Datasets:

hatakeyama-llm-team

/

PMC

like 0

Follow

Team Hatakeyama 25

A case of lytic lesion of the pelvis in a 23-year-old woman is presented. A biopsy led to the diagnosis aneurysmal bone cyst(ABC). Due to the histologically very aggressive growth of the tumor, a low malignant osteosarcoma could not be excluded.In an initial operation the tumour, affecting the sacrum, the iliac crest and the lower lumbar spine was resected. Temporaryrestabilisation of the pelvic ring was achieved by a titanium plate. The histological examination of the entire tumourconfirmed the diagnosis ABC. After 6 months, the MRI showed no recurrence. The observed tilt of the spine to the operatedside on the sacral base prompted a second surgical procedure: a transpedicular fixation of L5 and L4 was connected via benttitanium stems to the ischium, where the fixation was achieved by two screws. This construction allowed the correction of thebase angle and yielded a stable closure of the pelvic ring. The patient has now been followed for 6 years: the bone grafts havebeen incorporated and, in spite of radiological signs of screw loosening in the ischium, the patient is fully rehabilitated andfree of symptoms. Pedicle screws in the lower spine can be recommended for fixation of a pelvic ring discontinuity.

In the crystal structure, weak inter­molecular C—H⋯O hydrogen bonds link mol­ecules related by translation along the a axis into chains, which are further combined into layers parallel to the bc plane via C—H⋯π inter­actions. The crystal studied was a racemic twin with a 0.37 (19):0.63 (19) domain ratio.In the title mol­ecule, C Å b = 14.128 (6) Å c = 19.371 (8) Å V = 1956.3 (14) Å3 Z = 4 Kα radiationMo −1 μ = 0.45 mmT = 298 (2) K 0.50 × 0.18 × 0.15 mm Bruker SMART CCD area-detector diffractometerSADABS; Sheldrick, 1996T min = 0.806, T max = 0.935Absorption correction: multi-scan (9549 measured reflections3430 independent reflectionsI > 2σ(I)1466 reflections with R int = 0.097 R[F 2 > 2σ(F 2)] = 0.060 wR(F 2) = 0.248 S = 1.01 3430 reflections274 parameters93 restraintsH-atom parameters constrainedmax = 0.22 e Å−3 Δρmin = −0.24 e Å−3 ΔρAbsolute structure: Flack 1983; 1650 FrFlack parameter: 0.37 (19) SMART used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536808038993/cv2468sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536808038993/cv2468Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Substantial decreases in mtDNA variation between time points were observed in populations from just two islands (Marchena and Genovesa). Our results suggests that, for the majority of islands, a single, intense El Niño event did not reduce marine iguana populations to the point where substantial neutral genetic diversity was lost. In the case of Marchena, simultaneous changes to both nuclear and mitochondrial DNA variation may also be the result of a volcanic eruption on the island in 1991. Therefore, studies that seek to evaluate the genetic impact of El Niño must also consider the confounding or potentially synergistic effect of other environmental and biological forces shaping populations.The El Niño-Southern Oscillation (ENSO) is a major source of climatic disturbance, impacting the dynamics of ecosystems worldwide. Recent models predict that human-generated rises in green-house gas levels will cause an increase in the strength and frequency of El Niño warming events in the next several decades, highlighting the need to understand the potential biological consequences of increased ENSO activity. Studies have focused on the ecological and demographic implications of El Niño in a range of organisms, but there have been few systematic attempts to measure the impact of these processes on genetic diversity in populations. Here, we evaluate whether the 1997–1998 El Niño altered the genetic composition of Galápagos marine iguana populations from eleven islands, some of which experienced mortality rates of up to 90% as a result of El Niño warming. Specifically, we measured the temporal variation in microsatellite allele frequencies and mitochondrial DNA diversity (mtDNA) in samples collected before (1991/1993) and after (2004) the El Niño event. Based on microsatellite data, only one island (Marchena) showed signatures of a genetic bottleneck, where the harmonic mean of the effective population size ( The El Niño-Southern Oscillation (ENSO) refers to a complex set of ocean-atmosphere interactions that take place throughout the Pacific basin During periods of acute El Niño warming, there is widespread mortality in aquatic organisms in the eastern Pacific Amblyrhynchus cristatus), a species that is only found in the archipelago. Marine iguanas are known to inhabit the shoreline of all the major islands in Galápagos, where they forage almost exclusively on algae from intertidal and (nearshore) subtidal zones. The digestion of algae is made possible by a community of bacterial micro-symbionts that exist in the hindgut of the iguanas The Galápagos archipelago lies in Sharp population declines, or bottlenecks, like those seen during the recent El Niños, may translate into losses of genetic variation that can lead to increased rates of inbreeding and the fixation of deleterious alleles, and hinder the ability of populations to adapt to future changes in the environment eN) from such data, and methods based on demographic information tend to overestimate eN. Conversely, indirect methods of eN estimation based on genetic data have been shown to be particularly informative, making them an important component in evaluating the consequences of potential bottleneck events such as El Niño Although long-term demographic studies from several islands in Galápagos reveal the drastic effects of El Niño on marine iguana census numbers and reproductive behaviour, it is difficult to estimate the effective population size and at least one generation after (2004) the warming event. In order to corroborate our results, we also analysed the complete mitochondrial control region for the same populations and most individuals for signs of temporal genetic changes. The large number of individuals and genetic loci used in our analysis, combined with the temporal sampling design, makes this one of the most comprehensive studies to date trying to measure the short term genetic effects of a severe El Niño event on natural populations.In this study, we estimated the harmonic mean of Approximately 800 marine iguanas from 11 islands in the Galápagos archipelago were sampled at two different time points before (in 1991/1993) and after (in 2004) the 1997–1998 El Niño event (see eN) by measuring the temporal variance of microsatellite loci allele frequencies between time points using a likelihood-based approach. For the analysis of temporal changes in allele frequencies for eN estimation, the program NeESTIMATOR requires the user to define a reference time point of a population (generation 0) and at least one subsequent generation (in our case generation 1). Island populations sampled in 1991/1993 were entered as generation 0 and those sampled in 2004 as generation 1. Observed changes in allele frequencies and therefore estimates of eN only reflect changes that occurred from the reference point (generation 0 in 1991/1993) to the subsequent point (generation 1 in 2004). Since the TM3 program requires a maximum value for eN, we used the estimates of the maximum census size (cN) of a respective island population eN, as in most published studies, cN exceeds or equals eNeN was then estimated as the maximum likelihood value of 10,000 updates within that range.Thirteen species-specific microsatellite loci were amplified in 806 individuals and scored for alleles as previously described ST differentiation between pre- and post-El Niño samplings was estimated with the program ARLEQUIN version 3.0 Ft-test described by Nei ST values and their significance were calculated between time points for each population using ARLEQUIN version 3.0 H-test η) and θ . From this test, p values were obtained which actually reflect where the observed Hd value falls on the simulated distribution. Although the H-test was originally based on the number of segregating sites in a population (S), DNASP uses η in place of S. We chose to run the additional set of simulations with θ because it should be less sensitive to low frequency migrants, which can greatly elevate the value of η, and give a false signal of lower than expected Hd.Complete mitochondrial CR sequences (1183 base pairs) were generated for 838 marine iguanas . PCR was carried out on total genomic DNA using the primers IguanaCytb3 (5′-ACCAGTAGAACACCCMTTCATC-3′) and 12s1984 ST values calculated between pre- and post-El Niño samples were not significantly different from zero for most comparisons, but was 0.008 and significant (p<0.05) for Marchena (ST differentiation (0.008) was also found between time point samplings on Floreana, but in this case it was not significant at the 5% level.The average heterozygosity of the 13 microsatellite loci calculated for each population and time point ranged from 0.637 for Pinta in 1993 to 0.815 for Fernandina in 2004. Island specific FMarchena . The samp-values in p = 0.032) from 1993 to 2004, while there was a significant increase (p = 0.04) on Santa Cruz from 1991 to 2004.Based on the Wilcoxon signed-ranks test, locus specific heterozygosity was not significantly different (α = 0.05) between pre- and post-El Niño samples from a specific island, with the exception of Marchena and Santa Cruz obtained from microsatellite data using the temporal variance method. eN values for each population represent the harmonic mean of the effective population size over the time interval between pre- and post-El Niño samplings. A low eN value was only found for the population on Marchena, with a eN around 40 individuals and a narrow 95% CI of 21–86 individuals. For the remaining islands, eN estimates ranged from 770 and 783 individuals on the islands of Floreana and Genovesa respectively, to as high as 120,000 individuals on Fernandina. However, with the exception of Marchena, eN estimates from other islands had large CI values that overlapped with the minimum and maximum census size numbers of a specific island population eN estimate of around 40 individuals between 1993 and 2004 experienced by the population on Marchena , and are therefore in line with the FST results from the microsatellite data.Mitochondrial control region (CR) data was generated for nearly the same set of individuals and populations used in the microsatellite analysis see ; Table 2H-test) show that only Hd values for Marchena and Genovesa were significantly lower than expected under neutral evolution in samples from 2004 but not in those from 1991/1993, supporting the occurrence of some severe demographic event between time points (H-test description). Several other populations do show lower than expected levels of haplotype diversity compared to neutral expectations, but only for the first time point or for both time points (Santiago), which does not indicate that a genetic bottleneck occurred between time samplings. Only a single CR haplotype was found in samples collected on Santa Cruz in both 1991 and 2004, and therefore genetic diversity analyses and simulations could not be carried out for this island population.Coalescent simulations of haplotype diversity and at least 30 individuals per population eN beyond that of the simulation.The temporal sampling of genetic data can be a powerful means of estimating eN≤50) during the 1997–1998 warming period, it is very likely that iguanas sampled in 2004 would primarily be individuals born in the first generation after the bottleneck event and would therefore reflect the gene pool of the reduced population. On the other hand, if the population size remained fairly high during the warming period, the gene pool reflected in 2004 would not deviate significantly from its pre-El Niño composition. In the first scenario (eN≤50), given the number and variability of microsatellite loci employed in this study, we would be able to detect a critical reduction of eN with a rather high probability as pointed out above. In the second case, however, we would not expect to see any major changes in allele frequencies between time points, since the population makeup had not been significantly altered.In addition, the temporal variance approach, as well as other tests comparing populations before and after a population reduction , require that a population be sampled before and at least one generation after the potential bottleneck event. In our study, we collected marine iguana specimens from eleven different islands in 1991 or 1993, before the 1997–1998 El Niño, and in 2004, approximately six years after the end of the warming period. Since we sampled mainly adults and sub-adults in 2004, along with some juveniles, it is possible that some of these individuals were born prior to the El Niño period. However, if a given population was reduced to a critically small size populations along the Chilean coast fell by 50% compared with unaffected populations following the 1982–1983 El Niño S. mendiculus), whose populations have been severely diminished by ENSO, have significantly lower observed heterozygosity compared to the common and unaffected Magellanic penguin (Spheniscus magellanicus) from South America, possibly the outcome of a series of strong El Niño events Arhopala epimuta) in Borneo found that El Niño-induced forest fires did not alter the temporal genetic structure of microsatellite loci (5 loci) or mtDNA (control region) in populations that were sampled before and after the 1997–1998 El Niño There have only been a few attempts to measure the impact of severe El Niño events on genetic diversity in natural populations, with mixed results. Randomly amplified polymorphic DNA (RAPD) markers have shown that heterozygosity in intertidal kelp during intense El Niño periods and 2004 , indicatMarchena . Lastly,Marchena .The results of the mtDNA data were similar, where Marchena exhibited the largest decrease in haplotype diversity and nucleotide diversity from 1993 to 2004 ; Table 2The genetic signature of a population decline detected between 1991 and 2004 on Genovesa likely reflects the population crash, from 15,000 to 900 individuals, that was observed during the 1997–1998 El Niño event, and there is no evidence for other incidents which may have drastically effected the demography of this island during this time period [14 and Martin Wikelski pers. comm.]. Conversely, for Marchena, marine iguanas may also have been highly impacted by a strong volcanic eruption in 1991, where lava flows continued for at least 40 days. This eruption is likely to have caused mortality of marine iguanas in both the terrestrial environment per generation. Thus, genetic diversity is lost more rapidly in small populations. Yet, during brief bottleneck events, only a small amount of the total heterozygosity is lost, even after a considerable reduction in population size (e.g. 2% after the first generation of a bottleneck of eN = 50) eN. Therefore, it is not surprising that, with the exception of Marchena, a single, strong El Niño event did not stimulate a loss of heterozygosity in the populations, even if mortality rates were high. The temporal variance approach, on the other hand, relies on shifts in allele frequencies rather than loss of diversity, and has been shown to be particularly sensitive in estimating eN in small populations eN estimates suggest that the effective size of most populations of marine iguanas were so large that they underwent only slight shifts in allele frequencies. Such temporal stability has been observed in a number of other studies Under random mating, heterozygosity is lost from a population at a rate of 1/2eN estimate for Marchena, calculated over an interval in which a severe El Niño event and a volcanic eruption occurred, suggests that it is important to consider the potential synergistic relationship between El Niño and other phenomena. While we saw little evidence of a bottleneck in the majority of our populations, future experimental designs must account for multiple natural and human-induced (e.g. oil spill) disturbances, or else the causes of population reductions may be confounded.Although we did not find a strong influence of El Niño on genetic diversity in marine iguanas, the data show that the genetic impact of a single, intense environmental challenge may vary even within a single species and depends on the specific history of a population. The low eN over many generations eN is heavily influenced by generations in which the effective population size is small. Therefore, the high mortality rates of marine iguanas associated with El Niño warming may compound over multiple ENSO cycles. Since climate models predict that the strength and frequency of El Niño events will continue to increase, a true understanding of the long-term impact of ENSO on population persistence may only come from experiments designed to measure the genetic impact of this phenomenon following a series of consecutive events.Evolutionary theory predicts that the long-term effective size of a population is the harmonic mean of Table S1Sampling localities by island and sample sizes for 13 microsatellite loci and mitochondrial control region sequences (1183 bp) for the two temporal samplings (1991/1993 and 2004). The first column lists sampling localities by island, specific sampling location (in parentheses), and geographical coordinates. Sample sizes for 13 microsatellite loci and mitochondrial control region sequences (1183 bp) are reported in separate columns for the two temporal samplings before the 1997–1998 El Niño and after the 1997–1998 El Niño in the year 2004.(0.04 MB DOC)Click here for additional data file.Table S2Locus specific heterozygosity values for 13 microsatellite loci for pre- and post-El Niño island samplings. Locus specific heterozygosities calculated using the program ARLEQUIN for marine iguana populations sampled before the 1997–1998 El Niño (in 1991 or in 1993 or as for Santa Fé in both years) and after the 1997–1998 El Niño in the year 2004. The first column (locus) shows names of microsatellite loci. The other columns report the heterozygosity for a given population for each time point. Differences in heterozygosity between time points were tested with a Wilcoxon signed ranks test and associated p-values are provided in the last line. Significant p-values (p<0.05) are marked with an asterik (*). The only significant decrease of locus specific heterozygosity from 1993 to 2004 was found for the population on Marchena, whereas Santa Cruz showed a significant increase during this period.(0.11 MB DOC)Click here for additional data file.Table S3List of haplotype diversity (Hd) values and their variance (V) for marine iguana populations. List of haplotype diversity (Hd) values and their variance (V) for marine iguana populations from both time points. T-values and their corresponding probabilities are based on the test adapted by Nei (0.04 MB DOC)Click here for additional data file.Table S4List of nucleotide diversity (π) values and their variance (V) for marine iguana populations. List of nucleotide diversity (π) values and their variance (V) for marine iguana populations from both time points. T-values and their corresponding probabilities are based on the test adapted by Nei (0.04 MB DOC)Click here for additional data file.Figure S1Graphical display of the TM3 results as provided by the program NeESTIMATOR. Graphical display of the TM3 results (estimates of the effective population size (Ne) generated from the temporal variance of allele frequencies using a likelihood-based approach) as provided by the program NeESTIMATOR see . Point e(2.03 MB DOC)Click here for additional data file.

Bacterial translocation from the gut and subsequent immune activation are hallmarks of HIV infection and are thought to determine disease progression. Intestinal barrier integrity is impaired early in acute retroviral infection, but levels of plasma lipopolysaccharide (LPS), a marker of bacterial translocation, increase only later. We examined humanized mice infected with HIV to determine if disruption of the intestinal barrier alone is responsible for elevated levels of LPS and if bacterial translocation increases immune activation. Treating uninfected mice with dextran sodium sulfate (DSS) induced bacterial translocation, but did not result in elevated plasma LPS levels. DSS-induced translocation provoked LPS elevation only when phagocytic cells were depleted with clodronate liposomes (clodrolip). Macrophages of DSS-treated, HIV-negative mice phagocytosed more LPS ex vivo than those of control mice. In HIV-infected mice, however, LPS phagocytosis was insufficient to clear the translocated LPS. These conditions allowed higher levels of plasma LPS and CD8+ cell activation, which were associated with lower CD4+/CD8+ cell ratios and higher viral loads. LPS levels reflect both intestinal barrier and LPS clearance. Macrophages are essential in controlling systemic bacterial translocation, and this function might be hindered in chronic HIV infection. HIV infection leads to continuous destruction of the body's immune defenses. Furthermore, disease progression is linked to heightened levels of immune activation. However, the underlying activating factors and their relationships to HIV pathogenesis are controversial. In patients with chronic HIV infection, bacteria and their products, such as lipopolysaccharide (LPS), translocate from the intestinal lumen into the systemic circulation. In the current study, we investigated the pathogenic potential of bacterial translocation in HIV-infected humanized mice. By modulating the amount of bacterial translocation in the mice, we determined that LPS elevation depends on intestinal barrier dysfunction and defective LPS clearance by macrophages. HIV-infected mice showed inadequate LPS clearance, leading to a cascade of uncontrolled bacterial translocation, T-cell activation, HIV replication, and T-cell loss. Our study highlights how important the interplay between different immune cells is for maintaining a healthy balance between immune activation with the goal to defend the body against microbes and detrimental activation that fuels HIV replication. The clinical course of HIV infection varies considerably among patients, and the variability is even greater in simian models. Asian monkeys infected with simian immunodeficiency virus (SIV) rapidly progress to AIDS, but African monkeys do not get sick However, bacterial translocation manifests itself only later. Low T-cell numbers in the gut are an important characteristic of HIV or SIV pathogenesis −/−gammac−/− mice are transplanted with human cord-blood hematopoietic stem cells. A human lymphoid system develops Seeking evidence for this mechanism, we examined relationships among intestinal barrier integrity, microbial translocation, immune activation, and HIV replication in a mouse-model of HIV infection. In this model, RAG2In the current study, we dissected the effects of bacterial translocation alone or in the context of HIV infection by combining DSS and HIV in humanized mice. We defined the consequences of HIV infection and bacterial translocation on plasma LPS levels, LPS clearance by macrophages, immune activation, and T-cell loss.Lactobacilli, Staphylococcus xylosus, a typical mouse commensal, and Enterococci, whereas stool cultures yielded a multitude of aerobic and anaerobic bacteria. Only some bacterial species translocated to the organs in sufficient numbers to be cultured. HIV+ mice had similar microbiology results to HIV−/DSS+ mice. Overall, the range and amount of translocation were comparable between HIV−/DSS+, HIV+/DSS−, and HIV+/DSS+ mice. HIV infection alone seemed to facilitate bacterial invasion from the gut, and DSS treatment did not further increase the bacterial translocation in HIV+ humanized mice.In a DSS dose-response experiment, we established a treatment protocol that increases bacterial translocation without inducing colitis . BrieflyIn humans bacterial translocation is quantified by measuring surrogate markers, such as plasma LPS, soluble CD14 (sCD14), or LPS binding protein (LBP). We compared these markers to the direct measurement of intestinal barrier function in humanized mice.−/−gammac−/− mice in general have very poor antibody responses, serum immunoglobulin concentrations are several log lower than in humans Plasma LPS measurements showed a contrasting picture to microbiology results. Only HIV+ mice exhibited elevated levels of LPS in the systemic circulation. HIV−/DSS+ mice, which had increased intestinal permeability according to the organ culture results, controlled plasma LPS levels . In acco−/−gammac−/− mice. Thus, independent of humanization, RAG2−/−gammac−/− and wild-type mice had equal intestinal permeabilities, and the absence of intestinal lymphocytes had little effect on permeability in this model. In DSS-treated or HIV-infected mice there was a trend towards higher FITC-dextran values. In histological sections of the intestines, we found no evidence for exacerbated damage in HIV+ mice, and DSS-treated mice showed moderate changes -dextran with a molecular weight similar to that of LPS . Further changes .Defects in intestinal barrier integrity influenced translocation, but alone they were not sufficient to induce LPS elevation. In HIV-infected mice, some additional factors contributed to higher plasma LPS levels.We hypothesized that plasma LPS levels are a marker for bacterial translocation and for the clearance of bacterial products from the systemic circulation. One of the main LPS clearance mechanisms is phagocytosis by liver macrophages To assess macrophage function during HIV infection, we isolated liver macrophages from all four groups of mice and incubated the cells ex vivo with FITC-LPS . All macSince bacterial translocation has been implicated in immune activation during chronic HIV infection, we examined the effects of bacterial translocation alone or in the context of HIV infection on the expression of cell-surface markers of T-cell activation. We determined T-cell activation levels in the spleens of humanized mice by measuring percentages of CD38 HLA-DR double positive cells in human CD4+ or CD8+ cells . CD4+ ceThus, bacterial translocation, even if no detectable plasma LPS elevation occurred, activated CD4+ and CD8+ cells in HIV- mice. In HIV+ mice, where levels of plasma LPS were increased, CD8+ cell activation was even stronger.In HIV- mice, levels of CD4+ and CD8+ cell activation were tightly correlated . If thatIn humanized mice, absolute CD4+ T-cell numbers differ, because the efficiency of human engraftment is variable. However, CD4+/CD8+ cell ratios are independent of engraftment and are, thus, reasonably reliable estimates of CD4+ cell depletion. The ratios were similar for all four groups . IndividDysfunction of the intestinal barrier has severe consequences for the whole organism. It leads to translocation of bacteria from the gut and mediates inflammation. In chronic HIV infection, for instance, elevated levels of circulating bacterial products are associated with T-cell activation and disease progression A multilayered barrier protects the body from invading intestinal bacteria. The first line of defense is a tight, mucus-coated sheath of intestinal epithelial cells. Moreover, leukocytes in the underlying lamina propria contribute to the protection against bacteria. The humanized mice we used have low intestinal lymphocytes numbers Surprisingly, plasma LPS levels showed a different pattern . They diThe mechanism leading to macrophage dysfunction in HIV+ mice is not clear. It is tempting to postulate induction of an “endotoxin-tolerant” macrophage phenotype in HIV−/DSS+ mice, and loss of tolerance induction in HIV+ mice. Endotoxin tolerance is characterized by programming of macrophages towards phagocytosis instead of production of pro-inflammatory cytokines upon LPS re-exposure Mycobacterium phagocytosis Saccharomyces up-take is also decreased, and LPS-mediated enhancement of phagocytosis is less than the enhancement in monocytes from healthy donors So far, it is unknown if LPS clearance dysfunction also exists in HIV-positive humans, although some evidence supports the existence of macrophage defects in chronic HIV infection. Plasma LPS levels in acutely HIV-infected patients are not elevated Certainly, not all aspects of human HIV infection can be modeled accurately in humanized mice. For example, direct HIV infection of macrophages is rare in the mice. Engraftment of human monocytes was low; less than 2% of all monocytes were of human origin (data not shown). Most macrophages are of murine origin and therefore resistant to HIV infection. In humans, macrophage permissiveness to HIV infection varies from tissue to tissue. For example, intestinal macrophages are quite resistant to infection, but vaginal macrophages are readily infected Lymphoid engraftment, however, is quite good in humanized mice. This allowed the investigation of T-cell activation in DSS-treated or HIV-infected mice. Bacterial translocation induced CD4+ and CD8+ cell activation . Other aOur results might explain why levels of CD8+ T-cell activation are especially good markers of disease outcome In conclusion, we identified a critical role of macrophages in protection from systemic bacterial translocation. In humanized mice, failure of LPS clearance was associated with high levels of T-cell activation and HIV replication. Macrophage dysfunction might be an underestimated mechanism in HIV-induced immunodeficiency and certainly warrants further investigation.All experiments were approved by ethical committees of the University Zurich and the Federal Veterinary Department and were conducted according to local guidelines and the Swiss animal protection law (TschG). Cord blood was collected with written consent of the parents.−/−gammac−/− mice were irradiated with 2×2 Gy. CD34+ cells were isolated from human cord blood with immunomagnetic beads (Miltenyi Biotec), and 2.75±0.5×105 cells were transplanted into each mouse. After 10 to 16 weeks, the degree of blood engraftment was determined by flow cytometry of peripheral blood mononuclear cells stained for the panhuman marker CD45 in all mice (mean human cells/live cells 5.6±5.4% SD). Mice were infected intraperitoneally with HIV YU-2, 2×105 of the tissue-culture infectious dose50 per mouse. Plasma viral loads were measured by RT-PCR 4–6 weeks after inoculation and at the end of each experiment. The detection limit was 1,600 HIV RNA copies/ml. Activation levels of T cells were measured by flow cytometry of splenocytes stained for human CD45, CD4, CD8, HLA-DR, CD38, and appropriate isotype controls . In all experiments, mouse litters and cord blood donors were evenly distributed to all experimental groups.Mice were reconstituted and infected as described Bacterial translocation was induced by adding 0.75% (w/v) DSS to the drinking water for 2 weeks. Spleen and MLN were removed aseptically, mashed with a pestle in PBS, and plated on sheep blood and MacConkey agar plates. Plates were only incubated aerobically, since in a pilot experiment, no anaerobic bacteria could be detected in organ cultures. As a control, diluted stool samples were cultured both in aerobic and anaerobic conditions. A descriptive bacterial translocation index was calculated from organ culture results . LPS was quantified by endpoint chromogenic limulus amoebocyte lysate assay (Lonza). Plasma samples were diluted 1∶10 with endotoxin free water, incubated at 85°C for 12 min, and assayed according to the manufacturer's instructions. Standard endotoxin (Lonza) was diluted to cover plasma LPS values within a range of 0.5 to 20 EU/ml. Plasma mouse sCD14 and LBP were measured by ELISA (both from CellSciences), according to the manufacturer's instructions. For sCD14 measurement, samples were diluted 1∶150, and for LBP measurement, 1∶800.2, and then washed two times with room temperature PBS to remove non-adherent cells. This procedure yielded over 90% murine CD11b+ cells. Cells were then incubated with 0.1 mg/ml FITC-LPS (Sigma) in RPMI, 10% FCS, penicillin/streptomycin, and L-glutamine at 37°C, 5% CO2 for 1 h. As a control, cells were also incubated with FITC-LPS at 4°C. Cells were then washed two times with cold PBS, detached with trypsin, washed once again, and analyzed by flow cytometry. FITC-LPS mean fluorescent intensity was normalized to the fluorescence of samples from HIV−/DSS− mice.Liver mononuclear cells were isolated by Ficoll-Hypaque density gradient centrifugation. To further purify macrophages, cells were incubated for 3 h in RPMI, 10% FCS, penicillin/streptomycin, and L-glutamine at 37°C, 5% COMice were injected intraperitoneally with clodrolip (1 mg/20 g body weight) or with PBS GraphPad Prism 5.02 was used for statistical analysis. Data were analyzed by parametric one-way analysis of variance, followed by Bonferroni post-test. All p-values shown are adjusted for multiple comparisons. In the figures, p-values are presented for comparisons between treatment groups and controls and are denoted by asterisks. Values for HIV/DSS experiments for plasma LPS, viral load, FITC-dextran fluorescence, and percentages of activated CD8+ cells were log transformed before analysis to reduce right-skewing of the data. For all correlations, Pearson's correlation coefficient was calculated. In all figures, points represent values of individual mice, and lines depict mean values.Figure S1DSS induced bacterial translocation in humanized mice. 16 uninfected mice were treated with different doses of DSS in the drinking water for 2 weeks. (A) Systemic bacterial load was assessed by semi-quantitative microbiological culture of organ suspension from mesenteric lymph nodes, spleen and liver. (B) Mouse weight as an indicator for diarrhea and colitis was measured daily (mean). This experiment was done once.(0.32 MB TIF)Click here for additional data file.Figure S2−/−gammac−/− mice were included as a control. HIV−/DSS+ mice had higher FITC-dextran plasma values than WT, non-humanized and HIV−/DSS− control mice. Both HIV+ groups showed only a trend towards higher FITC-dextran translocation.Histological and functional measurement of the intestinal integrity. (A) Formalin fixed, haematoxylin and eosin stained tissue sections of HIV infected and/or DSS treated mice showed moderate changes of the intestinal mucosa. DSS treatment induced villus blunting, a modest vessel dilation (*) and discreet goblet cell hyperplasia (>). (B) Humanized mice were infected with HIV (white symbols) or mock treated (black symbols) and 4 weeks later received 0 (circles) or 0.75% (squares) w/v DSS. After two weeks, in vivo permeability was measured by FITC-dextran translocation. Mice were gavaged with FITC-dextran 20 mg/20 g body weight in 200 µl PBS and four hours later FITC fluorescence in the plasma was measured. Wild-type and non-humanized RAG2(3.69 MB TIF)Click here for additional data file.Figure S3Macrophage derived pro-inflammatory cytokines in HIV+ mice. We measured plasma cytokine levels by cytometric bead assay in HIV−/DSS− (black circle), HIV−/DSS+ (black square), HIV+/DSS− (white circle), and HIV+/DSS+ animals (white square). (A and B) Both human (left) and murine (right panel) cytokines were assessed. HIV+ mice showed a trend towards higher human (P = 0.084 and 0.096) and murine TNF-alpha levels . (C and D) Human IL-12p40 was below detection limit in many of the animals, while murine IL-12p40 was significantly elevated in HIV+ mice . IL-1 beta was undetectable in all mice and IL-6 values showed no significant differences (data not shown).(0.79 MB TIF)Click here for additional data file.Figure S4Diversity of CD4+/CD8+ cell ratios and viral loads in humanized mice. Humanized mice were infected with HIV (white symbols) or mock treated (black symbols) and 4 weeks later received 0 (circles) or 0.75% (squares) w/v DSS. (A) After 2 weeks, spleens were removed and splenocytes were analyzed for human CD4+ and CD8+ T-cell ratios by flow cytometry . (B) Plasma viral load was measured , 48 h before the beginning of DSS treatment , and at the end of the experiment .(0.40 MB TIF)Click here for additional data file.

