present and more worrisome was the fact that only 41.2% of non-diabetics and 90.4% diabetics were aware of the risk factors that cause diabetes. As prevention of diabetes is primarily dependent on altering lifestyle and increasing levels of physical activity, changing societal perceptions of health and improving knowledge about the risk factors of diabetes and steps to promote physical activity must receive urgent attention of policy makers and healthcare planners.6About 48.4% of the diabetic respondents were not aware of self care in diabetes, study by Kaur and others in Chandigarh observed that 63.3% of them were poor in practicing foot care through regular washing, monitoring of blood sugar was infrequent (46.7%).8 It is lThis study reveals that knowledge regarding diabetes is very poor in rural areas. This emphasizes the need for carrying the right messages regarding diabetes right down to the masses and also extending diabetes education activities to rural areas as well where the prevalence rates of diabetes have already begun to rise. In concl |
Neurology 2006;66:366-372). The objective of this study was to assess the long-term safety and effectiveness of TBZ for chorea in HD.Tetrabenazine (TBZ) selectively depletes central monoamines by reversibly binding to the type-2 vesicular monoamine transporter. A previous double blind study in Huntington disease (HD) demonstrated that TBZ effectively suppressed chorea, with a favorable short-term safety profile score from the Unified Huntington Disease Rating Scale.Of the 75 participants, 45 subjects completed 80 weeks. Three participants terminated due to adverse events (AEs) including depression, delusions with associated previous suicidal behavior, and vocal tics. One subject died due to breast cancer. The other 26 subjects chose not to continue on with each ensuing extension for various reasons. When mild and unrelated AEs were excluded, the most commonly reported AEs (number of subjects) were sedation/somnolence (18), depressed mood (17), anxiety (13), insomnia (10), and akathisia (9). Parkinsonism and dysphagia scores were significantly increased at week 80 compared to baseline. At week 80, chorea had significantly improved from baseline with a mean reduction in the TMC score of 4.6 (SD 5.5) units. The mean dosage at week 80 was 63.4 mg (range 12.5-175 mg).TBZ effectively suppresses HD-related chorea for up to 80 weeks. Patients treated chronically with TBZ should be monitored for parkinsonism, dysphagia and other side effects including sleep disturbance, depression, anxiety, and akathisia.Clinicaltrials.gov registration number : NCT00219804 Huntington disease (HD) is a hereditary, progressive neurodegenerative disease clinically characterized by a triad of chorea, cognitive symptoms and behavioral changes. Although there is no established treatment to delay the onset or forestall the progression of HD, symptomatic treatment of chorea may be beneficial in some individuals as it may have a favorable impact on motor function, quality of life and safety ,2.Many agents and surgical procedures have been evaluated in HD for their anti-choreic efficacy including dopamine depleting agents, dopamine antagonists, benzodiazepines, glutamate antagonists, acetylcholinesterase inhibitors, dopamine agonists, anti-seizure medications, cannabinoids, lithium, deep brain stimulation, and fetal cell transplantation -5. A preTBZ is a reversible dopamine depleting agent that is highly selective for the central vesicular monoamine transporter type 2 (VMAT2) . TBZ depFar too little evidence is available to guide long term symptomatic treatment in HD. Double-blind and long-term studies assessing various treatment strategies in HD are urgently needed . The obj2 receptor blockers, selective and non-selective monoamine-oxidase inhibitors, amantadine, levodopa, or dopamine agonists. Participants were permitted to be on antidepressants, antianxiety agents and other psychotropic medications at stable doses. Clinically, subjects could not have disabling dysarthria, dysphagia or depression present at screening or have an unstable or serious medical or psychiatric illness, untreated depression or lack of a caregiver.Patients with HD who were ambulatory, had a Total Functional Capacity (TFC) score of greater than 5 and a Total Maximal Chorea (TMC) score of greater than 9 from the Unified Huntington Disease Rating Scale (UHDRS), were initially enrolled in the thirteen-week, double-blind, placebo-controlled study . SubjectThe subjects completed the double-blind study within eight weeks of enrollment but were subsequently excluded if they had suffered from a serious adverse event (AE) judged to be possibly or probably related to study drug. There were three possible lengths of enrollment in the open-label study Figure . The iniWritten informed consent was obtained from all study participants and accompanying caregivers. In compliance with the Declaration of Helsinki, this study was approved by the Research Subjects Review Board at the University of Rochester as the coordinating site and by the ethics review boards at all individual sites that enrolled subjects.TBZ was titrated over a maximum of 12 weeks every 3-7 days to the best individual dose (maximum of 200 mg/day). All subjects started at 12.5 mg per day and were titrated upward at the end of each week by 12.5 mg increments to doses equal to or lower than 125 mg/day, and then by 25 mg increments for doses higher than 125 mg/day. If at any time during the titration phase, moderate to severe, possibly or probably drug-related AEs occurred, the dose of TBZ was decreased to the patient's previous well-tolerated dose. Study drug titration (up or down) was permitted only during the first 11 weeks of the study.Participants were examined at the end of weeks 2, 6, 12, 24 and then every 12 weeks; and had a safety follow-up visit one week after the end of treatment. Characteristics of participants and non-participants were compared using chi-square tests and Kruskal-Wallis tests, as appropriate.The primary efficacy endpoint was the TMC score from the UHDRS at week 80 compared with the baseline TMC score. TMC score at week 80 was also compared to week 81 (after washout) to determine the degree of re-emergent chorea. To determine if TBZ may have worsened overall underlying chorea over time, TMC at week 81 was compared with baseline. T-tests and analysis of covariance (ANCOVA), adjusted for site and baseline value, were used to determine significance. Secondary endpoints included the Clinical Global Impression scale and the individual sections of the UHDRS.Tolerability was assessed using adverse events, UHDRS parkinsonism score , Barnes Akathisia Scale (BAS) , UnifiedTreatment emergent AEs were designated to be those AEs that emerged after the start of the open-label study, excluding those for which subjects had a prior history and those that had been present during the double-blind study, including those without resolution. Those AEs that carried over from the double-blind portion of the study were not considered new events as they have been previously reported . The timThe total number (%) of subjects experiencing at least one AE was calculated separately for the titration and maintenance periods. McNemar's test was used to compare the number of subjects experiencing at least one AE during the titration phase with the number experiencing at least one AE during the maintenance phase. AEs starting in the period from the date of baseline visit to week 12 were designated as having occurred during the titration period. AEs starting in the period from the first day of week 12 to week 24 were designated as having occurred during the maintenance period. AEs designated as mild and/or not related to study medication were excluded, and three subjects with fewer than 13.5 weeks in this study period were omitted from this analysis.To determine if 12 additional weeks of exposure to study medication impacted chorea or HD, efficacy and safety measures were compared between subjects originally assigned to placebo and TBZ in the double-blind study using ANCOVA.Of the 84 subjects enrolled in the double-blind study, 6 subjects were ineligible to enroll in the open-label study due to early terminations or serious AEs. Four subjects decided not to participate due to moving away from the study site, decision with the caregiver not to enroll due to lethargy, intensity of protocol, and lost to follow-up. Although one subject who withdrew from the double-blind study early due to pre-existing breast cancer was initially excluded, once medically cleared, she was permitted to enroll, making a total of 75 subjects who enrolled in the open-label study Table . Three oExcluding subjects who had stopped medication, the mean daily dosage at week 24 (n = 66) was 74.2 mg , week 48 (n = 54) was 71.5 and at week 80 (n = 41) was 63.4 mg . For the 44 subjects with complete dosage data at week 80 (including three subjects with zero dose), 24 (55%) of participants were taking either 37.5 mg or 50 mg per day , have higher CAG repeat length , and have a lower total functional assessment score at baseline . There were no differences in race, affected parent, history of depression, chorea score, TFC, total motor score, age, years of education or duration of illness.There were 12 serious AEs including two falls, two cancer diagnoses, a single suicide attempt, pneumonia, hip replacement (elective) with post-op agitation, agitation, anxiety, akathisia and one abnormal CA 27-29 titer in a participant who later died due to metastatic breast cancer. During the study, 56 subjects reported 170 AEs. Seventeen subjects reported depressed mood as an AE during this study with a prior history of depression in 15 of those subjects. All AEs with an incidence of 5% or more are listed in Table When mild or unrelated events were excluded, 39 subjects reported at least one AE during titration while 20 subjects reported at least one AE during maintenance (p < 0.001). Insomnia, somnolence and diarrhea emerged during titration and subsequently resolved during maintenance. The number of subjects with somnolence decreased from 36 to 11 (p < 0.0001), insomnia from 14 to 2 (p < 0.003) and diarrhea from 5 to 1 (p < 0.05) when comparing titration to maintenance phases.Between baseline and week 80, the mean parkinsonism score increased 2.1 (SD 4.3) UHDRS units (p = 0.002) and the mean UPDRS dysarthria score increased 0.4 (SD 0.8) UPDRS units (p < 0.002). There were no significant changes in the HAM scale scores, UPDRS dysphagia score, or BAS. Marked or severe akathisia was experienced by only one participant, who terminated due to elevated bilirubin, rather than akathisia. Three participants (4%) had mild or moderate akathisia at baseline. Ten other participants (13.3%) developed mild or moderate akathisia during the course of the study.There were 3 participants with isolated elevation of AST, greater than 3 times the upper limit of normal. Two occurrences were at baseline and one at week 24. All abnormal liver tests returned to normal by week 80 or at the end of study participation except in one participant with >2 times upper limit of normal AST in isolation. No participant experienced clinical liver dysfunction, but one participant was terminated early due to elevated AST and ALT at baseline and one subject terminated due to elevated bilirubin without clear etiology.When TMC at week 80 was compared to baseline, there was a reduction in mean TMC score by 4.6 (SD 5.5) UHDRS units (p < 0.001). At week 81 after washout, chorea re-emerged with a mean TMC score increase of 5.3 (SD 3.2) UHDRS units (p < 0.001 compared to week 80) .At week 80, there was a significant change in the CGI score of 0.3 . Of the 45 completers, there was improvement in 16 (36%) and worsening of 4 (9%) with the remainder unchanged compared to baseline.In the 45 participants who completed 80 weeks, there was no significant change in total motor score, but there were significant declines in cognitive measures, including verbal fluency, symbol digit and Stroop and functional measures as measured by the functional checklist, independence score and TFC Table .When the groups initially randomized to placebo and TBZ were compared, there were no differences in numbers of subjects with AEs, change in TMC score, change in chorea after withdrawal, best dosage, or any of the secondary measures. There was a reduction in the total number of AEs (p < 0.002) and somnolence (p < 0.01) in maintenance for those subjects initially assigned to TBZ.The double-blind, randomized controlled trial preceding this study demonstrated that TBZ reduced chorea associated with HD for up to 12 weeks with the main AEs including drowsiness and insomnia . In thisIn this study, there were no completed suicides, but one attempt listed as a serious AE and an additional subject who expressed suicidal ideation. Depression was not assessed by formal psychiatric criteria, but depressed mood was screened for using the Hamilton Depression Scale and item 25 of the UHDRS. During the double-blind phase of this study, there was a completed suicide in a subject randomized to the TBZ group, despite scoring within the normal range on the Hamilton Depression Scale two weeks prior to the event . CliniciAt the conclusion of this study, the majority of participants were taking either 50 or 75 mg of TBZ. Notably, even after subjects had been on TBZ for over one year, dosage adjustments continued. In two other open-label, long term studies of TBZ used for a variety of hyperkinetic conditions including HD, the mean doses after more than two years were 60.4 and 106.2 mg, respectively [Discontinuation of TBZ after 80 weeks of treatment appears to be safe and is associated with the return of chorea, without significant worsening compared to baseline. Participants with higher baseline chorea scores experienced a greater reduction in chorea. When TBZ was discontinued, no subject developed signs consistent with neuroleptic withdrawal such as nausea, excessive sweating, tachycardia or akathisia. We did not identify AEs related to the withdrawal of TBZ, but other studies have specifically examined subjects when TBZ is stopped ,28. One Participants did not demonstrate a faster than expected rate of motor or functional decline due to HD. Although parkinsonism and dysphagia were increased in subjects at week 80, this finding was likely a result of the natural progression of disease. Had the parkinsonism been due to a pharmacological impact of tetrabenazine, we would have anticipated that the signs would have emerged more quickly and found on exams throughout the study. TBZ does not appear to have an effect on cognition or function after two years of therapy. Participants experienced an overall improvement on TBZ as demonstrated by the CGI at week 80, but there was no correlation to support the association of global improvement with either motor or chorea change. The UHDRS measures of cognition and function while taking TBZ declined at a rate consistent with the natural history of HD. The TFC scale declined 1.6 ± 0.4 points over almost two years in those initially assigned to TBZ, consistent with previously published measures of TFC ,32. AlthThe main limitation of this open-label study was the loss of subjects at each extension phase. The reasons for the attrition were related to administrative issues and a decision not to continue rather than any specific AEs. The majority of patients elected to complete 80 weeks on therapy, and in fact, once the study concluded, some subjects refused to stop taking TBZ and found other sources of the study medication prior to its availability on the US market. The findings support the clinical impression that chorea suppression in this large cohort of patients can be valuable to patients and families. The unblinded nature of this study limits the degree to which we can make conclusions about effectiveness, but the reduction in chorea was consistent with that seen in the double-blind trial. Further investigation is needed to determine the effectiveness and adverse event profile, particularly regarding cognition, when TBZ is combined with other commonly used medications.Chorea, the most striking physical manifestation of HD, may be disabling and stigmatizing. Frequent or large amplitude involuntary movements can cause embarrassment or frustration and physical harm due to direct injury or falls as well as impact quality of life. The impact of suppressing chorea on weight, gait, behavior and functioning deserves further study, as do the indications for suppressing chorea in the ambulatory high functioning patient and the more advanced patient in whom chorea may be injurious. In lieu of discovering therapy that modifies the global course of the disease, identifying targeted symptomatic treatments for HD, such as those for chorea, is a way to palliate some of the more disabling and stigmatizing aspects of the disorder. This study confirms efficacy in long term use and may guide clinicians in dosing and treatment emergent, long-term adverse effects.http://www.huntington-study-group.org/. None of the HSG investigators or staff had equity interests with Prestwick Pharmaceuticals, Inc. Dr. Fahn received consulting fees of less than $10,000 from Prestwick Pharmaceuticals. After the study was completed, Dr. Frank received consulting fees of less than $10,000 from Ovation Pharmaceuticals. Dr. Marshall presented data at meetings for which he received travel reimbursement from Prestwick Pharmaceuticals, Inc. Dr. Stamler and Ms. Wilson were employees of Prestwick Pharmaceuticals, Inc. The HSG Coordination and Biostatistics Centers at the University of Rochester independently compiled and analyzed the data for this study.This study was funded by a grant from Prestwick Pharmaceuticals, Inc. to the University of Rochester and in turn through subcontracts to the participating research sites. The Huntington Study Group (HSG) is a non-profit consortium of HD investigators The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2377/9/62/prepub |
The LMR-12/ β2-m staining results were confirmed by mRNA microarray data from an independent National Cancer Institute study, as well as by newly obtained reverse transcriptase polymerase chain reaction data. Further analysis of the microarray data showed that β2-m levels closely reflected levels of major histocompatibility complex class I heavy chains and the transporter associated with antigen processing. Since the ABC transporter associated with antigen processing was previously shown to contribute to multidrug-resistance, it may very well be that the observed LMR-12/ β2-m levels are secondary to (elevated) levels of the transporter associated with antigen processing. A perspective arising from the present study is that drug resistant tumour cells may, by having elevated levels of major histocompatibility complex related molecules, be particular good candidates for alternative therapeutic therapies, such as cytotoxic T cell mediated immune-therapies.The rat monoclonal antibody LMR-12 was shown earlier to react with a plasma membrane protein, upregulated in multidrug-resistant cell lines. In this study, we observed distinct LMR-12 staining in 36 out of 55 non-drug-selected tumour cell lines, including melanomas, renal cell-, colon- and lung carcinomas, whereas in other tumour types, such as leukaemia and ovarian cancer, LMR-12 staining was generally low or absent. The cDNA encoding the LMR-12 antigen was isolated from a library of the multidrug-resistant human fibrosarcoma cell line HT1080/DR4 by expression cloning in MOP8 cells. Sequence analysis showed that the LMR-12 antigen is identical to the major histocompatibility complex class I molecule beta 2-microglobulin 86, 1943–1950. doi:10.1038/sj.bjc.6600354www.bjcancer.comCancer Research UK© 2002 MDR1 gene, P-glycoprotein , reviewed in MDR1P-gp overexpression is particularly prominent in tumour cell lines selected in vitro by high concentrations of natural product drugs. Subsequently, in several non-P-gp MDR tumour cell lines high levels of other members of the ATP-binding cassette (ABC) transporter superfamily against proteins with elevated levels in non-P-gp MDR cell lines. Immunisation of mice with the lung cancer cell line SW-1573/2R120 led to the selection of the LRP-56 Mab anticancer drug screen panel was obtained and processed as described previously with 10% heat-inactivated foetal calf serum (Gibco Europe) and 2 mThe panel of 34 human tumours of different histogenetic origins included (snap frozen) tumours of the intestine, stomach, testis, prostate, lung, pancreas, bladder, adrenal gland, cervix, neurologic tissue, breast, ovary, kidney and melanoma.2-m (−1) amino-ethyl-carbazole and 0.02% (v v−1) H2O2 in 0.1 M sodium acetate buffer, pH 5.0. Evaluation was done on coded slides to avoid bias in scoring. As used before for this type of analysis (Cytocentrifuge preparations of tumour cell lines or frozen sections of tumour samples were air-dried overnight and fixed for 7 min in acetone. The slides were incubated for 1 h with LMR-12 (1 : 500) or isotype matched rat Ig in PBS containing 1% BSA. Additional control stainings were done with the W6/32 Mab. This mouse Mab is a broadly used pan-HLA class I-reactive monoclonal antibody that recognises a conformational epitope dependent on association between heavy chains and β6 viable cells per ml were incubated with 10 μg LMR-12, W6/32, control Mab or rabbit polyclonal anti β2-m for 1 h at room temperature. Antibody binding was detected using FITC-labelled rabbit-anti-rat serum , -anti-mouse serum or swine-anti-rabbit serum for another hour at room temperature. The samples were analysed on a FACS-Star flow cytometer .One hundred μl of cell suspensions at a concentration of 1×10BstXI adaptors . Transformation of the library into the Escherichia coli strain MC1061/P3 by electroporation yielded approximately 100 000 primary colonies. These were divided into 10 sublibraries of 10 000 colonies each.Previously, a cDNA-library was derived from mRNA isolated from the human MDR fibrosarcoma cell line HT1080/DR4 , and 12.5 μg ml−1 ampicillin . Plasmid DNA, containing cDNA inserts, was isolated from minipreparations of the bacterial sublibraries by alkaline lysis. MOP8 cells were transfected with isolated plasmid DNA using the DEAE-dextran method as described by Bacterial subpools were grown overnight in Luria-Bertani medium, supplemented with 7.5 μg mlThe LMR-12 cDNA clone was sequenced using the dideoxy Terminator Cycle Sequencing Kit on an automated 373A DNA sequencer . Sequencing was performed in both orientations to confirm the nucleotide sequence. The data were collected and analysed using 373A computer software.Total RNA was isolated using the RNeasy 96 kit and the QIAvac vacuum manifold per manufacturer's protocol. Total RNA samples were quantitated using the fluorescent Ribogreen RNA quantitation reagent kit (Molecular probes) and RNA was stored at −70°C until use for RT–PCR.2-m were designed with Primer Express software . GAPDH was used as an endogenous control . Primer concentrations for β2-m and GAPDH were 600 and 100 nM respectively. Thermocycler parameters were 30 min at 48°C, 10 min at 95°C and 40 PCR cycles of 15 s at 95°C and 1 min at 60°C. All RNA samples were tested in triplicate PCR reactions. Data was analysed using the comparative CT method and β2-m was normalysed to a calibrator cell line (HCC-2998).The RT–PCR reactions were measured with the ABI Prism 7700 Sequence Detection System using TaqMan one-step RT–PCR SYBR green PCR master mix in 50 μl reactions using 5 ng total RNA per reaction. Primers for β2-m mRNA data from the RT–PCR.Using SPSS 9.0 statistical software, two-tailed Pearson correlation coefficients (PCC) were calculated between (LMR-12) immunohistochemical staining data, microarray data from The COMPARE program of the NCI Developmental Therapeutics Program was used to examine the correlation between the LMR-12 staining results and sensitivity for compounds tested, and with basal patterns of gene expression in the 55 cell lines measured by cDNA microarray.r=0.515, P<0.001).As reported previously protein β2-m in the cell line panel, the correlation between the LMR-12/ β2-m staining data and microarray data on mRNA levels for β2-m was examined. 2-m. These data are available via http://dtp.nci.nih.gov. From a total of 45 cell lines, both protein and mRNA data could be compared. The analysis showed a moderate, but highly significant correlation , also showed a moderate, but significant correlation with the LMR-12/ β2-m staining data significant correlations were observed for both LMR-12/ β2-m staining data and β2-m mRNA data with microarray data for the MHC class I heavy chains HLA-A and HLA-B, as well as with the ABC transporter associated with antigen processing TAP1 . While these were the best correlations observed, they were not particularly strong, with Pearson correlation coefficients (PCC) in the 0.3–0.4 range. MRP1 also showed up in this analysis, ranked at position 17 with a PCC of 0.2. The top reverse COMPARE hit was glutathione S-transferase (GST) pi with a PCC of 0.454.When the LMR-12/ β2-m showed up in the analysis, at position 26, with a PCC of 0.47.Comparison to the microarray database yielded several unfamiliar genes in the top 10, but also two MHC class I molecules, F and A, at position 11 and 12, respectively, and with PCCs of around 0.5. Also, βStaining with the rat antibody LMR-12 was reported to be upregulated in a broad panel of MDR cell lines (2-m. The Mr 12 000 β2-m associates with MHC class I heavy chains to form class I human leukocyte antigen (HLA) complexes.Sequence analysis and database searches showed that the LMR-12 antigen has no homology with ABC transporter proteins involved in MDR. Instead, the protein turned out to be identical to the human MHC class I molecule β2-m staining data in the NCI cell line panel to independent, previously reported β2-m mRNA microarray data and to newly obtained RT–PCR mRNA data, we observed moderate, but significant correlations between protein and mRNA data. The RT–PCR data correlated highly significantly with the microarray data. As yet, only a few reports have been published on the correlation between mRNA and protein levels in cells and tissues, whereas none has correlated microarray data with RT–PCR data. Similar to our observations, 2-m as well. Furthermore, β2-m transcript levels appeared to vary considerably in individual cell lines, making β2-m a poor candidate for standardising mRNA levels as detected by e.g. RT–PCR. Although similar findings were already reported by 2-m as a standard housekeeping gene.When comparing our LMR-12/ βThe observed significant correlation between microarray data and protein data as well as mRNA data obtained by RT–PCR, indicates that publicly accessible databases containing microarray data for large numbers of genes can be an important valid information source for researchers.2-m results to reported microarray data on MHC related molecules showed that both β2-m staining and mRNA data (highly) significantly correlated with mRNA data for MHC class I heavy chains and TAP1. The connection of the LMR-12/ β2-m data with MHC class I heavy chains was also confirmed by staining results with the W6/32 Mab both in FACS experiments and immunohistochemical stainings of human tumour sections. Also in the COMPARE analysis to the microarray database MHC class I molecules turned up at high positions in the list. When compared to molecular targets, interesting molecules such as GST pi, BAD and the MDR marker MVP turned up, but no high correlations were observed for anticancer agents tested.Further accession of the microarray database to correlate our β2-m itself has no characteristics of a transporter protein, it seems very unlikely that the protein itself plays a causal role in the MDR phenotype. Still, upregulation of MHC related molecules in MDR cells was already observed in previous studies. 2-m, in gastric- and colon cancer cell lines after treatment with the plant polysaccharide PSK, which was examined for anti-tumour effects. Furthermore, in a study to examine the possible contribution of the ABC transporter associated with antigen processing (TAP) to MDR, we showed that in our panel of MDR cell lines elevated TAP levels were paralleled by elevated levels of MHC class I molecules lines of cell lines and differences in culture conditions. MHC class I levels may be influenced by differences in culture medium components, and the presence or absence of stimulating cytokines such as interferon gamma (As β |
Fractures of the scapular spine are relatively uncommon. We report a case of a 39 year old male who developed an atrophic non-union scapular spine fracture entering the spino-glenoid notch. We describe our experience with this rare fracture pattern and identify the need for early internal fixation in the young, active and working population. Scapular fractures are relatively uncommon and generally represent 0.5–1% of all fractures. Fracture3We describe a case of an uncommon fracture of the scapular spine, with the fracture extending into the spino-glenoid notch. The minimal displacement of this fracture at initial presentation led us to treat this injury conservatively. However, it went on to develop atrophic nonunion and required exploration, internal fixation, and autogenous bone grafting to alleviate the patient's pain and disability. From our experience with this rare fracture pattern and the ensuing complication, we feel that a case can be made for early internal fixation of these fractures in the young, active, and working population.A 39-year-old male patient presented to us in June 2006 with isolated left shoulder pain after he had fallen directly onto the shoulder whilst taking part in paintballing. On clinical examination, he had soft tissue swelling, with tenderness and bruising over the lateral aspect of the scapular spine. Passive and active abduction and forward flexion of the left shoulder were uncomfortable beyond 90°, with well-maintained internal and external rotation of the arm. Although the motor power of the rotator cuff muscles appeared grossly normal, there was evidence of mild inhibition of the rotator cuff function due to pain when muscle power was tested against resistance. There was no neurovascular compromise to the left upper limb. Radiograph of the left shoulder revealed a minimally displaced scapular spine fracture at the base of the acromion and entering the spino-glenoid notch .The patient consented to conservative treatment, which involved resting the arm in a polysling and using analgesic medication for pain relief. He was regularly followed-up in the fracture clinic and began a range of gradual movements after 4 weeks. However, he continued to have symptoms of aching and mobility at the fracture site, which started to affect his quality of life and his ability to carry out routine daily work and leisure activities. Follow-up radiographs failed to show any evidence of healing even after 6 months. A CT scan carried out at this stage clearly demonstrated nonunion at the fracture site .In view of his ongoing problems the patient was offered open reduction and internal fixation with bone grafting of the scapular spine fracture. After appropriate discussion, the patient gave informed consent for the procedure.The patient was placed in a lateral decubitus position and the bony prominences were padded adequately. Standard preparation of the left arm, shoulder, scapula, and left iliac crest was carried out. The incision was made one finger-breadth above and parallel to the spine of scapula, extending from 6 cm medial to the palpable fracture site to the posterolateral corner of the acromion. The deltoid-trapezius fascia was opened along the line of the scapular spine using sharp dissection. The trapezius insertion over the nonunion fracture site and the superior lip of the scapular spine were lifted off using subperiosteal dissection. Care was taken to ensure that there was minimal disruption of the deltoid muscle origin along the inferior lip of the scapular spine. Minimal dissection of the supraspinatus muscle belly was required to expose the nonunion, which was mobile and atrophic in nature. All atrophic tissue was removed with a curette down to fresh bleeding bone and a 2-mm drill bit was used to further open the sclerotic bone edges. Care was taken at all times to avoid transgressing into the spino-glenoid notch.Meanwhile, cancellous bone graft was harvested from the left iliac crest using a bone trephine and a curette. A six-hole small fragment low-contact dynamic compression plate (LCDCP) was contoured to the spine of the scapula such that it sat slightly above the scapular spine. It was fixed to the ridge of the scapular spine in this position with three cortical screws on either side of the nonunion. The harvested bone graft was then packed into both sides of the fracture Figures and 4. TThere were no immediate postoperative complications and the patient was discharged a day later in his polysling, which was worn for 4–5 weeks to rest the shoulder. During this time he was instructed to commence hand, wrist, and elbow exercises, stabilizing his arm against the chest wall. After 2 weeks the patient began gentle pendulum exercises under the supervision of physiotherapists. Passive shoulder abduction up to 60° and gentle assisted rotations with the arm by the side were commenced after 3 weeks. Increasing range of active assisted movements was undertaken between 5 and 6 weeks, along with the use of pulleys and bands in a graded fashion. Since the radiograph taken during the sixth week demonstrated good plate position with satisfactory ongoing consolidation, abduction beyond 90° was allowed. Although after 8 weeks the patient had commenced independent daily activity with abduction below 90°, he was not allowed to carry out any manual or heavy activity before 3 months had elapsed. He was also strongly advised not to play any sports until there was unequivocal evidence of fracture consolidation. The 3-month postoperative radiograph demonstrated complete fracture healing, with satisfactory implant position . More imScapular spine fractures, especially those at the base of the acromion, are uncommon. Furthermore, the complex bony anatomy of the scapula sometimes makes accurate classification of fractures on a plain radiograph rather difficult, thus justifying the need to use CT scanning. The use We are currently unaware of any major studies that have specifically focused upon scapular spine fractures, possibly because such fractures are frequently grouped with fractures of the scapular body or acromion. Those fractures that enter the spino-glenoid notch are clearly different from isolated acromial fractures and therefore should be identified and treated differently.Scapular spine fractures are generally a result of high-energy trauma and tend to be nondisplaced and treated nonoperatively. In our pet al.[et al.,[et al.[212The classification system proposed by Ogawa et al. consider.[et al., who repo.,[et al. describe.,[et al.21213 Opeet al.212The current case, though uncommon, is not unique. It highlights the need to perhaps have a low threshold for operative fixation of such (undisplaced) fractures, especially in young, fit, and active patients. |
We re-audited the CRM+ve rates 1 year after introducing a policy of mandatory preoperative MRI-based MDT discussion. Of the 298 patients diagnosed with rectal cancer, 39 (13%) were deemed palliative, 178 underwent surgery alone and 81 underwent neoadjuvant therapy. Of these, 62 out of 178 patients underwent surgery alone without MRI-based MDT discussion resulting in positive CRM in 16 cases (26%) as compared to 1 out of 116 (1%) in those patients with MDT discussion of MRI. Overall CRM+ve rate in all nonpalliative patients with or without MDT discussion was 12.5% (32 out of 256), significantly lower than the <20% rate (P<0.001) quoted in national guidelines. Re-audit in 98 consecutive patients following a change of policy produced a lower CRM+ve rate of 3% (1 out of 37) for all surgery alone patients and an overall CRM+ve rate of 7% (5 out of 70). In conclusion, MDT discussion of MRI and implementation of a preoperative treatment strategy results in significantly reduced positive CRM in rectal cancer patients.Histopathological audit of positive circumferential resection margins (CRMs) can be used as a surrogate measure of the success of rectal cancer treatment. We audited CRM involvement in rectal cancer patients and the impact of the multidisciplinary team (MDT) on implementing a magnetic resonance imaging (MRI)-based preoperative treatment strategy. Data were collected on all newly diagnosed rectal cancer patients treated in our network between January 1999 and December 2002. Data were analysed for MRI prediction and histopathological assessment of CRM together with the MDT meeting treatment decisions. The CRM+ve rate of those discussed at MDT The Colorectal Cancer Multidisciplinary Team (MDT) is composed of specialist surgeons, clinical and medical oncologists, radiologists, histopathologists and specialist nurses. The MDT should implement an agreed treatment strategy in rectal cancer patients based on nationally accepted guidelines with the aim of standardising and improving outcomes . Currently, there is no published data to support the central role of the MDT discussion in effecting improved outcomes.The main outcome measures of rectal cancer treatment have traditionally been the local recurrence rates, the development of distant metastases and overall survival. More recently, the circumferential resection margin (CRM) has been identified as an indicator of the quality of surgery within a unit, and there is now good evidence to relate the CRM status to improved outcomes has achieved good accuracy in the preoperative prediction of positive CRM, depth of extramural spread and other poor prognostic features suggestive of locally advanced disease with either CXR or CT thorax to determine the presence of metastatic disease. Patients were deemed palliative if they had metastatic disease unsuitable for resection or significant comorbidity that precluded any therapeutic intervention.Magnetic resonance imaging was used to categorise nonpalliative patients into three groups according to prognostic features:Group 1. The primary tumour showed good prognostic features with potentially negative CRM. Such features included T1 and T2 tumours (except those low tumours described in Group 3) and T3 tumours with a depth of extramural spread less than 5 mm together with less than four nodes involved with tumour and no evidence of extramural vascular invasion , T3 tumours with extramural depth of spread ⩾5 mm, presence of extramural vascular invasion and four or more involved lymph nodes , which is known to be associated with a higher rate of margin positivity and therefore a worse outcome surgery.vs 54% survival for cases with T3 ≥5 mm spread . The sagittal images were used to plan 3 mm oblique high spatial resolution axial images. The images were acquired in a plane orthogonal to the tumour and rectal wall using a T2-weighted FSE sequence . Depending on the length of tumour, scan duration was between 6 and 12 min.−2 day−1 for 12 weeks) with mitomycin C . Starting on week 13, 5-FU was reduced to 200 mg m−2 day−1 and concomitant pelvic radiotherapy 45 Gy in 25 fractions was commenced followed by 5.4–9 Gy boost to tumour bed. Surgery was planned 6 weeks after chemoradiation (Patients received protracted venous infusion 5-fluorouracil (5-FU) (300 mg mAny patient deemed eligible for neoadjuvant treatment on the basis of poor prognostic disease or involved margins but with contraindications to chemotherapy underwent long course radiotherapy (LRT) alone. As with the chemoradiotherapy group, surgical resection was planned 6 weeks following therapy. For the purposes of analysis, the LRT patients were included in the relevant neoadjuvant treatment groups on an intention to treat basis.All surgical resections were performed with curative intent. The operations performed included Hartmann's procedure, high anterior resection, low anterior resection with TME and loop ileostomy and abdomino-perineal resection. The decision with regard to the most appropriate operation was based on site of tumour together with patient characteristics and surgeon's preference.Histopathology examinations were performed according to the Royal College of Pathologists guidelines . The CRMvs those not discussed were compared using the kappa test. The 95% confidence intervals (95% CI) were calculated using the binomial distribution. Circumferential resection margin rates were compared to national standards of <20% (2004) and published CRM+ve rates of 28% and 58% were male. Thirty-nine patients (13%) were classified as palliative either because of irresectable metastatic disease or significant comorbidity that precluded therapeutic intervention – not all these cases were discussed at MDT. Thus, 259 patients (87%) were identified as eligible for potentially curative therapy . One hunThe audit identified 62 out of 259 (24%) patients who proceeded to surgery alone without preoperative MDT discussion of MRI. In addition, 116 patients with good prognosis tumours were discussed preoperatively and deemed suitable for primary surgery. However, two of these patients refused surgery . Of the Of the 81 patients undergoing neoadjuvant therapy, 21 were in Group 2 includinMRI prediction of appropriate treatment group in the surgery alone patients was correct in 93% (106 out of 114). Of the incorrectly predicted patients, 6% (7 out of 114) had one or more poor prognostic feature identified histologically following resection. The remaining patient had a tumour perforation at the time of surgery, which could not have been predicted preoperatively.P=0.483) (P=0.483) and 3.vs 26%) (P<0.001). These rates can be compared to national figures (2004) (8 vs <20%) (P<0.001). However, if we include those patients not discussed at MDT, the overall CRM+ve rate becomes 12.5% (32 out of 259), which is still well below recognised guidelines (2004).The CRM+ve rate for all patients undergoing surgery alone whether discussed or not was 9.5% (17 out of 180). Overall, there was a 2% CRM+ve rate (4 out of 182) in all resected patients discussed at MDT. If the 12 patients with irresectable disease were included together with the patients refusing surgery, the cumulative CRM+ve rate was 8% (16 out of 197). Therefore, the CRM+ve rate for all patients who underwent MDT discussion following an MRI (8%) is significantly lower than those patients not discussed (8 The re-audit (closure of the audit loop) identified 98 rectal cancer patients in a 10-month period from the same catchment area under the care of the original six surgeons. Twenty-four of ninety-eight patients (24%) were deemed palliative after MDT discussion on the basis of irresectable metastatic disease or profound co-morbidity . Of the In the re-audit, the CRM+ve rate was only 3% (1 out of 37) for all surgery alone patients (i.e. including the three patients not discussed). There was also a 3% CRM+ve rate (2 out of 64) in all resected patients discussed at MDT including those resected following preoperative neoadjuvant therapy. If the three patients with irresectable disease are included together with the patients who died during preoperative neoadjuvant therapy, the cumulative CRM+ve rate is 7% (5 out of 71) in discussed patients.P<0.001). Overall effective CRM+ve rates for all potentially curable patients – including those patients with unresectable disease after preoperative neoadjuvant therapy and those not discussed at MDT – was reduced from 12.5% (32 out of 259) in the original audit to 7% (5 out of 71) in the re-audit.The CRM+ve rate for all re-audit patients who underwent MDT discussion following an MRI (7%) is comparable to the original audit of 8% (16 out of 197) and significantly lower than national figures of <20% (2004) underwent an MRI, which was not reviewed preoperatively at an MDT – subsequent review of these images demonstrates that poor prognostic features could be identified in 10 cases (50%). Review of the original reports indicates understaging in some cases and could reflect the learning curve of MRI reporting for rectal cancer in less experienced radiologists. This highlights the need for MDT discussion and review of the films to aid identification of diagnostically challenging cases. In other cases, the surgeon deemed the tumour resectable on clinical examination but was concerned about impending obstruction and therefore, failed to wait for the MRI report before proceeding with surgery.In the original audit, only 13% of patients were deemed palliative as compared to 24% on re-audit. The identification of a higher proportion of palliative patients in the re-audit may reflect the introduction of the directive that all patients should be discussed at MDT with more thorough staging and assessment of irresectable metastatic disease and medical infirmity.Circumferential resection margin rates are becoming established as a short-term outcome measure of local recurrence, distant metastases and poor survival for this unselected and consecutive series of patients having MDT discussion of MRI is significantly better than the accepted national standards of <20% (2004). The guidelines specify CRM+ve rates of <20% in potentially curative cases but excluding patients undergoing LRT (2004). This rate was comparable (7.4%) in the re-audit. However, the overall CRM+ve rate for all potentially curative patients including those without MDT discussion of MRI in the original audit was 12.5%. This was reduced to 7% in the re-audit after mandating preoperative MRI-based MDT discussion of all rectal cancer patients. Our MDT network strategy is based on identifying those patients curable by surgery alone and intensifying treatment in those patients at risk of local and systemic failure. Our results demonstrate the effectiveness of an MRI-based MDT discussion in implementing preoperative treatment strategies. Discussion and demonstration of the MRI findings in the presence of all the MDT members appears more useful than issuing a standard report in which subtleties may be missed.In conclusion, it appears that the CRM+ve rate is reducible, but only in the presence of robust MRI staging, preoperative MDT discussion of all the staging investigations, optimal surgery, the availability of effective preoperative therapies and standardised histopathology reporting with comprehensive data collection. |
Pyramidella dolabrata, Ascobulla fragilis, Siphonaria pectinata, Onchidella celtica, and Myosotella myosotis), and we analyze them together with another ten complete mitochondrial genomes of gastropods currently available in molecular databases in order to reconstruct the phylogenetic relationships among the main lineages of gastropods.Gastropod mitochondrial genomes exhibit an unusually great variety of gene orders compared to other metazoan mitochondrial genome such as e.g those of vertebrates. Hence, gastropod mitochondrial genomes constitute a good model system to study patterns, rates, and mechanisms of mitochondrial genome rearrangement. However, this kind of evolutionary comparative analysis requires a robust phylogenetic framework of the group under study, which has been elusive so far for gastropods in spite of the efforts carried out during the last two decades. Here, we report the complete nucleotide sequence of five mitochondrial genomes of gastropods arrived at a single topology, which was used to reconstruct the evolution of mitochondrial gene rearrangements in the group.P. dolabrata) nor Pulmonata (polyphyletic) nor Opisthobranchia (because of the inclusion S. pectinata) were recovered as monophyletic groups. The gene order of the Vetigastropoda might represent the ancestral mitochondrial gene order for Gastropoda and we propose that at least three major rearrangements have taken place in the evolution of gastropods: one in the ancestor of Caenogastropoda, another in the ancestor of Patellogastropoda, and one more in the ancestor of Heterobranchia.Four main lineages were identified within gastropods: Caenogastropoda, Vetigastropoda, Patellogastropoda, and Heterobranchia. Caenogastropoda and Vetigastropoda are sister taxa, as well as, Patellogastropoda and Heterobranchia. This result rejects the validity of the derived clade Apogastropoda (Caenogastropoda + Heterobranchia). The position of Patellogastropoda remains unclear likely due to long-branch attraction biases. Within Heterobranchia, the most heterogeneous group of gastropods, neither Euthyneura (because of the inclusion of The animal mitochondrial (mt) genome is a circular double-stranded DNA molecule, which typically encodes for two rRNAs, 22 tRNAs, and 13 proteins that are essential for mitochondrial function ,5. InsteOn the other hand, mt genome arrangement comparisons may be useful for phylogenetic reconstruction ,7. For tAlbinaria coerulea [Cepaea nemoralis [Pupa strigosa [Roboastra europea [Biomphalaria glabrata [Haliotis rubra [Aplysia californica [Lottia digitalis and Ilyanassa obsoleta [Lophiotoma cerithiformis [Euhadra herklotsi [Littorina saxatilis [Omalogyra atomus [L. digitalis, which has two large non-coding regions that increase the total length of the mt genome up to 26 Kb [Gastropod mollusk mt genomes present high diversity of gene orders , and offcoerulea , Cepaea emoralis , Pupa ststrigosa , Roboast europea , Biomphaglabrata , Haliotiis rubra , Aplysiaifornica , Lottia obsoleta , and Lophiformis Fig. 1)Albinariaerklotsi , Littoriaxatilis , and Omaa atomus have beeto 26 Kb .Any meaningful evolutionary comparison between gastropod mt genome arrangements must rely explicitly on a robust phylogeny of these mollusks. However, phylogenetic relationships among extant groups of gastropods are the subject of a long-standing debate that lasts over a century -25. The Out of the six major gastropod groups, Heterobranchia seems to be the most heterogeneous one. This clade includes the paraphyletic Heterostropha ,28, and Pyramidella dolabrata), one of Opisthobranchia (Ascobulla fragilis), and three of Pulmonata . The newly reported sequences were aligned with all available complete mt genomes of gastropods deposited in GenBank, and subjected to commonly used methods of phylogenetic inference in order to reconstruct a robust phylogeny of gastropods. Genome arrangements of all gastropod mtDNAs were mapped onto the recovered phylogeny in order to determine rearrangement events, and to assess the phylogenetic utility of mt gene order comparisons.In this study, we analyze the evolution of mt gene order arrangements within gastropods in order to gain insights on rates and mechanisms of genome rearrangement within the group. We sequenced anew the complete mt genomes of five gastropods species including one representative of Heterostropha (P. dolabrata) to 14,745 bp (A. fragilis). Their A+T content varies from 55% (M. myosotis) to 67% (A. fragilis). All of them encode a total of 37 genes. Of these, 13 genes , atp8, trnN, atp6, trnR, trnE, rrnS, trnM, nad3, trnS (ucn), trnT, and cox3) are encoded in all the mt genomes by the minus strand.The main structural features of the five gastropod complete mt genomes that were sequenced anew in this study are described in Table cox1 gene overlaps with trnK gene in three mt genomes and with trnY gene in that of P. dolabrata and trnT genes in P. dolabrata. The total length of intergenic spacers is extremely small for the P. dolabrata genome (89 bp), medium for the S. pectinata, O. celtica, and M. myosotis genomes (200–300 bp) and relatively long for the mt genome of A. fragilis (644 bp) and repetitive motives. Putative trnQ-like and trnF-like structures were found have an extremely high A+T content (Table Overlapping of adjacent genes (even between genes encoded by the same strand) is fairly common in the five mt genomes. In almost all cases the overlap involves tRNA genes, although ata Fig. . In addi genomes 00–300 bpP. dolabrata and S. pectinata). Interestingly, cox3 gene ends with the incomplete stop codon T in all five mt genomes sequenced in this study.Initiation and termination codons for the 13 protein coding genes encoded by the five mt genomes are summarized in Table trnS genes lack the DHU stem. In some tRNAs genes, the acceptor stem is mispaired from 15 gastropods and 3 cephalopods were combined into a single data set that produced an alignment of 3,046 positions. Of these, 714 were invariant, and 1,870 were parsimony-informative. Mean character distances among ingroup taxa varied between 0.11 (I. obsoleta and L. cerithiformis) and 0.60 . The average mean character distance was 0.37 (± 0.07) among Heterobranchia lineages, 0.46 (± 0.02) between Heterobranchia and Caenogastropoda, 0.53 between L. digitalis and Caenogastropoda, and 0.57 (± 0.01) between L. digitalis and Heterobranchia.The deduced amino-acid sequences of 12 mitochondrial protein-coding genes . The only differences to the tree shown in Figure S. pectinata was recovered as sister group of A. californica to the exclusion of A. fragilis with low BPP support (91%), and that the sister group relationship of P. dolabrata + O. celtica was not supported. All the other nodes received maximal BPP support (not shown). An identical topology to that shown in Figure Katharina tunicata was used as outgroup (not shown).The reconstructed Bayesian 50% majority rule consensus tree (-lnL= 68443.87) based on the concatenated data set is shown in figure I. obsoleta and L. ceritiformis), Vetigastropoda (H. rubra), Patellogastropoda and Heterobranchia . According to the recovered tree, Caenogastropoda and Vetigastropoda are sister group taxa, as well as Patellogastropoda and Heterobranchia have the same gene order genes (data not shown).Attempts to recover phylogenetic relationships among gastropods based on genome arrangement information and using parsimony- or Bayesian-based methods of phylogenetic inference rendered highly unresolved trees [The mt genomes of the gastropods sequenced so far contain the 37 genes described for the majority of mt genomes within Metazoa . This isatp8, , but seeatp8, ) or bothnd atp8) -52. ThisL. digitalis, which is due to the presence of several non-coding tandem repeat units.The compact organization, gene order, and molecular features of the five heterobranch mt genomes sequenced anew in this study fit well within the general description of the gastropod mt genomes that have been sequenced so far -20. The P. dolabrata could be the result of the extreme reduction in length of the genes in the mt genome of this species.Several hypotheses have been proposed to explain overlapping of adjacent mt genes that are transcribed from the same strand, including the existence of multiple promoters, differential cleavage to generate diverse RNAs or post-transcriptional editing of the RNA . All oveQ-like and F-like) were found in the mt genome of O. celtica, in a non-coding region between the protein coding genes nad6 and nad5. These tRNA-like structures could result from duplication events in the mt genome of O. celtica and may have been able to remain as pseudogenes because they were located in a non-coding region. It has been suggested that mt genes are expressed as a polycistron, and that tRNA-like structures might be related to the processing of the primary transcripts liberating the flanking gene specific mRNAs [Two tRNA-like structures (ic mRNAs . Due to ic mRNAs . TherefoH. rubra [P. dolabrata and S. pectinata). Post-transcriptional poly-adenylation could generate the complete termination codon [cox3 might be a very conserved gene both in length and in codon usage within Gastropoda.There is no general pattern in the use of initiation and termination codons in the 13 protein coding genes of the five mt genomes analyzed in this study. Although a strand-specific pattern of termination codon usage has been described for the gastropod H. rubra , this doon codon ,20. Our The reconstructed gastropod phylogeny based on 12 mt protein-coding gene sequence data supports four natural groups within Gastropoda: Vetigastropoda, Caenogastropoda, Patellogastropoda, and Heterobranchia. The systematic validity of these groups is in full agreement with most recent phylogenetic analyses based on morphological and molecular data ,28,34. ML. digitalis is recovered as the sister group to Heterobranchia with statistical support when trees are rooted with both cephalopods and polyplacophorans (a sister group relationship between Eogastropoda and Orthogastropoda was rejected by the AU and KH (but not SH) tests; Table L. digitalis exhibits a unique mt gene order, and in the phylogenetic analyses, this taxon has a long branch compared to that of other gastropods. A number of studies have suggested that nucleotide substitution and gene rearrangement rates may be correlated in mitochondrial genomes belongs to Pyramidelloidea, a group of gastropods that has been excluded of Heterobranchia by some authors [P. dolabrata as closely related to systelommatophoran pulmonates and opisthobranchs, and confirm our previous studies [The monophyly of Heterobranchia is well supported by several morphological synapomorphies like the presence of pigmented mantle organs, longitudinal rows of cilia in the mantle cavity, a chalaze in the egg masses, heterostrophy, and simultaneous hermaphroditism . Phyloge authors ,25,61, p authors , or incl authors ,62-65 de studies .Pulmonata includes marine, freshwater and terrestrial gastropods with very different body plans. The monophyly of Pulmonata has been accepted by many authors based on some morphological characters like the streptoneuran inervation of the cephalic tentacles, and the lack of rhinophoric nerve (present in opisthobranchs and pyramidellids). However, the essential, traditionally accepted morphological synapomorphy of Pulmonata is the presence of a special neurosecretory system comprising procerebrum and cerebral gland ,66-68. TS. pectinata is more closely related to opisthobranchs than to the freshwater basommatophoran B. glabrata or to any other group of pulmonates considered in this study . All neO. celtica) as an independent linage more closely related to P. dolabrata and to opisthobranchs than to any other Pulmonate . Among these results, the polyphyly of pulmonates is perhaps the most remarkable, and warns against only relying on one or few morphological characters (even if they seem to be free of convergent evolution) to define deep phylogenetic relationships. In any case, the results here presented should be interpreted as a working phylogenetic hypothesis, which needs to be further confirmed with a larger taxon sampling of the studied groups, and the addition to the phylogenetic analyses of new taxa representing not previously included major lineages of gastropods.H. rubra and the cephalopod O. vulgaris have the same gene order suggesting that H. rubra may retain the ancestral mt gene order of Gastropoda. The relative placement of trnD and trnN in H. rubra might constitute autapomorphies in this species since these two tRNAs show the same location in Caenogastropoda and the cephalopod O. vulgaris.Gene order rearrangements in mt genomes are relatively rare, and if shared derived by two taxa can be considered molecular synapomorphies and may provide useful data for phylogenetic reconstruction. In this study, we have mapped gene orders of gastropod mt genomes onto the gastropod phylogeny and tentatively reconstructed the evolutionary history of mt gene order rearrangements in gastropods. The Vetigastropoda Considering all the data available so far, three major rearrangements have taken place in the evolutionary history of gastropods: one in the ancestor of Caenogastropoda, another in the ancestor of Patellogastropoda, and another one in the ancestor of Heterobranchia.L. saxatilis have identical gene arrangements (data not shown). Two rearrangements (one inversion and one translocation) separate the hypothetical ancestral state of gastropods from the gene order found in Caenogastropoda , has only few gene boundaries in common with the hypothetical ancestral mt gene order of gastropods. Considering all the data available so far, it is not possible to determine the precise mechanism responsible for rearrangements in this transition . The conad1 and trnE genes . However, the sequences of the trnY and K genes in P. dolabrata are nearly identical and preserved frozen at -20°C. S. pectinata and O. celtica were sampled in Ceuta (northern Africa) and preserved in EtOH 100%. P. dolabrata was collected in Annobon Island (western Africa) and preserved in EtOH 100%. M. myosotis was collected in Vigo (northwestern Iberian Peninsula) and preserved frozen at -20°C. All specimens were sampled between 2000 and 2002.Each of the five gastropod complete mt genomes sequenced anew in this study was obtained from a single specimen. cox1 , and Taq DNA polymerase in a final volume of 25 μl were subjected to 30 cycles of denaturing at 94°C for 60 s, annealing at 42°C for 60 s, and extending at 72°C for 90 s. The PCR amplified fragments were sequenced with the BigDye Deoxy Terminator cycle-sequencing kit (Perkin Elmer Biosystems) in an automated DNA sequencer (ABI PRISM 3100) using the PCR primers, and following manufacturer's instructions.Total cellular DNA was purified following a standard phenol/chloroform extraction . UniversCO-2198, ), rrnL , and rrd L1091, ) genes. 4 (pH 9.1), 18 mM (NH4)2 SO4, 1–2 mM MgSO4, 0.2 mM of each dNTP, 0.4 μM of each primer, and Takara enzyme in a final volume of 50 μl were subjected to 40 cycles of denaturing at 94°C for 30 s, annealing at 52°C for 30 s, and extending at 68°C for 7 min. Long PCR products in some cases and total cellular DNA extractions in others were used as DNA templates to amplify by standard PCR reactions (see conditions above) overlapping fragments that covered the complete mt genomes. These overlapping PCRs were performed using degenerated primers (designed based on published mt genome sequences of gastropods) and/or specific walking primers for each species. The sequences of all these primers are available from the authors upon request. PCR products were cloned into the pGEM-T vector (Promega), and sequenced using M13 universal primers in an automated sequencer (see above).The sequences of these fragments were used to design three sets of specific primers for each species that amplified, by long PCR, three fragments that covered the remaining mt genome. Long PCRs containing 60 mM Tris-SOAY345054 (P. dolabrata), AY098929 (A. fragilis), AY345049 (S. pectinata), AY345048 (O. celtica), and AY345053 (M. myosotis).Gene annotation was performed using BLAST comparisOctopus vulgaris, Todarodes pacificus [Loligo bleekeri [Katharina tunicata [atp8) were aligned independently using Clustal X version 1.62b [6 generations (sampled every 100 generations) under the WAG+I+G model. Trees sampled before the cold chain reached stationarity (as judged by plots of ML scores) were discarded as "burn-in". Runs were repeated twice. Robustness of the resulting BI tree was evaluated using Bayesian posterior probabilities (BPPs). In addition, BI was also applied to a data set that included the aligned amino acid sequence of each gene as independent partitions. The AIC implemented in ProtTest was used to select the substitution models for each gene: atp6 (RtREV+G+F), cox1 (WAG+G+F), cox2 (RtREV+I+G+F), cox3 (cpREV+G+F), cob (cpREV+I+G+F), nad1 (RtREV+G+F), nad2 (WAG+I+G+F), nad3 (RtREV+G+F), nad4 (WAG+I+G+F), nad4L (MtREV+G+F), nad5 (RtREV+I+G+F), nad6 (Dayhoff+G+F). This data set was subjected to the same searching parameters for BI described above plus the "set partition" and "unlink" options.Phylogenetic analyses included the five newly determined mtDNA sequences, as well as all gastropod complete mt genome sequences available in GenBank. In addition, the corresponding sequences of the cephalopod species acificus , and Lolbleekeri , and thetunicata were useon 1.62b followedon 1.62b were caron 1.62b ) as implon 1.62b was usedon 1.62b evolutioon 1.62b , and robon 1.62b by simula priori morphology-based hypotheses.Alternative phylogenetic hypotheses were tested using the approximately unbiased (AU), Shimodaira- Hasegawa (SH), and Kishino-Hasegawa (KH) tests as implePhylogenetic relationships among gastropods were also reconstructed based on genome arrangement data using parsimony and Bayesian inferences with the GRAPPA and BadgBI: Bayesian inference; ME: minimum evolution; ML: maximum likelihood; MP: maximum-parsimony; mt: mitochondrial. BPP: Bayesian posterior probabilities; BP: Bootstrap proportions;JT collected some specimens for this study. CG and RZ gathered the sequences, and performed phylogenetic analyses. All authors wrote the manuscript, read and approved the final version of the manuscript. |
In infants & children variety of conditions and syndromes are associated with difficult Airway. Anaesthetic management becomes a challenge if it remains unrecognized until induction and sometimes results in disaster, leading to oropharyngeal trauma, laryngeal oedema, cardiovascular & neurological complications. A 4-month-old child with multiple congenital anomalies was posted for cataract extraction for early and better development of vision. He had history of post birth respiratory distress, difficulty in feeding, breath holding with delayed mile stones. He was treated as for Juvenile asthma. This child was induced with inhalation anaesthesia. There was difficulty in laryngoscopic intubation and could pass much smaller size of the tube than predicted. He developed post operative stridor and desaturation. The problems which we faced during the anaesthetic management and during postoperative period are discussed with this case. Airway abnormality in a child may remain undetected in the presence of other multiple congenital defects. Wells et al reported association of subglottic stenosis, shortened trachea, fewer tracheal rings, shorter glottis carinal length in significant percent of the patients with several congenital malformation syndromes. Down's syndrome has the higher incidence of such associated airway abnormalitiesA 4-month-old male child weighing 4.5kg, height of 55cm, having congenital bilateral cataract was posted for cataract extraction of right eye. It was IInd full term normally delivered baby, cried well after birth but later developed respiratory distress which required neonatal intensive care for 15 days. Since birth he had excessive salivation, noisy breathing on and off, with breath holding during crying and feeding without cyanosis. He had repeated attacks of hacking cough and distress which required intensive treatment. Once surgery was postponed for the same reason. Diagnosis of recurrent lower respiratory tract infection with juvenile asthmatic exacerbations were made. Nothing specific in his family history and the milestones were moderately delayed.On investigation his haemoglobin was 9.8gm% with normal coagulation profile. X-ray chest depicted cardiomegaly with normal airway and lung fields.2D- echocardiography revealed mild valvular pulmonary stenosis. The electro- cardiogram was normal. Ultrasonography of brain revealed 4x3mm cyst in choroid plexus of right frontal horn. He was negative for rubella virus antibodies. On general examination he was afebrile, acyanotic, anicteric & dysphonic with weak cry. The respiratory rate (RR) of 48 /min with minimal sub costal, sternal in drawing. The neck mobility, head and tongue sizes were normal to his age. On oral examination soft palate and base of the uvula was seen. The heart rate (HR) was 140/min, with short systolic murmur and the chest was clear. There was no spinal deformity, muscle tone and the reflexes were normal. Pupils were normal in size, reaction and the visions were absent.−1 intravenously (IV) was given a day before and on the day of operation. Child was kept nil by mouth for 4 hours prior to the surgery. On pulse oximeter his SpO2 on air was 98%. Anaesthetic drugs & equipments were checked and premedicated with glycopyrrolate 0.01mg.kg−1, midazolam 0.05 mg.kg−1 IV. Patient was induced with halothane up to 2.5% in 50% of N2O and O2 with assisted ventilation and adequate depth was achieved .The laryngoscopy was performed with curved / straight blade No.1. Larynx could not be visualized. Intubation was attempted twice with size 3.5/3 mm plain endotracheal (ET) tube but failed to intubate. Mask ventilation was ensured and laryngoscopy performed under the effect of succinylcholine 1mg.kg−1.With external laryngeal pressure, posterior commissure was partly visible. Intubation succeeded with No.2 plain ET tube with resistance. The tracheal placement was confirmed and maintained on 50% O2 in N2O and halothane by assisted ventilation. Surgery lasted for 30min. Intra operatively vitals were stable. The child was extubated after full recovery of consciousness. SpO2 on air was 98%. After a period of 20 min in the recovery he developed mild stridor, SpO2=90% with RR of 52/ min.Informed consent was obtained from the parents. Prophylactic antibiotic, nebulisation with salbutamol, hydrocortisone 4mg.kgConsidering intubation attempts and snuggly fitted tube we avoided re intubation and managed the situation with lateral positioning, jaw thrust, O2, IV dexamethasone 2mg, hydrocortisone 25mg.O2 saturation improved to 96% with clear chest and normal vital records. Within an hour in pediatric intensive care unit (PICU), he re-developed biphasic stridor, ronchi and labored respiration. SpO2 dropped to 88%, RR was 66/min and HR-170/min.He was conscious, crying and struggling to move. He was nebulised with salbutamol, IV steroids, O2 by mask. He responded to the treatment slowly over 5days.The parents were informed about the difficult intra and post operative course, also the need of further investigations to rule out any associated airway problem. Considering the urgency of second operation for better vision, the risk of anaesthesia and if needed tracheostomy with intensive care was explained. The child was reposted for surgery of left eye, after 15 days. But due to poor economical status and refusal for the risk consent, surgery was postponed. The child reappeared after 8months for the reason of poor vision and status quo respiratory complaints. X-ray chest PA/Lat.view of neck and CTsc−1 and midazolam 0.05 mg/kg. Besides routine, tracheostomy tray and emergency transtracheal ventilation set were kept ready. The pediatric size LMA or fibreoptic scope were not available with us. We planned for induction & intubation under O2, N2O, and halothane anaesthesia. But we failed to achieve the desired level of induction after 20–30 min.As mask ventilation was possible, IV propofol 1mg.kg−1 and succinylcholine 1.25 mg.kg−1 was injected. On laryngoscopy with external laryngral pressure the highly placed larynx was seen as a small hole, with ill defined margins. 2% lidocaine sprayed over the larynx. On third attempt intubation was possible with No.2.5 ET tube on stylet. The tube position confirmed and the chest was clear. A dose of atracurium 0.5mg.kg−1 was given. Peribulbar block was achieved with 1.5ml of 1% lidocaine. After some time there was gradual fall in SpO2 up to 88% over 10 min, so halothane was cut off and supplemented with IV propofol 0.5 mg/kg. SpO2 improved up to 95%, end tidal CO2 of 35–40 mmHg. Moderate resistance to IPPV was present throughout the surgery. Reversal was achieved with neostigmine 0.05 mg/kg & glycopyrrolate 0.02 mg.kg−1. The child was extubated after full recovery and SpO2 on air was 98%.Immediately after extubation he again developed stridor, dyspnoea with desaturation. He was managed with O2, jaw thrust and nebulisation with steroids and bronchodilators and was observed inside the operation theatre for one hour and then shifted to PICU. Later in PICU he had similar respiratory distress within two hours and required intensive treatment with inhalational / parenteral steroids and bronchodilators for 6 postoperative days.He was shifted to the wards on 7th post operative day and discharged on 10th day.Pre-operatively IV steroids, nebulization with bronchodilator was given. Premedicated with. intramuscular glycopyrrolate 0.01mg.kgMultiple congenital defects when associated with airway abnormalities may present with mixed picture of respiratory symptoms. Airway malacia associated with bronchopulmonary dysplasia may be the reason for long term intensive care with tracheostomy and ventilatory supportThe paediatric airway itself and when associated with airway malacia/stenosis in a child with multiple congenital syndromes, have higher incidence of difficult intubation as well as post extubation complications. The associated airway anomaly may remain unrecognized or undiagnosed preoperatively. So with the history of recurrent respiratory tract infections requiring intensive care, the possibility of the narrowing of air passage and post extubation complications like stridor or respirstory distress must be kept in mind. The intra operative difficult course may be followed by dreadful complications. Hence one should be prepared with the plan for failed intubation /ventilation and for the post operative consequences. |
Behavior pattern influences the risk of unintentional injuries. This study was conducted to identify the pattern of household unsafe behavior in different socioeconomic strata, in Pune city, India.Population-based, cross-sectional study. Behaviors influencing the risk of burn, poisoning, drowning, and road traffic injuries were questioned from 200 randomly selected households.Nearly 28% of the households did not have a separate kitchen, 37.5% cooked at the ground level, 33.5% used a kerosene pressure stove, 12% used unprotected open fire as a source of warmth in winter, and 34.5% stored inflammable substances at home. Ninety one percent of the households reported storing poisonous chemicals in places that could not be locked. In 68.3% of the households with children below five years, these chemicals were kept in places accessible to children. Nearly 21% of the individuals, who could swim, did so in unsafe places and 25.2% of them were not trained in swimming. In 35.5% of the households, children used streets as playgrounds. Among all two-wheeled vehicle riders, 35.6% reported not having a helmet and 57.7% of those who had a helmet did not use it regularly. Socioeconomic status was strongly associated with the unsafe behaviors related to burns, drowning, and road traffic injuries.The study identifies the sociocultural and behavioral factors leading to unsafe behaviors, placing individuals at risk of unintentional injuries, which can be used as a first step toward prevention. Unintentional injuries are a major public health problem worldwide, but receive minimum attention in developing countries. In these countries, urban development in transition exposes individuals and households to unsafe environments. In India, the unintentional injury occurrence rate was reported to be 110 cases per 1000 individuals per year, which was more than 15 times that of intentional injury occurrence rates . The majo24646Knowledge about behavioral patterns of households is required for any preventive plan, to reduce the risk of injury and enhance behavioral changes. Among many factors influencing this pattern of behavior, socioeconomic status is an identified risk factor for unintentional injuries.–15 This Data collection for a population-based study to determine the burden, pattern, and risk factors for unintentional injuries was conducted in Pune, between March 2007 and April 2008. In this study, a sample of 2100 households was randomly selected through multistage, stratified, cluster random sampling. Ten percent of this sample population (200 households) was randomly selected from within 10 administrative wards of Pune city (20 households per ward). The pattern of household behavior that influences the risk of unintentional injuries was elicited from a household member, usually the head of the household or spouse of the head of the household. A semi-structured questionnaire was used to collect information about the sociodemographic status of the households and the pattern of household behaviors, which may increase the risk of the four most prevalent unintentional injuries, that is, burn, poisoning, drowning, and road traffic injuries. The socioeconomic classification was based on the revised Kuppuswamy score. Classifi7Out of 200 households interviewed, maximum households belonged to the lower socioeconomic strata . Twenty-five (12.5%) households resided in slums and two households (1%) were homeless. Eighteen (9%) households resided in semi-permanent houses and two (1.0%) in temporary houses. Thirty-three households (16.5%) had only one room as dwelling area, 62 households (31.0%) lived in homes with a density of two to five individuals per room, and five households (2.5%) lived in homes with a density between six to 10 individuals per room .P = 0.000), using unsafe cooking equipment (pressure stove or unprotected open fire) (P = 0.000), cooking at the ground level (P = 0.000), storing inflammable substances at home (P = 0.000), and using unprotected open fire for warmth during cold season (P = 0.000) [Unsafe behaviors increasing the risk of burn injury was cooking in the living area , use of kerosene pressure stove in addition to gas stove , cooking at ground level , using open fire as source of warmth during winter , and storage of inflammable substances at home . Only one household reported having a fire extinguisher in working condition and four households reported availability of fire extinguisher in the apartment block. Low socioeconomic status was strongly associated with behaviors and situations that increased the risk of burns, like cooking in the living area (= 0.000) .P = 0.682) [Presence of chemicals, which could be potential poisons , in unlocked storage places was reported by 91.0% of the households (n = 182). Seventy-one households (35.5%) reported storing kerosene at home in nonstandard containers usually meant for beverage or food items. Among 60 households with children below five years, 41 households (68.3%) reported that these chemicals were accessible to children. Storage of poisonous chemicals at home was not associated with the socioeconomic status of the households. However, households from the higher socioeconomic strata stored safer forms of chemicals, for example, insecticide spray (50%), while households from lower socioeconomic strata used unsafe forms like insecticides in tablet or liquid form (86.8%). There was no significant association between socioeconomic status and storage of poisonous chemicals at places accessible to children below five years (= 0.682) .P = 0.001), since use of streets for playing was reported in children of 54.8% of the households belonging to lower socioeconomic strata, but only from 10.7% of households that belonged to the upper socioeconomic strata. Not having a helmet (P = 0.002) and carrying more than one pillion rider (P = 0.014) was strongly associated with low socioeconomic status. Among individuals belonging to the lower socioeconomic strata, 54.5% (n = 18) did not have a helmet, while this proportion was 23.6% (n = 21) among individuals belonging to the upper socioeconomic strata. In the lower socioeconomic strata, 60.6% (n = 20) reported carrying more than one pillion rider, while this proportion was 32.6% (n = 29) in the upper socioeconomic strata. There was no significant association between socioeconomic status of individuals and driving without license (P = 0.879) or irregular use of helmet (P = 0.051) [Unsafe behaviors increasing the risk of road traffic injury were children playing in the streets , using motorized two-wheeled vehicles , being pedestrians , driving without having a license , not having a helmet among riders of two-wheeled vehicles , irregular use of helmet despite possessing one , and more than the permitted number of pillion riders . Low socioeconomic status was significantly associated with the unsafe outdoor playing area of children (= 0.051) .P = 0.075). There was a strong association between the socioeconomic status and swimming in unsafe places where lifeguard and safety devices were not available (P = 0.000). Among individuals belonging to the upper socioeconomic strata, who reported the habit of swimming, only 3.8% had not received formal training for swimming, but this proportion was 42.1% among individuals belonging to the lower socioeconomic strata [Presence of unprotected water surface in the vicinity (< 1 km) of the living area was reported by 32.5% of households (n = 65). Unsafe behaviors increasing the risk of drowning were swimming in places without lifeguard or safety devices and swimming without being trained in swimming . There was no association between the socioeconomic status and presence of unprotected water surface in the vicinity of the living area (c strata .A bibliographic search on unintentional injuries in India yields very few reports on injury-related, unsafe behavior. The available studies relate to specific injuries, for example, risky behavior of drivers of motorized two-wheeled vehicles, hand injIn this study, the underlying causes of unsafe behavior could be ascribed to socioeconomic and cultural factors, lack of awareness, lack of or poor urban infrastructure, and lack of proactive preventive measures by the government and public health agencies. Unsafe cooking practices could be related not only to the traditional Indian practice of floor level cooking, but also to poverty, which forces families to use unprotected open fire or a kerosene pressure stove for cooking. Irregular supply of cooking gas was also associated with at least one-third of the households using pressure kerosene stoves as a back-up cooking device. Thus, measures to ensure proper distribution of cooking gas along with price subsidies for the poor, could be an active preventive measure to reduce the risk of burns. Education about the importance of tabletop cooking is another preventive measure for increasing safe cooking practices. Rare reports of fire extinguishers at homes of even households belonging to the high strata of society, suggests the need for legislation to make fire extinguishers mandatory, at least in apartment blocks.Lack of awareness about the risk of poisoning was evident from the widespread unsafe practice of storing poisonous chemicals at places accessible to children, even among households from the higher socioeconomic strata. In addition to education, public health agencies can play an active role by promoting awareness on proper storage of poisonous substances and making use of childproof containers mandatory.Poor urban infrastructure like presence of unprotected water bodies and lack of safe playgrounds increase the risk of drowning and road traffic injuries, especially for children. High rate of pedestrian and public transport use, especially among the poor, highlights the need for improvement of urban infrastructure, especially in the face of the rapid population increase, including in-migration into cities. Not having a helmet was reported mostly among the poor. Creating awareness to increase the risk perception along with compulsory distribution of helmets at the time of selling motorized two-wheeled vehicles could be an intervention to support the safety of the poor. Low compliance to helmet use, in a situation where motorized two-wheeled vehicles were used by more than 35% of the households, shows the importance of legislation, education, and enforcement. One of the main reasons cited for not using a helmet was discomfort. Thus changing the design of helmets to give better side view could be effective in increasing the rate of helmet usage.Injury-related unsafe behavior is widely prevalent among households, with greater prevalence in the lower socioeconomic strata. Interventions aimed at behavior change have to be considered concomitantly with the necessity of improving and providing safer infrastructure in urban environments. |