The ankle brachial index (ABI) is a well-established tool for screening and diagnosis of peripheral arterial disease (PAD). In this study we assessed the validity of ABI determination using a pocket Doppler device compared with automatic vascular laboratory measurement in patients suspected of PAD.Consecutive patients with symptoms of PAD referred for ABI measurement between December 2006 and August 2007 were included. Resting ABI was determined with a pocket Doppler, followed by ABI measurement with automatic vascular laboratory equipment, performed by an experienced vascular technician. The leg with the lowest ABI was used for analysis.From 99 patients the mean resting ABI was 0.80 measured with the pocket Doppler and 0.85 measured with vascular laboratory equipment. A Bland-Altman plot demonstrated great correspondence between the two methods. The mean difference between the two methods was 0.05 (P < .001). Multivariate linear regression analysis showed no dependency of the difference on either the average measured ABI or affected or unaffected leg.Since the small, albeit statistically significant, difference between the two methods is not clinically relevant, our study demonstrates that ABI measurements with pocket Doppler and vascular laboratory equipment yield comparable results and can replace each other. Results support the use of the pocket Doppler for screening of PAD, allowing initiation of cardiovascular risk factor management in primary care, provided that the equipment operator is experienced. The ankle brachial index (ABI) is useful in the diagnosis of peripheral arterial disease (PAD). With a sensitivity and specificity of 90% and 98%, respectively, ABI is especially helpful in establishing lower extremity PAD ,2. The AEquipment used to measure arm and ankle pressures differs between the primary care setting, outpatient clinics, and the vascular laboratory setting. Arm and ankle pressures in primary care and in outpatient clinics are usually measured with a pocket Doppler device. In vascular laboratory settings, these measurements are performed with automatic vascular laboratory equipment. Although the pocket Doppler method is widely used, comparisons of this method with vascular laboratory equipment have been limited. A recent study compared the ABI measurements of 30 patients with both types of equipment . The pocNinety nine consecutive patients suspected of PAD who had been referred to the vascular laboratory of our hospital for an ABI measurement between December 2006 and August 2007 were included in this study. Informed consent was obtained and the study was approved by the medical ethical committee of the Atrium medical center Parkstad.For valid comparisons of ABI measurements performed by pocket Doppler and with laboratory equipment, both measurements were conducted on the same day in the vascular laboratory. For both methods, brachial pressures were measured bilaterally, and were repeated if the difference was > 10 mm Hg between the two arms. Ankle pressures were determined with cuffs placed proximal to the malleoli. Following a 15 minute resting period, systolic blood pressures (SBP) in the brachial, dorsal pedal, and posterior tibial arteries were determined in a supine position with a pocket Doppler device by a trained vascular laboratory professional. Brachial and ankle pressures were measured with a sphygmomanometer cuff which was inflated and deflated manually. The first audible signal of the first ventricular systole was used to identify the SBP at each location. The ABI was calculated by dividing the highest systolic ankle pressure in each leg by the highest systolic brachial pressure ,10. Thent-test. Multivariate linear regression analysis assessed the dependency of the observed difference between the two measurements and the average measured ABI for the affected and unaffected legs. Due to ethical considerations, intra arterial blood pressures were not performed and a Bland-Altman plot was used to visualise agreement between the two methods [ABI measurements for each leg of the same patient are probably correlated since atherosclerosis is a generalised disease. Therefore, we used the lower ABI of both legs of each patient for analyses. The ABI values obtained from the pocket Doppler and from the vascular laboratory were averaged. The leg affected with PAD was defined as a leg with an ABI < 0.9. Differences between measurements were assessed with a one-sample Student's P < .001). Multivariate linear regression analyses showed no dependency of the difference on the average measured ABI (P = .187) or whether the measurements were performed on affected or unaffected legs (P = .235).Characteristics of the study population are presented in Table The two methods were compared by a Bland-Altman plot Figure which deThis study shows that the ABI values determined by a simple pocket Doppler device and by automatic vascular laboratory equipment are interchangeable. In view of the importance of the ABI in detecting patients with atherosclerosis, our study supports the use of the easily accessible and applicable Doppler device for the screening and diagnosis of PAD, thus permitting the initiation of cardiovascular risk factor management in the primary care practice.The good clinical interchangeability between ABI assessment with pocket Doppler and automatic vascular laboratory equipment was elegantly demonstrated by a Bland-Altman plot. However, ABI, as measured by pocket Doppler, tended to be consistently lower, independent of the average of the measured ABI and whether measurements were obtained from the affected or the unaffected leg. Although the minor, albeit statistically significant, difference in ABI of 0.05 is not considered to be clinically relevant , it may The small difference in ABI between both methods may relate to the method of determination of SBP cut-off points and cuff in- and deflation. With the pocket Doppler, SBP is recorded from the sphygmomanometer simultaneously with the first audible signal, which can be influenced by human auditory limitations as well as by a slow response to the rapidly occurring audible signal. Most laboratory equipment automatically visualises the Doppler signal output with spectral analysis and displays the entire frequency and amplitude of the Doppler signal on the monitor . The scrIn general, screening for PAD by ABI and thus, screening for atherosclerosis in peripheral arteries of the leg as a reflection of generalised atherosclerosis is highly encouraged. However, we suggest that clinical judgement must be used in the interpretation of ABI values determined by pocket Doppler. Diabetes or longstanding renal failure medial calcinosis could lead to calcified arteries which may be inadequately compressed by the sphygmomanometer cuff, leading to falsely elevated ankle pressures. Referral to a vascular laboratory for the measurement of systolic toe pressures or additional vascular imaging is essential for adequate determination of the vascular status of these patients .et al. demonstrated that inexperienced doctors performed ABI measurements less reliably than their trained counterparts [Furthermore, an experienced operator is mandatory for accurate determination of the ABI, as previously indicated by the positive influence of experience and training on the reproducibility of the ABI measurement ,15. Ray terparts . In the terparts ,12,17. IPocket Doppler assessment was demonstrated to be a practical tool for reliable and quick evaluation of the vascular status of a patient. This provides a useful tool for the investigation of patients with lower limb pain, and enables the targeted referral of patients with symptomatic PAD to the vascular specialist. Even more importantly, it introduces the opportunity for atherosclerosis screening and cardiovascular risk management in asymptomatic patients to reduce cardiovascular morbidity and mortality.The authors declare that they have no competing interests.SN carried out the statistical analysis and was responsible for writing the drafts of the manuscript. LK contributed to the preparation of the manuscript and the statistical analysis. EV reviewed the manuscript critically. LW carried out the ABI measurements and contributed to the preparation of the manuscript. CR participated in development of the concept and design of the study and reviewed the manuscript. MH contributed to the concept and design of the study and to the statistical analysis. JT participated in the conception and design of the study and critically reviewed the manuscript.The pre-publication history for this paper can be accessed here:

Intramyocardial injection of skeletal myoblasts (SMB) has been shown to be a promising strategy for treating post-infarction chronic heart failure. However, insufficient therapeutic benefit and occurrence of ventricular arrhythmias are concerns. We hypothesised that the use of a retrograde intracoronary route for SMB-delivery might favourably alter the behaviour of the grafted SMB, consequently modulating the therapeutic effects and arrhythmogenicity.6 GFP-expressing SMB or PBS only (control) were injected via either the intramyocardial or retrograde intracoronary routes. Injection of SMB via either route similarly improved cardiac performance and physical activity, associated with reduced cardiomyocyte-hypertrophy and fibrosis. Grafted SMB via either route were only present in low numbers in the myocardium, analysed by real-time PCR for the Y-chromosome specific gene, Sry. Cardiomyogenic differentiation of grafted SMB was extremely rare. Continuous ECG monitoring by telemetry revealed that only intramyocardial injection of SMB produced spontaneous ventricular tachycardia up to 14 days, associated with local myocardial heterogeneity generated by clusters of injected SMB and accumulated inflammatory cells. A small number of ventricular premature contractions with latent ventricular tachycardia were detected in the late-phase of SMB injection regardless of the injection-route.Three weeks after coronary artery ligation in female wild-type rats, 5×10Retrograde intracoronary injection of SMB provided significant therapeutic benefits with attenuated early-phase arrhythmogenicity in treating ischaemic cardiomyopathy, indicating the promising utility of this route for SMB-delivery. Late-phase arrhythmogenicity remains a concern, regardless of the delivery route. Both experimental and initial clinical studies have shown that transplantation of skeletal myoblasts (SMB) into the heart is a promising treatment for post myocardial infarction (MI) chronic heart failure (HF). However, a recent large-scale randomised clinical study has suggested that the therapeutic efficacy of this strategy may not be as substantial as expected when conjugated with coronary artery bypass surgery Of note, almost all experimental and clinical studies to date have utilised intramyocardial (IM) injection for SMB delivery into the heart. However, this method is known to have disadvantages including formation of islet-like cell-clusters and induction of myocardial damage and disruption In this study, we therefore examined the efficiency and pattern of cell-distribution, behaviour of the grafted cells, therapeutic efficacy and arrhythmogenicity after retrograde IC injection of SMB into the post-MI chronically failing heart, in comparison with direct IM injection.Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health . All surgical procedures and evaluations, particularly cardiac function measurement by echocardiography, were carried out in a blinded manner.The investigation conforms to the n = 10) Primary SMB were isolated from male GFP-transgenic Sprague-Dawley (SD) rats by the single fibre method (n = 190) via either the direct IM or retrograde IC route was carried out (n = 165) 6 SMB suspended in 100 µl of PBS or 100 µl of PBS was injected into two sites of the peri-infarct area using a 31-gauge needle. For retrograde IC injection, 5×106 SMB suspended in 500 µl of PBS or 500 µl of PBS were slowly injected with a constant pressure over 30 seconds through a 24-gauge catheter (BD Biosciences) inserted into the left cardiac vein. The stem of left cardiac vein was snared from the start of injection till 30 seconds after the completion of injection.Female wild-type SD rats underwent permanent left coronary artery (LCA) ligation under mechanical ventilation and 1.5% isoflurane inhalation Echocardiography was carried out under 1.5% isoflurane inhalation n = 7 in the PBS-IM and PBS-IC groups and n = 8 in the SMB-IM and SMB-IC groups). The hourly number of ventricular premature contractions (VPC), calculated as an average over 24-hours recording, and frequency of VT were assessed.Spontaneous arrhythmia occurrence and physical activity were assessed by telemetry The signal strength, which is changed by physical movement of the rat, was monitored at 64 Hz as an indicator of physical activity 2O with modified Krebs-Henseleit buffer using a Langendorff apparatus at day 84 (n = 3 in the PBS-IM and PBS-IC groups and n = 6 in the SMB-IM and SMB-IC groups) −7 M isoproterenol (Sigma) was administered continuously via the perfusate for 10 minutes Isolated hearts were perfused at 100 cm Hn = 5 in each group). Fifteen-µm cryosections were labelled with polyclonal anti-GFP Hearts were collected at day 3 and 28, fixed by 4% paraformaldehyde perfusion, cut transversely and frozen (n = 5 in each group) n = 5 in each group) 2).To evaluate myocardial collagen deposition, cryosections from day-28 hearts were stained with 0.1% Picrosirus red for the Y-chromosome specific 6) and female entire LV walls at 21 days after LCA ligation (n = 3). The number of surviving grafted cells at day 3, 7, 28 and 84 (n = 5 in the SMB-IM and SMB-IC groups at each time point) was estimated by correcting relative Sry expression using this standard curve.A standard curve was prepared from serial dilution series of the DNA extracted from a mixture of male SMB At day 28, cardiomyocytes were isolated from the heart by enzymatic dissociation in total. Among the surviving rats, 4 (2.6%) were excluded due to their LVEF being more than 40% one day before cell injection. Mortality after cell injection was similar in all groups; 6.3% (2/32) in the PBS-IM, 8.3% (3/36) in the PBS-IC, 8.3% (4/48) in the SMB-IM, 8.2% (4/49) in the SMB-IC groups.n = 10). At 20 days after LCA ligation, reduced LVEF , enlarged LVDd/LVDs and reduced E/A (1.2±0.1 p<0.01) were observed (n = 165).Cardiac function and dimensions were serially assessed using echocardiography. Baseline values were 363±18 bpm for HR, 73.9±1.8% for LVEF, 6.7±0.3/3.8±0.3 mm for LVDd/LVDs and 1.7±0.2 for peak E/A . Compared to before injection , LVEF was improved by day 7 after IM or IC SMB injection . SMB injection via either route resulted in lower HR, smaller LVDs and greater E/A at day 28, but not at day 84, compared to PBS injection or till 84 days after PBS injection er route . Of noteer route , whereasp<0.05, via either route (p<0.05), while VPC number was not significantly increased in the hearts after PBS injection. Of note, VT was induced in 83.3% hearts after SMB injection via either route were present in the LV, while 5.2±2.7×105 cells (10±5%) existed at day 3 after retrograde IC injection of SMB (5 cells (4±1%) or 2.0±1.0×105 cells (4±1%) by day 7 and further decreased to 0.2±0.1×105 cells (0.3±0.2%) or 0.2±0.1×105 cells (0.3±0.2%) by day 28 after direct IM or retrograde IC injection of SMB, respectively.In our model, male cells were injected into female hearts in order to quantitatively analyse graft survival using real-time PCR for the Y-chromosome specific gene, n of SMB . The num2vs. 3,074±61 µm2, p<0.05, 2) or retrograde IC injection of SMB .Native (GFP-negative) cardiomyocytes, isolated by enzymatic dissociation, were assessed for cell size. Cardiomyocytes after PBS injection were significantly larger than those from uninfarcted, normal animals or retrograde IC (14.1±0.5%) route. Fibrosis was also observed in infarct-remote areas after PBS injection with the collagen volume fraction reaching approximately 15% (via IM (12.7±0.4%) or retrograde IC (11.3±1.2%) route. Capillary density, which was assessed in peri-infarct areas of vWF-labelled samples (2 in the SMB-IM group and 711±13/mm2 in the SMB-IC group), compared to the corresponding control group . These findings suggest that the host immune response against allogenicity, GFP or Y-chromosome does not induce inflammation or impair the fundamental behaviour of the grafted cells and consequent therapeutic outcomes.A possible limitation in our experimental model, in which SMB derived from GFP-transgenic male SD rat were injected into the female wild-type SD rat heart, was a host immune response against allogenicity, Y-chromosome and/or GFP. SD rat is not an inbred strain in a strict definition, but is very close to inbred. Actually, it has been successfully used for an organ or cell transplantation model for heart disease without use of immunodepressants In summary, we have demonstrated that retrograde IC injection of SMB was able to provide similar, or possibly greater, therapeutic benefits in treating ischaemic cardiomyopathy with less arrhythmogenicity in the early phase, compared to direct IM injection. This data demonstrates the promising utility of the retrograde IC route for SMB transplantation to treat post-MI chronic HF. Persistent arrhythmogenicity in the late phase remains a concern of SMB transplantation regardless of the delivery-route.

Center for Advanced Technology and Telemedicine at the University of Nebraska Medical Center has developed a novel fiberscope with a more anterior 60° curve to allow for easier midline insertion and intubation. The objective of this work was to evaluate the novel fiberscope, in comparison to the Bonfils intubating fiberscope, in terms of use and function in difficult airway intubation.The Bonfils intubating fiberscope has a limited upward tip angle of 40° and requires retromolar entry into the hypopharynx. These factors may make its use less desirable when managing the difficult airway because most anesthesia providers are well versed in midline oral intubation rather than the lateral retromolar approach. The Twenty-two anesthesia providers participated in simulated intubations of a difficult airway mannequin to compare the Bonfils intubating fiberscope with the novel curved Boedeker intubating fiberscope. The intubations were assessed based upon the following variables: recorded Cormack Lehane airway scores, requests for cricoid pressure, time to intubation, number of intubation attempts and success or failure of the procedure.Participants using the Bonfils fiberscope recorded an average Cormack Lehane (CL) airway score of 1.67 ± 1.02 (median = 1); with the novel fiberscope, the recorded average airway grade improved to 1.18 ± 0.50 (median = 1). The difference in airway scores was not statistically significant . There was, however, a statistically significant difference in intubation success rates between the two devices. With the Bonfils fiberscope, 68% (15/22) of participants were successful in intubation compared to a 100% success rate in intubation with the novel fiberscope (22/22) (p = 0.008). After the intubation trial, the majority of participants (95%) indicated a preference for the novel fiberscope (n = 20).With this data, we can infer that the novel fiberscope curvature appears to improve or maintain the quality of an intubation attempt . The data indicate that the novel fiberscope offers a superior intubation experience to currently available best practices. The instrument was well received and would be welcomed by most study participants should the device become clinically available in the future. Management of the difficult airway is a considerable challenge for anesthesia providers and is the major cause of morbidity and mortality. When confronted with a patient who has a predicted difficult airway , intubation may be extremely formidable. In cases such as these, it may be more advantageous to secure the airway while the patient is still awake. An airway device that allows for intubation without the need of a straight line of sight while lifting and navigating through airway structures would be beneficial.Multiple types of devices have been developed to avoid having a straight line of sight. A common methodology is to move the point of sight (using a miniature camera) to the tip of a standard (or modified) rigid laryngoscope . The endotracheal tube is then passed separately next to the device. The early passage is essentially blind, until the tip of the endotracheal tube enters the view of the camera. The rigid Bonfils Intubating Fiberscope has the endotracheal tube mounted (threaded) on the device, thereby acting as a fiberscope. The pathway is always in view, and the operator's second hand is free to perform other tasks.Prior studies have demonstrated the usefulness of the Bonfils Intubating Fiberscope during difficult intubation -6 as welBased on the above design and use limitations, the Boedeker intubating fiberscope Figures and 2 waFollowing IRB approval, anesthesia providers (n = 22) including anesthesia attending physicians and residents, and Certified Registered Nurse Anesthetists (including one student CRNA) at the University of Nebraska Medical Center and Omaha VAMC, Omaha, NE participated in intubation of a Laerdal Deluxe Difficult Airway Trainer™ with the tongue inflated to simulate a difficult airway . The proPrior to the exercise, the instructor demonstrated the use of both fiberscopes. The participants were then observed during their intubation attempts alternatively using the Bonfils and Boedeker intubating fiberscopes (randomized to eliminate learning effects) Figures and 2. DThe significance of non-parametric data , success/failure rate and rate of cricoid pressure requests were calculated using a Fisher's Exact Test. For the observed airway views, Cormack Lehane grades "1&2" were combined as "good views", and grades "3&4" were combined as "poor views." Values for the airway are reported as median. Timing comparisons and number of intubation attempts were recorded as means ± standard deviation and calculated using a Paired t-Test. A p-value < 0.05 was considered significant.Study participants consisted of one Student Registered Nurse Anesthetist, 5 Certified Registered Nurse Anesthetists and 16 MDs (8 residents and 8 attending), all of whom were anesthesia practitioners. At the time the study was conducted, the level of experience of the anesthesia practitioners in awake intubation ranged from having no experience to having 50+ (see Table In comparing the recorded median Cormack Lehane airway view scores between the two devices (both medians = 1), there is no significant difference. A breakdown of the recorded Cormack Lehane airway scores is shown in Table The data shows that there was essentially no difference in average times to intubation p = 0.27) or in the average number of intubation attempts between the two devices of participants were successful compared to a 100% success rate in intubation with the novel fiberscope (22/22) (p = 0.008) Figure .For the requests for cricoids pressure, when using the Boedeker fiberscope, 23% (5/22) of participants requested cricoid pressure as compared to 45% (10/22) of participants requesting cricoid pressure with the Bonfils fiberscope. Although there is a trend evident, the difference between the two devices is not statistically significant (p = 0.20) of the study participants preferred the Boedeker fiberscope when asked which device they had a preference for (n = 20). Comments by the participants were invited and collected and included the following: "Novel curve was easier to maneuver"; "Didn't like curve of Bonfils"; "Bonfils harder to manipulate".As previously established , our stuDue to the widespread popularity of the Bonfils intubating fiberscope, it stands to reason that users would take few tries to achieve a successful intubation. The interesting point to notice from Table The most dramatic difference between the two instruments was observed in the successful intubation rates were recorded when using the Boedeker fiberscope compared to 45% with the Bonfils. This difference is not statistically significant (p = 0.20) most likely due to the small sample size, but this trend is interesting.Two limitations to this study were the small sample size and the varied experience of the study participants in awake intubation. There was a very large standard deviation among the times to intubation. This is most likely due to the varied experience of the operators. For the most part, since the scenarios were randomized to eliminate any learning effects, if the users were inexperienced, they were slow to intubate in both the scenarios, leading to a wide range of intubating times. It is interesting to note that the values in Table For the most statistical power, one would like all participants to have minimal variation, and the standard deviation would be at the lowest range; however, the generalization to a different population is much less robust/applicable. Given a group such as ours, the study is more applicable to the population found in a typical medical institution. The wide standard deviation is an indication that trainees and novices to these techniques will have a wide range of training needs. Giving everyone a "time based" learning experience would not suffice.Prior studies have identified the learning curve associated with the Bonfils ,6,8. In The authors believe that the new device shows improvement in the intubation experience; however, due to the large standard deviations present in this data, the sample size should be increased to fully investigate the significance of the claims. The novel instrument was also well accepted among study participants indicating that, if available, most users would prefer using this novel fiberscope over the Bonfils when warranted for difficult airway intubation. Many of the participants in the study commented that it would be easier to tell which was the better solution (Boedeker vs. Bonfils fiberscope) in a real OR setting. To that end, the device is being taken through the FDA approval process so that it can be used on humans in the OR.Based on the data in our study, the novel curvature of the Boedeker fiberscope appears to improve and/or maintain the quality of an intubation attempt . In this study, the difference between the two devices with respect to the intubation success rates is statistically significant with the Boedeker fiberscope providing a 100% success rate versus 68% with the Bonfils. Our data has shown that the Boedeker fiberscope offers a superior intubation experience to that of the Bonfils fiberscope. As the new device was well received by the study participants, it is believed by the authors that many users would choose to include this device on their standard airway carts should it become clinically available in the future.The University of Nebraska Board of Regents holds all of the intellectual properties associated with this project. The authors declare that they have no competing interests.BHB conceptualized the device and its design. BHB designed the study protocol, the questionnaire, performed the testing and data collection and contributed to the manuscript preparation. MAB assisted in data analysis and manuscript development. DJM assisted in the device engineering, device testing, data collection and analysis, and manuscript preparation. TAN assisted in data collection and manuscript development. AL assisted in data collection and data analysis. WBM assisted in manuscript development and statistical analysis. All of the authors have read and approve of the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-227X/10/11/prepub

This study was conducted to increase the anti-tumour potency and reduce the toxic side-effects of tumour necrosis factor alpha . Natural human TNF-alpha was chemically conjugated with monomethoxy polyethylene glycol (PEG) using succinimidyl coupling of lysine amino groups of TNF-alpha. The number-average molecular weight of PEG-modified TNF-alpha increased with an increase in the reaction time and the initial molar ratio of PEG relative to TNF-alpha. The resulting modified TNF-alpha was separated into fractions of various molecular weights. The specific activity of separated PEG-TNF-alpha s relative to that of native TNF-alpha gradually decreased with an increase in the degree of PEG modification, but the plasma half-life was drastically increased with the increase in molecular weight of modified TNF-alpha. PEG-TNF-alpha s, in which 29% and 56% of lysine residues were coupled to PEG, had anti-tumour activity approximately 4 and 100 times greater than unmodified TNF-alpha in the murine Meth-A fibrosarcoma model. Extensive PEG modification did not increase its in vivo activity. A high dose of unmodified TNF-alpha induced toxic side-effects, but these were not observed with the modified TNF-alpha s. Optimal PEG modification of TNF-alpha markedly increased its bioavailability and may facilitate its potential anti-tumour therapeutic use.