Study A was a single dose study in castrate males. Study B was a single dose study in noncastrate males and study C was a multiple dose study in noncastrate males. The drug was given orally in a once-daily dose and blood samples taken to assess pharmacokinetic (PK) parameters and hormone levels in all patients. The study drug was well tolerated with some variability in PKs. Suppression of testosterone levels to <0.14 nmol l−1 was seen in four out of six castrate males treated with a single dose of 500 mg. At 800 mg given days 1–12 in noncastrate males, target suppression was achieved in three out of three patients, but a two- to three-fold increase of Luteinising Hormone (LH) levels in two out of three patients overcame suppression within 3 days. All patients in the multiple dose study developed an abnormal response to a short Synacthen test by day 11, although baseline cortisol levels remained normal. This is the first report of the use of a specific 17α-hydroxylase/17,20-lyase inhibitor in humans. Repeated treatment of men with intact gonadal function with abiraterone acetate at a dose of 800 mg can successfully suppress testosterone levels to the castrate range. However, this level of suppression may not be sustained in all patients due to compensatory hypersecretion of LH. The enhanced testosterone suppression achieved in castrate men merits further clinical study as a second-line hormonal treatment for prostate cancer. Adrenocortical suppression may necessitate concomitant administration of replacement glucocorticoid.A series of three dose escalating studies were conducted to investigate the ability of the 17 Prostate cancer continues to present an enormous challenge in the UK, where it is the second most common cause of cancer death in men, causing over 9000 deaths per year .The beneficial effect of androgen ablation on metastatic prostate cancer was realised in the 1940s, when Huggins and Hodges observed an antitumour response, as measured by a reduction in serum acid phosphatase, in patients treated by surgical or medical castration . In geneFigure 1prostate .Studies have shown that these extratesticular sources of testosterone represent an important alternative source of androgen stimulation in a significant proportion of patients with prostate cancer. As much as 10% of baseline circulating testosterone remains in castrated men, due to peripheral conversion of adrenal steroids to testosterone . First-lin situ hybridisation , a potent inhibitor of the enzyme with a Kiapp of 0.5 nM for at least 24 h. Although this finding may be indicative of depot characteristics of the mode of administration used, it may also indicate a degree of enterohepatic recirculation that could prove favourable in the clinical setting, providing sustained target enzyme inhibition.Using a rodent model, following intraperitoneal administration, abiraterone acetate showed rapid deacetylation. Levels of deacetylated drug reached >1 α hydroxylation as shown, for example, by the reduced weight of the ventral prostate and endocrine data, the latter to determine the specificity of inhibition. All three studies involved patients with advanced, that is, unresectable, prostate cancer.Here, we describe a series of three phase one trials in which abiraterone acetate was tested in humans for the first time. This is the first report of the effects of a specific 17Patients were recruited to one of the following three studies that were conducted in sequence. The study protocols were approved by the Research Ethics Committee of all participating institutions, and all patients gave written informed consent prior to inclusion. All three studies were conducted under the auspices of the Cancer Research UK Phase I/II Committee.−1) following orchidectomy or Gonadotrophin-Releasing Hormone agonist (GnRHa) therapy, to determine the dose of abiraterone acetate that was sufficient to cause suppression of testosterone synthesis to undetectable levels (<0.14 nmol l−1). Significant suppression was defined as either testosterone <0.14 nmol l−1 in individual patients with a pretreatment value of <0.6 nmol l−1 or a ⩾75% reduction in individual patients with a pretreatment value of ⩾0.6 nmol l−1.This was a single dose study in males with castrate levels of testosterone (testosterone ⩽2 nmol l−1) to determine the dose of abiraterone acetate that was sufficient to cause suppression of testosterone synthesis to castrate levels (⩽2.0 nmol l−1).This was a single dose study in noncastrate males in noncastrate males to determine the dose of abiraterone acetate that was sufficient to cause persistent suppression of testosterone synthesis to castrate levels. If this level of suppression was achieved, then it was planned to escalate the doses still higher to establish whether further suppression of testosterone was possible. Complete suppression of testosterone synthesis should result in testosterone levels <0.7 nmol lto determine the safety and tolerability of abiraterone acetate in the single and multiple dose setting;to study the PKs of this compound; andto determine any other endocrine effects especially suppression of cortisol synthesis.In all three studies, the secondary objectives were as follows:Abiraterone acetate was provided by Boehringer Ingelheim as a micronised powder and prepared by the Cancer Research UK Formulation Unit (Glasgow) as 10, 50, 100 and 200 mg dry-filled capsules. The capsules were stored at room temperature.−1, WBC ⩾4.0 × 109 l−1, platelet count ⩾100 × 109 l−1, alkaline phosphatase less than twice the upper limit of normal and a urea, creatinine and bilirubin of not more than 25% above the normal range. Patients were excluded with coexistent serious nonmalignant disease and were not allowed to take concomitant steroids. All patients had stable recurrent malignancy. At the time of participation in these trials, none of the patients was considered to require any alternative therapeutic intervention for symptomatic or progressive disease.Patients were required to be at least 18 years of age with a WHO performance status of ⩽2. No radiotherapy or hormonal therapy (with the exception of GnRHa in Study A as described above) was allowed within 6 weeks prior to study, although patients were allowed to receive concomitant bisphosphonates. Entry was further restricted to patients with haemoglobin ⩾10.0 g dl−1 was also required.This was a single-centre, open-label, phase one, single-dose study in which sequential cohorts of three medically or surgically castrate patients were to receive treatment at five dose levels: starting at 10 mg and increasing to 30, 100, 200 and 500 mg. Prior to study entry all patients must have had an orchidectomy or have received (and continued to receive) ongoing treatment with a GnRH agonist for at least 2 months. A confirmatory testosterone level of between 0.2 and 2.0 nmol lone patient at any dose level experienced ⩾Grade 3 toxicitythere was a significant suppression of serum cortisol in one patient as defined as a greater than 50% reduction in levels of cortisol, or a smaller fall associated with hypotension (systolic BP less than 90 mmHg) or persistent electrolyte disturbance.if the target suppression of testosterone was achieved in three patients at any one dose level.This was a single-centre, open-label, phase one, single-dose study in which sequential cohorts of three noncastrate patients were to be treated at four dose levels: 200, 500, 650 and 800 mg. The starting dose of 200 mg was chosen when the results of study A were available. It was envisaged that a dose level would be expanded to five patients if−1) as well as normal gonadotrophin levels (Luteinising Hormone (LH) ⩽13 IU l−1).All patients were required to have a normal testosterone level prior to study entry (i.e. ⩾9.0 nmol l−1) as well as normal gonadotrophin levels (LH⩽13 IU l−1) prior to study entry.This was a three-centre, open-label, phase one, multidose study in which sequential cohorts of three noncastrate patients were to receive treatment with abiraterone daily for 12 days. All patients were required to have a normal testosterone level (⩾9.0 nmol lThe starting dose of 500 mg was based upon the data from the single-dose studies. It was planned that a dose level would be expanded to six patients if any patient experienced toxicity ⩾ Grade III or if there was a significant suppression of serum cortisol in one patient (defined as per Study B above). All patients were followed for 28 days for any sign of toxicity. If any patient developed symptoms suggestive of progressive disease, confirmed by a rise in PSA during the study period, they would have been offered standard treatment with a GnRH agonist.In all studies, the capsules were administered in one oral dose at 0930 following an overnight fast. Free fluids were permitted and patients were allowed a light snack 4 h after dosing on the day of PK sampling.Prior to the first dose of therapy a complete history, physical examination and assessment of performance status was performed on all patients. Full-blood count, electrolytes and creatinine, liver function, urinanalysis, electrocardiograph and chest X-ray were obtained from all patients. The ECG was repeated 6 h after dosing. On the day of therapy heart rate, blood pressure and temperature were recorded every 4 h and then daily at the time of blood sampling. Thereafter, full-blood count, electrolytes, creatinine and liver function were re-evaluated on Days 2 and 7. Toxicity was recorded using the NCI-CTG Expanded Common Toxicity Criteria V1.α-hydroxyprogesterone (17HP), androstenedione, LH and follicle-stimulating hormone (FSH) using commercially available kits. However, the DPC Coat-a-count kit for testosterone was sensitised using a larger volume of sample/standard and extension of the standard curve. Prior to study initiation, this was demonstrated to have no significant effect on the values of testosterone measured but to provide sensitivity to a level of 0.05 nmol l−1. All endocrine analyses were conducted by radioimmunoassay except for LH and FSH, which were by enzyme immunoassay.Serum samples for endocrine analysis were obtained at 0, 2, 4, 8 and 24 h on a single day in the week prior to treatment commencement and then on Days 1, 2, 3, 4 and 7. As the duration of testosterone suppression was longer than originally anticipated, additional samples were added on Days 10, 14 and 21. The serum samples were analysed for testosterone, cortisol, 17 The schedule sampling differed slightly with samples removed at 0930 and 1730 on the day of treatment and thereafter in the morning on Days 2, 3, 4, 7, 8, 9, 10, 11, 14, 21 and 28. In Study C, a short Synacthen test was also performed prior to therapy and again around Day 11.μm, 250 × 4.6 mm) analytical column protected by a guard column . The mobile phase consisted of 570 ml of 20 mM ammonium acetate solution, 100 ml tetrahydrofuran and 1330 ml acetonitrile and was delivered at a flow rate of 1 ml min−1 throughout the system. Column eluant was subjected to electrospray ionisation and monitored by selected ion monitoring (SIM) of protonated pseudo-molecular ions of authentic standards of abiraterone acetate and abiraterone, and GP488 . For SIM, the scan width was 0.25 and the total scan time was 2.99 s. Also, heated capillary temperature=250°C, spray voltage=4.5 kV, collision offset=−49.9 V and electron multiplier voltage=1200 eV.Sample extracts were analysed by a fully validated liquid chromatography mass spectrometry method. The instrument consisted of Wisp Model 717 autosampler including a Model 600MS system controller with a quaternary U6K LC pump. A Finnigan MAT TSQ 700 triple quadrupole mass spectrometer was used as the detection system, together with Finnigan MAT ICIS and ICL software for data capture and processing . The separation of analytes was performed on a Supelcosil LC-ABZ and 2 min vortexing, 2 ml aliquots of the organic layer were transferred for drying in vacuo for 2 h. The dried residue was reconstituted by vortexing in 150 μl of acetonitrile and transferred into autosampler vials. Aliquots (100 μl) of these samples were injected onto the LC column. Calibration curves were obtained by plotting peak area ratios for abiraterone acetates or abiraterone to internal standard vs the nominal analyte concentrations using linear regression by Microsoft Excel version 5.0 . Calibrations curves were produced at the levels of 500 and 1000 nM for abiraterone acetate and 6.25, 12.5, 25, 50, 100 and 500 nM for abiraterone. Quality controls were included at the level of 8, 40 and 400 nM for abiraterone and 500 nM for abiraterone acetate.Samples were extracted as follows: 50 Cmax, Tmax, Tα1/2T1/2 and Kabs) was determined for each patient. Pharmacokinetic parameters were evaluated using WinNonLin Software® and were conducted at The Institute of Cancer Research (Sutton).A comprehensive PK profile were collected into vacutainer tubes containing EDTA and immediately centrifuged to separate the plasma. At least 2 ml of plasma was transferred into polypropylene tubes (NUNC) and frozen at –20° until analysis.A total of 16 male patients with histologically confirmed advanced adenocarcinoma of the prostate were enrolled. All patients had received previous antiandrogen therapy (flutamide or cyproterone acetate) and at time of enrolment in this study all were receiving treatment with a GnRH agonist; leuprorelin or goserelin. All patients were evaluable for safety, PK and endocrine assessments. The group had a median age of 73.5 years (Range 63–77 years) and all were performance status 0, 1.−1. On further questioning, it was discovered that there had been suboptimal compliance with goserelin therapy and he was deemed ineligible.Sequential cohorts of three patients were treated at 10, 30 and 100 mg. At these doses no consistent effect on testosterone was observed and the plasma concentrations of abiraterone were below the level of detection. Patient 4 (30 mg dose level) was observed to have noncastrate levels of testosterone during the study period despite a satisfactory screening testosterone level of 1.3 nmol l−1 or ⩾75% reduction in baseline level testosterone ⩾0.6 mmol l−1). The duration of the suppression was variable. In two of the three patients, suppression was sustained from Days 2 to 5 post-therapy. Three additional patients then received treatment at 500 mg. Target testosterone suppression was seen in one of these patients. The same level of suppression was not observed in the remaining two apparently due to incorrect prior dosing with goserelin and therefore escape of testosterone levels to noncastrate levels during the study period. These results are illustrated in Figure 3−1, falling to 81 nmol l−1 Day 1. However, as this reduction was apparent at the first time point on Day 1 it was felt to be inconsistent with suppression due to abiraterone. On questioning this patient denied the concomitant use of glucocorticoids.A dose escalation to 500 mg was considered necessary as a result of the absence of a pharmacodynamic effect at doses up to 100 mg after one patient had already consented to and had received therapy at 200 mg. A 75% reduction in testosterone was observed in this patient within the first 24 h after treatment with abiraterone. In all three patients treated at 500 mg, a reduction in testosterone to the target level was seen , and had performance status 0.Four male patients with histologically confirmed advanced adenocarcinoma of prostate were recruited. All patients had received prior antiandrogen therapy and previous therapy with a GnRH agonist but at the time of study entry had a serum testosterone of >9 nmol lThe first patient received treatment with abiraterone at 200 mg. No testosterone suppression was observed and three further patients were then treated at 500 mg. In all three patients a reduction in testosterone level of more than 50% from baseline was seen. The testosterone nadir was observed on the second day after therapy with recovery to pretreatment levels 6–9 days later. A corresponding rise in LH levels was seen (47–75%) maximal on Day 3 with recovery to pretreatment levels by Day 10 and had performance status 0 or 1.Six male patients with histologically confirmed advanced adenocarcinoma of the prostate were accrued. Five of the six had received prior antiandrogen therapy and the same five of six had received and completed prior therapy with a GnRH agonist. At the time of study entry, all patients had a testosterone level of >9 nmol l−1 was seen in all three patients, this did not reach the target level of ⩽0.7 nmol l−1. The pattern of suppression was variable with maximal suppression occurring Days 1–3 and substantial suppression sustained for up to 9 days at baseline in the patients treated with 500 mg, falling to only 42 nmol l−1 (+10%) by Day 11. A further cohort of three patients was then treated at 800 mg to investigate whether target testosterone suppression (⩽0.7 nmol l−1) could be reached. In the first patient, target suppression was obtained on Day 1, sustained for 3 days and then reversed in association with rising LH (three-fold increase) from Day 3. Despite this testosterone levels remained ⩽2.0 nmol l−1 for the duration of treatment. In the second, target suppression was reached on Day 4, testosterone rose to 0.77 nmol l−1 on Day 7 but otherwise remained below the target level for the duration of treatment. In the final patient, testosterone fell to 1.7 nmol l−1 by Day 2 but then rose again to >2.0 nmol l−1 from Day 4. A concomitant two-fold rise in LH was seen from Day 3 in this patient.An initial cohort of three patients received treatment at 500 mg. Although a reduction in testosterone level to ⩽2.0 nmol l−1 (120%) at baseline in this cohort of patients, falling to an increment of 65.3 nmol l−1 (23%) by Day 11. Serum cortisol levels were themselves reduced by the evening of Day 1 in three patients but all other assessments remained within normal limits. Evening cortisol falling by 60, 71 and 69%, respectively, from baseline evening cortisol in these three patients.The first and third patients treated at 500 mg had higher LH levels at baseline than all patients treated at 800 mg. This may have contributed to the difficulty in achieving suppression of testosterone at the lower dose level. As in those treated at 500 mg, the cortisol response to the short Synacthen test in all three patients treated at 800 mg was abnormal on Day 11. The mean change in cortisol levels in response to Synacthen was 385 nmol lThe PK parameters all show considerable variability between patients and are presented in Tmax was 2.70 h (±s.d. 2.71) with a mean elimination half-life of 27.6 h (±s.d. 20.17). A range of up to 10-fold in AUC was seen for a given dose.The mean R2=0.34). There was no evidence of saturation of drug absorption at the dose levels studied were reported by individual patients but no relation to dose or schedule was apparent. There were no grade three or four toxic events.α-hydroxylase/C17,20-lyase inhibitor in humans. The endocrine results that will determine the further development of abiraterone acetate are likely to be qualitatively representative of other drugs of this class.These are the first data to describe the systematic assessment of the endocrine effects of a specific 17α-OH-progesterone production. This indicates that any inhibition of 17α-hydroxylation that may occur as a result of treatment with abiraterone acetate is over-ridden by compensatory mechanisms related to cortisol feedback. Despite 17α-hydroxylase and C17,20-lyase activities being contained in a single enzyme the compensated effect on 17α-hydroxylase activity clearly did not prevent an inhibition of C17,20-lyase (as evidenced by androgen suppression). Supportive evidence for this is provided by the observation that there was no significant effect on cortisol levels in these patients. Since this study was conducted in castrate patients, the data assess adrenal function as opposed to mostly testicular function.The single dose study in castrate patients demonstrated that treatment with abiraterone acetate results in sustained suppression of the testosterone/androstenedione axis. The protracted duration of this suppression is possibly due to the irreversible nature of the drug action. In turn, therefore, one may predict that it may be possible to increase the effect with continuous dosing. This single dose study showed no effect on 1717,20-lyase activity.In the single dose study of noncastrate patients, there appeared to be a steep dose–response relationship. In the patients treated at 200 mg, no effect was observed in testosterone levels and this was not because of compensation by LH . At 500 mg treated patients showed persistent reductions in testosterone levels. In each case the level of testosterone on Day 3 was less than 50% that of baseline, despite increased LH levels in these patients. Again there was no indication in this component study of the series that there was any effect on baseline cortisol levels despite what would appears to be a persistent block in CFrom the repeat dose studies it can be seen that a dose of at least 800 mg is required to maintain testosterone suppression to target levels. In two patients treated at this dose level there was a marked rise in LH, which appeared to restrict the duration of testosterone suppression. However, in a further patient there was no compensatory LH response and testosterone levels remained very low. At 800 mg there was no effect on FSH levels apparent.Although baseline cortisol levels remained normal, all patients treated at 500 and 800 mg in the multiple dose study developed an abnormal response to a short Synacthen test by Day 11. Some impact on adrenal reserve was predictable from the steroid synthesis pathway.α-hydroxylase and C17,20-lyase inhibitors such as abiraterone acetate. However, the omission of glucocorticoid replacement when treating with aminoglutethimide and ketoconazole has been shown to be safe and effective (In the clinical use of both aminoglutethimide and ketoconazole, it is common practice to administer supplementary hydrocortisone and this may prove necessary with 17The level of interpatient variability made analysis of dose-dependent PK relationships in these studies difficult. The majority of patients reached maximum drug concentration within 4 h of administration with an elimination half-life of approximately 29 h. However, there was up to a 10-fold variation in AUC for a given dose. This is largely accounted for by two distinct groups of outliers. Firstly, a small number of patients who absorbed the compound more quickly, reaching maximum concentration within an hour. Secondly, a group of patients in whom the elimination half-life was extremely prolonged and exceeded 70 h. Several factors may theoretically contribute to such a variation particularly with an oral compound. Patterns of absorption may be influenced by the presence of residual food in the stomach despite an overnight fast, by intrinsic interindividual differences in upper gastrointestinal pH or by interaction with other concomitant medication exerting an influence on gastric pH. Furthermore, these studies were performed using capsules containing simply loose-filled, micronised powder and we cannot exclude the possibility that this formulation might accentuate such effects. Greater interpatient consistency might be achieved with a capsule containing a more homogeneous formulation, as a melt or with excipients, to aid reproducible dissolution. Interindividual differences in body fat percentages may lead to differences in the available volume of distribution. Lastly, there may be significant interpatient differences in the rate of drug metabolism due to the effect of concomitant medication on enzyme function or pharmacogenomic characteristics.Cmax and protracted β-half-life of abiraterone in patient 24 treated at 800 mg were noted; this patient may represent a true outlier to the overall relationship between AUC and dose, but additional PK information in patients receiving 800 mg would be helpful.The association between AUC and dose appeared nonlinear when results from all three studies were combined. As there were only three patients at the 800 mg level, each contributed proportionately more to the overall result. The particularly high AUC, high The degree of PK interpatient variability with abiraterone acetate is at the high end of the spectrum seen with oral anticancer compounds . Howeverin vitro and in vivo studies. It appears that this effect is not simply the result of C17,20-lyase and/or 5α reductase activity but is also mediated through a negative interaction directly with the androgen receptor (In addition to ketoconazole, aminoglutethimide and abiraterone, other compounds designed to inhibit general androgen production have been developed and show promise. Brodie and colleagues have described a series of novel steroidal inhibitors of androgen synthesis. The most potent of these L39, a Δ4-3-one-androstane derivative, is able to lower androgen levels effectively in animal models and inhibit tumour growth of androgen-dependent cancer cells in both α-hydroxylase/C17,20-lyase in causing reductions in testosterone levels in both castrate and noncastrate males with prostate cancer. The data indicate that reliably maintaining castrate testosterone levels in intact males in the face of increased levels of LH may require higher doses of abiraterone acetate. The present data, however, do support the potential utility of this drug in the second-line treatment of patients who have become refractory to gonadotrophin-releasing hormone agonists. In recent years, it has become routine to continue treatment with these agents in spite of disease progression, since without this, androgen stimulation may return. This being the case, a sustained further reduction in testosterone should be achievable with abiraterone acetate since the compensatory LH drive would be suppressed by the GnRH agonist. This hypothesis needs to be tested in a chronic dosing Phase I/II study in GnRH-resistant prostate cancer in the presence of continued GnRH dosing.These studies demonstrate for the first time the potential utility of specific inhibition of 17 |
Dengue is a major public health problem in tropical and subtropical countries. Rapid and easy diagnosis of dengue can assist patient triage and care-management. The detection of DENV NS1 on rapid lateral flow tests offers a fast route to a presumptive dengue diagnosis but careful evaluations are urgently needed as more and more people use them.The sensitivity and specificity of the Bio-Rad NS1 Ag Strip and SD Dengue Duo (NS1/IgM/IgG) lateral flow rapid tests were evaluated in a panel of plasma samples from 245 Vietnamese patients with RT-PCR confirmed dengue and 47 with other febrile illnesses.The NS1 rapid tests had similar diagnostic sensitivities (respectively 61.6% and 62.4%) in confirmed dengue cases but were 100% specific. When IgM/IgG results from the SD Dengue Duo were included in the test interpretation, the sensitivity improved significantly from 62.4% with NS1 alone to 75.5% when NS1 and/or IgM was positive and 83.7% when NS1 and/or IgM and/or IgG was positive. Both NS1 assays were significantly more sensitive for primary than secondary dengue. NS1 positivity was associated with the underlying viraemia as NS1-positive samples had a significantly higher viraemia than NS1-negative samples.These data suggest that the NS1 test component of these assays are highly specific and have similar levels of sensitivity. The IgM parameter in the SD Duo test improved overall test sensitivity without compromising specificity. The SD Dengue Duo lateral flow rapid test deserves further prospective evaluation in dengue endemic settings. Dengue is a major public health problem in tropical and subtropical countries ,2. Each There are several reasons why early and accurate diagnosis of dengue is important. First, an early and accurate diagnosis can assist in patient management by directing clinical attention to the appearance of major warning signs of severe or even life threatening complications, e.g. rapidly rising hematocrit, poor peripheral perfusion. Second, an accurate dengue diagnosis prevents unnecessary and possibly expensive antibiotic usage. Third, prompt diagnosis of index cases can facilitate vector control activities in the community so as to mitigate further transmission. Lastly, the expanded use of accurate dengue diagnostics provides important data on the epidemiology and health burden of dengue and in doing so can inform and guide public health policy, particularly as dengue vaccines and anti-virals make their way through development pipelines.Commercial ELISA tests that detect the DENV NS1 protein in plasma/sera have provided a new avenue for diagnosing dengue -10. The The purpose of the current study was to compare the sensitivity and specificity of 2 commercially available, lateral-flow dengue RDTs (Bio-Rad NS1 Ag Strip and SD Dengue Duo) in a panel of plasma samples from dengue patients with different viral serotypes and viraemia levels. The SD Dengue Duo is distinguished from the Bio-Rad NS1 Ag Strip in that it also tests for DENV IgM and IgG.The panel of plasma samples used in this study was from patients enrolled in the DENCO study, a multi-centre descriptive study of dengue conducted at the Hospital for Tropical Diseases, Paediatric Hospital #1 and Paediatric Hospital #2 in Ho Chi Minh City, Viet Nam from August 2006 to May 2007. Following written informed consent by the study participant, or a parent/guardian in the case of children, patients above 6 months of age with clinically suspected dengue and fever for less than 7 days were enrolled in the study. Ethical approval was obtained from the Ethics Review Committee of the Hospital for Tropical Diseases, Paediatric Hospital #1 and #2. Two plasma or sera samples were collected from each patient, one at day of enrolment and the second 7-14 days after fever onset.All of the plasma samples used in the panel described in this study were RT-PCR positive for dengue virus using an assay described previously . IgM annd analyst who was blind to the first assessment. Discordant results were referred to a 3rd analyst whose decision was final. The analysts performing and scoring the assays were blind to the reference assay results and to any clinical information on the patients.The Bio-Rad NS1 Ag Strip and SD Dengue Duo rapid tests were provided by Bio-Rad and Standard Diagnostics respectively and were performed according to the manufacturer's instructions. Each plasma sample for assessment was tested on both rapid tests in parallel. Each assay strip was independently assessed after the incubation time suggested by the manufacturer by the technician conducting the test and by a 2Concerning the SD Dengue Duo rapid test and for comparative purposes only, the IgM and IgG parameters were included in the interpretation of the test in some analyses. The statements "NS1 or IgM" and "NS1 or IgM or IgG" were then used and should be understood as if at least one of these parameters is positive the sample is considered as positive. However, the detection of IgM and/or IgG in the rapid test is not sufficient for a definitive diagnosis of dengue.P < 0.05 for all parameters and were two-sided unless otherwise indicated. Uncertainty was expressed by 95% confidence intervals. Categorical variables between groups were compared by Fisher's exact test. The t-test was used for continuous variables.All statistical analysis was performed using Intercooled STATA version 9.2 . Significance was assigned at The characteristics of the study population (n = 292 cases) that contributed acute plasma to the test panel is shown in Table vs SD Duo NS1 62.4%, P = 0.93). The specificity of both NS1 tests was 100%, albeit the number of patients who had no evidence of acute or recent dengue was small (n = 47). Inclusion of the IgM parameter in the interpretation of the SD Duo test significantly increased its diagnostic sensitivity . Inclusion of the IgM and the IgG parameters in the interpretation of the SD Duo test further increased the diagnostic sensitivity over NS1 alone but came at a cost of reduced specificity .Bio-Rad and SD Duo NS1 rapid tests were equally sensitive for the diagnosis of acute dengue relative to the reference qRT-PCR test (Table P = 0.05).The sensitivity of NS1 tests alone was not significantly different between test samples collected within 3 days of illness onset versus those collected at a later time (Table P = 0.71). Reduced sensitivity was also not associated with viraemia levels between primary and secondary dengue cases . In a more stratified analysis, NS1 sensitivity was also higher in DENV-1 infected patients (where the sample size was highest) with primary dengue compared to secondary dengue at all time points of acute illness, in the test sample was associated with a significant reduction in NS1 sensitivity in the SD assay Table . On the P = 0.0005) in patients who were NS1-positive versus those who NS1 negative in both tests at day 3 (with Bio-Rad and SD rapid test: log10 mean viraemia = 7.71 versus log10 mean viraemia = 6.11 respectively) viraemia levels were significantly higher Figure and 2B. ) Figure and 3B. vs 62.4% respectively) for the detection of NS1 in plasma from RT-PCR positive patients. The factors negatively influencing the detection of NS1 included the presence of DENV-reactive IgG in the test sample and the presence of secondary infection. The inclusion of the IgM test in the SD Dengue Duo provides for greater sensitivity (75.5%) without compromising specificity. The reasonable sensitivity and specificity of the SD Dengue Duo suggests it warrants additional prospective evaluations.In the present study we showed that two different commercially available lateral flow RDTs, the Bio-Rad NS1 Ag Strip and SD Dengue Duo, have similar sensitivities . The inclusion of the IgG test result modestly further improved sensitivity. Caution is needed however as a positive IgM or IgG result alone could also represent infection anytime in the previous few months and should therefore be considered a presumptive diagnosis. The potential for reduced specificity was highlighted in that one patient with no laboratory acute evidence of dengue had a positive IgG test result alone. Nevertheless the use of IgM and IgG test parameters in a NS1 RDT is rational as it will likely provide improved presumptive diagnostic coverage towards the end of the acute illness when NS1 levels are declining but the DENV-specific IgM and IgG titres are climbing rapidly. The sensitivity and specificity of the IgM and IgG test components of the SD Dengue Duo have been described previously as part of the TDR/WHO assessment of dengue RDTs .The presence of DENV-reactive IgG in the test sample, a relatively low viraemia and secondary dengue were the major factors associated with a negative NS1 finding on both tests. The bias of these RDTs towards patients with higher viraemia levels is probably a positive feature of these tests in that they are likely biased towards patients at risk for complications during their illness . SomewhaA weakness of this study was that it was performed using a panel of stored plasma specimens and was heavily biased towards DENV-1, the most common serotype in circulation in Viet Nam since 2006. Similarly, assay performance and interpretation were performed by experienced lab analysts and not by clinicians "at the bedside". Different results may also have been obtained if an outpatient population, rather than a hospitalized set of patients, were used to generate the assessment panel used here. The evaluation panel is also biased in that all samples from dengue patients were RT-PCR positive. Despite these limitations, the current study provides a baseline in terms of sensitivity and specificity of these two RDTs for Vietnamese dengue patients and highlights virological and immunological factors associated with assay performance. Further prospective evaluations of both tests are warranted.Our findings suggest that the NS1 components of each test are specific tools for diagnosing acute dengue, though the sensitivity of both is influenced by the level of viraemia and host humoral immune response. The addition of an IgM/G component to the SD Dengue Duo significantly improved diagnostic sensitivity above NS1 testing alone.The authors declare that they have no competing interests.VT participated in the study design, the experimental work, the analysis and interpretation of the data and drafted the manuscript. HTTV participated in the experimental work and helped draft the manuscript. NVNQ participated in the study design, the experimental work and the analysis and interpretation of the data. CVVN, HTT, JF and BW participated in the study design, interpretation of data and revising of the manuscript. CPS conceived and designed the study and participated in the analysis and interpretation of the data and writing of the manuscript. All authors have read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2334/10/142/prepub |
The aim of this paper is to illustrate a simple method for increasing the range of possible options for reducing adverse events in Australian hospitals, which could have been, but was not, adopted in the wake of the landmark 1995 'Quality in Australian Health Care' study, and to report the suggestions and the estimated lapse time before they would impact upon mortality and morbidity.The study used a modified Delphi technique that first elicited options for reducing adverse events from an invited panel selected on the basis of their knowledge of the area of adverse events and quality assurance. Initial suggestions were collated and returned to them for re-consideration and comment.Completed responses from both stages were obtained from 20 of those initially approached. Forty-one options for reducing AEs were identified with an average lapse time of 3.5 years. Hospital regulation had the least delay (2.4 years) and out of hospital information the greatest (6.4 years).Following identification of the magnitude of the problem of adverse events in the 'Quality in Australian Health Care' study a more rapid and broad ranging response was possible than occurred. Apparently viable options for reducing adverse events and associated mortality and morbidity remain unexploited. Results from the 1995 'Quality in Australian Health Care' (QAHC) study suggested that the quality of health care in Australia is a problem that overshadows all others in the health sector. In the initial study, reported by Wilson et al. . Subsequent studies have confirmed the existence of a major problem. For example, using Victorian Department of Human Services data, representing 90% of the direct hospital expenditure in Victoria, Ehsani et al. found that 6.88% of routine admissions were associated with a coded adverse event . The disSafety Innovations in Practice (SIIP) Program Mark II, Compendium of Project Reports th care' .While the exact dimensions of the problem were debated there was no suggestion at any stage that Australia did not face a very serious problem. One of the themes of the present paper is that the response to this could have, and should have, been significantly faster and more effective. Some of the problems responsible for AEs addressed below were self-evident, and immediate administrative and possibly legislative action might have been justified, albeit with close monitoring and review following confirmation of the causal factors: with preventable deaths reportedly occurring at a rate equivalent to a Bali bombing every 3 days, haste was justified but did not occur.One simple methodology demonstrating how this might have been achieved is described below. We report the results of a survey conducted among professionals diversely associated with the health industry that sought to canvass practical measures for addressing the problem of adverse events in hospitals. The purpose was not to create a comprehensive check-list of possible interventions but, rather, to demonstrate the feasibility of the approach, and act as a conduit for channelling options to policy makers and legislators. Some of these have subsequently been adopted into policy but we have made no attempt to screen these out as they indicate advice that was immediately available but often not acted upon. Other potentially important measures have still not been adopted. A second reason for the study is the belief that the identification of even modest new options, or the circulation of proposals currently under discussion, along with expert opinion about their feasibility, may be of value due to the size of the problem being addressed and the magnitude of benefits from even incremental improvements. The approach does not purport to be a definitive or an authoritative solution to the problem of AEs. It is more akin to a 'brainstorming' which seeks to throw up divergent ideas, some more feasible than others, to enlarge the scope of ideas for consideration.We consulted a number of Australian experts in health safety and quality issues. Their names were obtained from public domain resources: authors of published articles on safety and quality issues, departmental officials in the area of safety, those on relevant committees, conference participants, and AE researchers known to the investigators. Of the 76 individuals who were sent invitations, 23 held positions in quality control or practice improvement . The next largest group comprised 16 experts in clinical governance/management or clinical risk management Directors). There was some overlap between these two groups, e.g. when clinicians were Managers of quality control units.) Invitations were also sent to representatives of government departments (10), to senior nurses (5) and academics (5). The rest were made up of epidemiologists, business people, and 9 individuals for whom we had an affiliation but no position description. Invitees were asked to make their suggestions anonymously.The study adopted a modified Delphi methodology using a two-stage procedure. First, we sent a questionnaire describing a number of proposals for improving safety and quality and asked recipients to comment on the options and to make additional suggestions. The questionnaire was divided into 7 sections. These were: (1) error learning, (2) hospital accreditation, (3) hospital information systems, (4) out of hospital information, (5) other hospital regulation, (6) doctors, and (7) system level reform. New proposals from the first round were added to the original list and returned to the experts for comment on their feasibility and potential impact. Specifically, they were asked in the second stage to rate on a six-point scale: (i) the potential effect of each proposal , (ii) how quickly they believe it could be implemented ), and (iii) the time before the option would be likely to have a major impact ). They were also asked to write comments on the proposals, including arguments for and against their adoption.Terminology in this area is not uniform. In articulating the proposals we adopted the preferred terms and definitions used by the ACSQHC . In partThe analysis was essentially qualitative, not quantitative, and hypothesis testing of the results is therefore not appropriate. The objective was to demonstrate the methodology, elicit potentially good ideas, and determine their feasibility according to the prevailing views of a group of experts. A single idea from a single person might be more fruitful than the shared beliefs of a majority. For this reason also, survey response rates, detailed respondent characteristics and representativeness of respondents are of little interest for the main purposes of the study.Of the 76 individuals to whom invitations were sent, completed results from both stages of the survey were obtained from 20. For the reasons noted above and discussed later this relatively low response rate does not invalidate the results or subtract from the potential value of the suggestions made.The first section dealt with error learning and mandatory disclosure. The proposals in this section were rated close to 'high' in terms of their potential effect. The highest score reported in Table Responses to proposals concerning the hospital accreditation and auditing process are summarized in Table The third section, summarized in Table Among other things, Table Section five dealt with other hospital regulation. , which progresses through increasingly more stringent regulatory measures , up to 'command and control' at the top . The pyramid consists of 27 'mechanisms', 14 of which fall within the general categories of 'voluntarism', 'market mechanisms' or 'self-regulation'. It is doubtful that these mechanism alone will have the desired effect, but rather that, for example, 'dependence on voluntary reporting systems will lead to a gross and inconsistent underestimate of the size of the problem' . The published research on 'high reliability organizations' suggests that it is wise to separate information-gathering and inquisitorial processes from punishment such as dis-accreditation. Adverse events are unlikely to be reported if there is a financial incentive to hide the AE. For this reason legislative protection of doctors from the financial outcome of litigation is a reasonable prerequisite for a comprehensive, on-going process of error learning. The consequences for a doctor associated with an AE should be based upon medical criteria and uncoupled from the social mechanism for compensating patients, except where damage occurs due to negligence. In brief, 'the challenge for health care is to shift from a blame culture to a learning culture, in order to learn from adverse events' , aFor decades health professionals have believed that a significant number of small hospitals are dangerous. However, with full knowledge of the QAHC results, hospital accreditation remains voluntary in all States except Victoria. Although most public and private hospitals undergo formal accreditation procedures, the danger of self-selection remains. Low quality hospitals will not opt for accreditation and poorly qualified doctors will seek out these hospitals. Multiple accreditation teams could have the power to randomly inspect all hospitals or units within hospitals and (in the most extreme cases) close those judged to be dangerous – as occurs with restaurants with sub-standard hygiene. The proposal that universal accreditation should be mandated was rated 'high' by our experts in terms of its potential effect (P2.1).In a written response to our survey, the Victorian Department of Human Services expressed the view that formal accreditation should occur on pre-arranged dates 'as this provides value in allowing hospitals to independently check, maintain, improve their systems prior to accreditation'. Another respondent thought the proposal unfeasible because 'hospitals take up to 12 months to self-evaluate'. Of course, non-random accreditation also allows hospitals 'to independently check, maintain, improve their systems prior to accreditation'. But the problem with accreditation on pre-arranged dates is that it may give an atypical picture of a hospital during the much longer non-review period. The time-consuming nature of the review process should not be underestimated but neither should the human cost of sub-standard hospitals. The Victorian DHS agrees that 'follow-up review and spot checks should be carried out on random dates'.It is unclear whether or not present accreditation is sufficiently rigorous to reduce preventable adverse events significantly. There appears little reason why the accreditation process should not itself be reviewed to ensure that credentialed hospitals satisfy rigorous safety standards in their facilities and procedures. The proposal that there should be a review of the criteria for achieving accreditation, and that the criteria should be expanded to include more stringent procedures relating to safety (P 2.2), received a high impact rating from our experts.To date, the majority of the reforms contemplated in government-commissioned reports represent process measures of success. However, their objective is to reduce adverse events and for this reason medical record analysis of the form conducted by the QAHC study should arguably be an on-going feature of the system. The QAHC study was relatively expensive, but these costs are small compared to the importance of the surveillance, the costs, the morbidity and the deaths averted. The proposal that the audit procedures used in the QAHC study should be introduced as a permanent feature of the public and private hospital systems, with mandatory auditing of identified high-risk hospitals, and random auditing of the remainder, was also judged favourably by our panel.In 2005 the new Australian Commission on Safety and Quality in Health Care commissioned an advisory group to examine what data might be used to create a national dataset. The advisory group considered whether the QAHC study might be repeated, but concluded 'that the major difficulty of achieving consistent and reproducible definitions of 'adverse event' and 'preventable adverse event' would seriously hinder accurate comparisons of any new study with those of the past' This is not to deny that there may be cheaper ways of gaining the same information than repeating the ACSQHC. For example, valuable information on adverse event rates can be obtained from routinely collected admissions data ,18,19, aPatient notes are still transferred within hospitals using 19th Century clipboards. It is known that this commonly causes potentially lethal errors. The mandated use of (long available) electronic forms of transmission could alert staff to the risk of inappropriate procedures, the administration of conflicting drugs or the failure to administer a drug. Likewise X-ray films are sometimes misplaced or lost. The consequences may again be lethal. Legislation could mandate the use of digital technology (with appropriate back-up systems and staff training) to ensure immediate access to results. New wireless technologies make it possible for roving staff – doctors and other professionals – to have constant access to text and basic technical data. There is no reason why much of the health system should have missed the IT revolution that has transformed other parts of the community. In relation to the size of the AE problem, the cost of implementing 21st Century information technology throughout the health system is likely to be small relative to the human and financial cost of AEs averted. Making it a condition of accreditation that 'all hospitals ... should have an appropriate internal information system for recording patient history, treatment (including drugs), digitized radiological imaging, pre- and post-discharge requirements' (P 3.1) was rated 'high' by our experts in terms of its potential effect.A persuasive argument can be made that the public has a right to information relating to the performance of hospitals and individual doctors, provided 'that it is of high quality and able to be benchmarked in a valid way' As noted, our respondents were circumspect on the question of public access to the safety record of hospitals and providers of medical care (P 4.2), and thought it would take several years before any measures along these lines would have a major impact. Several of those surveyed indicated a particularly long timeframe – ten years or more – one suggesting that data regarding risk-adjusted mortality and adverse event by cause are slow to identify problems, both requiring more than 7 years to gain statistical significance. As noted earlier, the rather negative response to this proposal might, in part, be attributable to a desire to keep problems and solutions 'in-house' rather than tarnish professional reputations through publicity. However, it is hard to reconcile this with the later support for whistle blowing among our panel, and a more likely explanation is a belief that the public is ill-equipped to deal appropriately with the information. For example, as the Victorian Department of Human Services commented: 'There is not a sufficient level of sophistication or understanding of risk-adjusted mortality and adverse event by cause to make the information available to the public'. Arguably, however, this indicates the need for simple presentation of data, the provision of explanatory notes and public education. There is little reason to believe the Australian public is less able to appreciate this type of information than the UK and the US public. The important lesson from the latter experience is that publication of this data has not resulted in a negative response from the public but appears to have provided motivation for professional self-improvement.More generally, access to data relating to health system performance, other than the material routinely published by government, is very difficult to obtain. As an example, access to Australia-wide, de-identified public hospital records requires the separate consent of all States and Territories as well as the co-operation of the Commonwealth Department of Health or AIHW . Data linkage to determine the consequences of different treatment patterns – who lives and who dies – is so difficult that the research is effectively proscribed for most researchers.There is no regulation that links on-site expertise and the complexity or riskiness of the procedures that may be undertaken in a hospital. For example, it is possible for a hospital to permit significant surgery but have no on-site medical practitioner post-operatively. It was not until 2003 that the ACSQHC released a paper considering issues of staff rostering, skill mix, staff numbers, staff supervision and team functioning . While eThe proposal that all hospitals should have in place a risk management system that ensures personnel can initiate action to prevent and/or reduce the impact of risks, backed up by whistle-blower procedures that guarantee anonymity and/or protection (P. 5.2), received a 'high' effectiveness rating from our respondents, and in fact now exists in many hospitals. In general, the potential role of staff in adopting 'affirmative action' to reduce AEs was viewed very positively. This included support for the idea that all hospital staff should be trained in risk management so that staff assume 'ownership' of safety and quality issues (P 5.4).Patterns of private practice are already subject to scrutiny in Australia. But the chief purpose is to detect medical fraud. Legislation could require the examination of practices to detect those that deviate significantly from evidence-based guidelines constructed by the relevant Royal Colleges. When there is a known relationship between the small number of procedures carried out by a doctor and negative outcomes, as occurs with some types of surgery, critical annual procedure rates may be established that trigger the provision of information to the doctor, the mandatory review of the practice and finally, in the most extreme cases, the dis-accreditation of the doctor for the conduct of these procedures, perhaps contingent upon re-training. While it is true that some doctors take on the hard cases, partial standardisation for case complexity is possible, and this would obviously be taken into account by those conducting a review. Along these lines, a detailed national standard for credentialing and defining the scope of clinical practice has been produced by the ACSQHC .The single proposal judged by our panel to have highest potential effect concerned the supervision and support of junior doctors (P 6.4). This was judged to be implementable within nine months and likely to have a major impact upon AEs within another seven months. Similarly, the proposal that all medical students who become interns should be 'credentialed' before being allowed to undertake any unsupervised procedures was rated high (P 6.3). While flawed systems and procedures are clearly implicated in the occurrence of AEs, these latter results suggest that human error plays an important role in the occurrence of AEs.Financial incentives are one of the most effective, non-coercive ways of achieving desired outcomes and numerous economic studies have demonstrated their effectiveness. In Australia there has been limited use of this powerful instrument and the financing of medical services has generally been perceived as a reward for providers doing what they select to do rather than as an opportunity for influencing what is done. This is an important missed opportunity. Financial incentives are non-coercive and avoid the head-to-head conflict between 'clinical autonomy' and the 'patient's right to evidence-based medicine' that may accompany direct regulation. The proposal that higher payments should be made throughout the public and private system for practices that are known to improve safety received a high potential effect rating, but with implementation and impact times stretching into years rather than months -29.Medical Journal of Australia article its Chairman comments: 'one might assume that systematic improvements within the health system are either happening or, at the least, well advanced. Regrettably, improvements are still patchy. The greatest challenge for all remains how to achieve universal and systemic changes to the health system within a federated system' Among our panel there was support for such leadership – for example, the establishment of a National Centre for The Development of Clinical Guidelines and Clinical Pathways, which would promote evidence-based practice, disseminate evidence-based clinical guidelines, and prepare model clinical pathways to assist hospitals plan and organise care.Our study was, in part, illustrative of what might have, but did not, happen following publication of the QAHCS. Ideally this would have involved a much larger-scale study, and have canvassed suggestions from any individual or group in a position to make useful suggestions.The reported research was conducted with a limited budget and with no 'official endorsement' – e.g. from the Australian Medical Association. This narrowed the number and range of those who could be surveyed. Unsurprisingly, the response rate was low . The options for reform suggested were general, not detailed, and the time-lines nominated were subjective. The scope and detail of the suggestions are necessarily more limited than would have been outlined with a large, official survey. However, the conclusion that any of these factors invalidates the research or undermines its credibility would miss the point of the study.The study was based on the belief that a single idea from a single person, irrespective of their authority, may contribute to a reduction in unnecessary deaths. The minimum acceptable sample size is '1' if the suggestions obtained are valuable. The antithesis of this approach is the view that action should be delayed until 'due process' has been followed, consisting of the agreement or consensus of appropriate authorities. The cost of such delay, however, is loss of life and permanent injury.Our survey was akin to an organised 'brain storming' exercise with feedback. Suggestions are a starting point, not an endpoint for policy reform and development. Likewise, the nominated time-lines are indicative of a view among some well-informed commentators that action following the QAHC study could have been significantly swifter. They do not purport to reflect objective data.While the low response rate is of limited methodological relevance it was disappointing. We expected that, given the gravity of the subject, we might have obtained a higher rate. Informal feedback suggested one likely reason. The authors, being social scientists, would be perceived as having little authority, credibility or legitimate role in the field of service delivery and safety; that their research should have been limited to cost-benefit analysis. This response may be indicative of a 'closed shop' culture: the safety of our health services is a matter for accredited medical experts operating from within approved institutions with approved channels for effecting reform – a suggestion also made by others The appropriate test of the validity of a method, in this area, is whether or not it elicits useful suggestions which have not, to date, been canvassed or carefully examined. Our incomplete reading of the literature suggests that our minimalist research effort indeed identified options with the potential for saving lives – and did so quickly and at little expense. If correct, this reveals a significant deficiency in the methods used over the past fifteen years for governance of quality and safety in Australia's hospital system.Relative to the size of the problem, the response to the QAHC study was very surprising, to say the least. The study authoritatively documented what was arguably the most dramatic and serious problem ever found in the health system – and possibly the nation as a whole. Annual deaths from AEs were initially estimated to be equivalent to 13 jumbo jet crashes each year, each resulting in 350 deaths: events that would surely have galvanized rapid and decisive action. The lack of effective action that followed publication of the QAHC study revealed a fundamental failure of governance by both the State and the Commonwealth governments and an apparent lack of willingness to respond appropriately at both the bureaucratic and political levels.In terms of the magnitude of death and injury involved, an analogy with a war casualty rate is not unjustified. In the face of ongoing casualties, decision makers in war time must exercise judgement and take responsibility for a rapid response. With an estimated 50 Australians dying daily and another 140 sustaining permanent injury, at the time of the QAHC study, the appropriate criteria for immediate action should have been 'likely cause' and 'likely solution' not 'confirmed, demonstrated cause' or 'solution based on professional consensus'. This type of decision making clearly did not occur in Australia following the release of the QAHC study.Historically, safety and quality control of the health system has relied on internal rather than external monitoring: 'the state generally has left the regulation of health care performance to the medical profession' Medical Journal of Australia in 2005, a member of the Council asked, 'Ten years on can we confidently state that healthcare is safer for patients?' and answered forthrightly, 'There is insufficient information at a state or national level to determine whether any or all of the efforts over the past 10 years have increased safety in our hospitals' [The ACSQHC faced numerous obstacles during its six-year tenure and workspitals' . The purThe authors declare that they have no competing interests.Both authors contributed equally to this work. |
The piperazinium dication lies on an inversion centre and adopts a typical chair conformation. In the crystal, a combination of N—H⋯O, N—H⋯Cl and O—H⋯Cl hydrogen bonds results in the formation of a three-dimensional network.In the title compound, (C DOI: 10.1107/S1600536809041063/su2149Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials: |
Deliberate self-poisoning with older pesticides such as organophosphorus compounds are commonly fatal and a serious public health problem in the developing world. The clinical consequences of self-poisoning with newer pesticides are not well described. Such information may help to improve clinical management and inform pesticide regulators of their relative toxicity. This study reports the clinical outcomes and toxicokinetics of the neonicotinoid insecticide imidacloprid following acute self-poisoning in humans.Demographic and clinical data were prospectively recorded in patients with imidacloprid exposure in three hospitals in Sri Lanka. Blood samples were collected when possible for quantification of imidacloprid concentration. There were 68 patients with exposure to imidacloprid. Of the self-poisoning patients, the median time to presentation was 4 hours (IQR 2.3–6.0) and median amount ingested was 15 mL (IQR 10–50 mL). Most patients only developed mild symptoms such as nausea, vomiting, headache and diarrhoea. One patient developed respiratory failure needing mechanical ventilation while another was admitted to intensive care due to prolonged sedation. There were no deaths. Median admission imidacloprid concentration was 10.58 ng/L; IQR: 3.84–15.58 ng/L, Range: 0.02–51.25 ng/L. Changes in the concentration of imidacloprid in serial blood samples were consistent with prolonged absorption and/or saturable elimination.Imidacloprid generally demonstrates low human lethality even in large ingestions. Respiratory failure and reduced level of consciousness were the most serious complications, but these were uncommon. Substitution of imidacloprid for organophosphorus compounds in areas where the incidence of self-poisoning is high may help reduce deaths from self-poisoning. Intentional self-poisoning with pesticides is an important public health problem in the Asia- Pacific region with an estimated 300,000 deaths occurring each year The neonicotinoids are a new major class of highly potent insecticides that are used for crop protection and flea control 50 of imidacloprid in rats is 475 mg/kg and the acute dermal LD50 exceeds 5000 mg/kg. It also does not cause eye irritation (rabbits) or skin sensitization (guinea pigs) Imidacloprid with MSMS detection (Applied Biosystems API2000) of imidacloprid (MRM 255.9/208.9) and internal standard d4-Imidacloprid (MRM 260.0/213.1) at 3.7 min. Separation of the imidacloprid peak was performed using Strata C18 (5 mm×2 mm) online solid phase extraction and Gemini (50 mm×2 mm) analytical columns (Phenomenex) using a standard valve configuration Biochemical analyses were conducted by Queensland Health Forensic and Scientific Services at Princess Alexandra Hospital, Australia. This service is accredited by the National Association of Testing Authorities, Australia and certified to International Standards (ISO 9001).Data were entered in to an excel sheet and analyzed using the statistical Program STATA IC 10.Over the 5 year period, 68 patients presented to study hospitals with a history of imidacloprid exposure. Seven cases were occupational dermal exposures, all of whom remained asymptomatic and were discharged within 24 hours of admission. Five patients reported co-ingestion with another pesticide and were excluded from further analysis, leaving 56 patients with acute imidacloprid self-poisoning.The median time to present to a study hospital since ingestion was 4 hours (IQR 2.3–6.0 hours). The median volume reported as ingested in self-poisoning was 15 mL (IQR: 10–50); although in 23 the volume ingested was unknown.The majority of patients (54/56) had only mild symptoms such as nausea, vomiting, headache, dizziness, abdominal pain, and diarrhoea during the hospital stay which was largely self-resolving. The median Glasgow Coma Score (GCS) on presentation was 15 (IQR: 10–15). There were no deaths giving a case fatality of 0% (95% CI: 0.0–5.2%). However, two patients developed more severe symptoms requiring management in an intensive care unit and are described in more detail below.th ICU day after 3 days of mechanical ventilation and discharged home 9 days post-ingestion with no apparent residual effects. During her recovery the patient reported a history of imidacloprid only. This was subsequently confirmed on laboratory testing of a blood sample obtained 5 hours post-ingestion when the plasma concentration of imidacloprid was 44.6 ng/L for agitation. At 16 hours after ingestion she developed a respiratory arrest requiring endotracheal intubation using atracurium 25 mg and midazolam 5 mg. She received an atropine infusion at 1.2 mg/hour and prophylactic cefuroxime 750 mg 8 hourly and metronidazole 500 mg every 8 hours for suspected pulmonary aspiration. On her second day in ICU, she became hypotensive which was treated with dopamine infusion. Other treatments included regular pralidoxime (1g every 6 hours) and chest physiotherapy. She was extubated on her 44.6 ng/L and the A 26 year old man presented to a peripheral hospital following ingestion of an unknown amount of imidacloprid under the influence of alcohol. He received forced emesis and atropine (3 mg bolus followed by infusion of 2 mg/hour) and was then transferred to one of the study hospitals. On admission to the study hospital (4.5 hours post-ingestion) he had vomiting, a regular pulse rate of 84/minute, blood pressure 100/80 mmHg, pupil diameter 6 mm bilaterally, respiratory rate 40/minute, pulse oximetry was 100% and GCS 3/15. The patient was transferred to the ICU 9 hours post-ingestion for closer monitoring. He received nebulised salbutamol and intravenous cefuroxime and metronidazole for prophylaxis against aspiration pneumonia. His clinical condition improved within 24 hours and he was discharged alive 3 days later. Blood samples were not available to confirm exposure in this patient.Of the 56 patients with imidacloprid self-poisoning, 13 patients provided serial blood samples, 38 patients provided a single blood sample, and 5 patients refused to give any samples. Blood samples from the first 33 cases were analysed as described and the results of imidacloprid quantification are shown in Imidacloprid was only detected in eight of the patients who provided serial blood samples but in one patient the plasma concentrations were all less than 0.3 ng/L. The concentration-time profiles for these seven patients are shown in Admission blood samples from the same 33 patients were screened for biochemical abnormalities. No major abnormalities were noted in terms of electrolytes, blood glucose, renal function and liver function tests. Minor abnormalities included median venous bicarbonate of 14 mmol/L (IQR 10–15 mmol/L) and the median anion gap was raised at 20 mmol/L (IQR 18–26 mmol/L). We were not able to perform arterial blood gases which might have confirmed the presence of high anion gap metabolic acidosis. Median creatine kinase (CK) was measured at 115 IU/L (IQR 75–124), which is within the commonly quoted reference range and troponin-I was not elevated.This is the only prospective human case series reporting outcomes from acute self-poisoning with the neonicotinoid insecticide imidacloprid. We demonstrated that imidacloprid self-poisoning resulted in mostly minor toxicity with a case-fatality of 0%. This is favourable compared to outcomes with other insecticides, in particular the widely used organophosphorus compounds which commonly have a case fatality between 5 and 30% Tachycardia and hypertension have usually been reported in previous cases, and recurrent ventricular fibrillation was the reported cause of death in a 69 year-old woman with coronary artery disease Biochemical abnormalities and rhabdomyolysis have been reported as potentially serious complications that might lead to mortality In animals, imidacloprid penetrates the blood-brain barrier to only a very limited extent There are no specific antidotes for neonicotinoid poisoning in mammals The concentration-time profile shown in Of the patients who provided serial samples, the final blood sample was generally obtained from patients around the time of discharge, when they appeared to be in good health. It is noted in Four deaths have been reported in the literature, and the post-mortem blood concentrations in two cases were 12.5 and 2.05 ng/L This study demonstrates that an acute ingestion of 20% SL formulations of imidacloprid, even following large ingestions in patients with self-poisoning, is relatively safe. Therefore, it may be advantageous to promote the use of imidacloprid or similar pesticides in areas where the incidence of self-poisoning is high. However, before this occur the relative risks and benefits of this insecticide (which has been debated)Imidacloprid pesticides appear to be of low toxicity to humans causing only mild symptoms such as vomiting, abdominal pain, headache and diarrhoea in the majority of cases. Large ingestions may lead to sedation and respiratory arrest. Patients with a low GCS should be closely monitored for onset of respiratory compromise but most patients only need symptomatic and supportive care. More research is required to show if the replacement in agriculture of older anti-cholinesterase pesticides with newer pesticides with much lower in-hospital case-fatality will lead to an overall reduction in deaths from self-poisoning. |