Declining serum concentrations of 25-hydroxyvitamin D seen in the fall and winter as distance increases from the equator may be a factor in the seasonal increased prevalence of influenza and other viral infections. This study was done to determine if serum 25-hydroxyvitamin D concentrations correlated with the incidence of acute viral respiratory tract infections.In this prospective cohort study serial monthly concentrations of 25-hydroxyvitamin D were measured over the fall and winter 2009–2010 in 198 healthy adults, blinded to the nature of the substance being measured. The participants were evaluated for the development of any acute respiratory tract infections by investigators blinded to the 25-hydroxyvitamin D concentrations. The incidence of infection in participants with different concentrations of vitamin D was determined. One hundred ninety-five (98.5%) of the enrolled participants completed the study. Light skin pigmentation, lean body mass, and supplementation with vitamin D were found to correlate with higher concentrations of 25-hydroxyvitamin D. Concentrations of 38 ng/ml or more were associated with a significant (p<0.0001) two-fold reduction in the risk of developing acute respiratory tract infections and with a marked reduction in the percentages of days ill.Maintenance of a 25-hydroxyvitamin D serum concentration of 38 ng/ml or higher should significantly reduce the incidence of acute viral respiratory tract infections and the burden of illness caused thereby, at least during the fall and winter in temperate zones. The findings of the present study provide direction for and call for future interventional studies examining the efficacy of vitamin D supplementation in reducing the incidence and severity of specific viral infections, including influenza, in the general population and in subpopulations with lower 25-hydroxyvitamin D concentrations, such as pregnant women, dark skinned individuals, and the obese. There are seasonal variations in the incidences of viral respiratory tract infections, such as those caused by influenza Indoor crowding is commonly thought to contribute to the influenza epidemics seen each winter in temperate zones. However, influenza epidemics do not occur in the summer in crowded workplaces or other gatherings, despite the presence of the virus and a multitude of nonimmune persons There are well-documented seasonal variations in 25-hydroxyvitamin D (vitamin D) concentrations Vitamin D has known effects on the immune system. The production of the antimicrobial peptides cathelicidin by macrophages and β-defensin by endothelial cells is upregulated by vitamin D The association between vitamin D deficiency and susceptibility to infections of the respiratory tract has been suggested for many years, but has not been definitively proven. Children with nutritional rickets developed rachitic lung due to infections of the respiratory tract There have been no prospective, observational studies following adult women and men with known vitamin D concentrations for the development of acute viral respiratory tract infections. Since it is unknown if an acute infection could transiently alter the 25-hydroxyvitamin D concentration and concentrations would be expected to decline over the fall and winter as latitude increases from the equator, serial serum concentrations would have to be obtained in a prospective study done in a temperate zone.This study was undertaken to determine if there is any correlation between the incidence of acute viral respiratory tract infections and serum vitamin D concentrations as measured monthly from September 20, 2009 to January 10, 2010 in healthy adults living and/or working in or near Greenwich, CT, USA .All participants signed informed consent approved by the Greenwich Hospital Institutional Review Board. Healthy adults, contacted through formal and informal presentations, were asked to volunteer to participate in this study. Exclusion criteria were any chronic pulmonary, cardiac, renal, hepatic, hematologic, neurologic, neuromuscular, or metabolic disorders (including diabetes mellitus); immunosuppression; pregnancy; and/or high dose aspirin therapy. Participants were not excluded if on thyroid or estrogen replacement therapy, oral contraceptives, or if they had mild seasonal allergies.Participants agreed to donate one tube (7.5 cc) of blood monthly, starting in the third week of September 2009, for 4–5 months, depending on an interim analysis after the third blood draw. The participants were unaware of the nature of the substance being measured; they also understood they would be told the substance and their concentrations at the end of the study and that this data might be of benefit to them for health reasons unrelated to the study. The participants were asked to report any evidence of an acute respiratory tract infection , in which case they would be evaluated without charge at the study site.After obtained, sera were refrigerated and assayed within 4–48 hours in the Clinical Laboratory of Greenwich Hospital. Concentrations of 25-hydroxyvitamin D were measured in duplicate by a chemiluminescence immunoassay (Liaison®) Participants reporting any symptoms were seen the same day at the study site by one of the two board-certified Infectious Diseases investigators . Participants were interviewed, examined, and, if felt to have an acute respiratory tract infection, had a nasopharyngeal swab obtained for virology studies and bacterial cultures if a bacterial infection was suspected. The participants kept a diary of symptoms and were called every 1–3 days during the illness to review any signs or symptoms until asymptomatic. The duration of each symptom, the total illness duration, and any antimicrobials administered were recorded in the case report forms.Between each monthly visit for 25-hydroxyvitamin D determinations, all of the participants were reminded every 10 days to report any illness. At each visit after the first, a clinical assessment was made by both of the Infectious Diseases investigators to determine if an illness being retrospectively reported by a participant appeared to have been an acute viral respiratory tract infection. In that case, an illness diary was completed, but no virology studies performed. At each monthly visit records were made for each participant regarding medications, herbals, supplements, vitamins, receipt of seasonal and/or 2009 H1N1 vaccine. At the first visit, the skin pigmentation of each participant was determined to be light (white-yellow), intermediate (tan-light brown), or dark (brown-black); and, the following were recorded: age, sex, height, weight, occupation, and contact information.All data was entered into a secure web-accessible on-line database (MARVI) as well as into paper case report forms for back-up and quality verification purposes.All participants presenting with acute symptoms of a respiratory tract infection had a nasopharyngeal swab obtained and placed in viral transport media . These specimens were tested within 24 hours of collection at the Clinical Virology Laboratory at the Yale New Haven Hospital by cytospin-enhanced direct immunofluorescence (DFA) for adenovirus, parainfluenza types 1,2,3, respiratory syncytial virus, and influenza A and B All ill participants were determined to either have a bacterial infection or an acute viral respiratory tract infection, the latter of which were subclassified as either (1) an afebrile viral respiratory tract infection; (2) an influenza-like illness (ILI) with temperature >100°F, cough and/or sore throat in absence of a known cause; or, (3) a laboratory-confirmed viral infection.Bacterial infections were not evaluated in this study and were excluded from the analysis.Assuming an overall incidence of viral respiratory tract infections of 0.15 for the population over the time of study and a laboratory measurement coefficient of variation of 10% for serum vitamin D called for an enrollment of at least168 participants to achieve a Type I error of 0.05 and a Type II error of 0.2 if the odds ratio between the two groups for an event was ≥0.5 First, the initial serum 25-hydroxyvitamin D concentrations were examined with respect to the onset of respiratory tract viral infections seen over the entire study period. A non-linear pharmacodynamic concentration-response model was constructed, with parameters estimated by minimizing the log likelihood. Several families of sigmoid concentration-response model structures relating serum 25-hydroxyvitamin D concentration to the length of time of illness-free survival were evaluated, including exponential, extreme value, log-logistic, log-normal, normal, and Weibull functions.Next, for each of the three observation periods a mean concentration of 25-hydroxyvitamin D was calculated for each participant by averaging the concentrations for that participant from before and after the observation period. Mean concentrations were used rather than concentrations extrapolated to the date of illness, as (1) it could not be assumed that the change in a concentration from the beginning to the end of an observation period was necessarily linear, and (2) concentrations had to be assigned to the participants who did not become ill.Participants were stratified into two groups by presence or absence of an infectious event. An automated partition analysis For the survival analysis, participants who experienced an event (became infected) were assigned the mean vitamin D concentration for the period in which the event occurred. Participants who did not experience an event were assigned the minimum mean concentration taken over the three observation periods. This approach biased the study towards accepting the null hypothesis of no difference in event rate between the two groups.A semi-parametric Cox proportional hazards model The two groups were then examined in an analysis for differences in sex, age, skin pigmentation, use of herbals and supplements, use of vitamins other than D, use of vitamin D supplementation, and receipt of seasonal and 2009 H1N1 influenza vaccines prior to the observation periods. This analysis involved construction of a non-linear model relating skin pigmentation , gender , age (yrs), height (in), weight (lbs), and vitamin D daily dose (IU) to the observed serum vitamin D concentration obtained at the first blood draw. The preferred model was chosen based on the explanatory vector of covariates achieving the lowest Akaike Information Criterion For each period of observation and for the study duration the incidences of viral respiratory infections were determined for participants with 25-hydroxyvitamin D concentrations above and below the partition value. Comparisons were made, and 95% confidence intervals for the mean and p values were calculated using a bootstrap resampling routine in MATLAB with the resampling functions package from Resampling Statistics . Observations were then made regarding the burden of illness by comparing days of viral respiratory illness per days of observation for participants with 25-hydroxyvitamin D concentrations above and below the partition value.Lastly, the two groups were examined for differences in the number of participants who developed viral infections associated with positive virology laboratory studies.One hundred ninety-eight participants, 85 men and 113 women, with an age range of 20–88, were enrolled in the study. Skin pigmentation was light (white-yellow) in 154, intermediate (tan-light brown) in 32, and dark (brown-black) in 12. One participant withdrew from the study days after the first blood draw (concentration of 35.7 ng/ml) and two withdrew after the second blood draw (first period mean concentrations of 9.6 and 25.4 ng/ml). Thus, 197 were followed for the first period, and 195 for the remainder of the study.The study began on September 20, 2009, the date of the first blood draw, and ended on January 12, 2010, two days after the last blood draw. An interim analysis of the coded data 2-3 weeks after the second period of observation caused the investigators to decide to close the study after the fourth blood draw (the end of the third period).Four patients developed bacterial infections . None of these infections was included in the analysis, as they were not acute viral respiratory tract infections.Of the 103 clinical acute respiratory tract infections, 89 (86.4%) involved physician visits and 14 (13.6%) were documented by illness diary only. There were 103 acute viral infections diagnosed clinically in 84 patients during the study, including 62 afebrile respiratory tract infections, 8 ILI, and 33 laboratory confirmed infections. Of the 89 clinical viral infections in which virology studies were performed, 33 (37.1%) had positive results .The concentrations of 25-hydroxyvitamin D in the participants were consistent with what has been described in the literature, including the mean and range of values found; differences based on sex and skin pigmentation; and, seasonal decline . The resFor each of the three periods of observation and for the entire study the partition analysis determined that a vitamin D concentration of 38 ng/ml best discriminated between groups that did or did not develop viral infections of the respiratory tract. This was consistent with the value of 38 ng/ml obtained from the pharmacodynamic concentration-response curve based on the initial 25-hydroxyvitamin D concentrations .The results of the Cox proportional hazard model are presented in Analyses of the groups with concentrations ≥38 ng/ml and <38 ng/ml are delineated in To examine the burden of illness, the incidence of clinically diagnosed acute viral respiratory tract infections and percentages of days ill in participants with 25-hydroxyvitamin D concentrations ≥38 ng/ml and in those <38 ng/ml were determined . For eacFor participants with 25-hydroxyvitamin D concentrations ≥38 ng/ml, the median duration of illness was 6 days ; for participants with concentrations <38 ng/ml, the median duration was also 6 days . For influenza, the median durations for the high and low 25-hydroxyvitamin D groups were 2 days and 9 days , respectively. The number of infections in the participants with concentrations ≥38 ng/ml was too small to determine if these differences in illness duration were statistically significant.The numbers of participants with mean concentrations ≥38 ng/ml were 32 for the first period, 23 for the second, and 24 for the third. Eighteen participants maintained concentrations ≥38 ng/ml for the entire study. Of the 18, 3 developed viral infections. Of the 180 other participants, 81 developed infections, and all of the 81 had mean concentrations of vitamin D<38 ng/ml for the entire study. Of the 18 participants with high vitamin D concentrations, there was one (5.5%) who developed a laboratory-confirmed viral infection. Of the other180 participants, there were 32 (17.8%) laboratory-confirmed cases. Due to the small number of infections in the ≥38 ng/ml group, the study had a low power to detect a difference in the incidence of laboratory-confirmed infections in the two 25-hydroxyvitamin D groups .This study is the first prospective study that has correlated serum 25-hydroxyvitamin D concentrations with the incidence of viral respiratory infections in adult women and men. During 114 days of the fall and winter in a temperate zone a serum concentration of 25-hydroxyvitamin D of 38 ng/ml or higher was associated with a two-fold decrease (p<0.0001) in the risk of developing acute viral infections of the respiratory tract. The effect size was so large that it was demonstrated with confidence in a relatively small study. For three consecutive periods and for the whole study the incidences of infection for the group with 25-hydroxyvitamin D≥38 ng/ml were significantly lower than in the <38 ng/ml group.Analysis based on the initial 25-hydroxyvitamin D concentrations revealed that the higher the concentration, the greater the reduction in the incidence of viral infections of the respiratory tract, with the effect plateauing at concentrations ≥38 ng/ml. The findings herein may explain the apparent lack of an effect of supplementation with vitamin D on reducing the incidence of viral infections of the respiratory tract in a study done by Li-Ng et al The 25-hydroxyvitamin D concentrations observed in the present study were consistent with what is known about the pharmacology of vitamin D in humans. Importantly, increased melanin content in skin is known to block solar ultraviolet B radiation required for the first step of synthesis of the vitamin in the skin. The predicted vitamin D concentration ratio for individuals with intermediate and dark pigmentation compared to lightly pigmented individuals in this study was approximately 1/√2 and 1/√3, respectively, given no additional vitamin D intake and a similar body mass index. The 18 participants who were able to maintain 25-hydroxyvitamin D concentration ≥38 ng/ml for the entire study all had light skin pigmentation, and 72.2% were on vitamin D supplementation. The data suggested that there is a non-linear response in dose of vitamin D to serum concentration, which may be related to suggestions of increased metabolism of the vitamin in individuals with higher serum vitamin D concentrations There were a number of limitations in this study. First, the number of ill participants with concentrations ≥38 ng/ml was too small to determine whether once infected those participants had a statistically significant shorter duration of illness. A subsequent study will be required to determine the durations of illness caused by specific viruses examined in light of vitamin D concentrations.It had been expected that there would be many cases of 2009 H1N1 influenza, but the number of cases in the geographic area of the study was relatively small, and a large percentage of the subjects had received the 2009 H1N1 vaccine by the second period of the study, the peak time for influenza in the study's location. The virology studies performed used multiplex DFA as the initial screen and PCR only for selected viruses. Testing did not include coronavirus or parainfluenza type 4. Nevertheless, the recovery rate of 37.1% in this study was similar to rates of 39% The results of this study cannot be assumed to apply to other settings, but do call for other studies to determine if vitamin D concentrations have an effect on the following: (1) the incidence of acute viral respiratory tract infections in individuals under 18 years of age; (2) the incidence of viral infections affecting other organ systems and at other times of the year; (3) the course of bacterial, mycobacterial, and fungal infections; (4) the course of specific infections which can be worse in groups prone to lower concentrations of vitamin D, e.g., influenza in pregnant women and in the obese, tuberculosis in dark skinned individuals, and fungal infections in dark skinned patients. In addition, careful intervention studies would be required to evaluate any potential therapeutic effects of vitamin D in the course of established infections of any type.Our data suggest that there is a threshold above which progressively higher concentrations of vitamin D do not result in further benefit in reducing the incidence of viral infections of the respiratory tract. Larger studies might be undertaken examining different ranges of vitamin D concentrations above 38 ng/ml and monitoring for any long-term beneficial or adverse effects, given the widespread presence of vitamin D receptors on so many cell types.Importantly, this study demonstrated a beneficial effect of a serum concentration of vitamin D (38 ng/ml) only slightly higher than the concentration (30 ng/ml) currently believed to represent sufficiency It is estimated that 1 billion people worldwide have vitamin D concentrations under 30 ng/ml The data in this study suggests that supplementing with vitamin D to raise the concentrations in the general population to above 38 ng/ml could result in a significant health benefit by reducing the burden of illness from viral infections, at a minimum from viral infections of the respiratory tract in healthy adults living in temperate climates. Our findings may provide direction for and call for future interventional studies examining the efficacy of vitamin D supplementation in reducing the incidence and severity of specific viral infections, including influenza, in the general population and in specific subpopulations, such as pregnant women, dark skinned individuals, and the obese.

Plasmodium falciparum. Its use is strongly recommended in most sub-Saharan African countries, namely Cameroon, where resistance to chloroquine is widespread and antifolate resistance is emerging.The use of drug combinations, including non-artemisinin-based and artemisinin-based combination therapy (ACT), is a novel strategy that enhances therapeutic efficacy and delays the emergence of multidrug-resistant P. falciparum malaria according to the standard World Health Organization protocol at four sentinel sites between 2003 and 2007. A total of 1,401 children were enrolled, of whom 1,337 were assigned to randomized studies and 64 were included in a single non-randomized study. The proportions of adequate clinical and parasitological response (PCR-uncorrected on day 14 and PCR-corrected on day 28) were the primary endpoints to evaluate treatment efficacy on day 14 and day 28. The relative effectiveness of drug combinations was compared by a multi-treatment Bayesian random-effect meta-analysis.Studies were conducted in Cameroonian children with acute uncomplicated The results based on the meta-analysis suggested that artesunate-amodiaquine (AS-AQ) is as effective as other drugs . AM-LM appeared to be the most effective with no treatment failure due to recrudescence, closely followed by DH-PP.Although AM-LM requires six doses, rather than three doses for other artemisinin-based combinations, it has potential advantages over other forms of ACT. Further studies are needed to evaluate the clinical efficacy and tolerance of these combinations in different epidemiological context. Plasmodium falciparum is now widespread in Africa, and antifolate-resistant P. falciparum is emerging in some regions in Africa [P. falciparum infections, respectively, between 2002 and 2004.Chloroquine-resistant n Africa . In CameTo overcome drug-resistant malaria, malaria experts advocate the use of combination therapy ,3. The mCameroonian health authorities recommend AS-AQ for the treatment of uncomplicated malaria since 2004. AM-LM is an alternative therapy in Cameroon since 2006. In the previous studies, the results of the nationwide evaluation of the current therapeutic efficacy of monotherapies were presented . The aimP. falciparum parasites/μL of blood, without other Plasmodium species [Clinical studies were conducted at four different urban centres situated in different geographic area in Cameroon. Malaria transmission is intense and continuous throughout the year in the country, except for the northern (Garoua) and far-northern provinces (Maroua), where transmission is low and seasonal. Children were enrolled after free and informed consent of the parents and/or legal guardians if the following inclusion criteria were met: age ≤ five years of age, fever at the time of consultation, parasite density ≥ 2,000 asexual species . As reco species . Each suPatients were randomized to two or three treatment groups, with the exception of the study conducted in Maroua where only AS-AQ combination was evaluated. Separate concealed-random list based on random number tables was prepared for each trial by the principal investigator. Patients were consecutively allocated by the local investigator according to the corresponding list. Amodiaquine (AQ) was administered at a standard dose of 10 mg base/kg body weight on days 0, 1, and 2. Sulphadoxine-pyrimethamine was administered in a single dose. The dosage of AQ-SP was the same as that of monotherapies. The first doses of AQ and SP were administered simultaneously on day 0, followed by AQ alone on days 1 and 2.®) 6.4 mg/kg body weight of DH and 51.2 mg/kg body weight of piperaquine in 3 divided daily doses. Six doses of AM-LM (Coartem®) were administered as recommended by the manufacturer. For the AS-CD combination, the dose of chlorproguanil-dapsone (Lapdap®) was given once daily for three days, as recommended by the manufacturer. Paracetamol (30 mg/kg body weight/day) was administered to all patients.AS was administered at a total dose of 12 mg/kg body weight for all ACTs containing AS. The following dosages of ACT were administered: AS-AQ on days 0, 1, and 2; AS-SP, (SP on day 0); AS-MQ ; and DH-PP , merozoite surface antigen-1 (msa-2), and glutamine-rich protein (glurp) genes of the pre-treatment and recrudescent samples were amplified, as recommended by a group of malaria experts [Fingerprick capillary blood was collected for blood smear and DNA analysis at the time of treatment or parasitological failure occurring on day 7 or after. The polymorphic merozoite surface antigen-1 , significant difference between AQ, SP, AQ-SP arms was tested using ANOVA for the binary variable ACPR 1/treatment failure 0. The test of the efficacy trend of AQ-SP between 2003 and 2006 was performed by comparing the rate of ACPR in 2003 to the rate in 2006 using the odds ratio (OR) on day 14.For each 28-day follow-up study (2005-2007), the ORs and 95% confidence intervals were calculated. The Yusuf and Peto method was used for the 2006-study (AS-AQ versus AM-LM) as the AM-LM arm showed 100% ACPR patients after PCR adjustment [Unlike the classical random-effect meta-analysis, where there is the same reference treatment or placebo across the trials, a pooled effect and summary OR versus a reference treatment could not be directly estimated since treatments were not the same from one study to the other . As the The treatment response per subject was viewed as a binary variable, i.e. 1 for ACPR and 0 for failure. Data were agglomerated on day 14 for all studies, and on day 28 based on both PCR- uncorrected and corrected results when the follow-up reached 28 days or more. The model estimated i) posterior OR for each treatment compared to the AS-AQ treatment, ii) the variability among subjects within sub-trials and iii) the variability among treatment groups, starting with reasonable prior distribution for each parameter.Data were analysed using the statistical software R . For theP < 0.05). Even among patients with relatively high initial parasitaemia , the mean pre-treatment haematocrit (28.5 ± 5.4%) increased to 34.6 ± 4.0% on day 14, i.e. increase by 6.2% , attesting the general benefit of an effective combination therapy.A total of 1,401 patients were enrolled in our series of studies . All analysed data are presented in a CONSORT format in Fig. P = 0.01), with an overall cure rate of 87% on day 14. In 2003, the efficacy of AQ-SP was not statistically different from AQ monotherapy (P > 0.05). There was no significant difference in the efficacy of AQ-SP between 2003 (145/156 or 93%) and 2006 (64/67 or 96%) on day 14 .With the AQ-SP treatment, the overall cure rate, i.e. ACPR, was 93.0% on day 14 and 78% on day 28 before PCR correction and 91% after PCR correction . AS-AQ combination was less effective than DH-PP . After PCR adjustment, the cure rates on day 28 were 92.7% and 88.0% for DH-PP and AS-AQ, respectively . Parasite clearance time was longer with DH-PP than AS-AQ (P < 0.05). Based on the ITT analysis, the AS-CD combination was less effective than AS-SP . After PCR adjustment, the cure rates on day 28 were 91.7% and 76% for AS-SP and AS-CD, respectively .From 2005 to 2007, the efficacy of artemisinin derivatives combined with a partner drug was assessed on day 28. The treatment outcomes of combination therapies, before and after PCR adjustment of the number of ACPR, are summarized in Tables P < 0.05). However, on day 3 (see Table P = 0.13). Moreover, more than 90% of patients cleared their parasitaemia on day 3, except for the AQ-SP combination and AQ monotherapy.Based on the PCR-corrected proportions of ACPR on day 28, there was no statistical difference in the efficacy of AQ-SP and AS-MQ combinations . The decrease in parasitaemia was more rapid with AS-MQ than AQ-SP on day 2 . Three patients were excluded due to repeated vomiting associated with AS-MQ administration.Treatment failure occurred in one out of 61 patients treated with AS-MQ on day 28. Failure was observed in five additional patients between day 29 and day 42. Vomiting in children treated with AS-MQ occurred more frequently than in the AQ-SP group, on day 1 (10.3% vs 1.5%), day 2 (10.8% vs 0) and day 3 (3.3% vs 1.6). Significant difference was observed on day 1 and 2 (P < 0.05) than that of AQ-SP, at both endpoints on day 14 and day 28. AM-LM and DH-PP were significantly more effective than AQ-SP on day 28.The logistic regression on pooled individual patient data (PCR-uncorrected) comparing the efficacy of ACT to that of AQ-SP showed that the efficacy of AQ-SP is not statistically different from that of AS-AQ, AS-MQ, AS-SP, and DH-PP on day 14 Table . HoweverThe results of the multi-treatment Bayesian random-effects meta-analysis based on individual data of children are shown in Figure The present work concerned a global analysis of a series of randomized studies of anti-malarial treatment efficacy conducted in Cameroon between 2003 and 2007. Following comparison between arms within each study, a multi-treatment Bayesian random-effects meta-analysis of the binary outcome, ACPR/failure as a marker of efficacy, was carried out both on day 14 and day 28. The latter used PCR-uncorrected and PCR-corrected data. This global approach increased the power for detecting differences between treatments, while controlling the type-1 error.Anti-malarials were AQ and SP monotherapies, their combination AQ-SP, and new drugs included in ACT. AQ monotherapy is still effective in Cameroon but should be protected with artesunate (or SP) to delay the emergence of resistance. The current trend in Africa is to reserve SP for the intermittent preventive treatment in pregnant women . During In Cameroon, AS-AQ and AM-LM have being used nationwide since 2007 although AM-LM is relatively less prescribed due to its low supply in the public sector. The present study indicates that AS-AQ is well-tolerated and highly effective, confirming the results of an earlier multicentric study conducted in Africa . Currenti.e. AS-SP, AS-CD, AS-MQ, DH-PP, that require once daily dose for three days, did not show a significant difference with AS-AQ. Previous studies have shown that AS-SP is a highly effective ACT [The forms of ACT, tive ACT . Howevertive ACT -22.P. falciparum infections for more than a decade [AS-MQ combination has been widely used in some Southeast Asian countries to treat multidrug-resistant a decade . Its effa decade -26. In ma decade ,28. The a decade ,29.Piperaquine, an 'old' bisquinoline synthesized in the 1960s and used extensively in China, has been found to be a suitable partner of dihydroartemisinin . Recent P. falciparum in Central Africa is not well defined at present. In countries where SP is largely employed for intermittent preventive treatment in pregnant women, it may not be advisable to use AS-SP for malaria treatment of the general population. Further studies are required to evaluate the optimal dosing of AS-MQ for African children. At present, it is probably too early to recommend AS-MQ in Africa as an alternative to other existing forms of ACT, which are better tolerated than AS-MQ. There are other novel forms of ACT, including artesunate-pyronaridine and artesunate-atovaquone-proguanil, that have not been evaluated in the present study. Clinical efficacy and tolerance of these combinations need to be evaluated and compared with those of AS-AQ and AM-LM in Central Africa.The results of these studies on the efficacy of AS-AQ and AM-LM are in agreement with those conducted elsewhere in Africa . The varThe authors declare that they have no competing interests.SWY developed the analysis plan and carried out both the statistical analyses and software implementations under the close supervision of HG and JCT. All participated in the interpretation of data. RT was responsible for checking the data and performing molecular techniques. VFN supervised the enrolment and follow-up of patients and participated in data entry and collection. GS designed the studies and assisted with data interpretation. LKB was responsible for overall scientific management and drafted the manuscript. All authors participated in the preparation of the report and approved the final version.Table S1: Pre-treatment clinical and laboratory characteristics of enrolled children who completed the 14-day or 28-day follow-up. 1 Patients were followed-up for 14 days in studies conducted in 2003 and for 28 days in studies performed in 2005-2007. Patients assigned to artesunate-mefloquine group were followed for 42 days. AQ, amodiaquine; SP, sulphadoxine-pyrimethamine; AS, artesunate; MQ, mefloquine; AM, artemether; LM, lumefantrine; CD, chlorproguanil-dapsone; DH, dihydroartemisinin; PP, piperaquine. 2 Number of patients enrolled . 3 The numbers of children aged > 60 months old (and/or adults for Maroua) are 18/57 in Garoua 2003 AQ, 16/58 in Garoua 2003 SP, 27/58 in Garoua 2003 AQ-SP, and 18/64 (28.1%) in Maroua (none at other study sites). Garoua and Maroua are situated in northern Cameroon where malaria transmission is seasonal. 4 The following number of patients had > 200,000 asexual parasites/μL of blood: 2 (1 in AQ group and 1 in SP group) in Yaoundé 2003; 5 (2 in AQ group and 3 in SP group) in Bertoua 2003; 3 (2 in AQ group and 1 in AQ-SP group) in Garoua 2003; 10 in Yaoundé 2005; 1 in Maroua; 4 in Yaoundé 2006a; 5 in Yaoundé 2006b; 7 (5 in AS-SP group and 2 in AS-CD group) in Yaoundé 2007a; and 11 (5 in DH-PP group and 6 in AS-AQ group) in Yaoundé 2007b.Click here for file

Many well-represented domains recognize primary sequences usually less than 10 amino acids in length, called Short Linear Motifs (SLiMs). Accurate prediction of SLiMs has been difficult because they are short (often < 10 amino acids) and highly degenerate. In this study, we combined scoring matrixes derived from peptide library and conservation analysis to identify protein classes enriched of functional SLiMs recognized by SH2, SH3, PDZ and S/T kinase domains.Our combined approach revealed that SLiMs are highly conserved in proteins from functional classes that are known to interact with a specific domain, but that they are not conserved in most other protein groups. We found that SLiMs recognized by SH2 domains were highly conserved in receptor kinases/phosphatases, adaptor molecules, and tyrosine kinases/phosphatases, that SLiMs recognized by SH3 domains were highly conserved in cytoskeletal and cytoskeletal-associated proteins, that SLiMs recognized by PDZ domains were highly conserved in membrane proteins such as channels and receptors, and that SLiMs recognized by S/T kinase domains were highly conserved in adaptor molecules, S/T kinases/phosphatases, and proteins involved in transcription or cell cycle control. We studied Tyr-SLiMs recognized by SH2 domains in more detail, and found that SH2-recognized Tyr-SLiMs on the cytoplasmic side of membrane proteins are more highly conserved than those on the extra-cellular side. Also, we found that SH2-recognized Tyr-SLiMs that are associated with SH3 motifs and a tyrosine kinase phosphorylation motif are more highly conserved.The interactome of protein domains is reflected by the evolutionary conservation of SLiMs recognized by these domains. Combining scoring matrixes derived from peptide libraries and conservation analysis, we would be able to find those protein groups that are more likely to interact with specific domains. To address this issue, we conducted a global statistical analysis on the conservation of SLiMs recognized by SH2, SH3, PDZ and S/T kinase domains scores (which measures the relative conservation of a motif) than those sites that do not bind to SH2 domains , including EGFR, IR, KIT, PDGFRB, IGF-IR, VEGFR2, ERBB2, FGFR1, HGFR, RET and TKR-A. We manually extracted interactions from the literature between one of these RTKs and one of the 21 SH2 domains we are studying here, which yielded a total of 76 interactions involving 56 unique Tyr-SLiMs (refer to Table S1 for detail). Using our SLiM conservation calculation, we found that reported SH2 binding sites have significantly higher ln of SLiMs in proteins from reported binding groups to the SH2 selectivity values of SLiMs in proteins from groups that are not reported to bind. We found that less than 40% of non-binding SLiMs have a selectivity value > 5, whereas over 80% of binding SLiMs have a selectivity value greater than 5. Higher selectivity values correspond to a higher specificity of interaction Figure . These rR) scores, compared to Tyr-SLiMs in PLC-γ1 binding proteins score was observed for SH2-recognized (SH2 selectivity ≥5.0) Tyr-SLiMs in cell cycle control proteins have significantly higher ln(CR) score than those not recognized by SH2 domains ; 11 of these are statistically significant (p < 0.05). In the receptor kinase and phosphatase group, 8 cases showed a significant increase in ln(CR) score. However, no significant increase in ln(CR) score was observed in the cell cycle control protein group have a higher average ln in representative protein functional classes taken from the Hprd database Figure . Those fFor SH3-recognized SLiMs Figure .Consistent with biochemical evidences that PDZ domains frequently interact with membrane proteins, we found that PDZ domain-recognized SLiMs Figure . Our resAs shown in Figure Remarkably, most functional classes of proteins with a significant conservation signal were highly specific for the signal within one group of domains, but not in other groups. For example, receptor kinase/phosphatase group show conservation signal only in SH2 domain group and transcription factors only in Ser/Thr kinase domain group Figure NevertheR) score between SLiMs with high selectivity and those with low selectivity. We also compared functional classes that are frequent, occasional or rare interaction partners for each domain by setting thresholds for the percentage of proteins in the functional class that either interact with or become phosphorylated by proteins containing that domain score between SLiMs with upper-medium to medium selectivity values and SLiMs with low selectivity values showed similar trends, but were less significant . In the above experiments, SLiMs for SH2 domains, PDZ domains or S/T Kinases with selectivity values of < 5, 5–10, 10–15, and > 15 were assigned to the categories of low, medium, upper medium and high selectivity, respectively; SLiMs with SH3 selectivity values of < 3, 3–6, 6–9, and > 9 were assigned to the categories of low, medium, upper medium and high selectivity, respectively.In order to further examine the specificity of the conservation signal, we calculated the conservation profile of SLiMs in each protein functional class by calculating the difference in ln and adaptor molecules have both SH2 and SH3 domains, and it has been suggested that proteins containing multiple SH3 binding sites are more likely to be tyrosine phosphorylated and bind to SH2 domains as supported by biochemical studies ,11. ConsWe further divided signal transduction groups into subgroups according to sub-cellular localization. Under selections for both the kinase motif and SH3 binding motifs, a high level of SLiM conservation was most manifest in signal transduction proteins localized to the cytoplasm or plasma membrane, but conversation of SLiMs was weaker for those proteins localized to the nucleus Figure . This isThese findings support the hypothesis that tyrosine kinases and SH3 domains are frequently coupled to SH2 domain signaling. The coupling between a tyrosine kinase and SH2 domains is expected, since an SH2 domain can only bind to a Tyr-SLiM after the tyrosine residue has been phosphorylated by a Tyr-kinase. However, the coupling between SH2 and SH3 domains might be less direct. Either a sequential model or a cooperative model, depending on whether the target tyrosine residue is phosphorylated before the interaction, may be used to explain the coupling between SH2 and SH3 domains Figure . In the Protein-protein interactions mediated by SLiMs have a widespread influence on cellular functions,13. In tHelicobacter pylori can be phosphorylated by Src and associates with Shp2 , then CR of the SLiM among different species is calculated as:If CR score greater than 1 indicates the SLiM is CR times more conserved than the average level of the protein. A score smaller than 1 indicates 1/CR times greater variability between species. Note that the number k may be different for different SLiMs according to the pair-wise Blast results.A CThis method may not be suitable for SLiMs longer than 10 amino acids, since it assumes that most residues in the SLiM could influence the interaction. This may not be the case in longer sequences where only a small subset of the residues is critical to binding. This method was first developed in our lab and has demonstrated its effectiveness in another research where SLFor a putative SLiM, the selectivity value for domains were calculated as the product of enrichment values from peptide library experiments ,44. For Please see Additional File The authors declare that they have no competing interests.SR was involved in design and planning of the experiments, has done the computational analysis and drafted the manuscript. GY, YH and YW were involved in carrying out experiments and computational analysis. YL was involved in planning of the experiments. ZC was involved in design and planning of the experiments, drafted the manuscript and headed the project. All authors have read and approved the final manuscript.Additional methods and results. This additional file presents additional methods and results related to this article.Click here for file

There are three N-[(anthracen-9-yl)­methyl­ene­amino]­thio­ureate ligands coordinated to the CoIII atom via three imine N and three thio­amide S atoms. The Co—S and Co—N bond distances are in expected ranges . The endocyclic S—Co—N bond angles in the five-membered chelate rings range from 82.91 (7) to 85.33 (7)°. The structure contains four water mol­ecules which are disordered over 12 sites and link the complex mol­ecules into a three-dimensional network through N—H⋯O, O—H⋯O, O—H⋯N, and O—H⋯S hydrogen bonds.In the title complex, [Co(C DOI: 10.1107/S1600536808031425/pv2097Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Sir,Low Negative ERCP rate - 5% (i.e. 16/316 cases)Technique used for CBD clearance 3. Technique used for CBD drainage 4. Indications of Bilio-enteric bypassWe thank Sir A. Cuschieri for interest in our article and apprFirstly, for the low negative ERCP rate, we would like to clarify that in this series ERCP was attempted in patients who had confirmed CBD calculi on radiological imaging (USG / MRCP) and not just the suspicion on biochemical investigations. As such, the negative ERCP rates are expected to be low but we would stress that even with evidence of CBD stone there was 5% negative ERCP rate.Secondly, regarding the technique of ductal clearance, we agree that trans-cystic approach is a much better method in terms of reduced morbidity to the patient. However, we did not have an access to fine choledochoscope needed for this procedure. To add further, the stones in this part of the country are too large and fill the entire CBD which precludes the trans-cystic explorationThirdly, as for CBD drainage we agree with Sir A. Cuschieri and accept both options (endobiliary antegrade stent and cystic duct drainage cannula - Fr 8). We also agree that drainage should be done in cases where choledochotomy and CBDE has been attempted. However, we prefer to stent rather than keeping trans-cystic cannula due to the morbidity of tube attached to the abdominal wall for up to two weeks and it being the potential route for infection. As for additive advantage of obtaining a post-op contrast study with cannula, we do not think it is needed if clearance of CBD has been confirmed by choledochoscopy.Finally, regarding Biliary Enteric Anastomosis, 59 patients (33%) who had undergone this procedure were mainly concentrated in the early part of our series when we did not have the choledochoscope in our infrastructure and so in cases with dilated CBD (> 15 mm) with a large calculi load where there was slightest suspicion of left out stone or recurrence we preferred doing side-to-side choledocho-duodenostomy since follow-up of patients cannot be guaranteed in this part of the country and they usually end up presenting late with complications. Now, with availability of choledochoscope, we do confirm complete clearance of CBD and so bilio-enteric drainage is rarely needed as indicated by Sir Cuschieri.

The bond parameters in N34DMPBA are similar to those in N34DCPBA and other benzanilides. The mol­ecules in N34DMPBA are packed into a column-like structure in the direction of the a axis through N—H⋯O hydrogen bonds.The conformation of the NH bond in the structure of the title compound (N34DMPBA), C Å b = 9.8123 (2) Å c = 28.5126 (8) Å V = 2548.24 (10) Å3 Z = 8 Kα radiationMo −1 μ = 0.07 mmT = 295 (2) K 0.33 × 0.11 × 0.08 mm Oxford Diffraction Xcalibur System diffractometerAbsorption correction: none21605 measured reflections2527 independent reflectionsI > 2σ(I)1448 reflections with R int = 0.035 R[F 2 > 2σ(F 2)] = 0.058 wR(F 2) = 0.194 S = 0.97 2527 reflections159 parameters3 restraintsH atoms treated by a mixture of independent and constrained refinementmax = 0.37 e Å−3 Δρmin = −0.19 e Å−3 Δρ CrysAlis CCD used to solve structure: SHELXS97 (Sheldrick, 1997SHELXL97 (Sheldrick, 1997ORTEP-3 (Farrugia, 1997DIAMOND (Brandenburg, 2002SHELXL97, PLATON (Spek, 2003WinGX (Farrugia, 1999Data collection: 10.1107/S1600536807066937/dn2302sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536807066937/dn2302Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Binding of IL-24 to either of its two possible heterodimeric receptors IL-20R1/IL-20R2 and IL-22R/IL-20R2 activates STAT3 and/or STAT1 in target tissues such as lung, testis, ovary, keratinocytes and skin. To date, the physiological properties of IL-24 are still not well understood but available data suggest that IL-24 affects epidermal functions by increasing proliferation of dermal cells. In stark contrast to its “normal” and physiological behaviour, IL-24 has been reported to selectively and efficiently kill a vast variety of cancer cells, especially melanoma cells, independent of receptor expression and Jak-STAT signalling. These intriguing properties have led to the development of adenovirally-expressed IL-24, which is currently being evaluated in clinical trials. Using three different methods, we have analysed a large panel of melanoma cell lines with respect to IL-24 and IL-24 receptor expression and found that none of the investigated cell lines expressed sufficient amounts of functional receptor pairs and therefore did not react to IL-24 stimulation with Jak/STAT activation. Results for three cell lines contrasted with previous studies, which reported presence of IL-24 receptors and activation of STAT3 following IL-24 stimulation. Furthermore, evaluating four different sources and modes of IL-24 administration no induction or increase in cell death was detected when compared to appropriate control treatments. Thus, we conclude that the cytokine IL-24 itself has no cancer-specific apoptosis-inducing properties in melanoma cells.IL-24, also known as melanoma differentiation antigen 7 (mda-7), is a member of the IL-10 family of cytokines and is mainly produced by Th Interleukin (IL) -24 (mda-7), a member of the IL-10 family of cytokines , has been discovered in 1995 by subtraction hybridization following “differentiation therapy” of melanoma cells: through treatment with IFN-β and a protein kinase C inhibitor (mezerein) neoplastic melanoma cells terminally differentiate and lose their proliferative capacity. By comparing gene expression profiles in treated versus untreated cells, mda-7 (amongst others) was identified to be up-regulated in non-proliferative and differentiated melanoma cells IL-24 (and IL-20) interacts with two different heterodimeric receptor complexes from the class II cytokine receptor family: IL-20R1/IL-20R2 and IL-22R/IL-20R2. On receptor-expressing cells, IL-24 activates the JAK-STAT pathway, shown by phosphorylation of STAT3 A recent and comprehensive study by Kunz and colleagues The first interest in IL-24 as a possible therapeutic agent for cancer came from observations that IL-24 transcripts or protein were gradually lost during advanced invasive progression of melanoma in vitroE.coli bacteria, has been reported to kill prostate, breast and pancreatic carcinoma cell lines Despite this advanced stage of clinical testing many fundamental questions regarding the tentative IL-24-mediated selective killing of cancer cells remain to be answered. For example, conflicting data exist, concerning the effects of IL-24 expressed and delivered by routes other than the adenoviral over-expression system. IL-24 secreted from transfected human embryonic kidney cells (Hek) was shown to elicit apoptosis of various cancer types Depending on the type of cancer under investigation many different signalling molecules and pathways are believed to actively partake in the IL-24-mediated killing of target cells , were evaluated for classic Jak-STAT activation following IL-24 stimulation. In parallel, we analysed related IL-10-type cytokines, IL-19 and IL-20. To determine if STAT activation, in response to these recombinant cytokines follows a distinct kinetic, we stimulated 4 selected cell lines with 100 ng/ml of IL-24, IL-20, and IL-22 in addition to control treatments with OSM and IFN-γ over three different periods of time . Focusing on IL-24, we then performed standard dose-response and extended kinetic studies on HaCaT keratinocytes and the two melanoma cell lines MeWo and Wm35. Classic cytokine signalling events require the binding of a cytokine to its receptor(s), an event which results in the transphosphorylation and activation of Jaks. Subsequently, active Jaks phosphorylate tyrosine residues within the receptor cytoplasmic domain, which form docking sites for STATs. Jaks then tyrosine-phosphorylate receptor-bound STATs so that active STAT dimers can finally translocate to the nucleus where they initiate transcription by binding to response elements in the promoter of a target gene IL-24 signals through two heterodimeric receptor complexes, which share the short IL-20R2 chain but have distinct longer alpha chains: IL-20R1 and IL-22R Recently, it has been shown that primary keratinocytes harbour high mRNA amounts for IL-20R2 and approximately 10-fold less for IL-22R followed by very low levels of IL-20R1 mRNA Since levels of mRNA do not necessarily reflect actual protein expression, we analysed total cell lysates for the presence of IL-24 and its receptors by western blot . CommercTaken together, melanoma cell lines evaluated in this study did not express sufficient amounts of specific receptor pairs, which could mediate effects brought about by the cytokine IL-24. Hence, the “bystander” effect that secreted IL-24 has been reported to have on receptor-positive cancer and melanoma cells Exogenously administered recombinant cytokines were analysed with regard to their growth-modulating properties on a selection of melanoma cells . No growHaving established that commercially available recombinant cytokines expressed in mouse myeloma NSO cells (IL-24) or bacteria have no growth-modulating effect on melanoma cells, we continued to examine different sources of recombinant IL-24 for their impact on melanoma cells.Sauane and colleagues Since we did not detect any apoptosis-inducing properties of either the bacterially produced GST-IL-24 or the commercially available IL-24 (from mouse cells), we proceeded to produce FLAG-tagged IL-24 from supernatants of transfected Hek cells (Hek-IL-24) as has been described before [7]. ThiIn agreement with the latter, we did not observe increased apoptosis or inhibition of proliferation in A375, Wm9, MeWo or HaCaT cells following incubation with crude Hek supernatant containing approximately 40 ng/µl of recombinant IL-24 or with Finally and to test the possibility that only intracellularly over-expressed IL-24 would render cancer cells more susceptible to apoptosis, we transiently transfected melanoma and Hek cells with either full length IL-24 or IL-20 as well as with a construct that contains full length IL-24 together with a KDEL ER-targeting sequence (KDEL) as several studies have recently postulated that the apoptosis-inducing effects of IL-24 are mainly mediated by triggering ER stress responses in vivo and in vitro, leaving healthy cells unharmed that had previously been described to be receptor-positive and to react to an IL-24 stimulus with STAT3 activation. Activation of STAT3 had, however, been scored by a rather unspecific immunofluorescence assay, in which translocation of STAT3 to the nucleus was enumerated In agreement with Kunz et al. The receptor chains IL-20R1 and IL-22R seem to be widely expressed in many tissues, nevertheless, expression of a functional receptor for IL-24 depends on the presence of IL-20R2, the common chain for both receptor pairs Considering the calculations given by Kunz et al. To establish whether the cytokine IL-24 itself has the ability to induce apoptosis of cancer cells, we reasoned that delivery modes other than adenovirus-mediated over-expression of IL-24 should also be able to elicit cell death. Sauane and colleagues Next, we tested the properties of IL-24 produced from transfected Hek cells. Using crude or affinity purified Hek-IL-24, again no increase in apoptosis or reduced proliferation was observed relative to untreated cells or cells treated with accordingly produced IL-20 and thisTransient or stable inducible over-expression of proteins can trigger ER stress responses, which ultimately drive the host cell into apoptosis In summary, the ability of IL-24 to selectively and efficiently induce apoptosis of melanoma and many other cancer cells could not be reproduced using either commercial IL-24, bacterially expressed GST-IL-24, IL-24 secreted from transfected Hek cells, or transient over-expression of different IL-24 constructs. As none of the assayed melanoma cell lines expressed functional receptor pairs for IL-24, it was not surprising that Hek-IL-24 did not trigger increased cell death and in view of this, it seems questionable whether secreted IL-24 from transfected or infected cells could induce so-called bystander effects on receptor-negative melanoma cells. Finally, we could not detect significant cell death upon intracellular over-expression of IL-24 suggesting that the beneficial outcome seen after transduction of cancer cells with Ad-IL-24 may be due to combinatorial effects of IL-24 over-expression achieved via cancer-targeted adenovirus infection only. Adenoviral infection may lead to an upregulation of interferons and/or IL-24 receptors, which, in synergy with over-expressed IL-24 could possibly account for the previously observed therapeutic effects of Ad-IL-24. In view of this, care should be taken when attributing the cytokine IL-24 itself with apoptosis-inducing properties on melanoma cells.2. The keratinocyte cell line HaCaT was grown in DMEM supplemented with 10% FCS, 50 µg/ml penicillin, and 100 µg/ml streptomycin; normal human melanocytes (NHEM) were maintained according to the supplier's instructions in complete MGM-4 medium. Hek293 cells were grown in DMEM (supplemented with 10% FCS and antibiotics as above). All cultured cells were routinely tested to be negative for mycoplasma contamination.In total, 12 mycoplasma-free melanoma cell lines were analysed: A375 , Wm9, Wm35, Wm239, Wm902B, SKMel30, MelJuso, MelIm, IPC298, G361, IGR37, and MeWo. All cell lines were cultured in RPMI, supplemented with 10% FCS, 50 µg/ml penicillin, 100 µg/ml streptomycin, 0.5 mM L-glutamin in a humidified atmosphere with 5% COThe following antibodies were used for protein detection in western blots: STAT3, STAT1 ; STAT5 (Santa Cruz); P-STAT3-Tyr705; P-STAT1-Tyr701, P-STAT5-Tyr694 . HRP-labeled secondary antibodies were purchased from Dako . Antibodies directed against Fin13 or actin (Chemicon) were used as loading controls where applicable.For stimulation experiments, cells were treated for the indicated times with different concentrations of recombinant cytokines IL-19, -20, -22 , IL-24 , OSM, IFN-γ, IFN-α , GST-IL-24 or Hek-IL-24 (see below).3VO4, 10 mM PMSF, 1 mM benzaminidine, 5 µg/ml aprotinin, 3 µg/ml pepstatin, 5 µg/ml leupetpin) and the concentration of total cell lysates was determined by Bradford assay . Fifty µg of total lysates were boiled for 5 min at 95°C and loaded on a 10% SDS-PAGE gel. Proteins were transferred onto a PVDF membrane and detected with the relevant antibodies. Before re-probing, membranes were stripped for 30 min at 70°C in 62.5 mM Tris, 2% SDS, pH 6.7 and 78 µl ß-mercaptoethanol/10 ml buffer. Alternatively, for re-probing with phospho-specific antibodies, blots were stripped for 4–5 h at room temperature in 2 M glycine, pH 2.5 with 1 g of SDS for each blot, washed extensively in H2O, blocked for 1 h (TBS+5% BSA), and incubated with the next antibody. For highly sensitive detection of chemiluminescent signals, the ECL solution pCA was used as described Cells were seeded in appropriate culture vessels and were grown to approximately 90% density, washed 1× with PBS, followed by direct lysis on ice with Laemmli buffer ; generally 400 µl were used for 1 well from a 6-well plate. Alternatively, cells were lysed in lysis buffer . Increasing concentrations of cytokines or other compounds were added for different lengths of time as indicated. WST-1 reagent (5 µl/well) was added for 30 min at 37°C and absorbance was measured at 450 nm.For apoptosis assays, 750 000 cells were grown in quadruplicate in 6-well plates with addition of GST, GST-IL-24, Hek-control supernatant (Hek-ctrl), Hek-IL-24 or commercial recombinant cytokines for 48h or 72h. Cells were harvested and processed as described in the Annexin V-FITC Apoptosis Detection kit II manual . FITC and Propidiumiodide fluorescences were measured using a BD FACS Canto II (Becton Dickinson). Alternatively, cells were transiently transfected with pcDNA vector (mock control), pcDNA expressing full length IL-24, full length IL-20, or a pcDNA construct expressing IL-24 together with a KDEL sequence, which targets recombinant proteins to the endoplasmic reticulum (ER). Cells were transfected using the Nucleofector technology according to optimised protocols provided by Amaxa for Hek, A375 and Mewo cell lines and apoptosis was measured as described above after 48 and 72h. To control for successful transient expression of transfected proteins, correspondingly treated samples were washed with PBS and lysed directly on ice with 1× Laemmli buffer followed by western blot analysis.20 for priming. The newly synthesised cDNA was additionally treated with 2 units of RNase H at 37°C for 30 min.Total RNA was extracted from cells grown on a 10 cm petri dish (∼90% confluent) using the RNeasy Mini Kit according to the manufacturer's instructions with additional on-column DNase digestion. 1 µg of RNA was reverse transcribed using the Thermoscript RT PCR System (Invitrogen) and 50 mM oligo(dT)2, 0.2 mM dNTP mix, 10 pmol of each of the corresponding primers (Taq DNA Polymerase (Invitrogen).Amplification of the target genes with standard RT-PCR was performed on cDNA amounts equivalent to either 100 ng or 10 ng of RNA input. A 50 µl reaction consisted of 1× PCR buffer, 1.5 mM MgCl primers and 1 U/−ΔΔCt method was used to calculate the fold-relationships in gene expression between the tested melanoma lines Quantitative real time PCR (qPCR) was carried out on a MyiQ Single-Color Real-Time PCR Detection System (BIORAD). The reaction volume was 25 µl containing cDNA diluted to the equivalent of 12.5 ng RNA, 10 pmol of each primer, and 12.5 µl of iQ SYBR Green Supermix (BIORAD). The thermal cycling conditions for all qPCR assays included an initial enzyme activation step at 95°C for 3 min, followed by 40 cycles of denaturation at 95°C for 10 s and annealing at 60°C for 30 s. The PCR for the housekeeping gene TATA-binding protein (TBP), which was found to have medium but constant/similar mRNA levels across the different melanoma cell lines, and the target genes were performed in parallel for each sample. All samples were run in triplicate and in 3 independent experiments. The primers used for the amplification of the target genes are listed in 600 of 1.4 and then inoculated into 200 ml of LB (+2% glucose) medium. When the OD600 reached 0.4, temperature was dropped to 18°C. At an OD600 of 0.6, protein production was induced with 0.5 mM IPTG for 3 h at 18°C. Cells were harvested by 15 min centrifugation at 5000 rpm and the pellet was lysed in 40 ml lysis buffer in 50 ml lysis buffer) followed by 4 freeze (15 min dry ice)/thaw (10 min 37°C) cycles. 25 ug/ml DNase was added for 30 min at room temperature to the lysate, which was then clarified by 30 min centrifugation at 4°C. Subsequently, GST-containing proteins were affinity-purified by incubation with washed and equilibrated glutathione sepharose 4B slurry (Amersham Biosciences) (750 µl) overnight at 4°C. The sepharose was pelleted at 1000 rpm for 5 min (4°C) and washed 4×15 min with 7.5 ml PBS each. Fusion proteins were eluted with 500 µl elution buffer for 90 min rotating at room temperature followed by a second and third elution for 45 min each. Quality and purity of fusion proteins was verified on Coomassie gels and by western blot. Protein concentrations were determined using a standard Bradford assay (Biorad).For generation of GST-IL-24 (or synonymously GST-mda7) fusion proteins, full length IL-24 was amplified from RNA extracted with the RNeasy mini kit from HaCaT cells using RT-PCR primers listed in For ease of subsequent cloning steps, we modified the pcDNA5/FRT/TO vector (Invitrogen) by introducing a new multiple cloning site (MCS) containing restriction sites for the following enzymes: BsiWI, AscI, SbfI, SgrAI, FseI, PacI, and SwaI. For this, oligos with HindIII and NotI overhangs were synthesised , annealed, and then ligated into HindIII- and NotI-opened pcDNA5/FRT/TO resulting in the modified vector pcDNAmod. Forward oligo: 5′AGCTTCGTACGAAGGCGCGCCTACCTGCAGGTTTCACCGGTGTAAGGCC GGCCTGATTAATTAAGTAATTTAAATGC, Reverse oligo: 5′GGCCGCATTT AAATTACTTAATTAATCAGGCCGGCCTTACACCGGTGAAACCTGCAGGTAGGCGCGCCTTCGTACGA. Using standard cloning procedures, full length IL-24 was inserted into pcDNAmod. For this, the target was PCR-amplified from pGEX-5X1/IL-24 (described above) using primers listed in 2SO4 and absorbances were measured at 450 nm. Concentrations of affinity-purified IL-24 ranged between 3–8 ng/µl.Hek293 cells were transiently transfected with pCEP-FLAG vector, pCEP-FLAG-IL-20, or pCEP-FLAG-IL-24 vector as described before

Differences in duration of bone healing in various parts of the human skeleton are common experience for orthopaedic surgeons. The reason for these differences is not obvious and not clear.In this paper we decided to measure by the use of real-time RT-PCR technique the level of expression of genes for some isoforms of bone morphogenetic proteins (BMPs), whose role is proven in bone formation, bone induction and bone turnover. Seven bone samples recovered from various parts of skeletons from six cadavers of young healthy men who died in traffic accidents were collected. Activity of genes for BMP-2, -4 and -6 was measured by the use of fluorescent SYBR Green I.It was found that expression of m-RNA for BMP-2 and BMP-4 is higher in trabecular bone in epiphyses of long bones, cranial flat bones and corpus mandibulae then in the compact bone of diaphyses of long bones. In all samples examined the expression of m-RNA for BMP-4 was higher than for BMP-2.It was shown that m-RNA for BMP-6 is not expressed in the collected samples at all. It is postulated that differences in the level of activation of genes for BMPs is one of the important factors which determine the differences in duration of bone healing of various parts of the human skeleton. Bone mass is a changeable parameter. Its peak is reached in the age of 30–35 years. Bone turnover is under the control of two cell populations – osteoblasts and osteoclasts. These cells are influenced by many factors which control the balance of bone formation and bone resorption. The same cell populations and factors are active in bone healing. Bone morphogenetic proteins (BMPs) are involved in many processes which take place in bone formation, bone induction, and bone regeneration as e.g. callus formation in the course of bone healing. The full picture of bone turnover is not completed as yet, although many factors and interactions are well described. The complexity of bone turnover involves the long list of about 200 factors influencing each other in various physiological and/or pathological situations. PTGF (platelet derived growth factor) and TGF-β (transforming growth factor – beta) together with the BMPs are the most important factors in the process of bone healing. The new research data makDifferences in the dynamic of bone healing in various parts of skeleton are well documented in literature. In population of healthy people the cortical bone heals within 4–8 months, and trabecular bone in 3–6 months. The healing of cranial bones can take from several weeks to 5 years. Broken mandible heals normally during 3–4 weeks. It takes several months for healing of broken bones of pelvis. Broken humeri are healed in 3–6 months. Similar time is needed for healing of femurs. Complexity of orthopaedic situation has important influence on time of bone repair -7.BMPs play very important role in bone physiology influencing bone growth, turnover, bone formation and cartilage induction . Their iAccording to the literature BMPs -2,The aim of this paper is to show that, in spite of incomplete knowledge of the mechanisms of bone homeostasis, some important differences exist at the molecular level, which can explain the differences in the dynamic of healing of distinct parts of human skeleton. By the use of quantitative real-time RT-PCR we were able to show the differences in the level of expression of some isoforms of BMPs in various bones or their parts.The results were confirmed by the analysis of the electrophoretic bands.post mortem from six cadavers of young healthy men who died in traffic accidents were frozen. Biopsies were taken from seven different bones. The cadavers are treated as "young healthy" after the routine serology done for all tissue bank donors. Biopsies (5–7 cm long and 2–3 cm wide) were taken from seven different bones. Bone marrow was removed from trabecular bone by the routine technique used in our bone bank. There were: cranial flat bones, corpus mandibulae, diaphysis radii, distal epiphysis radii, ala ossis ilii, diaphysis femoris and distal epiphysis femoris. Total RNA was extracted using TRIzol Reagent (GIBCO BRL) according to manufacturer's recommendations. Frozen in liquid nitrogen and physically powdered bone (200 mg) was suspended in 1 ml of TRIzol Reagent, vortexed and incubated 30 min at room temperature with continuous horizontal rotation. The RNA pellet was dissolved in 20–30 μl of sterile diethylpyrocarbonate-treated Mili-Q water and quantified spectrophotometrically at 260 nm. The quality of the extracted RNAs was verified by agarose gel electrophoresis. RNAs were stored as a water solution at -70°C. The "donors" were transported after accidents to the Dept. of Forensic Medicine and located for the night in cold compartments. The samples were collected in the morning after medico-legal section and frozen in dry ice. We never attempted the investigation on degradation of beta-actin or BMPs – mRNAs as a function of time.Forty two biopsies of normal bone tissue taken 12–18 primers from 5 μg of total RNA using SUPERSCRIPT First-Strand Synthesis System for RT-PCR (GIBCO BRL) accordingly to the manufacturer's instruction.Single stranded complementary DNA (cDNA) was synthesized with oligo(dT)® 2 Real-Time Detection System (MJ Research) three times for each probe starting with 10 – 15 min of preincubation at 94°C followed by 45 amplification cycles as follows: 94°C for 1 min, annealing temperature for 1 min and 72°C for 1 min. Beta-actin was used as housekeeping gene for arbitrary unit calculation for every tested gen. Additionally product identity was confirmed by electrophoresis on a 1.7% agarose (GIBCO BRL) gel and visualized by ethidium bromide (SIGMA) staining under UV light.Accumulation of PCR products was measured in real-time by using QuantiTect SYBR Green PCR Kit (Qiagen). The sequences of primers are listed in Table Statitistics: All statistical analysis was performed using the STATISTICA 5.0 software . We compared the analysed groups using the analysis of variance (ANOVA). Levels of statistical significance was set as p = 0,05: S-significant difference , NS – no statistical difference was found .Real-time PCR technique was very useful for detection, determination and comparison of three BMP isoforms expressions. The use of β-actin gene expression as a housekeeping gene allowed for calculation of arbitrary units and for comparison of BMP-2, BMP-4 and BMP-6 genes expression not only between them but also between different types of bones. Obtained results showed significant expression of two isoforms of these proteins – BMP-2 and BMP-4 Figures and elecIn this paper we demonstrated the differences in expression of m-RNA for isoforms BMP-2, BMP-4 in various parts of the human skeleton declare that they have no competing interests.All authors contributed equally to this workThe pre-publication history for this paper can be accessed here:

Population-based association studies are used to identify common susceptibility variants for complex genetic traits. These studies are susceptible to confounding from unknown population substructure. Here we apply a model-based clustering approach to our case-control study of stroke among young women to examine if self-reported ethnicity can serve as a proxy for genetic ancestry.Structure program was used to iteratively evaluate for K = 1 to 5 potential genetic-based subpopulations. Evaluating the population as a whole, the Structure output plateaued at K = 2 clusters. 98% of self-reported Caucasians had an estimated probability ≥50% of belonging to Cluster 1, while 94% of self-reported African-Americans had an estimated probability ≥50% of belonging to Cluster 2. Stratifying the participants by self-reported ethnicity and repeating the analyses revealed the presence of two clusters among Caucasians, suggesting that potential substructure may exist.A population-based case-control study of stroke among women aged 15-49 identified 361 cases of first ischemic stroke and 401 age-comparable control subjects. Thirty single nucleotide polymorphisms (SNPs) throughout the genome unrelated to stroke risk and with established ancestry-based allele frequency differences were genotyped in all participants. The Among our combined sample of African-American and Caucasian participants there is no large unknown subpopulation and self-reported ethnicity can serve as a proxy for genetic ancestry. Ethnicity-specific analyses indicate that population substructure may exist among the Caucasian participants indicating that further studies are warranted. Population-based case-control studies are used to identify common susceptibility variants for complex genetic traits; however, population stratification may confound their results ,2. PopulThe Stroke Prevention in Young Women (SPYW) Study is a population-based case-control study initiated to examine risk factors for first ischemic stroke in women aged 15-49. All participants were identified from the same population including all of Maryland (except the far Western panhandle), Washington DC, and the southern portions of both Pennsylvania and Delaware. The methods for discharge surveillance, chart abstraction, and case adjudication have been described previously includin2 > 10) in allele frequencies between individuals from Utah with European ancestry (CEU) and individuals from Nigeria (YRI) [Twenty ancestry informative markers (i.e. SNPs) were chosen from a HapMap panel previously shown to differ (χia (YRI) . Ten addGenotyping was conducted using DNA isolated from whole blood using the QIAamp DNA Blood Maxi Kit . SNP genotyping was performed by either TaqMan or iPLEX methodologies. For each SNP, genotyping for all cases and controls was performed on the same platform.2 test). Major allele frequency differences between self-reported Caucasians and African-Americans were calculated (χ2 test). Analyses were performed using SAS®, Version 9.1 exhibited genotype call rates less than 80% and one SNP (rs2695) did not exhibit a difference in allele frequencies between our Caucasian and African-American populations. Hence, 26 SNPs distributed throughout the genome were included in the analyses ) was generated. Similar self-reported ethnicity-specific analyses were also performed.Model-based clustering for inferring population structure was performed using software . An admiStructure was implemented to assess information about the distribution of Q, the estimated membership coefficients for each individual in each cluster. When this function is activated, the output file includes the left- and right-hand ends of the probability intervals for each q(i). The ANCESTDIST (Boolean) function of Demographic and risk factor characteristics by case-control status are described in Table 2 comparison values.Table Structure output (log Pr (X | K) (denoted in Table Table 1) log Pr (X | K) plateaus at K = 2.2) Dirichlet parameter for amount of admixture (α) converges to a value < 0.2 once the Markov chain converges.3) Most individuals are strongly assigned to one of the two populations.Figure Structure ANCESTDIST option provided the 90% probability intervals for each individual. Of the 760 individuals, 130 (17%) have overlapping probability intervals. Hence, 83% of the study population demonstrated individual ancestry proportion estimates that had non-overlapping 90% probability intervals.The Ethnicity specific exploratory analyses (demonstrated in Table Our results indicate that among the combined sample of African-American and Caucasian participants, self-reported ethnicity can serve as a proxy for genetic ancestry or relatedness. Furthermore, no large unknown subpopulation was identified. The ethnicity-specific analyses demonstrate no clear substructure in self-reported African American participants. This differs from the accepted idea that greater genetic diversity, as measured by linkage disequilibrium, is seen in populations of African origin. The lack of substructure in our African-American participants may be related to limitations of our panel. Interestingly, the ethnicity-specific analyses do demonstrate that some population substructure may exist among self-reported Caucasian participants. Evaluation of substructure in Americans of European decent has shown a course separation of European populations along a northeast to southwest axis . In thisIn summary, among the combined population, a small number of individuals were genetically more consistent with the other ancestry. Specifically, with a 50% ancestry threshold, 22 self-reported African-Americans were more consistent with Caucasian ancestry, while 10 self-reported Caucasians were more consistent with African-American ancestry. This information may be incorporated into future association analyses in various ways. Individuals not satisfying an ethnicity-based ancestry threshold could simply be removed from the study. Alternatively, as mentioned above, more null markers could be genotyped to improve the ancestry classification. Lastly, a variable incorporating percentage of ancestry could be introduced into the association analyses.Among our combined sample of African-American and Caucasian participants there is no large unknown subpopulation and self-reported ethnicity can serve as a proxy for genetic ancestry or relatedness. Ethnicity-specific analyses indicate that population substructure may exist among the Caucasian participants indicating that further studies are warranted.The authors declare that they have no competing interests.All authors certify that they participated in the conceptual design of this work, the analysis of the data, and the writing of the manuscript to take public responsibility for it. All authors reviewed the final version of the manuscript and approve it for publication. JBM, JWC, BDM and SJK: participated in the writing of the initial draft. JWC, MAW, BJS and SJK: participated in data collection. JBM, TDH and OCS: participated in the genotyping. JBM, JWC, JRO, LRM, BDM, and JDS: participated in the data analysis. All authors provided critiques of the final manuscript.