These pathologies share many fibrogenic pathways with an abnormal fibrous wound-healing process; consequently, tissue repair and tissue regeneration-regulating mechanisms are altered.Pirfenidone (PFD) is a molecule that exhibits antifibrotic properties in a variety of To investigate the usefulness of PFD as an antifibrotic agent in clinical and experimental models of fibrotic disease.There is a growing understanding of the molecular effects of PFD on the wound healing mechanism, leading to novel approaches for the management of fibrosis in lung, liver and renal tissues. Although the optimum treatment for fibrosis remains undefined, it is possible that combined therapeutic regimens that include this wide-application molecule, pirfenidone, could offer a useful treatment for fibrotic disease. Pirfenidone (PFD) is a pyridine(5-methyl-1-phenyl-2-(1H)-pyridone) with a simple chemical structure and cleared (t1/2 = 2 to 2.5 hours). Pharmacokinetic parameters after multiple doses were similar to those after single doses, and concomitant intake of food reduced by 20% the rate and extent of absorption, which are associated with better tolerability of PFD. No significant sex differences were noted for the pharmacokinetic variables. Rubino et al [max and the risk of AEs associated with the GI system, suggesting that food may reduce the risk of certain AEs associated with PFD administration, which may improve tolerability. In mice, Cho et al [ss) was 0.71 ml/g, indicating that moderate extravascular distribution occurred within 5 min, with the drug reaching the following areas in descending order: kidney, liver, ventricle, lung, spleen, pancreas, testes, GI system, brain, skeletal muscle, adrenal glands and epididymal fat pad. Two metabolites were identified, which seem to be produced from oxidation of the methyl group on the pyrilidone ring followed by subsequent formation of the carboxylic acid.Studies on the pharmacokinetics and metabolism of PFD conducted by Shi et al evaluateho et al observedBraim observedet al [In a sheep model, Bruss et al , observePFD has been tested in a variety of cellular and animal models of inflammation and fibrosis, and has been shown to hav eanti-inflammatory, antioxidative stress and antiproliferative properties. PFD is known to regulate key fibrotic cytokines and growth factors. It inhibits several inflammatory mediators, has an antioxidant effect, and restores immune response balance. Beneficial effects have been shown for PFD in the treatment of fibrotic disease, including renal, liver and pulmonary fibrosis and multiple sclerosis (MS), conditions that share the pathology of abnormal deposition of collagen, which is determinant of clinical outcome. In these fibrosis-related diseases, the amount of collagen deposited in the tissue is controlled by the balance between synthesis and degradation of collagen in extracellular matrix (ECM) by matrix metalloproteinases (MMPs), which are regulated by tissue inhibitors of metalloproteinases (TIMPs). In fibrosis, the positive balance to collagen synthesis is influenced by production of transforming growth factor TGFβ and other growth factors, which can be downregulated by PFD.et al., unpublished data).Currently, several clinical trials using PFD for various diseases have been completed; these include studies on pulmonary fibrosis associated with Hermansk-Pudlak syndrome, focal segmental glomerulosclerosis, idiopathic pulmonary fibrosis, hypertrophic cardiomyopathy, kidney disease in patients with diabetes, neurofibromatosis type 1, plexiform neurofibromas, and fibrosis caused by radiation therapy for cancer. In addition, an open-label study on the long-term safety of PFD in patients with idiopathic pulmonary fibrosis has been devised, and there are studies investigating use of PFD as a non-invasive treatment for uterine leiomyomas, its influence on heart function and exercise capacity in patients with hypertrophic cardiomyopathy, its usefulness as a permeability factor in focal segmental glomerulosclerosis [in vitro and in vivo models and the clinical trials in which PFD has been used as therapy. We summarize the main molecular mechanisms that are triggered by PFD -α is a vital component of the inflammatory process, and its aberrant overexpression has been linked to numerous inflammatory states. The anti-inflammatory role of PFD has been exhaustively examined in several models of inflammation. Administration of PFD significantly reduced secreted levels of bioactive and cell-associated TNF-α after stimulation with lipopolysaccharide .Finally, persistent injury results in a chronic wound healing response that eventually leads to fibrosis. This fibrotic response shares common features in multiple organs that can be affected by these disorders. Experimental evidence has indicated PFD as a collagen and TGF-β production blocker, and as an activator of MMPs, thus modulating the fibrogenic pathway .A number of studies have been designed to assess the molecular mechanism and the clinical efficacy and safety of PFD when administered to treat lung diseases, including interstitial pulmonary fibrosis, the experimental bleomycin (BL) model of lung fibrosis, and several models of acute lung injury. This group of disorders is characterized by scarring of deep lung tissue, leading to shortness of breath and loss of functional alveoli, thus limiting oxygen exchange. Etiologies include inhalation of inorganic and organic dusts, gases, fumes and vapors, use of medications, exposure to radiation, and development of disorders such as hypersensitivity pneumonitis, coal worker's pneumoconiosis, silicosis and byssinosis (occurs after exposure to cotton dust), among others.in vitro lung models; PFD has been shown to diminish these pathological states. For example, PFD suppressed Hermansky-Pudlak syndrome (HPS)-1, alveolar macrophage cytokine and chemokine secretion in vitro in a dose-dependent manner [in vitro and in vivo, and the proliferation index of both CD4 and CD8 was reduced. Additionally, PFD inhibited TCR-induced production of multiple pro-inflammatory cytokines and chemokines. Interestingly, there was no change in TGF-β production by purified T cells, and PFD had no effect on the suppressive properties of naturally occurring regulatory T cells [Recently, it has been proposed that lung fibrosis is caused in part by chronic oxidative stress and inflammation. Increased production of reactive oxygen species (ROS), which leads to lipid peroxidation, oxidation of DNA and proteins, and activation of pro-inflammatory factors, has been observed in several t manner PFD was T cells In addit T cells .Since the first studies on PFD in lung fibrosis, several recent experimental and clinical trials have provided evidence of its role in decreasing fibrogenesis in the lung. Interstitial pulmonary fibrosis is the result of a wide variety of injuries to the lung, and involves inflammation, increase in cytokine levels, infiltration of immune cells and increase in ECM production in response to proliferating lung fibroblasts ,28, leadet al. [in vitro, suggesting that it must be acting at the transcriptional level. As a continuation of this work, Iyer et al. [Iyer et al. demonstrr et al. measuredr et al. .Furthermore, it was demonstrated that PFD treatment inhibited synthesis of both platelet-derived growth factor (PDGF)-A and -B isoforms by lung macrophages , reducedIn antigen-induced allergic models, sensitized mice or guinea pigs developed a prominent pulmonary inflammation 24 h after antigen challenge, reflected by a significant increase in the number of recoverable total cells and eosinophils in BAL samples. In both species, pretreatment with PFD (10 and 30 mg/kg) resulted in a dose-dependent inhibition of antigen-induced pulmonary inflammation, which was reflected by a significant decrease in eosinophils and total cells in BAL samples with the 30 mg/kg dose. In a non-allergic model of pulmonary inflammation, rats challenged with intratracheal LPS had a significant increase in neutrophils and total cells in BAL samples, along with significant increases in TNF-α and IL-6. Pre-treatment with PFD (3 and 30 mg/kg) showed a dose-dependent inhibition of the LPS-induced pulmonary inflammation, reflected by a significant decrease in the number of total and neutrophilic cells in BAL samples at both doses. Thus, PFD can inhibit allergic and non-allergic inflammatory cell recruitment, and its pulmonary anti-inflammatory activity is independent of TNF-α inhibition .Idiopathic pulmonary fibrosis is the most common form of interstitial lung disease, and is characterized by chronic progressive pulmonary parenchymal fibrosis. It is a progressive clinical syndrome with unknown etiology; the outcome is invariably fatal as no effective therapy exists.et al. [PFD has been evaluated for its tolerability and usefulness in patients with advanced idiopathic pulmonary fibrosis and other lung diseases. Most reported a few nonsignificant adverse effects (AEs), and found that the drug is generally well tolerated. Raghu et al. investig2) during a 6-minute exercise test. The primary endpoint from baseline to 6 months was not significantly different, but in a subset of patients who maintained a SpO2 of > 80% during the 6-minute exercise test at baseline, there was a significant difference in SpO2 in the PFD group at 6 and 9 months. PFD also enhanced percentage vital capacity, and episodes of acute exacerbation of IPF occurred exclusively in the placebo group [In a double-blind, randomized, placebo-controlled trial (RPCT), the effects of PFD were measured by the change in the lowest oxygen saturation by pulse oximetry for up to 44 months in an RPCT changed pulmonary function values. Reduction in predicted forced vital capacity (FVC) each year was 5% slower in 11 PFD-treated patients than in 10 placebo-treated patients. Using data restricted to patients with an initial FVC of > 50% of predicted values, patients in the PFD group lost pulmonary function at a slower rate (> 8%/year) than the placebo group. PFD appears to slow the progression of pulmonary fibrosis in patients with HPS who have significant residual lung function [Given the lack of effectiveness of current therapy in treating patients with IPF, these different points of evidence suggest that PFD might be a useful treatment for this deadly disease.Liver fibrosis occurs as a consequence of ECM accumulation, mainly of collagen types I and III, in response to liver injury. This is triggered by the activation of hepatic stellate cells (HSC), which change to a myofibroblast-like phenotype, with a consequent increase in their synthesis of matrix proteins that characterize fibrosis, such as interstitial collagens . In addi+H+ exchanger involved in PDGF-induced HSC proliferation. PFD also inhibited PDGF-induced protein kinase C activation, type I collagen accumulation and procollagen mRNA expression [In rat HSC, PFD at 1000 μM inhibited PDGF-induced HSC proliferation, without any toxic effects. It also did not affect HSC viability and did not induce apoptosis. The inhibition in cell proliferation was not associated either with variations in PDGF receptor autophosphorylation, or with activation of extracellular signal-related kinase (ERK)1/2 or of the 70 kDa ribosomal S6 kinase (pp70S6K), but PFD was able to inhibit PDGF-induced activation of the Napression .2O2 and chelating iron; however, in a deoxyribose degradation assay; PFD was a potent scavenger of hydroxyl radicals, which could be related to its beneficial effects [In sheep liver microsomes, PFD was found to be ineffective as a superoxide radical scavenger and in decomposing H effects .4)), significantly decreasing levels of alanine aminotransferase (ALT), aspartate aminotransferase and alkaline phosphatase compared with saline-treated animals. Fibrotic areas reduced by 50% in 4-week BDL rats, and by 70% in a CCl4 model, along with hydroxyproline levels. The number of activated HSC decreased, and there was a reduction in gene expression of collagens I, III and IV, TGF-β1, Smad-7, TIMP-1 and plasminogen activator inhibitor (PAI)-1.PFD provides a unequivocal protective anti-inflammatory effect against acute hepatic injury caused by D-galactosamine/LPS in rats by inhibiting elevated TNF levels and IFN-γ, and reducing the induction of inducible nitric oxide synthase (iNOS)/nitric oxide (NO) , partly It has been shown that PFD maintains its antifibrotic properties when administered after hepatic damage has already occurred. Rats treated with dimethylnitrosamine 10 mg/kg for 5 weeks received a liquid diet containing 0.5% PFD starting from the third week. The PFD treatment reduced the degree of liver injury, as determined by ALT values and necroinflammatory score, which was associated with reduced HSC proliferation and collagen deposition. Treatment with dimethylnitrosamine produced a fold increase in transcript levels of TGF-β1, TIMP-1 and MMP-2 of seven, seven, four and 15, respectively. PFD downregulated the elevated levels of these transcripts by 50 to 60%, which was associated with a 70% reduction in collagen deposition and downregulation of TGF-β1 and of MMP-2 mRNA, the two substances mainly implicated in the degradation of normal ECM .4 models of liver cirrhosis, PFD treatment caused a reduction in inflammation and in hepatic enzymes and bilirubin concentrations. It also downregulated TGF-β1 and collagen I-α(COL1A1) genes [in vivo compared with a well-known broad-spectrum antioxidant such as diphenyleneiodonium. The antioxidant capacity of PFD produced a 28% and 30% reduction, respectively, in nitrite and malonyldealdehide concentrations in the bile duct ligation model, and 52% and 38% in the CCl4 model. Furthermore, PFD downregulated gene expression of superoxide dismutase (SOD), catalase (CAT) and iNOS. The functional activity of SOD and CAT also decreased after PFD administration, raising the possibility of using PFD for diseases accompanied by oxidative stress.In bile duct ligation and CCl1) genes . In addiOwing to the wide range of etiologies that lead to fibrogenesis in the liver, specific and effective therapies for each kind of fibrosis remain elusive . FurtherFibroblasts are activated in tubulointerstitial injury and their presence is a marker of disease progression. A well-characterized model of experimental renal disease is the unilateral ureteral obstruction (UUO) which culminates in tubulointerstitial fibrosis.Cortical fibroblasts isolated from kidneys 3 days after UUO were exposed to increasing PFD concentrations, which produced a decrease in cell proliferation, α-smooth muscle actin and connective tissue growth factor protein expression, although synthesis of collagen was unaffected by PFD .Using five-sixths nephrectomy rat model, the effect of PFD on the progression of chronic renal failure was examined. PFD-treated rats had inhibition of TGF-β1, type IV and I mRNA collagen expression .With the UUO model, rats had upregulation of mRNA for collagen types I and IV, MMP-2 and TGF-β1. In addition, a progressive increase in hydroxyproline content was observed in the post-obstructed kidney despite the release of obstruction, but these increases were suppressed by PFD. Thus PFD can attenuate both renal fibrosis and renal damage in this model, and therefore could be clinically useful for preventing progressive, irreversible renal failure .One more animal model in which the antifibrotic properties of PFD were observed was the model of chronic nephrotoxicity induced by ciclosporin (CsA), which is characterized by tubulointerstitial fibrosis. Treatment with PFD ameliorated CsA-induced fibrosis by about 50%. PFD was associated with a decrease in TGF-β1 expression, which in turn was associated with a decrease in matrix deposition .Additional proof of reduction in ECM by PFD was observed in mouse mesangial cells, in which PFD decreased TGF-β promoter activity, reduced TGF-β protein secretion, and inhibited TGF-β-induced Smad2-phosphorylation, 3TP-lux promoter activity and generation of ROS. In addition, PFD treatment significantly reduced mesangial matrix expansion and expression of renal matrix genes. Thus, the renoprotective and antifibrotic PFD effects could be related, at least in part, to its inhibition of RNA processing .Streptozotocin (STZ)-induced diabetic rats treated with PFD and spironolactone showed both reversal in deposition of major ECM proteins, collagen and fibronectin, and a number of functional changes. Fibrosis leads to chronic impairment of cardiac and renal function, thus reversal of existing fibrosis may improve function and survival. Short-term treatment with PFD and spironolactone reversed cardiac and renal fibrosis and attenuated the increased diastolic stiffness, but without normalizing cardiac contractility or renal function in STZ-induced diabetic rats .The ability of PFD to reverse markers of renal dysfunction in rats was also tested. Tacrolimus-induced nephrotoxicity is thought to contribute to renal allograft dysfunction and subsequent failure, a process that is underpinned by alterations in mRNA expression of genes involved in matrix metabolism. PFD caused a decrease in collagen III and TIMP-1 mRNA expression, suggesting that it could attenuate the limited fibrotic potential of tacrolimus .PFD and the angiotensin II type I receptor antagonist candesartan cilexetil, given alone or in combination, were tested in rats with chronic antiglomerular basement membrane glomerulonephritis (anti-GBM GN). The combination of both agents produced an improvement in adsorption droplets and proteinuria in the glomeruli, and cortical collagen I mRNA expression was also significantly decreased. Rats treated with PFD had blood pressure values similar to control rats. Thus, the beneficial effects of PFD on morphological changes in anti-GBM GN were comparable with those of candesartan, and these results suggest an additive effect of combination treatment .In a model of spontaneous progressive glomerulosclerosis using FGS/Kist mice, PFD was evaluated for the prevention of renal fibrosis; proteinuria levels were lower in the PFD group compared with the control diet group The sclerosis scores of the PFD groups at 3 months were also reduced. There was no significant difference between the PFD and control diet groups after treatment for 1 or 2 months, but there was a significant difference after treatment for 3 months, suggesting that long-term administration of PFD is required to suppress the progression of glomerulosclerosis and improve renal function in the FGS/Kist mice .In a vanadate-induced kidney fibrosis model in rats, the antifibrotic effects of PFD were also seen. Treatment with PFD reduced vanadate-induced increases in kidney weight, RNA content and hydroxyproline levels. Histological evaluation revealed that the severity of the lesions in the vanadate-treated group was 'moderate to severe' before treatment with PFD; after treatment with PFD for 41 days, the severity decreased to 'mild'. The collagen content of the kidney was also reduced after PFD treatment .Finally, PFD produced a modulation of apoptosis mediators in a chronic CsA-induced nephrotoxicity animal model. PFD reduced the number of apoptosis-positive cells induced by CsA. In addition, PFD downregulated mRNA expression of CsA-induced p53 and Fas-ligand and increased that of Bcl-xL, which had previously been reduced by CsA. PFD significantly downregulated caspase 3 expression, mostly on renal tubular epithelial cells. Because apoptosis could partly explain the loss of cells associated with fibrosis, the influence of PFD on apoptosis-regulatory genes to cause a reduction in apoptosis may explain some of its antifibrotic properties .2 at baseline to -0.45 ml/min per 1.73 m2., a median improvement in the rate of decline of 25%. It was concluded that PFD slows renal function decline in patients with focal segmental glomerulosclerosis [PFD was tested in patients with focal segmental glomerulosclerosis. The monthly change in estimated glomerular filtration rate (GFR) was compared between baseline and after treatment. Patients received angiotensin antagonist therapy if tolerated. In total, 18 patients completed a median of 13 months of PFD treatment; the monthly change in GFR improved from a median of -0.61 ml/min per 1.73 mclerosis .Details of the clinical trials that used pirfenidone for various fibrotic diseases are listed in Table et al. [It was also observed that PFD reduces AEs such as capsule contracture in mammary implants in an animal model, Gancedo et al. observedIt has been shown that PFD reduces keloid formation in an animal model. A keloid is a type of scar with mainly type I and some type III collagen, which results in an overgrowth of tissue at the site of a healed skin injury. Keloids should not be confused with hypertrophic scars, which are raised scars that do not grow beyond the boundaries of the original wound. In athymic nude mice (nu-nu), PFD significantly reduced the weight of keloid implants weight compared with control implants at 60 and 90 days after implantation. PFD may cause increased degradation and absorption of keloid tissue .Our own clinical data has demonstrated that a scar reduction gel with 8% PFD topically administered during a 6-month period led to resolution of hypertrophic scars acquired after burns in pediatric patients. There was a significant improvement after treatment in all patients: 27.27% had a decrease of 55%; 66.66% a decrease of 30 to 45%, and the remainder a decrease of ≤ 30%, according to the Vancouver scar scale .Pesce E comparedsecondary progressive MS that stabilize or reverse the neurological disabilities associated with this disease. Oral PFD was found to stabilize and overcome the symptoms of secondary progressive MS in a phase II double-blind RPCT in patients who had advanced secondary progressive MS that had been present for at least 12 months. After 1 month of treatment with PFD, patients had improvement in their Scripps Neurological Rating Scale (SNRS) scores, and scores remained significantly improved for 3, 6 and 12 months compared with baseline SNRS scores. By contrast, the SNRS scores of patients on oral placebo were not significantly improved compared with baseline scores [Currently, there are no approved treatments for e scores .The advantages of PFD clearly exceed any possible AE ascribable to this drug. It obviously had powerful antifibrotic properties, as it can reduce oxidative, inflammatory and pro-fibrogenic markers. As many therapeutic agents target only one of these types of markers, but still produce a reduction in, PFD seems to be a particularly valuable drug. Thus, this agent could be as a promising drug not just in animal models, but also in clinical studies of fibrotic diseases, and eventually as a therapy for such diseases.The authors declare that they have no competing interests.in vivo and in vitro liver research with PFD, and contributed to the manuscript writing. AS-R wrote the lung section and made style and syntax changes to the manuscript. JN-P revised the manuscript, JA-B led the group working with PFD and oversaw the manuscript writing and style. All authors read and approved the final manuscript.JM-B carried out the |
Acute cholangitis is associated with a high mortality and morbidity and often requiresdrainage of the obstructed biliary system. The purpose of this study was to evaluate theusefulness and safety of endoscopic nasobiliary drainage in the treatment and preventionof acute cholangitis due to diverse etiology. During a 32-month period, 143 patients with age range of 15 to 84 years underwent urgent fluoroscopyguided endoscopic nasobiliary drainage using a 7 Fr catheter either to treat acutecholangitis not responding to antibiotics or to prevent its developmentfollowing endoscopic retrograde cholangiography performed in an obstructed biliarysystem . Underlying etiology included bile duct stones (92), malignantbiliary obstruction (34), choledochal cyst (4), chronic pancreatitis (4), ruptured hydatidcyst (3), portal hypertensive cholangiopathy (3) and liver abscess (3). Endoscopicnasobiliary drainage was performed successfully in 129 patients (90.2%). Cholangitisimproved within 1 to 3 days (in group A) or did not develop (in Group B) in 125 patients(96.7%) with successful endoscopic nasobiliary drainage. Two patients however requiredadditional drainage by percutaneous transhepatic route, while two died inspite of effectiveendoscopic drainage. Of the 14 patients (9.8%) with failed endoscopic drainage, 9 weremanaged by surgical decompression or percutaneous transhepatic drainage, 3 died ofsepticemia. Endoscopic nasobiliary drainage is a safe and effective method to treatpatients with acute cholangitis as well as to prevent its development followingcholangiography performed in an obstructed biliary system. |
Drosophila D-Mel2 cells, a subline of the Schneider S2 cell line. This approach identified multiple novel substrates for the fly caspases and revealed that bicaudal/βNAC is a conserved substrate for Drosophila and mammalian caspases. RNAi-mediated silencing of bicaudal expression in Drosophila D-Mel2 cells resulted in a block to proliferation, followed by spontaneous apoptosis. Similarly, silencing of expression of the mammalian bicaudal homologue, βNAC, in HeLa, HEK293T, MCF-7 and MRC5 cells also resulted in spontaneous apoptosis. These data suggest that bicaudal/βNAC is essential for cell survival and is a conserved target of caspases from flies to man.Members of the caspase family of cysteine proteases coordinate cell death through restricted proteolysis of diverse protein substrates and play a conserved role in apoptosis from nematodes to man. However, while numerous substrates for the mammalian cell death-associated caspases have now been described, few caspase substrates have been identified in other organisms. Here, we have utilized a proteomics-based approach to identify proteins that are cleaved by caspases during apoptosis in Members of the caspase family of cysteine proteases are involved in coordinating the terminal events of apoptosis in organisms as divergent as nematodes and mammals Caenorhabditis elegans was instrumental in the initial discovery of a role for caspases in cell death control While numerous substrates for human and mouse caspases have now been identified Drosophila and, of these, Dronc and DrICE appear to play particularly significant roles in the coordination of programmed cell death in this organism Because the phenotype of cells undergoing apoptosis in flies and mammals share remarkable similarities Drosophila caspases, DIAP1, Lamin DmO, and the Drosophila Apaf-1 homologue, ARK, have been identified Drosophila, and to identify caspase substrates that are conserved between species, we have conducted a proteomics-based screen to search for proteins that undergo caspase-dependent proteolysis during apoptosis of Drosophila D-Mel2 cells. This analysis resulted in the identification of 14 proteins that underwent caspase-dependent alterations to their relative mobilities on two-dimensional (2D) SDS-PAGE gels. We have cloned two of these substrates and confirm that they are efficiently cleaved by the Drosophila caspases DrICE and DCP-1. We also show that the human homologue of one of these substrates, bicaudal, is also cleaved by caspases during apoptosis of mammalian cells. Bicaudal and its human homologue, βNAC, appear to be essential for cell proliferation and cell survival as RNAi-mediated silencing of the expression of these proteins resulted in a block to cell division, followed by spontaneous apoptosis. This suggests that, as well as targeting substrate proteins that contribute to the ordered destruction of the cell, caspases also inactivate key proteins such as βNAC that are essential for cell survival.At present, three substrates for To search for substrates for the fly caspases, we used a subline of the Schneider (S2) cell line, D-Mel2, that can be induced to undergo apoptosis in response to many of the same stimuli that promote apoptosis in mammalian cells. D-Mel2 cells exposed to staurosporine, actinomycin D, etoposide or cycloheximide died rapidly , and disTo identify caspase-dependent alterations to the D-Mel2 proteome, we compared two-dimensional protein spot patterns from D-Mel2 cells induced to undergo apoptosis in the presence or absence of z-VAD-fmk . ApproxiProteins that underwent caspase-dependent proteolysis during apoptosis of D-Mel2 cells were identified by MALDI-TOF mass spectrometry . The 14 Drosophila caspases, we generated polyclonal antibodies against these proteins and used these to probe cell lysates prepared from healthy versus apoptotic D-Mel2 cells. As illustrated in in vitro transcribed and translated forms of bicaudal and stubarista were incubated in cell-free extracts generated from apoptotic versus untreated D-Mel2 cells that gene silencing may not faithfully reproduce. It is also important to note that expression of non-cleavable β-NAC in human cells did not give rise to any obvious change in the apoptotic phenotype (data not shown). This suggests that caspase-dependent proteolysis of β-NAC does not contribute to any obvious morphological feature of apoptosis. However, we propose that at least two functional categories of caspase substrates may be important in apoptosis. One category of caspase substrates may contribute to specific morphological features of this mode of cell death. Examples of such substrates include ICAD, the inactivation of which results in activation of the CAD endonuclease that contributes to apoptosis-associated DNA hydrolysis In line with this, here we have shown that interference with βNAC expression levels in Drosophila cell line. Clearly, numerous additional substrates for the fly caspases are likely to exist but will require techniques that penetrate deeper into the fly proteome to identify these. However, our study provides direct evidence that caspases most likely coordinate apoptosis in divergent organisms through cleaving overlapping cohorts of cellular substrates.In summary, here we have provided the first snapshot of the proteins that become targeted for proteolysis by caspases during programmed cell death in a Drosophila Lamin DmO and Actin were purchased from the Developmental Studies Hybridoma Bank (USA). Polyclonal antibodies to Drosophila Bicaudal and Stubarista were generated by repeated immunization of rabbits with recombinant polyhistidine-tagged forms of these proteins. Recombinant polyhistidine-tagged Bicaudal and Stubarista were expressed and purified from bacteria (data not shown). The peptides, z-VAD-fmk, Ac-DEVD-AFC, Ac-LEHD-AFC, and Ac-YVAD-AFC were all purchased from Bachem (UK). 17 cm IPG strips (pH 3–6 and pH 5–8), easymelt agarose and Bio-Lyte ampholytes™ were purchased from Biorad (UK). Unless otherwise indicated, all other reagents were purchased from Sigma (Ireland) Ltd.Antibodies specific to Drosophilia melanogaster embryos 2 in serum-free medium . HeLa and MRC-5 cells were cultured at 37°C in RPMI 1640 containing 5% foetal calf serum and HEK293T cells were cultured in DMEM containing 10% foetal calf serum.The S2 subline, D-Mel-2, are a subline of Schneider S2 insect cells isolated from late stage To quantify levels of apoptosis-associated cell shrinkage and fragmentation, forward scatter (FSC) and side scatter (SSC) of cell populations were measured by flow cytometery .Drosophila D-Mel-2 cells were prepared by allowing cells to swell for 20 minutes on ice in CEB containing 250 mM sucrose . Cells were then lysed by homogenization with ∼20–30 strokes of a B-type pestle and crude extracts centrifuged for 15 mins at 15,000 g to remove nuclei, unbroken cells and other debris. Extracts from human cells were prepared as described previously Cell-free extracts of For 2D gel electrophoresis, cells were lysed in 2D sample buffer and were rehydrated into 17cm IPG strips (BioRad). Passive sample rehydration into IPG strips was performed at room temperature overnight. Isoelectric point focussing (IEF) was performed in a BioRad Protean IEF Cell under the following conditions: (1) linear voltage ramp to 500 V over 1 hr, (2) 5 hr at 500 V, (3) linear voltage ramp to 3500V over 5 hr and (4) 12 hr at 3500 V. Following IEF, the IPG strips were reduced and alkylated with 2% DTT and 2.5% IAA, respectively, in 5 min incubations in an equilibration buffer containing 6M Urea, 375 mM Tris HCl, pH 8.8, 2% SDS and 20% Glycerol. Strips were then mounted on 12% SDS-PAGE gels using easymelt agarose and electrophoresed at 37.5 mA per gel in a Biorad Protean IIxi electrophoresis cell . 2D gels were either Coomassie-blue stained or stained using a Mass Spectrometry-compatible silver staining protocol that is based on a modification of the EMBL silver staining protocol 3Fe(CN)6, 50 mM Na2S2O3) until the spots were completely destained. Gel pieces were then washed 5 times (5–10 min per wash) in 50% methanol/10% acetic acid. Samples were then incubated in 50 mM NH4HCO3 for 5 minutes, prior to dehydrating in 100% acetonitrile. To further dehydrate the pellets, the acetonitrile was aspirated off and samples were spun in a speed-vac (ThermoSavant) for 5 minutes at room temperature. For trypsin digestion, a 100 µg/ml aliquot of Sequencing grade trypsin (Roche) dissolved in 1 mM HCl was diluted 1∶10 in digestion buffer . Typically, for low abundance silver stained spots, 2 µl of trypsin solution (20 ng) was pipetted directly unto the desiccated gel piece. After allowing the gel piece to rehydrate for 5 minutes, a further 10 µl of digestion buffer was added and samples were incubated overnight at 37°C. Following trypsin digestion, peptides were extracted twice into 40 µl 66% acetonitrile/0.1% trifluoroacetic acid in a sonicating water bath, followed by lyophilization in a speed-vac at room temperature.Protein spots were manually excised from 2D gels. Gel pieces were incubated at room temperature on a shaking platform in oxidation buffer were applied to a Teflon-coated 96-well MALDI target plate , followed by the addition of 0.5 to 1 µl of a 10 mg/ml matrix solution of α-cyano-4-hydroxy-cinnamic acid in 60% acetonitrile/0.1% trifluoroacetic acid. Samples were allowed to air-dry at room temperature before analysis in positive reflectron mode in a Voyager DE Pro MALDI mass spectrometer .Site-directed mutagenesis was carried out using the Quickchange kit (Stratagene). All plasmids were verified by DNA sequencing.DCP-1 and DrICE were expressed in BL21 cells as polyhistidine-tagged fusion proteins and were purified over Nickel-NTA agarose followed by elution with 100 mM imidazole. Both proteases demonstrated robust proteolysis of the synthetic peptide substrate DEVD-AFC and their activities were normalized using this peptide.Drosophila cell-free extract were typically assembled in a final volume of 100 µl. Following incubation at 37°C for 15 min, 2.5 µl samples were diluted to a final volume of 200 µl in WCEB containing 50 µM Ac-DEVD-AFC. Samples were then measured in an automated fluorimeter at wavelengths of 430 nm (excitation) and 535 nm (emission).Reactions containing recombinant caspases or 35S-methionine-labelled proteins were generated using the TNT kit (Promega) as described previously Drosophila was achieved using double-stranded RNA transcripts generated from the coding sequences of diap-1, bicaudal and dronc. All dsRNAs were generated using the Megascript kit followed by purification of RNA using ethanol precipitation. For gene-silencing, ∼15 µg of dsRNAs were transfected into D-Mel2 cells followed by incubation for 72 h. For siRNA-mediated gene silencing, 21 base long oligonucleotides were generated to match the target sequence and were transfected into mammalian cells using oligofectamine . siRNA oligos were transfected at 200 nM, followed by incubation for 48–96 h.RNAi-mediated silencing of gene expression in 2O. Specific RNAs were then reverse-transcribed to cDNAs using the Omniscript kit (Qiagen) and analysed by electrophoresis through agarose gels.To confirm knockdown following transfection with dsRNA, RNA was extracted from cells by lysis in RNeasy lysis buffer with 1% β-mercaptoethanol, followed by addition of an equal volume of 70% ethanol. Lysates were applied to RNeasy columns (Qiagen) and eluted with ddHThe images presented in |
Hereditary erythermalgia is a painful and debilitating genetic disorder associated with mutations in voltage-gated sodium channel Nav1.7. We have previously reported a Canadian family segregating erythermalgia consistently with a dominant genetic etiology. Molecular analysis of the proband from the family detected two different missense mutations in Nav1.7. In the present study we have performed a long-term follow-up clinical study of disease progression in three affected family members. A more extensive molecular study has also been completed, analyzing the segregation of the two missense variants in the family. The two variants segregate independently with respect to clinical presentation. Detailed genotype/phenotype correlation suggests that one of the two variants (L858F) is causal for erythermalgia. The second variant (P610T) may modify the phenotype in the proband. This is the second reported study of potential compound heterozygosity for coding polymorphisms in Nav1.7, the first being in a patient with paroxysmal extreme pain disorder. A Canadian family segregating erythermalgia as an apparent dominant genetic trait was originally ascertained and reported in 1979. One broWe have now revisited the affected family members in a long-term clinical follow-up see Fig. .Proband (III/3): The proband is a female now 43-years-old. She has continued to suffer extremely debilitating episodes of pain. On a scale of 1–10, with 10 the most extreme, she reports her pain as 10 in the absence of mitigating treatments. She has had no further amputations since the original ones at age 14. She reports burning, redness and pain in hands, arms and legs (above the amputations) as well as eartips, but not her nosetip. She does not suffer diarrhea. Symptoms are provoked by exercise or warm temperatures or use of bed sheets, and are more common during summertime. She is unable to wear shoes, and unable to work. Symptoms are incompletely alleviated by application of cold water or ice, air conditioning, elevation of the painful extremity, or by treatment with some medications.Brother (III/1): The oldest brother is now age 49. He reports having symptoms from birth, with burning and reddened hands and ears. Both legs were partially amputated at age 20, he continues to experience symptoms in the legs in the vicinity of the stumps. Symptoms are provoked by heat or use of bed sheets and are alleviated by application of ice or use of a ventilator. He does not wear shoes and symptoms interfere with his ability to work or leave the home. He does not use pain medication.Brother (III/2): The second brother is now age 48. He reports having symptoms from birth, with reddened and burning painful hands, feet, and ears. He reports warm and reddened but not painful nosetip. On a scale of 1–10 he reports pain at 8–9. He has suffered no amputations but has discolored and ulcerated skin in the affected regions. Symptoms are provoked by heat, exercise or use of bed sheets, and increase during summertime. He employs a ventilator but not ice or ice water for alleviation of symptoms. He does not wear shoes. He has worked sporadically and has experienced difficulties with adapting to inflexible work and school environments. Alcohol use exacerbates symptoms.Overall, although it is difficult to assess given the subjective nature of painful sensation, the proband appears to experience significantly greater pain and discomfort than her two siblings. This is based on the patients reports according to a numeric rating scale, the need for stronger medication and the requirement for amputations at a young age. The development of a near fatal case of hypothermia resulting from attempts to cool the extremities in a search for relief is also suggestive of more severe pain.Mother (II/1): The proband reports her mother was affected with symptoms from childhood, but the mother was unavailable for direct clinical examination.In the original molecular study of this family the entire coding region of Nav1.7 was sequenced in DNA from the proband. Two missense mutations were reported, at nucleotides C1828A and C2572T, corresponding to amino acid changes P610T and L858F respectively. We have now performed mutation analysis for these two variants in all available family members, including the affected mother, three affected and two unaffected siblings . Particularly in the case of erythermalgia, there is an extensive literature on other causes of the condition, although in most cases a potential genetic etiology was probably not explored or even discussed. So far,The authors declare that they have no competing interests.Dr. S coordinated the study and drafted the manuscript, Dr. D supervised molecular genetic experiments, RtM performed molecular genetic experiments, Dr. L performed clinical studies of the patients. All authors have read and approved the final manuscript.Approval for this project was obtained from the research ethics board of the Queen Elizabeth II hospital at Dalhousie University. Written informed consent was obtained from the patients for the work and for this publication. |
The use of hydride generation is often useful in environmentalanalysis. The normal acid sodium tetrahydroborate reactionprovides exceptional sensitivity with continuous flow hydridegenerators. In some situations there are interferences which willmask the sensitivity. An alternative chemistry system is describedhere and is shown to offer similar sensitivity to that normally used.A commercial continuous flow analyser is used in this work. |
Chronic obstructive pulmonary disease (COPD) is a major public health problem. The aim of this study was to identify genes involved in emphysema severity in COPD patients.Gene expression profiling was performed on total RNA extracted from non-tumor lung tissue from 30 smokers with emphysema. Class comparison analysis based on gas transfer measurement was performed to identify differentially expressed genes. Genes were then selected for technical validation by quantitative reverse transcriptase-PCR (qRT-PCR) if also represented on microarray platforms used in previously published emphysema studies. Genes technically validated advanced to tests of biological replication by qRT-PCR using an independent test set of 62 lung samples.p < 0.01). Fifty-one of those genes had been previously evaluated in differentiation between normal and severe emphysema lung. qRT-PCR confirmed the direction of change in expression in 29 of the 51 genes and 11 of those validated, remaining significant at p < 0.05. Biological replication in an independent cohort confirmed the altered expression of eight genes, with seven genes differentially expressed by greater than 1.3 fold, identifying these as candidate determinants of emphysema severity.Class comparison identified 98 differentially expressed genes (COL6A3, SERPINF1, ZNHIT6, NEDD4, CDKN2A, NRN1 and GSTM3.Gene expression profiling of lung from emphysema patients identified seven candidate genes associated with emphysema severity including Smokingoutcomes . Hence, outcomes , but manHigh throughput microarray technology has been used to profile gene expression patterns to identify important genes and pathways implicated in chronic lung disease. Susceptibility studies in COPD have used lung tissue and primary cells to profile gene expression. Four of these studies have compared gene expression changes between various Global Initiative for Chronic Obstructive Lung Disease (GOLD) stages (I-IV) -11, but et al [et al [1AT) enzyme deficiency [Spira et al performeet al . Similarl [et al comparedficiency . These sWe hypothesised that gene expression profiling would identify differentially expressed genes that are associated with the progression from mild to moderate emphysema. We chose these stages for two main reasons: (i) we considered this phase of progression (from mild to moderate) to be most critical in the development of symptomatic, clinically significant emphysema, as well as more responsive to treatment than end-stage lung disease and (ii) to avoid lack of sensitivity from previously shown global gene downregulation of severe acellular end-stage emphysema. The transcriptome profile in mild and moderately emphysematous lung was therefore compared to identify gene candidates for severity of disease, which were then validated in an independent set of test patients.1/VC ratio < 0.70. Exclusion criteria were the following: 1) current use of inhaled or oral steroids (to exclude the effects of steroids on gene expression), 2) pre-operative chest x-ray showing obstructive pneumonitis , 3) α1AT deficiency ascertained by genotyping genomic DNA (to exclude the effects of α1AT associated emphysema) [Patients who had undergone curative resection for lung cancer and who agreed to donate resected lung to The Prince Charles Hospital (TPCH) lung tissue bank were selected for this study if they fulfilled the following inclusion criteria: 1) > 20 pack years of self-reported smoking history , 2) ceased smoking > 10 months prior to surgery (to avoid the effects of current smoking on gene expression) and 3) chronic airflow limitation with FEVphysema) and 4) oAll subjects had pre-bronchodilator lung function testing before surgery. Spirometry and gas transfer were performed according to American Thoracic Society standards on the Jaeger Compactlab Transfer and Body Systems and results were compared to predicted values ,16. The http://www.operon.com containing 21,329 70 mer probes representing ~14,200 named transcripts printed by the British Columbia Gene Array Facility http://www.microarray.prostatecentre.com. Study design for microarray experiments conformed to MIAME guidelines http://www.mged.org/Workgroups/MIAME/miame_checklist.html. All data have been deposited in the NCBI Gene Expression Omnibus (GEO) public repository http://www.ncbi.nlm.nih.gov/geo and can be accessed through the accession number GSE17770.Immediately after surgery the non-tumor tissue from the peripheral lung was macroscopically dissected by a pathologist under aseptic conditions, snap-frozen in liquid nitrogen, and stored at -80°C. Total RNA was extracted from these samples using Trizol , DNase treated and quality checked on an Agilent Bioanalyzer as previously published from our laboratory . Lung anp > 0.05 were excluded as their signal ratios displayed no significant variance from the mean signal ratio of the samples.Raw images were imported into Imagene V5.1 for background correction, filtering of spots with poor morphology, and calculation and extraction of median intensity signals. Avadis V4.3 , was used to suppress 'bad' spots, which were signals fewer than 20 pixels or greater than 65,000 pixels. Data was centralized across all samples using Lowess normalization, to account for non-linear dye bias. The Cy5/Cy3 ratio was then computed and log transformed to the base two. Genes with log ratio variation of http://linus.nci.nih.gov/BRB-ArrayTools.html) to identify genes differentially expressed between mild (≥ 75% predicted KCO) and moderate emphysema (<75% predicted KCO) groups categorized by gas transfer.Class comparison analysis, based on the supervising parameter KCO, was performed in BRB ArrayTools V3.5β1 used the Affymetrix HG-U133A gene chip that contained probes for ~22,500 human transcripts and Golpon et al (GEO series GSE1122) used the HuGeneFL Affymetrix gene chip that contained probes for ~6,086 transcripts. Chip Comparer http://tenero.duhs.duke.edu/genearray/perl/chip/chipcomparer.pl was used to find genes that were common between the Operon V2.1, Affymetrix HG-U133A and HUGeneFL platforms. We chose to validate by qRT-PCR only those genes represented both in Operon and at least one of the other two platforms. This will facilitate external validation and identification of robust genes involved in the pathogenesis of emphysema.In order to prioritise significant dysregulated genes for technical validation, we initially selected those represented on the gene expression microarray platforms used in two previously published studies that analyzed emphysematous tissue accesse® green chemistry [ACTN4) and hepatocyte growth factor-regulated tyrosine kinase substrate (HGS) [Total RNA prepared for the microarray experiments was reverse transcribed using Superscript III according to the manufacturer's instructions, and 30 ng of cDNA was used for each qRT-PCR reaction. For each candidate gene, forward and reverse primers were designed using Primer Express v1.5 to a target close to the microarray probe to amplify the same transcripts if applicable. Primer sequences are listed in the additional file was usedifornia) . Target te (HGS) . The prit-test, p < 0.05) were selected for biological replication on an independent test set of 62 lung samples from the TPCH lung tissue bank. The subjects in the test set included smokers with at least ten pack-years smoking history with mild or moderate emphysema. The test set consisted of 21 patients with mild emphysema (>75% predicted KCO) and 41 patients with moderate emphysema (40-74% predicted KCO). These samples did not overlap with the samples used in the training set. Total RNA was isolated and reverse transcribed to cDNA as described above. Quantitative RT-PCR was performed and the mean expression ratio was calculated. Genes that showed concordant direction of transcript expression in the test and training set were judged biologically validated.Technically validated candidate genes that were statistically significant and moderate emphysema .p < 0.05) from the median expression of all genes, and hence were chosen for gene selection analysis.The filtering of poor quality spots and normalisation resulted in a list of 20,274 probes comprising 13,178 known genes. Of these, 6,420 transcripts representing 4,159 known genes varied significantly (p < 0.01) between mild and moderate emphysema study [et al. A flow chart showing prioritisation of genelists and the analysis work flow is included in Figure et al and Golpon et al datasets respectively were 77% (83% sensitivity and 67% specificity) and 80% (80% sensitivity and 80% specificity) in predicting normal and severe emphysema study that prot-test, p < 0.05). For information on genes and their p values please see Additional file The 51 shortlisted genes progressed to technical validation by qRT-PCR in the training set. For 29 genes the direction of mean expression ratios by qRT-PCR (up- or down-regulation) was concordant with their corresponding microarray expression ratios. Eleven of the 29 genes demonstrated statistically significant differences between mild and moderate emphysema accurate in classifying mild and moderate emphysema patients in TPCH independent test, 83% (83% sensitive and 83% specific) and 80% (80% sensitive and 80% specific) accurate in classifying normal and severe emphysema patients in Spira and Golpon studies respectively , whereas we decided to validate on all 30 training samples to avoid selection bias and chance. Nonetheless our lower technical validation rate could also be influenced by differences in platforms (Operon versus Affymetrix), technology , oligo printing (spotted versus photolithography) and/or oligo length (70 mer versus 25 mer). Despite these differences, genes with consistent expression differences between mild and moderate emphysema were identified in our study.The 98 genes differentially expressed between mild and moderate emphysema were prioritised for technical validation, initially by choosing 51 genes represented in at least one of two public emphysema microarray platforms . Using l [et al and Golpl [et al randomlyet al [et al [et al (n = 102) and Golpon et al (n = 84) studies. Only two genes, COL6A3 and SERPINF1, were significantly differentially expressed at p < 0.01 and in the same direction in Spira et al and our study. Only one gene, DOCK2, was differentially expressed but in different directions in Golpon et al and our study. Comparing the Spira et al and Golpon et al samples, we also identified one gene, TOMM20, to be differentially expressed but in different directions. Minimal or no gene overlaps between the three studies is a common observation in array comparisons, and likely to be due to the different populations studied, variation in biology, platforms, bioinformatics, statistical chance and technical differences [et al also emphasizes this issue of low reproducibility of differentially expressed genes between cohorts [To facilitate external validation we used previously published emphysema datasets to veriferences ,21. A re cohorts .CDKN2A, GSTM3, COL6A3, SERPINF1, NRN1, NEDD4 and ZNHIT6) had ontologies that were relevant to emphysema progression, including cell cycle regulation (CDKN2A) [COL6A3) [SERPINF1) [GSTM3) [http://www.ingenuity.com/) to map biological pathways that linked these genes , collage[COL6A3) , anti-anERPINF1) and oxid [GSTM3) . The exp [GSTM3) ,28. To e1. By correlating gene expression profile with DLCO and FEV1, Spira et al [et al [A potential limitation of this study is the use of gas transfer measurements (KCO) to classify emphysema severity and lack of histological verification of emphysema severity in the lung samples tested. This was a challenge for this study due to the lack of availability of fresh and formalin fixed paraffin embedded tissue (FFPE) sections from the same site for mRNA analysis and pathological quantification respectively. Despite this, we were able to biologically replicate the expression of candidate genes in an independent set of lung tissues. Also to develop biological markers for disease severity it is important to correlate expression to clinical phenotypes such as KCO and FEVra et al and Golpl [et al identifil [et al ,13 that COL6A3 and SERPINF1, are concordantly increased in three different studies. It is highly likely that pathways rather than single genes are involved in progression of emphysema, mandating further investigation of the pathways in which these candidate genes are involved. Future goals include measurement of protein expression and characterization of function by knocking down candidate expression in vitro and quantifying cellular endophenotypes relevant to emphysema. These candidates could then be used to develop therapeutic targets against emphysema progression and potential diagnostic biomarkers to identify smokers with mild to moderate emphysema in COPD patients who are most susceptible to disease progression.In conclusion, we have used microarray technology to identify seven plausible candidate genes with potential involvement in the progression from mild to moderate emphysema, two of which, et al and Golpon et al datasets with a high accuracy of 83% and 80% respectively. The use of these genes as therapeutic or diagnostic tools warrants further investigation.This study reports the identity of seven candidate genes that could be involved in emphysema severity. These genes have been technically and biologically validated in in-house training and independent datasets respectively. In addition, candidate genes also predicted normal and severe emphysema in Spira The authors declare that they have no competing interests.SS: Performed all experiments, data analysis and prepared the manuscript. JL: Optimized the microarray experiments and assisted with microarray data analysis. SP: Provided technical support and assisted in microarray data normalization and analysis. NK: Study design, project plan and data analysis. RB: Study design, project plan and data analysis. KF: Study design, project plan and data analysis. IY: Study design, project plan and data analysis. All authors read and approved the final manuscript.Primer sequences of genes chosen for technical and biological validation. List of primer sequences used in the validation of microarray probes using qRt-PCRClick here for fileTable of 91 genes identified using class comparison analysis. Genes differentially expressed between mild and moderate emphysema patients. "Y" indicates that the probes have been represented in Affymetrix HG-U133A microarray chip.Click here for fileComparison of class prediction analysis of 51 genes in public datasets. Class prediction results of 51 genes in TPCH training, Spira and Golpon dataset using Nearest Centroid Correct algorithm. "YES" indicates that the sample has been classified correctly and "NO" indicates that the sample has been classified incorrectly.Click here for fileDendrogram of shortlisted 51 genes. Supervised two-dimensional hierarchical clustering based on average linkage uncentered correlation of emphysema samples using microarray expression data of the 51 genes represented in Spira and Golpon platforms chosen for qRT-PCR validation on TPCH training set. Each column represents a sample and each row represents a gene. Mild emphysema samples are indicated by the blue bar and moderate emphysema samples are indicated by the orange bar. Heatmap indicates level of gene expression, red, high expression, green, low expression in moderate compared to mild emphysema severity.Click here for fileComparison of class prediction analysis of 7 candidate genes in public datasets. Class prediction results of 7 genes in TPCH test, Spira and Golpon dataset using Nearest Centroid Correct algorithm. "YES" indicates that the sample has been classified correctly and "NO" indicates that the sample has been classified incorrectly.Click here for filePathway analysis on candidate genes. Canonical Pathway analysis in IPA on the seven validated candidate genes. The most significant functional and canonical groups, with p < 0.05 are presented. The bars represent p-value in logarithmic scale for each functional or canonical group and genes assigned to each of the functions are listed.Click here for fileOver-representation of gene ontologies in candidate genes. Heatmap (a) and enrichment score (b) of gene ontologies overrepresented in six of the seven candidates. a) Represents common gene ontologies enriched in the candidate genes. b) Significant clustering of molecular, biological and cellular functions in the candidate genes.Click here for file |
Transcriptional termination of mammalian RNA polymerase II (Pol II) requires a poly(A) (pA) signal and, often, a downstream terminator sequence. Termination is triggered following recognition of the pA signal by Pol II and subsequent pre-mRNA cleavage, which occurs either at the pA site or in transcripts from terminator elements. Although this process has been extensively studied, it is generally considered inconsequential to the level of gene expression. However, our results demonstrate that termination acts as a driving force for optimal gene expression. We show that this effect is general but most dramatic where weak or noncanonical pA signals are present. We establish that termination of Pol II increases the efficiency of pre-mRNA processing that is completed posttranscriptionally. As such, transcripts escape from nuclear surveillance. We recently presented a dissection of the events that lead to mammalian RNA polymerase II (Pol II) termination . During trans-activating factors which measures transfection efficiency. Following this, β-globin and RBM21 proteins were detected by western blotting C. SimilaOn βΔTERM, Pol II does not terminate efficiently and so may reduce new rounds of initiation (and gene expression) by reading around the plasmid and back into the promoter sequence, causing transcription interference. To measure interference, we performed hybrid selection nuclear run-on (NRO) analysis on HeLa We next analyzed the effect of three other terminator elements on gene expression: the mouse serum albumin (MSA) terminator region , the engA termination-independent function for these sequences in pre-mRNA processing is unlikely. They share no apparent sequence homology, and the MAZ4 element has no effect on the processing of a synthetic pre-mRNA in vitro . We thercis-acting sequence required for termination is the pA signal A. The SPNext, we analyzed nuclear and cytoplasmic β-globin mRNA in HeLa cells transfected with ATERM, AΔTERM, PMTERM, or PMΔTERM C. We obsThe effects of the β-globin terminator on gene expression from weak and strong pA signals were then directly compared. HeLa cells were transfected with βΔTERM, βTERM, AΔTERM, or ATERM and nuclear and cytoplasmic β-globin mRNA was analyzed E. ComparThe above result was unexpected, because it has been suggested that gene expression correlates with pA signal strength . These dThe data so far show that Pol II termination is required for optimal β-globin expression. We next analyzed the effects of Pol II termination on the expression of a different human gene, erythropoietin (EPO). EPO does not contain a recognizable pA signal and instead uses an AAGAAC hexamer . This woEPO was cloned into βΔTERM and βTERM in place of the human β-globin gene, still retaining the HIV promoter, forming EΔTERM and ETERM, respectively. These constructs and VA were transfected into HeLa cells and efficient termination on ETERM was confirmed by using a previously described RT-PCR assay that recapitulates NRO analysis . NuclearWe next analyzed nuclear and cytoplasmic EPO mRNA from HeLa cells transfected with EΔTERM or ETERM together with VA B. As forWe next investigated whether termination enhances gene expression in the context of a different promoter with distinct properties to the HIV promoter. The CMV promoter was chosen as it supports high levels of transcription but induces relatively slow elongation . This coIf termination enhances gene expression, the above results predict that no difference in expression would be observed between CβTERM and CβΔTERM because the process is equally efficient on each construct. However, expression should be greater for CETERM than for CEΔTERM, because the terminator element improves termination on this construct. This was tested by transfecting HeLa cells with CβTERM, CβΔTERM, CETERM, or CEΔTERM and measuring cytoplasmic mRNA levels E. LittleWe sought to establish why termination enhances gene expression. It is well established that Pol II transcription and pre-mRNA processing are coupled . BecauseA potential criticism of the above result could be that pre-mRNA is degraded in the βTERM sample more efficiently than for βΔTERM. This is unlikely, given the lack of change between CβTERM and CβΔTERM samples. Even so, we repeated our analysis on a further two constructs (βΔTERM1m and βTERM1m) which contain a mutated first intron C. This mThe enhanced splicing as a result of termination suggests a posttranscriptional effect. We therefore analyzed cotranscriptional splicing on βTERM and βΔTERM using a modified NRO protocol to incorporate bromo-labeled UTP (brU) into nascent RNAs which were purified using a brU-specific antibody . We puriWe next asked what degrades the transcripts when termination is inefficient. To this end, we depleted the nuclear exosome subunit PMScl100 using RNA interference (RNAi). Western blot analysis of PMScl100 protein in cells that had been mock treated or transfected with PMScl100-specific siRNAs showed that levels were depleted by 2- to 3-fold A. Equal The effect of this depletion was tested in situations where termination and splicing are inefficient and for strong and weak pA signals. Mock and PMScl100-depleted cells were transfected with βΔTERM or AΔTERM and levels of cytoplasmic β-globin mRNA were analyzed by RT-PCR B. We obsWe next determined the timing of degradation in relation to 3′ end processing. Mock and PMScl100-depleted cells were transfected with AΔTERM, and RNA samples were reverse transcribed with pAR (to detect uncleaved) or dT (to detect cleaved and polyadenylated RNAs). Subsequent PCR was with the e3f and e3r primer pair C. As befCollectively, the above results show that inefficient termination promotes the degradation of transcripts by the exosome after pA site cleavage. These data predict that termination releases mRNA from this decay, which can exist close to transcription sites . We finaThe data presented in this study show that termination releases transcripts from the DNA template, which promotes their processing and subsequent gene expression. Previous studies identified the pA signal as a key determinant of gene expression levels and termination efficiency . AlthougOur studies show that the CMV promoter reduces the necessity for terminator elements, as termination on CβTERM and CβΔTERM is equivalent. However, a terminator element is still required to terminate transcription of the EPO gene when the CMV promoter is used. This could be accounted for by the differences in the EPO and β-globin pA signals. The strong β-globin pA signal is rapidly processed to drive efficient pA site-dependent termination on CβΔTERM. However, the EPO pA signal is not sufficiently strong to do the same on CEΔTERM so that, in this case, efficient Pol II termination depends on the terminator. A strong pA signal may permit Pol II termination to occur when transcription initiates from the CMV promoter, if elongation is slow enough to negate the need for a pause element. Such pause sites are normally needed for pA site cleavage-dependent termination when transcription is from the HIV promoter. In support of this being the case, CMV transcription promotes splicing patterns that are typical of slow elongation . FurtherOur results show that a variety of unspliced pre-mRNA accumulates when Pol II termination is inefficient, suggesting an influence of termination on pre-mRNA processing. Data in We show in these studies that gene expression can be greatly enhanced by transcriptional termination. As indicated in the model , we predNRO and hybrid selection NRO have previously been described . M13 procDNA was made using SuperScript III (Invitrogen), and 1 μl of the 20 μl reaction was analyzed by real-time PCR or semiquantitative PCR . Experiments were quantitated after subtraction of values obtained from minus RT samples.Fifty percent of lysate from a confluent 5 cm dish of HeLa cells was used for analysis. For secreted EPO, 10–100 μl of culture media was used. Membranes were probed with anti-human β-globin (Santa Cruz Biotechnology) at 1:1000, anti-EPO (Santa Cruz Biotechnology) at 1:1000, anti-PMScl100 (Abcam) at 1:1000, and anti-actin (Sigma) at 1:1000 or anti-HA (Santa Cruz Biotechnology) at 1:1000. Secondary antibodies were anti-mouse (Sigma) at 1:2000 or anti-rabbit (Sigma) at 1:2000. Signals were detected with an ECL kit and quantitated using ImageQuant software.http://www.narrykim.org/Northern_blot_analysis_for_microRNA.pdf. RNA samples were RNase H cleaved using primer 4.5 and dT. RNA was fractionated on a 6% gel and products were detected using 5′ 32P-labeled e3r primer.The protocol is available at Semiconfluent HeLa cells, in 5 or 10 cm plates, were transfected with 1–5 μg of reporter plasmid, 1–2 μg of VA plasmid, and 1.5 μg of Tat plasmid. Lipofectamine 2000 (Invitrogen) was used.The procedures for isolating nuclear and cytoplasmic RNA and for Tat , VA Dye, and βTEThis protocol was previously described .RNA interference of PMScl100 was previously described .Primer sequences are in |
Saccharomyces cerevisiae subpopulations. We mapped natural variation in freeze-thaw tolerance to two water transporters, AQY1 and AQY2, previously implicated in freeze-thaw survival. However, whereas freeze-thaw–tolerant strains harbor functional aquaporin genes, the set of sensitive strains lost aquaporin function at least 6 independent times. Several genomic signatures at AQY1 and/or AQY2 reveal low variation surrounding these loci within strains of the same haplotype, but high variation between strain groups. This is consistent with recent adaptive loss of aquaporins in subgroups of strains, leading to incipient balancing selection. We show that, although aquaporins are critical for surviving freeze-thaw stress, loss of both genes provides a major fitness advantage on high-sugar substrates common to many strains' natural niche. Strikingly, strains with non-functional alleles have also lost the ancestral requirement for aquaporins during spore formation. Thus, the antagonistic effect of aquaporin function—providing an advantage in freeze-thaw tolerance but a fitness defect for growth in high-sugar environments—contributes to the maintenance of both functional and nonfunctional alleles in S. cerevisiae. This work also shows that gene loss through multiple missense and nonsense mutations, hallmarks of pseudogenization presumed to emerge after loss of constraint, can arise through positive selection.A major goal in evolutionary biology is to understand how adaptive evolution has influenced natural variation, but identifying loci subject to positive selection has been a challenge. Here we present the adaptive loss of a pair of paralogous genes in specific AQY1 and AQY2. Although tolerant strains harbor functional alleles of both genes, the set of sensitive strains lost aquaporins at least 6 independent times, through missense mutations and frame-shifting deletions. Genome-wide scans reveal several signatures of recent, partial selective sweeps at the aquaporin loci, indicating positive selection for gene loss. This was likely driven by a major fitness advantage of aquaporin loss when cells grow in high sugar concentrations common to many strains' niche. Surprisingly, strains that lost aquaporins also lost the ancestral requirement for these genes during sexual reproduction. This work provides a compelling example of how gene loss through nonsense mutations, a hallmark of pseudogenization, is caused not by loss of constraint but by positive selection.Local adaptation is thought to be a driving force in population differentiation and the formation of new species. Yet, there are few examples of ecologically relevant phenotypes that have been mapped to individual genes, making it difficult to know what drives the evolution of such genes and contributes to the molecular mechanisms underlying divergence. Here, we provide a unique case of local adaptation through multi-gene loss. We mapped the genetic basis for natural variation in yeast freeze-thaw tolerance to two water transporters, Biologists have long sought to understand the process of natural selection and the signatures left behind in extant species. Finding evidence of adaptive evolution has been a holy grail for evolutionary biologists, because it can provide insights into how and why organisms evolve. However, examples of adaptive selection from which to glean insights remain relatively scarce Saccharomycetes collected from diverse environments and found that relatively few of those strains (12%) could survive freeze-thaw (FT) stress AQY1 and AQY2 were implicated in FT stress by the baking industry, which found that AQY over-expression increases yeast viability in frozen bread dough Saccharomyces lineage AQY2, while several strains harbor a non-functional version of AQY1S. cerevisiae, leading to incipient balancing selection via spatial variation in selective pressures.Here, we used the power of yeast genetics and genomics to uncover a unique example of adaptive gene loss, involving multiple paralogous genes and several sequential evolutionary events. We previously surveyed phenotypic variation in AQY2 and AQY1, respectively, which were previously linked to freeze-thaw tolerance AQY2 alone explaining two-thirds of the effect . This cannot be simply explained by shared ancestry, which would have produced similar protein trees and a limited combination of alleles, and instead supports the non-random retention or loss of both AQY genes.Sequencing alleles . There wur assay . Severalur assay . There wtext see , the V12AQY1 and AQY2 show an excess of replacement polymorphism, assessed by the McDonald-Kreitman test AQY1 showed an A/S ratio of polymorphism (5/4 = 1.25) that was significantly higher than that of divergence . AQY2 also showed an excess of polymorphic sites (A/S of 8/20 = 0.4) compared to divergent sites , as well as an excess of deletions . AQY2 (but not AQY1) also deviated from neutral evolution at synonymous sites, showing an excess of SNPs compared to 8 intergenic sequences . Strains harboring the full-length AQY2 showed a smaller peak of 1,800 bp with high between-group variation . These results show that strains harboring either deletion have low variation within those strain groups, and that the high variation at AQY2 distinguishes the three groups from one another. Indeed, a genome-wide plot of FSTAQY2 with above-average FST, ranking among the top 1.5th percentile genome-wide . Thus, the profiles we observe in AQY2 was not significant by this assessment (26th percentile).A confounding feature is the extensive population structure within lele see . The regAQY2 resulted from two separate partial selective sweeps that reduced variation within each group. The high variation distinguishing strain groups is a signature of balancing selection, which may be maintaining both functional and non-functional AQY2 alleles in the population. Indeed, we observed a positive Tajima's D at AQY2, assessed on a smaller set of high-quality sequences , they were not significant compared to random-SNP partitioning described above . Thus, the slight skew in between-group versus within-group variation at AQY1 could be due to demographic factors, incorrect strain groupings, or older or weaker selective sweep(s) that have since recovered variation through recombination or mutation.The patterns at 1 region . AlthougAQY function in some strains, perhaps driven by environmental factors. We previously reported an anti-correlation between FT survival and osmo tolerance across a wide range of S. cerevisiae strains AQY function presents a substantial fitness defect in conditions relevant in nature, likely due to passive water loss triggered by the high osmolarity of sugary substrates.The above results strongly suggest selective pressure to lose AQY1 had been previously implicated in a late step in spore maturation S. paradoxus aqy1Δ mutant displayed an identical defect did not significantly improve spore production , high between-group variation surrounding AQY2 that distinguishes strain groups are all consistent with non-neutral evolution. Furthermore, AQY paralogs have been lost at least 6 independent times, through 2 partial selective sweeps at AQY2 and possibly others at AQY1. The high variation between strain groups, and the non-random retention or loss of both paralogs in diverse strains, is consistent with the establishment of balanced polymorphism. We propose that the antagonistic pleiotropy of aquaporin function, coupled with spatial differences in selective pressures, provide pressure to maintain both functional or both non-functional alleles in distinct subpopulations of S. cerevisiae.This work provides the first clear evidence for adaptive loss of AQY function in subgroups of wild S. paradoxus is 2 - 6X lower for AQYs compared to the genomic average , one haplotype may eventually win out to fixation, eliminating the balanced alleles. On the other hand, long-term balancing selection could result if equivalent selective constraints are maintained in each respective niche. In the extreme case, strongly opposing selective forces could restrict yeast migration between environments to promote ecological speciation S. cerevisiae migration between tree soil and fruits, although oak-soil strains are genetically well separated from vineyard/fermentation isolates The selective sweeps of nonfunctional aquaporin alleles appear to have been recent events, given the strength of the signal at S. cerevisiae strains (DY8 and DY9) were isolated from oak-tree soil from Maribel, Wisconsin using the method of S. cerevisiae strain . Gene deletions were created by homologous recombination, replacing AQY1 and/or AQY2 with KanMX3 or NatMX3 drug-resistance cassettes, respectively. Homothalic wild strains capable of mating-type switching were sporulated and dissected, and drug-marked colonies were selected as homozygous diploids. In all cases, homozygous gene deletions were confirmed by diagnostic PCR. The region corresponding to the 870 bp full-length AQY2 ORF plus 971 bp upstream and 393 bp downstream sequence was cloned from YPS163 or BY4741, by homologous recombination replacing a GFP-ADH1-terminator cassette in plasmid BA1924 (provided by P. Kainth and B. Andrews), which is derived from pRS315-based CEN plasmid BA1926 LEU2 marker. The region corresponding to the 918 bp full-length AQY1 ORF with the flanking 947 bp upstream and 747 bp downstream was similarly cloned. All clones were verified by sequencing. To assess functionality of the different alleles, AQY1 ORFs representing M22, BY4741, or Y55 alleles or the Malaysian AQY2 allele were cloned between the native upstream and downstream AQY1 sequence from YPS163. This was done to prevent confounding influences on expression through variation in the flanking regulatory regions. Plasmids were introduced into YPS163 aqy1Δ, BY4741, or other naturally AQY-minus strains, and complementation of spore production in the YPS163 aqy1Δ mutant or of FT tolerance in BY4741 was scored (Strains and plasmid constructs are described in s scored .600) of 0.3–0.4 in 24-well plates. To measure freeze-thaw tolerance, 200 µl of cells was transferred to 1.5 ml tubes and frozen in a dry ice/ethanol bath (<−50C) for two hours or on ice as control. Viability was measured by scoring serial dilutions spotted onto agar plates as previously described Yeast strains were grown at 30°C in YPD medium to an optical density at 600 nm .To monitor the skew variation within and between groups, a difference profile of between-group variation minus within-group variation was taken across the genome, and all contiguous regions (“peaks”) where the difference value was >1.5X the chromosome-wide average were identified see . The areFigure S1AQY2 and AQY1. The plot shows AQY2 (top) and AQY1 coding sequences, arranged 5′ (left) to 3′ (right). Blue bars indicate SNPs and orange represents verified gaps in the AQY coding sequences compared to the YPS163 allele for strains in different groups (rows). Strains are organized as shown in Polymorphisms in (0.41 MB TIF)Click here for additional data file.Figure S2AQY2 locus. Blue windows highlight identified peaks over AQY2; ORF positions are shown above the figure as described in Difference profiles of between-group minus within-group variation. To identify regions with a skew in between-group and within-group variation, we calculated the difference profile as described in the text. Peaks where values were >1.5X the chromosome-wide average were identified and compared to peaks identified at the (1.54 MB TIF)Click here for additional data file.Figure S3AQY2 (red) and AQY1 (orange) coding sequences were compared to other intergenic loci. The 95% confidence interval (mean of non-AQY loci plus two standard deviations) is shown with a horizontal red line. Many genes show negative D values, consistent with previous genome wide estimates for S. cerevisiaeTajima's D at AQY loci. Tajima's D was measured at 12 different loci with high-quality sequence data from (0.22 MB TIF)Click here for additional data file.Figure S4AQY1. As shown in AQY1.Within-group versus between-group variation at (3.16 MB TIF)Click here for additional data file.Figure S5AQY1/aqy1Δ but not YPS163 AQY2/aqy2Δ, suggesting AQY1 plays a more significant role in YPS163 sporulation. (C) Complementation experiments show that the YPS163 aqy1Δ sporulation defect is not complemented by AQY1 ORFs from S288c derivative BY4741 (BY), M22, or the YPS163 coding sequence with the A881 deletion. To avoid defects due to regulatory differences, each ORF was cloned between the 947-bp upstream and 747-bp downstream sequences from YPS163, exactly as for the pYPS_AQY1 clone that was able to complement the sporulation defect. Further confirming that these alleles are non-functional in our context, we found that none of these AQY1 versions contributed FT tolerance to BY4741 (data not shown), unlike the AQY1 allele from YPS163 Sporulation efficiency as shown in m YPS163 . Althoug(0.97 MB TIF)Click here for additional data file.Table S1AQY2 and AQY1 alleles and phenotypes across strains. The table lists strain names, source of sequences analyzed, allele types, number of functional AQY alleles per strain, and strain phenotypes (as described in Summary of (0.02 MB XLS)Click here for additional data file.Table S2aqy1Δ.Summary of major-allele phenotying. The table lists the allele tested, functional prediction based on sequence polymorphism, strain from which gene was cloned, and the ability to donate freeze-thaw tolerance to the lab strain or complement the sporulation defect of YPS163 (0.02 MB XLS)Click here for additional data file.Table S3S. paradoxus strain Q69.8, which had the best high-quality sequence coverage McDonald-Kreitman tables and p-values. McDonald-Kreitman tests were performed using DNASP on high-quality sequence data from this study, using (0.06 MB DOC)Click here for additional data file.Table S4a Sample size (number of strains), b number of segregating sites, c number of divergent sites. S. paradoxus strain Q69.8 was used as the outgroup AQY2 and AQY1, compared to 7 intergenic sequences with data for both S. cerevisiae and S. paradoxusAQY1 allele started at position 100, removing of an upstream, inframe ATG and 30 additional basepairs that were clearly not orthologous to the full-length AQY1 from other strains. Intergenic regions were analyzed after removing two clearly non-orthologous regions from all strains (350 bp from the chr2 fragment and 387 bp from the chr16 fragment), the result of apparent recombination in subgroups of strains. This dataset amounted to 183 and 150 silent positions in AQY2 and AQY1, respectively, and 3,337 scorable sites across 7 intergenic fragments.Input data for ML-HKA test. (0.07 MB DOC)Click here for additional data file.Table S5AQY2, AQY1, or AQY2 and AQY1 were under selection. The program was run with chain length 100,000 in all cases. P-values were calculated based on the chiX distribution of the likelihood statistic listed degrees of freedom (df), as described (Wright and Charlesworth 2004). There was no increase in significance when all sites in AQY2 and AQY1 were treated as silent (data not shown). We also ran the analysis separately for only strains in Full-length group, Asian G25 deletion group, or 11 bp-deletion group. Variation at AQY2 and AQY1 within each group was compared to variation at other loci only for strains in that group. The results were the same when the genes in question were scored against intergenic sequences from all available strains. None of the tests were significant in any case.Results of ML-HKA analysis. ML-HKA tests were run under a model in which all loci were evolving neutrally and compared to models in which (0.06 MB DOC)Click here for additional data file.Table S6Strains and plasmids used in this study.(0.02 MB XLS)Click here for additional data file.Table S7AQY2 scan. Each column shows the chromosome, start position of peak, length of identified peak, maximum difference in between-group variation minus within-group variation, and area under the difference curve.Peak areas identified in (0.19 MB XLS)Click here for additional data file. |
Intermolecular N—H⋯N hydrogen bonding further helps to stabilize the crystal structure.The molecule of the title compound, C Å b = 7.4238 (19) Å c = 11.997 (3) Å β = 97.145 (3)°V = 661.7 (3) Å3 Z = 4 Kα radiationMo −1 μ = 0.10 mmT = 93 K 0.43 × 0.43 × 0.33 mm Rigaku Saturn724+ diffractometerAbsorption correction: none5172 measured reflections1520 independent reflectionsI > 2σ(I)1334 reflections with R int = 0.024 R[F 2 > 2σ(F 2)] = 0.036 wR(F 2) = 0.088 S = 1.00 1520 reflections101 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.28 e Å−3 Δρmin = −0.17 e Å−3 Δρ CrystalClear used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008ORTEP-3 (Farrugia, 1997WinGX (Farrugia, 1999Data collection: 10.1107/S1600536809024994/xu2546sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809024994/xu2546Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials: |