Ultrasound imaging technology has wide applications in cattle reproduction and has been used to monitor individual follicles and determine the patterns of follicular development. However, the speckles in ultrasound images affect the post-processing, such as follicle segmentation and finally affect the measurement of the follicles. In order to reduce the effect of speckles, a bilateral filter is developed in this paper.We develop a new bilateral filter for speckle reduction in ultrasound images for follicle segmentation and measurement. Different from the previous bilateral filters, the proposed bilateral filter uses normalized difference in the computation of the Gaussian intensity difference. We also present the results of follicle segmentation after speckle reduction. Experimental results on both synthetic images and real ultrasound images demonstrate the effectiveness of the proposed filter.Compared with the previous bilateral filters, the proposed bilateral filter can reduce speckles in both high-intensity regions and low intensity regions in ultrasound images. The segmentation of the follicles in the speckle reduced images by the proposed method has higher performance than the segmentation in the original ultrasound image, and the images filtered by Gaussian filter, the conventional bilateral filter respectively. Ultrasound imaging technology has wide applications in cattle reproduction and has been used to monitor individual follicles and determine the patterns of follicular development -6. The aIn the applications of ultrasound imaging to monitoring individual follicles and determining the patterns of follicular development, the acquisition of the measurements of the individual follicles such as diameters, areas and perimeters is very important. In order to acquire the measurements of an individual follicle, image segmentation techniques are often used to extract the individual follicles. However, speckles in ultrasound images affect the segmentation and finally affect the measurement of the follicles. Speckle noise, seen as a granular structure, is caused by the interaction between the ultrasound waves and the scatters within the tissue . The inhIn this paper, we will investigate using bilateral filter to reduce the speckles in ultrasound images for cattle follicle segmentation. It is well known that bilateral filter has good performance in noise reduction and edge preservation. However, current existing bilateral filters are mainly used for additive noise reduction. It is not effective when it is applied to speckles, which are generally modelled as multiplicative noise. In order to solve this issue, we propose an adaptive bilateral filter, which can reduce the speckles effectively.Bilateral filter was developed by Tomasi and Manduchi . The basJ (Y) is the input pixel values, X and Y are the coordinates vectors,d σ 2 and rσ 2 are the parameters controlling the fall-off of weights in spatial and intensity domains, respectively, N(X) is a spatial neighborhood of pixel J(X), || || is Euclidean distance, C is used for the normalization and is expressed as [where essed as 17] is the oX and Y are 2-D vectors, the bilateral filter is called 2-D bilateral filter, which can be used to reduce the noise in 2-D images.In the above equation, when dσ 2 and rσ 2 is very important. If their values are set too high, the filter will act as a smoothing filter and will blur the edges. If their values are set too low, the noise cannot be removed. Generally speaking, the choice of dσ 2 and rσ 2 depends on the variance of the noise. Based on the research in al alσ Generally speaking, noise can be modelled by an additive model or a multiplicative model. Additive noise model is the simpler case of the two and can be described by a linear modelJ(X) = I(X) + n(X) (3)J(·) is the noised image, I(·) is the original image and n(·) is the noise. Multiplicative noise is generally expressed by a multiplicative modelwhere J (X) = I (X) * n(X) (4)It is well known that multiplicative noise appears much worse in bright image regions than dark regions since it multiplies the gray intensities.Speckle noise is generally treated as multiplicative noise and can be modelled using equation (4). Thus, compared with other types of noise, speckle noise is generally difficult to be removed. Our research below shows that the conventional bilateral filter described in equation (1) and (2) generally gets bad results when it is applied to speckle reduction directly. Thus, the bilateral filter described in (1) and (2) needs improvement or enhancement so that it can be applied to reduce the speckles in images effectively. In order to do this, we will first analyze the behavior of J(Y) and J(X) be two different pixels from image J. If J is corrupted by additive noise, then we can use equation (3) to compute the difference between these two pixelsLet J(Y) - J(X)|| = ||I(Y) + n(Y) -I(X) - n(X)|| (5)||J(Y) and J(X) are from the same homogenous region, then we have I(Y) = I(X), thusIf both J(Y) - J(X)|| = ||n(Y) - n(X)|| (6)||J is corrupted by multiplicative noise, then we can use equation (4) to compute the difference between these two pixels. From equation (4), we haveEquation (6) means that the difference between any two pixels from the same homogenous region is only related to the difference of the noise. If J(Y) - J(X)|| = ||I(Y) * n(Y) - I(X) * n(X)|| (7)||J(Y) and J(X) are from the same homogenous region, then we have I(Y) = I(X), thusSimilarly, if both J(Y) - J (X)|| = ||I(X)||||n(Y) - n(X)|| (8)||From equation (8), we can understand that the difference between two pixels in the same homogenous region(in the image corrupted by multiplicative noise) is not only related to the difference of the noise. It also depends on the intensity of the region. As is seen in equation (8), the difference is big when the intensity of the region is big while the difference is small when the intensity of the image is small.rσ 2 is fixed in the processing, when rσ 2 is set to be big, the edge in lower intensity regions will be removed, while the noise can’t be removed in the higher-intensity regions when rσ 2 is set to be small. Thus, in order to develop an effective bilateral filter to remove the speckle, we need to develop a new representation of the difference. Dividing each side of equation (8) by ||J (X)||, in the homogenous regions, we haveThe above analysis shows the bilateral filter described in (1) and (2) is not suitable for removing speckle noise, which is multiplicative noise. The reason lies in the difference of the corrupted image has different distributions in different homogenous regions. For example, if Equation (9) shows that the normalized difference is only related to the noise and doesn’t depend on the intensities of the region. Thus, the proposed adaptive bilateral filter can be expressed as followswhereBilateral filter is famous because it is non-iterative, however, the non-iterative bilateral filter doesn’t yield good results. In order to improve its effectiveness, we use iterative bilateral filter. The basic idea of iterative bilateral filter is to use the filtered image obtained by equation (10) as the input of equation (1) and implement it many times, the mathematical expression is as follows:whereWhere In order to analyze and monitor the reproduction of cattle, the acquisition of some quantitative parameters is very important. These parameters include diameters, areas and perimeters of the follicles. These parameters can be used to monitor the development and maturity of follicles. In order to get these parameters, we need to segment the follicles.Many image segmentation methods have been proposed, which includes histogram based methods, edge detection based methods, region based methods, active contour model based methods, etc. Active contour model based methods have drawn a lot of attention in the past decade because of their significant advantages. In this paper, we adopt active contour model based method for the segmentation of the follicles. An active contour or a snake is defing is a decreasing function of the edge-force magnitude and is defined as follows:where k is a non-negative smoothing parameter for the field . The functional described by equation (15) smoothes the force field only when the edge strength is low. Solving the energy functional optimization problem in (14), we can obtain the generalized gradient vector flow, which can be used as external forces that attract the snake to the follicle boundary [Here boundary 21]..k is a nP0 through mP. The knot-value sequence is a non-decreasing sequence of knot values t0 through mt+4, and iQ is a curve segment defined by control points i-P3, i-P2, i-P1, iP and blending functions i-B3,4, iB-2,4, iB-1, 4, iB, 4 (t) as follows 24].[24].23][.[24].23] follows :iQ (t) = i-P3 · Bi-3, 4 + Pi-2 · iB-2,4 + iP-1 · iB-1,4 + iP · iB,4 (t) (16)≤ i ≤ m and i ≤ t ≤ ti+t1. The blending functions can be obtained using recursion as follows 25].[25].p=4,.[25].p=4For the segmentation of the follicles, we initialize the B-spline GVF snake using a circle inside each follicle. The circle is represented by B-spline and the number of control points is set to 48 in this paper. Then, starting from the initial contour, the GVF is used to drive the contour to the boundary of the follicle. The evolution of the contours is the same as that in the B-spline GVF snake in single scale proposed by .α and edge preservation parameter β[To test the effectiveness of the proposed bilateral filter, we used both conventional bilateral filter and the proposed bilateral filter to process the synthetic image with speckles and compare the results. Fig.rameter β. The NMSrameter β0 and I are the original image and the corrupted image, respectively, N is the pixel number of the image I0 (or) I, 0, respectively. The NMSE generally represents the difference between the original image and the processed image. The noise reduction measure is defined as [where Ifined as whereThe edge preservation parameter is given by α and β represent better performance in noise reduction and edge preservation.where Δ is the Laplacian operator. Higher dσ was fixed to be 3 and rσ was set to be ranged from 0.1 to 1.0. We use the iterative scheme in the conventional bilateral filter and the proposed filter, iteration is 5 for the two filters. The values of NMSE, α and β obtained from the processed images are given in Fig.rσ is small, we have big NMSE values, small α and β values for both filters. This result means that both filters have poor performance in noise suppression and edge preservation when rσ is small. When rσ increases, the performance (in both noise reduction and edge preservation) of both filters will be improved and then the best performance is achieved when some rσ is reached. We call the rσ which makes a filter have the best performance as the optimal point, denoted by rTσ . Obviously, the two filters have different optimal points and the performance of a filter will become worse when rσ is bigger than its optimal point rTσ . The above quantitative measurement also reveals that the conventional bilateral filter behaves better than the proposed bilateral filter when rσ is small, and the proposed bilateral filter outperforms the conventional bilateral filter quickly with the increase of rσ . However, at the optimal points, the proposed bilateral filter has better performance than the conventional bilateral filter.The conventional bilateral filter and the proposed bilateral filter were applied to process the speckled images. In both filters, rσ = 0.3 and the proposed bilateral filter with rσ = 0.7 respectively. In Fig. rσ = 0.3, which is the same as the setting in Fig.α and β are 0.1391, 0.9891 and 0.6571 in Fig.rσ = 0.7 as the result in Fig. α and β are 0.2937, 0.9762 and 0.6335 in Fig.Fig.All of the above experiments show that the proposed bilateral filter can achieve better performance in noise removal and edge preservation than the conventional bilateral filter.In this subsection, we will compare the proposed bilateral filter with Gaussian filter and the conventional bilateral filter in speckle reduction using real ultrasound images. Fig.To compare and evaluate the three filters quantitatively, we used them to reduce the speckles in real ultrasound image and then calculated the contrast of the homogenous region and edges in the image. A good filter should preserve the edges and reduce speckles in the image, which means the contrast in homogenous region should be low while the contrast in edges should be high. The contrast measure used in this paper is the measure adopted in , which ic, the local contrast at pixel , is the Laplacian operationwhere c = 4I - {I + I + I + I} (17)I is the pixel intensity value at pixel of an image, w is a region or a set of edge points, and m is the number of the pixels in the region or edge points.where Fig.After the images were processed, we applied B-spline snake to extraIn order to evaluate the segmentation results, we adopted the segmentation metric, Pratt's quality measurement metric (FOM), which is defined as A is the number of boundary pixels delineated by an automatic segmentation method, II is the number of boundary pixels delineated by the technicians. d(i) is the Euclidean distance between a boundary pixel of ground truth or delineated by the technicians and the nearest boundary pixel extracted by automatic segmentation, and γ is a scaling constant(0.05 in our experiments).where IFig.dσ 2 and rσ 2 play a vital role in noise removal and edge preservation. It has been demonstrated that the optimal dσ 2 is relatively insensitive to noise variance while the optimal rσ 2 value changes significantly as the noise standard deviation changes. To investigate the performance of bilateral filter with different values of rσ 2, we applied the bilateral filters on synthetic images and used three quantitative measures including NMSE, noise reduction measure and edge preservation measure for analysis and comparison. We can see that the proposed method is more robust and effective than the conventional bilateral filter. The above three measures can be used for parameter selection of bilateral filters. However, since the ideal signals or non-noised images are usually unknown for real biomedical images, we should define other measures such as local contrast of homogenous regions and edge points set. Our local contrast is more robust and effective for algorithm evaluation in noise reduction and details preservation. This kind of measure can be adopted for parameter selection in bilateral filters when the filters are applied to real images. We compared the proposed filter with the conventional bilateral filter and Gaussian filter. Although Gaussian filter can reduce noises more or less, most of the edges and details have been smeared out. The conventional bilateral filter behaved poorly in speckle reduction. Experimental results of real ultrasound images of follicles illustrate that our proposed algorithm could obtain the best performance.Bilateral filter is a powerful technique in image de-noising due to its stability, and simplicity. The basic idea of bilateral filter is to replace a pixel value by a weighted average of its neighbours in both space and range . However, the conventional bilateral filter performs poorly on ultrasound images due to the speckles. From the multiplicative noise model, we investigated a normalized scheme based on the conventional bilateral filter so as to remove the speckles effectively while preserving useful details. For bilateral filter, the parameters including We presented a normalized bilateral filter for speckle reduction in ultrasound images for follicles segmentation. We compared the conventional bilateral filter with the proposed filter using synthetic speckled images and demonstrated its good performance in speckle reduction and edge preservation. Besides, we also tested the proposed filter, the conventional bilateral filter and Gaussian filter using real ultrasound images of cattle follicles. The contrast values of homogenous regions and edge points set demonstrated the proposed algorithm could achieve the best performance. The segmentation experiments also proved that B-spline snake can accurately find the boundary of the follicles from the filtered images by the proposed method. Experimental results validated the effectiveness and the accuracy of the proposed filter in noise reduction and edge preservation for follicle segmentation.The authors declare that they have no competing interests.JT developed the algorithm and wrote non-results part of the paper. SG implemented the algorithm and wrote the result part. QS attended to develop the algorithm. YD and DZ helped data analysis. All authors read and approved the final manuscript.

Once tumors start growing, the mice were injected with 5-FU/or 5-FU-loaded PEG-hydrogel once a week for 4 weeks. The growth of the tumors was monitored by measuring the tumor volume and calculating the tumor inhibition rate (IR) over the duration of the study.A 5-FU-loaded PEG-hydrogel was implanted subcutaneously to evaluate the drug retention time and the anticancer effect. For the pharmacokinetic study, two groups of male rats were administered either an aqueous solution of 5-FU (control group)/or a 5-FU-loaded PEG-hydrogel (treated group) at a dose of 100 mg/kg. For the pharmacodynamic study, a human non-small-cell lung adenocarcinoma (NSCLC) cell line, A549 was inoculated to male nude mice with a cell density of 3 × 10In the pharmacokinetic study, the 5-FU-loaded PEG-hydrogel gave a mean residence time (MRT) of 8.0 h and the elimination half-life of 0.9 h; these values were 14- and 6-fold, respectively, longer than those for the free solution of 5-FU (p < 0.05). In the pharmacodynamic study, A549 tumor growth was significantly inhibited in the 5-FU-loaded PEG-hydrogel group in comparison to the untreated group beginning on Day 14 (p < 0.05-0.01). Moreover, the 5-FU-loaded PEG-hydrogel group had a significantly enhanced tumor IR (p < 0.05) compared to the free 5-FU drug treatment group.We suggest that 5-FU-loaded PEG-hydrogels could provide a useful tool for the development of an anticancer drug delivery system. The drug 5-Fluorouracil (5-FU) is one of the most common chemotherapeutic agents used against malignant tumors . However2PO4, Na2HPO, methyl alcohol , and diethyl ether were supplied by Sigma . Dulbecco's modified Eagle medium (DMEM), penicillin/streptomycin, and trypsin EDTA were purchased from GIBCO . Aqueous fetal bovine serum (FBS) was obtained from WelGENE .The 6-arm PEG-SG (6-arm polyethylene glycol N-hydroxy succinimidyl glutarate), and 6-arm PEG-AM (6-arm polyethylene glycol amine) were developed by SunBio Inc. . The 5-fluorouracil (5-FU), NaHin vivo experiments were carried out with the approval of the Institutional Animal Care and Use Committee (IACUC) at Konkuk University and in harmony with the Guide for Laboratory Animal Care and Use For the pharmacokinetic study, male Sprague-Dawley rats were obtained from Orient Bio Inc. . The A549 human lung carcinoma cell line, a generous gift from Cha Biomedical Center , was carefully inoculated into the dorsal neck of male nude mice , which were supplied from the Central Lab Animal Inc. . All in vitro release study was carried out over 8 days. To quantify 5-FU released from the hydrogel, 2.5 ml of 10 mM phosphate buffer (pH 7.2) was added into each well and replaced every day. The plate was sealed and placed at room temperature. The quantity of 5-FU released from the hydrogel was measured by monitoring the absorbance at 265 nm. Since the released NHS or other PEG compounds gave additional signals at this wavelength, we carried out an additional experiment to assess background values without 5-FU. We calculated the net concentration of 5-FU by subtracting the background signals resulting from other compounds from the total signal.The 5-FU-loaded PEG-hydrogel was designed as shown in Fig 2) are cross-linked with the amine (-NH2) groups of PEG-AM. This cross-linking between PEG-AM and PEG-SG changes the two PEG solutions into a gelatinous form (US Patent 6858736).Fig. 2 gas in a water bath adjusted at 60°C. A 1.5 mM sodium phosphate buffer (pH 5.8) was added to reconstitute the residue. Approximately 200-300 μl of the reconstituted solutions were filtered and injected for HPLC . Separation was accomplished via isocratic elution of the mobile phase, which contained methanol and 1.5 mM sodium phosphate buffer , with a flow rate of 1 ml/min. A C18 was used as an analytical column. The analysis was carried out at a column temperature of 40°C. The wavelengths of the FLD (fluorescence detector) were 260 nm and 350 nm for excitation and emission, respectively.Rats were divided into two groups: a free 5-FU treatment group and a 5-FU-loaded PEG-hydrogel group. An aqueous solution of free 5-FU and a 5-FU-loaded PEG-hydrogel were administered subcutaneously to the rats at a dose of 100 mg/kg. To formulate the 5-FU-loaded PEG-hydrogel, PEG-SG and PEG-AM containing 5-FU were dissolved in sodium phosphate buffer (pH 8.0) and mixed together in equal volumes. The free 5-FU drug solution was injected into rats using a normal syringe, and the 5-FU-loaded PEG-hydrogel was injected using a mixing syringe device . The aqueous solution of PEG-hydrogel (PEG-SG and PEG-AM) immediately changed into a gel after passing through the injection needle. Blood samples were collected at minutes and hours after drug administration. Sampling continued until the PEG-hydrogel could not be palpated under the skin. Blood samples were centrifuged at 8000 rpm for 5 minutes , and harvested serum (150-200 μl) was subjected to HPLC analysis . SamplesWinNonlin" to fit the serum concentration versus time data to the following equation: Cp = (Ka*F*D)/{Vd*(ka-kel)}*(expkel*t -- expka*t-), where Cp is the serum concentration and ka and kel are the absorption and the elimination rate constants, respectively. The F, D, and Vd represent the bioavailability, dose, and volume of distribution, respectively. The lag time was not considered, and the absorption and elimination rates were applied using first-order kinetics. The area under the concentration vursus time curve (AUC0-8 day) was calculated using the trapezoidal rule from time t = 0 to the last measured concentration on Day 8. Serum drug concentrations and the estimated pharmacokinetic parameters were reported as means ± SD.Pharmacokinetic parameters were estimated for each rat by using the program "6 of cells from the A549 line, a human non-small-cell lung adenocarcinoma cell line, were inoculated into the dorsal neck of 4-week-old male nude mice as described in earlier reports [3, the mice were randomized into three groups: an untreated control group, a free 5-FU drug control group, and a 5-FU-loaded PEG-hydrogel group. The free 5-FU drug and 5-FU-loaded PEG-hydrogel were prepared as described above was subcutaneously injecting around the tumor mass once per week for 4 weeks at a dose of 85 mg/kg. Body weight, tumor volume, and clinical assessment of the mice were monitored every week until the end of the study. There was no significant difference in body weight changes among the groups. When tumors were palpable and visible, the tumor volume (TV) was measured with a Vernier caliper and calculated using the following formula:A total of 3 × 10 reports ,8. The tThe antitumor effect was estimated by calculating the relative tumor volume and the relative tumor inhibition rate . The relative tumor volume (RTV) represents the tumor volume when the drugs are given to the mice.0 is the tumor volume when the drugs are given to the mice and Vt is the tumor volume at each measurement.where VRTV represents the RTV of treated groups, and the CRTV represents the RTV of the untreated control group.The TSections of A549 taken from subcutaneously transplanted tumor masses were fixed with formalin and embedded in paraffin. Five micrometer tissue sections were prepared and stained with H & E.t-test was also used to compare the 5-FU-loaded PEG-hydrogel group versus the 5-FU-treated control group. The level of significance was taken as p < 0.05 or 0.01. Values represent means ± SD. Statistical analyses were performed with Statistical Analysis Systems software .Multiple comparison tests for different treatment groups were conducted. An ANOVA multiple comparison test (Dunnett's test) was performed to determine which pairs of groups differed significantly. An unpaired Student's The optimal cross-linking reaction was obtained using 1 mM phosphate buffer (pH of 8.0). Fig. versus time curves of 5-FU following subcutaneous administration of both the free 5-FU drug and 5-FU-loaded PEG-hydrogel to rats at 100 mg/kg. The 5-FU-loaded PEG-hydrogel released 5-FU into the serum over a period of one week, whereas the 5-FU from the free drug injection rapidly disappeared from the serum within several hours after injection. The serum concentration profiles for the free 5-FU and 5-FU-loaded PEG-hydrogel were well described by a one-compartment open pharmacokinetic model. As shown in Table max), the elimination half-lives (t1/2) and the area under the curves (AUC). The Cmax and t1/2 in the free 5-FU treated group were about 68 μg/ml and 0.15 h, respectively, while those parameters in 5-FU-loaded PEG-hydrogel group were 8 μg/ml and 0.9 h, respectively. In the free 5-FU treated group, the AUC and the area under the moment curve (AUMC) were roughly 60 μg h/ml and 33 μg h2/ml, respectively. In the 5-FU-loaded PEG-hydrogel group, the AUC and AUMC were 14 μg hr/ml and 112 μg h2/ml, respectively.Fig. 6 A549 cells were inoculated into nude mice. The subcutaneous inoculation of tumor cells resulted in tumor generation at the injection site. Solid tumors were locally measurable by 1 month after inoculation. As shown in Fig. A total of 3 × 10Compared to the free 5-FU-treated group, A549 tumor growth was significantly inhibited in the 5-FU-loaded PEG-hydrogel group on Day 28 (p < 0.05). The 5-FU-loaded PEG-hydrogel produced an inhibition rate of 64%, and the free 5-FU drug produced an inhibition rate of 38%. The PEG-hydrogel itself showed no cytotoxicity for A549 cells and had no inhibitory effect on tumor growth in the mouse xenograft (data not shown).Because the use of 5-FU is limited by its short half-life and rapid elimination, short duration 5-FU bolus administration has a relatively low response rate . For thein vivo pharmacokinetics and antitumor screening studies. Furthermore, this PEG-hydrogel system is based on a very simple injection that does not require a surgical procedure.An optimal crosslinking reaction of PEG-SG and PEG-AM was observed in 1 mM phosphate buffer at a pH of 8.0. PEG-hydrogel formation was maximized by using 15% concentrations of PEG-AM and PEG-SG. These conditions of PEG-hydrogel formation were applied in our Many other groups have reported that the pharmacokinetics of 5-FU in patients vary significantly based on the dosing regimen . In addiin vivo. Compared to the free 5-FU-treated control group, the 5-FU-loaded PEG-hydrogel group demonstrated a strong tumor growth inhibition effect. Following injection once a week, the tumor inhibition rate (IR) of the 5-FU-loaded PEG-hydrogel animals markedly increased from 20% (Day 7) to 65% (Day 28). In contrast, the IR of animals in the free 5-FU-treated control group showed a smaller increase from 30 to 40%. These pharmacodynamic data demonstrate that the PEG-hydrogel system is very effective in maintaining the optimal blood concentration of 5-FU necessary to suppress growth of tumor cells efficiently. The current finding is in agreement with the fact that 5-FU is not a dose-dependent but rather a time-dependent drug [We report that the controlled release of 5-FU from by the PEG-hydrogel effectively suppressed tumor growth max of 5-FU were markedly decreased after treatment with the PEG-hydrogel system. These findings may suggest that 5-FU treatment with a PEG-hydrogel may be used to reduce the severe toxic effects of this drug.The common acute toxic effects of 5-FU include myelosuppression, mucositis, and diarrhea ,23,24. IOur results suggest that the injectable PEG-hydrogel system offers an efficient approach to cancer therapy using a direct injection method that circumvents surgical incision.max): maximum serum concentration; (Tmax): time to maximum concentration; (t1/2): elimination half-life; (AUC): area under the curve; (AUMC): area under the moment curve.(PEG): polyethylene glycol; (5-FU): 5-fluorouracil; (IR): inhibition rate; (MRT): mean residence time; : polyethylene glycol N-hydroxy succinimidyl glutarate; (PEG-AM): polyethylene glycol amine; (TV): tumor volume; (RTV): relative tumor volume; (CThe authors declare that they have no competing interests.in vivo and vitro antitumor studies. SY, GB and KN developed the 6-arm PEG-SG and 6-arm PEG-AM, and performed in vitro release study of 5-FU from PEG-hydrogel. AMAE, BK, CL, MGB and JK contributed to the scientific discussion and the manuscript editing. All authors read and approved the final manuscript.HY, KN and HS conceived the study and finalized the manuscript. HY, HC, SC and DL carried out the sample preparation, pharmacokinetics, histopathological examination and The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/10/211/prepub