Escherichia coli strains associated with intestinal colonization or urinary tract disease. Because uropathogenic E. coli are believed to reside in the gut microbiome prior to infection, we compared siderophore production between urinary and rectal isolates within individual patients with recurrent UTI. While all strains produced enterobactin, strong preferential expression of the siderophores yersiniabactin and salmochelin was observed among urinary strains. Conventional PCR genotyping of siderophore receptors was often insensitive to these differences. A linearized enterobactin siderophore was also identified as a product of strains with an active salmochelin gene cluster. These findings argue that qualitative and quantitative epi-genetic optimization occurs in the E. coli secondary metabolome among human uropathogens. Because the virulence-associated biosynthetic pathways are distinct from those associated with rectal colonization, these results suggest strategies for virulence-targeted therapies.Bacterial pathogens are frequently distinguished by the presence of acquired genes associated with iron acquisition. The presence of specific siderophore receptor genes, however, does not reliably predict activity of the complex protein assemblies involved in synthesis and transport of these secondary metabolites. Here, we have developed a novel quantitative metabolomic approach based on stable isotope dilution to compare the complement of siderophores produced by Escherichia coli are the most common bacteria causing UTI and the infecting strains are widely believed to originate from the gastrointestinal tract where multiple E. coli strains reside. Here, we use a novel mass spectrometric technique in a population of patients with recurrent UTI to identify how strains that cause UTI differ from other strains that were present in the gastrointestinal tract at the same time. We found that urinary E. coli strains preferentially expressed two small molecules called yersiniabactin and salmochelin. These molecules are called siderophores, meaning they are able to scavenge iron to support bacterial survival and growth. Synthesis and transport of these small molecules requires a coordinated network of proteins encoded by a collection of different genes. These findings suggest that new antibiotics directed against yersiniabactin or salmochelin-producing E. coli strains may be an improved, and more targeted, strategy to prevent recurrent UTIs.Urinary tract infections (UTIs) are among the most common bacterial infections treated by physicians worldwide. Although symptoms of acute infection are often resolved with a course of antibiotics, the same bacterial strain often causes subsequent bouts of symptomatic infection. E. coli is responsible for up to 85% of community-acquired UTI, and previous studies suggest that the same E. coli strain can cause recurrent UTI's despite initial antibiotic treatment Urinary tract infection (UTI) is a highly prevalent infectious disease with a well-known female predilection and a high incidence of recurrence E. coli populations is stochastic or the result of intrinsic strain properties has been the subject of multiple investigations. Genes involved with iron acquisition routinely emerge as correlates of urinary pathogenesis in these studies. In one such study, a genome-wide search in the model uropathogen UTI89 revealed extensive selection of 29 genes including those involved in synthesis of the siderophore enterobactin Whether selection of UTI-associated strains from gut 3+) E. coli isolates with enterobactin being the only system conserved in all isolates encodes the genes necessary for the synthesis and uptake of yersiniabactin. Aerobactin biogenesis is encoded in the iucABCD cluster of genes.Siderophores are a chemically diverse family of small molecules that are produced by a wide variety of pathogenic and non-pathogenic bacteria to scavenge ferric iron (Feisolates . Among tE. coli isolates from the urines of women with recurrent UTI (urinary E. coli). Comparisons of coincident urinary and rectal strains from patients with recurrent UTI revealed that urinary strains exhibited significantly higher production of yersiniabactin and salmochelin, even amongst genotype-positive strains, but not enterobactin and aerobactin. Also, the siderophore receptor genotype did not always correspond to production of the associated siderophore, in contrast to previous assumptions E. coli strains associated with recurrent urinary tract infection have a preferred metabolomic profile involving a complex metabolic network.In this study we have used a quantitative metabolomics approach together with microbiologic, genomic, and clinical strategies to uncover a preferential metabolic signature among E. coli isolates, we compared culture supernatants from strains grown for 18 hours in iron-poor and iron-rich minimal media , salmochelin (15), and enterobactin (16), and the [M−2H+Fe(III)]+ ion of ferric yersiniabactin (17). These siderophore peaks elute from a reversed phase column in the order reported previously (19). Confirmatory structural information was available by comparing the m/z difference between the [M+H]+ of salmochelin and its precursor, enterobactin. The salmochelin [M+H]+ is 342 m/z units greater .rUTI2 was chosen as a model strain to develop a quantitative metabolomic approach because it produced all four known greater , consist13C3-glycerol or 15N-ammonium sulfate were substituted for the unlabeled compounds. This heavy isotope labeling strategy resulted in mass shifts for each ion peak based on the number of carbons or nitrogens in their empiric formulae and the M+2 ion from 34S (base peak contains 32S). After mixing labeled and unlabeled supernatants, the labeled and unlabeled siderophore ions all co-eluted, consistent with their expected identical structures. This isotope labeling technique provides both structural confirmation and a source of stable isotope labeled internal standards for MS-based quantification.To further confirm the identity of presumptive siderophore ions, rUTI2 was grown in defined minimal media in which formulae . Labelin+ at m/z 670 fragmented predominantly at the ester bonds to yield dihydroxybenzoyl serine monomer (m/z 224) and dimer (m/z 446) as previously reported 15N-labeled products. Consistent with the hallmark C-glucosylation in salmochelin, we observed no loss of glucose as is typically seen with O- or N-linked sugars. The aerobactin [M+H]+ at m/z 565 fragmented to give the neutral losses of water (m/z 547) and HCOOH (m/z 519) of a multiply hydroxylated and carboxylated compound. MS/MS of ferric yersiniabactin [M−2H+Fe(III)]+ gave a complex spectrum, as expected from a heterocyclic compound, that included the prominent m/z 489 peak observed in previous MALDI spectra MS/MS fragmentations were also studied for further structural confirmation using strain rUTI2 . The ententBybtSybtS encodes a salicylate synthase, yersiniabactin expression could be restored in UTI89ΔybtS by growth in the presence of exogenous 0.3 mM sodium salicylate (data not shown). Selective loss of salmochelin was observed with deletion of iroB, which forms C-glucose bonds with enterobactin The sequenced model uropathogen UTI89 was observed to produce enterobactin, salmochelin, and yersiniabactin. To validate the stable isotope dilution LC-MS/MS metabolomic assay, we analyzed UTI89 strains with deletion mutations in selected siderophore biosynthetic genes . Ions coentB, ybtS, iroB) remained positive for siderophore production by the chrome azurol S plate assay based on blue-to-yellow transformation surrounding streaked colonies entBΔybtS double mutant which was predicted to selectively abolish synthesis of all known siderophores in UTI89. Metabolomic profiling of UTI89ΔentBΔybtS confirmed the absence of all three siderophores in this mutant and the chrome azurol S assay revealed unchanged colony growth without siderophore production. Thus, for UTI89, total siderophore activity is accountable using this metabolomic analysis as confirmed using a combined biochemical, genetic, and chemical approach. Unlike the K12 E. coli strains described previously Single deletion mutants in the siderophore biosynthetic pathways described above (E. coli strains MG1655 E. coli urinary isolates fyuA) and aerobactin receptor (iutA) genotypes were known for all 21 strains. Of the 16 fyuA-positive strains, three pyelonephritic strains, CFT073, pyelo1, and pyelo3 produced no detectable yersiniabactin despite producing other siderophores. Of the 8 iutA-positive strains, two, rUTI4 and pyelo3, produced no detectable aerobactin while still producing other siderophores. The inability of CFT073 to synthesize yersiniabactin is presumably due to mutations that have been identified within essential yersiniabactin biosynthetic genes in this strain To compare siderophore expression phenotype to bacterial genotype, we examined siderophore production by three fully sequenced E. coli strains exhibited preferential siderophore expression when compared to distinct, coincident rectal strains, we collected a new set of E. coli strains from 18 recurrent UTI patients and we PFGE-typed the isolates higher salmochelin and yersiniabactin production among urinary strains. It was also notable that we found no instances in which the rectal-only strain produced yersiniabactin or salmochelin while the urine strain did not. Furthermore, urinary strains always produced more salmochelin, even when non-urinary strains also expressed salmochelin (n = 3) suggesting that salmochelin biosynthesis was more active in urinary strains. Among all urinary strains in this study, prevalence was in the order enterobactin (100%), yersiniabactin (71%), salmochelin (50%) and aerobactin (14%). These data show that, while all strains made enterobactin, a biosynthetically active Yersinia HPI and iroA cassette were common among urinary isolates in this population and that production of these siderophores may have a clinically evident impact on UTI recurrence.To determine if quantitative and qualitative differences in the siderophore metabolome distinguish urinary from rectal isolates in this set of 13 patients, we used quantitative metabolomic profiling and then compared these results to a genotypic analysis. In the metabolomic analysis, we measured differences between coincident urinary and rectal strains within individual patients. For each patient, the quantity of each siderophore produced by rectal strains was subtracted from the quantity produced by the coincident urinary strains to yield a difference . In the fyuA for yersiniabactin, iroN for salmochelin, iutA for aerobactin) E. coli was supported by product analysis, which revealed enterobactin production by all patient isolates. For yersiniabactin and salmochelin, the siderophore receptor genotyping analysis had the limitation of being unable to discern strain differences when both a rectal and urinary strain pair were genotype positive. This was a frequent occurrence. In the ten patients from whom at least one fyuA+ strain was recovered, product analysis revealed rectal-urinary differences in yersiniabactin production in all ten, while genotyping predicted differences in four. Similarly, in the eight patients from whom at least one iroN+ strain was recovered, product analysis revealed differential yersiniabactin production in seven, while genotype predicted differential expression in four. Among fyuA− or iroN-positive strain pairs, mean and median yersiniabactin or salmochelin production remained higher among the urinary strains.The siderophore expression analysis of the rectal and urinary strains from the 13 patients described above was compared to PCR genotyping using established PCR primers for siderophore receptor genes and was mirrored by a significant association between fyuA and iroN positivity (p = 0.008). Salmochelin and yersiniabactin co-expression was seen more often among patient urinary (6/13 (46%)) than rectal (3/13 (23%)) strains, although this trend did not reach statistical significance (p = 0.18). Thus, salmochelin expression tended to occur in addition to yersiniabactin expression and co-expression was a common feature among urinary strains in this population. These data raise the possibility that these two siderophore types exhibit complementary activities.Yersiniabactin was the most prevelant non-enterobactin siderophore and strikingly, was co-expressed in 90% of the strains that expressed salmochelin. This was the most frequent co-association of any of the non-enterobactin siderophores of a single ester bond when a genotype-positive strain was unable to produce detectable levels of the corresponding siderophore and 2) when siderophore production differed significantly between genotype-positive strain pairs. Ten of the thirteen patients in this study yielded at least one strain pair in which either or both of these circumstances was operative. Deficient or enhanced siderophore biosynthesis may arise in multiple environmental contexts. Pathogenic bacteria may benefit from increased production of siderophores that are better adapted to the infection microenvironment, as may be the case with salmochelin and yersiniabactin. Alternatively, bacterial strains in polymicrobial communities may benefit from inactivated siderophore production if they retain the ability to “steal” ferric siderophores produced by a neighbor, thereby avoiding the metabolic cost of siderophore biosynthesis iutA positivity among pathogenic strains is often used to conclude that aerobactin is an important virulence factor, we did not observe preferential expression of this siderophore when urinary and rectal isolates were compared. The sample size may not have allowed us to discern preferential aerobactin production in this population. Alternatively, iutA-positive clinical isolates might exhibit urinary virulence properties that are unrelated to aerobactin production.Enterobactin or aerobactin production was not preferentially associated with urinary strains in this population. The lack of increased enterobactin production among urinary strains suggests that qualitative shifts in siderophore type may be more conducive to uropathogenesis than a quantitative shift in enterobactin production. Although These results suggest that yersiniabactin and salmochelin expression may facilitate infection of the human urinary tract. This effect is not absolute, as there are urinary strains in this study that express neither siderophore. Although rectal isolates in this and other studies This study was conducted according to the principles expressed in the Declaration of Helsinki. The study was approved by the Institutional Review Board of the University of Washington. All patients provided written informed consent for the collection of samples and subsequent analysis.E. coli grown in LB broth were diluted 1∶100 into M63 medium containing 0.2% glycerol and 10 mg/mL niacin and incubated for 18 h at 37 C in a rotary shaker.To examine siderophore production in liquid culture, previously published conditions were used Deletion mutations were made using the red recombinase method, as previously described, using pKD4 or pKD13 as a template and the primers as listed in 13C labeled standards as described above. Data was collected in the positive centroid mode. Ions were monitored with a window of +/−0.5 amu.The mass spectrometer used for the studies was a Thermo-Finnigan LCQ Deca coupled to a Waters CapLC (Waters MA) equipped with a Vydac C18 MS column (0.3×150 mm). The flow rate was 6 ul/min with a gradient as follows: Solvent A (0.1% formic acid) was held constant at 95% and solvent B (80% acetonitrile in 0.1% formic acid) was held constant at 5% for 5 minutes, increased to 44% B in the next 60 minutes, and then to 95% B in the next 20 minutes. All data was collected in a positive mode. The spray voltage on the mass spectrometer was held constant at 4.5 K and the capillary temperature was 200°C. For CID experiments helium was used as the collision gas with the collision energy set to 32% of the maximum (∼5 eV). The isolation width was 3 amu. Quantitation was carried out in the SRM mode using 0.1 M ferric chloride was added to cell supernatants to a final concentration of 3.75 mM. After a 15 minute room temperature incubation the precipitate was removed by centrifugation. The supernatant was applied to a column packed with 200 uL of DEAE slurry E. coli siderophore types, or UTI89. Strains were each grown for 3 hours in LB broth, which was subsequently inoculated 1∶100 into M63 medium containing 0.2% 13C3-glycerol , and 10 mg/mL niacin and incubated for 18 h at 37 C in a rotary shaker. Cells were removed by centrifugation and a frozen stock of supernatant was kept for use as internal standard. Isotopic labeling was confirmed by LC-MS.Internal standards were produced by rUTI2, a clinical urine isolate found to express all four known 13C-labeled internal standard was added 1∶1 to each clarified culture supernatant and mixed prior to siderophore extraction. Siderophore extracts subject to comparison were then prepared and analyzed by LC-MS/MS using the parent and daughter ions described above and listed in 13C-labeled internal standard peak. These peak area ratios were then converted to molar ratios by comparison to standard curves generated by mixing known ratios of unlabeled and labeled rUTI2 supernatants. Siderophore quantities were expressed as rUTI2 equivalents by normalizing each molar ratio to that observed for strain rUTI2 under identical culture conditions.Strains to be compared, along with the reference strain rUTI2, were prepared together on the same day using the same media, reagents, and internal standard. Siderophore quantities are expressed as reference strain equivalents determined through the stable isotope dilution method. fyuA, iutA, and iroN genes, respectively Isolates were grown to log phase on 5 ml LB medium. Primer combinations FyuA f'–FyuA r (880 bp product)/AerJ f–AerJ r (300 bp)/IRONEC-F–IRONEC-R (665 bp) were used for amplification of Patients presenting with UTI were enrolled and monitored prospectively as described previously t test was used to compare urinary versus rectal strain growth as well as growth differences between paired strains. Categorical data was analyzed using Fisher's exact test.Statistics and graphs were generated using GraphPad Prism 4. For groupwise comparisons of siderophore production, the Mann-Whitney U Test was performed. Analyses of paired strain differences in siderophore production were performed using the Wilcoxon signed rank test for significance. For analysis of stationary phase density, the data passed the F test for equal variances and the Figure S1Dendrogram, PFGE patterns, siderophore status and hemolytic properties of patient strains collected for comparison of urinary strains with coexisting rectal strains.(4.89 MB TIF)Click here for additional data file.Table S1CID fragmentations used to identify and quantify siderophores by LC-MS/MS.(0.03 MB DOC)Click here for additional data file.Table S2Primers used in construction of UTI89 mutants.(0.02 MB DOC)Click here for additional data file. |
Ca2+-ionophore caused a dose-dependent detachment of phosphofructokinase (EC 2.7.1.11), one of the key enzymes of glycolysis, from cytoskeleton. It also induced a decrease in the levels of glucose 1,6-bisphosphate and fructose 1,6-bisphosphate, the two stimulatory signal molecules of glycolysis. All these changes occurred at lower concentrations of the drug than those required to induce a reduction in viability of melanoma cells. We also found that low concentrations of Ca2+-ionophore induced an increase in adenosine 5′-triphosphate (ATP), which most probably resulted from the increase in mitochondrial-bound hexokinase, which reflects a defence mechanism. This mechanism can no longer operate at high concentrations of the Ca2+-ionophore, which causes a decrease in mitochondrial and cytosolic hexokinase, leading to a drastic fall in ATP and melanoma cell death. The present results suggest that drugs which are capable of inducing accumulation of intracellular-free Ca2+ in melanoma cells would cause a reduction in energy-producing systems, leading to melanoma cell death. © 1999 Cancer Research CampaignCancer cells are characterized by a high rate of glycolysis, which is their primary energy source. We show here that a rise in intracellular-free calcium ion (Ca |
Metastatic melanoma is a highly chemotherapy resistant tumour. The use of newer targeted therapies alone and in combination with chemotherapy may offer new hope of improving response to treatment. Dasatinib, a multi-target kinase inhibitor, is currently approved for the treatment of chronic myeloid leukaemia and has shown promising results in preclinical studies in a number of solid tumours.We examined the effects of dasatinib on proliferation, chemo-sensitivity, cell cycle arrest, apoptosis, migration and invasion in human melanoma cell lines. Expression and activation of Src kinase, FAK and EphA2 were also examined in the melanoma cells.Dasatinib inhibited growth of three of the five melanoma cell lines. Comparison with sorafenib showed that in these three cell lines dasatinib inhibited growth at lower concentrations than sorafenib. Dasatinib in combination with the chemotherapy drug temozolomide showed greater efficacy than either drug alone. Dasatinib induced cell cycle arrest and apoptosis and significantly inhibited cell migration and invasion of melanoma cells. Dasatinib inhibition of proliferation was associated with reduced phosphorylation of Src kinase, while decreased phosphorylation of FAK was implicated in dasatinib-mediated inhibition of migration and invasion in melanoma cells.Dasatinib has both anti-proliferative and anti-invasive effects in melanoma cells and combined with chemotherapy may have clinical benefit in the treatment of malignant melanoma. Metastatic melanoma is notoriously resistant to cytotoxic chemotherapy. Commonly used agents such as dacarbazine and temozolomide yield poor response rates of less than 20% and comb.Sorafenib BAY43-9006) inhibits vascular endothelial growth factor receptor (VEGFR) and Raf kinase, but also has activity against c-kit and platelet derived growth factor receptor beta (PDGFR-β). Activating B-Raf mutations are detected in greater than 60% of malignant melanomas -9006 inh and is p50 of 0.5 nM for Src kinase (IC50 of < 30 nM for the other targets) [Src kinase regulates key pathways in metastasis including cell adhesion, invasion and motility and membtargets) . Dasatintargets) , triple targets) and coloDue to the deficiency of effective treatment options for advanced melanoma and the reported relationship between Src kinase and melanoma progression, we examined the preclinical activity of Src inhibition, using dasatinib, alone and in combination with temozolomide in metastatic melanoma cell lines.2 in RPMI medium with 10% FCS (Gibco) except HT144 which was grown in McCoys 5A (Sigma-Aldrich) with 10% FCS. Stock solutions of temozolomide (9.7 mM), , epirubicin (3.45 mM), taxotere (11.6 μM) , dasatinib (10 mM), sorafenib (10 mM) (Sequoia Research Products) and imatinib (16.9 mM) (Novartis) were prepared in dimethyl sulfoxide (Sigma-Aldrich).Lox-IMVI, Malme-3M, Sk-Mel-5, and Sk-Mel-28 were obtained from the Department of Developmental Therapeutics, National Cancer Institute (NCI) and HT144 from the American Tissue Culture Centre (ATCC). Cell lines were grown at 37°C with 5% CO500 μL RIPA buffer with 1 × protease inhibitors, 2 mM PMSF and 1 mM sodium orthovanadate (Sigma-Aldrich) was added to cells and incubated on ice for 20 minutes. Following centrifugation at 10,000 rpm for 5 minutes at 4°C the resulting lysate was stored at -80°C. Protein quantification was performed using the Bicinchoninic acid (BCA) assay (Pierce). 40 μg of protein in sample buffer was heated to 95°C for 5 minutes and proteins were separated on 7.5 or 10% gels (Cambrex). The protein was transferred to Hybond-ECL nitrocellulose membrane (Amersham Biosciences). The membrane was blocked with blocking solution (PBS + 0.1% Tween + 5% skimmed milk powder (BioRad)) at room temperature for 1 hour, then incubated overnight at 4°C with 1 μg/ml primary antibody in blocking solution. The membrane was washed three times with PBS-Tween, then incubated at room temperature with anti-mouse secondary antibody (Sigma-Aldrich) at 1:1000 dilution or anti-rabbit secondary antibody (Pierce) at 1:3000 dilution) in blocking solution for 1 hour. The membrane was washed three times with PBS-Tween followed by one PBS wash. Detection was performed using Luminol (Santa Cruz Biotechnology). For detection of phosphorylated EphA2, EphA2 was immunoprecipitated from 500 μg of protein using EphA2 antibody (Millipore) and immunoblotted with a mouse anti-phosphotyrosine antibody .3 cells/well were seeded in 96-well plates, apart from HT144 and Malme-3M which were seeded at 2 × 103 cells/well. Plates were incubated overnight at 37°C followed by addition of drug at the appropriate concentrations and incubated for a further 5 days until wells were 80% to 90% confluent. All media was removed and the wells were washed once with PBS. Paranitrophenol phosphate substrate (0.263 g of PNP in 100 ml sodium acetate buffer) was added to each well and incubated at 37°C for 2 hours. 50 μl of 1 M NaOH was added and the absorbance was read at 405 nM (reference – 620 nM), as previously described [Proliferation was measured using an acid phosphatase assay. 1 × 10escribed .5 cells in matrigel-coated 24-well invasion inserts for invasion assays and uncoated inserts for migration assays. Cells were incubated for 6 hours before dasatinib treatment to allow cells to attach and then incubated at 37°C with dasatinib at varying concentrations for 24 hours. Cells were stained with crystal violet and the number of invading/migrating cells was estimated by counting 10 fields of view at 200 × magnification. The average count was multiplied by the conversion factor 140 to determine the total number of invading/migrating cells. All assays were performed in triplicate.Invasion and migration assays were performed as previously described , using 14 cells were seeded per well in 24-well plates and incubated overnight at 37°C, followed by addition of drug at the appropriate concentrations. After 72 hours, media was collected and the wells washed once with PBS. Cells were trypsinised and added to the media collected for each sample. Cells were centrifuged at 300 × g for 5 minutes and the media was aspirated. 150 μl of PBS was added, the pellet re-suspended and the total volume transferred to a round bottomed 96 well plate. 50 μL of 4% para-formaldehyde was added to the wells and mixed. Cells were incubated at 4°C for 60 minutes. The plate was centrifuged at 300 × g for 5 minutes and the supernatant aspirated leaving approximately 15 μL in each well. The remaining volume was used to resuspend the cells and 200 μL of ice cold 70% ethanol was added to the cells. The plates were then stored at -20°C for 2 hours. After fixing the cells were stained according to the protocol for the TUNEL assay (Guava Technologies). Cells were analysed on the Guava EasyCyte (Guava Technologies). Positive and negative controls were performed with each assay.2.5 × 104 cells were seeded per well in 24-well plates and incubated overnight at 37°C. After 24 hours cells were synchronised by removing the media and replacing it with serum free medium (SFM) for a further 24 hours. SFM was removed and the cells incubated for a further 6 hours in media containing serum before the drug was added at the appropriate concentrations. Plates were then incubated at 37°C for a further 24 hours. Media was collected and the wells washed once with PBS. Cells were trypsinised and added to the media collected for each sample. Cells were centrifuged at 300 × g for 5 minutes and the media was aspirated. 150 μl of PBS was added, the pellet re-suspended and the total volume transferred to a round bottomed 96 well plate. The plate was centrifuged at 300 × g for 5 minutes and the supernatant aspirated leaving approximately 15 μL in each well. The remaining volume was used to resuspend the cells and 200 μL of ice cold 70% ethanol was added. The plates were then stored at -20°C for 2 hours. After fixing the cells were stained according to the protocol for the Guava Cell Cycle assay (Guava Technologies). Cells were analysed on the Guava EasyCyte and the data was analysed using Modfit LT software (Verity).2.5 × 1050 values were calculated using CalcuSyn software (BioSoft). For Lox-IMVI, combination index (CI) values were calculated using CalcuSyn software. A CI value of < 1 is considered synergistic, 1 is considered additive and > 1 is considered antagonistic. CI values were not calculated for the other cell lines, as dasatinib did not achieve 50% inhibition of growth at concentrations up to 1 μM. The Student's t test was used to compare temozolomide IC50s alone and in combination with dasatinib, migration/invasion assays and cell cycle assays P < 0.05 was considered statistically significant. ANOVA one way analysis was performed to compare dasatinib alone, taxotere/epirubicin alone and the combination. P < 0.05 was considered statistically significant.IC50 of 35.4 nM (± 8.8 nM). HT144 and Malme-3M also display some sensitivity to dasatinib with a maximum growth inhibition of 40% and 30%, respectively, achieved in these cell lines at 1 μM dasatinib. Growth of Sk-Mel-28 and Sk-Mel-5 appear to be slightly increased in response to dasatinib treatment. IC50 values for sorafenib ranged from the most sensitive cell line Sk-Mel-5 (IC50 = 1.4 ± 0.4 μM) to the most resistant HT144 (IC50 = 4.1 ± 0.4 μM). Sensitivity to the multi-target kinase inhibitor, imatinib, was also examined in HT144 and Lox-IMVI cells. Imatinib did not inhibit the growth of either cell line at concentrations up to 5 μM revealed the combination of dasatinib and temozolomide was slightly synergistic. The IC50 for temozolomide when administered in combination with dasatinib, was significantly reduced compared to temozolomide alone in HT144 and in Malme-3M . In Sk-Mel-28, which is resistant to dasatinib, temozolomide combined with dasatinib produces a similar response to temozolomide alone .The effect of dasatinib in combination with chemotherapy was examined in the three dasatinib responsive cell lines, Lox-IMVI, HT144 and Malme-3M and in one of the dasatinib-resistant cell lines, Sk-Mel-28. In both HT144 and Malme-3M, dasatinib enhanced response to temozolomide and one resistant cell line (Sk-Mel-28). Dasatinib significantly decreased invasion of HT144 and Sk-Mel-28 cells Figure and migrSrc, EphA2, FAK and phosphorylated Src, EphA2 and FAK were detected in all cell lines tested, although the levels of phosphorylated Src kinase detected were low Figure . Phosphoin vivo) [We have evaluated the effects of dasatinib, a multi-targeted tyrosine kinase inhibitor, in human melanoma cell lines . In a prin vivo) . Therefo, the IC50 for sorafenib was above 1 μM in each case. These results suggest that dasatinib-sensitive melanoma cells are more sensitive to dasatinib than to sorafenib in vitro.Sorafenib which is currently in clinical trials for advanced melanoma, has shown little activity when tested alone but shows promising results when tested in combination with chemotherapy . In the Furthermore, dasatinib in combination with temozolomide significantly improved response in HT144 and Lox-IMVI compared to either drug alone. In Malme-3M cells, there was a small but significant improvement in response compared to temozolomide alone. In the dasatinib-resistant cell line Sk-Mel-28, the combination was slightly better than temozolomide alone although the difference was not significant. Therefore the combination of dasatinib with temozolomide may improve response in some melanoma patients. In dasatinib resistant tumours, the addition of dasatinib would not impact on sensitivity to temozolomide but may help to prevent further tumour spread by inhibiting melanoma cell migration and invasion, as we observed in dasatinib-resistant Sk-Mel-28 cells.Studies in lung cancer , head anImatinib targets Bcr-Abl, c-Kit and PDGFR. Previous studies identified that c-kit expression was reduced with melanoma progression and trials testing imatinib as a single agent showed no benefit in the clinical setting ,22. Howeet al [Imatinib however does not inhibit the growth of either HT144 or Lox-IMVI cells. Thus sensitivity of melanoma cell lines to dasatinib may be due to targeting Src kinase or EphA receptors, which are not targeted by imatinib. Differences in the level or phosphorylation of Src kinase do not appear to predict sensitivity to dasatinib in the melanoma panel. Similar to preclinical studies in other solid tumour types , phosphoet al showed tet al .50 = 0.2 nM) [Previous studies have shown that dasatinib treatment did not reduce phosphorylation of FAK at Tyr397, an autophosphorylation site required for recruitment of Src kinase which in turn phosphorylates FAK at Tyr576, Tyr577, and Tyr861 . Phospho 0.2 nM) . TherefoOther dasatinib preclinical studies did not examine the role of EphA receptors in response to dasatinib. EphA2 has been identified as a potential dasatinib sensitivity biomarker . Interesin vitro effects of dasatinib in melanoma cell lines observed in this study provide strong evidence for evaluation of dasatinib in clinical trials in melanoma patients. Two clinical trials of dasatinib in melanoma are currently underway, including a phase I/II study of dasatinib in combination with dacarbazine .The in vitro. Furthermore, combining dasatinib with temozolomide improved response in melanoma cell lines. Thus, dasatinib is an exciting new therapeutic option for malignant melanoma. Phospho-Src represents a promising pharmacodynamic marker for response to dasatinib and high levels of EphA2 may be a predictive marker for dasatinib. Identification and validation of appropriate biomarkers will be crucial to maximise the potential clinical benefits of dasatinib treatment for melanoma.Our preclinical evaluation of dasatinib, shows that it has anti-proliferative, pro-apoptotic and anti-invasive effects in some melanoma cells The authors declare that they have no competing interests.AJE contributed to the design of the study and carried out the proliferation assays, TUNEL assays, cell cycle assays, Western blotting and statistical analysis. JC and MC contributed to the interpretation of the data. NOD conceived the study, supervised the research, and participated in interpretation of the data and drafting the manuscript. All authors read and approved the final manuscript.Effect of imatinib on proliferation. The data compares the effect of imatinib on the proliferation of HT144 and Lox-IMVI.Click here for fileComparison of IC50 concentrations of temozolomide when tested alone and in combination with dasatinib in HT144, Lox-IMVI, Malme-3M and Sk-Mel-28 cells. Standard deviations represent average results of triplicate experiments. IC50 values were compared using the Student's T-test.Click here for fileCombination assays of dasatinib with epirubicin or taxotere in HT144 and Lox-IMVI.Click here for fileEffect of dasatinib on cell cycle arrest. Comparing the effect of dasatinib versus untreated cells on the percentage of cells tested in the G1, S and G2/M phases of cell cycle.Click here for file |
In the UK and many other countries, many specialties have had longstanding problems with recruitment and have increasingly relied on international medical graduates to fill junior and senior posts. We aimed to determine what specialties were the most popular and desirable among candidates for training posts, and whether this differed by country of undergraduate training.We conducted a database analysis of applications to Modernising Medical Careers for all training posts in England in 2008. Total number of applications (as an index of popularity) and applications per vacancy (as an index of desirability) were analysed for ten different specialties. We tested whether mean consultant incomes correlated with specialty choice.In, 2008, there were 80,949 applications for specialty training in England, of which 31,434 were UK graduates (39%). Among UK medical graduates, psychiatry was the sixth most popular specialty (999 applicants) out of 10 specialty groups, while it was fourth for international graduates . Among UK graduates, surgery (9.4 applicants per vacancy) and radiology (8.0) had the highest number of applicants per vacancy and paediatrics (1.2) and psychiatry (1.1) the lowest. Among international medical graduates, psychiatry had the fourth highest number of applicants per place (6.3). Specialty popularity for UK graduates was correlated with predicted income (p = 0.006).Based on the number of applicants per place, there was some consistency in the most popular specialties for both UK and international medical graduates, but there were differences in the popularity of psychiatry. With anticipated decreases in the number of new international medical graduates training in the UK, university departments and professional associations may need to review strategies to attract more UK medical graduates into certain specialties, particularly psychiatry and paediatrics. A number of countries have increased medical school places to address shortages in the amount of graduates training in certain specialties -3. To maIn the UK, the introduction of a new national application system for medical specialties in 2007, Modernising Medical Careers (MMC), was designed in part to redress the uneven demand for medical specialties by introducing a national competition for places. Using MMC data for applications for training posts in 2008, we examined the specialty choices of UK compared with international medical graduates (IMGs). We aimed to determine which specialties were the most popular and desirable, and whether this differed by country of training. Our hypotheses were related to the known preferences of medical students for specialty training , but as http://www.mmc.nhs.uk/ is the national clearing house for all post-graduate medical specialty training applications. It was set up in 2007 and is administered as an office of the UK Department of Health in London. In 2008, applications were locally led, and individuals could apply to as many specialty choices as they wishes, apart from obstetrics and gynaecology and general practice where the number of applications was limited nationally. Information about the country of medical school is collected as part of the application form. We defined IMGs as those whose medical school education was completed outside the UK. We requested and received summary information about all applications for all training grades and specialties in England in 2008, including the number of advertised posts in English Deaneries and the fill rate for each specialty by training grade.MMC http://www.ic.nhs.uk/. As UK consultant salaries are determined centrally and not thought to vary markedly, means were considered to be the best estimate of average incomes. A plausible hypothesis was that the attractiveness of specialty training, estimated as number of applications per available post, would be influenced by the predicted financial rewards. We tested therefore whether average consultant incomes were correlated with specialty choice in UK graduates compared with IMGs.To compare competition levels for the estimated economical attractiveness of medical specialty, we also requested average consultant incomes broken down by specialty based on payments made to staff in the three months July to September 2008 from the Workforce Analysis Team at the NHS Information Centre s) was used to examine if average income of specialty was correlated with choice. Statistical analysis was done with StatsDirect and SPSS .We performed chi-square tests to examine differences in the choices of specialty by country of medical training (UK vs. IMG). We grouped specialties according to the following: Accident and Emergency ; Medicine ; Laboratory Medicine ; General Practice; Psychiatry; Paediatrics (which included Paediatric Cardiology); Public Health; and Surgery (which included Trauma and Orthopaedics). We used a large grouping for Medicine as applications at more junior levels are for core medical training, and subspecialties are chosen after some years of this core training. We also examined trends for specialty by training seniority in Psychiatry. Spearman's rank correlation were filled. There were 80,949 applications by doctors for these posts, of whom 49,515 (61%) were IMGs.In 2008, medicine had the highest number of training places , followed by General Practice , and Surgery n = 1289, 13%). Psychiatry had 944 posts, which represented 9% of all training posts .The number and proportion of applicants with UK and international medical qualifications varied significantly between the different specialty groups: in Surgery, the proportion of UK graduates was highest at 50%; in Psychiatry, it was lowest at 14% Figure . There ws = 0.95).As an index of relative popularity, we examined the absolute number of applications for different specialties Figure . PsychiaAs an index of relative desirability, we computed applications per vacancy in each specialty for UK and IMGs separately Table . For UK s = 0.85, p = 0.006 in UK graduates; rs = 0.44, p = 0.25 in IMGs).We examined the correlation between mean income levels by consultants in each specialty and their applicants per place by UK graduates and IMGs. Estimated annual NHS consultant salaries within the specialty groups varied from £108 k (Psychiatry) to £123 k (Surgery). Expected consultant salary correlated highly with specialty popularity in UK graduates, but not in IMGs . As part of MMC, information was collected on medical school of origin of all applicants, and this enabled us to assess any differences in specialty choice between UK graduates and IMGs. Previous work on specialty preference has been based on surveys of UK medical school graduates, and thus not been able to assess the impact of overseas applicants . In addiThe findings on Psychiatry were notable. The first was Psychiatry had the highest proportion of overseas applicants at 86%. Second, the number of applications per training place, a marker of specialty desirability, was lowest for Psychiatry among UK graduates. Psychiatry has had longstanding problems with recruitment in the UK ,8 and otA number of implications arise from the large proportion of overseas applicants to Psychiatry. The first relates to the potential impact of the loss of qualified doctors on the medical systems of the country of origin of these international graduates . Second,Another specialty with low numbers of applicants per place was Paediatrics which had the second lowest proportion of applicants per place among UK applicants and the lowest proportion among IMGs. In the US, barriers to careers in Paediatrics have included perceptions that it is associated with lower incomes, longer hours, more on call, and high rates of burnout . In the Our finding that specialty popularity was not correlated with the mean consultant income in that specialty for IMGs may be the consequence of a number of factors. Factors that may be relevant in driving these doctors from their countries include hierarchical and inflexible medical careers. A specific interest in certain specialities, such as Psychiatry, or a lack of a materialistic attitude seem less likely an explanations for the different behaviour of IMGs. Other factors including the influence of undergraduate medical education on specialty choice may be relevant and, in some individuals, a reduced confidence to compete in the more desirable specialty groups may be important when the priority is to find any training post at all. Nevertheless, one would assume that motivations for subject choice are similar in principle between UK trainees and IMGs. If IMGs opt for Psychiatry, that may just reflect the availability of vacancies (and relative chances of success), given that the attractions of training in the UK are still the same for Psychiatry. The vastly different salaries in the UK compared with some overseas countries may also mean that IMGs do not find differential amounts of pay important in determining their choice.This study is limited by the use of data from one country and from one year, and is based on applications. The impact of the new medical schools and the graduate entry programmes will not have fully materialised by 2008, and it is possible that application patterns may change in subsequent years. However, evidence from a large survey of graduate entrants showed little difference in specialty choice between graduate and non-graduate entrants to UK medical schools, with a modest increase in the number who wish to train in General Practice . In addiThe 57% increase in UK medical graduates from 1998 to 2005 has been welcomed as a positive move to address workforce planning issues , which pThis analysis of all 80,949 applications for medical training in England found large differences between specialties in terms of popularity and desirability, which were mostly consistent depending on whether the applicant was a UK graduate or an IMG. Based on applicants per place, Psychiatry and Paediatrics were the least popular broad specialty groupings for UK medical graduates. Improving recruitment and retention of trainee doctors in certain specialties remain significant issues for consideration by medical schools and professional associations.The authors declare that they have no competing interests.SF and KPE devised the study, interpreted the findings, drafted the article, critically revised it, and approved the final version. KPE conducted the analysis.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6920/9/77/prepub |
The Ad5CMV-αVEGF vector may be useful in targeting the tumour vasculature in the treatment of breast cancer. © 2001 Cancer Research Campaign http://www.bjcancer.comIncreased expression of VEGF in several types of tumours has been shown to correlate with poor prognosis. We used a replication-deficient adenoviral vector containing antisense VEGF cDNA (Ad5CMV-αVEGF) to down-regulate VEGF expression and increase the efficiency of delivery of the antisense sequence in the human breast cancer cell line MDA231-MB. Transfection of these cells with Ad5CMV-αVEGF in vitro reduced secreted levels of VEGF protein without affecting cell growth. Moreover, injection of the Ad5CMV-αVEGF vector into intramammary xenografts of these cells established in nude mice inhibited tumour growth and reduced the amount of VEGF protein and the density of microvessels in those tumours relative to tumours treated with the control vector Ad5(dl312). Our results showed that antisense VEGF |
Acrythosiphon pisum. However, the invasive soybean aphid, Aphis glycines, lacks in any significant molecular resources.Aphids are one of the most important insect taxa in terms of ecology, evolutionary biology, genetics and genomics, and interactions with endosymbionts. Additionally, many aphids are serious pest species of agricultural and horticultural plants. Recent genetic and genomic research has expanded molecular resources for many aphid species, including the whole genome sequencing of the pea aphid, Buchnera aphidicola, as well as sequences that suggest the presence of Hamiltonella defensa, a facultative endosymbiont.Two next-generation sequencing technologies (Roche-454 and Illumina GA-II) were used in a combined approach to develop both transcriptomic and genomic resources, including expressed genes and molecular markers. Over 278 million bp were sequenced among the two methods, resulting in 19,293 transcripts and 56,688 genomic sequences. From this data set, 635 SNPs and 1,382 microsatellite markers were identified. For each sequencing method, different soybean aphid biotypes were used which revealed potential biotype specific markers. In addition, we uncovered 39,822 bp of sequence that were related to the obligatory endosymbiont, Molecular resources for an invasive, non-model aphid species were generated. Additionally, the power of next-generation sequencing to uncover endosymbionts was demonstrated. The resources presented here will complement ongoing molecular studies within the Aphididae, including the pea aphid whole genome, lead to better understanding of aphid adaptation and evolution, and help provide novel targets for soybean aphid control. Aphids are among the most important and intensely studied insect taxa. Species within the Aphididae represent model systems to study basic and broad biological questions including speciation and adaptation Acrythosiphon pisum and green peach aphid, Myzus persicae. The remaining 3 species belong to the tribe Aphidini: the brown citrus aphid, Toxoptera citricida; the bird cherry-oat aphid, Rhopalosiphum padi; and cotton-melon aphid, Aphis gossypii. Gene divergence within tribes has been estimated to be 5–10%, and up to 15% when comparing among tribes Ac. pisum, is complete D. melanogaster genome Ac. pisum genome Given the importance of the Aphididae, it is no surprise that substantial molecular resources exist for a few species Buchnera aphidicolaBuchnera produces essential amino acids and nutrients lacking from the insect host's diet Buchnera and Ac. pisum has been minimal, but metabolic pathway sharing is extensive Buchnera, the presence and roles of other facultative endosymbionts such as Hamiltonella defensa in aphid defense and adaptation are becoming better understood Although substantial genomic information existed for bacterial endosymbionts before any such aphid resources, the development of aphid genomics has led to a better understanding of the interaction between bacterial endosymbionts and host species, namely with Aphis glycines. Better known as the soybean aphid, this species invaded North America in 2000 Glycine max L. Merr.) is the third largest crop in USA. The estimated value of 2008 soybean crop in the USA alone was over $27 billion (USDA-NASS). Yield losses due to soybean aphid were reported to be more than 50% in Minnesota in 2001 and up to 58% in China In this study, we present both transcriptomic and genomic resources for a less studied aphid, Rag1 resistance gene whereas Biotype 2 does. Although the formation of biotypes is fairly common within Aphididae—14 species have at least 2 described biotypes each Despite the genetic bottleneck during the recent introduction e.g. microsatellites, single nucleotide polymorphism (SNPs), for population-level genetic analyses. These issues become readily apparent for non-model invasive species, whose importance is heightened due to the environmental and ecological impacts on the invaded regions. For the soybean aphid in particular, maximizing outputs from sequencing projects is difficult because of a genetic bottleneck and a lack of molecular resources.The current next-generation sequencing technologies offer a prime opportunity to generate molecular resources for many non-model species Our goal was to rapidly generate molecular resources for the soybean aphid and find potential candidate genes responsible for biotype adaptation. In this study, we used multiple platforms: Illumina technology to target genomic, non-coding, and potentially more polymorphic regions and Roche-454 technology to generate longer reads from the transcriptome, which would allow a more robust characterization to other aphid EST libraries. In addition, we used a different biotype as starting material for each technology that uncovered potential diagnostic markers related to biotype adaptation.Rag1 Rag1, whereas Biotype 2 (OH), hereafter B2, can survive and reproduce on Rag1. These biotypes are housed in 2 different locations at The Ohio Agricultural Research and Development Center (OARDC) to prevent contamination. B1 individuals were obtained from the National Soybean Research Laboratory, Department of Crop Sciences, University of Illinois, Urbana-Champaign in February 2008. An OARDC laboratory population was established from these initial individuals. The laboratory population of B2 was established from field collected aphids from Wooster, OH in 2005. The aphid laboratory populations were maintained on cultivar Williams 82 (susceptible to both biotypes) in growth chambers or rearing rooms at temperatures between 22 and 24°C, with a photosynthetically active radiation of 330 µmol m−2s−1 for 15 h daily and 60 to 70% relative humidity The two soybean aphid biotypes used for this study, Biotype 1 (IL) and Biotype 2 (OH), show differential responses to soybean plants containing the soybean aphid resistance gene, Only B1 aphids were used for the 454 transcript sequencing. Total RNA was isolated from 50 aphids with Trizol Reagent (Invitrogen). Approximately 10–20 µg total RNA were sent to Purdue University Genome Center for 454 cDNA library construction and sequencing using ¼ of a pico titer plate. Briefly, the poly(A) RNA was collected using RiboMinus (Invitrogen) kit following manufacturer's instructions. Double-stranded cDNA was synthesized using cDNA Synthesis System Kit (Roche) and separated in an agarose gel. The DNA bands of 500–800 bp were excised from the gel and purified. The isolated DNA was blunt ended, ligated to adapters and immobilized on Library Immobilization Beads. After the gaps were repaired, a single-stranded DNA library was isolated from the beads and quality controlled for the correct size using a LabChip 7500 machine. The concentration and the proper ligation of the adapters were examined using qPCR. The library was subjected to sequencing using Roche 454 GS Titanium platform using 1/4according to manufacturer's protocol.EcoRI in a total of 25 µL. Restriction digests were run overnight to ensure complete digestions. DNA was then electrophoresed in a 1% agarose gel, and the fragments 2–3 Kb in size were extracted and purified using the QIAquick Gel Extraction Kit (Qiagen). The procedure was repeated with 3 separate reactions to obtain a total of 1 µg DNA. DNA was then fragmented into 200 bp using the Adaptive Focused Acoustics technology from Covaris ™ and then purified using QIAquick PCR Purification Kit (Qiagen). Using only the 2–3 Kb fragments resulted in a “reduced representation” library Only B2 aphids were used for Illumina sequencing. DNA was extracted from 25–30 aphids of the B2 laboratory population using the OMEGA EZNA DNA tissue kit following manufacturer's instructions. Whole extractions were then subjected to restriction digests with 5 µg of DNA and 25 U of About 1 µg of the 200-bp fragments was used to prepare Illumina paired-end library using Paired-End Sequencing Sample Preparation Kit (Illumina) following manufacturer's instructions. Briefly, the DNA fragments were end-repaired and ‘A’ bases were added to the 3′-end of the DNA fragments, followed by the ligation of Illumina adapters. After purification, a 10 cycle enrichment of the adapter-modified fragments was performed. The library was validated by measuring 260/280 ratio using a Nanodrop D-1000 spectrophotometer and TBE polyacrylamide gel electrophoresis. The validated library was sent for sequencing using a single lane on an Illumina GAII.A. glycines B1 were assembled using Newbler program (Roche) after the removal of adapter sequences. The contigs and singletons were further assembled using Phrap program. To achieve better consistency, the contigs and singletons were renamed in the format of “ESTAGB1WB000001” with “EST” standing for expressed sequence tag, “AG” for Aphis glycines, “B1” for B1, “WB” for whole body library, and “000001” for an arbitrarily assigned number.The 454 transcript data from the A. glycines B2 were assembled using velvet program de novo assembly than single-end sequences . We selected the contigs with a length cutoff of 500 bp for further analysis to limit the inclusion of contaminant or low quality sequences and to ensure adequate flanking sequence was present to design PCR primers for microsatellite and SNP analysis. To achieve better consistency, these contigs were renamed in the format of “GMAGB2RR000001” with “GM” standing for genomic, “AG” for Aphis glycines, “B2” for B2, “RR” for reduced representation library, and “000001” for an arbitrarily assigned number.The 51-bp Illumina paired-end data of the reduced representation genomic library of A. glycines B1 and the genomic sequences of A. glycines B2 were annotated by searching against GenBank non-redundant database using BLASTx algorithms A. glycines B1 transcriptome sequences were searched against the draft genome (Acyr_1.0) of pea aphid Ac. pisum (http://www.aphidbase.com/aphidbase) using BLASTn algorithm The transcriptome sequences of A. glycines B2 Illumina data were predicted by MAQ program (http://maq.sourceforge.net/) with the default 3-read threshold for SNP calling. The SNPs in A. glycines B1 454 data were predicted by gsMapper program (Roche) with an arbitrary criterion of at least 4 reads supporting the consensus or variant. We also identified the SNPs between the two biotypes by mapping the 454 raw reads to the Illumina contigs using the gsMapper program with the above settings.The SNPs in The Allele Specific Primer Extension (ASPE) assay was used for validation of 11 SNPs. Briefly, the ASPE entails 2 rounds of PCR: one to amplify sequence flanking the SNP, and a second, ASPE- PCR. For the ASPE-PCR reaction, the allele-specific primers are tagged, allowing linking of fluorescently labeled polystyrene microspheres, with each SNP allele associated with a different color The microsatellite markers were identified using the msatfinder program with the minimal repeat number of 8 for di-nucleotide motifs and 5 for motifs consisting of three and more nucleotides Hamiltonella defensa sequence confirmation, primers were designed using Primer 3 For A. glycines B1 and raw Illumina genomic reads of A. glycines B2 were deposited in NCBI Sequence Read Archive under the accession number of SRA010354.The raw 454 transcript reads of A. glycines B1 yielded 102,024 transcript reads totaling 30,438,043 bp. After the removal of adapter sequences, the trimmed sequences went through two rounds of assembly using Newbler and phrap programs, resulting in 19,293 high quality transcript sequences totaling 7,366,599 bp. In total, the 454 transcript data consisted of 7,427 contigs (>1 read after assembly) and 11,866 singletons (a single read after assembly). The singletons ranged from 50–824 bp with an average length of 281 bp and total length of 3,334,913 bp matched to proteins in the GenBank nr database with the E value cutoff of 1e-5 (Ac. pisum. Another 539 matches (7%) were to non-aphid insect proteins. The rest of the matches were to proteins of non-insect eukaryotes, bacteria, viruses, and synthetic construct. At the nucleotide level, 13,818 transcripts (72%) matched to the Ac. pisum draft genome based on the BLASTn search with an E value cutoff of 1e-5. A comparison with the ESTs of A. gossypii using tBLASTx algorithm revealed 3,875 (20%) of A. glycines B1 transcripts had significant similarity to A. gossypii sequences.Among the 19,293 high quality transcript contigs and singletons, of of 1e-5 . A vast A. glycines B2 yielded 2,437,477 paired-end reads that were 51 bp in length, totaling 248,622,654 bp. The assembly using velvet program resulted in 56,688 contigs of 8,994,108 bp, ranging from 61 to 2,680 bp in contig length. Only the 1,240 contigs of over 500 bp in length, totaling 881,864 bp, were selected for the molecular marker prediction to ensure adequate flanking sequence for PCR primer design. While both transcripts and genomic sequences were used for molecular marker predictions, gene annotation of the genomic sequences was not performed because the intron-containing genomic sequences were too short for informative gene prediction and annotation.The reduced representation genomic sequencing for A. glycines B2, 293 (24%) had significant matches to proteins in GenBank nr database A. glycines B2 contigs had sequence similarity to Ac. pisum genomic sequences.Among the 1,240 contigs of database . A signiAphis spp. range from 479 Mbp to 655 Mbp A. glycines and Ac. pisum at the nucleotide and protein (deduced amino acid) levels. Despite this similarity, 28% of A. glycines B1 sequences and 19% of A. glycines B2 sequences had no similar sequences with the current Ac. pisum draft genome. Of the 28% of A. glycines B1 transcriptomic sequences, 75 matched to Ac. pisum proteins, 154 to proteins of other organisms, and the remaining 5,246 had no significant similarity to any proteins in GenBank nr database. Among the 19% (237) of A. glycines B2 genomic sequences that do not have similar sequences in the current Ac. pisum draft genome, 16 matched to Ac. pisum proteins, 59 to proteins of other organisms, and 162 had no significant similarity to any proteins in the GenBank nr database. The sequences with potential bacterial, viral, and artificial origins were removed from further annotation and molecular marker development.The genome size of the soybean aphid is unknown, although estimate from other A. glycines B1 was the most dominant biological process term, while the most dominant molecular function and cellular component terms were “protein binding” and “cytoplasma”, respectively. The GO terms were summarized according to the top-level terms (Gene Ontology (GO) terms were assigned to 3,031 transcripts of cines B1 . The GO el terms . The topA. glycines B1 transcripts , which digest single-stranded RNA based on sequence similarity to the microRNA or siRNA involved in RNA interference (RNAi) A. glycines B2 were di- or tri-nucleotide repeats were found in the Schizaphis graminumtrpG, trpE, trpD, argS, dapF, ilvC, leuS, aroE, hisG, Buchnera is responsible for the synthesis of essential amino acids in the aphid's diet, these genes could play a role in the different biotype responses on resistant soybeans.We identified 83 sequences among the Hamiltonella defensa. PCR amplification of this fragment was successful in all 16 additional soybean aphid individuals tested. DNA sequencing revealed exact matches to the previous sequences, and no differences among biotypes. H. defensa is a facultative symbiont of other phloem-feeding insects and its 2.1 Mbp genome showed dramatic genome reduction compared to its close free-living relatives of Yersinia and Serratia species A. glycines using universal primers spanning the intergenic spacer between the 16S and 23S rDNA genes S. symbiotica nor R. insecticola were found. While a H. defensa PCR fragment was amplified using conserved rDNA primers, sequencing of this fragment revealed more similarity to Arsenophonus, another facultative endosymbiont not found in either our 454 or reduced representation libraries. Given the close genetic similarity between Hamiltonella and Arsenophonus, it is possible that preferential amplification occurred with the universal rDNA primers, decreasing the chance of H. defensa detection through standard PCR A. glycines harbors H. defensa.We also detected a fragment (1.2 kb) with similarity to A major advantage of next generation sequencing technologies is the rapid and inexpensive generation of molecular resources relative to traditional methods. Choosing among technologies to maximize information content depends not only on the research interests and needs but on the organism's biology as well. In the case of the soybean aphid, the recent bottleneck during the North American invasion severely decreased genetic diversity Figure S1Aphis glycines B1 transcript sequences. Summary of top-level GO terms of (A) Biological Process, (B) Cellular Component, and (C) Molecular Function assigned to A. glycines B1 transcript sequences. Percentage was calculated by considering the total number of term assignment in that category, which is larger than the number of transcripts assigned terms in that category, as 100%.Summary of the top-level Gene Ontology terms of (2.84 MB TIF)Click here for additional data file.Table S1Aphis glycines B1 transcript sequencesGene Ontology assignment for (0.61 MB XLS)Click here for additional data file.Table S2Aphis glycines B1 transcript sequences in Kyoto Encyclopedia of Genes and Genome (KEGG)Metabolic pathways for (0.06 MB XLS)Click here for additional data file.Table S3Aphis glycines B1 transcript sequencesPredicted Pfam domains in (0.64 MB XLS)Click here for additional data file.Table S4Aphis glycines B2 genomic sequencesSingle nucleotide polymorphisms (SNPs) predicted in (0.07 MB XLS)Click here for additional data file.Table S5Aphis glycines B1 transcript sequencesSingle nucleotide polymorphisms (SNPs) predicted in (0.03 MB XLS)Click here for additional data file.Table S6Aphis glycines B1 and B2 sequencesSingle nucleotide polymorphisms (SNPs) predicted between (0.02 MB XLS)Click here for additional data file.Table S7Aphis glycines B1 and B2 sequencesMicrosatellite loci predicted in (0.21 MB XLS)Click here for additional data file.Table S8Aphis glycines B1 and B2 sequencesPotential Buchnera sequences in (0.03 MB XLS)Click here for additional data file. |
Suicide is an important issue in the Indian context. More than one lakh (one hundred thousand) lives are lost every year to suicide in our country. In the last two decades, the suicide rate has increased from 7.9 to 10.3 per 100,000. There is a wide variation in the suicide rates within the country. The southern states of Kerala, Karnataka, Andhra Pradesh and Tamil Nadu have a suicide rate of > 15 while in the Northern States of Punjab, Uttar Pradesh, Bihar and Jammu and Kashmir, the suicide rate is < 3. This variable pattern has been stable for the last twenty years. Higher literacy, a better reporting system, lower external aggression, higher socioeconomic status and higher expectations are the possible explanations for the higher suicide rates in the southern states.The majority of suicides 37.8%) in India are by those below the age of 30 years. The fact that 71% of suicides in India and the 7.8% in Ivs social stressors in the causation of suicide has divided our thoughts on suicide. Suicide is best understood as a multidimensional, multifactorial malaise. Suicide is perceived as a social problem in our country and hence, mental disorder is given equal conceptual status with family conflicts, social maladjustment etc.[Although suicide is a deeply personal and an individual act, suicidal behaviour is determined by a number of individual and social factors. Ever since Esquirol wrote that “All those who committed suicide are insane” and Durkheim proposed that suicide was an outcome of social / societal situations, the debate of individual vulnerability ment etc. AccordinDivorce, dowry, love affairs, cancellation or the inability to get married (according to the system of arranged marriages in India), illegitimate pregnancy, extra-marital affairs and such conflicts relating to the issue of marriage, play a crucial role, particularly in the suicide of women in India. A distressing feature is the frequent occurrence of suicide pacts and family suicides, which are more due to social reasons and can be viewed as a protest against archaic societal norms and expectations. In a population-based study on domestic violence, it was found that 64% had a significant correlation between domestic violence of women and suicidal ideation. The popun = 15629). The majority (82.2%) of such reports come from Europe and North America with a mere 1.3% from developing countries.[Mental disorders occupy a premier position in the matrix of causation of suicide. Majority of studies note that around 90% of those who die by suicide have a mental disorder.[majority 2.2% of sountries. and Bangountries. in IndiaCountless experts have found that affective disorders are the most important diagnosis related to suicide. In Chennai, 25% of completed suicides were found to be due to mood disorders. However, the suicide rate increased to 35% when suicide cases with adjustment disorder with depressed mood were also counted. The crucial and causal role of depression in suicide has limited validity in India. Even those who were depressed, were depressed for a short duration and had only mild to moderate symptomatology. The majority of cases committed suicide during their very first episode of depression and more than 60% of the depressive suicides had only mild to moderate depression. AlthoughP = 0.001).Personality disorder was found in 20% of completed suicides. The OR was 9.5 (CI 2.29-84.11). Cluster B personality disorder was found in 12% of suicides. Comorbid diagnosis was found only in 30% of suicides. A historThe media sometimes gives intense publicity to “suicide clusters” - a series of suicides that occur mainly among young people in a small area within a short period of time. These have a contagious effect especially when they have been glamorized, provoking imitation or “copycat suicides”. This phenomenon has been observed in India on many occasions, especially after the death of a celebrity, most often a movie star or a politician. The wide exposure given to these suicides by the media has led to suicides in a similar manner. Copying methods shown in movies are also not uncommon. This is a serious problem especially in India where film stars enjoy an iconic status and wield enormous influence especially over the young who often look up to them as role models.n = 31) around the country. These copycat suicides caused public outcry and was considered one of the reasons for the fall of the government in power at that time.[The implementation of the recommendation of the Mandal Commission to reserve 27% of the positions for employment in Government created unrest in the student community and a student committed self-immolation in front of a group of people protesting against such a reservation. This was sensationalized and widely publicized by the media. There was a spate of student self-immolation .[Religion acts as a protective factor both at the individual and societal levels. The often-debated question is whether the social network offered by religion is protective or whether it is the individual's faith. A study in Chennai found that the OR for lack of belief in God was 6.8 (CI 2.88-19.69). Those whIn India, attempted suicide is a punishable offence. Section 309 of the Indian Penal Code states that “whoever attempts to commit suicide and does any act towards the commission of such an offense shall be punished with simple imprisonment for a term which may extend to one year or with a fine or with both”.However, the aim of the law to prevent suicide by legal methods has proved to be counter-productive. Emergency care to those who have attempted suicide is denied as many hospitals and practitioners hesitate to provide the needed treatment fearful of legal hassles. The actual data on attempted suicides becomes difficult to ascertain as many attempts are described to be accidental to avoid entanglement with police and courts.The view that suicide cannot be prevented is commonly held even among health professionals. Many beliefs may explain this negative attitude. Chief among these is that suicide is a personal matter that should be left for the individual to decide. Another belief is that suicide cannot be prevented because its major determinants are social and environmental factors such as unemployment over which an individual has relatively little control. However, for the overwhelming majority who engage in suicidal behaviour, there is a probably an appropriate alternative resolution of the precipitating problems. Suicide is often a permanent solution to a temporary problem.Mrazek and Haggerty's frameworIndia grapples with infectious diseases, malnutrition, infant and maternal mortality and other major health problems and hence, suicide is accorded low priority in the competition for meager resources. The mental health services are inadequate for the needs of the country. For a population of over a billion, there are only about 3,500 psychiatrists. Rapid urbanization, industrialization and emerging family systems are resulting in social upheaval and distress. The diminishing traditional support systems leave people vulnerable to suicidal behavior. Hence, there is an emerging need for external emotional support. The enormity of the problem combined with the paucity of mental health service has led to the emergence of NGOs in the field of suicide prevention.The primary aim of these NGOs is to provide support to suicidal individuals by befriending them. Often these centers function as an entry point for those needing professional services. Apart from befriending suicidal individuals, the NGOs have also undertaken education of gatekeepers, raising awareness in the public and media and some intervention programmes. However, there are certain limitations in the activities of the NGOs. There is a wide variability in the expertise of their volunteers and in the services they provide. Quality control measures are inadequate and the majority of their endeavors are not evaluated.The World Health Organization's (WHO's) suicide prevention multisite intervention study on suicidal behaviors (SUPRE-MISS), an intervention study, has revealed that it is possible to reduce suicide mortality through brief, low-cost intervention in developing countries.There is an urgent need to develop a national plan for suicide prevention in India. The priority areas are reducing the availability of and access to pesticide, reducing alcohol availability and consumption, promoting responsible media reporting of suicide and related issues, promoting and supporting NGOs, improving the capacity of primary care workers and specialist mental health services and providing support to those bereaved by suicide and training gatekeepers like teachers, police officers and practitioners of alternative system of medicine and faith healers. Above all, decriminalising attempted suicide is an urgent need if any suicide prevention strategy is to succeed in the prevailing system in India.th September - World Suicide Prevention Day: The World Suicide Prevention Day was formally announced on 10th September, 2003. Each year the International Association for Suicide Prevention (IASP) in collaboration with WHO uses this day to call attention to suicide as a leading cause of premature and preventable death. The theme for the year 2007 is “Suicide Prevention—Across the Life Span”. It calls attention to the fact that suicide occurs at all ages and that suicide prevention and intervention strategies may be adapted to meet the needs of different age groups. It is hoped that the theme will focus on vulnerable, ignored and stigmatized groups and also draw together researchers, clinicians, societies, politicians, policy makers, volunteers and survivors in a concerted action.10Suicide is a multifaceted problem and hence suicide prevention programmes should also be multidimensional. Collaboration, coordination, cooperation and commitment are needed to develop and implement a national plan, which is cost-effective, appropriate and relevant to the needs of the community. In India, suicide prevention is more of a social and public health objective than a traditional exercise in the mental health sector. The time is ripe for mental health professionals to adopt proactive and leadership roles in suicide prevention and save the lives of thousands of young Indians. |
Many kinds of microevolutionary studies require data on multiple polymorphisms in multiple populations. Increasingly, and especially for human populations, multiple research groups collect relevant data and those data are dispersed widely in the literature. ALFRED has been designed to hold data from many sources and make them available over the web. Data are assembled from multiple sources, curated, and entered into the database. Multiple links to other resources are also established by the curators. A variety of search options are available and additional geographic based interfaces are being developed. The database can serve the human anthropologic genetic community by identifying what loci are already typed on many populations thereby helping to focus efforts on a common set of markers. The database can also serve as a model for databases handling similar DNA polymorphism data for other species. In our data model, we consider the individual specific polymorphisms as “sites” within a “locus” where “locus” can be a functional gene or an arbitrarily defined segment of DNA that may have no coding regions nearby. An allele at a site is a specific nucleotide sequence. Alleles can be of different lengths or just differ at a single nucleotide. Tables in ALFRED can handle all types of DNA polymorphisms including Single Nucleotide Polymorphisms (SNPs), insertion/deletions (indels), Short Tandem Repeat Polymorphisms (STRPs), Variable Number Tandem Repeats (VNTRs) and combinations of multiple sites (haplotypes). So that the same polymorphism can be studied by multiple laboratories and the results compared, it is essential that the polymorphism be described unambiguously. In ALFRED this involves not only storing relevant DNA sequence but also protocols and links to such international databases as dbSNP where the full genomic context is given.As ALFRED is designed to address anthropological and evolutionary research questions, it includes the detailed description of the population samples . Such information includes the geographic context and language spoken, at a minimum. Because relevant research questions involve variation in allele frequencies, the samples of individuals used to calculate an allele frequency need to be considered separately from the populations they represent. Various ascertainment biases could exist and even a single population can have genetic structure.As of September 2005, ALFRED contained 35,531 frequency tables (a single population sample typed for a single site) for 1302 sites in 573 loci. There are >1382 population samples typed for at least one of these sites. Note that not all sites are typed for all populations and vice versa. The general emptiness of the site X population data matrix is a problem for the field, as discussed later.ALFRED has gone through different stages of development. In the initial stage, we used the rapid prototyping technique to identify the user needs and to design and develop the database system. To implement the prototype system, Microsoft’s Access was used to create the database. Access is developer friendly in terms of its ease of code development and code change. Access provides an easy-to-use graphical interface for developers to create tables and forms for data queries and display. This was critical as the initial development of ALFRED was an interactive and iterative process in which system requirements tended to change rapidly. The Web front-end was built using Active Server Pages (ASP). Most of the user interface code was written in Visual Basic scripts (VBscripts) and database access was implemented using Open Database Connectivity (ODBC). We used Internet Information Server (IIS) as our Web server (ASP is a part of IIS), which runs on Windows 2000. The use of Access together with ASP enabled us to achieve rapid prototyping.With the system becoming more stable and the size of the database growing, we began to look for a more robust and powerful database engine. We have migrated the ALFRED database from Access to Oracle (version 9i). The database as well as the user interface code required several modifications to ensure complete compatibility.Daily curation of ALFRED data is performed through a separate web application that is password and firewall protected. This application is written in Java using servlets, JSPs, JDBC, Java Mail and HTML. In addition every curatorial action through the application is logged.Sites table) within a locus (Loci table) and samples (Samples table) of populations (Populations table). Populations are organized by geographic regions (Geographic_Region table). In our database representation, one population can have more than one sample. It is important to maintain distinction of separate samples of the same population collected from different geographic regions but grouped under the same population. Population samples are typed to determine frequencies of alleles (Alleles table) at a site. The linkage between a polymorphism and a sample is captured in the Typed_Sample bridging table. In addition, the Typed_Sample table associates the typing method with a specific frequency. Multiple different typing methods exist for characterizing many polymorphisms and could be developed for almost any polymorphism. Almost all methods can be affected by differences in the DNA sequence other than those occurring at the site being assayed, whether in the adjacent few nucleotides for 5′ exo- and oligo annealing assays or more distantly under the 3′ end of a PCR primer. Whether such additional variation is relevant to a given allele frequency will depend on the typing method used. The allele frequency data for each Typed_Sample entry are stored in the Frequencies table. The typing method used for typing the site for allele frequencies is stored in the Typing_Method table. Detailed descriptions of the individual tables (including their fields) are available via: http://alfred.med.yale.edu/alfred/table_list.asp.ALFRED is a relational database, with the data stored in tables that are related through the primary-foreign key mechanism. The core structure of our database, as shown in Publications table and intermediate tables are defined to link Publications to Frequencies, Samples, Sites and Loci. Links to other Web sites are stored in the URLs table. These links are associated with the Loci, Sites, Populations and Publication tables. All frequency records are linked to the contributor (Contributors table), which stores information about individuals who contribute the allele frequency data.All publication related information is stored in a single http://alfred.med.yale.edu/alfred/recordinfo.asp?UNI D=<UID> .Every record in ALFRED has a unique identifier (UID). The UIDs are a text string consisting of three parts: a Table Identifier, a Record Number, and a Check Character. The Table Identifier is a two character symbol representing the table the record belongs to, such as PO for POpulations, LO for LOci and so on. The Record Number is an internal identifier for the specific record. The Check Character is a simple checksum for the digits in the Record Number. The Check Character is determined by summing the digits of the Record Number, taking the modulo 26 of that number, and representing the resulting number as an upper case ASCII character (A-Z). For example, LO000423J is the UID for the locus ADH4 . Based on these UIDs, we can create URLs in the following format: LinkOut function provided by NCBI’s search interface ‘Entrez SNP’. This makes ALFRED’s data accessible from NCBI.Other web resources can utilize these URLs to access ALFRED for allele frequency tables and related information. In addition, ALFRED UIDs are mapped to corresponding dbSNP accession number (rs) and GDB ids. This mapping information has allowed us, for example, to utilize the ALFRED curators follow certain guidelines when extracting data from the literature. Locus/site information and population/sample information along with the actual data have to meet specific criteria. For example, some researchers publish data on “Asians”. However, the term “Asians” is so general and can refer to a diverse group of populations with genetic differences among them . If the While the basic structure of the database has not changed since the last paper several Geographic_Region table to support the linking of a population to multiple geographic regions and the table ‘Synonyms’ to facilitate the new keyword search function and display of alternate names/synonyms for a locus, site or population. Two new fields for dbSNP accession number and chromosomal position were added to the ‘Sites’ table to permit the ordered display of sites under a selected locus by their chromosomal positions.For example, the The structure described above is designed for allele frequencies at nuclear DNA polymorphisms. Mitochondrial DNA (mt DNA) is uniparentally inherited and generally analyzed as a gene tree rather than as allele frequencies. The variation on the non-recombining part of the Y is similarly uniparently inherited and similarly analyzed. Both require a different database structure and are not considered in ALFRED.Sources of data in ALFRED include the following:Data extracted from published literature. ALFRED researchers and curators routinely scan through the literature to find relevant papers containing allele frequency data of interest. The allele frequency data and related information from the selected papers are first extracted by the curatorial staff into an Excel Spread sheet. In the spreadsheet, the curators associate the extracted datasets with existing ALFRED data objects . A software utility then reads the spreadsheet file, performs data integrity checks, and uploads the data into ALFRED.Data generated in the Kidd Lab are maintained in a separate database called PhenoDB , which iData submitted by collaborators or other researchers in electronic format are first extracted into the standard Excel Spreadsheet and a number of curatorial steps as described above are performed before the data are uploaded into the database.http://alfred.med.yale.edu/alfred/recordinfo.asp?UNID=PO000036J). Population samples are organized by populations and annotated with sample information such as sample-size and relation to other samples. Loci are organized by chromosome and each locus record is annotated with alternate-names (synonyms), chromosomal position and a valid locus symbol and links to external databases such as GDB, Entrez Gene, UniGene. For example, see . Genetic polymorphisms and haplotypes are organized by locus and each polymorphism record is annotated with dbSNP rs number (refSNP Identifier), alternate-names (synonyms), ancestral allele, and links to external databases for expanded molecular information such as dbSNP. For example, see . The active links to other databases provided from ALFRED’s populations, loci, and sites information pages facilitate easy retrieval of additional information. Each allele frequency record displayed is linked to the population sample information, polymorphism information, typing method and the publication the frequency was extracted from. Most publication entries are linked to PubMed for relevant citation.The web user interface of ALFRED allows the users to easily query and display allele frequencies and related data. It has the following organization. Populations are organized by geographic regions and each population record is annotated with alternate-names (synonyms), linguistic, geographical location information and links to external databases such as Ethnologue and Rosetta Project for additional information. For example, see . On the other hand, the tabular format offers frequency values and related information which can be used in analysis tools .Data queries can start with locus, population, publication author, ALFRED UID, dbSNP accession numbers (either refSNP accession number (rs#) or submitter-supplied accession number (ss#)), geographic region or a combination of gene name and population name. The results of frequency searches can be viewed both in graphical and tabular format. The graphical stacked-bar format offers a quick visual display of the frequency variation among populations help to identify and capture sources of variation in how modern human populations have evolved. The same factors would be relevant to the evolution of other species whether from the animal or plant kingdom. Clinal patterns of gene frequencies in existing populations sampled today can be signals that help us reconstruct ancient waves of human population migration. Some of the observed discontinuities in many different gene frequency patterns sampled from the genome may represent indications of past population formation/subdivision or of random genetic drift as a consequence of “founder” effects or population “bottlenecks”. These and many other related ideas have long been the subject of study and interest. For some recent examples from human population genetics of this very extensive and rich literature see The ability to visualize genetic data on human polymorphisms in a geographic context is an important aspect of interpreting the data, be they classical markers , mtDNA dhttp://alfredgis.med.yale.edu/maps/?mode=None) and being systematically integrated into ALFRED.Two aspects of the data benefit from a geographic display: selection of populations based on their location and display of data at the location of the population/sample. Several months ago we added a prototype geographic interface to display locations of populations and allow sets of populations to be selected. Unfortunately, making that interface compatible with multiple browsers was not possible. Moreover, the package was not readily amenable to display of data. Development was shifted to an interface that would interact with GIS (Geographic Information System) servers to allow much more flexibility and place ALFRED data into a standard format for correlation with extensive data accessible through GIS. The ALFRED Map Interface is now online . The XML format is more appropriate for exchanging data between different database applications.Users frequently want to analyze in various ways data retrieved from ALFRED. Several options are available. The existing HTML screen display of the allele frequency tables can be captured and imported into a spreadsheet. Though inadequate for statistical analysis, the stacked-bar graphics output can be captured as an image to illustrate variation. All the allele frequency tables (in semicolon-delimited format), polymorphismand population information tables (in tab-delimited format) can be downloaded in text format as well. In addition, the entire database can be downloaded in XML format by following the link provided in the web site shows graphically the number of allele frequency tables for each population. Currently, the maximum is 1033 for the Han. A ‘populations per site’ web page represents the number of allele frequency tables for each polymorphic site. Currently, the Alu-insertion/deletion polymorphic sites and the forensic markers top the list with ACE Alu insertion having the maximum (frequency tables for 172 population samples). However, though some populations have data on many markers and some markers have data on many populations, the matrix of sites by populations is largely empty. Anthropologic genetics is plagued by this empty matrix problem: the paucity of markers uniformly typed on a large number of populations.Several search procedures to identify the availability of allele frequency tables for a particular polymorphism and population combination are accessible from the ALFRED home page. Several graphical overviews are also available to direct users to the more extensive ‘comparative’ aspects of the database. A ‘sites per population’ web page data. This standardized XML syntax is called Polymorphism Markup Language (PML). In March of 2005, PML was accepted as an adopted specification by Object Management Group (OMG). The consortium includes representatives of major SNP-related databases including dbSNP, PharmGKB, HGVBase, JSNP, ALFRED, HapMap, and the Chinese Population Genetic Diversity database. ALFRED will be set up to export data in PML format in the near future.We will implement more data export formats for supporting different types of evolutionary data analyses. We are in the process of extending ALFRED to provide genotype data for selected systems. We will also extend the database to model haplotype systems based on combination of multiple locus systems (sites). Such flexible modeling of haplotypes will facilitate the study of evolution.The current ALFRED public interface was designed to be a prototype. Expansion of ALFRED in quality and quantity is demanding a framework which is scalable, portable and facilitates easy integration with other software packages such as the GIS map interface. Apart from the flexibility that will be offered at the level of viewing and downloading of ALFRED data, several new functions will be incorporated into the database to enhance the quality and clarity of the displayed data.ALFRED now offers several search tools for data searching and retrieval. Currently, ALFRED tables are available for download in text and XML format. But the increase in the contents in ALFRED and in the number of ALFRED users over the past 4 years requires more efficient and flexible search tools and download options. We are planning to consolidate all the different search tools ALFRED already offers and create new search tools that can retrieve and download data in an efficient manner. We are also planning to offer as download options various data formats that are being used by different population genetics programs. Though the matrix is still largely empty, there are subsets of populations and sites sufficient for meaningful analyses.We will continue to add more data to ALFRED as new data are published in the literature. In addition, we will explore the use of biomedical literature text mining tools to automate our data acquisition. For example, we have recently used PubMatrix and PubChttp://www.w3.org/TR/soap/) to provide a standard programmatic interface for external software applications to access the AFLRED database automatically. For example, an application can be written to construct phylogenetic trees based on allele frequency data by interoperating the ALFRED web service with the PHYLIP web service that is available at PathPort (We will implement a web service interface based on the Simple Object Access Protocol or SOAP (PathPort . As PML http://alfred.med.yale.eduALFRED http://ncbi.nih.gov/SNPdbSNP http://www.ethnologue.comEthnologue http://www.hapmap.org/HapMap http://staff.vbi.vt.edu/pathport/services/PathPort http://pubcrawler.gen.tcd.ie/PubCrawler http://pubmatrix.grc.nia.nih.gov/PubMatrix |
Pseudomonas aeruginosa exhibits an epidemic population structure; clinical isolates are indistinguishable from environmental isolates, and they do not exhibit a specific (disease) habitat selection. However, some important issues, such as the worldwide emergence of highly transmissible P. aeruginosa clones among cystic fibrosis (CF) patients and the spread and persistence of multidrug resistant (MDR) strains in hospital wards with high antibiotic pressure, remain contentious. To further investigate the population structure of P. aeruginosa, eight parameters were analyzed and combined for 328 unrelated isolates, collected over the last 125 years from 69 localities in 30 countries on five continents, from diverse clinical and environmental habitats. The analysed parameters were: i) O serotype, ii) Fluorescent Amplified-Fragment Length Polymorphism (FALFP) pattern, nucleotide sequences of outer membrane protein genes, iii) oprI, iv) oprL, v) oprD, vi) pyoverdine receptor gene profile , and prevalence of vii) exoenzyme genes exoS and exoU and viii) group I pilin glycosyltransferase gene tfpO. These traits were combined and analysed using biological data analysis software and visualized in the form of a minimum spanning tree (MST). We revealed a network of relationships between all analyzed parameters and non-congruence between experiments. At the same time we observed several conserved clones, characterized by an almost identical data set. These observations confirm the nonclonal epidemic population structure of P. aeruginosa, a superficially clonal structure with frequent recombinations, in which occasionally highly successful epidemic clones arise. One of these clones is the renown and widespread MDR serotype O12 clone. On the other hand, we found no evidence for a widespread CF transmissible clone. All but one of the 43 analysed CF strains belonged to a ubiquitous P. aeruginosa “core lineage” and typically exhibited the exoS+/exoU− genotype and group B oprL and oprD alleles. This is to our knowledge the first report of an MST analysis conducted on a polyphasic data set.At present there are strong indications that Bacillus (rod) pyocyaneus. Today we refer to this organism as Pseudomonas aeruginosa. This species is ubiquitous in the biosphere, has wide metabolic versatility and high intrinsic and acquired resistance to antimicrobials. It can be found in a wide variety of ecological environments ranging from fresh and salt water to the rhizosphere in which they colonize the endemic fauna (e.g. nematodes), flora and fungi (e.g. Pythium spp.) P. aeruginosa occasionally migrates from its natural environment and causes disease in animals and humans. In the latter it has emerged, partly due to its intrinsic antibiotic resistance, as a major pathogen in the airways of cystic fibrosis (CF) patients, causing often-fatal chronic respiratory infections, and as one of the most clinically significant opportunist nosocomial agents. Immunosuppressed patients such as those with severe burns, cancer or AIDS are particularly at risk.In his 1882 paper, “Sur les colorations bleue et verte des linges à pansements”, introduced by Louis Pasteur, Carle Gessard describes the isolation of an organism causing a blue-green coloration of wound dressings P. aeruginosa clinical isolates are genotypically, chemotaxonomically, and functionally indistinguishable from environmental isolates. Römling et al. observed that the most frequently identified clone in CF patients was also detected at a relatively high frequency in aquatic environments et al. demonstrated the infectivity of a P. aeruginosa strain in both plant and animal models P. aeruginosa strains isolated from a gasoline-contaminated aquifer were indistinguishable from clinical isolates Numerous research groups have demonstrated that Using multilocus enzyme electrophoresis, Maynard Smith and colleagues demonstrated that bacterial population structures could range from panmictic or fully sexual, with random association between alleles, to clonal, with nonrandom association of alleles, the latter resulting in the frequent recovery of relatively few of the many possible multilocus genotypes P. aeruginosa has been the subject of numerous investigations, we present an overview. Both Denamur et al. in 1993, and Picard et al. in 1994, suggested a panmictic population structure for the species but highlighted the need for caution in inferring the population structure from any single class of genetic marker et al. demonstrated that bacteremia and pneumonia were not caused by specific P. aeruginosa clones P. aeruginosa population isolated mainly from patients with keratitis and their environment P. aeruginosa isolates, collected across the world and observed a clear mosaicism in the results and a non-congruence between experiments, features of a panmictic population structure P. aeruginosa. Using multi locus sequence typing (MLST), Curran et al. confirmed in 2004 that P. aeruginosa exhibits a nonclonal epidemic population structure P. aeruginosa population in the River Woluwe in Brussels was found to be almost as diverse as the global population, harbouring members of nearly all successful clonal complexes The population structure of P. aeruginosa possessed a highly conserved genome, which encoded genes important for survival in numerous environments including humans and evolved through the acquisition, loss, and reorganisation of genome islands and genome islets P. aeruginosa to different habitats. Despite not believed to be naturally competent, P. aeruginosa displays a high level of interstrain genomic plasticity and contains a high number of unfixed genes. Shen et al. put forward the idea of a population-based supra-genome that is substantially larger than the genome size of any of the component strains Several groups found that P. aeruginosaEnvironmentally endemic bacteriophages are probably responsible for a fair amount of HGT, as they were shown to be formidable transducers of naturally occurring microbial communities of P. aeruginosa strains in a Caenorhabditis elegans pathogenicity model and showed that genes required for pathogenicity in one strain of P. aeruginosa were neither required for, nor predictive of virulence in other strains P. aeruginosa is both multifactorial and combinatorial, the result of a pool of pathogenicity-related genes that interact in various combinations in different backgrounds.In 2006 Lee and colleagues tested the pathogenicity of diverse P. aeruginosa strains with a DNA array tube assay and reported the segregation of strains from diverse habitats and geographic origin into two large nonoverlapping clusters and 45 isolated clonal complexes composed of a few or even single strains In 2007 Wiehlmann and colleagues analysed 240 P. aeruginosa population structure is nonclonal epidemic, that clinical isolates are indistinguishable from environmental isolates, and that there are no specific clones with a specific (disease) habitat selection. The P. aeruginosa genome consists of a highly conserved core spiked with mobile islands and elements, which are exchanged between strains through intensive and basically phage-mediated HGT, thus creating the striking diversity of this ubiquitous opportunistic pathogen.In conclusion, there appears to be a consensus that the Despite the above-mentioned studies, some important contentious issues remain. First, since the 1980s several studies have reported the emergence, spread and persistence of multidrug resistant (MDR) clones in hospitals, mainly in intensive care wards with high antibiotic pressure. Two serotypes, O11 and O12, are highly associated with these epidemic strains P. aeruginosa ‘transmissible’ CF clones have been reported worldwide Second, since the second half of the 1990s, an increasing number of P. aeruginosa clones in the global population structure, we decided to expand our earlier study To provide a reference evolutionary framework and to position these emergent P. aeruginosa genome oprL, and v) oprD, vi) pyoverdine receptor gene profile , and the prevalence of vii) exoenzyme genes exoS and exoU and viii) group I pilin glycosyltransferase gene tfpO.Since different (genetic) markers have been shown to measure different evolutionary forces, confirming the importance of a polyphasic approach to population analysis a genome . The parP. aeruginosa isolates, but because it has been performed all over the world for more than 80 years Serotyping only allows for a crude discrimination between different FAFLP is a highly discriminatory and reproducible genotyping method based on the selective amplification of a subset of DNA fragments generated by restriction enzyme digestion oprI, oprL and oprD genes generated equally discriminative data oprI and oprL genes, which code for outer membrane lipoproteins Although it is generally assumed that the best means of indexing natural variation in a population structure is to sequence housekeeping genes P. aeruginosa oprD gene codes for a specialized pore protein, OprD, which allows selective permeation of basic amino acids and their structural analogs like the carbapenem antibiotics imipenem and meropenem oprD sequence data have proven to be an extremely interesting genetic marker, for the following reasons: (i) resistance to carbapenems is often achieved by defective oprD mutations (DOMs), (ii) the mosaic structure of the oprD gene exposes evidence of recombination events between P. aeruginosa strains, (iii) the virtually unlimited number of oprD alleles provides high discriminatory power, (iv) despite this extremely high sequence variability, members of narrow clonal complexes often show identical oprD sequences, thus illustrating the stability of these complexes The P. aeruginosa in order to scavenge Fe(III) in the extracellular environment and shuttle it into the cell P. aeruginosa siderovars can be distinguished, each producing a different pyoverdine and a matching cognate FpvA receptor P. aeruginosa strains, the capacity to utilize type I pyoverdine as a source of iron. The majority of P. aeruginosa strains were shown to possess the fpvB gene.Pyoverdines are high-affinity fluorescent peptidic siderophores secreted by ExoS and ExoU are effector molecules (exoenzymes) that can be injected directly into the host cell by the type III secretion system. There are indications that ExoS is the major cytotoxin required for colonization and dissemination during infection, while secretion of ExoU has been associated with increased virulence The pilin glycosyltransferase TfpO is an inner membrane protein that captures O antigen subunits and attaches them to a serine residue at the carboxy terminus of the group I pilins The above-described traits were combined and analysed using biological data analysis software. The results were visualised using a minimum spanning tree (MST).Finally, the minimum inhibitory concentrations (MIC) of 21 antimicrobials were determined for the 328 isolates.P. aeruginosa.Only 215 (65%) out of the 328 strains could be serotyped . This suP. aeruginosa strains were normalised and clustered using the Unweighted Pair Group Method with Arithmetic mean (UPGMA). By applying the criteria for differentiation of P. aeruginosa by FAFLP P. aeruginosa clones during short time spans. In contrast, the relationship between the different clonal complexes, and sometimes even between distinct clones within a complex, was not always supported by FAFLP . All CF isolates but one possessed the group B oprL allele . The oprD genes of strains US376 and W15 Oct 31 could not be amplified by PCR. The oprD gene of these strains is probably not present or exhibits an aberrant nucleotide sequence . With the exception of three isolates , all CF isolates exhibited a group B oprD allele , conferring resistance to carbapenem antibiotics, were observed origin of the P. aeruginosa isolates No significant correlation could be established between the habitat . De Vos P. aeruginosa and claimed that the pyoverdine region is the most divergent locus of the core genome because it is subject to speciation and coevolution, encodes a trait of altruistic cooperation (the production of siderophores), and encodes a receptor that is both a major fitness allele and a major deleterious allele fpvA types among the different clonal complexes of P. aeruginosa isolates, including all 43 CF isolates.As expected, the tfpO gene, indicative for group I pilins, was detected in 48.2% of isolates . Thus, in contrast to Kus et al. tfpO gene in 69.7% of CF isolates, we did not find a strong association of tfpO with CF. The tfpO data were found to have only very limited value and discriminatory power and were therefore not included in the combined analysis.The isolates . The tfpisolates . The tfpP. aeruginosa, and where a large number of single locus variants (SLVs) may evolve from one common type Listeria monocytogenesP. aeruginosa strains in such a way that the sum of the distances (number of differences between two distinct PPs) is minimized.MSTs have long been used in the context of mathematical topology. When a set of distances is given between entries (strains in this case), a minimum spanning tree connects all entries in such a way that the summed distance of all branches of the tree is the shortest possible P. aeruginosa population structure study a UPGMA dendrogram, based on the comparison of the composite data set consisting of 4 markers in 73 strains, revealed 7 distinct clonal complexes, arbitrarily labelled CC A to CC G oprD gene , which is the result of a history of intra and possibly inter species recombinational exchanges of DNA blocks P. aeruginosa, i.e. a superficially clonal structure with frequent recombinations, in which occasionally highly successful epidemic clones arise.In our previous A conventional UPGMA dendrogram based on the composite similarity matrix is shown in oprD goup B (93.0%), oprL group B (97.7%), exoS+ (97.7%) and fpvB+ (100%) in this study were also prevalent in this ‘core lineage’. This supports the argument that not one parameter in itself, but rather a multitude of linked characteristics are responsible for the selection of particular strains in the CF niche.According to this study, a typical CF strain shows the following profile: non- or polyagglutinable (76.5%), + (100%) . Althoug+ (100%) . This ‘c+ (100%) . Li004 w+ (100%) , but it et al. determined some genetic features of 162 isolates from different ecological origins P. aeruginosa isolates were able to colonize CF patients. Unfortunately, due to different choices of typing techniques and strains between studies, we are not able to match these genogroups to our clonal complexes.Although CF strains isolated in different locations across the world were shown to be genotypically non-identical and thus probably not directly related , they alP. aeruginosa CF strains is unlikely to have occurred. Our data suggest that strains belonging to the successful ‘core lineage’ are ubiquitous in the natural environment and are therefore more likely to infect CF patients. In 1994, Römling et al. observed that clone C, the major clone in the CF population in Germany, was also overrepresented in soil and aquatic habitats, and suggested that the isolation frequency in CF patients simply reflected the distribution of clones in the environment Occasional transmission of CF strains in CF clinics and holiday or rehabilitation camps has been reported oprD goup A (100%), oprL group B (100%), oprI group B (100%), exoS+ (100%), fpvB+ (100%) and tfpOb+ (100%) . MDR ser+ (100%) and show+ (100%) . SerotypP. aeruginosa to a novel environment. Man-made changes to the environment, like the introduction of antimicrobials, are affecting the P. aeruginosa population structure.We feel that the emerging MDR O12 clone is an example of a rapid and sustained adaptation of P. aeruginosa was determined by means of a combination of seven valuable experiments. Analysis and clustering based on a single experiment broadly conserved the clonal complexes and clones designated in the MST based on the combined experiments . Additionally, the exchange of standardized data between laboratories and the creation of international reference databases of typed microorganisms should be encouraged. It will enable an efficient monitoring of changes in microbial populations and consequently allow more adequate infection control measures. Knowing a species population structure and evolutionary paths is the cornerstone of strategies aiming to control it. Specialised follow-up papers, based on the evolutionary framework presented here and dealing with some clinically relevant issues, are in preparation.P. aeruginosa clinical and environmental isolates, collected worldwide were examined , 63 animal clinical isolates and 55 environmental isolates . Geographical origin, isolation site and time and other relevant characteristics of all P. aeruginosa isolates can be found in Most of them were isolated in the late eighties and nineties, but 49 were isolated before 1980, including 14 P. aeruginosa strains were kindly provided by: Dr. A. T. McManus, US Army Institute of Surgical Research, Texas, USA; Dr. L. Ménesi, General Hospital St. Istvan, Budapest, Hungary; Dr. A. Vanderkelen, Dr. S. Jennes, G. Verbeken and D. Schoeters, Queen Astrid Military Hospital, Neder-Over-Heembeek (Brussels), Belgium; Dr. J. A. Clark, Queen Mary's University Hospital, London, England; Dr. A. F. Vloemans, Rode Kruis Ziekenhuis, Beverwijk, The Netherlands; Dr. T. Taddonio, University of Michigan, Michigan, USA; Dr. A. Radke, Klinik für Verbrennungs- und Plastische Wiederherstellungschirurgie, Aachen, Germany; Prof. R. Konigova, Charles University Hospital, Prague, Czech Republic; Dr. R. G. Tompkins, Burns Institute, Shriners Hospital for Children, Boston, USA; Prof. B. Tümmler, Medizinische Hochschule, Hannover, Germany; Dr. M. Caneira, Hospital de Santa Maria, Lisboa, Portugal; Prof. A. Boudabous, Science Faculty, Tunis, Tunisia; Dr. M. Mergeay, Environmental Technology Expertise Centre, Mol, Belgium; Dr. A. E. Lim Jr., St. Scholastica's College of Health Sciences, Tacloban City, Philippines; Prof. O. Hadjiiski, Scientific Institute of Emergency Medicine Pirogov, Sofia, Bulgaria; Prof. K. Taviloglu, University of Istanbul, Istanbul, Turkey; Dr. W. D. H. Hendriks, Zuiderziekenhuis, Rotterdam, The Netherlands; Dr. G. Wauters, University of Louvain, Brussels, Belgium; Dr. O. Vandenberg, Universitair Ziekenhuis St.-Pierre, Brussels, Belgium; Prof. M. Vaneechoutte, University Hospital Ghent, Gent, Belgium; Prof. J. Van Eldere, Catholic University of Leuven, Leuven, Belgium; Dr. U. Römling, Karolinska Institute, Stockholm, Sweden; Dr. L. Roddam and R. Bradbury, University of Tasmania, Hobart, Australia; Dr. T. L. Pitt, Health Protection Agency, London, UK; Dr. A. Leitão, Faculty of Veterinary Medicine, Lisboa, Portugal; Dr. R. W. Brimicombe, Haga Ziekenhuis, Den Haag, The Netherlands; Prof. N. J. Legakis and Dr. P. T. Tassios, National and Kapodastrian University of Athens, Athens, Greece; Prof. J.-M. Meyer, University Louis Pasteur, Strasbourg, France and Dr. M. P. Crespo, Universidad Santiago de Cali, Cali, Colombia; Dr. M. Merabishvili and Dr. Nina Chanishvili, Eliava Institute, Tbilisi, Georgia; Dr. L. Griffiths, Dr. K. Craven and J. Awong-Taylor, Armstrong Atlantic State University, Savannah, US; Prof. M. de Chial, University of Panama, Panama City, Panama; Dr. N. H. Khan, Dr. N. Kimata and Prof. K. Kogure, University of Tokyo, Tokyo, Japan; Dr. D. Armstrong, Monash Medical Center, Melbourne, Australia; A. Catrijsse, Vlaams Instituut voor de Zee, Oostende, Belgium.The Strains LMG 2107, 5031, 10643, and 14083-5 were purchased from the BCCM™/LMG bacteria collection. The 20 ‘CPHL strains’ were purchased from the National Collection of Type Cultures in London (UK). Strain PAO-1 was kindly provided by Dr. C. K. Stover . Strain ATCC 27853 was purchased from Gibson Laboratories (USA).All isolates were grown overnight in Luria-Bertani broth medium at 37°C on a rotary shaker (150 rpm). The overnight cultures were mixed with equal amounts of sterile 50% (vol/vol) glycerol in PBS buffer and stored in duplicate at −80°C.EcoRI, and Tru9I . The primer pair used was EcoRI-0[FAM]/MseI-C. GeneScan-500[ROX] internal standard (Applied Biosystems) was co-electrophoresed with each sample in order to allow an accurate calculation of fragment lengths and correction for variation rates and gel distortions. Normalization and fragment sizing were carried out using GeneScan software . Band patterns were imported into the BioNumerics v5.1 software and normalised; parameters used: background subtraction (10% disc diameter), filtering (arithmetic average), band search . Cluster analysis was performed by pairwise calculation of the Pearson correlation; the similarity matrix was clustered using the UPGMA algorithm with optimisation: 0%, position tolerance: 1%; uncertain bands were ignored.FAFLP utilized an ABI 377 automated fluorescence sequencer , and the AFLP™ Microbial Fingerprinting Kit (Applied Biosystems) as detailed in the manufacturer's protocols. The enzymes used were T4 DNA ligase, P. aeruginosaStrains were grown overnight on Luria-Bertani agar medium (Gibco-BRL-Life Technologies) at 37°C. Isolates were serotyped by slide agglutination according to the International Antigenic Typing Scheme (IATS) for oprI, oprL, and oprD genes and a fragment of the exoS, exoU, fpvA, fpvB and tfpO genes were amplified by PCR, using the primers described in 2 (2.5 mmol/l), 5 µl of a primer mixture (10 µmol/l each), 5 µl template DNA, and 0.5 µl AmpliTaq DNA polymerase (5 U/µl). All PCR-reagents and primers were ordered from PE-Applied Biosystems. The amplification was performed in a GeneAmp® 9700 thermocycler (Applied Biosystems). The amplification program was set at 50 cycles of denaturation at 94°C for 30 s, annealing at a temperature in accordance to the primers (fpvA gene required degenerate primers. The reaction mixture was put on an agarose gel of 1.5 % (wt/vol) for electrophoresis and visualization of the PCR-product after staining with ethidium bromide on a transilluminator. Prior to the sequencing of the oprD, oprL and oprI genes, the respective PCR-products were purified, using centricon® 100 micro-concentrators according to the manufacturer's instructions. Five µl of the purified PCR fragment was used as a template in the sequencing reaction. PCR primers were used for sequencing. Sequencing of the coding and anti-coding strand of the oprD PCR products necessitated two additional internal primers (oprD gene of isolate Be128 was sequenced directly from genomic DNA. Some genes were sequenced in the VIB Genetic Service Facility (Belgium) using a capillary Applied Biosystems 3730 DNA Analyzer. PCR and sequencing were performed in duplicate in order to be able to detect eventual PCR mistakes.Strains were grown overnight in Luria-Bertani broth medium (Gibco-BRL-Life Technologies) at 37°C on a rotary shaker (150 rpm). DNA was extracted from the overnight cultures using the High Pure™ PCR Template Preparation Kit (Roche Diagnostics) according to the manufacturer's guidelines. The complete primers , for 30 primers . DNA seqUsing the BioNumerics v5.1 software, sequences were grouped via a pairwise clustering . The obtained UPGMA tree was used to seed a multiple alignment . Finally, multiple aligned sequences were clustered using the same parameters as used in the initial pairwise clustering, resulting in the final UPGMA tree.oprI, oprL, and oprD gene sequences, pyoverdine receptor profile (fpvA and fpvB) and prevalence of the genes exoS and exoU of 328 P. aeruginosa isolates was analyzed using the biological data analysis software BioNumerics v5.1. The settings used for the comparison of the FAFLP fingerprints and the gene sequences are described in the respective paragraphs. Serotype, pyoverdine receptor profile and presence of exoS/U were compared using the Pearson correlation. These individual comparisons resulted in individual similarity matrices, which were averaged into the similarity matrix of the composite data set. No correction for internal weights was applied. Each isolate was thus assigned a ‘polyphasic profile’ (PP) contributing to the composite similarity matrix. Grouping of the averaged composite similarity matrix was achieved by MST analysis using BioNumerics v5.1 software. The MST coefficient was taken from the composite similarity matrix. The Degeneracy of the MST was reduced through the use of a priority rule by which types that had a maximum number of entries were linked first, confirming a biological meaning that these clones are most likely older. For visual purposes, isolates were further grouped into clonal complexes. For the creation of the clonal complexes, the similarity bin size (1 change) was set to 2.5%; the maximal neighbour distance between two complexes was 5 changes (12.5%) and the minimum size of a complex was 5 types. Originally a clonal complex was defined as a cluster of STs in a burstdiagram in which all STs are linked as SLVs to at least one other ST. In our case a clonal complex is a cluster of PPs, after MST analysis, in which all PPs with less than 5 changes ( = less than 12.5% distance in the similarity matrix) are linked. Congruence between experiments was calculated using the Pearson product-moment correlation coefficient between the respective similarity matrices.A data set consisting of the serotype, FAFLP pattern, P. aeruginosa ATCC 27853 was used as control strain. For some isolates the MIC was determined by the broth microdilution method Strains were grown 18–24 h at 37°C on Columbia agar containing 5% horse blood (bioMérieux). Suspensions of these cultures were made in 0.45% saline, adjusted to the turbidity of a 0.6 McFarland standard, and used to load the test cards for VITEK 2 (bioMérieux), which was used in accordance with the manufacturer's directions. The following antibiotics were tested using the AST-N020 antimicrobial susceptibility cards: AMP, ampicilin; AMC, amoxicillin + clavulanic acid; PIP, piperacillin; TZP, piperacillin + tazobactam; CEF, cephalothin; CXM, cefuroxime; CTX, cefotaxime; CAZ, ceftazidime; CPD, cefpodoxime; FOX, cefoxitin; FEP, cefepime; MEM, meropenem; GEN, gentamicin; TOB, tobramycin; AMK, amikacin; NOR, norfloxacin; OFX, ofloxacin; CIP, ciprofloxacin; NIT, nitrofurantoin; SXT, trimethoprim + sulfamethoxazole. Antibiotic resistance phenotypes, represented by the minimum inhibitory concentrations (MICs) for the above-mentioned antibiotics, were determined using VITEK 2 Advanced Expert System (AES) Pseudomonas aeruginosa Genome database .The nucleotide sequences generated in this study have been deposited in the P. aeruginosa strains were deposited in the Belgian Coordinated Collections of Microorganisms (BCCM) of the Laboratorium voor Microbiologie (LMG) of the Ghent University. Strains were assigned a BCCM/LMG number (LMG 24881 - 25202). Strains that were obtained from a culture collection (BCCM/LMG or ATCC) maintained their original reference number.All studied Strains can be obtained from the LMG bacteria collection for research use only and with the consent of the strain donors.Figure S1P. aeruginosa strains.UPGMA dendrogram of the FAFLP patterns of the 328 studied (0.42 MB PDF)Click here for additional data file.Figure S2oprI, L, and D gene sequences, pyoverdine receptor profile and prevalence of exoS/U genes for the 328 studied P. aeruginosa strains.UPGMA dendrogram of the similarity matrix of the composite data set consisting of the serotype, FAFLP pattern, (0.02 MB PDF)Click here for additional data file. |
Rheumatoid arthritis (RA) is a chronic inflammatory autoimmune disease characterized by sustained synovitis. Recently, several studies have proposed neutrophils and Th17 cells as key players in the onset and perpetuation of this disease. The main goal of this work was to determine whether cytokines driving neutrophil and Th17 activation are dysregulated in very early rheumatoid arthritis patients with less than 6 weeks of disease duration and before treatment (VERA).Cytokines related to neutrophil and Th17 activation were quantified in the serum of VERA and established RA patients and compared with other very early arthritis (VEA) and healthy controls. Synovial fluid (SF) from RA and osteoarthritis (OA) patients was also analyzed.VERA patients had increased serum levels of cytokines promoting Th17 polarization (IL-1β and IL-6), as well as IL-8 and Th17-derived cytokines (IL-17A and IL-22) known to induce neutrophil-mediated inflammation. In established RA this pattern is more evident within the SF. Early treatment with methotrexate or corticosteroids led to clinical improvement but without an impact on the cytokine pattern.VERA patients already display increased levels of cytokines related with Th17 polarization and neutrophil recruitment and activation, a dysregulation also found in SF of established RA. 0 Thus, our data suggest that a cytokine-milieu favoring Th17 and neutrophil activity is an early event in RA pathogenesis. Rheumatoid arthritis (RA), the most common chronic autoimmune disease, affects approximately 1% of the population worldwide. This disease comprises a syndrome of pain, stiffness, and symmetrical synovitis which leads to joint destruction, functional disability, and substantial comorbidity due to the involvement of multiple organs and systems. The migration of leukocytes toward the synovium is crucial for the establishment of a chronic inflammatory process in RA . This muNeutrophils specifically play an important role in the onset and perpetuation of RA, not only as interleukin (IL)-producing cells but also as cells responsible for the release of high amounts of reactive oxygen species and destructive enzymes, such as metalloproteases, contributing to joint erosions . NeutropT helper 17 (Th17) cells have also been proposed to have a relevant role in the early phase of RA through the production of IL-17 . This cyThus, the main goal of our work was to determine whether cytokines driving neutrophil and Th17 cell activation and proinflammatory function were already present in very early RA (with less than 6 weeks of disease duration) and how this early cytokine environment differs from established RA. We also evaluated whether the introduction of low-dose corticosteroids and methotrexate (MTX) therapy had any influence on the cytokine profile observed at that early stage of the disease. We found that cytokines related to Th17 polarization and neutrophil recruitment and activation were elevated in early RA and that the conventional therapeutic options, though able to control clinical manifestations of the disease, were ineffective in reversing this underlying proinflammatory drive.Blood samples were obtained from 38 consecutive untreated polyarthritis patients with less than 6 weeks of disease duration. Some of these patients 19), after a minimum follow-up of 3 months, fulfilled the 1987 American College of Rheumatology (ACR) criteria for RA . These p9, after IL-1β, IL-2, IL-4, IL-6, IL-8, IL-10, IL-12(p70), IL-17A, IL-22, IL-23, and interferon-gamma levels were measured in the serum and SF by FlowCytomix assay kit in accordance with the instructions of the manufacturer. Standard curves for each cytokine were generated by using reference cytokine concentrations supplied by the manufacturer. Samples were acquired with a FACS Calibur flow cytometer . Raw data of the flow cytometry bead assay were analyzed by FlowCytomix Pro 2.2 software (Bender MedSystems).Rheumatoid factor (RF)-IgM was determined in all patients by means of an IMTEC Autoimmune Diagnostics ELISA [enzyme-linked immunosorbent assay] kit in accordance with instructions of the manufacturer, and samples were processed using a ChemWell 2910 automated analyzer . Serum levels of anti-cyclic citrullinated peptide (anti-CCP) were measured by ELIA™ CCP test system , and samples were analyzed with an ImmunoCAP 100 instrument (Phadia GmbH).P values of less than 0.05.Statistical differences were determined with non-parametric Kruskal-Wallis, Mann-Whitney, and Wilcoxon signed-rank tests and GraphPad Prism . Correlation analysis was performed with the Spearman test. Differences were considered statistically significant for A total of 38 polyarthritis patients with less than 6 weeks of disease duration were evaluated. Nineteen patients fulfilled the 1987 ACR criteria for RA after a minimum follow-up of 3 months and were classified as VERA patients. The mean age of the VERA patients was 59 ± 17 years, 84% were female, 42% were RF-positive and 32% anti-CCP-positive, the initial DAS28 was 6.1 ± 1.8, and the initial HAQ was 1.4 ± 0.8. After treatment with low doses of prednisone and MTX, there was a significant reduction of both DAS28 and HAQ values . Moreover, IL-17A was significantly increased locally within the joints of patients with established RA in comparison with control SF from patients with OA Figure .Having found that IL-17A was elevated in VERA patients, we decided to quantify a panel of cytokines known to be associated with Th17 polarization. At baseline, VERA patients had significantly higher levels of IL-1β and IL-22 in comparison with both VEA and healthy controls. In addition, we found that VERA patients have significantly higher IL-6 levels than healthy controls Figure . FurtherLocally, within the joints of patients with RA, the SF displayed elevated levels of IL-1β and IL-6 in comparison with OA SF Figure . MoreoveSeveral studies have previously demonstrated that neutrophils play an important role in the onset of RA . This hyIn the present study, we demonstrate that a neutrophil- and Th17-driving cytokine pattern is present in untreated VERA patients with less than 6 weeks of disease duration. We consider this observation of interest because the knowledge concerning the immune mechanisms associated with the onset of RA is still elusive. In fact, the majority of early RA studies include patients with 3 to 12 months of disease duration or even more. In accordance with an early participation of neutrophils in RA, our results revealed that VERA patients have increased levels of IL-8 when compared with both VEA and healthy controls, and this could explain the preactivated state of circulating neutrophils and theiIn addition, Th17 cells are known to be important for the promotion of neutrophil-mediated inflammation by producing IL-17A, a cytokine known to indirectly activate neutrophil chemotaxis and extend their survival ,22. We fAdditionally, the elevated levels of IL-1β observed in VERA patients can stimulate endothelial cells, T and B cells, and fibroblasts in the joints to produce IL-6 and IL-8. But importantly, IL-1β and IL-6, both found to be increased in VERA patients, are known to promote the differentiation of Th17 cells, which in turn secrete IL-17A and IL-22 ,29, two Currently, the treatment of choice for RA at the time of presentation is MTX. Interestingly, in spite of clinical improvement (DAS28 reduced from 6.1 ± 1.8 to 3.1 ± 1.6), neither therapy with low-dose corticosteroids nor combined therapy with low-dose corticosteroids and MTX corrected the dysregulated cytokine pattern observed in VERA patients. In fact, low-dose corticosteroids and MTX have unclear effects on the RA cytokine network. For instance, corticosteroids fail to reduce serum levels of IL-1β and IL-8 and MTX The elevated IL-1β, IL-6, IL-8, and IL-17A levels observed in the SF of patients with RA confirm a local role for these cytokines in the maintenance of synovitis. Moreover, IL-6 can support a continuous recruitment of autoreactive B cells toward the synovium ,34, contTaken together, our data reinforce the potential relevance of therapies targeting IL-1β ,36 and IACR: American College of Rheumatology; anti-CCP: anti-cyclic citrullinated peptide; DAS28: disease activity score using 28 joint counts; HAQ: health assessment questionnaire; IL: interleukin; MTX: methotrexate; OA: osteoarthritis; RA: rheumatoid arthritis; RF: rheumatoid factor; SF: synovial fluid; Th17: T helper 17; VEA: very early arthritis; VERA: very early rheumatoid arthritis.The authors declare that they have no competing interests.RC and RAM equally performed all of the laboratorial work, data collection, and statistical analysis and wrote the paper. IP contributed to some of the laboratory experiments. HC, ES, AFM, AMR, and JP-P were responsible for the selection, follow-up, and medical care of patients enrolled in this study and helped review the paper. MVQ participated as the head of the Rheumatology Department of Hospital de Santa Maria, which approved the study and patients' management. HSR and MMS-C made a substantial intellectual contribution to the present work and revised it critically. LG and JEF, as senior authors, conceived of the study, participated in its design and coordination, and contributed important intellectual input to the draft of the manuscript. All authors read and approved the final manuscript. |
Several lines of evidence suggest that transcription factors are involved in the pathogenesis of Multiple Sclerosis (MS) but complete mapping of the whole network has been elusive. One of the reasons is that there are several clinical subtypes of MS and transcription factors that may be involved in one subtype may not be in others. We investigate the possibility that this network could be mapped using microarray technologies and contemporary bioinformatics methods on a dataset derived from whole blood in 99 untreated MS patients and 45 age-matched healthy controls.We have used two different analytical methodologies: a non-standard differential expression analysis and a differential co-expression analysis, which have converged on a significant number of regulatory motifs that are statistically overrepresented in genes that are either differentially expressed in cases and controls .Our analysis uncovered a network of transcription factors that potentially dysregulate several genes in MS or one or more of its disease subtypes. The most significant transcription factor motifs were for the Early Growth Response EGR/KROX family, ATF2, YY1 (Yin and Yang 1), E2F-1/DP-1 and E2F-4/DP-2 heterodimers, SOX5, and CREB and ATF families. These transcription factors are involved in early T-lymphocyte specification and commitment as well as in oligodendrocyte dedifferentiation and development, both pathways that have significant biological plausibility in MS causation. Multiple Sclerosis (MS) There are three principal clinical subtypes of MS, the most prevalent being: relapsing remitting (RRMS), where unpredictable relapsing episodes alternate with periods of remission; primary progressive (PPMS), where there is steady progression of the illness from onset; and secondary progressive (SPMS), where after an initial relapsing remitting pattern, there is progressive neurological decline with or without relapses. The question of whether some MS subtypes are associated with particular susceptibility genes is open and merits further examination. Currently there is only modest evidence for any association Previous research has demonstrated the potential of differential gene expression profiling in elucidating complex traits, including disease susceptibility, when expression is measured in tissue related to the trait under study network of transcription factors that are implicated in MS and its subtypes as inferred from the differential expression and co-expression of several hundreds of genes.Evidence suggests that transcription factors are involved in the pathogenesis of MS and other autoimmune diseases We are aware that a cautionary note is required to our study and all others that aim to correlate variations in the transcriptome of whole-blood with gene expression and its regulation mechanisms and their consequences in the brain . There exist few studies in the area. In a recent study As the effects of processing whole blood may also contribute to changes of these gene expression patterns, our cautionary note remains until we could better narrow the valid consistencies. In some sense, the diagnostic need of a simple blood test for MS, as well as our present atlas of expression changes with this technology will certainly motivate useful studies like the one in http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE17408).The data discussed in this publication have been deposited in NCBI's Gene Expression Omnibus co-expressed between control and MS samples. The first analysis is better at revealing differences in gene expression between the sample groups, while the second aims to find specific groups of genes which have lost their normal pattern of co-expression and are affected by MS irrespective of disease subtype. Overrepresented binding motifs, and their corresponding transcription factors, were obtained for the groups of genes identified under both approaches.Two different analyses were used to define potentially relevant transcription factors. Gene expression using microarray detection techniques utilize short sequences (“probes”) that target specific genes, and even specific protein isoforms (particularly true in Illumina technology). All differential expression or co-expression analysis here are performed on individual probe identifiers, while transcription factor overrepresentation are performed based on the target genes identifiers. The first identified gene probes differentially expressed between the four different clinical groups in the study's sample set; the second, groups of gene probes pair-wise differentially -k-feature set selection method Seven molecular genetic signatures were derived from the whole blood mRNA expression data collected in p-value <0.05. The complete profiles for all signatures are given in A profile of overrepresented regulatory sequences was obtained for each of the seven signatures using the profiling tool GATHER Additionally, we profiled the above TRANSFAC profiles themselves to reveal higher-level overrepresented regulatory sequences. These higher-level regulatory sequences – which effectively identify ‘regulators of regulators’ – were obtained by TRANSFAC profiling the coding genes of transcription factors corresponding to key sequences in the above TRANSFAC profiles. We considered the identification of the key sequences to be a problem of combinatorial optimization as described under We highlight the appearance of V$E2F1DP1_01 complex , V$DEAF1_01 , V$MAZR_01 and V$E2F4DP2_01 . V$DEAF1_01 is a binding motif for the DEAF1 transcription factor, which has been related to negative regulation of T-lymphocytes Finally, we profiled up-/down regulated subsets of the signatures to reveal any regulatory sequences associated with increased/decreased expression only. The intersection of the signatures is depicted in The heterogeneity of the C/MS signature makes it relatively difficult to talk about individual probes, as it is unlikely that they will have the same pattern of expression across all subtypes of MS. Nevertheless, we highlight the following for future discussion. First, a probe for LOC649143 (DR-9) (DR9)) has a tendency to be consistently upregulated in controls but not in MS samples. Second, a probe for LOC650557 beta chain precursor (DQB1*0501)) has the opposite behaviour, a tendency to be downregulated in controls. CASP8 appears upregulated in MS and RRMS groups; the protective effect of its inhibition to oligodendrocytes has been suggested in FOXO3 An interesting finding in this signature is the presence of a probe for HAR1A (highly accelerated region 1A (non-protein coding)). HAR1A was first identified in 2006 by Katherine Pollard et al. as part of a novel “RNA gene” expressed specifically in Cajal-Retzius neurons in the developing human neocortex from 7 to 19 weeks of gestation Other notable biomarkers include CD52, RNASE2, and EGR3 (upregulated in PPMS in comparison to Controls). The CD52 molecule We again note the presence of a probe for LOC649143 (DR-9) (DR9)). Another probe that seems to be consistently upregulated in controls but not in MS samples is for HLA-DQB1 . This is of potential interest in view of the strong evidence that the expression of the MHC class II Allele HLA-DRB1*1501 is regulated by vitamin D With a different behaviour, we should cite a probe for VDR receptor) and, as in the C/MS signature, a probe for LOC650557 beta chain precursor (DQB1*0501)), which are upregulated in MS. Other interesting biomarkers include CA2 (Carbonic anhydrase II) (downregulated in RRMS), IRF5 (Interferon Regulatory Factor 5) and CD3D ), both upregulated in RRMS. CA2 is localized to oligodendrocytes, myelin, and choroid plexus epithelium in the human brain IRF5, SOD1, NF1 (neurofibromin 1), CD3D, ADAM-17 and ILF2/NF45 , on the contrary, have a tendency to be upregulated in RRMS samples. An allele in IRF5 has been reported as conferring an increased risk for inflammatory bowel diseases, systemic lupus erythematosus and MS, suggesting that there is a link between IRF5 and several autoimmune diseases p-value <0.005, are provided in the C/PP signature that are responsible for almost all the terms in its profile see . Most ofkNN-MST clustering algorithm In this section, we report on the results of applying our second method of differential gene (co-)expression analysis. A star’. Each star contains a designated centre node and its immediate neighbours; a high cardinality star has a centre with at least twenty neighbours. A star indicates that a group of genes exhibit differential co-expression between two different class labelling; in this case to the control and MS groups only. The co-expression of the centre with each neighbour (inversely) correlates over one sample group but not the other. To illustrate, a plot of the correlation behaviour of one star centre with its neighbours is shown in Of particular interest are nodes with many immediate neighbours – a configuration that we call a ‘Profiles containing overrepresented regulatory sequences were obtained for the 39 high cardinality stars. The members of the stars were assigned to one of 15 groups according to the cluster containing the star, which were profiled for overrepresented TRANSFAC binding motifs using GATHER 9, i.e. p-value <10−9). A similar proportion occurs in the intersection between the star and up/down regulated signature subset profiles: 75 motifs, or 77.3% of the up/down signature subset motifs and 38.9% of the star motifs .A significantly large proportion of these motifs intersect with those in the TRANSFAC profiles of the signatures see . In partThe significant agreement between the two approaches is notable because patterns of differential expression and differential co-expression are unlikely to contain a large number of the same genes. This is indeed the case; there are 790 and 1,256 unique probes in the signatures and stars respectively, only 53 of these (6.7% and 4.2% respectively) occur in the intersection. The agreement in the regulatory motifs between both approaches could be explained by the occurrence of transcriptional dysregulation in MS, mediated by the transcription factors associated with these particular regulatory sequences.We now highlight some of the probes that correspond to “stars”, seem to indicate genes that are differentially co-expressed in MS patients.ASPM homolog, microcephaly associated (Drosophila)) is a centrosome protein PTPRN , appears in the literature with different names . The literature reports associations with insulin dependent diabetes mellitus Insulin signalling pathway as the most significant when all neighbours of the 39 stars are searched; 17 out of the 21 probes that appear in the insulin signalling pathway (including INSR and MAPK3 themselves) have V$KROX_06 as a binding motif, and all 21 have V$E2F_Q6, pointing again to the KROX family of proteins and E2F, now linked to insulin signalling regulation.A probe for INSR, the Insulin Receptor (probe ILMN_1670918), has lost its pattern of co-expression with a group of 20 other probes. If the INSR has lost co-expression in MS with some other partner probes we should expect downstream effects on the insulin signaling pathway. Indeed, MAPK3 also belongs to the insulin signaling pathway and has also been identified at the centre of a star with 23 neighbours. It is noteworthy that GATHER brings The star corresponding to UniGene HS.495215 , probe ILMN_1820392) has 56 neighbours. Of these 56, 15 have also appeared in one of our seven genetic signatures. With the exception of only one, they have appeared in either the signatures C/PP or C/RR. There is a relative big number of ribosomal proteins associated , LOC441246 , LOC285900 , LOC646483 . We have also found CD3D ), GNL3/Nucleostemin (guanine nucleotide binding protein-like 3 (nucleolar)) SNRPD2 , SEC11A/Endopeptidase SP18 (SEC11 homolog A (S. cerevisiae)), TOMM7 ). The only downregulated gene (in a signature SP/PP) is MAD2L1BP (MAD2L1 binding protein). From this group, it is perhaps CD3D and its the relationship with the TCRA locus that caught our immediate attention, since progress in the understanding of CD3D's functions come from studies on its deficiency, defects and/or inactivation Interestingly, of the genes present in the MS signature only three, two of which are ribosomal proteins, occur in any of the 39 highest cardinality stars . Of the 790 genes differentially expressed in some signature, three are also star centres , while fifty appear as neighbours of star centres. Of these 53 genes, sixteen (30%) appear in a single star, the star with centre Hs.495215 , most of which come from C/PP and C/RR. The TRAV38-1 star is strongly associated with ribosomal proteins.In this paper we have analysed gene expression data with a variety of computational methods with the aim of uncovering transcription factors that potentially dysregulate in MS or one or more of its disease subtypes. The zinc finger protein YY1 YY1 inhibits human papillomavirus (HPV) replication in vitro, and binds the human papillomavirus-6 E1 promoter et al. who observed that these gene tends to harbour viral integrations of the 1.4 strain of Graffi murine leukemia virus YY1 is considered a critical regulator of early B-cell development The role of overexpression of YY1 in the differentiation of oligodendrocyte progenitors has been studied in In summary, YY1 transcription factor seems to be playing a key role in the pathogenesis of MS or its subtypes, given its connection to processes affecting myelin protein generation, viral replication and immune response processes. It appears as one the most significant transcription factors related to the differential expression of genes in MS patients.A motif for the Early Growth Response family was one of the most significantly overrepresented motifs identified by this study. A member of this family, EGR2/KROX-20 has been previously associated with the regulation of Schwann cells Activation of KROX-20 is an indispensable transcription factor for myelination and a prerequisite for Schwann cell differentiation” As it was the case of the YY1 transcription factor, this family role in the immune response has to be monitored as there are reports of EGR/KROX being negative regulators of T cell activation Studies of homozygous shiverer mutant mice have identified ATF2 as a regulator of the expression of MAG expression at a specific stage of shi/she oligodendrocyte differentiation Another transcription factor motif significantly overrepresented is SOX5 . Together with SOX6, SOX5 was identified as cell-autonomously regulating several stages of oligodendrocyte development in the mouse spinal cord It is widely believed that T cells are central to the pathogenesis of MS; autoreactive T cells are hypothesised to coordinate an attack against central nervous system myelin, triggering an inflammatory response leading to neurological damage. However, the origin of the autoreactive lymphocytes is unknown. We looked for a correspondence between the regulators that we found above and those of T cell specification (the process by which haematopoietic stem cells progress through intermediate progenitor cell types to mature T cells), which may help to identify a defect in the T cell developmental program in MS. Such defects have been linked to many diseases, including a proposed contribution to diabetes susceptibility in non-obese diabetic mice, with CD4+CD8+ blasts that have abnormally high expression of IL-7Ralpha, and c-Kit Cell specification is well understood for T cells compared to most other cell types and many regulators of the process have been identified. In two recent comprehensive studies, a sizeable network of regulatory relationships involved in T cell specification was constructed T-cell lineage differentiation is an ongoing process in mammals with a clear transcription factor “armature” regulation To obtain a time-series of early T-cell development for gene expression analysis, David-Fung et al. sorted subsets of immature mouse thymocytes from postnatal, weanling mice. Stages of development were based on the expression of CD44, CD25, and the growth factor receptor c-Kit and markers CD44, CD25 and the heat-stable antigen (CD24) and CD27. In the first stages of T-cell development the cells that enter the thymus are defined as “double negative” (DN), since they do not have the T-cell markers of maturity (CD4 and CD8). David-Fung et al, indexed these stages in terms of increasing maturity as DN1 , DN2, DN3a, DN3b, and DN4. Using four independent series of samples , DN1, DN2, total DN3, and DN4 cells were collected in each of the first two sets . In the second two sets the DN3 cells were subdivided into DN3a (pre-selection) and DN3b (the first stage past β-selection).YY1, together with Ikaros (Ikzf1), MYB and other transcription factors have been shown to have minimal changes from DN1 to DN3 stage. The list of other transcription factors that have critical roles in T-cell differentiation and development, and that have minimal changes of gene expression also includes MLL1, Gfi-1, GABPα, Stat5b, Oct1 (Pou2f1), and TOX. More recently, David-Fung et al have included YY1 together with FOG-1 (Zfpm1), Gse1, and Zfp598 to this list of “legacy genes” If transcription factors do dysregulate genes in MS, it is reasonable to suspect that some are only associated with specific disease subtypes. Based on our data, we propose the following speculative, informal initial model that links transcription factors to MS disease subtype. The model is limited to transcription factors currently known to be involved in T cell specification The model is illustrated in The model is intended as a starting point to motivate further research for identifying transcription factors involved in the pathogenesis of MS, as it relies on simplifying and biologically naïve assumptions – for instance, T cell specification does not occur in peripheral blood, where the samples were collected, but in the thymus, but effects on peripheral blood are still measurable. Thus, there is room for refinement and it could be extended also by considering other transcription factors such as the key regulators identified by the hitting set analyses. However, our hope is that this model can be used to corroborate other findings, single out transcription factors for more detailed research, and participate in unravelling some of the heterogeneity in MS.Using state-of-the-art bioinformatics methods, our analysis uncovered a network of transcription factors that putatively contribute to the dysregulation of several genes in MS or one or more of its disease subtypes. Separate analytical methods were used on the same dataset, involving sophisticated mathematical algorithms to solve combinatorial optimization problems. We noted a convergence of findings, leading to a set of transcription factors which are involved in the early T-lymphocyte specification and commitment as well as in oligodendrocyte dedifferentiation and development. The most significant transcription factors motifs were for the Early Growth response EGR/KROX family, ATF2, YY1 (Yin and Yang 1), E2F-1/DP-1 and E2F-4/DP-2 heterodimers, SOX5, and CREB and ATF families.Institutional Human Research Ethics Committees approval to conduct this study was obtained by the Chief Investigators of the ANZgene Consortium, that included: E08/910 from Eastern Health Research and Ethics Committee (VIC), Research Application 105/07 from Flinders Medical Centre Research Ethics Committee (SA), GU Protocol HSC/09/03/HREC from Griffith University (QLD), MEC/07/12/176 from Multi-Region Ethics Committee (NZ), 05/04/13/3.09 from Hunter New England Human Research Ethics Committee (NSW), H-505-0607 from the University of Newcastle Human Research Ethics Comitee (NSW), HREC #1980 from The University of Sydney Human Research Ethics Committee (NSW) and H0009782 from the Human Research Ethics Committee (Tasmania) Network (TAS).Written informed consent was obtained from all subjects prior to participation in this project.A cohort of 99 people with MS and 45 healthy controls was recruited from Sydney, Newcastle (NSW) and Gold Coast (QLD). Diagnosis of MS was confirmed using the revised McDonald criteria The peripheral blood samples were collected between 9AM and 1PM and total RNA was extracted from the whole blood in PAXgene tubes using PAXgene™ Blood RNA kit according to the manufacturer's instruction unless otherwise stated. Total RNA quality was assessed and its concentration was measured using Agilent RNA 6000 series II Nano kit . Minimum RNA Integrity Number (RIN) of >7 was employed for each sample to pass the quality assessment. 250 ng total RNA from each sample was biotinylated and amplified using Illumina® TotalPrep RNA Amplification Kit . Total RNA was reverse transcribed to synthesize first strand of cDNA followed by second strand synthesis. Double stranded cDNA was then transcribed and amplified in vitro to synthesize biotin labelled complementary mRNA (cRNA). The cRNA yield was measured at 260 nm using NanoDrop 1000A Spectrophotometer. 750 ng of cRNA sample was hybridized on a human HT-12 expression beadchip profiling 48,804 transcripts per sample. The chips were stained with streptavidin-Cye3 conjugate and scanned using an Illumina BeadArray Reader (Illumina Inc.).The dataset is available in Gene Expression Omnibus under the reference GSE17048.p-value <0.01 for at least one of all samples. The detection p-value measures the probability of observing signal without specific probe-target hybridization.The average signal intensity for each gene was measured using Beadstudio v3. The sample signals were normalized with cubic spline in order to minimize variation due to non-biological factors. Approximately 19,000 genes were selected for differential expression analysis with detection p-value filtered dataset for each pair of sample groups by applying an additional two-step filtering process, which removed probes lacking sufficient discriminative power according to information content and predictive ability respectively.A genetic ‘signature’ was obtained from the detection An entropy-based selection procedure employing Fayyad and Irani's multi-class, multi-interval discretisation algorithm k-feature set selection method k-feature set problem asks, in this context, for the smallest subset of probe sequences containing: i) at least α probes differentially expressed (after discretisation) between every pair of samples in the Cartesian product of the two sample groups , and ii) at least β probes with equal (discretised) value for all pairs over the Cartesian product of the sample groups. Intuitively, α and β specify the degree of inter-class differentiation and intra-class similarity respectively. In practise, we use α maximum and β maximal to facilitate computation of a solution; Following, an kNN-MST graph clustering analysis ijd is the distance between probes i and j, ijCk), andA cluster map was constructed for the approximately 19,000 probe sequences found to be expressed in whole blood, using a ijd = 0, which occurs when the expression of i and j are perfectly correlated over controls and perfectly anti-correlated over disease (or vice versa). A distance of ijd = 1, which is relatively short, occurs between a pair of probe sequences correlated (or anti-correlated) over controls and uncorrelated over disease.changed or lost correlation with the centre in disease. Under our working hypothesis, this effect is attributed to dysregulation of the transcription factor(s) associated with the centre and not with the neighbours.With this definition of distance, high cardinality stars are particularly important since all the immediate neighbours of the centre have S (of TRANSFAC motifs), a collection C of n subsets C1,…,nC ⊆ S, and a positive integer m. The elements of S have positive weights sw , µs ∈ S. We seek a subset HS ⊆ S such that |HS ∩ iC| ≥ m, i = 1,…,n, and Σssw is minimal. Such a set HS, if it exists, is a weight-minimal hitting set because it ‘hits’ all subsets iC at least m times.Our hitting set filter is formally defined as follows. Consider a set iC is defined by iC = {js | M = ‘x’ }, where M is the i,jth entry in the matrix with the row for w removed; for example, C3 = {s1, s3, s5}.To illustrate, consider the hitting set instance given in the matrix shown in m = 1,…,4. Note that there is a two-fold effect as m grows: first, |HS| tends to increase with m; but second, beyond a certain point no satisfying HS exists. Throughout this paper, m = 1, 2, and 3.On the right, weight minimal solutions are shown for sx = 1 if s ∈ HS, sx = 0 otherwise.We employed CPLEX, an integer linear programming tool, to efficiently compute solutions to the hitting set instances. The hitting set problem can be formulated as an integer linear programming problem as followsTable S1Signature Control - MS. Heatmap and annotation for the C/MS signature. Probe Ids, expression values, hitting set annotation, and gene annotations are given.(1.08 MB XLS)Click here for additional data file.Table S2Signatures Control - RRMS and Control - SPMS. For each signature, the probe Ids, expression values, heatmap, hitting set annotation, and gene annotations are given.(1.88 MB XLS)Click here for additional data file.Table S3Signatures Control - PPMS, PPMS - SPMS, RRMS - PPMS and RRMS - SPMS. For each signature, the probe Ids, expression values, heatmap, hitting set annotation, and gene annotations are given.(2.27 MB XLS)Click here for additional data file.Table S4 k-feature set summary statistics. Summary statistics of the k-feature set selection process for each of the signatures and combined listing of all signatures, showing over or under expression and signature overlap. Overlap with the signatures in the companion study are also given.(0.52 MB XLS)Click here for additional data file.Table S5TRANSFAC Profiles. Excel file containing the TRANSFAC profiles for the 7 signatures, 14 up/down-regulated signature subsets, and 15 star clusters.(0.30 MB XLS)Click here for additional data file.Table S6g:Profiler functional profiles for signatures. Functional profiles for each signature. Profiling was performed with g:PROFILER (0.47 MB PDF)Click here for additional data file.Table S7Members of high cardinality stars. Complete member listing of all 39 high cardinality stars.(0.29 MB XLS)Click here for additional data file.Figure S1Stars correlation plots. Correlation plots for all high cardinality stars.(8.18 MB PDF)Click here for additional data file.Figure S2Largest clusters. The seventeen largest clusters found by analysis of genes differentially co-expressed over controls and MS. Figure is in GML format.(0.44 MB ZIP)Click here for additional data file. |