There is a considerable interest in characterizing the biological role of specific protein residue substitutions through mutagenesis experiments. Additionally, recent efforts related to the detection of disease-associated SNPs motivated both the manual annotation, as well as the automatic extraction, of naturally occurring sequence variations from the literature, especially for protein families that play a significant role in signaling processes such as kinases. Systematic integration and comparison of kinase mutation information from multiple sources, covering literature, manual annotation databases and large-scale experiments can result in a more comprehensive view of functional, structural and disease associated aspects of protein sequence variants. Previously published mutation extraction approaches did not sufficiently distinguish between two fundamentally different variation origin categories, namely natural occurring and induced mutations generated through in vitro experiments.We present a literature mining pipeline for the automatic extraction and disambiguation of single-point mutation mentions from both abstracts as well as full text articles, followed by a sequence validation check to link mutations to their corresponding kinase protein sequences. Each mutation is scored according to whether it corresponds to an induced mutation or a natural sequence variant. We were able to provide direct literature links for a considerable fraction of previously annotated kinase mutations, enabling thus more efficient interpretation of their biological characterization and experimental context. In order to test the capabilities of the presented pipeline, the mutations in the protein kinase domain of the kinase family were analyzed. Using our literature extraction system, we were able to recover a total of 643 mutations-protein associations from PubMed abstracts and 6,970 from a large collection of full text articles. When compared to state-of-the-art annotation databases and high throughput genotyping studies, the mutation mentions extracted from the literature overlap to a good extent with the existing knowledgebases, whereas the remaining mentions suggest new mutation records that were not previously annotated in the databases.Using the proposed residue disambiguation and classification approach, we were able to differentiate between natural variant and mutagenesis types of mutations with an accuracy of 93.88. The resulting system is useful for constructing a Gold Standard set of mutations extracted from the literature by human experts with minimal manual curation effort, providing direct pointers to relevant evidence sentences. Our system is able to recover mutations from the literature that are not present in state-of-the-art databases. Human expert manual validation of a subset of the literature extracted mutations conducted on 100 mutations from PubMed abstracts highlights that almost three quarters (72%) of the extracted mutations turned out to be correct, and more than half of these had not been previously annotated in databases. Protein kinases are the most ubiquitous family of signaling molecules in human cells, accounting for approximately 2% of the proteins encoded by the human genome . They caet al. carried out the first large scale study of the variation associated with 518 protein kinase genes in 210 samples of cancer tissues and cell lines. Other HT studies not specifically restricted to kinases have obviously also contributed in understanding and providing information on mutations in protein kinases [et al. [The relation of kinases with a number of diseases and in p kinases ,15. The [et al. .The sizeable amounts of information provided by large scale variation studies and the growing efforts of databases and resources to store and curate this information, are still not perfectly/completely connected with the many efforts dedicated to the detailed study of specific kinases in various biological systems publisheDespite difficulties in extracting more complex language expressions referring to mutation mentions, regularities in describing mutations based on existing nomenclature conventions, promoted the implementation of automated information extraction and text mining systems for the identification of mutations in the literature -30. TablEven though most of the existing manually curated mutation annotation resources are based on reading full text articles, existing automated systems mainly relied only on (subsets of) PubMed abstracts or a small collection of full text articles. To facilitate the interpretation of the biological implications and phenotypic effects of a given mutation, not only by clinical experts but also by database curators or for designing biochemical experiments it is crucial to know whether a given mutation has been experimentally generated or is present in a naturally occurring sequence variation. This aspect has generally been neglected by previously developed approaches. Finally, only few systems were able to show results based on the combination of heterogeneous data derived from multiple information sources, derived from literature as well as based on experimental data generated by genotyping studies.Here we examined the use of text mining methods to extract information from the literature about protein kinases and their specific mutations, link this information to the corresponding protein sequences from databases and analyze how this information is distributed in protein kinases related databases and repositories. The results of comparing information from databases and text repositories are analyzed in terms of the quality of the information provided and the significance in terms of the knowledge related to PK structure and function. We therefore applied an available mutation extraction system, called MutationFinder to the wHere we present a workflow for extracting mutations within human protein kinases. The pipeline integrates article retrieval, detection of mutations mentioned in the literature, and a final validation of mutations linked to their corresponding protein sources. We carried out a comparative analysis of multiple annotation resources containing different mutation types. An overview of the resulting approach is presented in figure For the initial extraction of single amino acid substitutions we applied the MutationFinder system, a modular software for point mutation recognition based on regular expressions and patterns detecting mutation mentions corresponding to residue abbreviations as well as other language expressions used to describe mutation events . This syQ30201), known to be associated to several human diseases. These two mutations are mentioned over 3,500 and 1,900 times respectively. Some of the most frequent mutation types corresponded to cases of false positive (ambiguous) mutations mentions that actually consisted in names of cell lines (T47D cells) or mouse strains (G93A mouse model).We applied the MutationFinder tool to the whole PubMed database November 2008), resulting in the detection of 302,956 mutation mentions from 88,405 records, corresponding to a total of 61,329 unique mutation types . A more detailed analysis of the most frequent mutation types , we carried out a coarse level consistency analysis to determine how scalable this system is when applied to the whole PubMed database, where many articles do not necessarily resemble the data collection used for the initial system development. Assuming that the overall mutation types, contained in manually annotated resources like the SwissProt database should be similar to the ones encountered throughout PubMed we compared mutations extracted automatically from the literature to information contained in SwissProt, namely mutations being annotated as either natural variant, induced (mutagenesis) or both single amino acid substitutions. A comparative analysis of the frequencies of annotated mutation pairs (wild type residue and the associated mutation) showed that there are considerable differences between the mutations often encountered in naturally occurring variations as opposed to experimentally induced amino acid changes. The overall profiles resulting from the relative percentages of mutation types from different sources are similar . This is due to the intrinsic ambiguity of single letter mutation mentions that can correspond to both mutations at the DNA or protein level depending on the context. In order to distinguish between these two mutation levels, additional processing would be required. A more detailed analysis of the wild type residue and the mutant residue frequencies revealed that automatically extracted mutation residues are in line from what would be expected when examining the relative frequencies within a manually curated database figure and 3B.The most frequently mutated residues mentioned in PubMed are Arginine, Glycine and Serine, corresponding also to the top ranking ones annotated in SwissProt. SwissProt shows more variability when comparing annotations of wild type residues from naturally to induced variations. In case of experimentally generated mutations, the residues most frequently replaced are Serines, Lysines, Arginines, Cysteines and Tyrosines, corresponding to functionally important residues. Considering the mutant residues, the literature mining extracted residues are consistent with the mutant residues from SwissProt, which shows great variation in case of Alanine induced and natural variant mutants. This can be explained by the widespread use of experimental approaches relying on the Alanine scanning method for identifying functionally relevant sites, as substitutions to Alanine usually still allow protein folding yet may give an altered phenotype. A more detailed description of the mutation disambiguation and filtering approach to remove false positive mutation mentions is provided in the method section.For extraction and management of biological annotations and to carry out functional analysis of mutations it is crucial to know the level of granularity and experimental context used for determining the phenotypic effect of a given amino acid substitution. The SwissProt database distinguishes here between induced or artificial (mutagenesis) and natural variant mutations, corresponding the former to less than 13 percent of the mutation annotations. Characterizations at the level of molecular functional implications and sub-cellular interactions of specific residues are commonly studied through experimentally induced amino acid changes. On the other hand associations to diseases such as certain cancer types and relevance for population groups or patients of a given mutation is usually studied by examining naturally occurring sequence variants. To address this important issue, allowing mutation mention scoring for each of these two basic categories of phenotypic descriptions we applied a supervised machine learning strategy for mutation sentence classification. We applied a SVM algorithm trained on a balanced sample set of 3,482 (71%) labeled sentences for induced and natural variant mutations and evaluated it on an independent test set of 1,400 sentences (29%), obtaining an accuracy of 94.64 on this collection. The size of the feature dictionary used by the classifier was of 11,803 word types . A manual inspection of the generated feature dictionary revealed that some of the relevant features corresponded to terms comprised in experimental techniques used to generate artificial mutations, such as site-directed mutagenesis. This basic evaluation schema is suitable to determine the performance on a controlled set of balanced instances, but does not take into account the actual distribution of the classes within a large collection of unlabelled data nor cases that even by human experts can not be clearly classified into one of these binary categories. Therefore we carried out both, a classification consistency analysis on the resulting sentence scores as well as a detailed evaluation and comparison against manually examined mutation sentences to minus 4 . Sentences of each of these sets underwent a two-step blindfold manual classification process to provide a more fine-grained analysis of the different aspects that might influence the actual systems performance. The first step consisted in classifying whether the sentence is mentioning a mutation or not to determine the effect of false positive mutation extraction. As a separate class we also recorded cases of mutation mentioning sentences where the directionality of the automatically extracted mutation event (wild type residue vs. mutant residue) was wrongly derived. When considering the mutation extraction performance across the score intervals for mutations classified as induced and natural variants, it seems that it was more difficult to correctly identify mutation mentions in abstracts that where close to the classification boundary or where scored as experimentally generated mutations.f-score of 92.46) and an accuracy of 93.88, in line with the performance obtained with the previously used test set. An interesting false negative case was the sentence: The hexameric structure is important for protein stability, as demonstrated by studies with natural mutants (the Killer-of-prune mutant of Drosophila NDP kinase and the S120G mutant of the human NDP kinase A in neuroblastomas) and with mutants obtained by site-directed mutagenesis. In this particular case the authors refer to both natural variants as well as induced mutations, being S120G actually a natural mutation.The second step involved manually classifying mutation mentions into one of the following categories: (1) natural variant, (2) induced mutation or (3) unclear cases. We decided to add the latter category to take into account mutation mentions that even by humans could not be classified clearly into one of the two other types, either because the context of mention is not informative enough or because it is a truly ambiguous case. Figure Providing associations of mutations to their corresponding protein record and sequence is crucial to facilitate a more detailed characterization of structural effects of a given mutation and distribution within certain protein domains. This also allows direct comparison to functional annotations of proteins and mutations contained in manually curated annotation databases as well as to large-scale experimental results obtained by genotyping studies. Here we focus on associating the extracted mutations specifically to human protein kinases.To obtain links between mutation mentions and human kinases we assumed that the corresponding protein names should be co-mentioned in the articles. After extracting all the mutation mentions from PubMed abstracts and a large collection of full text articles, these two data sets were processed for retrieving mentions of human protein kinases. In order to detect kinase protein mentions we applied a dictionary look-up approach, similar to strategies that participated successfully at the gene normalization task of BioCreative II . To takeThis high recall protein normalization scoring strategy was followed by a more stringent sequence validation approach that allowed us to detect links of mutations and proteins by checking whether the actual mutation mention can be confirmed by looking them up at the protein sequence position. We restricted our analysis specifically to mutations occurring in the protein kinase domain, as defined in Kinbase . A totalThe global context of co-mention of kinase proteins and mutations defined by the multi-document collection where these co-occur, can be indicative for the actual importance of a particular mutation, being described and studied in various different paper. To use information provided by the corpus co-mention context, in addition to the total number of documents where the sequence validated mutation-kinase pair co-occurred we calculated the mutual information for each mutation pair.Several genomic studies have been dedicated to the characterization of mutations occurring in protein kinases in a variety of cancer tissues and cell lines. In these studies, a number of point mutations detected in somatic cell lines have been found to be associated with specific cancer types. The pathogenicity of these mutations depends on multiple factors related to the complex molecular environment in which protein kinase function takes place. Of special interest are mutations found within the protein kinase domain, as it is essential for the functional activity of these proteins. We therefore focused our analysis on automatic extraction of mutations mapped to this particular domain, common to all kinases, and carefully examined how they relate to previously characterized mutations retrieved from multiple databases and experimental high throughput genomic studies. We used the kinase domain definition followed by Kinbase , analyziFigure In order to assess whether the mutations recovered from the existing literature by our system were already present in commonly used databases or are newly recovered instances, we herein studied the overlap between the mutations in the protein kinase domain both in the databases and the results from our extraction pipeline. Table KinMutBase is a manThe Swissprot Variant database providesWhen considering the overlap of extracted mutations with respect to each of these two mutation type classes we were able to obtain similar percentages for both groups from the combined article collection, 50.11% of the mutations annotated as natural variant and 53.78% of the mutations annotated in SwissProt as mutagenesis.Interestingly, we found differences in the overlap percentages of recovered mutations from abstracts and from full text articles when looking at these mutation classes individually. When considering the mutations derived from abstracts, 21.57% of the natural variant annotated mutations could be detected, as opposed to only 13.94% of the mutagenesis annotated mutations. The opposite trend was observed in case of full text articles, where we extracted 52.59% of the induced mutations and 42.70% of the natural variant mutations. This suggests to certain extent that experimentally induced mutations annotated in SwissProt are usually not mentioned in abstracts, but rather in full text articles.The SAAPdb is a resOur system recovered 65 (10.66%) and 106 (17.38%) of the mutations previously stored in the database when the abstracts and full text articles were taken into consideration. For the joint abstracts-fulltext dataset, 125 (20.49%) of the mutations present in SAAPdb were found.With regard to the pathogenicity of the mutations found, for the particular case of the combined dataset, we were able to find 123 (38.08%) of the pathogenic deviations, whereas only 2 neutral SNPs were recovered. This highlights the fact that the literature is biased towards those mutations known to be functionally active and harmful for the individual. It is interesting to remark that none of the other databases analyzed contained records for the neutral SNPs in SAAPdb either.The Greenman and Wood dataset was built from the results shown in the original papers ,16 by thOur system recovers only a very small fraction of these somatic mutations since only 13 (5.12%) of the instances in the dataset were able to be recovered in the best case scenario, where the combined article set (abstracts+fulltext) was used. This means that only a small proportion of the mutation dataset detected by experimental High Throughput approaches could be linked directly to other literature evidences. Our system recovered 9 (7.56%) driver mutations versus 4 (2.96%) passenger mutations. A very similar trend was observed for the case of the COSMIC database, which shares around 95% of the information contained in the Greenman/Wood dataset for the particular case of the protein kinase domain.Finally, we wanted to assess how many of the mutations we were able to recover from the total set of mutations in the 5 studied datasets were found by the Text Mining approach when the Pubmed abstracts were scanned. By contrast 354 (27.98%) mutations were recovered when the full-text articles were taken into consideration, and 399 (31.54%) when the combined abstracts+fulltext dataset was used. The increased recall of this combined method clearly justifies the computational effort required.Although there are mutations scattered everywhere in the kinase domain structure, a considerable mutation density is encountered close to functionally relevant parts of the protein, i.e. the ATP binding pocket, the DFG motif in the activation loop. Figure The interest of the system presented here is not only that the user can gather mutations from the literature that are not reported in the databases, but also that one can get a summary of sentences mentioning those mutations that will help to assess the pathogenicity of the mutations newly discovered. A working example is provided here: Mutations in the EGFR.The epidermal growth factor receptor, also known as EGFR, is a protein kinase involved in the control of cell growth and differentiation which has been reported of interest in the development of breast cancer since binding of EGF to its receptor leads to dimerization, internalization of the binary complex, induction of the tyrosine kinase activity, stimulation of cell DNA synthesis, and cell proliferation.There are several well-known mutations reported for this protein in current state-of-the-art databases storing information on mutations we were able to find the following sentences 'Furthermore, transient expression of a Y845F variant EGFR in murine fibroblasts resulted in an ablation of EGF-induced DNA synthesis to nonstimulated levels.' (PMID:10075741), 'Stably transfected B82L cells with a point mutation of the EGFR at Tyr-845 (B82L-Y845F) exhibited only basal Ras activity following exposure to Zn2+' (PMID:11983694), 'In contrast, LPA-elicited DNA synthesis and migration were augmented in cells expressing EGFR, EGFR(K721A), or EGFR(Y845F), but not EGFR(Y5F), although the PDGF responses were indistinguishable' (PUBMED 15364923). The information retrieved suggests the involvement of Tyrosine-845 from EGFR in DNA synthesis via binding to EGF.In addition, the system also retrieves functionally neutral results that are often discarded and not stored in the databases although they contain very useful information for the contextual interpretation of the involvement of point residues in protein function 'Unexpectedly, the Y845F mutant EGFR was found to retain its full kinase activity and its ability to activate the adapter protein SHC and extracellular signal-regulated kinase ERK2 in response to EGF, demonstrating that the mitogenic pathway involving phosphorylation of Y845 is independent of ERK2-activation' (PUBMED 9990038). The structural model of this protein together with a summary of the residue and mutation information is included in additional material file 3In this paper we presented the first approach to extract human kinase mutations from both PubMed abstracts and a large collection of full text articles, comparing the obtained results to mutations that have been manually curated from the literature by annotation databases as well as data generated by genotyping studies. Automated mutation extraction can assist manual curation efforts by providing direct pointers to mutation evidence sentences for quick manual examination. The MutationFinder system was useful to detect mutation mentions from both abstracts and full text articles combined with some additional filtering of ambiguous mutation mentions. Some potential future improvements of this basic mutation extraction system could consider wrongly extracted mutation mentions resulting from mentions of sequence ranges or the inclusion of detection of stop codons (e.g. R97X). Several strategies have been used to filter ambiguous mutation mentions and to discriminate between mutations at the level of DNA and proteins. We carried out a detailed consistency analysis of the mutations detected by means of literature mining to the content of manually curated annotations. Future steps could include a more detailed exploration of the actual reliability scoring and ranking of sequence validated mutations through the use of: (1) mutation-protein proximity analysis in full text articles, (2) species and organism source ambiguity examination and (3) analysis of the probability of finding a given mutation within the target sequence per chance, considering the actual residue composition of proteins and kinases. By using a standard machine learning approach we were able to score the level of phenotypic description based on contextual information provided for a given mutation, classifying each mutation mention as induced or natural variant . This aspect is especially important as it connects mutation relevant information generated by different scientific domains, i.e. data generated by clinical, epidemiological and human genetics studies with molecular biology and biochemical in vitro experiments. Extraction of mutation information from multi-document collections is useful to complement different scientific discoveries and characterizations described across various papers, increasing thus efficiency in relating entries to each other and integrating multiple complementary evidences discovered by different research groups. Problems related to sequence shifts or cases of so-called sequence conflicts when comparing the numbering used by article authors to the sequences contained databases like SwissProt were addressed by using various sequence validation strategies, from the basic residue look-up to the use of text derived sequence patterns. These Sequence conflicts can be the result of sequencing errors, sequence variants or isoforms that are not well characterized or even from alternative counting when considering N-terminal signal peptides . To resoInterestingly only a very minor fraction of the mutations detected in hight throughput genotyping studies ,16 correThe experiment shows that for 23% of the mutations there was a positive confirmed record in at least one of the analyzed knowledgebases were too ambiguous even for human experts, lacking enough information even to perform manual validation., [The KinBase resource is a reAt the time of the analysis, KinBase contained 620 human protein sequences of which 518 correspond to protein kinases not considered to be pseudogenes. Although kinases described as pseudogenes are transcribed and might even have a residual or scaffolding function, kinase pseudogenes were not mapped onto Uniprot (SwissProt/Trembl) since many of them are partial transcripts or have stop codons in their sequence. Since KinBase does not directly map its entries onto Uniprot, this mapping was performed using a BlastP search fThe used mutation extraction pipeline has been applied to two text data sets, one consisting in the whole collection of PubMed abstracts, and the other in a set of 19,404 full text articles. The full text articles were automatically downloaded using an in house full text retrieval system that had previously been implemented. To prioritize full text articles for download, three different criteria were considered. The first selection criteria was based on information contained in the corresponding abstracts, such as mention of mutations, mention of human kinase proteins and a combination of keywords (including 'human kinase mutation'). The second selection criteria was based on extracting all the PubMed references for human kinases contained in multiple databases . The third selection criteria was based on analyzing the fraction of mutation mentioning abstracts for each journal, prioritizing a set of journals (and thus their articles) for retrieving their full text articles. These journals included: the American Journal of Human Genetics, European Journal of Human Genetics, Human Genetics, Human Mutation and Human Molecular Genetics. Each of the full text articles was automatically converted into plain text using pdftotext. Both abstracts and full text articles were then preprocessed applying an in house rule-based sentence boundary detection system that we optimized for PubMed abstracts. We applied the MutationFinder system two both the full text and abstract sentence collections using a cluster of 64 Mac PPC G5 processors running Darwin.et al. compiled manually a list of exceptions to avoid mislabeling of other phrases as mutations, examining also certain terms co-mentioned in the context . For filtering single letter mentions that might correspond to mutations at the level of DNA or RNA they analyzed words surrounding the point mutation, but did not provide further details regarding this process [The performance of information extraction methods that detect mutation mentions from the literature is affected by the underlying article selection criteria used. When applied to the whole PubMed database, a fraction of extracted mutation mentions are ambiguous, and therefore can, depending on the context correspond to a range of other bio-entities, like cell lines, protein names or clones. Only few previously published approaches did a more careful examination of wrongly extracted mutation mentions, most of these ambiguous mentions correspond to single letter mutations. Horn process . Erdogmu process .We propose an approach for targeted mutation pattern sense disambiguation and filtering of mentions that do not correspond to protein mutations. Therefore we examined manually a large collection of mutation mentions to determine the sense inventory with respect to the context of occurrence, discriminating the main classes of false positive ambiguous mutation mentions and characterizing their semantic categories. The majority of these corresponded to one of the following three semantic types:• Cell lines or cell types. There are several frequently mentioned cell lines that resemble mutation mentions. Among these are the human glioblastoma cell line T98G, the T-cell line M14T, the adrenocortical cell line H295R or other commonly used cell lines such as T47D or T24C.• Taxonomic entities. Certain taxonomic names, especially bacterial strains, cloning vectors and certain animal models (e.g. mouse strains) contain words that are similar to single letter mutations. Example cases include the strains: E. coli K12S, A. viscosus T14V, P. pneumoniae R36A, A. naeslundii T14V, Mycoplasma sp. G145T or the yeast strain S288C. Also clone identifiers (e.g. W12I and W12E) or plasmids (e.g. E. coli plasmids P15A) can result in false positive mutation hits. A special case of ambiguous mutation mentions is encountered in transgenic mouse models like G93A transgenic mice. It consists in a mouse strain expressing a G93A mutant form of human SOD1 protein, but usually is mentioned as the name of the strain rather than as a reference to this particular mutation.• Protein and gene names. Several protein names do match the patterns used to identify mutations from the literature, although some of these correspond to human proteins like S100D and S100E, a considerable fraction are viral gene names .We found some additional cases of wrongly tagged mutations that could be classified as drugs or compounds . To determine the semantic class of a given mutation occurrence we explored the use of knowledge-based methods relying on machine-readable dictionaries (MRDs) for sense disambiguation based on local context analysis. In order to address this disambiguation task we assumed (1) One sense per discourse, namely that within a given document the target mutation mention is consistently used as either a mutation or one of the three other semantic types previously introduced; and (2) One sense per collocation, implying that nearby co-mentioned words provide strong clues to the sense of the target mutation mention.Three lexical resources were compiled for taxonomic entities, protein/gene names as well as cell lines. Due to limited lexical coverage of cell line information in existing biological ontologies such as the Cell Type ontology, we generated automatically a cell line dictionary through use of a named entity recognition method appliedFor taxonomic entities we assembled a dictionary of species names derived from the NCBI Taxonomy and used a dictionary look-up approach with these names for filtering potentially ambiguous mutations. A total of 584 taxonomic names (and their variations) contained words matching mutation regular expressions, most of them from cloning vectors and bacterial strains. Out of these we generated 128 disambiguation patterns for taxonomic mentions. A similar approach was followed for disambiguation of mutations matching protein and gene names, relying on a protein dictionary extracted from the UniProt database. The total number of protein and gene names from UniProt matching mutation mentions was 295. These were exploited for generating 29 disambiguation patterns that were manually revised to remove too general patterns, resulting finally in a set of 25 patterns.A special case of ambiguity is encountered when distinguishing between mutations at the level of DNA, RNA and protein sequences. To enable discrimination between these different mutation types official nomenclature guidelines state that the description should be preceded by a letter indicating the type of reference sequence, p in case of protein sequences (e.g. pCys76Ala or p.C76A), g for genomic sequences, c for cDNA, m for mitochondrial sequences and r for RNA sequences . UnfortuTo handle the automatic distinction between DNA and protein mutations, we explored the use of different selection criteria that humans actually follow to achieve this task. We applied a hand crafted rule-based technique, with the implicit advantage that it does not require the construction of large training collections of representative sample cases for different types of DNA/protein ambiguous mutations. As contextual representation for disambiguation of mutation patterns we used: (a) implicit information from the mutation itself, i.e. mutation sequence position, (b) features derived from the local context, i.e. words enclosed in the corresponding sentence, and (c) distant content words from the whole abstract as contextual cues, i.e. other co-occurring mutations.A useful characteristic to distinguish mutations at the DNA and protein level is actually provided by the mutation position number. The average length of sequences in UniProt is 360 amino acids, being the longest sequence 35,213 (the Titin protein from mouse). When looking at the mutation positions annotated in SwisProt, 96.76% are below 2000, 98.72% are below 3000 and 99.25% are below 4000. Therefore a basic aspect that we explored here was to filter mutations by position numbers allowing three positional cut-offs . Example cases of DNA mutations that can be successfully detected with this simple criterion are T1191C (PMID 15993850), G2950692A (PMID 15862761) and G20210A (PMID 18501222).The local context of a given mutation mention, represented by the sentence in which it occurs can provide hints towards the mutation type. We generated two lists of terms that are associated either to mutations at the level of proteins or DNA based on manual inspection and extension of the features used by a sentence classifier trained on a small sample set of 687 DNA and protein mutation mentions. We used terms from these two lists mentioned within the mutation sentences to calculated the overlap coefficient of Lesk for scoring them as DNA or protein associated .Certain distant content words co-occurring with a mutation in the whole abstract can be used as contextual cues for disambiguation. Here we explored the use of other co-mentioned mutations to determine the cooperative effect for mutation disambiguation, under the assumption that if multiple mutation patterns co-occur, and all of them resemble DNA mutations, it is consequently more probable for each of them to corresponds to a DNA rather than a protein level mutation. From manual examination of the resulting hits, we determined that at least 4 distinct mutations had to be co-mentioned in a given abstract, and that at least two different mutation combinations were needed (to avoid filtering of systematic Cys to Ala-scanning mutations). An example case illustrating this idea is the PubMed record 9240741, where all the following mutations are co-occurring: T1448C, T1366G, G1604A, A1226G. Finally we also took into account the numerical relation underlying the codon triplets and their encoding for amino acids as filtering criterion for cases where for a given ambiguous mutation, another co-mentioned mutation fulfill the positional information condition: position of DNA ambiguous mutation is equal to 3 times the position of a co mentioned mutation, as illustrated for C684G and N228K in: The novel mutations include T302C (L101P), C684G (N228K), and G1063C (A354P) (PMID 9889017).The classification of mutation mentions into natural variant or induced mutations was carried out using a sentence classifier approach using words co-mentioned with the mutation within the sentence. We used a SVM implementation with raFor the detection of protein and organism names we used a dictionary look-up and maximum sub-string matching algorithm implemented in C and Perl. The initial gene and protein dictionary of human kinases was extracted from SwissProt and automatically extended using heuristics and rules taking into account common typographical variations encountered in gene and protein names and symbols. These covered aspects related to the use of hyphens , capitalization and word ordering. This resulted in a human kinase protein dictionary of 2,582,220 protein name-database identifier associations. This dictionary was further manually processed based on the information content of each tagged protein mention to remove some highly ambiguous protein name variations.To associate co-mentioned proteins and mutations from a given article, previous efforts ,27 oftenThe authors declare that they have no competing interests.AV conceived the idea. AV, JMGI and MK planned the analysis. MK, JMGI and CR generated the datasets. MK and JMGI performed the analysis. AV and MK wrote the first draft and MK and JMGI the final version. All authors read and approved the manuscript.Click here for fileClick here for fileClick here for fileClick here for file

We characterized a natural human antibody to adenocarcinomas and investigated the biological role of this Ab/Ag complex in cancer expansion. Human monoclonal antibodies (HuMAbs) were generated with hybridoma fusion methods using regional nodal lymphocytes of colon carcinoma patients. Among 1036 HuMAbs, only one, termed SK1, an IgM, was adenocarcinoma specific in the immunohistochemical study. The antigen recognized by SK1 (Ag-SK1) was a glycoprotein with a molecular weight of 42-46 kDa. The expression of Ag-SK1 on carcinoma cells varied according to the cell growth periods but was independent of cell cycle state as elucidated by two-colour fluorescence-activated cell sorter (FACS) analysis. A dot-blot analysis showed that the concentration of Ag-SK1 per total protein differed considerably among eight colon carcinoma cells examined and that the difference was closely correlated with the invasion capacity of the cells as assessed by a microchemotaxis assay. Furthermore, up to 87% of cell migration was inhibited by SK1 in a dose-dependent manner. These data suggested that Ag-SK1 is metabolized and expressed on highly invasive carcinoma cells. In addition, it appears that, although rare, some patients do mount an anti-cancer antigen response in their draining lymph nodes. A HuMAb such as SK1 may be a good candidate for the treatment of cancer invasion and metastasis.