Protein structure alignments are usually based on very different techniques to sequence alignments. We propose a method which treats sequence, structure and even combined sequence + structure in a single framework. Using a probabilistic approach, we calculate a similarity measure which can be applied to fragments containing only protein sequence, structure or both simultaneously.Proof-of-concept results are given for the different problems. For sequence alignments, the methodology is no better than conventional methods. For structure alignments, the techniques are very fast, reliable and tolerant of a range of alignment parameters. Combined sequence and structure alignments may provide a more reliable alignment for pairs of proteins where pure structural alignments can be misled by repetitive elements or apparent symmetries.The probabilistic framework has an elegance in principle, merging sequence and structure descriptors into a single framework. It has a practical use in fast structural alignments and a potential use in finding those examples where sequence and structural similarities apparently disagree. Protein sequence alignments usually rely on a substitution matrix. This reflects an evolutionary model and the probability that one type of residue has mutated to another ,2. Protek, where k = 1. There is plenty of data to estimate the log-odds probabilities of 20 × 21/2 = 210 possible mutations [k = 2 (dipeptides) [Just considering sequences, there is already a history working with different sized fragments. Firstly, one can think of conventional sequence alignment as working with fragments of length eptides) ,4. Unforeptides) . The dirk = 1 will never be a good way to represent structural properties. Furthermore, of the mass of structural alignment methods [Proteins can also be aligned on the basis of their structures, but there is no single popular methodology. Structure reflects the arrangement of residues in space and is not a property of a single residue, so fragments with methods -34, hard methods .If one is willing to forget the evolutionary model, it should be possible to statistically measure fragment similarity, but based on what is observed, rather than requiring that everything possible be observed. Furthermore, one should be able to work with larger fragment lengths. A fragment could be characterised by some vector of properties and the similarity of two such vectors would measure the similarity of the fragments.Nc classes, a fragment has a vector of probabilities that it is in class 1, 2, ...Nc. Given this vector for two such fragments, one can then ask, what is the probability that two fragments are in the same class ? Regardless of which class this is, similar fragments will have similar vectors of probabilities. The classification may not be perfect, so some fragments may have a non-zero probability of being in several classes. Even if one cannot say which class the fragments are in, similar fragments will have similar patterns of probabilities. This could be seen by the dot product of class membership probability vectors and is formalised below (eq. 4). In this work, the classification comes from a maximally parsimonious Bayesian classification of fragments. The number of classes is typically of the order of 102, the fragment length k = 6 and the amount of training data of the order of 106 observations.This has been done using physical or chemical properties which seem reasonable to a chemist ,28, but φ and ψ backbone angles. One class within such a classification would have k pairs of φ and ψ distributions (one for each of the k residues). Given some observation (fragment), one can can calculate its probability of being in a class by calculating the probability of each φ,ψ pair within the corresponding distributions that define the class and taking the product of these probabilities.The classes used here are sets of statistical distributions. These are multinomial Bernoulli distributions for the discrete (sequence) properties, Gaussian for the continuous properties and appropriate mixture models to combine sequence and structure. For example, one may have a pure structure classification based on k sites within a class. Instead of Gaussian distributions, one has 20-way probabilities at each site. Different classes will reflect the different probabilities of finding each amino acid at each position. Class membership of a fragment is simply calculated from the product of the probabilities of each amino acid occurring at each site within the class.Exactly the same process can be applied to sequence by using distributions of amino acid probabilities at each of the Finally, a classification can combine sequence and structure distributions. Class membership of a fragment is just the product of probabilities of finding its sequence (discrete) and structure (continuous) descriptors within some class.φ,ψ angles within residues.In practice, structure classes were based on bivariate Gaussian distributions in order to account for the strong correlation of Describing proteins by fragments is not new, but the philosophy here differs from most literature examples -39. Firsk was extracted. Fragments with any bond longer than 2 Å were discarded, leaving a set of just over 1.5 × 106 fragments of length k ≤ 6.The training data was a set of protein chains taken from the protein data bank (PDB) such thaA set of protein pairs was used for testing alignments and selected so that there should be some structural similarity, but little sequence similarity. Starting from a list of related pairs of proteins -45, a sek residues in each class was modelled by a 20-way categorical (multi-way Bernoulli) distribution. For classifications using backbone angles, φ and ψ of each residue were shifted into the periods of 0 to 2π and -π/2 to 3π/2 respectively and treated as continuous descriptors. To allow for correlations between φ and ψ angles, they were modelled as bivariate Gaussian distributions of the formFor classifications based only on sequence, each of the θ is the two-dimensional vector for a φ, ψ pair and μθ is the corresponding vector of means. C is the covariance matrix, |C| the absolute value of the corresponding determinant and (θ-μθ)T is the transpose of (θ-μθ). Classifications using both sequence and structure used a mixture model with both the discrete and continuous distributions.where Given the distribution types, expectation maximization was used to find the model (parameter set) which maximises the likelihood of the data . One useP(fi ∈ cj) that a fragment i with its vector of attributes fi is a member of class cj. This depends on the product of the probability of seeing each of the m attributes in each of the distributionsProbability calculations were done in wurst , but thevj is the set of distribution properties describing class j. wj is the weight or probability associated with class j. The product runs over the m attributes and considers the parameters vj,m which describe the m'th attribute in the j'th class. When calculating the probability of a fragment being in a class, eq 2 is applied to all classes and normalised so that the sum of probabilities is one. The class weights, w, reflect the importance of a class and are subject to the normalisation where F of fragments depends on the probability of seeing all of the contributing fragments and the set V of all vj,mThere are two more consequences. Firstly, there is a measure for the relative success of a classification. The probability of the database and this introduces a strong element of parsimony. Any time new parameters are introduced, one brings in a multiplicative factor less than one. Thus, any time a new class is introduced, the probability of the data set appears to decrease unless the new class is strongly supported by the data. This means the method is not very susceptible to overfitting and there is a tendency to find the minimal number of classes necessary to model the data.k, this leads to a number of parameters to optimize as shown in Table The search over parameters can then be summarised. For a given trial number of classes, distribution parameters were initially chosen randomly, optimized with expectation minimization and the process repeated many times. This was then repeated so as to optimise the number of classes. For a fragment length of k, then a protein with nr residues is broken into nr - k + 1 overlapping fragments. The class membership probabilities could then be assigned using eq 2. Given nc classes, a fragment is characterised by an nc-dimensional vector, so a protein can be seen as nr - k + 1 vectors in an nc-dimensional space. Given two such protein fragments i and j, probably from different proteins, one can calculate a similarity measure sijGiven a classification, it could then be used for the calculation of alignments. If a classification is based on fragments of length pi denotes the vector of class probabilities for fragment i. If the two vectors have been normalised to unit vector length, sij offers a rather rigorous measure of similarity in the range 0 to 1. These sij scores can be used as the elements of a similarity matrix suitable for calculating optimal pairwise alignments. The procedure can be applied to probabilities calculated from pure sequence or pure structure or combined sequence and structure. Unlike conventional scoring methods, eq. 4 does not relate to single sites or amino acids in a protein. The vector pi reflects k residues. This means that each entry sij in the score matrix reflects the contribution of k overlapping fragments, each of length k, so it is sensitive to an environment of 2k - 1 residues. All alignments were calculated with wurst [where th wurst using thth wurst of the Sth wurst algorithQ-value common in the folding literature which quantifies how many correct contacts are made within a protein [α based distance matrices [In order to optimize alignment parameters or measure the quality of alignments, a cost function was used which does not rely on any reference or ideal alignments. Given a pair of proteins "A" and "B" of known structure, they can be aligned by some method such as sequence alignment. From the alignment, a backbone model for "A" can be calculated using the coordinates of "B". The operational definition of alignment quality is a geometric measure for how close the model is to the original coordinates for "A". This can be calculated and averaged over the set of 2 902 protein pairs (described above) and done for both AB and BA pairs. The structural measure used is similar to the protein ,52. Firsmatrices ,54, somematrices ,56αi and Cαj in the native structure and Nres aligned residues. Next, one defines a threshold, DMEcut = 4.0 Å, bearing in mind the typical Cα - Cα distance between adjacent residues is 3.8 Å. Then one discards the elements where the two distance matrices are most different, until DMEnat,model is less than or equal to DMEcut. The remaining fraction of the distance matrix is f where {rx} is the set of Cα coordinate vectors from molecule x. In pseudocode, one can describe the process:where nat,model >DMEcut) { while = fraction of distance difference matrix remaining }f near 1 means structures are nearly identical, but below about 0.5, there is little similarity. This leads to the use of a smooth switching function centred at 0.7. The final cost function C is thenTo convert this to a penalty function, one notes that a = 0.7 and b = 15 (an arbitrary choice for the shape of the sigmoid). The summation ran over all Npair = 2 902 protein pairs.where Given this measure of alignment quality, parameters were optimized with a simplex optimizer as previously described . In thise-value < 10-10, 10 iterations with the threshold set at 10-8 and 5 iterations with the threshold set at 2 × 10-5. This profile was then used as a query against sequences derived from protein data bank structures. For comparison, the default acceptance threshold is e-value < 5 × 10-3.The one psi-blast database search referred to below used a profile built with acceptance parameters orders of magnitude more careful than default values . 15 iterk = 6. Larger values of k may be desirable and there may be ample data (1.5 × 106 data points), but the parameter search space becomes intractably large. One should note that one never finds the optimal classification or even the correct number of classes for any realistic problem. The next point is that it is not always meaningful to simply quote the number of classes. For fragment length k = 6 and a pure structural classification, a good classification was found with 248 classes, but this number alone is misleading. One can estimate the importance of each class by summing class membership probabilities over all data points and their partial class memberships. Figure Fragment classifications were attempted for pure sequence, pure structure and combined sequence+structure and for fragment lengths up to φ and ψ dimensions and treated as a probability distribution which could be compared against probabilities from a classification. The first measure was the Kullback-Leibler divergence, DKL given byFinally, one can see how well a classification reflects the original data. First, the training data was put into bins of 0.4 × 0.4 radians in the H denotes a histogram from the training data, C denotes the classification and pij is the probability for bin i,j. DKL is zero if two distributions are the same and grows as they differ. Similarly, one can treat the two-dimensional histogram from the training data and probabilities from the classification as vectors and then calculate a dot product. This will equal 1 if the two distributions are the same.where the superscript DKL = 0.22, whereas a random distribution gives DKL = 2.01. Labelling the dot product as Dp, we find Dp = 0.89 for the classification, but 0.26 for a random distribution. Figure wi in eq. 2) mean that these classes rarely come into play.Using the same classification as above, Given these overall properties, one can consider some example results from each type of classification.This type of classification is included as a matter of principle, rather than practical use. There are, however, two reasons why it may have been of interest. Firstly, if one believes in the importance of sequence motifs, this could be a method for finding them. Practically all motif finding methods use some form of supervised learning (training from known data) -61. The k = 6, the most statistically unusual class, as measured by the cross entropy, is HHHHHH. The second most unusual class was another common sequence tag. The other classes may be interpreted in terms of chemical properties, but it is more sensible to refrain from over-interpretation. This kind of unsupervised learning is not the best way to recognise biologically interesting sequence motifs.First we consider whether there are some statistical patterns which are so strong and distinct that they will be found by this kind of unsupervised learning/classification. The answer is yes, but it is of no practical use. For fragments of length Next, we briefly consider the question of sequence alignment using a score matrix based on similarities of class probability vectors (eq. 4). With the set of 2 902 distantly related protein pairs, alignments were calculated, models constructed and the alignment quality measured as described under Methods. For comparison, the same procedure was done with conventional pair-wise alignments based on a blosum62 substitution matrix [k = 6 and 248 classes. Not surprisingly, the three most populated classes are recognisable classic secondary structure, but soon one reaches classes which may or may not have literature names. The practical application of this classification is more interesting than a reinvestigation of protein structural motifs. When the vectors in eq. 4 are based only on structural properties, they form the basis of a swift and robust protein structure alignment method, available as a web service [Unlike a pure sequence-based classification, the pure structure-based classification leads to a directly useful application and often easily interpretable results. We concentrate on results from a classification with fragment length service and fastFirstly, one can look at the very gross average behaviour and compare the quality of the alignments with those from the same methodology using sequences or conventional sequence alignment (previous section). Figure One can look at average performance, but when comparing protein alignments, it may be that there are many methods which perform similarly, even with approaches based on methods ranging from local distance information mean field methods -35,63-66To make the point, we consider two extreme examples, one of which may suggest a weakness in the implementation here. The first example is 1qys. This was deliberately constructed so as to have a unique topology . By desith rank) is 1jjo shown on the right hand side of the figure. The similarity by eye is clear, but the irregularity in the query structure renders it a difficult case for some programs. Obviously, one example does not mean the code described here is in any sense better than other structure similarity finding programs. It is a deliberately chosen extreme example which highlights different properties of this methodology.Secondly one can consider a protein with little regular secondary structure. The protein data bank was searched for a chain with more than 100 residues, whose structure was determined by X-ray crystallography and with less than 7 % annotated α-helix or β-strand. The first protein found was 1kct , an α-1-k = 6 and 267 classes. The structural fragments were constructed using the φ and ψ angles from each of the 6 bivariate Gaussian distributions in the class. The residue probabilities in the bar plots are scaled relative to background probabilities, so a 1/4 high bar at a position in a fragment would mean that the probability of an amino acid type simply follows the background distribution.We have considered alignments based on class probability vectors where the original descriptors came from protein sequence (Bernoulli distributions) or structure (Gaussian distributions). The methodology implied by eq. 2 and 3 can also be applied to the mixture model including both sequence and structure information. This means one can calculate true combined sequence and structure alignments. Firstly, it is easy to see why this approach will differ from either a pure sequence or structure method. To make the point, Figure The three classes with the highest statistical weight are structurally indistinguishable α-helical, but differ in their sequence profile. The second and third classes show the periodicity of amphipathic helices. Two example β-strand classes are shown which again differ in their sequence propensities. The last example (class 15) at the bottom of the plot shows a different property. The amino acid probabilities do not differ too much from background probabilities, except at position 4, which almost has to be a glycine. Looking at the fragment, it is clear that this is part of a classic, well characterised turn ,70.α atoms of 16.5 Å.These fragments from the combined mixture model were also used for alignments and the gross performance is given by the bar in Figure e-value (0.02). By itself, this would also not be considered significant. Most persuasively, the iterated sequence search from psi-blast aligns residues 34 to 123 of 1zpu and the combined sequence/structure alignment using our code aligns almost exactly the same stretch (residues 37 to 124). This appears to be simply an example of normal divergent evolution, but it is an example of where structure has diverged to the point where a simple structural superposition is not conclusive.A combined sequence to structure alignment resulted in the superposition of Figure Again one should be clear that this kind of result is not in its own significant. When one is dealing with remote homologues, different programs will produce different results. With enough time, one would be able to find alignments which are found with other codes, but missed or miscalculated using our methods. The interesting point is that there is one method and one scoring scheme which can operate on both protein sequences and structures.Clearly, it is possible to have a single probabilistic methodology for finding similarities based on sequence, structure or simultaneous sequence and structure. The question is whether one would want to. The application to sequence alignment is interesting, but not obviously useful. The pure structure alignment, based on continuous descriptors is obviously useful and available as a web service . The comφ, ψ correlations within a residue, but test calculations on smaller data sets suggest that in a small number of classes there are correlations between neighbouring residues which could be accounted for. The problem is that there are currently 18 parameters per class in a pure structure classification with k = 6. Using a full covariance matrix results in 27 parameters per class.The methodology is in most senses rather unusual and there are some assumptions and limitations. If one feels the underlying statistical models are a good representation of protein data, then the rest of the procedure is completely justified. Of course the underlying models are not perfect. Gaussian distributions are mainly chosen for convenience and one knows that there are some correlations which could be included. The distributions in this work accounted for vice versa). They also require some similarity measure between clusters [There are already many protein fragment classifications in the literature, but usually with a different philosophy. Generally, these use a structure classification and then see which sequence patterns fit to each structure motif for pure sequence alignment make it clear that this methodology will not displace conventional sequence-based methods. The results for structure and combined sequence and structure are far more promising. There are several reasons. Firstly, there are no preconceptions of regular protein structure. If some motif is statistically described it is part of the model. There is little preference for strands, helices or recognized turns over other motifs. Next, the method handles unusual structures. When faced with a fragment which has never been seen before, it will not be placed into any particular class. It will have some probability of being in a few classes. Any similar fragment, even if it has never been observed before, will have a similar set of class membership probabilities and will be recognized as similar. Next, the procedure is rather free of thresholds. The probability of similarity (eq. 4) runs smoothly between 0 and 1. There are no absolute matching steps necessary. Finally, each residue in a protein is involved in 2The procedure is also rather swift. To make database searches fast, class probability vectors for representative chains can be precalculated. This leaves the normal quadratic running time for the dynamic programming step. Compared to simple sequence alignment, this is slower by a constant factor since the normal table lookup from a substitution matrix is replaced by a dot product calculation.ad hoc weighting of the terms. Since the methodology is fast enough for phylogenetic calculations, we are now interested in finding examples where the different approach yield different results. It remains to be seen which is more reliable or at least persuasively believable.The approach may be useful for pure structure alignment, but its performance needs to be demonstrated quantitatively in terms of accuracy and speed, rather than by the proof-of-concept examples given here. The main advance is that one can mix sequence and structure on equal probabilistic terms without any With modest assumptions, it is possible to combine protein sequence and structure in one framework for protein alignment and comparison. Larger scale testing needs to be done to estimate its significance. The server is available for structure comparisons and all The author(s) declare that they have no competing interests.All authors have read and approved the manuscript and contributed equally to this work. |
This retrospective study was performed to determine the prevalence of lower extremity venous duplication using duplex ultrasound in the patient population of a large urban medical center.The reports of all lower extremity venous ultrasound examinations performed at our institution between January 1, 2002 and December 31, 2002 were reviewed. Ultrasound examinations that were performed for purposes other than the detection of lower extremity deep vein thrombosis were excluded. The prevalence of duplication and its specific location were recorded. In addition, the prevalence of thrombus and its specific location were also recorded.A total of 3118 exams were performed in 2664 patients. Of the 2664 patients, 2311 had only one examination performed during the study period; 353 patients had more than one examination performed. We found that 10.1% of patients (270/2664) had at least one venous segment duplicated and 5.4% of patients (143/2664) had a thrombus in at least one venous segment. There was a statistically significant difference in the prevalence of both duplication and thrombus with a change in venous segment. Only 0.4% of patients (11/2664) had thrombus within a duplicated segment. Of those who had more than one examination performed, 15.3% (54/353) had the same venous segment(s) seen on one examination but not another.Lower extremity venous duplication is a frequent anatomic variant that is seen in 10.1% of patients, but it may not be as common as is generally believed. It can result in a false negative result for deep vein thrombosis. Deep venous thrombosis (DVT), along with pulmonary embolism (PE), constitutes a disease process known as venous thromboembolic disease (VTD). Most PEs are thought to originate in deep vein thrombi in the lower extremities. The thrombus forms in the calf veins, propagates into the femoral-popliteal system, and subsequently embolizes to the lungs. Approximately 300,000 new cases of VTD are reported each year, with 100,000 cases of PE. TreatmenThe diagnosis of DVT based on clinical signs and symptoms is notoriously fallible.4 Duplex 68The purpose of this study was to determine the prevalence of duplicated lower extremity veins using duplex USG in the patient population of a large urban academic medical center.The reports of all venous Doppler studies performed in the radiology department at our medical center between January 1, 2002 and December 31, 2002 were reviewed. The images were reviewed if there was any ambiguity in the report. Studies that were performed for purposes other than detection of lower extremity DVT were excluded. The study was approved by the institutional investigational review board, with a waiver of informed consent due to the retrospective nature of the study.During the study period, 3582 venous Doppler studies were performed. Of these, 464 were excluded because they were not performed for the detection of lower extremity DVT; specifically, 350 were performed for the detection of upper extremity DVT, 75 were performed for detection or characterization of a groin pseudoaneurysm, 17 were nonvascular studies incorrectly scheduled as vascular ones, 15 were excluded because they were incomplete evaluations of the femoral-popliteal venous system, three were performed for evaluation of the pelvic veins, and two studies were for evaluation of the inferior vena cava; two other studies were excluded for other reasons. Thus, 3118 lower extremity venous Doppler studies met our criteria for inclusion in the study.All lower extremity venous Doppler studies were performed on an HDI 5000 or a Sequoia 512 sonography unit using 5 to 7 MHz linear or 4 to6 MHz curved-array transducers. The studies that were performed during normal business hours were carried out by sonography technicians having 1 to 6 years experience in performing venous Doppler studies. Studies that were performed after working hours and on weekends and holidays were done by second- or third-year radiology residents. Each study consisted of gray-scale evaluation of the veins in both the transverse and longitudinal planes to detect intraluminal thrombus, color Doppler with spectral tracing to document the waveform and respiratory variation, and compression USG of the common femoral vein (CFV), femoral vein (FV), and popliteal vein (PopV). The FV was divided into the following three segments: the proximal FV was the most cranial third, near the CFV; the mid femoral vein (mFV) was the middle third of the vein; and the distal FV was the most caudal third, near the adductor canal. Either one lower extremity or both were interrogated based on the clinical indication or clinician preference. The presence of duplication and its specific location were recorded. For the purpose of this study, any number of vein moiety more than one was considered as duplication. The presence of thrombus and its specific location were also documented. The studies were interpreted by board-certified attending radiologists with subspecialty training in body imaging and 3 to 30 years post-training experience in performing and interpreting venous Doppler studies.To determine whether there were associations between two dichotomous variables, such as gender and leg observed or duplication and thrombus, or in any instance where two proportions were compared, the chi square analysis was utilized. To discern whether the distribution of segmental duplication was similar, a weighted least squares method for one population regression analysis of marginal proportions was performed. The goal was to answer the question: Does the prevalence of duplication change with vein segment location? This is a type of repeated-measures analysis for categorical data, because we were considering five vein segments per patient. The same procedure was followed to explore the formation of thrombus. All data were analyzed using SAS system software .A total of 3118 studies were performed in 2664 patients . Of the 2664 patients, 2311 patients had only one study performed during the study period, whereas 353 had more than one study performed. Of the 3118 studies, imaging of both femoral-popliteal venous systems was performed in 1692 (54%), whereas 1426 (46%) surveyed only one extremity. Of these unilateral studies, 686 were performed on the left femoral-popliteal venous system and 740 on the right. Thus, imaging was performed for a total of 4810 limbs and 24,050 venous segments.P<0.0001).In this study, 1163 patients underwent a unilateral lower extremity venous Doppler study; 596 had a study of the left limb and 567 had a study of the right limb. Of these, 88 had duplication in at least one segment . Of the P<0.001]. Of the 88 patients with unilateral studies who had at least one duplicated segment, 19 had a thrombus in at least one segment (21.6%). There was a statistically significant difference (P = 0.0004) when we compared patients with unilateral studies who had a thrombus in a limb with no duplication (9.6%) and those who had a thrombus as well as a duplication (21.6%).Of the 1163 patients with unilateral lower extremity venous Doppler studies, 122 (10.5%) had a thrombus in at leP<0.001). Of the 184 patients with bilateral studies who had at least one duplicated segment in either limb or both, 21 patients had a thrombus in at least one segment (11.4%) of either or both limbs. There was no statistically significant difference (P= 0.85) between patients with bilateral studies who had a thrombus in a limb with no duplication (10.9%) and those who had a thrombus along with a duplication (11.4%). Only 11 patients in the study had a thrombus seen within a duplicated segment [Of the 1501 patients who had bilateral lower extremity venous Doppler studies, 21 (1.4%) had a thrombus in at least one segment. Using the weighted least squares method, we found a statistically significant difference in the prevalence of thrombus with a change in vein segment seen on one study but not another was 54 (15.3%), with the following distribution: 44 of the 277 patients with two studies; seven of the 58 patients with three studies; one of the 14 patients with four studies; and the two patients with five studies. Interestingly, the patients with six and seven studies each did not have a duplication seen on one study that was also not seen on the other studies, that is, there was 100% agreement on duplicated segments in those with the highest number of repeat exams.Much of the literature on lower extremity venous duplication is based on venography studies. The prevalence in these studies varies widely, from 5% for the et al. It is similar to the study of Dona et al. which demonstrated a prevalence of 15.7% in a study population of 177 patients (248 limbs). Gordon et al. demonstrated a duplication prevalence of 25%; however, that study examined only 58 patients (116 limbs). The larger studies, which are likely more representative of the general population, tend to show lower prevalence rates.To the best of our knowledge, this is the largest USG study of the lower extremity venous system with over 2600 patients (4810 limbs). The 10.1% prevalence is in line with the 9.1% prevalence reported in the study of 800 patients (1600 limbs) by Kerr Similar to other studies,–9 our stThrombus was seen in at least one segment of 5.4% of the patients in the study. Again, there was a statistically significant difference in the prevalence in the location of thrombus when the various potentially thrombosed segments were compared. Thrombus and a duplicated segment were seen in 14.7% (40/272); however, only 0.4% of patients had a thrombus in a duplicated segment.This study had several limitations. As the study was conducted in an academic medical center, most of the venous Doppler examinations that were done after working hours and on weekends during the study period were performed by second- and third-year radiology residents, whereas during daytime hours the examinations were performed by USG technologists. Thus, the pool of sonographers was diverse in ability. As USG is an operator-dependent modality, some duplicated vein segments may have been missed. In addition, the examinations that comprised our study group were interpreted by seven different board-certified attending radiologists. Some of those radiologists considered a duplicated vein segment to be a normal anatomic variant and did not always include the finding in the report . A large patient body habitus or marked edema of a lower extremity can also decrease the sensitivity of the examination for visualization of the veins on gray-scale imaging, particularly the mid and distal segments of the FV. An uncooperative patient can also result in a suboptimal study for visualization of all venous segments. In this study population, 193 examinations (6.2%) were limited in at least one of the aforementioned ways. Therefore, our 10.1% prevalence may be a slight underestimation of the actual prevalence. However, since most of these factors are related to the intrinsic limitations of the imaging modality and would apply to previous studies using USG, we do not feel this significantly decreased the actual prevalence, especially in view of the large sample size in this study.In conclusion, this is the largest study reported to date of the prevalence of lower extremity venous duplication using duplex USG. The prevalence of duplication of 10.1% is similar to that reported by other large USG-based studies but lower than most venography studies and smaller USG- based studies. The FV is most commonly duplicated, with the mFV being the most frequently duplicated segment. In addition, 15.3% of the studies had a duplicated segment missed on a previous or subsequent examination. Almost 15% of patients had a study showing both thrombus and a duplicated segment in the same limb; however, thrombus within a duplicated segment was extremely rare, occurring in only 0.4% of patients. Duplication of the lower extremity venous system is the anatomic variation which is the most common reason for a false negative DVT study that consequently results in failure to diagnose VTD and PE. |
For the continuous production of electricity with solar heat power plants the storage of heat at a temperature level around 400 °C is essential. High temperature metal hydrides offer high heat storage capacities around this temperature. Based on Mg-compounds, these hydrides are in principle low-cost materials with excellent cycling stability. Relevant properties of these hydrides and their possible applications as heat storage materials are described. If the formation of a metal hydride under certain conditions is a reversible reaction , then the metal hydride can by a heat supply upon decomposition into the metal and hydrogen. Upon thermal dissociation of a metal hydride by heat absorption . The gravimetric energy density of hydrogen . In. In2 is 3. Pipe containers are another simple method for the storage of natural gas up to pressures of 100 bar. A similar construction can also be used for the storage of hydrogen.Natural gas storage under elevated pressures in spherical gas tanks is a widely used method. A system with a diameter up to 40 m and a maximum gas pressure of roughly 10 bar for natural gas has been constructed in Wuppertal, Germany and is in use since the 1950’s. The volume of this storage vessel is 55,000 m2 can be stored in existing hydrogen pipelines. A hydrogen pipeline can possibly be situated near a thermal solar power plant.Large volumes of H3. The hydrogen gas is under a constant pressure of 45 bar, which is the result of brine replacement. These values are close to those of a conceptual storage system based on a MgH2/Mg storage system for a 50 MW solar thermal power plant. On condition is that a suitable geological formation can be found close to the power plant, but underground hydrogen storage option appears to be a cheap and simple storage method for hydrogen released from MgH2.The storage of natural gas in underground salt caverns is also a widely used method to overcome fluctations in the demand for the gas . RecentlIn the face of todays’ urgent climate, energy and economical problems we are at present witnessing intensified planning and building of thermal solar power plants . To enab2 storage capacity, as required for heat pumps and production of cold, but first and foremost as hydrogen storage materials for fuel-cell driven cars [On the basis of the present short overview one can easily recognize that in the research field of metal hydrides as energy storage systems both at high and low temperatures there remains yet a lot to be discovered. Currently the search for low temperature reversible hydride systems with higher than at present known Hven cars , 35, see |
Both FK506 and CsAenhanced the percentage of IL-6- producing monocytes stimulated with100 pg/ml-1 μg/ml of LPS up to values near thoseobtained with 10 μg/ml of LPS. The enhancement by FK506 andCsA was not seen when monocytes were stimulated with a highconcentration of LPS (10 μg/ml). When monocytes werestimulated with a low concentration of LPS (10 ng/ml), FK506 andCsA enhanced IL-6 production in a dose dependent manner, at a drugconcentration of 0.12 nM–1.2 μM (0.1–1 000 ng/ml)for FK506 and 0.83 nM–8.3 μM (1–10 000 ng/ml) forCsA. The optimal effect of FK506 was achieved at a concentration7-fold lower than that of CsA. In contrast, production of turnoutnecrosis factor-α (TNFα and interleukin 1β(IL-1β) was slightly suppressed by FK506 and CsA at theconcentrations tested. Moreover, pretreatment of monocytes withFK506 and CsA had a significant enhancing effect on LPS-induced IL-6production, while treatment with FK506 or CsA after LPS stimulationhad no effects on IL-6 production, suggesting that the enhancingeffect of each drug is exerted before LPS stimulation or at an earlystage of the post-receptor pathway after LPS stimulation. Theseexperiments demonstrate that FK506 and CsA can selectively enhanceIL-6 production in monocytes under certain conditions |
Lung fibrosis, reduced lung compliance, and severe hypoxemia found in patients with acute lung injury often result in a need for the support of mechanical ventilation. High-tidal-volume mechanical ventilation can increase lung damage and fibrogeneic activity but the mechanisms regulating the interaction between high tidal volume and lung fibrosis are unclear. We hypothesized that high-tidal-volume ventilation increased pulmonary fibrosis in acute lung injury via the serine/threonine kinase-protein kinase B (Akt) and mitogen-activated protein kinase pathways.After 5 days of bleomycin administration to simulate acute lung injury, male C57BL/6 mice, weighing 20 to 25 g, were exposed to either high-tidal-volume mechanical ventilation (30 ml/kg) or low-tidal-volume mechanical ventilation (6 ml/kg) with room air for 1 to 5 hours.High-tidal-volume ventilation induced type I and type III procollagen mRNA expression, microvascular permeability, hydroxyproline content, Masson's trichrome staining, S100A4/fibroblast specific protein-1 staining, activation of Akt and extracellular signal-regulated kinase (ERK) 1/2, and production of macrophage inflammatory protein-2 and 10 kDa IFNγ-inducible protein in a dose-dependent manner. High-tidal-volume ventilation-induced lung fibrosis was attenuated in Akt-deficient mice and in mice with pharmacologic inhibition of ERK1/2 activity by PD98059.We conclude that high-tidal-volume ventilation-induced microvascular permeability, lung fibrosis, and chemokine production were dependent, in part, on activation of the Akt and ERK1/2 pathways. Severe lung injuries are characterized by an initial diffuse inflammatory reaction or epithelial injury that is followed by fibroblast proliferation and extracellular matrix accumulation ,2. DeathT) of 3 ml/kg was more protective than 6 ml/kg VT, so even a very low 6 ml/kg VT can still overdistend more compliant regions of the lung and cause lung injury . We calculated the Evans blue dye amount extracted from lung tissue and divided the amount by the weight of lung tissue.Total RNA (1 μg) was reverse transcribed using a GeneAmp PCR system 9600 , as previously described . The folThe western blots were quantitated using a National Institutes of Health image analyzer and are presented as the ratio of phospho-MAPK to MAPK or the ratio of phospho-Akt to Akt (relative phosphorylation) in arbitrary units. Values are expressed as the mean ± standard deviation of at least six experiments.The data for Evans blue dye, hydroxyproline, MIP-2, and IP-10 were analyzed using Statview 5.0 .P < 0.05 was considered statistically significant.All results of the western blot analyses were normalized to control, nonventilated wild-type bleomycin-treated mice breathing room air. Analysis of variance was used to assess the statistical significance of the differences, followed by multiple comparisons with a Scheffe test. There were no statistical differences in the pH, the arterial carbon dioxide pressure, and the mean arterial pressure at the beginning versus the end of mechanical ventilation Table . High-tiThe inhibition of Akt/MAPK activation with Akt-deficient mice and pharmacological inhibitors reduced the high-tidal-volume-induced microvascular permeability, lung fibrosis, and chemokine production.T mechanical ventilation compared with those either of mice receiving 6 ml/kg VT or of control, nonventilated mice. The Evans blue dye levels were also significantly increased in 6 ml/kg VT mice compared with control, nonventilated mice.In a previous study, we have shown that high-tidal-volume ventilation caused more pulmonary edema than in control, nonventilated rats or in rats ventilated at low tidal volume . To measT = 24.6 ± 2.8 μg, 30 ml/kg VT = 46.2 ± 1.6 μg, 30 ml/kg VT with PD98059 = 22.1 ± 3.1 μg, 30 ml/kg VT with SB203580 = 23.8 ± 1.7 μg, and 30 ml/kg VT in Akt+/- mice = 18.4 ± 1.2 μg, all P < 0.05 versus control).In another previous study we showed that normalizing the EBD as nanograms per milligram of lung may have underestimated the amount of Evans blue dye for the high-tidal-volume group, but the data of Evans blue dye not normalized with lung weight showed similar results . The datT was significantly elevated compared with control, nonventilated mice, and compared with mice ventilated at 6 ml/kg VT. To determine the effects of high-tidal-volume ventilation on pulmonary fibrosis – which were measured by hydroxyproline content and Masson's trichrome staining, and were associated with upregulation of procollagen peptide – we measured type I and type III procollagen mRNA . No significant increases of phosphorylation of JNK were found between control, nonventilated mice and mice ventilated at either 6 ml/kg VT or 30 ml/kg VT . The roles of Akt, ERK1/2, and P38 in the regulation of high-tidal-volume ventilation during lung fibrosis need to be further explored.The phosphorylation of Akt, ERK1/2, and P38 was further increased after 5 hours of mechanical ventilation subcutaneously for 30 minutes . Using immunohistochemistry, we confirmed that high-tidal-volume ventilation induced Akt and ERK1/2 activation in bronchial epithelial cells . The second method showed an improvement of histopathology indicative of effective re-epithelialization with reduced fibrosis in Akt-deficient mice and in mice with pharmacologic inhibition by PD98059 and SB203580 [A high tidal volume increased lung fibrosis, as found by qualitative detection of peribronchiolar and parenchymal fibrosis via Masson's trichrome stain and fibrosis scoring, quantitative measurement of the collagen level via hydroxyproline assay, and FSP1 staining for fibroblasts via immunohistochemistry Figures , and 4. SB203580 or by the absence (IP-10) of the Glu-Leu-Arg motif, which dictates their angiogenetic activity in the presence of the Glu-Leu-Arg motif . MIP-2 win vivo bleomycin-induced lung fibrosis model in rats [The three MAPKs activated in fibroblasts in the lung tissues of idiopathic pulmonary fibrosis may participate in the fibrogenesis of lung tissue . Akt pho in rats . We foun in rats . High-ti in rats ,20.Members of the S100A4/FSP1 family have been implicated in cytoskeletal–membrane interactions and in cellular growth and differentiation. The expression of S100A4/FSP1 indicates the presence of an ongoing angiogenetic program determining the mesenchymal phenotype . FSP1 isT) and hyaluronan synthase knockout mice (5 hours ventilation at 30 ml/kg VT), we found high-tidal-volume-induced hyaluronan synthase 3 mRNA and hyaluronan production in fibroblasts, contributing to the extracellular matrix-induced inflammatory changes involved in VILI [The physical forces of mechanical ventilation are sensed and converted into the reactions of intracellular signal transduction via stress failure of the plasma membrane, stress failure of the epithelial and endothelial barriers, mechanical stain, or shear stress . Using a in VILI ,38. In tA variety of cytokines are involved in the process of pulmonary fibrosis, and no one factor is solely responsible for lung fibrosis. While TNFα, IL-1β, transforming growth factor beta, and chemokines contribute to the recruitment of inflammatory cells, the altered balance between angiogenic chemokines and angiostatic chemokines may promote aberrant angiogenesis/fibrosis. All of these mediators induce extracellular matrix deposition by fibroblasts in the early repair process, which aids epithelial migration ,32. In oin vivo bleomycin mouse model, we have found that high-tidal-volume ventilation increased pulmonary fibrosis by biochemical analysis of hydroxyproline, Masson trichrome staining of collagen, immunohistochemical staining for fibroblasts, microvascular permeability, and production of MIP-2, but not IP-10 production, which was, at least in part, dependent, on the Akt and ERK1/2 pathways (Figure Using an s Figure . These d• High-tidal-volume ventilation increased pulmonary fibrosis in ALI.• High-tidal-volume ventilation-induced pulmonary fibrosis was dependent on Akt and ERK1/2 activation.• Inhibition of Akt and of ERK1/2 may offer new treatment options for patients with severe ARDS.2-terminal kinase; MAPK = mitogen-activated protein kinase; MIP-2 = murine macrophage inflammatory protein-2; PBS = phosphate-buffered saline; PCR = polymerase chain reaction; RT = reverse transcriptase; TNF = tumor necrosis factor; VILI = ventilator-induced lung injury; VT = tidal volume.Akt = serine/threonine kinase/protein kinase B; ALI = acute lung injury; ARDS = acute respiratory distress syndrome; ERK = extracellular signal-regulated kinase; FSP1 = fibroblast-specific protein 1; GAPDH = glyceraldehyde-phosphate dehydrogenase; IFN = interferon; IL = interleukin; IP-10 = 10 kDa IFNγ-inducible protein; JNK = c-Jun NHThe authors declare that they have no competing interests.L-KL and DAQ collected and analyzed the data. S-KL, M-JH, and C-CH reviewed and coordinated the study. |
In the crystal, intermolecular O—H⋯O and N—H⋯O hydrogen bonds assemble the molecules into infinite two-dimensional ribbons. These ribbons are linked into a network by intermolecular C—H⋯π contacts.In the title compound, C DOI: 10.1107/S1600536809048041/bq2173Isup2.hklStructure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF reportAdditional supplementary materials: |
P = .008). No prozone effect was observed after dilution of discrepant samples. RSR-ELISA-IA-2A achieved specificity of 69% and sensitivity was lower (59%) compared with RIA . Negative or low positive patients and control samples in the RSR-ELISA-IA-2A increased after dilution. Eluates from DBS can readily be used to analyse GADA with the RSR-ELISA, even if low levels of autoantibodies were not detected. Some factor could disturb RSR-ELISA-IA-2A analyses.To evaluate the performance of dried blood spots (DBSs) with subsequent analyses of glutamic acid decarboxylase (GADA) and islet antigen-2 (IA-2A) with the RSR-ELISAs, we selected 80 children newly diagnosed with type 1 diabetes and 120 healthy women. DBSs from patients and controls were used for RSR-ELISAs while patients samples were analysed also with in-house RIAs. The RSR-ELISA-GADA performed well with a specificity of 100%, albeit sensitivity (46%) was lower compared to in RIA (56%; Sampling of blood as dried blood spots (DBSs) for clinical use is currently used for such diverse diseases as congenital metabolic disorders, diabetes, and HIV infections –4. There2+-treated plasma can also be used [n = 7) sensitivity varied from 84% to 94% and specificity from 97% to 99% for serum samples. For RSR-IA-2A-ELISA kits, sensitivity ranged from 64% to 68% and specificity from 98% to 100% for serum samples. In DASP 2005, our in-house RIA-GADA assay gave a sensitivity of 76% and a specificity of 91% for serum samples, and our in-house RIA-IA-2A assay gave a sensitivity of 72% and a specificity of 100%. GADA and IA-2A have been analysed in whole blood eluates with RIA assays with high performance [Five islet autoantibodies are known to characterize type 1 diabetes, namely, islet cell antibodies (ICA), insulin autoantibodies (IAA), glutamic acid decarboxylase antibodies (GADA), islet antigen-2 antibodies (IA-2A), and antibodies against the beta cell specific zink-transporter (ZnT8A) . The fir be used , 17. In be used . For RSRformance , 19. In this study, we wanted to test if GADA and IA-2A can be analysed from whole blood eluates with RSR-ELISAs. If these assays show high performances, the measurements of GADA and IA-2A using ELISA have a potential to be applied in large screening programs for identifying individuals at risk for type 1 diabetes.μL blood was needed to fill the marked circles on the filters.Dried blood spots (DBS) were obtained as EDTA-blood spotted onto filter forms and air-dried before transportation to the laboratory. A minimum of 60 n = 80; median age 10 yrs; range 2–18; M/F = 1.29) and healthy control women were obtained from five Maternity Clinics in our region as described [n = 120; median age 32 yrs; range 19–44). The patient's (DBSs) had been stored at room temperature for a median of 56 days (range 8–150) and (DBSs) from controls had been stored for a median of 18 days (range 5–57) before punching with subsequent elution was performed.The study population consisted of a random selection of children with newly diagnosed type 1 diabetes was added to each well. Samples were left on a plateshaker at 500 rpm, at +4°C overnight. Next morning, whole blood eluates were spun down . Whole blood eluates were pooled into an Eppendorf-micro tube and spun at 10000 × g for 10 min to remove cell debris.Discs with a diameter of 6 mm were punched out with a special punching device . Four discs were punched out from each specimen into separate wells. A total of 80 RSR-ELISA kits for GADA (GDE/96) and IA-2A (IAE/96) were used for analyses of GADA and IA-2A. The assays were performed according to the instructions from the manufacturer, except that whole blood eluates were used in equal amounts as recommended for serum. Optical density was read on an ELISA platereader at 450 nm, with software Multicalc .Standards were calibrated against the WHO reference NIBSC (97/550) for the GADA assay . High vaAlso for IA-2A, standards were calibrated against the NIBSC (97/550). High values (>400 WHO Units/ml) were replaced with 400 for statistical and clinical evaluations. The cut-off level was set to 15 WHO Units/ml for IA-2A, which is the lowest standard concentration and also the recommended cut-off by the manufacturer for serum samples. Duplicate sampling including the whole preanalytic procedure was performed in ten subjects for GADA and IA-2A. The coefficient of variation (CV) was calculated as the ratio between standard deviation and mean value for duplicates. The median value of these observations was 6.3% (range 0.76–13) for GADA in the range of 5.0–46.4 WHO Units/ml. Interassay variation for the same samples in two repetitions was a median 7.7% (range 1.8%–40%). The CV for IA-2A was a median 5.0% (range 0.77–15) in the range 15–25 WHO Units/ml. Interassay variation in two repetitions was a median 46% (range 25%–88%). Samples with a high level of antibodies (GADA or IA-2A) in the in-house RIA, but low in the ELISA were diluted to reveal if this finding could be validated or was due to the prozone effect. The prozone effect is well-known to interfere with titers for ICA , 23.μL of whole blood eluates were obtained using the procedure described in Sample preparation and were added into wells with 30 μL of 35S-radiolabelled antigen (GAD65 or IA-2) and incubated overnight on a plateshaker (500 rpm) at +4°C. Next morning, plates were spun for 1 min 1500 × g. Duplicates of 50 μL of the antibody-antigen-complex-solution were added to 50 μL of 20% rProtein A Sepharose Fast Flow and incubated for 90 minutes at +4°C on a plateshaker (500 rpm). Excess antigen was removed by repeated washing of plates (8 times with cold TBST-buffer) using a special washing device . Plates were air-dried for 30 min, before addition of 50 μL of scintillation liquid to each well. The radioactivity was measured in a beta counter .Aliquots of 30 Logaritmic standard curves were used for the GADA assay and IA-2A assay. Our laboratory uses the WHO-standard as local standard. Samples above 50 WHO-Units/ml were considered as positive in the GADA assay as were samples above 10 WHO-Units/ml in the IA-2A assay. These cut-off limits were defined using previous results from healthy individuals. A GADA level of 500 WHO Units/ml and an IA-2A level of 250 WHO Units/ml were considered as endpoints for samples analysed with RIA and were not diluted further. n = 29) for GADA and interassay variation was 10.1% (n = 29) for a sample of 35 WHO Units/ml. For another sample of 96 WHO Units/ml, median CV was 3.1 % and interassay variation was 8.7% (n = 29).The median CV for duplicates was 3.5% for IA-2A and interassay variation was 7.8% (n = 30) for a sample of 24 WHO Units/ml. For another sample of 155 WHO Units/ml the median CV was 2.7% (range 0–11: n = 24) and interassay variation was 9.7%.The median CV for duplicates was 3.7% .The threshold of 5.0 WHO-Units/ml corresponded to a specificity of 100% and a sensitivity of 46% 37/80; . A totalP = .008; n = 37) that were positive in the RSR-ELISA-GADA were also positive in the in-house RIA. The discordant samples were all low level positive samples in the in-house RIA . Twelve samples were high when analysed with the in-house RIA (range 198–≥500 WHO-Units/ml) but relatively low in the RSR-ELISA (range 7.3–46 WHO-Units/ml). These samples were checked for prozone effect by dilution but levels were similar after dilution . There was a correlation in GADA levels in patient's samples found to be positive in both assays compared to GADA levels analysed with ELISA .The RSR-ELISA-GADA achieved lower sensitivity 46% (37/80) compared with the in-house RIA 56% and the sensitivity was 59% 47/80; . A totalP < .001; n = 6; range 193–≥250 WHO-Units/ml) but low in the RSR-ELISA . After dilution IA-2A levels increased in all samples when analysed in the RSR-ELISA-IA-2A. Four patient's samples that were all negative in the in-house RIA, three of whom were low level positive in the RSR-ELISA and one that was negative were diluted and reanalysed in the RSR-ELISA and also in this case, levels increased . Furthermore, 10 control samples found to be clearly negative in the RSR-ELISA were also diluted and reanalysed and also in this case levels were higher when diluted . A total of 42 samples were positive in both assays. There was a weak correlation between IA-2A double positive samples analysed with ELISA and RIA compared with ELISA .The RSR-ELISA-IA-2A achieved lower sensitivity 59% (47/80) compared with the in-house RIA 66% . Likewise, combining the results from GADA and IA-2A measurements with RSR-ELISAs increased the sensitivity to 71% and expected specificity decreased to 69% (83/120).Combining the results from GADA and IA-2A measurements with in-house RIAs increased the sensitivity for detecting type 1 diabetes to 79% for the RSR-ELISA-GADA, while sensitivity was lower (46%) compared with the in-house RIA (56%). Discordant samples that were negative in the RSR-ELISA-GADA were low level positive in the in-house RIA. Moreover, GADA levels were lower in the RSR-ELISA in samples found to be positive in both assays. Samples found to have high GADA levels in the in-house RIA, but low in the RSR-ELISA were reanalysed in dilution but levels did not increase. These findings indicate that samples that are positive in the RSR-ELISA-GADA are concordant with measurements in the in-house RIA. However, the RSR-ELISA failed to detect low level GADA. The lower frequency and lower levels of GADA positive samples can be due to interference of haemoglobin or some other factor in the whole blood. The possibility to measure very high level autoantibodies has little importance in the routine clinical laboratory but can be of interest in intervention studies aimed to decrease levels of autoantibodies .The specificity was very low for RSR-ELISA-IA-2A (69%) and also the sensitivity was lower for the RSR-ELISA-IA-2A (59%) compared with the in-house RIA (66%). Among the discordant patient samples, most were high level positive in the in-house RIA. When two of the discordant samples and also four other patient's samples found to be low level positive or negative in the RSR-ELISA-IA-2A were reanalysed in dilution in the RSR-ELISA, levels increased significantly. Also when ten control samples were reanalysed in dilution, IA-2A levels increased. We believe that haemoglobin or some other factor in whole blood interfered with the measurement of the antibodies, either via a direct binding to the antigen or antibodies or through a colour shift that affected the optical density, even though we have not fully examined the impact of haemoglobin in this study. It must be borne in mind that these commercial kits are recommended for analyses of autoantibodies in serum. One limitation with our study is that we have not analysed paired serum and DBS samples from patients and controls. However, a similar set of patient serum samples have shown excellent performance for the RSR-ELISA-GADA and IA-2A in our hands . Both ouWe have not done a specific study on reproducibility over time due to limited amount of specimens. However, GADA and IA-2A autoantibodies are of IgG type as are HIn conclusion, the RSR-ELISA can be used for measurement of GADA in whole blood eluates in a reliable manner even if sensitivity is lower compared with an in-house RIA. Some factor could disturb RSR-ELISA-IA-2A analyses. |
Psychotic illness following childbirth is a relatively rare but severe condition with unexplained etiology. The aim of this study was to investigate the impact of maternal background characteristics and obstetric factors on the risk of postpartum psychosis, specifically among mothers with no previous psychiatric hospitalizations.n = 745,596). Proportional hazard regression models were used to estimate relative risks of psychoses during and after the first 90 d postpartum, among mothers without any previous psychiatric hospitalization and among all mothers. Within 90 d after delivery, 892 women were hospitalized due to psychoses and 436 of these had not previously been hospitalized for any psychiatric disorder. During follow-up after the 90 d postpartum period, the corresponding incidence rates per 1,000 person-years were reduced to 0.65 for all women and 0.49 for women not previously hospitalized. During (but not after) the first 90 d postpartum the risk of psychoses among women without any previous psychiatric hospitalization was independently affected by: maternal age ; high birth weight ; and diabetes (hazard ratio 0).We investigated incidence rates and potential maternal and obstetric risk factors of psychoses after childbirth in a national cohort of women who were first-time mothers from 1983 through 2000 , up to 80% of new mothers experience some sort of mental disturbance. Usually, this is the “baby blues,” a normal reaction to childbirth that is characterized by short-lived mood swings or postnatal depression. However, about one in 1,000 women develop postpartum psychosis, a serious mental disorder that needs immediate medical attention. Postpartum psychosis usually develops suddenly in the first 2–3 weeks after delivery and, like other forms of psychosis, is characterized by a loss of contact with reality. Women with postpartum psychosis may have false ideas about current events and about themselves (delusions) and see and hear things that are not there . They sometimes stop eating or sleeping and may become anxious and agitated. In the worst cases, they can have suicidal thoughts or even threaten their baby's life. Treatment for postpartum psychosis includes antipsychotic drugs, counseling, and hospital admission if the woman is a danger to herself or others.Women with a personal or family history of psychosis have an increased risk of developing postpartum psychosis, but what causes this disorder is unknown. The rapid changes in hormone levels that occur after delivery are likely to be involved—but might social circumstances, stress, other illnesses, or the birth itself also affect whether a woman develops postpartum psychosis? If additional risk factors for postpartum psychosis could be identified, it might be possible to prevent some cases of this serious mental disorder. In this study, the researchers investigate the incidence rate (the rate at which new cases occur in a population) and risk factors for psychotic illnesses diagnosed among first-time mothers registered in the Swedish Medical Birth Registry between 1983 and 2000.The researchers identified three-quarters of a million first-time mothers and, from the Swedish Hospital Discharge Registry, found that 892 of these women had been admitted to hospital because of psychosis within 90 days of giving birth. Put another way, the incidence rate of psychosis over the first 90 days postpartum in this population was 4.84 per 1,000 person-years. Almost half of the women who developed postpartum psychosis had not been previously admitted to hospital for any psychiatric disorder. Among this subset of women, the incidence rate of postpartum psychosis was highest during the first month after delivery but dropped to less than a tenth of this initial rate after 90 days postpartum. Furthermore, the risk of developing psychosis during the first 90 days postpartum (but not after) increased with age—women older than 35 years were more than twice as likely to develop psychosis than those aged 19 years or less—but was reduced in women who had large babies or who had diabetes. Many other factors (including smoking and not living with the infant's father) did not affect the risk of psychosis during the first 90 days postpartum in these women.These findings indicate that the occurrence of psychotic illness severe enough to require hospitalization peaks shortly after giving birth for the first time, even in women with no previous psychiatric illness. Indeed, women with no history of mental disorders account for almost half the women admitted to hospital for postpartum psychosis, at least in Sweden. The timing of the peak of postpartum psychosis supports the idea that either giving birth or the hormonal changes that occur shortly after may trigger the development of psychosis, and the findings that maternal diabetes and high infant birth weight reduce the risk of postpartum psychosis whereas increasing maternal age increases the risk provide new clues about the causes of postpartum psychosis. Most importantly, however, these findings highlight the importance of carefully monitoring women for psychosis during the first month after delivery.http://dx.doi.org/10.1371/journal.pmed.1000013.Please access these Web sites via the online version of this summary at PLoS MedicinePerspective by Phillipa HayThis paper is further discussed in a MedlinePlus encyclopedia psychosis (in English and Spanish); MedlinePlus also provides links to information on psychotic disordersThe MedlinePlus Encyclopedia contains a page on psychosis and on postnatal depressionThe UK National Health Service Direct Health encyclopedia has information on postpartum disordersMental Health America has a fact sheet on A psychotic illness starting shortly after childbirth is a relatively rare condition ,2. HowevWhether the postpartum period really poses any additional risk of psychoses has been a matter of speculation: compared to population- or prepregnancy rates, relative risks from 1.09 to 12.7 Studying risk factors for psychoses during the postpartum period is a methodological challenge, because of low incidence rates and the confounding effects of previous psychiatric morbidity. Sweden has excellent conditions for research in this area, with population-based registers covering essentially all births and inpatient records. Using these data sources, we investigated the incidence rate and risk factors of psychotic illnesses diagnosed during and after the first 90 d postpartum among all Swedish first-time mothers, and specifically among mothers without any previous psychiatric hospitalization. Controlling for previous psychiatric hospitalizations, we hypothesized that established risk factors for nonpuerperal psychosis as well as obstetric complications would increase the risk of maternal psychoses during the first 90 d postpartum.n = 745,596) were considered. Diseases in Swedish registers are coded according to the International Classification of Diseases (ICD); the 8th version (ICD-8) was used through 1986, the 9th revision (ICD-9) between 1987 and 1996, and the 10th revision (ICD-10) has been used since 1997. Women without any registered psychiatric diagnosis in the Hospital Discharge Registry before the date of delivery were analyzed separately.All primiparous women registered in the Swedish Medical Birth Registry from 1 January 1983 to 31 December 2000 during the first 90 d postpartum; or alternatively, later than 90 d until next pregnancy, emigration from Sweden, death, or end of follow-up (31 December 2001). A psychosis case could have had more than one hospitalization for psychoses after childbirth, but we counted only the first hospitalization. The discharge diagnoses are made by the attending psychiatrist based on observations during hospitalization and evaluation of the patient as well as medical records at discharge. The registered ICD discharge diagnoses have been reported to have high agreement with diagnoses based on DSM criteria .Women hospitalized for psychoses were categorized into the following diagnoses: (1) postpartum psychosis , (2) acute/reactive psychosis , (3) schizophrenia , (4) affective , (5) paranoia and, (6) schizoaffective disorder .Independent variables were mainly obtained from the Medical Birth Registry. The maternal background factors were: age at birth; years of education (from the Education Registry); family situation (living with child's father or not); country of birth ; living in one of the three biggest cities in Sweden or not; hypertensive disease ; diabetes ; maternal cigarette smoking at admission to maternity care; and year of birth.Obstetric and perinatal exposures were: perinatal death (stillbirth or infant death within 7 d), congenital malformations , gestational age (in completed weeks), and birth weight. Large for gestational age (LGA) and small for gestational age (SGA) were defined as a birth weight of more or less than 2 standard deviations from the mean birth weight for gestational age, respectively, according to the Swedish reference curve for fetal growth . We alsoThe study conforms to STROBE guidelines for cohort studies and was We calculated the proportion of cases with no previous psychiatric hospitalizations from the total psychosis cases during the first 90 d after first births. The incidence rates of total psychosis cases and first psychosis cases were calculated within categories of 30 d of the first year postpartum and then annually until next pregnancy, death, emigration from Sweden, or towards the end of the observation period (31 December 2001); whichever occurred first. We used Cox's proportional hazard regression models to calculate adjusted hazard ratios for psychoses during and after the first 90 d postpartum. The Wald test for interactions was performed to test potential interactions between previous psychiatric hospitalizations and all maternal as well as obstetric characteristics on the risk of psychosis during the first 90 d postpartum. SAS systems software version 9.1 was used for the statistical analyses.Of 745,596 first-time mothers, 892 women were hospitalized for psychoses during the first 90 d postpartum. In all, 436 women had not previously been hospitalized for any psychiatric disorder, and the majority of them were diagnosed with reactive/acute psychoses or a postpartum psychosis .Incidence rates of maternal psychoses during the first 12 mo postpartum and then annual incidence rates until the end of the observation period are illustrated in Maternal age and diabetes specifically affect the risk of psychoses during the first 90 d postpartum. Higher maternal age increases the risk of psychoses among mothers without any previous psychiatric hospitalization during the first 90 d postpartum. Compared to mothers aged 19 y or younger, mothers aged 35 y or older had a more than two-fold increased risk of psychoses during, but not after, the first 90 d postpartum.More than 6,000 women were diagnosed with diabetes ; none of these women developed postpartum psychoses during the first 90 d postpartum, while the corresponding risk after the 90 d was around 1.0.In contrast to all women, women without any previous psychiatric hospitalization had none or a limited increase in risk of psychoses during the first 90 d postpartum due to low level of education, not cohabitating with the infant's father, and maternal smoking. However, these factors had similar impact on the risk of psychoses after the first 90 d postpartum among all women as well as among women without any previous psychiatric hospitalization. The increased risk of psychoses among immigrant women (the mother being born outside Sweden), particularly among mothers born in another Nordic country, was amplified after the first 90 d postpartum. Psychosis hospitalizations of all women, before and after the 90 d postpartum period, decreased markedly in Sweden during the observation period .When we added perinatal death to the model presented in Women without any previous psychiatric hospitalization had an increased risk of psychoses when giving birth to a child with very low birth weight . In contrast, high birth weight and LGA decreased the risk by 70%–80% during, but not after, the first 90 d postpartum . Perinatp = 0.0015); maternal age (p = 0.0830) and gestational age (p = 0.0949) were the only other variables approaching (but not reaching) statistical significance. We further tested for interactions between maternal age and other maternal characteristics on the risk of postpartum psychosis; none of these proved statistically significant.The Wald test for interactions was performed to test potential interactions between previous psychiatric hospitalizations and all maternal as well as obstetric characteristics on the risk of psychosis during the first 90 d postpartum. No statistically significant interactions were observed except for cesarean section (Our findings suggest that the immediate time period following childbirth entails (compared to subsequent periods) a substantially increased risk of psychotic illness of the first-time mother. This also holds true for mothers without any previous psychiatric hospitalization that account for almost half of the psychosis cases during the first 90 d postpartum. Among women without any previous psychiatric hospitalization, greater maternal age and lower birth weight of the infant increase the risk of psychoses distinctly during the postpartum period, while maternal diabetes and high birth weight of the infant appear to be protective. These findings have implications for the etiology of psychotic illness occurring in the immediate postpartum period.Women without any previous psychiatric hospitalizations before the date of delivery had a more than ten times higher incidence rate during the first month postpartum compared to after the first 90 d postpartum. Thus, our findings provide strong support for the notion that the period following childbirth carries an increased risk of psychoses among women without any previous psychiatric hospitalization. Whether the rate of first psychosis episodes in first-time mothers reaches the levels of nulliparous women following the 90 d postpartum remains to be investigated. Population rates of first psychoses among women represent a complicated comparison to our study since these typically reflect rates of nulliparous, primiparous, and multiparous women during and after the postpartum period.The fact that one-third of all the psychosis cases during the first 90 d are concentrated in the first 7 d indicates that the birth may have a causal role. As suggested by previous research ,13 stresThe investigation of risk factors for maternal psychoses following childbirth is complicated by the risk of confounding by previous psychiatric illness. We therefore specifically studied potential maternal and obstetric risk factors among women without any previous psychiatric hospitalization.We found that maternal diabetes and high infant birth weight seemed protective of first-onset psychoses during, but not after, the first 90 d postpartum. We are not aware of any previous study reporting such findings. Regarding diabetes, the possibility of a chance finding cannot be excluded; however, similar findings were reported in a German study: in 313 people newly diagnosed with type 1 diabetes, none had a probable nonpuerperal psychotic disorder as compared to 1.5% in representative comparison sample of 2,046 individuals . IntenseThe majority of previous studies addressing mean maternal age ,9,24,25 The fact that the relationship between maternal age and psychoses is restricted to the first 90 d indicates that our findings are reasonably not explained by a “natural” age of onset of psychotic disorders. Further, previous findings suggest that the onset of nonpuerperal psychotic disorders peaks at a somewhat different age level than was observed in the present study among first-time mothers ,27. MoreOur findings provide no evidence that the relationship between severe obstetric hazards and postpartum psychosis is different for all mothers versus mothers without previous psychiatric hospitalizations. While a previous investigation reported an increased risk of postpartum psychosis after cesarean delivery , our intIn contrast to the postpartum-specific risk factors, our findings indicate that not cohabitating with the child's father, maternal smoking, and lower maternal education are general risk factors for maternal psychoses; it is unlikely that these factors have any causal role for psychoses that are limited to the immediate postpartum period. Further, we observed an increased risk of psychoses among mothers born outside of Sweden. Being born in another Nordic country was a risk factor for maternal psychoses during and after the first 90 d postpartum. Additional analyses among the women born in other Nordic countries revealed that a Finnish nationality carried the highest risks (unpublished data). A previous Swedish study indicates that after controlling for sociodemographic factors, elevated relative risks of psychotic conditions remain high among first- and second-generation Finnish immigrants .Based on a nationwide cohort of 745,596 first-time mothers, to our knowledge our study is the largest to date to address risk factors of maternal psychosis during the postpartum period. Strengths of the study include the use of complete population-based registers of births and hospThe immediate period following childbirth carries, compared to subsequent periods, high incidence rates for psychoses in first-time mothers, even among those without any previous psychiatric hospitalization. We found the risk of such first-onset psychotic illness during the 90 d postpartum period to be increased with maternal age and reduced among mothers with diabetes and those giving birth to infants with high birth weight. These findings may have implications for the etiology of psychotic disorders during the postpartum period.Text S1(89 KB DOC)Click here for additional data file. |
Cancer poses a massive health burden with incidence rates expected to double globally over the next decade. In the United Kingdom screening programmes exists for cervical, breast, and colorectal cancer. The ability to screen individuals for solid malignant tumours using only a peripheral blood sample would revolutionise cancer services and permit early diagnosis and intervention. Raman spectroscopy interrogates native biochemistry through the interaction of light with matter, producing a high definition biochemical 'fingerprint' of the target material. This paper explores the possibility of using Raman spectroscopy to discriminate between cancer and non-cancer patients through a peripheral blood sample. Forty blood samples were obtained from patients with Head and Neck cancer and patients with respiratory illnesses to act as a positive control. Raman spectroscopy was carried out on all samples with the resulting spectra being used to build a classifier in order to distinguish between the cancer and respiratory patients' spectra; firstly using principal component analysis (PCA)/linear discriminant analysis (LDA), and secondly with a genetic evolutionary algorithm. The PCA/LDA classifier gave a 65% sensitivity and specificity for discrimination between the cancer and respiratory groups. A sensitivity score of 75% with a specificity of 75% was achieved with a 'trained' evolutionary algorithm. In conclusion this preliminary study has demonstrated the feasibility of using Raman spectroscopy in cancer screening and diagnostics of solid tumours through a peripheral blood sample. Further work needs to be carried out for this technique to be implemented in the clinical setting. Cancer poses a massive health burden with incidence rates expected to double globally over the next decade. In the Previous work has investigated plasma and serum levels of deoxyribonucleic acid (DNA), and ribonucleic acid (RNA) in attempts to detect the presence of cancer -5. It haFluorescence spectroscopy has also been used for potential cancer detection in blood samples . These eThis highlights the need for a sensitive biochemical analysis where changes in the biochemical composition of blood products can be detected. It may then be possible to detect the presence of cancer in an individual whether due to the presence of abnormal molecules; increased levels of naturally occurring biochemical products; or changes in native biochemistry secondary to tumour formation.Raman spectroscopy relies on the scattering of photons when incident light interacts with the target matter. The molecular interactions cause a frequency shift that reflects the energy of particular molecular vibrations. These vibrations are molecular bond specific allowing a 'biochemical fingerprint' to be constructed of the material. Any physiological change or pathological process that results in changes to the native biochemistry would therefore lead to changes in Raman spectra. These spectra are highly detailed allowing subtle differences in biochemistry to be identified. This technique has received much attention in tissue diagnostic possibilities but there is a paucity of literature in its application to cancer diagnosis through a peripheral blood sample -11.Raman spectra of biochemical compounds produce high dimensional multivariate datasets; in order to 'unlock' this data to detect subtle differences between cohorts it is paramount that the analysis is performed by equally sophisticated techniques. Multivariate statistical methods such as Principal Component Analysis (PCA) and Linear Discriminant Analysis (LDA) are generally accepted for use in the classification of Raman spectra,13. PCA Whether based upon the detection of cancer products or the body's response to the disease process the advantage of cancer screening through a peripheral blood sample is clear. The aim of this preliminary study was to identify whether Raman spectroscopy coupled with sophisticated data analysis techniques could discriminate between peripheral blood samples from patients with and without cancer.All patients participating in this study did so with their full informed consent. Peripheral blood samples were obtained from 20 patients attending the Leeds Head and Neck multidisciplinary clinic. All patients were new referrals to the clinic, although this would also include patients who had previously undergone resection of cancer and had re-presented with recurrence. Patients had tumours from the head and neck; tongue, larynx, skin, and salivary glands. The tumours were of various type, grade and stage.Control samples were obtained from patients attending the Leeds Chest Clinic. These patients suffered a range of respiratory diseases including asthma, chronic obstructive pulmonary disease (COPD), and bronchiectasis. Patients with a history of cancer or ongoing treatment for cancer were excluded from the study.Ethical opinion was sought and granted from Leeds West ethical committee. Ref: 06/Q1205/226.2 blood samples were collected from each patient in specialist blood tubes containing 3.2% sodium citrate. Samples were centrifuged immediately at 3000 rpm for approximately 10 minutes. The supernatant (plasma) was removed and split into 4 cryovials. These vials were placed in a -80°C freezer for storage until use.The Raman spectra were obtained from all samples using a Renishaw 'System 1000' Raman microscope. Excitation was provided by a Sacher Lasertechnik Littrow external cavity laser set at 783 nm. Detection of the Raman scattered light was via a Renishaw RenCam NIR enhanced thermoelectrically cooled CCD camera. The spectrometer was coupled to a Leica DMLM microscope; and the exciting light is delivered to the sample, and the scattered light collected from the sample, via a 50 times Leica microscope objective. The spectrometer used holographic notch filters to remove Rayleigh scattered light from the collected light. The Raman scattered light was then dispersed across the CCD array detector by a single stage, 250 mm focal length grating spectrometer. The microscope was equipped with a motorised XYZ positioning stage (Prior) with integrated position sensors on the X and Y axes (Renishaw). Instrument control and data collection were performed with Renishaw WiRE software which operates within Galactic GRAMS software.Individual samples were each thawed and pipetted onto a quartz microscope slide. This was allowed to air dry before Raman spectroscopy measurements were taken. An extended spectrum reading from 600 - 1800 nm was recorded. The time to acquire the spectral reading was 20 seconds for all samples. The microscope lens was a 50 times air objective with a 0.75 numerical aperture. Ten spectra were obtained from each plasma sample. The 10 spectra could then be converted to a mean spectrum for each sample. The plasma samples for the cancer and non-cancer patients were run alternate so as to rule out any possible influence of time of day and machine variability.The intensity of each Raman spectrum not only depends on sample characteristics but also on operating equipment. The equipment currently used was un-calibrated as an experimental calibration protocol has yet to be devised. The raw data was normalised in order to compare data across samples as follows;• The data was re-sampled so that the measurements all correspond to the same Raman shift points by interpolation between the closest points.• Each spectra is normalised so that the area under the curve between a Raman shift of x = 700 and 1400 is equal. The normalisation factor is based just on this section as much greater variations arise in spectra outside of this range; however the same multiplicative factor was used on the entire spectrum for each sample. The normalisation process appeared to align the spectra intensities well. The actual area under the whole curve varied between 1.6 and 1.9.• The data was smoothed with a Gaussian window function (a weighted linear filter) to smooth out some of the noise effects. The weights used were [0.0146 0.0831 0.2356 0.3333 0.2356 0.0831 0.0146 ]. Due to the measurement techniques used, we expected the spectra to be locally smooth, and this procedure helped to reduce the measurement noise seen in the data.• A mean spectra for each patient is then produced which can be used for the analysis.Raman spectra are high-dimensional data sets. Each spectra contains 1200 Raman shift intensities. We wanted to be able to distinguish between cancer and non-cancer (respiratory) samples, from the mean spectra for each patient. Often it is useful to reduce the dimensionality of the data, and here we considered 3 ways of doing this: (1) by choosing the 25 best features from the 1200 data points using a two sample t-test to identify good features for the binary classification task, (2) using principal component analysis (PCA), to map the data to a lower dimensional space, here with 25 components, and (3) using a combination of the two, first choosing the 100 best features, and then PCA to reduce to 25. For discrimination between cancer and non-cancer cohorts LDA was performed on the reduced spectra. To evaluate performance, ten-fold cross-validation was performed, 100 times and an average performance calculated to avoid bias in the partition.The mean spectra were provided as input sequences to the Implicit Context Representation Cartesian Genetic Programming algorithm (IRCGP),15. IRCGAll cancer patients agreed to be in the study. The mean age was 64.7 years, with 12 patients being male and 8 female. Twenty-one patients were recruited for the control group, 1 patient declined due to being on renal dialysis later that day and therefore 20 patients were used. The mean age for the control patients was 66.8 years, with 11 males and 9 females. Table The raw spectra show some variation in intensity levels Figure , and theFigures Classification results for the four classification schemes used to classify the cancer and respiratory data are shown in Table Figure Respiratory patients were used as a control group for this study due to their similar ages, sex distribution and lifestyle risk factors, and also because of their co-morbid state. We therefore hoped to eliminate any differences between the cohorts as being due to the body's common response to a disease process.We have demonstrated that using Raman spectroscopy and LDA analysis yields approximately 65% sensitivity and specificity for discrimination for cancer and non-cancer in peripheral blood samples. However, when the genetic programme was applied to the data, this increased sensitivity to 75% with 75% specificity.et al used Raman spectroscopy to compare serum samples from breast cancer patients and non-cancer patients [et al.2001 using a Raman system with incident wavelengths of 488 nm and 514.5 nm [In a similar study to ours Pichardo-Molina patients . They re514.5 nm . A largeIn a review of the accuracy of the conventional papanicolaou cervical smear test, Nanda and colleagues found sensitivity to vary between 30 to 87% and specificity from 86 to 100% . Breast There are limitations to our study especially the sample size which makes extrapolation onto populations difficult. This study was set out as a pilot project; head and neck patients were chosen yet the malignancies chosen were not only squamous cell carcinoma (90% of head and neck cancers). The next trial this group will undertake is to discriminate between malignancies as well as a non-cancer cohort. Further work would then need to categorize patients regarding tumour load and spread. Patients used in these trails would need to be followed up after measurements have finished especially in the non-cancer group; as this may contain individuals with undiagnosed cancer or pre-malignant changes yet to be recorded. In this event what may seem erroneous results may well be accurate.The ultimate aim is to be able to distinguish between cancers in the clinic setting; in this study the groups were quite coarse representations but the initial study was to solely to discriminate cancer from non-cancer using this methodology.It may well prove to be the case that Raman spectroscopy could diagnose solid tumours from a peripheral blood sample in the future; however, a more feasible prospect is the ability to screen individuals at risk of cancer. Compared to cervical screening which is invasive, mammography which is undertaken in hospital, Raman blood analysis could be achieved at the local surgery. Along with screening, this test could be used as a diagnostic adjunct for those who attend the general practitioner with symptoms suggestive of malignant disease.This preliminary study has demonstrated the possible feasibility of using Raman spectroscopy in cancer screening and diagnostics of solid tumours through a peripheral blood sample. Further work needs to be carried out for this technique to be implemented in the clinical setting.The authors declare that they have no competing interests.ATH and AL undertook Raman spectroscopy on blood samples. CJN pre-processed the data and processed the linear discriminant analysis. MAL and SLS trained and tested the evolutionary algorithm. SEF, ASH and NC provided support with the samples. DAS provided support with the Raman system. JK, SEF, DAS, ASH and XY provided support with the sample collection and methodology. DPM-H provided support with the clinical application. All authors provided an editorial contribution.All authors read and approved the manuscript. |
MALDI-TOF mass spectrometry is currently used in microbiological diagnosis to characterize bacterial populations. Our aim was to determine whether this technique could be applied to intact eukaryotic cells, and in particular, to cells involved in the immune response.A comparison of frozen monocytes, T lymphocytes and polymorphonuclear leukocytes revealed specific peak profiles. We also found that twenty cell types had specific profiles, permitting the establishment of a cell database. The circulating immune cells, namely monocytes, T lymphocytes and polymorphonuclear cells, were distinct from tissue immune cells such as monocyte-derived macrophages and dendritic cells. In addition, MALDI-TOF mass spectrometry was valuable to easily identify the signatures of monocytes and T lymphocytes in peripheral mononuclear cells.This method was rapid and easy to perform, and unlike flow cytometry, it did not require any additional components such as specific antibodies. The MALDI-TOF mass spectrometry approach could be extended to analyze the cell composition of tissues and the activation state of immune cells. Immune cells are characterized by specific morphologies and functions, which can be used to identify different immune cell types. This is illustrated by the use of flow cytometry to identify immune cell populations based on the recognition of increasing numbers of membrane antigens by specific antibodies. This method has been widely applied in the fields of immunology and hematology. The development of systems biology approaches (such as transcriptomics) has enabled cell subsets to be identified through their characteristic transcriptional signatures. For example, it has been recently reported that circulating lymphocytes and polymorphonuclear cells (PMNs) exhibit gene expression signatures reflecting the enrichment of genes encoding specific surface proteins that can be used as biomarkers for estimating the abundance of these cell types within complex tissues Mass spectrometry (MS) is a key tool in cell proteomics Our objective was to determine whether intact immune cells exhibited reproducible and specific signatures in MALDI-TOF MS. We found that this approach was useful for discriminating between immune cells. For example, circulating T lymphocytes, monocytes and PMNs as well as monocyte-derived macrophages and DCs all exhibited distinct spectra. We describe the first elements of a database that will be useful for studying cell subsets in tissues and possibly their activation state.Healthy human placentas were collected after informed and written consent obtained from each subject, and the study was approved by the Ethics Committee of the Université de la Méditerranée, Marseille, France.g, and a hypotonic shock of 30 s was applied to cell pellets to remove contaminating RBCs; more than 98% of the cells were PMNs. RBCs were diluted and suspended in RPMI 1640 containing 20 mM HEPES before use.Peripheral blood mononuclear cells (PBMCs) from healthy donors were isolated from leukopacks (Etablissement Français du Sang) by Ficoll gradient and suspended in RPMI 1640 containing 20 mM HEPES (Invitrogen), as previously described g on 25–60% Percoll gradients . Cells present at the interface were subjected to positive selection using MicroBeads coupled with rat anti-mouse IgG2 antibodies (Miltenyi Biotec) and mouse antibodies directed against epidermal growth factor receptor (Santa Cruz Biotechnology), a specific marker of trophoblasts. Primary trophoblasts were cultured in Dulbecco's Minimum Eagle's Medium (DMEM)-F12-Ham containing 10% FCS and antibiotics.Human placentas were collected, and small pieces were rinsed several times and digested in Hank's balanced salt solution containing DNase I and 2.5% trypsin (Invitrogen) for 2×45 min, as previously described Bone marrow-derived macrophages (BMDMs) were generated from six- to eight-week-old C57BL/6 mice killed by cervical dislocation, as previously described The human monocytic leukemia cell line THP1 (ATCC N° TIB-202) and the murine J774 (ATCC N° TIB-67) and canine DH82 (ATCC N° CRL-10389) macrophage cell lines were cultured in RPMI 1640 containing 10% FCS, L-glutamine and antibiotics. The human T cell leukemia cell line C8166 that stably expresses the CCR5 chemokine receptor Xenopus laevis, was cultured in Leibowitz-15 medium containing L-glutamine, amino-acids, 5% FCS and 2% tryptose phosphate (Invitrogen) at 28°C, as previously described Acanthamoeba polyphaga (ATCC N° 30461), Acanthamoeba castellanii (ATCC N° 30234), Hartmannella vermiformis (ATCC N° 50237) and Poteriochromonas melhamensis (ATCC N° 11532) were grown in peptone yeast-extract glucose (PYG) medium consisting of 20 g/L roteosepeptone, 1 g/L yeast extract, 1 g/L sodium citrate, 4 µM MgSO4, 0.4 µM CaCl2, 2.5 µM Na2HPO4, 2.5 µM KH2PO4, 5 µM (NH4)2FeII(SO4)2, and 0.1 M glucose for three days at 32°C, as previously described The XTC-2 cell line, derived from 6 cells per assay) were centrifuged at 300× g for 5 min, washed in sterile PBS without Ca2+ or Mg2+, and again centrifuged to remove medium traces. Cell pellets were collected in 10 µL of sterile PBS without Ca2+ or Mg2+ and were frozen at −80°C for 2–3 days before analysis. When monocytes (106 cells) and T lymphocytes (106 cells) were mixed, cell pellets were collected in 20 µL of PBS. In some experiments, human monocytes were lysed with a RIPA buffer containing 25 mM Tris, 750 mM NaCl, 5% TritonX-100 (Sigma-Aldrich), 25 mM MgCl2, 5 mM EDTA and 0.5% sodium dodecyl sulfate, or they were sonicated in the presence of complete protease inhibitor cocktail tablets (Roche Applied Science). MALDI-TOF MS was performed using an AutoflexII mass spectrometer and FlexControl software , as previously described m/z range of 2000–20,000). Each spectrum resulted from the sum of positive ions obtained after 525 laser shots performed in seven different regions of the analyzed sample. A signal-to-noise ratio of 3 was selected to define peaks, with a maximum of 100 peaks per spectrum.Primary cells and cell lines were obtained from at least ten different isolation procedures, and MALDI-TOF MS was performed at least in duplicate on each cell isolate. Isolated cells (10http://www.tm4.org/) to perform hierarchical clustering with dendrogram representations of collected MALDI-TOF MS data. The mass values of peaks of the reference spectrum of each cell type were selected after treatment of these spectra (smoothing and subtraction of background noise) by the FlexAnalysis software. For a given spectrum, only the weight values with a gap strictly greater than 3 were selected; for spectra of different cell types, the gap must be greater than or equal to 3. The m/z values of peaks from given spectra were transferred into an Excel file with a value of +1. The value of −1 was assigned to m/z positions without a peak, and conventional color code was applied to hierarchical clustering representation.The ClinProTools version 2.2 software was used to analyze the variability between samples from different blood donors. The Gel View representation displays two types of spectra arranged in a pseudo-gel format. The 2D Peak Distribution View automatically selects two peaks, and their relative intensities are expressed as a 2D representation. The Biotyper version 2.0 software was used to create an averaged spectrum for each cell type corresponding to at least 20 individual spectra obtained from at least ten different cell cultures tested in duplicate. Baselines were automatically subtracted from spectra, and the background noise was smoothed during acquisition through the FlexControl software. This reference was validated by other samples from the same cell type. The Biotyper software realigns acquired spectra from each cell type and automatically creates an average spectrum using default Biotyper software settings provided by the manufacturer. These settings were the same than those used in routine bacteriology 6 monocytes per assay were used, several peaks with different intensities were detected by 5- or 10-fold did not modify the position or the intensity of detected peaks, but it did increase the background. Using 105 monocytes was insufficient to detect the full range of peaks that were detected with 5×105 or 106 monocytes. As a consequence, further experiments were performed using 106 frozen cells per assay. Taken together, these results showed that monocyte freezing was a very simple method that permitted delayed handling of samples.The effect of monocyte concentration on the presence and positions of peaks was then assessed. Increasing the initial cell concentration . Similarly, the MALDI-TOF MS spectrum of PMNs (m/z) and presence (see the peak at 4329 m/z) of certain peaks distinguished PMNs from both monocytes and T lymphocytes. Finally, the MALDI-TOF MS spectrum of RBCs (m/z) were present only in RBCs, whereas other peaks common to monocytes, T lymphocytes and PMNs, such as the peaks at 2484, 4964 m/z, were lacking in RBCs.We then compared the profiles of circulating cells isolated from a healthy blood donor. The MALDI-TOF MS signature of T lymphocytes was distinct from that of monocytes compare . The gel of PMNs differed of RBCs differedThe reproducibility of the signatures of monocytes, T lymphocytes and PMNs was tested using ten different donors. The 2D representation provided by the ClinProTools version 2.2 software illustrates the differences between monocytes, T lymphocytes and PMNs, and it shows that their signatures are remarkably homogenous . The MALXenopus cell line and different types of amoebae for analysis.Because MALDI-TOF MS profiles seemed to be specific for different types of circulating cells, we created a cell database using the BioTyper version 2.0 software. We included primary myeloid cells such as human MDMs and murine BMDMs in the database. We also included human THP-1 myelomonocytic cells and the murine J774 and canine DH82 macrophage cell lines. Because circulating monocytes differentiate into MDMs or DCs depending on culture conditions, we also assessed the ability of MALDI-TOF MS to discriminate between MDMs, monocyte-derived DCs, and circulating monocytes. Similarly, circulating CD3 T cells were compared to a human CCR5-transfected leukemia cell line. We also analyzed one fibroblast-like cell line, murine L929 cells, and two epithelial cell lines, consisting of human HeLa and 293T cells. Additionally, we compared human placenta trophoblasts with the human BeWo and JEG trophoblast cell lines. Finally, we selected non-mammalian cells such as a The mean spectra of the 22 different cell types were introduced into the database, allowing for an accurate comparison. The cell database was then used to classify and clusterize the various primary cells and cell lines . Two maj6 each cell type) were mixed and the spectra obtained were compared to the database. Monocytes and T lymphocytes were respectively identified with a correct score of 2.25 for both monocytes and T lymphocytes. Third, the MALDI-TOF MS profile of PBMCs was analyzed according to the same procedure. Although the proportion of monocytes was small compared to T lymphocytes (about 1/7), we identified both T lymphocytes (with a score of 2.22) and monocytes (with a score of 2.21). Taken together, these results demonstrate that we were able to identify monocytes and T lymphocytes in a complex mixture, and they suggest that MALDI-TOF MS allows the confident identification of cell subsets in tissues.We tested the efficiency of the database in three different ways. First, we compared a new monocyte sample with the mean spectrum of monocytes generated within the database . The resIn this report, we showed that a MALDI-TOF MS approach was able to identify intact immune cells. This method was rapid and easy to perform and did not require any additional components (such as specific antibodies), in contrast to flow cytometry. In addition, the repertoire of analyzed molecules is different between MALDI-TOF MS and flow cytometry because MALDI-TOF MS is applicable to soluble molecules with a molecular weight ranging from 2 to 20 kDa, whereas flow cytometry detects surface markers or intracellular proteins through permeabilization procedures. Our MALDI-TOF MS approach extended to eukaryotic cells an approach previously used for bacterial identification We demonstrated that the spectra of immune cells were specific since they were markedly distinct from those of unrelated cell lines and differed between related immune cells. This specificity was supported by a set of peaks that represent the MS signature of each cell type. In addition, this study enabled us to develop a cell database comprised of 22 cell types representing diverse lineages of eukaryotic cells +CD16− and CD14+CD16+ monocyte subsets. Similarly, we preliminarily found that the activation of monocytes and macrophages resulted in specific spectra that correlated with their transcriptomic patterns (manuscript in preparation).The use of the database enabled us to identify different cell populations among cell mixtures. The common signature of monocytes among individual donors was robust. Additionally, monocytes and T lymphocytes were accurately identified when they were mixed. Furthermore, the specific signatures of monocytes and T lymphocytes were found when PBMCs were studied. We suggest that the MALDI-TOF MS approach can be used to identify different cell types among tissue infiltrates. In addition, it is likely that its discriminative power is similar to that of genomic In conclusion, we developed a new method for identifying immune cells based on a MALDI-TOF MS approach. A major advantage of this method compared to the usual techniques is the lack of purification steps and staining procedures, which often lead to cell activation. The cell database we constructed was useful for identifying a cell type within a cell mixture, and it could potentially be used to identify different functional states of a cell population such as monocytes or macrophages.Figure S1MALDI-TOF MS spectra of monocyte preparations. Human monocytes (106 cells per assay) were collected in 10 µl of PBS, and 1 µl was deposited on the MALDI target. Representative MALDI-TOF MS spectra are shown: A, in the absence of monocytes; B, lysed monocytes; C, sonicated monocytes.(0.30 MB TIF)Click here for additional data file. |
Rotaviruses are the leading cause of severe dehydrating diarrhea in children worldwide. Rotavirus-induced immune responses, especially the T and B cell responses, have been extensively characterized; however, little is known about innate immune mechanisms involved in the control of rotavirus infection. Although increased levels of systemic type I interferon (IFNα and β) correlate with accelerated resolution of rotavirus disease, multiple rotavirus strains, including rhesus rotavirus (RRV), have been demonstrated to antagonize type I IFN production in a variety of epithelial and fibroblast cell types through several mechanisms, including degradation of multiple interferon regulatory factors by a viral nonstructural protein. This report demonstrates that stimulation of highly purified primary human peripheral plasmacytoid dendritic cells (pDCs) with either live or inactivated RRV induces substantial IFNα production by a subset of pDCs in which RRV does not replicate. Characterization of pDC responses to viral stimulus by flow cytometry and Luminex revealed that RRV replicates in a small subset of human primary pDCs and, in this RRV-permissive small subset, IFNα production is diminished. pDC activation and maturation were observed independently of viral replication and were enhanced in cells in which virus replicates. Production of IFNα by pDCs following RRV exposure required viral dsRNA and surface proteins, but neither viral replication nor activation by trypsin cleavage of VP4. These results demonstrate that a minor subset of purified primary human peripheral pDCs are permissive to RRV infection, and that pDCs retain functionality following RRV stimulus. Additionally, this study demonstrates trypsin-independent infection of primary peripheral cells by rotavirus, which may allow for the establishment of extraintestinal viremia and antigenemia. Importantly, these data provide the first evidence of IFNα induction in primary human pDCs by a dsRNA virus, while simultaneously demonstrating impaired IFNα production in primary human cells in which RRV replicates. Rotavirus infection of primary human pDCs provides a powerful experimental system for the study of mechanisms underlying pDC-mediated innate immunity to viral infection and reveals a potentially novel dsRNA-dependent pathway of IFNα induction. Rotaviruses cause severe dehydrating diarrhea and are a leading cause of death in children worldwide. A potent antiviral, interferon-α (IFNα), is rapidly secreted by plasmacytoid dendritic cells (pDCs) in response to viral single-stranded RNA or DNA genomes. Here, we examined the effects of rotavirus on pDCs purified from human blood. We found that very few pDCs supported rotavirus replication, and that pDCs retained similar functionality in response to live or inactivated rotaviruses. While pDCs produced large quantities of IFNα shortly after rotavirus exposure, this was impaired in cells supporting viral replication. We also found that two viral proteins and the rotavirus double-stranded RNA genome were required for the initiation of the pDC IFNα response to rotavirus. Additionally, we found that cleavage of one of these viral proteins, a traditional prerequisite for rotavirus infection in other cell types, was not required for the infection of pDCs or production of IFNα. This may enable the host to rapidly initiate an immune response to rotavirus that subsequently restricts infection to the intestine and contributes to the resolution of disease. Our study provides novel insight into the interaction between rotavirus and the host innate immune response, and also identifies a unique mechanism for the production of IFNα by pDCs. There are two known major subsets of primary human and murine circulating DCs: myeloid DCs, which function principally in antigen presentation, and plasmacytoid DCs (pDCs), which secrete the type I interferons (IFN), IFNα and IFNβ in vivo, as there is an inverse correlation between circulating pDC numbers and human immunodeficiency virus (HIV) or hepatitis C virus (HCV) viral load It is well understood that pDCs activate natural killer cells Reoviridae family, is the leading cause of severe dehydrating diarrhea in young children worldwide, with 500,000 to 600,000 annual deaths attributed to rotavirus infections Rotavirus, a dsRNA icosahedral virus in the Rotaviruses are characterized by a triple-layered protein capsid composed of four major structural proteins. Viral protein (VP)2 comprises the innermost layer, in which the dsRNA genome is contained, while the middle layer consists of VP6. The outer layer of the virion is composed of the VP7 glycoprotein and protease-sensitive VP4 spikes Rotavirus-induced immune responses, especially the T and B cell responses, have been extensively characterized; however, little is known about innate immune mechanisms required to control rotavirus infection. Rotavirus structural and nonstructural proteins have been detected in primary DCs from murine mesenteric lymph nodes and spleens Here we report the effects of rotavirus infection on highly purified primary human pDCs. We demonstrate that although rotavirus initiates detectable transcription and translation in only a small percentage of pDCs, a significant percentage of pDCs activate and mature following exposure to virus. Importantly, we demonstrate that stimulation of pDCs with live or inactivated RRV effects secretion of IFNα and multiple proinflammatory cytokines and chemokines. This response is dependent on the presence of the viral dsRNA genome. As IFNα production by pDCs is classically triggered in response to ssRNA or DNA, the induction of this response by a replication-incompetent dsRNA virus indicates a potentially novel mechanism of viral sensing by pDCs.-HLA-DR+CD11c-CD123+ cells, + cells, NSP2dim and NSP2bright, were frequently apparent in pDCs exposed to live RRV , but remained a minor proportion of the total pDC population . pDCs from multiple donors were titered after overnight culture to determine whether rotavirus infection was productive. A significant increase in viral titer (data not shown) was observed in two of these donors, while the other three showed no significant change over time (data not shown). While pDC viability was significantly decreased from 6 to 12hpi in cultures receiving mock, RRV (moi 5) or iRRV stimulus , viral exposure did not result in significant cell death compared to mock stimulus at a given time point . The per, 12hpi) . Furthernk test) . The lowTo establish whether pDCs activate or mature following inoculation with RRV, the frequency of pDCs expressing markers for activation (CD86) or maturation (CD83) was determined by flow cytometry. pDC activation and matuProduction of IFNα is an important component of the pDC-derived antiviral response. To assess this component of the pDC anti-rotaviral response, the frequency of cells expressing IFNα was determined by flow cytometry. Intracellular IFNα was detected within 4hpi of RRV stimulus, peaked at 6hpi and was sustained until at least 12hpi . IFNα wa+ pDCs compared to pDCs dim or bright for NSP2 , supporting the hypothesis that increased levels of RRV infection are inversely correlated with IFNα production. More significant was the sustained production of IFNα in uninfected (NSP2-) pDCs following RRV stimulus. A similar correlation between NSP2 expression and IFNβ production was also observed and thus does not account for the observed differences in IRF7 phosphorylation. The increased levels of pIRF7 in NSP2dim pDCs may represent continual, direct stimulus of the IRF7 pathway in virus-positive pDCs, as well as a mechanism by which the IFNα response is directly initiated. Alternately, pIRF7 may be sequestered in a nontraditional cellular compartment prior to degradation, leading to increased protein accumulation. Interestingly, levels of IRF7 phosphorylation in IFNα+NSP2- pDCs were intermediate to that of NSP2dim and NSP2bright or NSP2-IFNα- pDCs . This supports the notion that recognition of secreted IFNα is an essential component of the IFNα response following rotavirus exposure, as has been reported with Newcastle disease virus To further investigate the impairment of the IFNα response in pDCs undergoing rotavirus replication, phosphorylation of IRF7, the key transcription factor for the IFNα response in pDCs nk test) , and is nk test) . To detenk test) . While tnk test) . The sliTrypsin-mediated cleavage of VP4 is canonically required for productive entry of rotavirus into permissive cells Although the ability of pDCs to mount an IFNα response to viral infection is well described, the only documented viral TLR ligands for pDCs are ssRNA and DNA To begin to characterize the mechanism by which pDC recognition and subsequent induction of the IFNα response occurs following rotavirus exposure, pDCs were treated with concanamycin A, a potent inhibitor of endosomal acidification, and thus TLR7/9 function pDCs play a vital role in the generation of innate and adaptive immunity following viral infection, primarily through the production of large quantities of IFNα in response to stimulus of TLR7 or TLR9 PRRs by ssRNA or DNA PAMPs, respectively. Traditional receptors for dsRNA, such as RIG-I, MDA5 and TLR3, are largely thought to not play a role in the initiation of the IFN response in human pDCs In the present study, we demonstrate that primary human pDCs are largely resistant to rotavirus replication, as intracellular staining for NSP2 was observed in only a small percentage (≤5%) of cells following RRV exposure, even at a non-physiologically relevant moi of 100. While productive infection was observed in a subset of donors, this was significantly less than that observed in cells highly permissive for rotavirus infection - bystander population, although activation and maturation were significantly enhanced in the few NSP2+ pDCs, as well. The induction of this phenotype by inactivated RRV further indicates that the pDCs are responding to the presence of input virus or to secreted factors, and not to viral replication. The upregulation of DC costimulatory and maturation markers suggests antigen presentation to T cells is preserved, in line with previous reports that pDCs are necessary for stimulation of IFNγ-secreting memory T cells + pDCs compared to bystander pDCs, indicating that the presence of virus enhances this phenotype. Conversely, IFNα/β production is impaired in NSP2+ pDCs. Combined with decreased IRF7 phosphorylation in NSP2bright pDCs, this suggests the direct inhibition of the type I IFN response by rotavirus replication, as has been previously observed in fibroblasts and epithelial cells Consistent with the general resistance to rotavirus infection, pDCs retained several important functional abilities following RRV exposure, as evidenced by their activation, maturation and cytokine production. Evidence of this functionality was observed primarily in the major NSP2et alet al used NSP4 as a marker for rotavirus infection. Extracellular NSP4 has been identified on uninfected cells +IFNα+ pDCs would be artificially increased. This, combined with differences in sample size, may explain the discrepancies in the incidence of NSP4+IFNα+ pDCs (n = 3) observed by Mesa et al and the frequency of NSP2+IFNα+ pDCs (n = 27) reported here.This study is the first to demonstrate that rotavirus, a segmented dsRNA virus, directly induces IFNα and IFNβ production by primary human pDCs. While it has previously been reported that exposure to rotavirus induces IFNα secretion by murine FLT3 ligand-driven pDCs + or IFNα+ pDC populations when the moi is increased to 25 or 100 (data not shown). Importantly, the decrease in IFNα and pIRF7 in pDCs expressing high levels of NSP2 illustrates that the local suppression of the interferon response by actively replicating virus pDCs possess a seemingly unique phenotype in the context of rotavirus infection, as the ability of NSP1 to degrade multiple IRFs appears to subvert the type I IFN response in many other cells, including epithelial and fibroblastic cells The uniqueness of pDCs in the context of rotavirus infection is further demonstrated by the ability of trypsinized and non-trypsinized rotavirus to induce IFNα and NSP2 expression at similar frequencies. The long-standing understanding of the requirement for VP4 proteolytic cleavage by luminal trypsin to activate viral entry and infection in the gut led to the assumption that efficient rotavirus infection could not occur systemically due to absence of appropriate extracellular proteases. Rotavirus infection was thought to be largely constrained to the intestine because this was the only anatomical location with substantial amounts of active extracellular trypsin available. The apparent dispensability of this proteolytic requirement for pDC infection may represent an alternate mechanism of rotavirus entry. This “non-trypsin dependent” mechanism of infectious entry might also account for the low levels of systemic organ infection and spread that normally occurs during rotavirus infection, and the elevated levels seen during rotavirus infection of highly immunocompromised people or animals, where the systemic availability of trypsin to proteolytically activate rotavirus is unlikely. Additionally, this provides a mechanism for the establishment of an antiviral state systemically, where circulating virus would not be expected to be able to infect cells in the traditional, trypsin cleavage-dependent, manner.We have demonstrated that both live and inactivated rhesus rotavirus efficiently stimulate secretion of type I IFN, in addition to many other cytokines, suggesting that transcription of viral nucleic acid is not required for either viral recognition or subsequent cytokine production by primary human pDCs. Conversely, viral replication is required for activation of the IFN response in fibroblasts Reoviridae family, have been demonstrated to induce IFNβ production in epithelial and human embryonic kidney 293T cells, respectively, via RIG-I, but not PKR or TLR3 Importantly, this finding may represent an alternative mechanism of IFNα induction in primary human pDCs. The ability of a pDC that takes up rotavirus to mount a vigorous type I IFN response independently of rotavirus mRNA or protein expression provides a potential mechanism by which the host could effectively circumvent the anti-IFN effects of NSP1-mediated IRF degradation The induction of both IFNα and TNFα by rotavirus may create a synergistic effect in the suppression of viral replication, as has been observed following RIG-I stimulus by myxoma virus in vivo rotavirus infection Peripheral pDCs likely represent a significant source of the systemic IFNα observed following In summary, these studies show that primary human pDCs are largely resistant to rotavirus replication, but that they remain responsive and functional following viral exposure, as indicated by cellular activation, maturation and production of multiple cytokines, including TNFα and large amounts of IFNα. The pDC response is demonstrated to require both the viral dsRNA genome and acidification of the pDC endosome, implying the likely initiation of the type I IFN response by TLR7 or TLR9. To our knowledge, these data are the first to show that inactivated rotavirus can efficiently induce a type I IFN response, which differs from what has been seen in fibroblasts and epithelial cells exposed to rotavirus in vitro assay. Except where noted, viral preparations were trypsin activated (5 µg/ml) at 37°C for 20–30 minutes prior to pDC infection. Preparations were endotoxin-free, as determined by Limulus amebocyte lysate test .Simian (RRV and SA11) tissue-culture adapted rotaviruses were grown in fetal monkey kidney (MA104) cells in the presence of trypsin, except where noted, as previously described Spodoptera frugiperda 9 cells with two or three recombinant baculoviruses, respectively, at a moi ≥5 plaque forming units per cell, as previously described Rotavirus-like particles (VLPs) expressing VP2 and VP6 (2/6 VLPs), or VP2, VP6 and VP7 (2/6/7 VLPs), were generated by coinfecting All viral preparations were titrated by plaque assay on MA104 cells and expressed as plaque forming units per ml, as described , defined as viable, lineage-HLA-DR+CD11c-CD123+ cells, were isolated per donor; preparations were routinely >85% pure.PBMCs were isolated from leukoreduction chambers obtained from the Stanford Blood Center by centrifugation over ficoll-hypaque . Plasmacytoid DCs were negatively selected using the pDC Isolation Kit , according to manufacturer's instructions. To increase the purity of the pDC preparations, consecutive purifications were performed using an AutoMACS . An average of 2 million pDCs5 pDCs were exposed to rotavirus particles or 4 µg/mL CpG ODN 2395 , as indicated, for 1 hour in serum-free RPMI-1640 supplemented with penicillin/streptomycin and L-glutamine . pDCs were washed and suspended at a concentration of 1 million pDCs/mL in RPMI-1640 with 10% heat-inactivated fetal bovine serum , penicillin/streptomycin, L-glutamine and 10 ng/mL IL3 until harvest. Where indicated, rotavirus infection was blocked using neutralizing monoclonal antibodies to VP5 (mAb 2G4) or VP7 (mAb 159), or as a non-neutralizing control, a VP6 monoclonal antibody (mAb 1E11). In studies determining whether pDC infection was productive, highly-purified pDCs (mean purity: 91.51%) were exposed to RRV at an moi of 10 for one hour; neutralizing mAb 159 was then added for 30 minutes. pDCs were washed 3 times, and were frozen immediately or after overnight culture. The resulting pDC pellets and supernatants were freeze/thawed three times, and virus titer determined by FFU assay, as previously described Approximately 2×10Purified pDCs were incubated with 20 nM concanamycin A at 37 degrees for one hour prior to infection with live or inactivated RRV (moi 10).-HLA-DR+CD11c-CD123+. Cellular fixation and permeabilization were performed using Cytofix/Cytoperm , per the manufacturer's instructions. Following blocking of Fc receptors , intracellular staining was performed with antibodies to IFNα, total IRF7, phosphorylated IRF7 (pS477/pS479) , IFNβ or NSP2 (mAb 191). The presence of NSP2 staining of exposed pDCs was considered to be indicative of rotaviral replication in those cells. Direct conjugation of mAb 191 to APC was performed by Chromaprobe Inc . Data were acquired using a LSRII and DIVA software ; analysis was performed using FlowJo .Supernatants were harvested by centrifugation of cultured pDCs, which were then washed once with PBS . The LIVE/DEAD Aqua Dead Cell Stain Kit was utilized to assess cellular viability via amine exclusion. Surface staining was performed using antibodies against human CD3, CD14, CD16, HLA-DR, CD83, CD86, CD123 , CD11c, CD19, CD20 , and BDCA2 ; pDCs were defined as being lineageSupernatants of cultures >85% (mean ± SEM: 90.84%±0.7499) pure for pDCs were analyzed by Luminex using MILLIPLEX MAP per the manufacturer's instructions for the presence of IFNα, IFNγ, TNFα, TNFβ, IL1β, IL1RA, IL2, IL4, IL6, IL8, IL10, IL12p40, IL12p70, CXCL10 (IP10), CCL3 (MIP1α), CCL4 (MIP1β), CCL5 (RANTES) and sCD40L. Secreted IFNβ was detected by ELISA, per the manufacturer's instructions .Mann-Whitney and Wilcoxon signed rank tests were performed using GraphPad Prism . A p-value of ≤0.05 was considered significant.Figure S1- (viable) lineage-HLA-DR+CD11c-CD123+ cells. (E) Representative FACS plot demonstrating BDCA2 vs. NSP2 staining of pDCs (red) vs. contaminating HLA-DR- (blue) cells exposed to RRV (n = 12).pDC gating strategy. (A-D) pDCs were defined in these studies as amine(0.39 MB TIF)Click here for additional data file. |
We report a case of a 78-year-old patient with penile leiomyosarcoma, treated by radical penectomy. Two years after theoperation the patient is without evidence of local recurrence or metastatic disease.We also discuss the treatment optionsand attempt a review of the literature. |
Epithelial ovarian cancer is one of the most malignant cancers in women because metastasis occurs in the most of patients by the time of diagnosis. Cancer cells have strong capacity to form angiogenesis or vasculogenic mimicry, which plays the major role in its malignant phenotype. Vasculogenic mimicry might contribute to the failure of the angiogenesis-targeted therapy strategies. Under the microenvironment of the tumor, hypoxia is the most common phenomena because of the vast energy and oxygen consuming. In the present study, the endothelial-like cells induced by hypoxia from SKOV-3 and ES-2 ovarian cancer cells were harvested to investigate the changes in their biological behaviors.The endothelial-like cells from SKOV-3 and ES-2 cells were harvested by laser capture microdissection. The biological behaviors of the endothelial-like cells, including proliferation, cell cycle, apoptosis, invasion and telomerase activity were determined by MTT, FCM, Transwell chamber and TRAP-ELISA methods. HIF-1α is the most important factor for the behavior changes under hypoxic condition. Some other genes relative to biological behaviors are also changes following the changes of HIF-1α. In order to elucidate the underlying mechanisms for these changes by hypoxia, the relative genes expressions including HIF-1α, CyclinD1, Flk-1, VEGF, p53 and V-src were determined by real-time PCR.SKOV-3 and ES-2 cells were resistant to hypoxia by adoption of proliferation, apoptosis, differentiation and invasion. Combined with other studies, the more poorly cancer cells differentiate, the more strongly cells are resistant to hypoxia, the more possible to form vasculogenic mimicry. The changes in the expression of HIF-1α, and HIF-1α-dependent VEGF, Flk-1, Cyclin D1, and HIF-1α-independent p53 have been involved in this process.HIF-1α took an important role in the behavioral changes of SKOV-3 and ES-2 cells by hypoxia. At the same time, other mechanisms were also involved in this process. Epithelial ovarian cancer (EOC) has the ~50% mortality rate, making it the leading cause of death from gynecological cancers ,2. In moin vitro [The traditionally recognized mechanism for tumor vasculature and perfusion has been thought to be endothelial cells-lined vascular networks . Howeverin vitro -9. That'in vivo and in vitro [Hypoxia is one of the major important factors in angiogenesis descried by Folkman for it is associated with resistance to chemo- and radio-therapies. The development of tissue hypoxia is characteristically observed as malignant tumor rapidly increase in size. Such hypoxic conditions exert selective pressure on cancer cells, and the ability of tumor cells to survive in a hypoxic microenvironment has been associated with a poor prognosis and resistance to therapy . One of in vitro -13, in wAs it is known that the endothelial-like cells (EL) origin from cancer cells are different from the endothelial cells. However, the detailed difference and the mechanisms are not well understood. In the present study, we set out to determine some biological behaviors of the ELs from two malignant ovarian cancer cell lines, SKOV-3 and ES-2, such as the proliferation, cell cycle, apoptosis, the activity of telomerase and invasion. At the same time, we compared these biological behaviors with traditional endothelial cell, human umbilical vein endothelial cell (HUVEC) and the original cancer cells. Further, we tried to explore the underlying mechanisms by detection the expression of some relative genes.Human epithelial ovarian carcinoma cell lines SKOV-3 and ES-2 were purchased from American Type Culture Collection , and were maintained in McCoy's 5a. Primary human umbilical vein endothelial cells (HUVEC) were isolated from umbilical vein and cultured as described previously 2 incubator, as described previously [4) were seeded onto the three-dimensional gel. The medium supplied with 15% FBS was changed every 36 h. Hypoxic condition was created by flushing 5% CO2 and 95% N2 through a modified chamber , until O2 concentration was reduced to 1%, measured with a Mini oxygen meter. The culture system was sealed and incubated at 37°C [Thirty microliters of Matrigel were dropped onto each glass coverslip in a 12-well culture plate and polymerized for 1 h at room temperature, followed by 30 min's incubation at 37°C in a humidified 5% COeviously . Tumor c at 37°C . The cel4 SKOV-3, ES-2 and HUVEC cells, were seeded into a flat bottom 96-well plate and incubated at 37°C for 3 and 7 d under normoxia or hypoxia (1% O2) respectively, prior to the addition of 20 μL of MTT solution (5 mg/ml in PBS). After incubated for additional 4 h at 37°C, absorbance at 490 nm was measured with a multi-function reader to determine cell viability.For the proliferation assay, 1 × 106 cells/ml) and fixed with 70% ice-cold ethanol for 30 min, followed by centrifuged, washed and resuspended in 500 μl PBS contained 10 μl of DNase free RNase . After 30 min incubation, pyridine iodide was added to the solution to incubate for an additional 15 min in the dark and filtered by a nylon mesh to remove cell clusters. The fluorescence of PI was measured using FACS Calibur Flow Cytometer . Cell subpopulations in G0/G1, S and G2/M phases and apoptosis were calculated by gating analysis based on differences in DNA content. At least 20000 cells were analyzed per sample. Cell proliferation characters were indexed by the ratio in S-phase.Cell cycle and apoptosis assay were performed on cells with or without hypoxia treatment (for 3 or 7 d) to determine whether hypoxia regulates the growth phase and apoptosis of epithelial ovarian cells. Cells were trypsinized and centrifuged at 300 × g (1000 rpm) for 5 min, then resuspended (1 × 104 cells/filter) in 200 μL of serum-free medium in triplicate. Another 500 μL of serum-free media was added in the lower parts of the chambers. After 7d's incubation under hypoxia, the upper Matrigel coated surface was wiped off using a cotton swab. Cells migrated through the filters were fixed, stained with Giemsa , photographed, and counted.Invasion assays were performed in a 24-well transwell chamber as previously described . Briefly5. After 7 d, samples on EVA membrane were washed with PBS-DEPC and air-dried, channels formed by endothelial-like cells (ELs) were selected by microscopy and microdissected with laser capture microdissection (LCM) system (Leica). About 1,500-2,000 ELs were laser-captured from each EVA membrane. The cells were immersed in digestion buffer for quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) and telomerase activity assay.Fifteen microliters of Matrigel were mounted on ethylene vinyl acetate (EVA) membrane with frame instead of coverslip in 9-cm dishes and treated to establish three-dimensional culture as described above. The density of tumor cells seeded onto gel was adjusted to 1 × 104 cells using TRIzol reagent . Aliquots of RNA were reverse transcribed to cDNA using a Superscribe First-Strand synthesis system (Invitrogen). Real-time PCR analysis was performed to quantify mRNA expression of HIF-1α, VEGF, Flk-1, Cyclin D1, p53, and V-src by a Rotor-Gene3000 PCR system using SYBR-Green PCR Master mix . The PCR reaction consisted of 12.5 μl of SYBR-Green PCR Master mix, 1.0 μl of forward and reverse primers , and 2.0 μl of 1:10-diluted template cDNA in a total volume of 25 μl. Amplification was initiated at 50°C for 2 min, 95°C for 70 sec, followed by 40 cycles of 95°C for 20 sec, 58°C for 20 sec, and 72°C for 30 sec. To verify only a single product produced, a dissociation protocol was added after thermocycling. The assay included a no-template control, a standard curve of four serial dilution points (in steps by 10-fold) of a cDNA mixture. All data were controlled by Rotor-Gene software (version 6.0) for quantity of RNA input, an endogenous reference gene (β-actin) was performed as control in the same reverse transcription reaction. Data were presented as the means ± S.E from three separate experiments. The primers used in this experiment were shown in Table Total RNA was extracted from 2 × 10The telomerase activity of all the cells was tested by telomerase repeat sequence amplification-enzyme linked immunosorbent assay (TRAP-ELISA) using the kit from Huamei Biotechnology Co., Ltd. according to the manufacturer's instruction.ANOVA analysis or paired-samples t-test were performed to identify differences, using SPSS11.5 statistical software . Statistical significance was assumed at P < 0.05, P-values are presented as two-tailed.2 for 7 d before harvested by LCM. The morphology of the endothelial-like cells induced by hypoxia were pictured by microscope and shown in Figure To investigate the morphology of the endothelial-like cells from ovarian cancer induced by hypoxia, the SKOV-3 and ES-2 cells were cultured in the 3-dimensional Matrigel system on EVA membrane under 1% OIn order to elucidate the biological behaviors changes in SKOV-3, ES-2 and HUVEC cells by hypoxia, the proliferation, cell cycle, apoptosis and invasion were detected by MTT, FCM and transwell chamber after induced by hypoxia for 3 or 7 d. As shown in Fig. The percent of cells in S-phase and apoptosis after incubation for 3 or 7 d under hypoxia were shown in Fig. The numbers of cell migrated through basement membrane of the transwell chamber were shown in Fig. In order to study the malignant of the ovarian cancer cells, the activities of telomerase of SKOV-3, ES-2 and HUVEC cells incubated under hypoxia, normoxia or hypoxia with Sirolimus were detected by TRAP-ELISA. As shown in Table In order to elucidate the underlying mechanisms for the biological behaviors changes of the ELs by hypoxia, the mRNA expression of HIF-1α, CyclinD1, VEGF, Flk-1, p53 and V-src in SKOV-3, ES-2 and HUVEC cells incubated under hypoxia, normoxia or hypoxia with Sirolimus were detected by Real-time PCR. The genes expression mentioned above in SKOV-3 and SKOV-3 relative cells were shown in Fig. As shown in Fig. VEGF mRNA expression in both of the two tumors' ELs was significantly higher than that in the cells under normoxia and with Sirolimus, but was greatly lower than that in HUVEC cells.Flk-1 mRNA expression in both of the two tumors' ELs was significantly higher than that in the cells under normoxia, but was greatly lower than that in HUVEC cells. On the other hand, Flk-1mRNA expression in ES-2 endothelial-like cells was significantly higher than that in cells treated with Sirolimus, however, there was no difference in Flk-1 mRNA expression between SKOV-3 endothelial-like cells and SKOV-3 cells treated with Sirolimus.Cyclin D1 mRNA expression in both of the two tumors' ELs was greatly lower than that in the cells under normoxia, while there was no difference in Cyclin D1 mRNA expression in the cells treated with Sirolimus and HUVEC cells.p53 mRNA expression in both of the two tumors' ELs was significantly higher than that in the cells under normoxia and in HUVEC cells, however, there was no significant changes after treated with Sirolimus.V-src mRNA didn't express in all kinds of cells under hypoxia or normoxia.In the present study, we induced two ovarian cancer cell lines, SKOV-3 and ES-2, to endothelial-like cells by hypoxia and harvested the ELs by LCM. On the base of our previous study , the ELsAs shown in the results, under the condition of hypoxia, the cancer cells' growth was inhibited in the short period (3 d), however, after the long-time hypoxia (7 d) incubation, the cells were recovered to grow. The results of the proliferation assay, cell cycle and apoptosis assay demonstrated these. HUVEC, on the other hand, could not endure hypoxia, which showed inhibited proliferation, reduced S-phase ratio, and increases in apoptosis under the condition of hypoxia. As indicated by previous studies ,18, the Telomerase, an enzyme complex that binds the chromosome ends (telomeres) and maintains telomere length and integrity, is present in germ cells, proliferative granulose cells, germline stem cells, and neoplastic cells in the ovary, but is absent from differentiated or aged cells. Activation of telomerase in the ovary underpins both benign and malignant cell proliferation. Normally, high levels of telomerase activity are a hallmark of cancer, including ovarian epithelial carcinoma . AccumulTo explore the underlying mechanisms of the SKOV-3 and ES-2 changed to ELs by hypoxia treatment, we detected the expression of some relative genes in the SKOV-3, ES-2, SKOV-3 ELs, ES-2 ELs, with or without Sirolimus, and HUVECs. As Fig. In summary, the ovarian cancer cells could be induced into ELs which seemed similarly to progenitor endothelial cells by hypoxia. After induced, the ELs would get some characteristics of endothelial cells and would lose some malignant characteristics of the original cancer cells. The increased expression of HIF-1a, and HIF-1α depended VEGF and Flk-1 might contribute to the VM and the vasculogenesis. During the transition, HIF-1α took an important role in the molecular mechanisms, while there still has other HIF-1α-independent mechanism in this process.EL(s): endothelial-like cell(s); EOC: epithelial ovarian cancer; EVA: ethylene vinyl acetate; HIF-1: hypoxia-inducible factor-1; HUVEC: human umbilical vein endothelial cell; LCM: laser capture microdissection; RT-PCR: reverse transcription polymerase chain reaction; TRAP-ELISA: telomerase repeat sequence amplification-enzyme linked immunosorbent assay; VEGF: vascular endothelial growth factor.The authors declare that they have no competing interests.PZ carried out the proliferation, cell cycle and apoptosis assay, participated in drafted the manuscript. YN carried out the invasion experiment, participated in experiment design and drafted the manuscript. LY conceived of the study, participated in its design and coordination, performed the statistical analysis and helped to draft the manuscript. MC carried out the telomerase activity assay, participated in the draft preparation. CX participated in the design of the study and performed the statistical analysis. All authors read and approved the final manuscript.PZ, M.D., medical master candidate, Dept. Gynecology, Obstetrics & Gynecology Hospital, Fudan University; senior medical registrar, Dept. Obstetric & Gynecology, Shangyu City Hospital; YN, M.D. & Ph.D., assistant professor, Dept. Physiology & Pathophysiology, Shanghai Medical College, Fudan University; LY, M.D. & Ph.D., associate professor & medical consultant, Dept. Gynecology, Obstetrics & Gynecology Hospital, Fudan University; MC, M.B., medical master candidate, Dept. Gynecology, Obstetrics & Gynecology Hospital, Fudan University; CX, M.D. & Ph.D., professor & senior medical consultant, Dept. Gynecology, Obstetrics & Gynecology Hospital, Fudan University. |
Members of the dynamin super-family of GTPases are involved in disparate cellular pathways. Dynamin1 and dynamin2 have been implicated in clathrin-mediated endocytosis. While some models suggest that dynamin functions specifically at the point of vesicle fission, evidence also exists for a role prior to fission during vesicle formation and it is unknown if there is a role for dynamin after vesicle fission. Although dynamin2 is ubiquitously expressed, dynamin1 is restricted to the nervous system. These two structurally similar endocytic accessory proteins have not been studied in cells that endogenously express both.The present study quantitatively assesses the dynamics of dynamin1 and dynamin2 during clathrin-mediated endocytosis in PC12 cells, which endogenously express both proteins. Both dynamin isoforms co-localized with clathrin and showed sharp increases in fluorescence intensity immediately prior to internalization of the nascent clathrin-coated vesicle. The fluorescence intensity of both proteins then decreased with two time constants. The slower time constant closely matched the time constant for the decrease of clathrin intensity and likely represents vesicle movement away from the membrane. The faster rate may reflect release of dynamin at the neck of nascent vesicle following GTP hydrolysis.This study analyses the role of dynamin in clathrin-mediated endocytosis in a model for cellular neuroscience and these results may provide direct evidence for the existence of two populations of dynamin associated with nascent clathrin-coated vesicles. One population of dynamin (70%) decreased in fluorescence at the same rate as clathrin or internalized cargo, consistent with being the result of movement of the vesicle out of the excitatory evanescent field. A second population (30%) decreased much faster (20–40 fold) and may represent dynamin dissociated from the vesicle. Similar results were observed for dynamin1 and dynamin2. Thus, imaging individual events of endocytosis provides evidence for two dynamin populations associated with clathrin-mediated endocytosis: one that is rapidly released as well as one that internalizes associated with the nascent clathrin-coated vesicle.All constructs were the same as we employed in previous studies 2. Cells were plated onto MatTek 35 mm glass bottom dishes coated with Mouse Collagen Type IV , according to the supplier's directions. Cells were transfected using Lipofectamine 2000 according to the supplier's directions. All imaging was performed 48 hours post-transfection.PC12 cells were obtained from American Type Culture Collection and were cultured in DMEM supplemented with 10% horse serum and 5% fetal bovine serum in a humidified 37°C incubator with 5% COTIR-FM was performed at 37°C using an Apo 60× 1.45 NA microscope objective , as previously described After subtraction of extracellular background, 12-bit dual-color TIR-FM image streams were aligned in MetaMorph. On the basis of single-fluorophore control experiments, green-to-red bleed-through corrections of 10% for were employed; following background subtraction and alignment, 10% of the EGFP signal was subtracted from dsRed images.Paradigms determined from our previous studies in this area were applied to the current data sets The criteria for identification and analysis of dynamic spots from image stacks were based upon that for static co-localization studies. However, spots were omitted if any laterally mobile spots, or other separation or coalescence of spots, interfered with identification, tracking or quantification. Furthermore, if the dynamin signal appeared to show multiple flashes, only spots where the first flash was the brightest were analyzed – In order to be able to clearly identify the point at which disappearance began. Regions around spots to be analyzed were drawn to maximize the spot fluorescence and minimize the contribution of local background fluorescence. “Temporal alignment” and normalization of fluorescence intensity data was performed as in our previous studies Clathrin and dynamin tagged with fluorescent proteins have been previously employed in numerous live-cell imaging studies without evidence of perturbation of the endocytic system Very similar observations were obtained when clathrin and dynamin2 were analyzed by the same methods . HoweverIn order to test whether differences between dynamin1 and dynamin2 during clathrin-mediated endocytosis could be observed, each was imaged simultaneously with clathrin by live-cell TIR-FM in PC12 cells. When individual spots were tracked over time, the clathrin fluorescence in individual puncta was observed to disappear, while the fluorescence at neighboring sites remained unchanged decreased with a time constant of 17 seconds, which was the same as the time constant for clathrin disappearance. However, the rest of the dynamin1 decreased with a much faster time constant of 0.89 seconds. The time constant for clathrin decrease at sites of dynamin2 recruitment equals 21.5 seconds. While ∼70% of dynamin2 signal decreased with a time constant of 15.8 seconds, ∼30% decreased with a much faster time constant of 0.36 seconds.Previously, we, and others, have employed total internal reflection fluorescence microscopy (TIR-FM) to analyze the dynamics of proteins involved in clathrin-mediated endocytosis Our results demonstrate that both dynamin1 and dynamin2 significantly co-localise with clathrin in PC12 cells. The observation that ∼70% of the clathrin puncta are positive for dynamin1 and ∼80% of the clathrin puncta are positive for dynamin2 suggests that a substantial percentage of the clathrin puncta are positive for both dynamins. Additionally, the clathrin puncta that were disappearing, and thus endocytosing, were equally labeled with dynamin1 and dynamin2. These results do not provide evidence for a functional difference between dynamin1 and dynamin2 in these cells. Thus, for some endocytic events they may have redundant functions and, at least in these non-stimulated PC-12 cells, under the growth conditions used, the minor differences discerned in individual static images may not reflect a functional disparity.Prior to internalization, the dynamin was observed to increase in parallel with clathrin. However, just before the clathrin puncta internalized the fluorescence intensity of either dynamin1 or dynamin2 increased over a second by 50–65%. As the complete duration of dynamin ‘burst’ only lasted ∼2 seconds, this demonstrates the need for rapid sampling when performing live-cell imaging studies of the dynamics of endocytosis. This increase in the fluorescence could result from the recruitment of additional dynamin. Alternatively, it may not reflect an increase in the number of dynamin molecules, but may reflect a physical movement of dynamin molecules to the neck of the vesicle. This would move them closer to the cover slip and increase their fluorescence excitation. If we assume that the evanescent field decays with a space constant of 70 nm and the vesicle has a radius of 35 nm then the fluorescence should increase 58%. The larger the radius of the vesicle, the greater the predicted increase of fluorescence (see table). This calculation assumes that that dynamin initially is evenly distributed over the membrane, and then 100% of the dynamin moves to the interface between the vesicle and the plasma membrane. If less than all of the dynamin moves, the predicted increase would be less. However, the calculation exists that the increase could be sufficient to account for the observed increase.While the behaviors of dynamin1 during clathrin mediated endocytosis in PC12 cells were similar to those observed in other cells lines that lacked dynamin 1, the dynamics of dynamin2 were different than seen in some previous studies Previously we have observed within each endocytic puncta, other endocytic markers such as epsin and endocytic cargo such as transferrin leaves the evanescent field with a time course that is indistinguishable from clathrin |
Soluble E-cadherin concentrations of the cancer group were significantly higher (P < 0.001) than those of the controls but the benign group was not significantly different from either the cancer group or the controls. When sE-cadherin concentrations were adjusted for creatinine, similar but more statistically significant results were obtained and the benign group was significantly elevated compared with the controls (P < 0.01). No differences were apparent between the invasive (pT1–4) and non-invasive (pTa) cancers. Urinary total protein concentrations in the cancer group were significantly higher than the controls (P < 0.001) and the benign group (P < 0.05) although no difference was seen between the benign group and patients with non-invasive (pTa) cancer or between the benign group and controls. When expressed as the protein/creatinine index, results were similar but more statistically significant and a significant difference was seen between invasive and non-invasive cancers (P < 0.01). Only the protein/creatinine index correlated significantly with stage of the tumour (P < 0.01). It is concluded that urinary sE-cadherin measurements are of no greater value than urinary total protein. © 1999 Cancer Research CampaignReduced expression of the adhesion molecule E-cadherin has been associated with increased invasiveness and poorer survival in patients with bladder cancer. We have examined soluble E-cadherin (sE-cadherin) and total protein concentrations in urine from patients with bladder cancer ( |
They showed 2 defects: incoming capsids failed to migrate to the nuclear margin following membrane fusion, and genomes that did reach the nucleus failed to initiate normal gene expression. The latter defect was associated with a failure of in-coming virions to disassemble PML bodies. The capsid transport deficit seemed to be functionally more important, since ORF75c− MuHV-4 infected both PML+ and PML− cells poorly. The original host enzyme has therefore evolved into a set of distinct and multi-functional viral tegument proteins. One important function is moving incoming capsids to the nuclear margin for viral genome delivery.All gamma-herpesviruses encode at least one homolog of the cellular enzyme formyl-glycineamide-phosphoribosyl-amidotransferase. Murid herpesvirus-4 (MuHV-4) encodes 3 , suggesting that at least some copies have acquired new functions. Here we show that the corresponding proteins are all present in virions and localize to infected cell nuclei. Despite these common features, ORFs 75a and 75b did not substitute functionally for a lack of ORF75c, as ORF75c virus knockouts were severely impaired for lytic replication Enzymes of DNA metabolism feature prominently among the host genes captured by herpesviruses. An increased capacity for nucleoside processing presumably once conferred on the capturing virus a selective advantage. However, evolutionary pressures change, for example as additional genes are acquired, allowing established protein folds to be put to other uses. For example, the cytomegalovirus ribonucleotide reductase homolog no longer functions as such de novo purine biosynthesis All sequenced gamma-herpesviruses share a homolog of the cellular formyl-glycineamide-phosphoribosyl-amidotransferase (FGARAT or FGAM synthase), which catalyzes the fourth of ten steps in in vitro lytic replication. These data supported the idea of functional divergence. However, what these functions might be was not addressed. Analyzing MuHV-4 lytic transcripts by microarray hybridization One approach to defining viral gene functions has been genome-wide screening. A preliminary analysis of MuHV-4 random insertion mutants A mass spectrometry-based analysis of MuHV-4 virions Genome-wide screens notwithstanding, basic facts such as the distribution of viral FGARAT homologs in infected cells remain unknown. Here we have analyzed the MuHV-4 ORFs 75a, 75b and 75c using monoclonal antibodies. We find that all 3 proteins are present in virions and that at least ORFs 75b and 75c accumulate in the nucleus after membrane fusion, even when new protein synthesis is blocked. None of the FGARAT homologs appeared to retain significant FGARAT activity. We show further that ORF75c-deficient MuHV-4 remains capable of lytic replication, although it was severely attenuated relative to the wild-type. This reflected mainly a defect in capsid transport from the site of membrane fusion in late endosomes to the nuclear margin. ORF75c also disassembled PML bodies after viral entry. Thus, the original host enzyme has evolved into a set of functionally distinct virion tegument proteins.Female C57BL/6 mice were purchased from Harlan U.K. Ltd. , housed in the Cambridge University Department of Pathology, and infected intranasally with MuHV-4 when 6–8 weeks old. Animal welfare conformed to the UK Animal Health Act of 1981 (Home Office Project Licence 80/1992).+ cells, the fetal calf serum was dialyzed extensively to remove free purines and the medium was supplemented with 100 µM hypoxanthine . Cells were transfected where indicated using Fugene-6 .BHK-21 fibroblasts, 293T cells, HeLa cells, human foreskin fibroblasts stably transfected with a PML-specific or a control siRNA MfeI site and a 3′ SalI site to each coding sequence. The PCR products were cloned into the EcoRI/XhoI sites of pcDNA3 (Invitrogen). To disrupt ORF75c, a BamHI genomic clone spanning genomic co-ordinates 107477-111869 HpaI (109078) and dephosphorylated with Antarctic alkaline phosphatase (New England Biolabs). A self-complementary oligonucleotide encoding multiple stop codons, 5′-CTAGCTAGCTAGAATTCTAGCTAGCTAG-3′, was annealed, phosphorylated with polynucleotide kinase (New England Biolabs) and ligated into the HpaI site. The mutated genomic clone was then sub-cloned as a BamHI-digested fragment into the BamHI restriction site of the pST76K-SR shuttle vector, and recombined into the MuHV-4 BAC (strain MHV-68) by transient RecA expression −.4, 75c−.7, 75c−.9) plus revertants of 75c−.4 (revertant.1) and 75c−.7 (revertant.2) in which the wild-type genomic sequence was recombined into the BAC in place of the inserted oligonucleotide. ORF50− MuHV-4, in which genomic co-ordinates 69177-67792 are replaced by the luciferase coding sequence, was kindly provided by Dr. Stacey Efstathiou (Division of Virology) and propagated in NIH-3T3 cells with tetracycline-inducible ORF50 expression. This mutant will be described in detail elsewhere. Infectious virus was reconstituted by transfecting BAC DNA into BHK-21 cells. The loxP-flanked BAC/eGFP cassette was removed where indicated by virus passage through 3T3-CRE cells. Virus stocks were then grown in BHK-21 cells + viruses and approximately 2 weeks post-inoculation for ORF75c− viruses. Cell debris was pelleted by low-speed centrifugation and discarded. Virions were then recovered from supernatants by high speed centrifugation and stored at −70°C.ORFs 75a (genomic co-ordinates 117904-114029 of Genbank accession number U97553), 75b (113901-110074) and 75c (109999-106067) ex vivo tissue samples was analyzed similarly, with adenosine phosphoribosyl transferase (APRT) GGGGCAAAACCAAAAAAGGA, reverse primer GCTGGAATTACCGCGGCT, probe CGCAAATTACCCACTCCCGACCC).Infectious virus was titered by plaque assay on BHK-21 cells CGGCTACCACATCCAAGGAA, reverse primer TGTGTGTGGGGCCTGAGTC, probe TGCCTAAACACAAGCATCCCTACCTCAA). PCR primers and HPLC-purified Taqman probes were manufactured by TIB-Molbiol . A standard curve for each primer set was generated by parallel amplifications of plasmid template dilutions, and the average copy number of triplicate PCR reactions for each sample calculated from this.RNA was recovered from MuHV-4-infected cells and reverse transcribed with a 3′ gene-specific primer, followed by real-time PCR with the same primer plus a 5′ partner. PCR products were quantitated with a gene-specific probe. We analyzed ORF73 , ORF50 and the cellular 18S rRNA as a control . A 32P-dCTP labelled probe was generated by random primer extension of the BamHI-H genomic clone (genomic co-ordinates 107477-111869) 6 cells/lane loaded into a vertical agarose gel. The cells were then overlaid with an equal volume of 5% Ficoll/1% SDS/100 µg/ml proteinase K and electrophoresed to resolve linear and circular viral genomes. The DNA was transferred to nylon membranes as above and probed with a 32P-dCTP labelled probe corresponding to a 1.2 kb PstI-restricted fragment Viral DNA was extracted from virus stocks by alkaline lysis 1) 2a) 2a) 2a) 2a) 2a) 1) was identified as such by mass spectrometry of a 160 kDa protein it precipitated from MuHV-4 virion lysates . The cells were washed ×2 in PBS/0.1% Tween-20 after each antibody incubation and mounted in ProLong Gold anti-fade reagent with DAPI (Invitrogen). Fluorescence was visualized with an Olympus IX70 microscope plus a Retiga 2000R camera line (QImaging) or with a Leica SP2 confocal microscope.Adherent cells were washed in PBS, fixed in 4% paraformaldehyde (15 min), then permeabilized with 0.1% Triton-X100 (30 min) and blocked with 10% fetal bovine serum in PBS (60 min). MuHV-4 virion components were detected with mAbs (see above) plus Alexa488- or Alexa568-labeled anti-mouse IgG or Alexa488- or Alexa633- labeled anti-mouse IgG35S-labelled cysteine-methionine g, 10 min) and virions recovered from the cleared supernatants by ultracentrifugation . Each fraction was lysed in 1% Triton X-100, 50 mM TrisCl pH 7.4, 150 mM NaCl, 5 mM EDTA, 1 mM PMSF, plus Complete protease inhibitors (Roche Diagnostics). Insoluble debris was removed by centrifugation . The supernatants were precleared with normal rabbit serum plus protein A/protein G-sepharose. Thymidine kinase, ORF75a and ORF75c were then immunoprecipitated with specific mAbs followed by protein A/protein G-sepharose. The sepharose beads were washed ×5 in lysis buffer. The precipitated proteins were then eluted and denatured by heating in Laemmli's buffer and resolved by SDS-PAGE. Dried gels were exposed to X-ray film.BHK-21 cells were infected with MuHV-4 then washed ×2 in PBS, and labelled for 2 h in cysteine/methionine-free medium with dialysed fetal calf serum plus Virions were lysed and denatured by heating in Laemmli's buffer. Virion proteins were resolved by SDS-PAGE, transferred to PVDF membranes and probed with MuHV-4-specific mAbs plus horseradish peroxidase-conjugated rabbit anti-mouse IgG pAb , followed by ECL substrate development (APBiotech) + ORF75+ or ORF75− MuHV-4 , then trypsinized, washed ×2 in PBS and analyzed for viral eGFP expression by flow cytometry using a FACSort .BHK-21 cells were left uninfected or exposed to BAC−.4 MuHV-4 to an equivalent level of viral eGFP expression, then washed in 0.9% NaCl, fixed in 2% Glutaraldehyde/0.3% H2O2 , washed in 0.1 M HEPES buffer pH = 7.4, and stained and embedded for transmission electron microscopy BHK-21 cells were infected with wild-type MuHV-4 or with ORF75cOur first aim was to derive antibodies capable of identifying the ORF75a, ORF75b and ORF75c gene products. To this end, B cell hybridomas were derived from MuHV-4-infected mice by fusing their spleen cells with NS0 myeloma cells. Antibodies specific for ORFs 75a, 75b or 75c were identified by using hybridoma supernatants to stain 293T cells transfected with the corresponding expression plasmids . AlthougWe also stably expressed each FGARAT homolog in FGARAT-deficient CHO-AdeB cells. These showed the same nuclear localization of ORF75a/b/c . None ofWe next determined the distributions of ORF75a/b/c in MuHV-4-infected cells . Again, We reasoned that if ORFs 75a/b/c were virion components they would be delivered into newly infected cells, and might therefore appear in the nuclei of these cells shortly after membrane fusion, even without new protein synthesis. To test this, we exposed BHK-21 cells to wild-type MuHV-4 virions for 4 h, with or without concurrent cycloheximide treatment to block protein synthesis, then stained the cells for ORFs 75a, 75b and 75c. The cells were also stained for glycoprotein N and the ORF65 capsid component. As a further control, we treated some cells with bafilomycin to block viral membrane fusion ORFs 75b and 75c both accumulated in the nuclei of cells exposed to virions regardless of cycloheximide treatment. They therefore appeared to be virion components rather than immediate-early gene products. Neither was identifiable in the nuclei of bafilomycin-treated cells. Instead, there was staining of cytoplasmic inclusions in a similar pattern to gN. These data were consistent with ORFs 75b and 75c being endocytosed as components of virions, then homing to the nucleus when released from the virion tegument by membrane fusion.ORF75a nuclear staining was hard to discern in newly infected cells, either because this antibody was less good for detection or because MuHV-4 virions contain less ORF75a protein than ORF75b or ORF75c. 35S-cysteine/methionine from 6–48 h post-infection. Infected cell debris was then removed by centrifugation, cell-free virions were recovered from the cleared supernatants by ultracentrifugation, and ORF75a was immunoprecipitated from each fraction. The known virion proteins ORF75c and thymidine kinase (TK) were immunoprecipitated in parallel as controls. ORF75a was clearly recoverable from both virions and infected cells, much like ORF75c. A 70 kDa protein co-precipitated, albeit weakly, with both ORF75a and ORF75c from virions but not from infected cells. This protein was equivalent in size to TK, and the TK-specific mAb reciprocally co-precipitated a 150 kDa band from virions but not from infected cells. These data were consistent with TK and ORF75a/ORF75c associating in the virion tegument. The co-precipitation with TK of a 45 kDa band from infected cells but not from virions pointed to additional changes in protein association during virion assembly. This was not pursued further. The main conclusion of the immunoprecipitations was that ORF75a, like ORF75c, was present in virions.Because the detection of incoming ORF75a by immunofluorescence was weak, we confirmed its presence in virions by immunoprecipitation from virion lysates . MuHV-4-In so far as ORFs 75a/b/c all encoded tegument proteins that localized to the nuclei of infected cells, they appeared to be quite similar. However, the viability of ORF75a and ORF75b but not ORF75c mutants − mutants after BHK-21 cell transfection with BAC DNA was noticeably worse than that of the wild-type. ORF75c+ viruses all spread rapidly, whereas several cell passages were required before ORF75c− viral replication outstripped cell division. ORF75c− plaque formation was correspondingly poor: the cells tended to over-grow before a plaque was formed. We therefore compared ORF75c+ and ORF75c− virus stocks primarily by viral genome content, using real-time PCR, and we assayed infectivity by eGFP expression from a Human cytomegalovirus (HCMV) IE1 promoter in the BAC cassette rather than by plaque formation. The genome∶eGFP expression ratio was 10–100-fold higher for ORF75c− mutants than the wild-type, depending on the multiplicity of infection .We performed growth curves by measuring the %eGFPiplicity . This ap+ and ORF75c− virus stocks, equivalent genome numbers corresponded to roughly equivalent amounts of virion capsid (ORF17), glycoprotein (gB) and tegument (thymidine kinase) . The onl kinase) was a re kinase) , ORF75a kinase) , ORF75b 21 cells . In part− viruses seemed likely to reflect a problem in establishing infection. Cell binding and penetration depend primarily on virion glycoproteins, but post-fusion events may depend on the tegument. One possibility suggested by the nuclear localization of incoming ORF75c might be involved in the ORF75c− virions. A severe ORF75c-dependent block to viral eGFP expression remained and failed to migrate to the nuclear margin.The same was true of NIH-3T3 fibroblast and NMuMG epithelial cell infections : incomine normal . Imaginge normal showed lin vivo. We addressed this here by intranasal infection of mice with ORF75c− and ORF75c+ viruses proteins, at least some of which participate in anti-viral defence − phenotype of defective incoming capsid transport remains incomplete. However, the effect of ORF75c on PML (TRIM19), while insufficient by itself to explain the low infectivity of ORF75c− mutants, suggested that ORF75c might also target other TRIMs. Innate anti-viral defences are plausible targets for the herpesvirus tegument, as incoming genomes must reach the nucleus silently enough for latently infected cells not to become immune targets. Mapping the ORF75 host interaction partners may tell us how this is achieved.In summary, the evolution of a captured host FGARAT into a set of viral tegument proteins had suggested that these proteins no longer function mainly as FGARATs, and such was found to be the case. ORF75c showed functional similarity to the EBV BNRF1, in that infection by the knockout virus was inhibited at a pre-nuclear entry step. ORFs 75a and 75b, although related in DNA sequence to ORF75c and also present in the tegument, were unable to substitute for it, indicating that their functions are distinct. The molecular explanation for the ORF75cFigure S1(2.81 MB TIF)Click here for additional data file. |
Behningia baei, new species, is described from larvae taken in Thailand. The new species is differentiated from congeners primarily by its labial palps, labrum, and base of the mid legs. It is the first species of the genus Behningia, and only the second species of the family Behningiidae, to be taken from the Oriental biogeographic region. Larvae previously regarded as B. tshernovae Edmunds and Traver are considered to be assignable to B. lestagei Motas and Bacesco.A new species of primitive tuskless burrowing mayflies , Behningia . Other material: six middle instar larvae with same collecting data as holotype; three with same depostion as holotype, and three deposited in the Wilbur Enns Entomology Museum, University of Missouri, Columbia, Missouri, U.S.A. For comparative purposes we also examined larval material at Purdue of other Behningia species larvae as follows: B. lestagei Motas and Bacesco, Poland, Warta, Ostrowska, 11-VI-1960, 12-VI-1904; and B. sp. A, Poland, Warta, Kuczki, 22-VI-1958.Etymology: The species is named for Professor Jae Bae, our esteemed ephemeropterist colleague from Seoul, Korea.Behningia baei represents the only known species of the genus Behningia outside the Palearctic, and only the second species of Behningiidae known from the Orient, where Protobehningia merga Peters and Gillies is also known from Thailand. The cladistic evidence is compelling that Behningia and the Nearctic genus Dolania are sister genera and represent a clade opposite the more plesiotypic Protobehningia Tshernova . The forB. baei with other species of Behningia are based on material we have of B. lestagei and a presumably unnamed species very similar or equivalent to B. ulmeri Lestage, which we refer to as B. sp. A, in addition to published data currently associated with Behningia larvae. As further shown below, no essential basis has been found for recognizing the larvae previously associated with B. tshernovae as being different than the larvae of B. lestagei. The type of B. tshernovae is based on adults figured by Tshernova . In B. sp. A, the emargination is somewhat deeper and more narrowly V shaped than in B. ulmeri. In B. lestagei , the emargination is shallow, narrower, and more U shaped than in B. ulmeri. One other feature that may be of some limited use in diagnosing B. baei is the size of the mid trochanter relative to the mid coxa. In B. baei (B. ulmeri (Figure 5b in B. sp. A, the trochanter is considerably longer than the coxa; whereas, in B. lestagei, the trochanter is highly reduced (Fig. 14 in We have also found the labrum to be of some use in distinguishing B. baei , the lab B. baei , B. ulme |