In order to provide evidence on health impacts of the tobacco industry on cultivators in Vietnam, this study aims to provide comparison between tobacco cultivation related revenue and expenditure in selected areas in rural Vietnam and examine the relationship between tobacco cultivation and self-reported illness in the study population.Two tobacco farming communes and two non-tobacco farming communes were selected for this study. In each selected commune, 120 households were sampled using two-stage cluster sampling technique. Local health workers were recruited and trained to conduct household interviews using structured questionnaire.Where the expenditure figures do not include personnel costs , it appeared that the average tobacco farmer did benefit financially from tobacco cultivation. However, if a personal opportunity cost was added to give a financial value to their labour, the profit from tobacco cultivation was seen to be minimal. The occurrences of 9 out of the 16 health problems were statistically significant higher among tobacco growing farmers compared to that among non-tobacco farmers. Tobacco farming was shown to be the second strong predictor of self-reported health problems among the farmer (after the effect of old age).The present study provides evidence that can be used to increase public awareness about the harmful effects of tobacco growing. For years, in search of even more profits, the tobacco industry has encouraged countries and farmers to grow more tobacco. Tobacco companies have promoted tobacco growing as a panacea, claiming that it will bring unparalleled prosperity to farmers, their communities, and their countries .Viet Nam is a prime target for the tobacco industry: a developing country with a tropical climate appropriate for tobacco cultivation, and hard-working laborers. The total area devoted to tobacco cultivation in Vietnam in 2002 was about 18,000 hectares which gave an output of about 27,400 tones of tobacco per year .While the cigarette industry argues that tobacco farming is a major contributor to the country's economy, the seriously damaging health and environmental impacts caused by tobacco farming have been well documented. From the moment the tobacco seed is planted to the time the tobacco plant is harvested and cured, the health of those who cultivate the crop is constantly at risk ,2.The hazards posed by tobacco cultivation place tobacco workers at increased risk of injury and illness. Children and adults (mainly women) working with tobacco frequently suffer from green tobacco sickness (GTS), which is caused by dermal absorption of nicotine from contact with wet tobacco leaves. GTS is characterized by symptoms that may include nausea, vomiting, weakness, headache, dizziness, abdominal cramps, and difficulty in breathing, as well as fluctuations in blood pressure and heart rate -6. LargeTobacco growing also causes a lot of damage to the environment. In many developing countries wood is used as fuel to cure tobacco leaves and to construct curing barns. An internationally estimated 200 000 hectares of forests and woodlands are cut down each year because of tobacco farming . EnvironIn Vietnam, tobacco control has recently received greater attention. The Vietnamese Government's readiness to curb the epidemic of tobacco related disease was reflected in the Prime Minister's Decision No 77/2002/QD-TTg on the Ratification of the Programme of Prevention and Control of Certain Non-communicable Diseases for the Period 2002–2010 and the In order to enforce the policies on tobacco control in Vietnam, especially the enactment of the tobacco control law, reliable information on the economic and health effects of tobacco farming is urgently needed by health advocates, as well as for society in general. However, even though the amount of research on tobacco in Vietnam has recently increased rapidly, to the best of our knowledge, there remains no research on the health impact of the tobacco industry on cultivators. This study therefore aims to 1) provide a preliminary comparison between tobacco cultivation related revenue and expenditure in selected areas in rural Vietnam; and 2) examine the relationship between tobacco cultivation and self-reported illness in the study population. The findings of this study may be of use for evidence-based policy making against tobacco in Vietnam and elsewhere.This was a cross-sectional household survey. The study was undertaken in 2007 in 2 rural districts in Vietnam (Vo Nhai in the North and Cam My in the South). Vo Nhai district is located about 90 km north of Hanoi capital. The district has 14 communes and one town. It covers an area of about 85,000 hectares, mainly highland and mountainous areas. The total population of Vo Nhai in 2006 was about 63,000 people. Cam My district is located about 100 km south of Ho Chi Minh City. The district has 13 communes and 1 town, spread over 47,000 hectares. The total population of Cam My in 2006 was about 156,000. In both districts, tobacco cultivation has been clustered in several communes. The tobacco cultivation includes different types of work like land preparation, seeding/planting, taking care of the leaves, harvesting, curing/toasting, processing, storing, etc.Two tobacco farming communes (one per study district) were selected for exposed subjects. We also chose two non-tobacco farming communes for comparison. The non-tobacco farming communes were selected based on consultations with health bureau and health statistics office in the respective study district.In each selected commune, 120 households were sampled using two-stage cluster sampling technique. The sampling procedure is presented in Figure Local health workers were recruited and trained to conduct household interviews using structured questionnaire. The questionnaire was developed by research team with reference to the one used in the Vietnam Living Standard Survey 2002. It was pilot-tested in both the North and the South before official use. The field manual was also developed to ensure the standard of the data collection process. Spot-checks and re-checks of 10% sample data were conducted by the research team for quality control.In this paper, tobacco cultivation-related revenue, expenditure and self-reported illness are the main outcome variables. Information on tobacco cultivation-related revenue and expenditure was obtained from detailed interviews with the heads of household. The annual revenue from tobacco cultivation is the total amount of money the family gets from the sales of all tobacco products produced in a year. The annual expenditure on tobacco production is the sum of different items needed for the whole process . There were 9 cases where the respondents did not remember an input quantity and/or price, estimates based on corresponding figures provided by neighbors were used to calculate the expenditure.Information on self-reported illness during the last six months among the study populations was collected using questions about the occurrence of 16 health problems (Table Tobacco cultivation status (yes/no) and socio-demographic conditions of the study participants were included as independent variables. The socio-demographic conditions of the study subjects were assessed by educational level, occupational status and per capita income per month. Information on education and occupation was obtained through the direct interviews with the study subject. Educational level was classified into five groups: (I) no education; (II) not yet complete primary education; (III) complete primary education (completion of grade 6); (IV) complete primary education (completion of grade 9); (V) tertiary education (completion of grade 12) and higher. Occupational status (main occupation of the study subjects) was grouped as: (I) farmer; (II) government staff; (III) pupil/student and (IV) other jobs . Economic status of the respondent's household was measured by income quintiles. Information on income was collected through detailed interviews with the head of household. Average per capita income per month was the total income of the household divided the number of household members.Data were processed using Epi-Data by experienced research assistants. Double entry was applied with 10% filled questionnaires. Both descriptive and analytical statistics were carried out using Stata 9 software (Stata Corporation). The Chi squared test was used to examine the differences in the occurrence of 16 illnesses/symptoms among the tobacco growers compared to that among the non-tobacco farmers. Multivariate logistic regression and linear regression modeling were performed to establish the relationships of "illness presence" and "total illness score" with tobacco cultivation status as well as the socio-demographic variables. Both logistic and linear regression models were constructed using fixed variable method (i.e. based on our hypothesis on the relationships between outcome variables and independent factors). A cluster option was introduced in the analyses to reflect the nature of the sampling technique. A significance level of p < 0.05 was used. In calculating expenditure and revenue, local currency values were converted into US dollars using the 2007 exchange rate of US$ 1 = VND 16,000.Ethical clearance for conducting this research was given by the Institutional Review Board of Hanoi School of Public Health. The study also got the approval from People's Commune Committees in each study commune. Before participating into this study, all invited respondents were provided with clear information regarding this research. They were informed that participation would be voluntary following informed consent. Their responses would be confidential, there would be no right or wrong answers, and they could stop or withdraw from participation at any time. The refusal or withdrawal would not have any effect on them.A total of 480 households from the four selected communes were surveyed. All the study communes had nearly the same percentage of men and women. A large proportion of population in the study communes aged below 44 years old and a small proportion of people were elderly (i.e. aged 65 year old and over). The educational level of the study populations was quite limited. The main occupation of the populations in the studied areas was recorded as 'farmer'. There was no significant difference in demographic characteristics between the tobacco farmers and the non tobacco-farming ones Table .However, there was variation in economic conditions across the four communes. The per capita income per month was highest in the tobacco-farming commune in the South US$ 28.5) and lowest in the tobacco-farming commune in the North (US$ 19.1) , it seemed that tobacco farmers in the South got some profit from tobacco cultivation. However, the profit was seen to be minimal (expenditure of US$ 481.4 vs. revenue of US$ 513.0). In the tobacco farming commune in the North, including opportunity costs, the expenditure on tobacco cultivation was higher than the corresponding revenue (expenditure of US$ 609.9 vs. revenue of US$ 467.6).In this study, a total of 968 farmers aged from 15 to 69 years old from the four selected communes (480 households) were interviewed about the occurrence of the 16 selected health problems. Table The multivariate logistic regression analyses of the effects of tobacco cultivation as well as socio-demographic factors on "illness presence" are presented in Table The effects of tobacco cultivation and socio-demographic variables on "total illness score" were examined by multivariate linear regression and shown in Table While the economic and health problems associated with both active and passive tobacco smoking have been well documented in literature worldwide, little is known about the effects of tobacco cultivation, especially in developing countries . The preThe demographic characteristics of the study populations are typical for rural communities in Vietnam. The education level is low, and farming is the predominant occupation. The distributions of age and sex in the population correspond well to the usual pattern of population pyramid in Vietnam, which has a small proportion of elderly people.The figures of monthly income indicate that tobacco cultivators are not wealthier than other farmers Table . This isOur data clearly show that tobacco cultivation was strongly associated with the occurrence of a range of health problems. The finding is similar to those reported by previous studies, conducted in other countries ,21,22. TThe findings of the present study indicated that increasing age was associated with higher occurrence of tobacco farming related health problems Table . This isWe found that the health problems were more commonly reported by the women than men Table . This isThe present study also revealed clear economic disparities in health effects of tobacco cultivation Table , 5. The The study uses a retrospective approach to collect information on income, expenditure, and self-reported illness. This may be open to recall bias, especially information on annual income and expenditures on and details of pesticides, fertilizers, etc.The validity of self reported information also depends on characteristics of both interviewers and respondents. Probing skills of interviewers are very important. In this study, village health workers were selected as interviewers because they already had some experiences in doing household interviews. However, this was the first time they did interviews using a long questionnaire with quite many difficult questions such as estimation of expenditure, revenue, name of fertilizer, pesticide, etc. Even though the trainings were conducted carefully, the interviewers still made a number of mistakes. As a result, about 10% of interviews were redone by researchers of this study.Characteristics of respondents such as their educational level, their ability to recall it and their willingness to report it, might also have influenced the validity of the study findings. In this study, we had difficulties when asking the respondents, who were normally with low education, to recall the name of pesticides, fertilizer they used and make some calculations and estimations on quantity of pesticide, fertilizer used per unit of land, etc. As a result, the information collected might not be totally correct.Vietnam is still in the early stages of the battle against tobacco. The findings from the present study provide valuable and timely evidence that can be used to increase public awareness as well as develop and implement appropriate responses to the harmful effects of tobacco growing.The authors declare that they have no competing interests.Hoang Van Minh, Kim Bao Giang, Nguyen Ngoc Bich and Nguyen Thanh Huong made substantial contributions to conception and design, or acquisition of data, or analysis and interpretation of data. All three have been involved in drafting the manuscript or revising it critically for important intellectual content.The pre-publication history for this paper can be accessed here:

Although DCs can be directly infected by certain strains of HIV-1, productive infection of DCs is not required during trans-infection; instead, DCs capture and internalize infectious HIV-1 virions in vesicles for later transmission to CD4 T cells via vesicular exocytosis across the infectious synapse. This model of sequential endocytosis and exocytosis of intact HIV-1 virions has been dubbed the “Trojan horse” model of HIV-1 trans-infection. While this model gained rapid favor as a strong example of how a pathogen exploits the natural properties of its cellular host, our recent studies challenge this model by showing that the vast majority of virions transmitted in trans originate from the plasma membrane rather than from intracellular vesicles. This review traces the experimental lines of evidence that have contributed to what we view as the “rise and decline” of the Trojan horse model of HIV-1 trans-infection.To ensure their survival, microbial pathogens have evolved diverse strategies to subvert host immune defenses. The human retrovirus HIV-1 has been proposed to hijack the natural endocytic function of dendritic cells (DCs) to infect interacting CD4 T cells in a process termed Dendritic cells (DCs) play a central role in initiating the adaptive immune response that counters pathogen infection. Immature DCs patrol the peripheral mucosal tissues, searching for unwanted intruders. Once a pathogen is sensed, captured, and internalized, DCs undergo a maturation process and migrate to the regional lymph nodes. Meanwhile, the internalized pathogens are processed into antigenic peptides, and co-stimulatory molecules are expressed on the cell surface, readying these professional antigen-presenting cells for effective T-cell stimulation trans-infection.Pathogens have evolved various means to escape the host immune response by subverting the function of DCs. HIV-1 excels in this capacity. Like many other microbial pathogens, HIV-1 interferes with Toll-like receptor signaling, impairing the secretion of antiviral and inflammatory cytokines needed for the development of an effective immune response trans-infection in vivo is lacking, numerous in vitro observations suggest that such capture and transfer of virions to permissive cells is advantageous for the virus, in particular when quantities of infectious particles are limiting. In early studies of ex vivo tissue explants, most HIV-1 replication was observed within DC–T-cell conjugates Although direct evidence of in trans to interacting CD4 T cells trans-infection involved internalization of virions into an endocytic compartment trans-infection in which exocytosis of virion-laden vesicles into the synapse promoted highly efficient infection of CD4 T cells.The mechanism underlying this DC-dependent enhancement of HIV infection remained unknown until the discovery of DC-specific intercellular adhesion molecule-grabbing non-integrin (DC-SIGN) trans-infection of T cells trans-infection of T cells by DCs derived in vitro from monocytes (MDDCs) involves DC-SIGN DC-SIGN, the most-studied C-type lectin receptor that captures HIV-1 virions, is a calcium-dependent lectin that binds the HIV envelope with an affinity similar to that of CD4 trans-infection mediated by mannose receptors in DCs is lacking, but in macrophages, these receptors appear to play an important role in the trans-infection of CD4 T cells in transtrans-infection mediated by DC-SIGN on MDDCs, suggesting that langerin and DC-SIGN may, in fact, mediate opposite fates for HIV-1 virions. However, caution is warranted when comparing results from ex vivo LCs and in vitro derived DCs. LCs derived in vitro from CD34-expressing precursor cells, like MDDCs, mediate efficient trans-infection of T cells despite expression of langerin trans-infection Other C-type lectin receptors, such as langerin and mannose receptors, are at least equally important for gp120 binding to epithelial DCs As part of their normal function, DCs internalize pathogens and process proteins from these organisms into small antigenic peptides for subsequent presentation to CD4 T cells on MHC-II receptors. Typically, immature DCs display high levels of endocytic capacity while mature DCs are characterized by efficient antigen processing and presentation. Early in vitro and ex vivo studies supported the notion that DCs internalize structurally intact HIV-1 virions into large vacuolar structures In mature MDDCs, the compartment harboring HIV-1 virions shares certain features with the late endosome or the multivesicular body (MVB), but other features differentiate these structures from classical late endosomes or lysosomes trans-infection of CD4 T cells Upon interaction with T cells, HIV-1-loaded MDDCs redistribute virion-containing vesicles to the DC–T-cell junctions trans-infection, we tested the effects of soluble CD4 (sCD4). This agent selectively neutralizes gp120 on surface-bound virions while not altering internalized virions. To our surprise, sCD4 completely inhibited HIV-1 trans-infection trans-infection. To exclude possible unappreciated effects of sCD4, we also inactivated surface-bound virions with pronase. Again, trans-infection was abrogated by the selective incapacitation of surface-bound HIV-1 virions in both MDDCs and CD34-derived LCs. These findings implicating surface virions in trans-infection .A major drawback of protease treatment of the cell surface is its relative lack of specificity for bound HIV-1 virions. Key components of the infectious synapse could be digested, resulting in altered or delayed synapse formation. The use of more specific membrane-impermeable inhibitors, such as sCD4 and HIV-1-neutralizing antibodies, avoids these complications. Two studies with these agents have appeared trans-infection in the context of opsonized HIV-1 virions.Recently, a twist on the Trojan horse model emerged in a study suggesting that HIV-1 virions in immune complexes may recover their infectivity after capture by immature MDDCs and release of the bound antibodies within the acidified endocytic compartment trans-infect T cells. Such factors include the state of DC activation and maturation, the time elapsing between virion capture by DCs and contact with interacting T cells, and the nature of receptors that mediate binding of HIV-1 virions.The fact that virions are almost exclusively transmitted from the DC surface implies that virion internalization is chiefly a dead end for infectious virions. Several factors influencing the internalization of HIV-1 virions might affect their likelihood to trans-infect T cells External molecules are taken up in DCs via multiple pathways, including phagocytosis, macropinocytosis, and receptor-mediated endocytosis via clathrin-coated pits and caveolae. DC differentiation and maturation are associated with a decline in endocytic activity, particularly macropinocytosis trans-infection. In initial studies, virions captured by Raji-DC-SIGN and MDDCs retained their infectivity for several days trans-infection for only a few hours after capture trans-infection trans-infection trans-infection, as seen in macrophages trans-infection of T cells by DCs. Interestingly, the use of inhibitors that impair intracellular trafficking and/or acidification of the endosomes appear to exert only minimal effects on trans-infection trans-infection trans-infection. Conversely, expression of Nef in MDDCs and neutralization of CD4 by antibodies decrease available surface CD4 and are associated with increases in trans-infection. Collectively, these studies suggest that virion internalization negatively regulates trans-infection and are consistent with surface-bound virions forming the principal source of virions mediating trans-infection.The time elapsing between virion capture by DCs and contact with interacting T cells may also affect the efficiency of trans-infection of T cells by DCs involves primarily surface-bound virions argues that future research should be refocused on how HIV-1 hijacks the plasma membrane rather than the intracellular trafficking pathway as suggested by the original Trojan horse model. Unraveling how these virions are recruited to the infectious synapse is crucial. The presence of C-type lectin receptors in lipid rafts in trans will be important. Finally, our new model suggests that in vivo transmission of virions captured by DCs to T cells is likely to be far more sensitive to attachment inhibitors and neutralizing antibodies than previously anticipated. Only time will tell whether this fact can be therapeutically exploited.The finding that

Palaeovegetation (pollen data) and palaeofire records are synthesized from 20 sites within the present tropical forest biome, and the underlying causes of any emergent patterns or changes are explored by reference to independent palaeoclimate data and present-day patterns of precipitation, forest cover and fire activity across Amazonia. During the Early–Mid-Holocene, Andean cloud forest taxa were replaced by lowland tree taxa as the cloud base rose while lowland ecotonal areas, which are presently covered by evergreen rainforest, were instead dominated by savannahs and/or semi-deciduous dry forests. Elsewhere in the Amazon Basin there is considerable spatial and temporal variation in patterns of vegetation disturbance and fire, which probably reflects the complex heterogeneous patterns in precipitation and seasonality across the basin, and the interactions between climate change, drought- and fire susceptibility of the forests, and Palaeo-Indian land use. Our analysis shows that the forest biome in most parts of Amazonia appears to have been remarkably resilient to climatic conditions significantly drier than those of today, despite widespread evidence of forest burning. Only in ecotonal areas is there evidence of biome replacement in the Holocene. From this palaeoecological perspective, we argue against the Amazon forest ‘dieback’ scenario simulated for the future.This paper uses a palaeoecological approach to examine the impact of drier climatic conditions of the Early–Mid-Holocene ( We also consider how fire regimes may have changed throughout the Holocene, given that drier climates would be expected to promote increased fire, either directly due to drier soils and reduced humidity or indirectly by favouring more flammable ecosystems (e.g. savannahs). If past fire activity is found to be unrelated to climatic conditions or vegetation flammability, then this would be indicative of anthropogenic, rather than natural, burning.http://www.bridge.bris.ac.uk/projects/QUEST_IGBP_Global_Palaeofire_WG). Site metadata are shown in We discuss a selection of previously published sites from tropical South America, which show strong evidence for precipitation change throughout the Holocene, all of which come from the tropical Andes and 2. WThere is widespread evidence that during the Early–Mid-Holocene (approx. 8000–4000 years BP) climatic conditions in the tropical Andes were significantly drier than present. Evidence comes from a variety of proxies , e.g. pea,b), and the vast size of this region, it is unsurprising that the timing of these Holocene precipitation maxima and minima differs significantly among these records. Tropical Southern Hemisphere lake-level low-stands occur progressively later in the Holocene with increasing latitude and positively correlated with the length and severity of the dry season (figure 1b), and proximity to ecotones .The impact of the drier conditions of the Early–Mid-Holocene upon tropical forests varied across the Amazon Basin , and, asfigure 1b). At Carajas (eastern Amazon ecotone), this reduction in precipitation caused replacement of forest by open savannah between ca 8900 and 4460 years BP, which in turn gave way to forest again when precipitation increased once more in the Late Holocene (c). Throughout most of the Holocene, these sites were dominated by a dry forest/savannah mosaic and yet the surrounding tropical forests have experienced little change over the past 6000–7000 years , and, crucially, the Beni savannahs are not climatically controlled but are instead a function of edaphic and hydrological conditions that are unfavourable to woody plants , which conceivably was longer and more severe earlier in the Holocene (if the Andean climate records are representative of the eastern Amazon). It is possible that increased severity and/or frequency of droughts led to greater tree mortality and hence more forest gaps, leading to a greater proportion of the forest in an early successional (i.e. Cecropia-dominated) state and longer-lived tree taxa. Furthermore, the marked variability in timing of this Cecropia phase among this tight cluster of sites does not fit with a regional climatic forcing and instead points to a non-climatic cause for this forest disturbance (e.g. humans) for at least some of the sites (see below).The cluster of five sites in eastern Amazonia , show a change from terra firme forests to predominantly varzea–igapó forests in the Late Holocene , tributaries close to the main Amazon River channel c, show aHolocene , consista,b), and each exhibits floristic changes during the Mid-Holocene, coincident with peak aridity in the high Andes. The Lake Pata pollen record has previously been interpreted by the site investigators between 8700 and 5800 years BP , reduced precipitation (9000–5000 years BP) caused local replacement of cloud forest taxa by lowland rainforest taxa , shows surprisingly little change in forest composition throughout the Holocene , although the presence of charcoal in a single sample at Pata ca 5000 years BP raises the possibility that it might be causally related to reduced Mid-Holocene precipitation.Despite this heterogeneity, there is a hint of a broader scale regional pattern, suggesting that climate forcing may also have played a role in Holocene fire regimes. Several sites show clear Mid-Holocene (6000–4000 years BP) charcoal peaks, perhaps due to the drier climate at this time making forests more combustible. The absence of charcoal at Consuelo, and near-absence at Pata, is unsurprising, given that these sites occur in the wettest parts of the basin a,b, althCecropia and/or grass, spanning several millennia, in particular at Santa Maria, Geral and La Teta-2, point to burning of sufficient frequency to maintain forests in a continually disturbed, early successional state.Although the impact of past fires on the structure and species composition of Holocene Amazonian forests is difficult to discern from pollen records, correlative peaks in charcoal and In the most seasonal, ecotonal regions of the Amazon lowlands, the drier climate of the Early–Mid-Holocene caused either the replacement of forest by savannah (Carajas) or supported the continued presence of savannahs in regions which were previously unforested . On the eastern slopes of the Andes, reduced cloud cover caused replacement of cloud forest taxa by lowland tree taxa. Even in the wettest central part of the Amazon (Pata), closed-canopy forest may have given way to more open vegetation, consistent with Mid-Holocene drying.Cecropia pollen, constituting clear evidence of disturbance. This disturbance may have been caused by drought, fire or humans, or a combination of all three, the probable cause at a given site depending on how well the palaeoclimate, pollen and charcoal patterns match one another, as well as the precipitation regime and fire return interval of the locality today. Even where it is clear that the disturbance was driven by fire (e.g. Santa Maria), the cause of fire may itself be an issue. Palaeo-Indians are the most probable source of ignition, even at seasonal sites such as Santa Maria, where the charcoal peak supports the hypothesis that a Cecropia phase spanning several millennia is best explained by Palaeo-Indians maintaining the forest in an early successional state using fire. In fact, the widespread evidence for these long-lasting Cecropia phases suggests that humans, rather than climate, may have been the key agents of disturbance of Holocene forests in many parts of the basin, especially if ‘pre-Conquest’ Amazonia was much more densely populated than previously thought . Although the effects of continually rising COncertain , in combn et al. , 2000 an

CML is elevated in diabetic patients and apparent in atherosclerotic lesions. AGEs are associated with hypertension and arterial stiffness potentially by qualitative changes of elastic fibers. We investigated whether CML affects carotid and aortic properties in normoglycemic subjects.Nth percentile: 181.6 ng/ml, 75th percentile: 226.1 ng/ml) into "high CML" versus "low CML" as determined by ELISA. Local carotid artery properties, carotid intima media thickness (IMT), aortic pulse wave velocity (PWV), blood pressure and fetuin-A were analyzed. In 26 patients after carotidectomy, CML was visualized using immunohistochemistry.Hundred-two subjects (age 48.2 ± 11.3 years) of the FLEMENGHO study were stratified according to the median of the plasma CML level , in particular in participants with elevated blood pressure and with "high" CML . CML was associated fetuin-A as marker of vascular inflammation in the whole cohort and with carotid diameter in hypertensive subjects . CML level had no effect on aortic stiffness. CML was detected in the subendothelial space of human carotid arteries.In normoglycemic subjects CML was associated with carotid diameter without adaptive changes of elastic properties and with fetuin-A as vascular inflammation marker, in particular in subjects with elevated blood pressure. This may suggest qualitative changes of elastic fibers resulting in a defective mechanotransduction, in particular as CML is present in human carotid arteries. The latter are induced by advanced glycation end products (AGEs) which are generated by non-enzymatic glycation and oxidation of protein and reducing sugars . Their fy action . In athey action .Circulating levels of AGEs have been measured and related to the degree of coronary arteriosclerosis in both diabetic and non-Hundred-two subjects of the FLEMish study of ENvironment, Genes and Health Outcomes (FLEMENGHO) involvinε-Carboxymethyllysine (CML) plasma level of free CML and protein-bound CML was measured using an ELISA kit , following the instructions of the manufacturer. Intra- and interassay variability were below 5%. The entire cohort was grouped according to the median of plasma CML . The values below median are referred to as "low" and these above median as "high" CML, respectively. Blood glucose, total cholesterol, HDL, LDL, triglycerides, and serum creatinine were also measured in all subjects by routine laboratory methods. Fetuin-A was measured by commercially available ELISA according to the manufacturer protocol [For at least 3 h before being examined, the participants refrained from heavy exercise, smoking, alcohol or caffeine-containing beverages. Trained nurses measured blood pressure and anthropometric characteristics. They administered a questionnaire to collect information about each subject's medical history, smoking and drinking habits, and intake of medications. Each participant's office blood pressure was the average of five consecutive readings. Elevated blood pressure was a systolic blood pressure above 140 mmHg and/or 90 mmHg diastolic or use of antihypertensive treatment. Body mass index (BMI) was weight in kilograms divided by the square of height in metres. Nprotocol .2 and ΔA=πX[(D+ΔD)/2)2-πX(D/2), respectively. The intraobserver intrasession variability was <10% for the carotid measurements. The intraobserver intersession and interobserver intrasession variability were of the same order of magnitude.By means of a pulsed ultrasound wall-tracking system , 3 trained researchers obtained vascular measurements at the common carotid artery 2 cm proximal of the carotid bulb. During the ultrasound examination, an automated oscillometric device recorded blood pressure at the upper arm at 5-minute intervals. As for the conventional auscultatory measurements, cuff size was adjusted to the circumference of the upper arm. Standard cuffs had an inflatable bladder of 12 × 24 cm . As descThe observers also determined carotid-femoral pulse wave velocity (PWV) from the length of the carotid-femoral segment and the transit time of the pulse wave. The carotid-femoral segment was the difference of the distances between the site of the carotid ultrasound measurement and the suprasternal notch and between the suprasternal notch and the site of the femoral measurement. We measured PWV using a high-fidelity SPC-301 micromanometer interfaced with a laptop computer running the SphygmoCor software, version 6.31 .Immunohistochemical CML staining of a carotid artery with atherosclerotic lesions was performed in human material after carotidectomy . Twenty 2-test. The Spearman correlation coefficient was assessed for CML and the clinical properties in the whole cohort and the subgroup of normotensive and hypertensive subjects. Results are expressed as mean ± SD. A p value of less than 0.05 was considered to be statistically significant.Statistical analyses were performed using SPSS software version 15.0 . Comparison between subjects with above and below the median of CML was performed by unpaired t-test or the χth percentile: 181.6, 75th percentile: 226.1) are given in Table Baseline characteristics of the Flemish cohort and according to the median plasma CML level of the cohort . PWV was not different between the "low" and "high" CML group. The bivariate Spearman association of CML and carotid diameter is for the normotensive cohort r = -0.01 (P = 0.92) and for subjects with elevated blood pressure r = 0.42 and distensibility were comparable between these two subgroups.Subdividing the normotensive subjects according to the CML median no significant differences were apparent for carotid and aortic properties (data not shown). In contrast, subdividing the group with elevated blood pressure according to the CML median resulted in an increased carotid diameter in the 13 subjects with "high" CML (514.5 ± 151.6 μm) as compared to the 20 subjects with "low" CML and 2B (400×) reveal CML positive cells in the subendothelial space. CML staining is present in atheromatous lesions and colocalizes with inflammatory cells.The characteristics of the patients with carotidectomy are summarized in Table The main finding of this study is that carotid enlargement is apparent in context with elevated CML plasma levels which are still in the normal range. Moreover, the effect of CML on carotid enlargement is predominantly present in subjects with elevated blood pressure without changes in cross-sectional compliance or distensibility. Finally, CML was associated with fetuin-A as vasculo-inflammatory marker and was present in the subendothelial space of human carotid arteries.CML is involved in vascular stiffening of type 1 diabetics as well as of hypertensive subjects ,16. Our Although no prospective data exist on carotid diameter, Kawamoto et al. showed that the carotid artery diameter correlates with conventional cardiovascular risk factors including alcohol consumption , these fThe mechanisms underlying this CML-related effect on carotid diameter cannot primarily be explained by an enhanced cross linking by AGEs as CML may affect the properties of the AGE-modified proteins but does not cause cross-linking in or between proteins ,26. TherCML had no effect on carotid enlargement in subjects with normotensive blood pressure values. By contrast, in subjects with elevated blood pressure the CML plasma level characterized the extent of carotid enlargement without adaptive changes of the elastic artery properties. This may in turn lead to increased circumferential wall stress and consecutively result in a potentially defective mechanotransduction, that is, the control of smooth muscle cell growth and migration, and production of extracellular matrix in response to diameter enlargement . FurtherIn this cohort no effect of CML on PWV was observed. Therefore this study contrasts a recent observation describing CML as blood pressure independent factor in aortic stiffness . HoweverIn summary, normoglycemic subjects with higher CML plasma levels are characterized by carotid enlargement without changes in elastic properties, in particular in elevated blood pressure. This may be associated with a qualitative change of elastic fibers and may lead to a defective mechanotransduction both explainable by local glycoxidation and lipid peroxidation induced inflammation.The authors declare that they have no competing interests.MB designed, coordinated and wrote the manuscript. TR, TK and JS generated the data of the Flemish cohort. JP and HE provided the human carotid arteries. DS and UH coordinated and wrote the manuscript. All authors read and approved the final manuscript.

Comparative genomic hybridization (CGH) was used to detect copy number changes of DNA sequences in the Ewing family of tumours (ET). We analysed 20 samples from 17 patients. Fifteen tumours (75%) showed copy number changes. Gains of DNA sequences were much more frequent than losses, the majority of the gains affecting whole chromosomes or whole chromosome arms. Recurrent findings included copy number increases for chromosomes 8 , 1q and 12 . The minimal common regions of these gains were the whole chromosomes 8 and 12, and 1q21-22. High-level amplifications affected 8q13-24, 1q and 1q21-22, each once. Southern blot analysis of the specimen with high-level amplification at 1q21-22 showed an amplification of FLG and SPRR3, both mapped to this region. All cases with a gain of chromosome 12 simultaneously showed a gain of chromosome 8. Comparison of CGH findings with cytogenetic analysis of the same tumours and previous cytogenetic reports of ET showed, in general, concordant results. In conclusion, our findings confirm that secondary changes, which may have prognostic significance in ET, are trisomy 8, trisomy 12 and a gain of DNA sequences in 1q.