Here, we provide evidence that pyrvinium suppresses the transcriptional activation of GRP78 and GRP94 induced by glucose deprivation or 2-deoxyglucose , but not by tunicamycin or A23187. Other UPR pathways induced by glucose starvation, e.g. XBP-1, ATF4, were also found suppressed by pyrvinium. Constitutive expression of GRP78 via transgene partially protected cells from pyrvinium induced cell death under glucose starvation, suggesting that suppression of the UPR is involved in pyrvinium mediated cytotoxicity under glucose starvation. Xenograft experiments showed rather marginal overall anti-tumor activity for pyrvinium as a monotherapy. However, the combination of pyrvinium and Doxorubicin demonstrated significantly enhanced efficacy in vivo, supporting a mechanistic treatment concept based on tumor hypoglycemia and UPR.We identified pyrvinium pamoate, an old anthelminthic medicine, which preferentially inhibits anchorage-independent growth of cancer cells over anchorage-dependent growth (∼10 fold). It was also reported by others to have anti-tumor activity Intratumoral heterogeneity is a common characteristic of solid tumors via transcriptional activation e.g. GRP78, GRP94, ATF-6, ATF-4, PERK, IREα, XBP-1 (Glucose-regulated protein 78 (GRP78) is a molecular chaperone resident in the endoplasmic reticulum (ER) and plays a major role in protecting cells from the apoptosis induced by ER stresses, including glucose deprivation and hypoxia α, XBP-1 .e.g. aggressive breast cancer New evidence indicates that GRP78 plays a critical role in tumor development, progression and resistance to chemotherapy Pyrvinium pamoate was an old anthelminthic medicine. Esumi and colleagues recently reported that it was preferentially toxic to glucose-starved cancer cells and had anti-cancer activity in a hypovascular Panc-1 pancreatic cancer model, known to be resistant to hypoglycemia Pyrvinium phosphate salt was prepared by following sequential steps: a) placing pyrvinium pamoate in an Erlenmeyer flask with a magnetic stirring bar, b) mixing with chloroform (Fisher), c) mixing with 95% ethanol (Pharmaco), d) warming to 50°C with stir for 10 minute, e) adding 2% phosphoric acid (85% in 95% ethanol) to produce a precipitate, f) adding ethyl acetate 2 minutes later, g) stirring for 20 minutes, h) collecting the solids by filtration followed by washing with 2/1/1 ethyl acetate/chloroform /ethanol, i) drying by air. The phosphate salt is freely soluble in water at 1 mg/ml, giving an orange red solution. 2-deoxyglucose (2DG), A23187 and tunicamycin were purchased from Sigma .2 at 37°C.A549, SW480, DLD1, A2058, MCF7, SK-BR-3, PA-1, DU145, PANC-1, IMR90, WI38, CCD-112CoN and HUVEC cells were purchased from American Tissue Culture Collection (ATCC) and cultured per recommendations. HOP62, HOP92, NCI-H460, NCI-H522, HCT116, HT29, HS 578T, T47D, MDA-MB-231, MDA-MB-435, A2780, OVCAR-1, OVCAR-4, OVCAR-5, OVCAR-8, SK-OV-3, Caov-3, UACC62, UACC257, and PC3 cells were obtained from NCI and were adapted to a single growth medium, RPMI 1640 (Invitrogen) supplemented with 10% FBS and 2 mM L-Glu. The establishment of C.1 cells and culture conditions for both CHO and C.1 cells were described previouslyRenilla luciferase activity using the Dual Luciferase kit (Promega) per protocol provided by manufacturer The pGL2-Grp78-169/LUC reporter gene was previously described Anchorage-dependent (liquid cell culture) and anchorage-independent (soft agar culture) growth in 96-well plates were previously described For measurement of growth of the Panc-1 cells expressing exogenous GRP78, the cells in 96-well plates cells were co-transfected using Lipofectamine 2000 (Invitrogen) as with total same amount of DNA containing pcDNA-GRP78 and pGL2- LUC reporter gene plasmids, adjusted with pcDNA3 empty vector. The firefly luciferase activity was measured after transfection for 24 hrs as a surrogate of cell growth 5′-/56 FAM/CAAACTTGTCCCCGAGCGACGAGA /BHQ1/-3′, GRP78-forward primer: 5′- TGGCAGGAGAGAGTTACAGTCG, GRP78-reverse primer: 5′- GCCCTGCAGTCTCTCCCAC-3′); GRP94-probe: 5′-/56FAM/ TGTTTGACGAATA TGGATCTAAAAAGAGCGATTACAT/3BHQ-1/3′, GRP94-forward primer: 5′- CCCACATCTGCTCCACGTG; GRP94-reverse primer: 5′-CACGGCGCACATAG AGCTT -3′); ATF4-probe: 5′/56FAM/TTGGTCAGTCCCT CCAACAACAGC AAG /3BHQ-1/3′, ATF4-forward primer: 5′- TGGCTGGCTGT GGATGG; ATF4-reverse primer: 5′-TCCCGGAGAAGGCATCCT-3′); XBP1-probe: 5′-/56FAM/ CCCAGTTG TCACCCCTCCAGAACATCTC/3BHQ-1/3′, XBP1-forward primer: 5′- ACCTCTGCAGCAGGTGCAG; XBP1-reverse primer: 5′-AATACCGCCAGAATCCA TGG -3′). XBP1-spliced -probe: 5′-/56FAM/ CCCAGTTGTCACCCCTCCAGAACAT CTC /3BHQ-1/3′, XBP1-spliced -forward primer: 5′-ACCTCTGCAGCAGGTGCAG-3′; XBP1-spliced -reverse primer: 5′-AATACCGCCAGAATCCATGG -3′).Real time RT-PCR used to quantitate mRNA levels in cells was described previously with PCR primer and probe sequences as follows: GRP78-probe: Western blot analysis procedure was also previously describednu/nu) (4–6 weeks old) were purchased from Simonsen Laboratory, Inc. . The animal use and care protocol was approved by Perry Scientific's Animal Care and Use Committee (ACUC) and all procedures were conducted according to the guidelines of NIH/Department of Human and Health Services. Athymic mice were inoculated (s.c.) with 5×106 cancer cells in PBS on the athymic mouse flanking site. Animals were randomly divided into treatment and control groups with similar average tumor sizes.The establishment of human xenograft tumor was previously described via oral administration (p.o.) and 0.5 mg/kg via intraperitoneal (i.p.) administration, 6 times weekly for five weeks respectively. For PC3 cancer model, animals in the first group were treated with pyrvinium pamoate daily at 10 mg/kg via oral dosing, 6 times weekly for five weeks. The second group was administrated with doxorubicin i.p. at 4 mg/kg, once per week for two weeks. The third group was treated with both pyrvinium pamoate and doxorubicin as described above. The control groups were dosed with 5% dextrose (vehicle) with the same schedule as the treatment group. Tumor volumes were manually measured and calculated as previously reported For HCT116 and AsPC-1 xenograft models, animals in the treatment group received pyrvinium pamoate daily at 10 mg/kg Anchorage-independent growth of cancer cells is a hallmark of cell transformation. In an effort to identify compounds with selective anti-cancer activity, we screened a small compound library composed of drugs, drug-like and natural compounds, using 96-well format soft-agar (SA) assay, an anchorage-independent growth assay we recently developed 50∼0.1 µM) or 3-dimensional growth (spheroid), both subsequently confirmed by us. Our soft agar growth assay may resemble spheroid growth since both are 3-dimensional without attaching to culture dish, although the interpretation for the observed sensitivity for spheroid growth by these authors was due to glucose deprivation inside the spheroid itself.During the course of our study, Esumi and colleagues reported anti-tumor activity of pyrvinium pamoate in human pancreatic cancer Panc-1 xenograft models in vivo pharmacological evaluation (see below). We created several new pyrvinium salts including phosphate and sulfate salts, with significantly increased water solubility (data not shown). These new salts were retested in the same in vitro assays and were confirmed to have the same phenotypes as seen for pyrvinium pamoate, verifying that the pyrvinium moiety, instead of pamoate, is responsible for the observed phenotypes since pamoate alone did not show any observable effect , thus not a practical salt form for e effect . Pyrvinie.g. panc-1. There must be other pathways involved in the pyrvinium actions.Esumi and colleagues reported that pyrvinium pamoate dephosphorylated Akt in Panc-1 cells only when glucose was deprived, which was correlated to the observed preferential cytotoxicity. This hinted a possible role of Akt in the pyrvinium pamoate action GRP78 and GRP94 are two ER resident stress response chaperones that are transcriptionally induced during glucose deprivation as part of the UPR, which protects cells from apoptosis under a variety of stress conditions 2-deoxyglucose (2DG) is a glucose analog, a glycolysis inhibitor and also a transcriptional activator of GRP78 or the UPR response cis-acting ER stress response element (ERSE) that is required for ER stress-mediated transcriptional activation renilla luciferase gene driven by constitutive promoter as an internal control, which ensures that the observed effect is related to UPR-specific transcriptional regulation, rather than the changes in general protein synthesis or the variation in transfection efficiency. As shown in We were also interested in whether down-regulation of the steady state levels of GRP78 mRNA/proteins resulted from transcriptional suppression, a characteristic UPR regulation. To this end, a reporter system for GRP78 transcription, pGL2-Grp78-169/LUC, was used. This system contains a GRP78 promoter driven luciferase reporter gene. The promoter harbors the Since GPR78/94 induction constitutes one of the key pro-survival mechanisms of cancer cells in response to glucose deprivation, pyrvinium-mediated suppression of GRP78 and GRP94 expression may counter this survival mechanism and resulted in rapid cell death. This assumption was indeed supported by the observed correlation between the suppressed expression of GRP78 and GRP94 by pyrvinium and cytotoxicity. As shown in Although CHO cells, the parental cell line of C.1, also show the properties of preferential cytotoxicity and GRP78 down regulation by pyrivinium under glycolytic suppression as seen in Panc-1 and other tested cell lines , one maySeveral factors are known to be responsible for ER stress-mediated transcriptional activation of GRP78, including the alternatively spliced XBP-1 (sXBP-1) and activated ATF6 ATF-4 is a cAMP response element-binding transcription factor (CREB) and promotes cell survival by activating certain gene transcription including those involved in the stress response, including the GRP78 promoter With this new information of ATF-4 up-regulation by glucose deprivation, we next asked whether this up-regulation can also be suppressed by pyrvinium. We demonstrated that the mRNA and protein induction was completely suppressed by pyrvinium treatment. In contrast, no suppression was observed for tunicamycin-mediated ATF4 induction. These results again provided evidence that pyrvinium also affects the UPR by acting on the PERK pathway, another major UPR pathway. It is noteworthy that pyrvinium actually up-regulates ATF4 protein in the presence of glucose , contrasvia oral administration or i.p. injection. We tested systemic delivery of soluble pyrvinium salt to enhance anti-tumor activity by overcoming the limitation of oral absorption. Overall, our data showed rather marginal tumor responses to pyrvinium treatment and insensitive to hypoglycemia, as compared to other solid tumors. They confirmed their hypothesis by demonstrating the Panc-1 xengraft tumor response to oral administration of pyrvinium pamoate ment see , with soe.g. exterior) and/or further deprive glucose levels in solid tumor via shutting down blood flow, thus broadening therapeutic window. We therefore evaluated the combination therapy of pyrvinium with a conventional chemotherapy agent doxorubicin for being potent against dividing cancer cells and their anti-angiogenic effects.The weak anti-tumor activity of pyrvinium could be explained by the following possibilities: first, attacking the hypoglycemic tumor areas is simply insufficient to mount an effective overall anti-cancer treatment, similar to those seen in many anti-angiogenic monotherapies; second, glucose levels in tumors are still too high to render pyrvinium effective. These two putative limitations can potentially be overcome by combination therapy with existing chemotherapy agents that efficiently kill the dividing cancer cells in normal glycermic areas dosing), group 2 (4 mg/kg doxorubicin once a week i.p. dosing for 2 week), group 3 dosing), group 4 dosing). The tumor responses to these treatments are shown in in vivo. General toxicity was evaluated on the basis of changes in animal body weight in cytotoxicity and inhibition of GRP78 (10∼100 fold); second, there absolutely is no structural similarity between the two was proven to be effective, supporting our assumed effective solid tumor treatment mechanism based on the simultaneous targeting of hypoglycemic areas and normal glycermic areas. One of the most serious problems confronting current chemotherapies is their undesirable general toxicity, Figure S1ER stress-mediated UPR signal pathways. Red color represents targets or pathways affected by both pyrvinium and versipelostatin.(4.51 MB TIF)Click here for additional data file.Figure S2Inhibition of cell growth by different pyrvinium salts. Cells were seeded into each well of a 96-well plate in liquid culture with or without glucose at 1e3/well for one day. Cells were treated with pyrvinium at indicated concentrations and cell growth in culture was measured after incubation at 37°C for 3 days by alamarBlue staining. Error bars: standard deviations (SD).(2.78 MB TIF)Click here for additional data file.Figure S3Structures of pyrvinium and versipelostatin.(2.31 MB TIF)Click here for additional data file.Table S1Pyrvinium phosphate preferentially inhibits cancer cell anchorage-independent growth over anchorage-dependent growth(0.06 MB DOC)Click here for additional data file.Table S2Pyrvinium phosphate preferentially inhibits cancer cell growth deprived with glucose(0.03 MB DOC)Click here for additional data file.Table S3A Summary of tumor responses to pyrvinium in xenograft tumor models(0.05 MB DOC)Click here for additional data file.Table S4Comparison of pyrvinium and VST-1 effects on UPR(0.03 MB DOC)Click here for additional data file. |
MRC1 gene with sarcoidosis.Mannose receptor (MR) is a member of the C-type lectin receptor family involved in pathogen molecular-pattern recognition and thought to be critical in shaping host immune response. The aim of this study was to investigate potential associations of genetic variants in the MRC1 gene, were genotyped in a total of 605 Japanese consisting of 181 sarcoidosis patients and 424 healthy controls.Nine single nucleotide polymorphisms (SNPs), encompassing the P = 0.001).Suggestive evidence of association between rs691005 SNP and risk of sarcoidosis was observed independent of sex and age in a recessive model (MRC1 is an important candidate gene for sarcoidosis. This is the first study to imply that genetic variants in MRC1, a major member of the C-type lectin, contribute to the development of sarcoidosis.These results suggest that Mycobacterium and Propionibacterium species have been suggested to play roles in the pathogenesis of sarcoidosis based on our previous report [Initially, we selected and genotyped seven SNPs in the 240G/A rs26736 and240G/A rs26736 andMRC1 gene was tested for deviation from Hardy-Weinberg equilibrium using a χ2 test. Both genotypic and allelic association among subjects with sarcoidosis and healthy controls were statistically compared using the logistic regression analysis adjusting for sex and age. The relative risk was estimated as odds ratios (OR) with 95% confidence intervals (95%CI). For LD mapping, pair-wise LD between polymorphisms in MRC1 was evaluated using Haploview software version 4.2 [P values for each haplotype and further adjusts for covariates. Haplotypes with frequency below 5% were excluded from haplotype analysis. These statistical analyses were performed using a program R version 2.11.1 (http://www.R-project.org/) [P values were adjusted using the Bonferroni correction for 10 tests. Levels of significance for all statistical analyses were set to P < 0.005.Each of the SNPs in the sion 4.2 . For hapct.org/) . P valueP < 0.05). The sarcoidosis group included significantly more females than the control group (P < 0.05). Pair-wise LD values for 7 SNPs are shown in Figure P > 0.05). Genotype and allele frequencies and counts for each SNP in the MRC1 gene are shown in Table P = 0.02; rs692527, OR 1.58, 95%CI 1.02-2.46, P = 0.042; and rs691005, OR 2.53, 95%CI 1.47-4.37, P = 0.001; Table P = 0.011), when analysis was performed under a dominant model. The rs691005 SNP remained statistically significant after Bonferroni correction. The linkage disequilibrium map constructed from 7 SNPs is shown in Figure Demographic characteristics of the 424 healthy controls and 181 subjects with sarcoidosis from this population are listed in Table Based on LD structure and significant association of rs691005 for initial analysis, we further genotyped two additional SNPs (rs554995 and rs554313) close to rs691005. Unfortunately, these two SNPs did not show significant associations was confirmed considering for multiple testing and Bonferroni correction, suggesting MRC1 gene as a plausible candidate gene for development of sarcoidosis. Of interest, recent genome-wide association analyses have shown that 10p12, where MRC1 is situated, is a susceptibility locus for the development of sarcoidosis [MRC1 gene variants may contribute to the development of sarcoidosis.In the present study we demonstrated the association between coidosis . Thus, fMRC1 showed the strongest association (OR 2.53). Although the real functions of this gene are unclear, variants in the 3'-UTR are known to disrupt a regulatory binding sequence and alter mRNA expression [MRC1 gene sequences and sarcoidosis.The rs691005 located within the 3'-untranslated region (3'-UTR) of pression . AlternaMRC1 spanning chr10:17,891,368-17,993,183 (HapMap Data Rel 27) and were referred to by their MRC1L1 'rs'numbers (NCBI EntrezSNP database Build 130). Alter et al reported no evidence for a common gene duplication event [MRC1L is an erroneous annotation caused by the presence of a sequence gap and the incorrect assignment of a polymorphic haplotype.It should be noted that SNPs with two positions were mapped to on event . The autMRC1 gene polymorphism and risk of asthma in two independent ethnically diverse populations [MRC1 might be involved in the pathogenesis of a number of chronic inflammatory diseases. Several reports have shown that genetic variants of genes related to PRRs such as TLR4 and CD14 are associated with susceptibility to both diseases [We also reported the association of ulations , suggestdiseases ,11,25-27P = 0.02, P = 0.011, P = 0.042), but this association did not reach significance after the Bonferroni correction. However, associations of rs691005 remained significant even after Bonferroni correction (P = 0.001). In addition, power calculations based on study subjects of 181 cases and 424 controls, OR of 2.53 showed a sufficient genetic power (0.81) at the level of significance of 0.005. As the sample size of this study is not sufficiently large and is restricted to Japanese population, the present data should be validated in larger samples and in other ethnic groups.Of the SNPs examined, three SNPs showed tendency for association with sarcoidosis (MRC1 gene may represent an important susceptibility locus for sarcoidosis at chromosome 10p12 and genetic variants in MRC1 may play significant roles in the pathogenesis of sarcoidosis. Importantly, the association we observed between MRC1 polymorphisms and sarcoidosis adds further evidence for the involvement of macrophage PRRs in the development of a number of chronic inflammatory diseases, including sarcoidosis. However, further studies are clearly needed to achieve a comprehensive coverage of genetic variants in and around the MRC1 gene, in order to identify causal variants conferring susceptibility to an increased risk of sarcoidosis.This study suggests that the The authors declare that they have no competing interests.The authors TH, SK, PG, SH, NH and MN made substantial contribution to the conception and design of the study, and analysis and interpretation of the data. AT, AI, Kaouruko S, Kenichi S, and NT, and EY made a substantial contribution to the collection of the resources and an intellectual contribution to the study design. All authors read and approved the final version.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2350/11/151/prepub |
Occult breast cancer has frequently been described as presenting as axillary lymph node metastases but rarely as gastrointestinal metastases, Varadarajan et al. (2007). In extremely rare situations, cancerous lesions identified in the gastrointestinal tract have been determined to be metastatic lesions from primary breast cancers, Taal et al. (2000). We report a case of an occult lobular adenocarcinoma presenting as gastrointestinal metastases. It is essential that the possibility of lesions found in the gastrointestinal tract originating from distant or occult cancers be considered in order that appropriate therapeutic options may be discussed and considered early after diagnosis. Breast carcinoma is the most common malignancy in women after skin cancer and, after lung cancer, the most frequent cause of cancer death in females. Over 175,000 women were diagnosed with breast cancer in 2007 and more than 40,000 died from the disease. With advancements in screening over the past 25 years, fewer than ten percent of patients will present with metastatic breast carcinoma at the time of diagnosis. However, despite improvements in surgical and chemotherapeutic therapies, women with early-stage and locally advanced breast cancer relapse not infrequently, usually presenting with distant metastatic disease. Metastatic disease of breast cancer origin commonly appears in the skeleton 43%), stomach (27%), lung (8%), and liver (4%) [%, stomacOur review of the literature revealed one case report of occult breast carcinoma presenting as a pancreatic tumor . We repoA 53-year-old female presented to an outside institution with a one-month complaint of abdominal pain. An extensive evaluation was only remarkable for an umbilical hernia and a chest wall nodule. The chest wall nodule was excised and reported as benign. Screening colonoscopy was negative except for a reportedly benign colon polyp that was removed. She underwent an umbilical hernia repair with mesh placement. Her postoperative course was complicated by omental herniation under the mesh with omental infarction and intraperitoneal bleeding. She underwent repair of this process but continued to feel anorexic and ill. Five months following her initial operation, she developed borborygmi associated with watery diarrhea occurring up to ten times a day. H. pylori or celiac sprue was noted. The biopsy revealed metastatic carcinoma consistent with a breast primary. Estrogen receptor was strongly positive and progesterone receptor was negative. HER2 was negative by FISH. She offered no breast complaints at the time of diagnosis. Clinical examination of the breasts and axillae was normal. Screening mammograms performed previously showed heterogeneously dense nodular parenchyma bilaterally. Minimal architectural distortion was present in the superior portion of the left breast but this was previously noted and felt to be benign. Family history was remarkable for a maternal aunt and a paternal aunt with postmenopausal breast carcinoma. An upper gastrointestinal endoscopic study with biopsies of the antrum was performed. No evidence of Given her unusual pathology, all of her prior pathology was sent to our institution for review. The previously resected colon polyp and chest wall lesion were reevaluated and found to be consistent with metastatic breast carcinoma. She underwent a bilateral breast MRI examination, which showed no worrisome areas of focal enhancement. She was then started on with hormonal therapy with an aromatase inhibitor.The stomach biopsy specimen showed metastatic carcinoma consistent with breast primary. Immunohistochemical stains CK7, CK20, CD45, CDX2, estrogen receptor (ER), progesterone receptor (PR), and HER2 were performed. The neoplastic cells were ER positive (>95% nuclear staining), PR weakly positive (10% nuclear staining), and CK7 positive. Tumor stainings for HER2, CK20, CD45, and CDX2 were negative. The pattern of tumor infiltration, morphology and immunohistochemical profiles were consistent with lobular breast carcinoma. The stomach lesion exhibited a linitus plastica appearance.The chest wall lesion was also consistent with metastatic breast carcinoma which was ER positive, PR weakly positive, and equivocal for HER2 (score 2+) with negative HER2 gene amplification by FISH. Occult breast carcinoma may rarely present as axillary metastasis ; howeverThe metastatic patterns of lobular and ductal carcinoma have been reported to differ considerably. Metastatic breast carcinomas of ductal origin usually present with hepatic, lung, brain, and bone metastases whereas metastatic lobular carcinoma is noted to spread to gastrointestinal, gynecological, and peritoneal structures . Autopsy Cormier et al. reportedAbdominal pain was found to be the most common symptom of breast cancer metastatic to the gastrointestinal tract, followed by bloating, melena, GI hemorrhage, bowel obstruction, early satiety, dysphagia, weight loss, anemia, fatigue, and a palpable abdominal mass .Metastatic breast cancer can easily be mistaken for a primary gastrointestinal cancer , 12. SchMetastatic breast cancer can be difficult to distinguish from primary gastric cancer. Metastasis to the stomach from lobular type carcinoma tends to exhibit tumor cells that are infiltrating in single file process between benign gastric glands. Signet cells may be occasionally noted. This histologic finding resembles primary diffuse type gastric carcinomas (linitis plastica). Metastasis from ductal type carcinoma can resemble poorly differentiated intestinal type gastric adenocarcinomas . ImmunohIt is important for physicians who follow survivors of invasive lobular carcinoma of the breast to remember that gastrointestinal symptoms can be a manifestation of metastatic disease. The disease free interval between primary breast cancer and gastrointestinal involvement may be as long as 10 years from the time of diagnosis. In our unique case, the breast primary was not found. Once the correct diagnosis is made, targeted systemic treatment specific for breast cancer may be considered and initiated if appropriate. |
Cell survival was measured based on quantitative staining of cellular protein by sulforhodamine B. A 24 h treatment with ET-743 before radiation resulted in a moderate increase in radiosensitivity in three out of four cell lines. Dose enhancement factors ⩾1.8 were observed for concentrations resulting in 52, 46 and 30% cell kill in ECV304, H292 and CAL-27, respectively, whereas in A549 no radiosensitisation was observed (no significant increase in radiosensitivity). According to the combination index analysis, synergism was observed only in ECV304 and CAL-27 cells. A 24 h incubation with ET-743 resulted in a concentration-dependent G2/M block, which might explain the moderate radiosensitising effects in ECV304 and H292. The lack of radiosensitisation in A549 might be due to the S phase delay preceding the G2/M block at the moment of radiation, which only occurred in this cell line. In conclusion, ET-743 has moderate cell line-dependent radiosensitising properties; however, only when cytotoxic concentrations of ET-743 are used. In one of the four cell lines tested, no radiosensitisation was observed.Ecteinascidin 743 (ET-743) is a new marine-derived agent with promising activity against a number of solid tumours. In four human tumour cell lines, the interaction between ET-743 and radiation was investigated in relation to the effects of ET-743 on the cell cycle, Ecteinascidia turbinata and grow preferentially on mangrove roots. Ecteinascidin 743 (ET-743) (Yondelis™) is the most promising compound, based on its cytotoxicity and its abundance in the tunicate merit special consideration. These colonial tunicates are produced by WAF−1/CIP−1, c-Jun, c-Fos, MDR1 and others. This compound is a novel, potent and general inhibitor of activated but not constitutive transcription development in different tumour types. Phase II studies both in the US and Europe have indicated that ET-743 is an active agent for the treatment of patients with soft-tissue sarcoma . A poolein vitro, before applying concomitant chemoradiotherapy in the clinic. However, one should keep in mind that radiosensitising effects do not by definition lead to an improved therapeutic index. The selectivity of the interaction between the cytotoxic agents and radiotherapy is a key issue for improved clinical outcome. Although ET-743 shows a peculiar pattern of selectivity in cells with different defects in their DNA-repair pathways and 10% fetal calf serum. CAL-27 cells were grown in Dulbecco's modified Eagle's medium (DMEM) medium, supplemented with 2 mM glutamine and 10% fetal calf serum. No antibiotics were added to the media. The cultures were maintained in exponential growth at 37°C in a humidified 5% CO2 atmosphere.Four different human tumour cell lines have been used: ECV304, an epidermoid bladder cancer cell line; H292, a mucoepidermoid lung cancer cell line; A549, a squamous lung cancer cell line and CAL-27, a squamous cell carcinoma cell line of the tongue. ECV304 cells were grown in Medium 199 supplemented with 10% fetal calf serum . H292 and A549 cells were cultured in RPMI-1640 medium, supplemented with 2 mμM and stored in aliquots at −20°C. Aliquots were thawed for each new experiment. Before use, the stock solution was diluted in phosphate-buffered saline to the desired concentrations.Ecteinascidin 743 was kindly provided by Dr Glynn T Faircloth, PharmaMar USA, Inc., Cambridge, MA, USA. Ecteinascidin 743 was dissolved in dimethyl sulphoxide (DMSO) to create a concentrated stock solution of 660 −1 for all the cell lines tested. Cells were treated, after a 24 h recovery period, in two treatment schedules: 24 h incubation with ET-743 followed by radiation and 24 h incubation with ET-743 just after radiation . Cells were washed with a drug-free medium after 24 h incubation with the drug, and maintained at 37°C. At 7 or 8 days (about six doubling times) after the radiation treatment, cell survival was determined by the sulforhodamine B (SRB) assay. Each concentration was tested six times within the same experiment. All experiments were performed at least three times.Cells were harvested from exponential phase cultures by trypsinisation, counted and plated at optimal seeding densities in 48-well plates, to assure exponential growth during the experiments. Cell densities were about 100 cells wellin vitro radiosensitivity testing, which has shown to be comparable in outcome with the clonogenic assay, when cells are allowed to undergo at least six doubling times after irradiation , dissolved in 1% acetic acid for at least 15 min and washed four times with 1% acetic acid to remove unbound stain. The plates were left to dry at room temperature and the bound protein stain was solubilised with 200 μl 10 mM unbuffered TRIS base (tris(hydroxymethyl) aminomethane) and transferred onto 96-well plates for reading the optical density at 540 nm .The SRB test is a suitable test system for −1 for ECV304 and A549, and 25 000 cells well−1 for H292. Following plating and a 24 h recovery period, cells were incubated with different concentrations of ET-743 near the IC50. After a 24 or 48 h incubation period, cell cycle analysis was performed immediately, 4 or 24 h later, by flow cytometry.Cells from exponential phase cultures were trypsinised and plated in 6-well plates. In order to assure exponential growth during the experiment, seeding densities were 20 000 cells wellμl PBS and after addition of 100 μl solution A (trypsin), the cells were incubated for 20 min at room temperature. Then, 75 μl solution B (trypsin inhibitor spermine and ribonuclease A) was added and after 10 min incubation at room temperature, 75 μl solution C (propidium iodide) was added for at least 30 min at 4°C. Samples were analysed in a FACScan flow cytometer .DNA was stained according to the Vindelov method, after trypsinisation (αD-βD2), using WinNonlin . The radiation dose–survival curves were corrected for the cytotoxic effect of ET-743 alone . From the dose–survival curves, the ID50 was calculated, which is the radiation dose causing 50% growth inhibition. A two-sample t-test was used to investigate significant differences between ID50 values. The results are expressed as mean±s.d.The survival rates were calculated by: mean optical density (OD) of treated cells/mean OD of untreated cells × 100%. Radiation dose–survival curves were fitted according to the linear-quadratic model: survival=exp(−50 of the untreated cells/ID50 of the cells treated with ET-743.Radiosensitisation was expressed by the dose enhancement factor (DEF): ID50 or Dm) and the shape of the dose–survival curve . The general equation for the classic isobologram is given by:Possible synergism was determined by the calculation of the combination index (CI) by the Dx)1 and (Dx)2 are the doses (or concentrations) for D1 (ET-743) and D2 (radiation) alone that give x% inhibition, whereas (D)1 and (D)2 are the doses of ET-743 and radiation in combination that also inhibit x% (i.e. isoeffect).where (Dx)1 or (Dx)2 (for ET-743 and radiation) are calculated by the formula:The (Dm is the dose required to produce absorbance readings 50% lower than those of nontreated wells (IC50 or ID50), fa is the fraction affected and m is the slope of the median-effect plot. The CI values obtained from the classic isobologram calculations are given. In short, 1.10>CI>0.90, 0.90>CI>0.85, 0.85>CI>0.70 and 0.70>CI>0.30 indicates a nearly additive effect, slight synergism, moderate synergism and synergism, respectively.where P-value, was used to investigate the significance of the differences between the percentages of cells in the different cell cycle phases after treatment with ET-743 vs the untreated cells.Flow cytometric data were analysed using Cell Quest (Becton Dickinson). A one-way analysis of variance (ANOVA), followed by a Bonferroni adjustment of the 50 values of 1.6±0.6, 1.1±0.5, 0.9±0.4 and 1.5±0.5 nM for ECV304, H292, CAL-27 and A549, respectively.The four cell lines used in this study were almost equally sensitive to the cytotoxic effect of ET-743, with mean ICFigure 250 values of the ET-743-treated cells compared with the untreated cells was observed (p<0.001). Pretreatment with ET-743 therefore seemed to increase the radiosensitivity of ECV304, H292 and CAL-27 cells. On the contrary, no radiosensitising effect was observed in A549.In ECV304, H292 and CAL-27, a significant decrease in ID50, without a significant decrease in ID50). In the other three cell lines, rather toxic concentrations were needed to obtain a clear radiosensitising effect: DEFs ⩾1.8 were observed for concentrations resulting in 52, 46 and 30% cell kill in ECV304, H292 and CAL-27, respectively.An increase in radiosensitivity can be described by the DEF. This DEF seemed to correlate with the cytotoxic effect of ET-743 alone. In 80, with a CI value of 0.74 (DEF=2.03). For concentrations below the IC80, additivity was found. In H292, the calculation of the CI resulted in a value between 0.90 and 1.10 for concentrations between IC40 and IC80, so only a nearly additive effect. In CAL-27, concentrations of ET-743 between IC30 and IC50 already gave a CI value of 0.82 (DEF=1.88), resulting in moderate synergism. Concentrations around the IC50 resulted in a clear synergistic effect, with a CI value of 0.65 (DEF=2.23). In A549 cells, no synergism was observed (CI=1.08).To investigate whether these concentrations result in a synergistic effect between ET-743 and radiation, the CI was calculated. In ECV304, moderate synergism was observed for concentrations around ICM ET-743 in ECV304; and 1.07 for 0.75 nM ET-743 in H292.In the other treatment schedule, 24 h incubation with ET-743 immediately after radiation, no radiosensitising effect was observed in the four cell lines tested. Figure 4M ET-743 and to 37.8±1.8% after 48 h incubation with 3 nM ET-743. In A549 cells, there was an increase from 15.1±0.8% in untreated cells, to 43.0±7.5% after 48 h with 0.8 nM ET-743 and to 67.4±3.3% after 48 h with 1.8 nM ET-743.Treatment with ET-743 caused an accumulation of cells in the G2/M phase of the cell cycle. This cell cycle effect is concentration dependent in the three cell lines tested. In ECV304 cells, the percentage of cells in the G2/M phase increased from 14.2±0.9% in the untreated cells, to 31.9±2.9% after 48 h incubation with 2 n50 values of the cell lines. In all the three cell lines, an increase in incubation time (48 h instead of 24 h) resulted in an increase in the amount of cells in the G2/M phase. At 4 h after a 24- or 48 h-incubation period, the percentage of cells in G2/M still increased, although less pronounced in H292. At 24 h after a 24 h-incubation period, cell cycle distributions are restored, except in A549 cells. In this cell line, 24 h after a 24 h-incubation period, cells were still accumulating in the G2/M phase. The duration of this G2/M block seemed to be concentration dependent: 24 h after 24 h incubation with 1.8 nM ET-743, the percentage of cells in G2/M phase was further increasing, while for a lower concentration of ET-743 (0.8 nM), the same effect as in ECV304 was observed (data not shown). As shown in Figure 6In Figure 5in vitro. Treatment with ET-743 during 24 h before radiation resulted in a moderate increase in radiosensitivity in three out of four cell lines. In ECV304, H292 and CAL-27, a significant decrease in ID50 was observed. The decrease in ID50 or the increase in DEF clearly correlated with the cytotoxic effect of ET-743 alone. Combination index analysis showed moderate synergism in ECV304 for quite toxic concentrations around the IC80. In H292 and for lower concentrations in ECV304, additivity was found. In CAL-27, synergism was already observed with concentrations around the IC50, whereas in A549 cells, treatment with ET-743 did not influence the radiosensitivity of the cell line. Treatment with ET-743 during 24 h after radiation instead of before did not result in any radiosensitisation.In the current study, we investigated the interaction between ET-743 and radiation and the effects of ET-743 on the cell cycle, It has long been known that radiosensitivity changes with the progression of cells through the cell cycle; while the S phase is most radioresistant, the G2/M phase is usually considered to be most radiosensitive . SynchroThe influence of ET-743 on the cell cycle was investigated in ECV304, H292 and A549 cells. In all the three cell lines, a concentration-dependent G2/M block was observed after 24 h incubation with ET-743, which confirmed earlier results approximate to peak plasma concentrations observed with 24 h infusion of ET-743 in patients (approximately 2.3 nM) (in vivo testing should be considered for further elucidation of the clinical relevance of the combination of ET-743 and radiotherapy.The In conclusion, ET-743 has moderate cell line-dependent radiosensitising properties. Radiosensitisation might be due to a G2/M block, and when this would be an important factor, radiosensitisation might be more pronounced when cells are irradiated 4–24 h after incubation with ET-743, or when the incubation period is prolonged to 48 h. However, further investigation is necessary to confirm the role of the cell cycle effects caused by ET-743 in the observed radiosensitisation. |
Plasmodium falciparum mouse model an analysis of innate defences responsible for the substantial control of P. falciparum which remains in such mice, was performed.Mice with genetic deficiencies in adaptive immunity are used for the grafting of human cells or pathogens, to study human diseases, however, the innate immune responses to xenografts in these mice has received little attention. Using the NOD/SCID P. falciparum. The systematic and kinetic analysis of the remaining innate immune responses included the number and phenotype of peripheral blood leukocytes as well as inflammatory cytokines/chemokines released in periphery. The innate responses towards the murine parasite Plasmodium yoelii were used as a control.NOD/SCID mice undergoing an immunomodulatory protocol that includes, clodronate-loaded liposomes to deplete macrophages and an anti-polymorphonuclear leukocytes antibody, were grafted with human red blood cells and P. falciparum induces a strong inflammation characterized by an increase in circulating leukocytes and the release of inflammatory cytokines; 2) in contrast, the rodent parasite P. yoelii, induces a far more moderate inflammation; 3) human red blood cells and the anti-inflammatory agents employed induce low-grade inflammation; and 4) macrophages seem to bear the most critical function in controlling P. falciparum survival in those mice, whereas polymorphonuclear and NK cells have only a minor role.Results show that 1) Despite the use of an immunomodulatory treatment, immunodeficient NOD/SCID mice are still able to mount substantial innate responses that seem to be correlated with parasite clearance. Those results bring new insights on the ability of innate immunity from immunodeficient mice to control xenografts of cells of human origin and human pathogens. Defences against foreign cells, including pathogens, rely on both innate or non-adaptive responses, and adaptive or antigen-specific immune responses. However, modern immunology has focused primarily or almost exclusively on the latter.i.e. T and B lymphocytes) have been selected, which have been used for the grafting of xenogenic cells, particularly those of a human origin. Indeed, the vast majority of these studies have focused on the grafting of human lymphocytes, haematopoietic stem cells and to a lesser extent tumor cells [Therefore, various strains of mice having a genetic deficiency in cells responsible for adaptive immunity injected intra-peritoneally in SCID mice could cross the peritoneum and colonize the peripheral blood was an iPlasmodium falciparum was injected into SCID mice, the parasites became pycnotic within hours in erythrocytes. After excluding a potential toxicity of mouse serum by in vitro methods, [P. falciparum parasitaemia in some of the NOD/SCID mice [However, when methods, , it was methods, ,5. FurthCID mice . Blood donors had no history of malaria and all the blood groups were used without observing any difference on parasite survival. Whole blood was washed three times by centrifugation at 900 ×g, 5 minutes at room temperature and buffy coat was separated in order to eliminate white blood cells and platelets. Packed HuRBC were suspended in SAGM and kept at 4°C for a maximum of 2 weeks. Before use HuRBC were washed three times in RPMI-1640 medium supplemented with 1 mg hypoxanthine per liter and warmed 10 minutes at 37°C.P. falciparum 3D7 clone was employed in this study. This parasite strain was maintained in vitro at 5% haematocrit in complete culture medium at 37°C in a candle jar. This medium contained RPMI-1640 medium (Gibco/BRL), 35 mM HEPES (Sigma), 24 mM NaHCO3, 0.5% albumax (Gibco/BRL) and 1 mg of hypoxanthine (Sigma) per liter. Cryopreserved parasites were thawed using the glycerol/sorbitol method [The l method and usedPlasmodium yoelii XNL1.1 was preserved in 500 μl aliquot of cryo-preserving buffer at -80°C at 22% parasitaemia. The strain was thawed at room temperature, diluted twice in RPMI-1640 medium followed by the injection of 50 × 106 parasite directly into the mice.A non-lethal rodent parasite strain Numerous attempts were made to increase the success rate of the grafting of infected RBC. Clo-lip (provided by N. Van Rooijen) was injected through intraperitoneal (i.p.) route in order to reduce the number of tissue MP, as described previously . The antP. falciparum at a parasitaemia of 1% mixed with a dose of 10 mg/kg of NIMP-R14 antibody. Afterwards, a dose of 10 mg/kg of antibody NIMP-R14, 0.2 ml of clo-lip and 0.5 ml of HuRBC was injected i.p. at 3 days interval, until the end of the study. The follow-up of the infection was performed by daily Giemsa stained thin blood films drawn from the tail vein.In the current study, a previously described immunomodulation protocol was employed , modifie+, CD115+), inflammatory monocytes , PMN , and natural killer cells . Total leukocyte number (leukocytes/μl blood) was evaluated by lysing 20 μl of total blood with BD FACS™ Lysing solution, and counting on Malassez haematocytometer. Since successfully grafted mice have a significant, but variable, percentage of HuRBC in their peripheral blood, parasitaemia in mice was expressed as the overall percentage of P. falciparum infected RBC among total RBC, i.e. both human and mouse RBC observed in thin blood smears. In addition, the peritoneal blood parasitaemia was measured in the smears drawn from the peritoneum. The percentage of HuRBC in the peripheral blood of mice was determined by an immunofluorescence technique using a FITC labeled anti-human glycophorin A monoclonal antibody .The study blood samples were collected from mice retro-orbital sinus on heparin. Various haematological parameters such as haematocrit, leukocyte number and phenotype , CD115 PE, CD43 FITC, CD62L FITC, CD11b FITC, DX5 FITC, CD122 PE in peripheral blood samples were monitored, as well as the phenotype characterization of monocytes were quantified using the BD™ Cytometric Bead Array mouse inflammatory kit following the manufacturer's recommendations.The paired test was used for statistical analysis. P values of less than 0.05 were considered significant. In the results section only differences reaching significance are mentioned.P. falciparum, 17% of mice remained parasitologically negative, 34% showed a transient parasitaemia lasting for ca. 12 days post-infection, 12% showed a stable parasitaemia for more than 20 days and 37% showed an almost total parasite clearance from peripheral blood, however followed by a re-emergence a few days later, without new parasite inoculation, i.e. a second wave of parasitaemia lasting for the life-span of the animal. The sequence of events of the latter pattern considered the most informative, was selected for further analysis.Although stable long-lasting parasitaemia could be obtained and employed for various applications ,11 the pi.e. infected and uninfected HuRBC, clo-lip and NIMP-R14, including modifications proposed by others [Various modifications to the standard protocol were assessed, and resulted only in differences in the proportion of mice presenting the four patterns of parasitaemia described above. These modifications include: 1) variations in the dose and schedule of administration of the different components (y others ); 2) useThese results raise the question of which factor(s) are critical to control in order to obtain a stable parasitaemia and prompted the launch of a detailed analysis of the remaining innate immune defences, mainly MP and PMN.In mice showing a recrudescence and to a lesser extent PMN (the Gr-1 antigen is not expressed on NOD/SCID MO surface). In addition, the parasite induces a major recruitment of leukocytes in the peritoneal cavity as compared to controls receiving uninfected HuRBC (1690 ± 1080 MO/μl on day 7 post-infection ) Figure . Moreove) Figure in bloodC Figure .vs 33 ± 6.5 pg/ml on day -1 before infection), IFNγ (290 ± 215 pg/ml on day 7 vs 5 ± 2.2 pg/ml on day -1) and TNFα (155 ± 53 pg/ml on day 7 vs 53 ± 26 pg/ml on day -1) or chemokine such as MCP-1 (from 355 ± 290 pg/ml on day -1 to 960 ± 480 pg/ml on day 7 post-infection) (P < 0.009).The peak of blood MO was associated with a peak of secretion of several inflammatory cytokines such as IL-12p70 but its basal level was already elevated (80 pg/ml) .) Figure . The oth) Figure . Moreovem Figure , but onlm Figure . In the vs 47 ± 14.7 pg/ml; P < 0.003) and TNFα the number and phenotype of blood leukocytes, and 2) cytokines serum levels, were examined. The inflammatory effect of HuRBC was not unexpected, as it represents a heterologous graft. The i.p. injection of HuRBC induced an increase in leukocyte numbers Figure P < 0.0. HuRBC g Figures and 4E, - CD62L+ Ly-6C+) that lasted for more than three days Figure (P < 0.0vs 30 ± 7 pg/ml at 3 hours post-injection) and of MCP-1 (2425 ± 760 pg/ml at 3 hours post-injection) Figure and 4D, ) Figure , MCP-1 (322 ± 31 vs 580 ± 58 pg/ml), and TNF(40 ± 12 vs 72 ± 12 pg/ml) (P < 0.03). The number of leukocytes and the percentage of CD43- CD62L+ Ly-6C+ MO also decreased over time .An attempt was made to identify the cell subset most critical in controlling P. falciparum is predominantly due to an important increase in PMN numbers, leading to legitimately suspect their involvement. To explore the role of PMN, three different monoclonal antibodies were employed, that differ in their efficiency to deplete PMN, namely 1A8, RB6-8C5 and NIMP-R14 antibodies. 1A8 antibody led to a major depletion of PMN for a period of ten days after infection, whereas the other two had only a moderate effect. Despite these differences, the resulting parasitaemia were essentially similar, which does not designate PMN as a main effector against infected HuRBC . Therefore, it was decided to focus further work on the analysis of murine innate immune defences induced by this very pro-inflammatory parasite in order to gather an understanding, i.e. to attempt to identify the critical defence component(s) limiting successful grafting.Results confirm that innate defences are potent against xenografts and pathogens in mice lacking T, B and NK cell functions, and provide an insight of their effect against ndidates ,7,11 or ndidates with any isolate . The repP. falciparum induces a major inflammation characterized by an increase in peripheral leukocytes and by the release of inflammatory cytokines in the serum; 2) parasitaemia in the peritoneum remains stable whereas the decrease observed in the peripheral blood is related to HuRBC clearance in this compartment, triggered by the parasite; 3) P. yoelii, induces a very moderate inflammation as compared to P. falciparum, suggesting that a parasite adapted to its host does not trigger the same inflammatory response ; 4) clo-lip, NIMP-R14 and HuRBC also induce an inflammation, but far less important than that triggered by the parasite itself, and the former is anyhow essential to parasite grafting; 5) none of the additional immunosuppressive, anti-inflammatory, anti-oxidant and nutritive factors assessed in empirical manner was able to significantly, or reproducibly, improve P. falciparum survival; and 6) MP seem to bear the most critical function in controlling P. falciparum in these mice.The present study shows that 1) -/- mice, which present substantial additional defects in innate immunity still require the use of pharmacological agents or irradiation/splenectomy to allow for the grafting of cells of human origin [The innate immune defences that remain in immunocompromized mice have seldom been analysed. Surprisingly, only one study has so far focused on this issue. It reported the occurrence of a major inflammation in relation to human leukocytes grafting in SCID mouse peritoneum . It consn origin ,17.P. falciparum. A first limitation of this model is the lack of understanding of the transperitoneal passage of both uninfected and infected HuRBC in mouse peripheral blood, and its lack of reproducibility (17% of mice were negative). The i.p. route of administration of HuRBC was chosen as it was previously found effective using bovine RBC [The present study model includes a "double xenograft", of HuRBC and of vine RBC , as it cvine RBC . Howevervine RBC ,20, the vine RBC to improvine RBC . Splenecvine RBC ,23. ThirP. falciparum survival, stressing also in this model the importance of MP.Together these data suggest a prominent role of MP in the rejection of both uninfected and infected HuRBC by two main mechanisms: the release of inflammatory mediators reflecting the activation of MO and the resulting increased erythrophagocytosis. The role of MP in xenograft rejection is well documented . For insP. falciparum infected HuRBC by MP is well documented, and the scavenger receptor CD36, which recognizes PfEMP-1 on the surface of infected RBC, is widely implicated in this process. Indeed, P. falciparum phagocytosis decreases by 80% using blocking antibodies or CD36-/- murine MP [P. falciparum GPI anchors, that are considered as key malaria pathogenicity factors [P. falciparum infection [in vivo administration [i.e. pro-inflammation followed by a relative anergy, may explain this apparent contradiction. Whatever the complexity of the inflammatory response induced by the parasite, it probably explains the present observation, also made by another group, that the injection of infected HuRBC induces a decrease of the number of circulating HuRBC, either infected or not. The results of the present study suggest that, whereas uninfected HuRBC induce a moderate inflammation, the parasite is a far more potent pro-inflammatory component leading to a significant phagocytosis of HuRBC (both infected and uninfected).The mechanism of HuRBC phagocytosis by murine MP is yet to be elucidated. It can not be due to complement or by Fc receptors-mediated opsonization, as NOD/SCID mice have neither complement activity nor antiurine MP ,36. MP a factors ,38. TLR- factors whereas factors -42, but nfection . The effnfection -46, but stration -49. SuccP. falciparum activation of innate defences in humans. Recent studies performed in P. falciparum infected and exposed individuals have shown a strong pro-inflammatory effect with an overall increase in intermediate and inflammatory MO expressing CD16+, mIFNγ and 2- to 10-fold increase in serum mediators, such as IL-6, IL-10, IFNγ, TNF and MCP-1 [P. yoelii induces much less inflammation than the human parasite in mice challenges the general assumption that the evolution-driven adaptation of Plasmodium to their respective hosts depends mainly on the adaptive immune system, and indicates that the role of non-adaptive immunity should be taken in consideration. The fine molecular tuning of parasite molecules required for the adaptation through the co-evolution of the parasite with their usual host has most likely taken place for molecules interacting with the adaptive immune system ("antigens") and for molecules interacting with the innate defences. The numerous differences between P. yoelii and P. falciparum observed in our study bring support to this hypothesis.The remarkable efficiency of the innate immune system to control plasmodium infection is in keeping with observations in humans: indeed, the parasitaemia recorded in a primary malaria attack, in non-immune travellers, is usually quite modest, 0.1% on average , whereas the theoretical 16×/48 h multiplication rate would lead to heavy parasitaemia in the absence of strong innate defences. Results in NOD/SCID show similarities and differences with nd MCP-1 . Howevernd MCP-1 . These tP. falciparum-SCID mice constitute a convenient model as the effect of innate defences is readily visible within hours, in contrast with other types of grafts (e.g. lymphocytes). However, innate immunity proved as efficient as it is difficult to control. Three strategies have been used for this purpose. Firstly, splenectomy improved P. falciparum survival in NOD/SCID mice [P. falciparum erythrocytic stages as well as human hepatocytes and P. falciparum liver stages in uPA-SCID [- CD62L+ Ly-6C+ MO subset and an increase of IL-6 and MCP-1. These results suggest that conclusions from studies using clo-lip in mice should be interpreted with care. A third, and likely more satisfactory, strategy relies on the generation of mice with improved genetic deficiency of innate immunity. In this respect, the NOD/SCID/IL2rγ-/- (NOG) mice open new perspectives [+ haematopoietic stem cells did not sustain the development of human B cells, and most T cells could neither proliferate nor produce IL-2 in response to antigenic stimulation [More generally, the results of the present study stress that a deficiency in adaptive immunity is far from being enough to ensure the success of xenografts. It is also essential to control innate defences (which can not be knocked out safely). In this respect, CID mice . SecondlCID mice , despiteuPA-SCID . Yet, a pectives , but simpectives , and, NOmulation . These rP. falciparum. Moreover, the immunomodulatory treatment itself induced inflammatory responses. These results indicate that the use of SCID mice to study human disease need to be carefully interpreted and that further improvements are required to obtain a mouse model fully receptive to grafts of foreign origin.Taken together data presented in this study show that immunocompromized mice such as NOD/SCID mice in which the number of MP and PMN are controlled to a certain extent by repeated injection of clo-lip and NIMP-R14 antibody respectively, are still able to mount substantial innate defences against xenografts, notably HuRBC and HuRBC: Human red blood cells; MP: macrophage; MO: monocyte; PMN: polymorphonuclear; clo-lip: clodronate-loaded liposomes.The authors declare that they have no competing interests.P. falciparum survival. NVR supplied the clo-lip to the lab. JLP was involved in revising the manuscript. PD revised the manuscript and was responsible for overall strategy. All authors read and approved the final manuscript.LA planned and carried out the research, performed experiments and analysed the results, drafted and revised the manuscript. RKT performed experiments and helped to write the manuscript. PM has performed experiments concerning the use of different reagents to improve Comparison of the effects of three anti-PMN monoclonal antibodies. (A) Peripheral blood parasitaemia in 3 different NOD/SCID mice treated either with NIMP-R14 , RB6-8C5 (open circle) or 1A8 (black square) monoclonal antibody at 10 mg/kg. Black arrows represent injection of HuRBC + clo-clip and one of the three anti-PMN antibodies. (B) Peritoneal blood parasitaemia obtained in the NOD/SCID mice treated with different anti-PMN. (C) Percentages of CD11b+ Ly-6G+ PMN in mouse peripheral blood following repeated administration of the anti-PMN monoclonal antibodies.Click here for file |
Roquinimex (Roq) is an immunomodulator known to stimulate cellular immune responses. It is currently used for immunotherapy after bone marrow transplantation (BMT). One of the major features of this compound is an enhancement of natural killer (NK) cell activity and numbers. We studied the in vitro effect of Roq on human peripheral blood NK and adherent lymphokine-activated killer cell (ALAK) activities. In cultures supplemented with recombinant interleukin 2 (rIL-2) (1000 U ml-1) and Roq a significant increase in NK and LAK function was observed without a parallel increase in cell numbers. We also examined the generation of NK cells from human bone marrow (BM) immature progenitors, obtained by purging with 4-hydroperoxycyclophosphamide (4HC). NK cell numbers and activity were both increased when cultures with rIL-2 (10 U ml-1) were supplemented with Roq. These results confirm findings obtained in vivo and in vitro in the murine system and suggest that Roq is an active agent on these lymphoid populations. These properties and good tolerability make Roq an attractive tool for immunotherapy. |
To investigate the susceptibility of retinal pigment epithelium (RPE) from αA (-/-) and αB (-/-) mice to oxidative stress, and the subcellular changes of αA and αB-crystallins under oxidative stress.2O2) on apoptosis in RPE from αA (-/-), αB (-/-), and wild type (wt) mice was assessed by TUNEL and AnnexinV/Propidium Iodide assays. H2O2-induced changes in caspase-3 activity and mitochondrial permeability transition (MPT) were determined. Human RPE in early passages (2-4) were starved in 1% FBS-containing Dulbecco's modified Eagle medium (DMEM) and treated with H2O2 for 24 h. Gene expression was quantitated by real time PCR. Confocal microscopy was used to examine α-crystallin compartmentalization. Whole cell and mitochondrial α-crystallin protein amounts were examined by transmission electron microscopy (TEM) and Western blot analysis.The effect of hydrogen peroxide , αB (-/-) mice exhibited increased susceptibility to apoptosis induced by HLack of α-crystallins renders RPE cells more susceptible to apoptosis from oxidative stress. Mitochondrial α-crystallins may play an important role in the protection from increased susceptibility of RPE in oxidative stress. While oAn analysis of the expression of crystallins in the mouse retina showed that αA, αB, β, and γ-crystallins were found in the inner and outer nuclear layers and the retinal pigment epithelium (RPE) . In anotGeneration of mice lacking αA (αA(-/-)) and αB (αB(-/-))-crystallin has provided valuable insights into the functional roles of these proteins in the lens. Lenses of αA-crystallin deficient mice appeared structurally normal, but developed opacification quickly with age . The preIn an attempt to better understand the role of drusen in age-related macular degeneration (AMD), Crabb et al. performed a proteomic analysis of drusen preparations from AMD and non-AMD donor eyes . They foThe compartmental localization of α-crystallins in ocular tissues and its significance are topics of great interest. α-Crystallins are predominantly cytosolic proteins but nuclear localization of αB-crystallins has been reported ,25. DereIn the present study we have investigated the effect of the absence of α-crystallins on the susceptibility of RPE cells to apoptotic stimuli. The influence of oxidative stress on the expression and subcellular distribution of α-crystallins in human RPE is also examined.Hydrogen peroxide was obtained from Sigma Aldrich . The 129S6/SvEvTac control mice were purchased from Taconic Farms , while the αA and αB-crystallin knockout mice in 129S6/SvEvTac background were obtained from the National Eye Institute . Human R2O2 (100 μM -200 μM) for 24 h. RPE cell cultures were characterized by immunoreactivity for cytokeratin and RPE65, established markers of RPE.All animal studies were conducted with adherence to the ARVO animal statement. The cornea, lens, vitreous, and retina were removed from eyes soaked in phosphate buffered saline (PBS) containing 5% penicillin/streptomycin (Sigma). The choroid/sclera tissue was then placed into a 2% dispase solution in PBS for 20 min at 37 °C. After the incubation, the tissue was rapidly pipetted up and down for 30 s. The dispase solution containing the RPE cells was passed through a 70 μ filter followed by a 40 μ filter after which the cells were spun down and resuspended in Ham's F-12 Media containing at least 25% fetal bovine serum . The RPE were then grown on laminin coated plates , and primary passages of wild type RPE controls, αA(-/-), and αB(-/-) mice were then incubated in medium containing 1% FBS overnight prior to treatment with H2O2 for 24 h. Initial studies on time course of H2O2 treatment established 24 h as an optimal time point for all studies. Experiments in 1% serum were repeated in serum-free media, and subsequent results revealed similar trends. Cell viability following H2O2 treatment protocol in our experiments was verified by Trypan Blue (Cellgro), and Annexin V staining .Studies using cultured human RPE were approved by the Institutional Review Board of the University of Southern California and adhere to the Declaration of Helsinki. Primary RPE cells were cultured in DMEM with 2 mM L-glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin (Sigma), and 10% heat-inactivated FBS as previously described . Third tTo determine whether knockout of α-crystallin gene expression in mouse RPE cells would cause an increase in apoptosis, DNA cleavage of αA and αB-crystallin knockout mice and wild type control cells were measured by TdT-mediated dUTP nick-end labeling . After treatment, floating and adherent cells were collected and pooled together. The cells were then fixed with 4% paraformaldehyde in PBS (pH 7.4) followed by permeabilization with 0.1% Triton X-100 in 0.1% sodium citrate. To label DNA strand breaks, cells were incubated with 50 μl TUNEL reaction mixture containing TdT and fluorescein-dUTP in the binding buffer and incubated for 90 min at 37 °C in a humidified chamber. Cells were then washed and analyzed by flow cytometry. Further differentiation between apoptotic versus necrotic mechanisms of cell death was achieved by Annexin V and propidium iodide (PI) staining of RPE isolated from wild type and α-crystallin knockout mice at the various doses of oxidative stress. Cells were analyzed using flow cytometry. Cells positive for Annexin V staining, but not PI were gated as early apoptotic cells. AnnexinV/PI double positive cells indicated either late stage apoptosis or necrosis.TM FITC-VAD-FMK In Situ Marker , a FITC-conjugated caspase inhibitor. Cells were collected and incubated with FITC-VAD-FMK for 60 min, then measured by flow cytometry using the FL-1 setting. Ten thousand events were recorded in each analysis.Caspase-3 activation was determined using a CaspACEThe loss of mitochondrial membrane potential by apoptosis is marked by increased mitochondrial permeability transition (MPT) thought to occur through the formation of pores in the mitochondria by dimerizing apoptotic proteins. During this process, the electrochemical gradient across the mitochondrial membrane collapses. To assess the mitochondrial membrane potential, a cell permeable cationic dye is added to the cells for 30 min at culture conditions and then analyzed by flow cytometry using FL-3 setting. Ten thousand events were recorded in each analysis. Healthy cells retain the reagent, while apoptotic cells exhibit a lower fluorescence signal due to less accumulation of the dye.2, 10X buffer, dNTP, primers (see below), and Taq polymerase . After 30 cycles, samples were run on an agarose gel with ethidium bromide. Quantitative expression of α-crystallin was examined using real-time PCR . Trizol was used to extract and isolate RNA, while contaminating genomic DNA was removed with a DNAase kit . One μg of total RNA, measured by a spectrophotometer, was added to oligo(dT)15 primer and AMV reverse transcriptase (Promega) for the reverse transcriptase reaction. After a 1:10 dilution of the cDNA, 2 μl of the cDNA was added to 2 μl of green fluorescent dye with Taq DNA polymerase in a 20 μl PCR mix . Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as an internal control. Human primers were designed using Primer Express software and were only selected if the pair spanned across exons to minimize non-specific products and purchased from Qiagen : αA 5'-GAG ATC CAC GGA AAG CAC AAC-3' (nucleotide position 52-72) and 5'- GGT AGC GGC GGT GGA ACT-3' (107-127); αB 5'-TCC CCA GAG GAA CTC AAA GTT AAG-3' (278-301) and 5'-GGC GCT CTT CAT GTT TCC A-3' (327-347); GAPDH 5'-CCA CAT CGC TCA GAC ACC AT-3' (85-104) and 5'-GGC AAC AAT ATC CAC TTT ACC AGA GT-3' (150-169).Initial relative gene expression levels of αA and αB-crystallin was examined by semi-quantitative reverse transcriptase polymerase chain reaction (RT-PCR). cDNA from harvested RNA was transcribed using oligo(dT) and 5 μg of total RNA. 1 μl of cDNA was added to a master mix of MgClT) was determined. Relative change in mRNA expression was calculated to obtain the ΔΔCT values. Four separate sets of RNA were isolated and examined, and each set was tested in duplicate. Levels were normalized relative to GAPDH mRNA and reported as fold change over controls.Product formation detection was set in the center of the linear portion of PCR amplification, and the cycle at which each reaction reached the set threshold , along with a 1:100 dilution of proteinase inhibitor mix (Sigma), was added to each pellet. After incubation for 1 h at 4 °C, cell debris was pelleted at 14,000xg for 10 min. The remaining supernatant, containing the soluble cell proteins, was measured for protein concentration, using bovine serum albumin as a standard.To separate mitochondrial proteins from cytosolic proteins, mitochondria were first isolated using a Mitochondria/Cytosol Fractionation Kit . To check the efficiency of homogenization, suspensions were observed under a microscope. A shiny ring around the cell indicated intact cells, and 35 strokes with a dounce homogenizer lysed 90% of the cells. The lysate was first spun for 10 min at 700xg to remove cellular debris and then at 10,000xg for 30 min to pellet the mitochondria. The resulting supernatant was saved as the cytosol portion while the pellet, containing whole mitochondria, was lysed with a mitochondria-specific buffer supplied with the kit. The purity of the fractions was checked by Western blot analysis with a polyclonal antibody against prohibitin, a mitochondrial marker and GW182, a cytoplasmic resident protein . Nuclear fractions were isolated using a Nuclear/Cytosol Fractionation Kit (BioVision Inc.). Harvested samples were examined by Western blot analysis.Protein expression was examined using Western blot techniques. Concentration of harvested proteins was examined by the Bradford-Lowry assay. Equal amounts of protein lysate (15-50 μg) were resolved on 12.5-15% Tris-HCl polyacrylamide gels at 120 V and then transferred to a PVDF blotting membrane . Each membrane was blocked with 5% blotting grade non-fat dry milk (Biorad), incubated with rabbit anti-αA crystallin or anti-αB crystallin antibody . Specificity of antibodies was confirmed by testing in knockout mice; αA showed no immunoreactive band in αA(-/-) and αB showed no immunoreactive band in αB(-/-) retina. After incubation with the secondary antibody , protein bands were detected by chemiluminescence . To verify equal loading of proteins, gels were stained with Coomassie stain or PVDF membranes were stripped with Tris-buffered saline with 0.1% Tween for 30 min at 60 °C and then incubated with GAPDH antibody (Ambion).RPE cells, grown to >90% confluency on chamber slides and exposed to oxidative stress, were examined for α-crystallin expression and for mitochondrial localization. To visualize the mitochondria, mitochondria tracker was added to samples for 30 min, prior to fixation with 4% paraformaldehyde. GM130 antibody was used to label the Golgi body. Cells were then permeabilized with 0.1% Triton-X100 for 15 min, and then blocked with 5% blotting grade non-fat dry milk (Bio-Rad) in Tris buffered saline plus 0.1% Tween for 15 min. A 1:100 dilution of αA or αB crystallin antibody was incubated overnight at 4 °C prior to addition of Cy5-conjugated goat anti-rabbit secondary antibody for 30 min the following day. Slides were examined using a Zeiss LSM510 confocal microscope.Trypsinized cells were pelleted and fixed in 2% paraformaldehyde and 0.1% glutaraldehyde in phosphate buffer (pH 7.4) for 1 h at room temperature. The fixed pellets were dehydrated through an ethanol (EtOH) dilution series up to 100% EtOH, infiltrated in an 1:1 EtOH / LR White mixture overnight, embedded in 100% LR White acrylic resin in beam capsules, and incubated overnight at 60 °C. The blocks were then ultra thin sectioned (75 nm in thickness) and placed on parlodian coated nickel grids. Sections on grids were etched with 0.5% sodium metaperiodate 10 min at room temperature to remove excess resin, and then washed 5 times for 10 min each by drops of 0.025 M Tris buffer (pH 7.4). Sections were placed in a blocking solution of 5% BSA in 0.025 M Tris buffer for 15 min at room temp. After addition of the primary antibody diluted with 5% BSA and 0.025 M Tris for 2 h at 37 °C, the grids were then incubated in secondary antibody conjugated to 10 nm gold (Ted Pella Inc.) in 0.025 M Tris buffer at 37 °C for 45 min and counterstained with saturated uranyl acetate and lead citrate. Analysis was performed on a Zeiss EM 10 electron microscope (Zeiss).Statistical analyses were performed using SAS Proc GLM procedure . Different statistical strategies of multiple comparisons were used to test the differences among experimental groups. Specifically, multiple comparisons were performed on TUNEL data with Bonferroni correction and AnnexinV/PI cell death data with Tukey tests. All other data were analyzed using Dunnett's tests. Accepted level of significance for all tests was p<0.05.2O2 for 24 h. Live and dead cells were harvested and stained by TUNEL and then analyzed for TUNEL positivity by flow cytometry (2O2) compared to wild type cells (2O2 treatment in αA and αB knockout RPE (19% and 15%) was significantly higher than the wild type control RPE (p<0.05). Percentage of apoptotic cells showed a further increase to 42.5% and 32% in αA and αB knockout RPE with 200 μM H2O2, which was again significantly higher (p<0.05) than the corresponding controls. Cell death was also analyzed by Annexin V and PI assays. Results confirmed that cell death from H2O2 treatment in α-crystallin knockout RPE was predominantly by apoptosis (2O2), >85% of the dead cell population was AnnexinV+/PI- indicating an apoptotic mechanism of cell death; <15% of cells were positive for both Annexin V and PI indicating either necrosis or later stage apoptosis. Similar to TUNEL data, αA(-/-) and αB(-/-) RPE showed a greater susceptibility to dose-dependent cell death , and values of knockout cells were significantly higher in comparison to wild type controls (p<0.05).RPE cells isolated from αA(-/-), αB(-/-), and wild-type mice were treated with 100 μM or 200 μM Hytometry . αA(-/-)poptosis . In the 2O2 in αA-crystallin(-/-) RPE by flow cytometry is shown in 2O2 treatment only modestly increased the number of active caspase-3 positive cells in wild type RPE from 1.4% to 8.1% (p<0.05) while dramatically increasing the number of active caspase-3 positive cells in αA-crystallin(-/-) RPE from 2.1-34.8% (p<0.01 versus untreated and wild type controls). MPT studies also revealed an increased change in membrane potential in H2O2-treated αA(-/-) RPE compared to wild type cells (B). In wild type RPE, the MPT values by flow cytometry revealed no statistically significant changes with and without H2O2 treatment. In αA(-/-) RPE, treatment with 100 μM H2O2 resulted in a 64.2% decrease in fluorescence from untreated controls (p<0.01). Insufficient numbers of cells were available to perform parallel multiple experiments in αB(-/-) RPE; however, in one complete experiment (results not shown), we were able to demonstrate that H2O2-treated αB(-/-) RPE showed a similar response as αA(-/-) with increased caspase-3 activation and MPT. In support of our study, Kamradt et al. [Evidence for the increased activation of caspase-3 with Ht et al. reported2O2 on αA and αB-crystallin gene expression was examined by using quantitative real time RT-PCR. αA mRNA increased with 25 μM H2O2 and remained elevated with an increase in H2O2 dose until 350 μM returns to control levels at 150 μM H2O2, and decreases nearly 50% from control levels at 350 μM H2O2 (p<0.05) . There w(p<0.05) . Isotype2O2 on cytosolic and mitochondrial α-crystallin levels. Prior to analysis, mitochondrial and cytosolic fractions were checked for purity by two specific markers: prohibitin for mitochondria and GW182 for cytosol and 150 μM H2O2 (0.64) treatment to number of gold particles in the untreated controls was found for αA-crystallin. αB-Crystallin immunogold labeling increased by a 55% with 25 μM H2O2 (1.84) and returned to control levels with 150 μM H2O2 (1.09). The content of α-crystallins within mitochondria was then further quantitated. 2O2 treatment; however, only αB values had statistical significance compared to untreated controls (2 of area per cell) was quantitated for each condition.Immunogold-transmission electron microscopy served as an additional method to assess overall subcellular distribution and quantitation of α-crystallins in the RPE. Expression of αA and αB-crystallin was then quantitated by counting the number of 10 nm gold particles per 25 μmcontrols . Due to 2O2 exposure, and the extent of sensitivity to αA and αB-crystallin knockouts is similar despite marked differences in their cellular levels; (2) RPE from αA-crystallin knockout mice show increased caspase-3 activation and mitochondrial membrane permeability transition ; (3) αB-crystallin expression and distribution in human RPE changes with oxidative stress while that of αA was unchanged; (4) gene expression of αB-crystallin followed the same trend as that of protein while αA-crystallin mRNA showed an increase in expression; and (5) oxidative stress results in decreased αB-crystallin in mitochondria while αA-crystallin remains unaltered. These results reveal that both αA and αB-crystallins are critical for protection from oxidative insult but the mechanisms of action may vary between the two.Our studies have demonstrated the following: (1) RPE from α-crystallin knockout mice show increased apoptotic sensitivity in response to oxidative stress from HSmall heat shock protein dysfunction is implicated in many diseases such as cataracts, myopathies, and a number of neuropathologies . In the The magnitude and mechanisms of cellular protection from αA and αB-crystallins remain a subject of debate and has for the most part been studied in lens cells. Studies by Andley et al. (2000) suggest R120G mice. These authors further found that mitochondrial dysfunction is one of the earliest detectable events in the development of R120G-mediated cardiac myopathy. Furthermore, Kadono et al. [α-Crystallins are considered to be soluble cytoplasmic proteins but have also been described in association with subcellular organelles. αB-Crystallin was shown to reside in the nucleus and the o et al. found th2O2 treatment increases ROS generation in human RPE [2O2 doses (>300 μM) in human RPE may reflect the consumption of αB-crystallin for scavenging large amounts of ROS generated.The mitochondrion is the main organelle in which oxygen metabolism occurs, and stress from Human RPE . We founuman RPE and αA and αB(-/-) RPE, but it is interesting that the utilization of antiapoptotic mechanistic pathways could vary among the three prominent members of the sHSP family, namely Hsp27, αA and αB-crystallins [Studies on crystallins have focused predominantly in the lens, where both αA and αB-crystallin are expressed in equal amounts and comprise a huge portion of total soluble protein . On the stallins ,43-45.2O2 insult. While BCL-2 family members are thought to be the sentinels of cell death [2O2-treated RPE cells from αA(-/-) show increased caspase-3 activation compared to wildtype RPE. Studies done by others show that αB-crystallin negatively regulates cyt c and caspase-8-independent activation of caspase 3 by inhibiting its autoproteolytic maturation, which may provide further clues [The BCL-2 family contributes to the regulation of the swelling of the mitochondria and the opening of the permeability transition pore. Our studies have revealed that RPE cells from αA(-/-) mice show an increased mitochondrial membrane permeability transition compared to wildtype cells under Hll death , crystaler clues . Further |
Saphenous nerve, a pure sensory nerve, may compromise as a result or complication of a surgical procedure or secondary to trauma or insidiously. We present a male patient with low back pain concomitant with pain in medial portion of left thigh in addition to pain and numbness in medial part of leg and inferior part of patella after a strenuous activity. Preliminary diagnosis suggested that the patient had radiculopathy but electrodiagnostic tests revealed the absence of left saphenous response both in medial leg and infrapatellar region, while normal findings were recorded from right side. Needle electromyography in L4 innervated muscles were normal. The patient had saphenous nerve entrapment in left thigh. Two months later symptoms relieved with conservative therapy. Saphenous nerve is a pure sensory nerve that is made up of fibers from L3 and L4 spinal segments . BecauseThe patient is a 32-year old athlete man who complained of low back pain concomitant with pain in medial portion of left thigh in addition to pain and numbness in medial part of leg and inferior part of patella. After a strenuous activity, he felt pain in low back area and severe local pain in midportion of thigh accompanied by numbness of infrapatellar area and medial part of leg. His low back pain was reduced after consumption of NSAIDs but numbness continued. In physical examination, sensation to light touch and pinprick in infrapatellar and medial part of left leg was impaired. Manual muscle test and muscle stretch reflexes were normal, and the patient had no pain in straight as well as reversed straight leg raise. MRI of lumbosacral region showed bulging of the L4, L5 and S1 discs.With impression of radiculopathy, surgical intervention for discopathy was recommended for the patient. Electrodiagnostic tests performed in standard protocol by firstClinical symptoms and electrodiagnostic findings revealed saphenous nerve entrapment at adductor canal or above this region. Saphenous neuropathy usually presents with pain however,A thorough physical examination is mandatory in patients with low back pain and uncommon neuropathies like saphenous nerve entrapment must be considered.Written informed consent was obtained from the patient for publication of this case report.The authors declare that they have no competing interests.TA and GR contributed in electrodiagnosis testing. All authors contributed in taking patient history. Physical exam and preparation of the paper. All authors read and approved the final manuscript. |
Subsets and Splits