A double staining technique was developed for the simultaneous measurement of tissue hypoxia and the concentration of non-protein sulphydryls (NPSH), based on the fluorinated nitroimidazole EF5 and the fluorescent histochemical NPSH stain 1-(4-chloromercuriphenoylazo)-naphthol-2 (mercury orange). Cryostat sections of tumour tissue were examined by fluorescence image analysis, using a computer-controlled microscope stage to generate large tiled field images of the cut tumour surface. This method was applied to the human cervical squamous cell carcinoma lines ME180 and SiHa, grown as xenografts in severe combined immunodeficient (SCID) mice, in order to determine if there is a systematic relationship between tissue hypoxia and NPSH levels. Hypoxic regions of the tumours, defined by EF5 labelling, were found to show greater NPSH concentrations relative to better oxygenated regions. This is probably due to increases in glutathione, since the ME180 and SiHa xenografts contained low levels of cysteine and metallothionein; the other major cellular thiols that can bind to mercury orange. Because the effects of glutathione on radiation and chemotherapy resistance are likely to be greater under hypoxic conditions, these results have potentially important implications for the study of resistance mechanisms in solid tumours. © 1999 Cancer Research Campaign

The liaison between academia and the pharmaceutical industry was originally served primarily through the scientific literature and limited, specific industry–academia partnerships. Some of these partnerships have resulted in drugs on the market, such as Vorinostat and Tenofovir , but the timescales from concept to clinic have, in most cases, taken many decades. We now find ourselves in a world in which the edges between these sectors are more blurred and the establishment and acceptance of high-throughput screening alongside the wider concept of ‘hit discovery’ in academia provides one of the key platforms required to enable this sector to contribute directly to addressing unmet medical need. The days of a clear distinction between academia's and industry's roles in developing new therapies are long gone and, in the past ten years, a small revolution has taken place within institutions previously recognized as centres of international excellence in fundamental research. Many such institutions now have translational research-based groups and platforms developed to take basic research and apply it towards clinical applications. Academia has for some time recognized the role of identification of chemical matter in the endeavour of addressing specific biological questions, and the stochastic nature of screening for these molecules is now widely accepted as a legitimate discipline in this sector. There are many academic contextualized screening centres across the world, each with different specializations and remits and, collectively, they represent a vast transfer of knowledge and technology bases from industry into academia. The resulting blend of academic endeavour and innovation with industrial purpose and discipline provides fertile grounds for translational research. It is anticipated that the drive from funding bodies towards translational research will sustain these activities as they continue to address chemical genomics and, increasingly, enter the world of drug discovery. While the pharmaceutical sector has to moderate its strategy to cope with challenging business and economic times, the academic drug discovery sector has the potential to develop to a level of maturity and robustness with which it can contribute meaningfully to the development of new mode-of-action therapies against a range of diseases, not least neglected and niche diseases. In this review, we aim to give an overview of the current academic screening sector and provide opinions on areas for future focus and development. We use the terms ‘academia’ and ‘academic’ to encompass both teaching and non-teaching institutes, plus some other not-for-profit centres, and to distinguish them from the traditionally recognized pharmaceutical and biotechnology sectors.In addition to the university system itself, there are several other bodies that have important roles in funding, overseeing, translating and guiding the research and screening output in the academic sector. Government-funded bodies, such as the Medical Research Council (MRC) in the UK and the National Institutes for Health (NIH) in the US, have always invested in leading-edge research activities within universities and research institutes, but over the past decade a noticeable focus on drug discovery initiatives and screening facilities has been evident: for example, see the MRC's Translational Research Strategy The Society of Biomolecular Sciences Reference Library Where once academic laboratories were devoid of the automation instrumentation that was increasingly deployed in the pharma and biotech sectors of the industry during the 1990s, many of the academic screening centres are now The discipline of hit discovery is underpinned by a raft of technology requirements including a plethora of assay formats: liquid handling, automation, large data set management and chemoinformatics . The extThe majority of centres have a range of the conventional biochemical assay options that use all of the well-established photo-detection technologies underpinning both molecular-target- and cell-based screening. These formats are often supported by a range of detectors, from standard multi-modal readers to laser scanning cytometry, ultra-fast charge-coupled-device-based wide field imaging and ultimately confocal high-content screening systems. Some centres support their specialist interests with whole-organism screening in protozoan parasites and model multicellular organisms, such as zebrafish The importance of high stringency assay development in this sector cannot be overestimated. This subject belies one of the main cultural and operational distinctions between academic and industry-trained scientists. The concept of developing biological assays and systems with sufficient robustness to operate at scale for screening and then with longevity to support chemical probe development or drug discovery is the one that brings distinct challenges when adapting assay concepts from research laboratories. In recognition of this, the NCGC, in collaboration with investigators from Eli Lilly, have compiled an Assay Guidance Manual In the past, screening centres have tended to develop in isolation from the associated technologies and capabilities required to make their outputs of the highest value. The most effective groups in the sector recognize the importance of stringent compound management Lessons learned over several years have now produced the concept of a healthy balance of options for the discovery of chemical matter for biological systems involving high-quality screening of well-designed, appropriately propertied and enriched small molecule compound libraries, besides the use of alternate approaches, including natural products and small molecular fragments.Small-molecule-based high-throughput screening has had a chequered history, even within its ancestral home of industrial drug discovery. Much of the controversy surrounding its effectiveness is born out of other trends in the pharmaceutical sector that happened in parallel; notably, the advent of combinatorial chemistry and the molecular genomic revolution. When all three major events connected – the availability of millions of chemistries, hundreds of new molecular targets and the systems to permit large-scale cross-screening – the outcome was one of considerable investment without the anticipated stream of new chemical entities progressing towards the clinic Most academic centres focus on small-molecule screening, and many have several compound collections incorporMany precedents have been set regarding the utility of natural products as therapeutics, including lovastatin Fragment-based hit discovery offers new possibilities for academic screening groups, providing the opportunity to probe large areas of chemical space in small-scale screening campaigns with a technology that is now a proven method of hit identification in industry in vitro but require progression to in vivo disease models to further assess their therapeutic potential. This is often hindered by the inability to identify or develop drug-like chemical matter. Our ability to address these difficult targets (e.g. protein–protein interactions and protein–RNA interactions) can be improved by focussing on the development of suitable alternative assay methodologies. For example, there is increasing confidence that fragment-based approaches offer improved opportunities for screening against difficult targets, such as protein–protein interactions, that standard biochemical HTS cannot offer There are numerous targets and mechanisms that have already established good validation in vitro human stem cell culture, differentiation and re-programming. Advances in this field are aimed at overcoming the esoteric, ill-defined growth factor or serum component relevance and genetic-modification-based protocols historically associated with differentiation protocols. Several academically based groups have been identifying small molecules that could mimic these processes (reviewed in Refs. Drives to enhance the efficiency of hit triaging and progression decisions will come from developments in many disciplines, not least chemoinformatics applications. Whatever the nature of the biological information at hit stage, its information content and physiological relevance will be a major factor in the downstream success of any compound series. The availability of human primary cells for screening in primary mode is very limited, but this could be abridged through progress being made in Innovation in academic screening and its contribution to drug discovery will also come from the evolution of its operating models. There is increasing evidence of pharmaceutical companies wanting to marry their in-house cell models with chemical matter developed in the academic sector, such as Eli Lilly's open innovation programme. A sign that a new era of collaboration might be upon us comes from early indications that companies are now considering sharing the riches of their corporate collections with academic screening centres to further exploit their chemical matter in novel target systems and/or support neglected disease drug discovery.There are numerous areas of drug discovery in which academically contextualized groups can provide a pre-competitive harbour for the development and testing of new targets, methods and paradigms that can be implemented one day to improve drug discovery productivity. Applied research in this sector will no doubt lead to validation of new targets and mechanisms, new lead matter, new methodologies and production of trained staff. There are sceptics who suggest that the level of investment in the NIH initiative does not equate to tangible outputs For universities considering hosting a screening centre, the primary advice is to align these operations with the academic strengths of the organization in question and to have chemistry embedded to enable the progression of projects in a meaningful and timely manner. Besides having an important part to play in target validation, screening centres have the potential and opportunity to move away from the individual molecular-target approach and embark upon novel target discovery through strategically coupled phenotypic screening and target identification platforms. This represents a clear opportunity for the sector to distinguish itself from industry-led approaches and, ultimately, to provide important new knowledge to feed into both the scientific literature and future pharmaceutical industry pipelines.

In some instances, the phylogenetic trees used for such analyses are fully bifurcating, but in many cases the phylogenies being used contain unresolved nodes (i.e. polytomies). The lack of phylogenetic resolution in such studies, while certainly not preferred, is likely to continue particularly for those analyzing diverse communities and datasets with hundreds to thousands of taxa. Thus it is imperative that we quantify potential biases and losses of statistical power in studies that use phylogenetic trees that are not completely resolved. The present study is designed to meet both of these goals by quantifying the phylogenetic diversity and dispersion of simulated communities using resolved and gradually ‘unresolved’ phylogenies. The results show that: ( The species list from a community may be used to provide two immediate indices depicting its biodiversity. The first is the number of species, or species richness, found in the community. The second is a measure of the taxonomic dispersion between co-existing species such as the genus to species ratio. While these two measures are still often reported and analyzed, conservationists and community ecologist have become increasingly interested in quantifying the phylogenetic diversity and phylogenetic dispersion of communities Despite this interest in quantifying the phylogenetic diversity and dispersion of communities, many methodological hurdles remain. First, ecologists and conservationists are often limited in their capacity to calculate such phylogenetic metrics due to a lack of phylogenetic hypotheses for the communities of interest. This barrier has resulted in ecologists and conservationists taking one of two pathways. The first pathway has been to not perform phylogenetic analyses and to quantify the species richness and taxonomic ratios of a community. The second pathway has been to construct a phylogenetic hypothesis using novel molecular data or to generate a phylogenetic supertree using previously published datasets.n−1 contrasts Although the second pathway has the potential to garner a more quantitative and evolutionarily grounded metric of biodiversity, the researcher must still confront the possibilities of biased results due to uncertainty in the phylogenetic tree. The loss of statistical power in phylogenetic studies due tree uncertainty is not a new problem. Comparative biologists have faced and are facing similar issues in the development of their methods a priori predictions are less clear because phylogenetic dispersion is quantified using randomizations that may mitigate the loss of statistical power and the potential to over- or under-estimate phylogenetic diversity and dispersion.In this article, I focus on the issue of soft polytomies and their potential to bias metrics of phylogenetic diversity and dispersion. I have chosen this focus because ecologists are increasingly generating phylogenetic supertrees in their work that contain multiple soft polytomies i) how correlated are the phylogenetic diversity and dispersion values generated using a fully resolved phylogeny to those generated using a phylogeny containing polytomies?; (ii) is the phylogenetic diversity and dispersion generally over- or under-estimated when using a phylogeny containing polytomies?; (iii) are metrics of phylogenetic diversity and dispersion less powerful as the number of polytomies in the phylogeny increases?; (iv) is the power to detect the known phylogenetic diversity and dispersion influenced more by basal or terminal polytomies?; (v) are metrics of phylogenetic diversity and dispersion less powerful as the number of species in the community relative to the number of species in the phylogeny increases?; and (vi) are different metrics of phylogenetic diversity and dispersion equally sensitive to the above conditions.Given the increasing interest in quantifying the phylogenetic diversity and dispersion in communities and the increasing use of phylogenetic supertrees to conduct such measurements, it is critical that we quantify the potential biases and the potential loss of statistical power introduced by this approach. The present study is designed to provide such insights. Specifically, it starts by quantifying the phylogenetic diversity and dispersion in communities using a fully resolved phylogeny. Then it compares those values to those for the same communities using a phylogeny that is gradually ‘unresolved’ using two different methods. The results are used to address the following questions: (http://www.cibiv.at/software/pda/) with the number of terminal taxa being 20, 40, 80, 160 or 320. Five random phylogenies were generated for each number of terminal nodes thereby providing the 25 fully bifurcating phylogenetic trees used in this study. These trees represented the species pool from which community assemblages were drawn. A Yule-Harding branching process with constant birth rates through time was used as a first step towards uncovering biases in the methods analyzed in the present study and it serves as a satisfactory model A priori it would be expected that a decrease in diversification through time would reduce statistical bias and increase statistical power and an acceleration in lineage diversification through time would likely increase bias and reduce statistical power.The present study was designed to quantify the degree to which polytomies in phylogenetic trees influence measures of phylogenetic diversity and dispersion in communities. To achieve this, I first randomly generated fully resolved ultrametric phylogenies using a uniform Yule-Harding branching process using the software PDA - Phylogenetic Diversity Algorithm Version 0.5 The community assemblages used in this study had species diversities that were 10, 15, 20, 25, or 30 percent of the number of terminal taxa in the phylogenetic trees representing the species pools. The assemblages were generated using three different methods. The first method was designed to generate the assemblage with the maximum possible phylogenetic diversity given a species richness. These assemblages were generated using the “Greedy Algorithm” The phylogenetic diversity of the assemblages was measured using three methods commonly used by ecologists. The first measure was Faith's Index The phylogenetic diversity of assemblages is generally correlated to species richness. At the same time community ecologists are also interested in whether the phylogenetic diversity in an assemblage is greater or less than that expected given the assemblage species richness. This is termed here as the phylogenetic dispersion of an assemblage. Two commonly used metrics were used in this study to quantify the phylogenetic dispersion of assemblages. Specifically, the Net Relatedness Index (NRI) and Nearest Taxon Index (NTI) of Webb and colleagues Two methods were used to introduce soft polytomies into the original fully bifurcating phylogenetic tress. The first method used in this study was designed to randomly ‘unresolve’ internal nodes in the phylogeny. There were four different degrees to which the phylogeny was unresolved. Specifically, I randomly collapsed 15, 20, 25, and 30 percent of the internal nodes. The branch lengths for the edges subtended by the collapsed node were set to equal the length between the collapsed node and the next most terminal node in each lineage. This approach provided four phylogenies containing different numbers of polytomies for each original resolved phylogeny. This method was used to mirror a study where some basal nodes are unresolved, while at the same time some terminal clades have some nodes resolved.The second method ‘unresolved’ the most terminal nodes on the phylogeny. Specifically, I collapsed 15, 20, 25, and 30 percent of the internal nodes in the phylogeny that were the most terminal on the phylogeny. The branch lengths for the edges subtended by the collapsed node were set to equal the length between the collapsed node and the tip of the tree. This method was used to simulate a scenario where species- or genus-level relationships are unknown, but the most basal nodes are bifurcating. The lack of resolution in more terminal internal nodes is common in studies using phylogenetic supertrees, but these studies also tend to have polytomous nodes basally as well The first goal of this study was to determine the degree to which the phylogenetic diversity and dispersion in a community measured using a fully bifurcating phylogeny is correlated with the phylogenetic diversity and dispersion of the same community using a phylogeny with multiple polytomies. The second was to determine whether phylogenetic diversity and dispersion tended to be over- or under-estimated, false positives and false negatives respectively, when a less resolved phylogeny was used. In order to answer both of these questions, I regressed the phylogenetic diversity and dispersion metrics from the phylogenies with polytomies onto the phylogenetic diversity and dispersion metrics from the fully resolved phylogeny. The expectation was a perfect correlation with a regression slope of unity. Thus all regression lines were forced through the origin and the coefficient of determination and the slope of the regression line were recorded. The coefficient of determination was used to answer the first question as to how tightly the results from the less resolved and fully resolved phylogenies were correlated. The regression slope was used to determine whether the results from the less resolved phylogeny tended to produce over- or under-estimates of the results from the fully resolved phylogeny. In i) the mean pair-wise phylogenetic distance between all taxa in an assemblage (MDP); (ii) the mean nearest phylogenetic neighbor distance for the taxa in an assemblage (MNND); and (iii) the proportion of the total branch lengths in the phylogeny represented in the assemblage excluding the root (Faith's Index: FI). The sensitivity of each of these three metrics to the resolution of the phylogenetic tree was quantified by ‘unresolving’ the phylogeny to varying degrees. There were a few general results from these analyses.Three metrics of community phylogenetic diversity were used in this study. Specifically, I used: (r2>0.95) for all of the metrics analyzed and the Nearest Taxon Index (NTI), to varying degrees of phylogenetic resolution. When randomly ‘unresolving’ nodes on the phylogeny, the correlation between the NRI from the fully bifurcating tree and the NRI derived from phylogenies with polytomies generally became weaker as the phylogenetic resolution decreased , and 5. r2>0.8) with the NRI and NTI values from the fully bifurcating phylogeny tended to underestimate the known phylogenetic diversity to the greatest degree as the number of polytomies and phylogeny size increased followed by the MPD and MNND metrics. This result is most likely due to FI being represented as a proportion. For example, as the total phylogenetic tree length increased or decreased the FI will be altered even if the taxa subtended by the unresolved nodes are not in the community . ConversThe second section of this study was designed to quantify the sensitivity of two commonly used phylogenetic dispersion metrics (NRI and NTI) to phylogenetic resolution. The NRI and NTI are calculated using the MPD and MNND respectively of the communities, but are standardized by the mean and variance of the MPD's and MNND's of the null assemblages. Thus, it has been unclear whether the NRI and NTI should be equally or less sensitive to the resolution of the phylogeny as compared to MPD and MNND. The results from this study show that both the correlation of the NRI and NTI measured using a fully resolved phylogeny and the NRI and NTI measured using a ‘unresolved’ phylogeny generally decreases as the phylogeny becomes less resolved , and S3.The last portion of this study analyzed whether the species richness of an assemblage compared to the number of terminal taxa in the phylogeny influenced the degree to which phylogenetic dispersion results were biased. There were no clear and consistent trends stemming from these analyses. The main result of interest came from the analyses using the largest phylogeny, where the NRI and NTI metrics were biased in opposing directions as the number of taxa in the assemblage increased. Specifically, power increased as the number of taxa increased when using NRI and the power decreased for NTI. This result is likely due to the NRI being calculated from pair-wise distances and NTI being calculated from nearest neighbor distances that are expected to be more sensitive to the degree of phylogenetic resolution . Thus, iAs the interest in including phylogenetic information into studies of species diversity and co-existence has outpaced our ability to generate fully resolved phylogenetic hypotheses for every study system, more and more researchers have begun to use phylogenies in their research that contain multiple unresolved nodes. It is clear that the use of phylogenies with multiple unresolved nodes is not the most desirable scenario, but it is likely to persist. Thus, it is now critical to quantify how this lack of resolution influences the metrics of phylogenetic diversity and dispersion and in what instances do we compromise the greatest amount of statistical power. The present analyses provide a first step towards explicitly quantifying these biases. In particular, I have shown that both phylogenetic diversity and dispersion metrics can be very sensitive to phylogenetic resolution when the phylogeny is large and when the lack of resolution is basal. Encouragingly, when the lack of resolution is terminal the loss of statistical power is greatly minimized. Lastly, the analyses indicate that researchers utilizing the metrics analyzed here are generally prone to underestimate the phylogenetic diversity and dispersion in communities when phylogenies are not completely resolved.Table S1(0.06 MB DOC)Click here for additional data file.Table S2(0.07 MB DOC)Click here for additional data file.Table S3(0.07 MB DOC)Click here for additional data file.Table S4(0.07 MB DOC)Click here for additional data file.Table S5(0.07 MB DOC)Click here for additional data file.Table S6(0.07 MB DOC)Click here for additional data file.Figure S1(0.46 MB DOC)Click here for additional data file.Figure S2(0.45 MB DOC)Click here for additional data file.Figure S3(0.09 MB DOC)Click here for additional data file.Figure S4(0.18 MB DOC)Click here for additional data file.

Peripheral-blood monocytes from normal individuals and from patients with malignant melanoma reduce nitroblue tetrazolium (NBT). A quantitative assay for dye reduction was applied to 25 healthy donors and 31 patients with malignant melanoma. NBT reduction expressed as dye reduction per monocyte was significantly impaired in patients with disseminated disease, and they responded poorly to a phagocytic stimulus. Monocytes from patients with micrometastatic disease, however, showed normal resting NBT reduction but, following exposure to a suspension of latex-polystyrene, showed significantly greater NBT reduction than those from normal individuals. Since NBT reduction is an indirect measure of intracellular hexose-monophosphate-shunt activity we conclude that the monocytes from patients with minimal disease are in some way activated.

The benzene ring is axially substituted on the heterocyclic ring, resulting in a folded conformation of the cation. The absolute configuration was determined with reference to d-tartaric acid. The crystal structure is stabilized by an extensive network of intra- and inter­molecular O—H⋯O hydrogen bonds.In the title compound, C Å b = 10.812 (4) Å c = 29.338 (11) Å V = 2266.7 (15) Å3 Z = 4 Kα radiationMo −1 μ = 0.10 mmT = 293 (2) K 0.20 × 0.15 × 0.12 mm Bruker SMART APEX CCD area-detector diffractometerSADABS; Sheldrick, 1996T min = 0.979, T max = 0.988Absorption correction: multi-scan (11334 measured reflections2855 independent reflectionsI > 2σ(I)2173 reflections with R int = 0.076 R[F 2 > 2σ(F 2)] = 0.061 wR(F 2) = 0.163 S = 1.04 2855 reflections319 parameters19 restraintsH atoms treated by a mixture of independent and constrained refinementmax = 0.43 e Å−3 Δρmin = −0.26 e Å−3 Δρ SMART used to solve structure: SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL and ORTEP-3 (Farrugia, 1997SHELXTL and local programs.Data collection: 10.1107/S1600536808005898/wn2243sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536808005898/wn2243Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Introduction. Retroperitoneal sarcomas are uncommon large malignant tumors. Methods. Forty-one consecutive patients with localized retroperitoneal sarcoma were retrospectively studied. Results. Median age was 58 years (range 20–91 years). Median tumor size was 17.5 cm (range 4–41 cm). Only 2 tumors were <5 cm. Most were liposarcoma (44%) and high-grade (59%). 59% were stage 3 and the rest was stage 1. Median followup was 10 months (range 1–106 months). Thirty-eight patients had an initial complete resection; 15 (37%) developed recurrent sarcoma and 12 (80%) had a second complete resection. Patients with an initial complete resection had a 5-year survival of 46%. For all patients, tumor grade affected overall survival (P = .006). Complete surgical resection improved overall survival for high-grade tumors (P = .03). Conclusions. Tumor grade/stage and complete surgical resection for high-grade tumors are important prognostic variables. Radiation therapy or chemotherapy had no significant impact on overall or recurrence-free survival. Complete surgical resection is the treatment of choice for patients with initial and locally recurrent retroperitoneal sarcoma. Sarcomas are uncommon malignant tumors arising from mesenchymal tissue. Retroperitoneal sarcomas account for approximately 10% of soft tissue sarcomas and less than 1% of all malignant neoplasms . The comDue to minimal early symptoms, retroperitoneal sarcomas are often diagnosed when the tumors are large and involve surrounding organs. En bloc surgical resection is the treatment of choice. This has been described recently as compartmental resection in which there is a systematic removal of adjacent organs to obtain a rim of normal tissue surrounding the tumor . CompartIn contrast to patients with extremity sarcomas, the efficacy of adjuvant radiation therapy for retroperitoneal sarcomas is less clear. One of the major limiting factors is difficulty in delivering sufficient radiation dose because of toxicity to adjacent organs including bowel, kidneys, liver, and spinal cord , 11. TwoBetween January 1996 and 2007, 102 consecutive patients with a presumptive diagnosis of retroperitoneal sarcoma were referred to Stanford Hospital and Clinics. Among these, eight patients were found to have gastrointestinal stromal tumors, one a desmoplastic round small cell tumor, and ten non-cancerous disease. Thirty-four patients had a previous surgical resection at another institution, and two had medical contraindications to major surgery. Six patients had distant metastatic disease. The remaining forty one patients had previously untreated localized retroperitoneal sarcoma and comprise the cohort of this study. Medical records, including clinic notes, radiographic, operative, and pathology reports were reviewed. The association between patient demographics, tumor characteristics, treatment variables, and outcomes was assessed. Patient demographics included sex, age, and duration of symptoms. Tumors were characterized based on histopathologic type, size in greatest dimension, grade, and pathological stage. We used the sixth edition of the American Joint Committee on Cancer (AJCC) staging system for soft tissue sarcomas. It categorizes stages 1–4 based on tumor size, depth, grade, lymph node, and distant metastases . Treatmehttp://ssdi.rootsweb.com). First recurrence was used as the endpoint for disease-free survival. Kaplan-Meier method and the log-rank test were utilized for univariate analysis and comparison of studied variables. The Cox-regression proportional hazards model was used for multivariate analysis of prognostic factors significant in the univariate analysis. All P-values recorded are two-sided and a P-value <.05 was considered statistically significant.Statistical analysis was performed with SAS software . Overall and disease-free survival was calculated. Date of diagnosis was defined as the time of initial tissue diagnosis. Local recurrence was defined as biopsy proof of tumor recurrence at the primary tumor site. Distant recurrence was defined as recurrent tumor at a site distant from the primary tumor. Overall survival was calculated from time of diagnosis to time of last followup or death. Deaths were confirmed by an internet-based search via the Social Security Death Index (n = 21.51%), mass/abdominal distention (n = 12.29%), constitutional symptoms (n = 3), and others (n = 5). Liposarcoma was the most common histological type (54%), followed by leiomyosarcoma (17%). Median tumor size was 17.5 cm (range 4–41 cm); 59% of the sarcomas were high grade. Seventeen patients (41%) had stage 1 , and 24 (59%) had stage 3 disease. Median followup was 10 months (range 1–106 months).n = 18, colon n = 14, small intestine n = 6, spleen n = 4, pancreas n = 4, rectum/anus n = 3, liver n = 2, bladder n = 1, stomach n = 1, prostate n = 1, gallbladder n = 1). Morbidity rate was 19%. Complications included infection (n = 5), anastomotic leak (n = 2), post-operative hemorrhage (n = 2), small bowel obstruction (n = 2), and myocardial infarction (n = 2). Mortality rate was 2%.All patients underwent abdominal retroperitoneal exploration using an open approach. A total of 67 surgical procedures were performed in 41 patients; 18 patients underwent multiple surgical procedures. At time of resection, 38 patients (93%) had a complete resection with negative macroscopic margins (R0/R1) . The magn = 10), distant (n = 2), and both local and distant (n = 3). Of these, 12 (80%) underwent re-exploration and a second complete resection was achieved in all patients (100%). Ninety-three percent of patients had complete resection of the retroperitoneal sarcoma. Rates of complete resection were 100%, 86%, and 100% for the 1st, 2nd, and 3rd recurrences, respectively. CT imaging was able to accurately predict those who could have all tumor removed.Tumor recurred in fifteen patients (37%), with recurrent site local (Nineteen (46%) patients had radiation therapy with their initial surgery, 10 (83%) with their second or third surgical resection. All patients with either R1 or R2 resection received adjuvant radiation therapy, whereas patients with R0 resections did not.n = 1), intra-operative or postoperative radiation therapy (n = 15), or a combination of both (n = 3). Post-operative external beam radiation (n = 6), intraoperative radiation (IORT) (n = 8), or both treatment modalities (n = 5) were administered. IORT dose was commonly 12.5 Gy and external beam radiation dose ranged from 45–50 Gy [Radiation therapy with the initial surgical resection included either preoperative radiation therapy (45–50 Gy . Eight pP = .05). Estimated 5-year survival for low-grade tumors versus high-grade tumors was 100% and 26%, respectively , median local recurrence-free survival was 1.65 years. Estimated 2-year and 5-year recurrence-free survival for patients with complete resections was 44% and 18%, respectively (P = .02). Adjuvant chemotherapy and radiation therapy did not significantly affect recurrence-free survival.4 (10%) patients developed distant metastases during subsequent followup such that most tumor recurrences were local. For patients with an initial complete resection as well as multivariate analysis (P < .006). This was also reported by Lewis et al., who showed that patients with low-grade tumors had a median survival of 149 months compared to only 33 months for high-grade tumors [Reported prognostic factors for overall survival for retroperitoneal sarcoma include grade, stage, histology, size, and margin status , 19, 20.e tumors , 12, 21.A major challenge in treating retroperitoneal sarcomas today remains the high rate of local recurrence. Even when a complete resection has been achieved, local recurrence is the main site of treatment failure. For patients in our series who had a complete resection, the 5-year disease-free survival rate was only 18%. This is a discouraging result and one that needs further work. Local recurrences, even on multiple occasions, are still able to be treated by subsequent surgical resection. We followed our patients closely with imaging (CT +/or MRI) and local recurrences were identified early. This early recognition of recurrence allowed tumor to be completely removed surgically. Fortunately, we did not see sarcomatosis or multifocality as a pattern of recurrence that has been described by others as a potential result of tumor spill during the initial resection. Sarcomatosis has a much poorer prognosis . For allThe use of adjuvant therapy to reduce the probability of recurrence and distant metastases has long been a topic of dispute. In our series, we were unable to show that radiation therapy or chemotherapy had any significant impact on overall or recurrence-free survival. Other studies have suggested that adjuvant radiation therapy may decrease the probability of local recurrence , 13, 14.In conclusion, our results show that sarcoma tumor grade and complete resection are important prognostic variables in patients with primary retroperitoneal sarcomas. Aggressive complete surgical resection can be done safely in the vast majority of patients, and, in general is the only effective therapy. It remains the treatment of choice and for patients with initial and recurrent retroperitoneal sarcoma. The role of adjuvant radiation and chemotherapy needs to be for evaluated in multicenter randomized trials. We therefore recommend that surgery is to be optimized in the care of patients with retroperitoneal sarcomas. Advancements in tumor biology and selective targeted therapy should hopefully result in improved management of retroperitoneal sarcomas.

Humans can distinguish visual stimuli that differ by features the size of only a few photoreceptors. This is possible despite the incessant image motion due to fixational eye movements, which can be many times larger than the features to be distinguished. To perform well, the brain must identify the retinal firing patterns induced by the stimulus while discounting similar patterns caused by spontaneous retinal activity. This is a challenge since the trajectory of the eye movements, and consequently, the stimulus position, are unknown. We derive a decision rule for using retinal spike trains to discriminate between two stimuli, given that their retinal image moves with an unknown random walk trajectory. This algorithm dynamically estimates the probability of the stimulus at different retinal locations, and uses this to modulate the influence of retinal spikes acquired later. Applied to a simple orientation-discrimination task, the algorithm performance is consistent with human acuity, whereas naive strategies that neglect eye movements perform much worse. We then show how a simple, biologically plausible neural network could implement this algorithm using a local, activity-dependent gain and lateral interactions approximately matched to the statistics of eye movements. Finally, we discuss evidence that such a network could be operating in the primary visual cortex. Like a camera, the eye projects an image of the world onto our retina. But unlike a camera, the eye continues to execute small, random movements, even when we fix our gaze. Consequently, the projected image jitters over the retina. In a camera, such jitter leads to a blurred image on the film. Interestingly, our visual acuity is many times sharper than expected from the motion blur. Apparently, the brain uses an active process to track the image through its jittering motion across the retina. Here, we propose an algorithm for how this can be accomplished. The algorithm uses realistic spike responses of optic nerve fibers to reconstruct the visual image, and requires no knowledge of the eye movement trajectory. Its performance can account for human visual acuity. Furthermore, we show that this algorithm could be implemented biologically by the neural circuits of primary visual cortex. Even when we hold our gaze still, small eye movements jitter the visual image of the world across the retina. The authors show how a stable and sharp image might be recovered through neural processing in the visual cortex. People with normal visual acuity are able to resolve visual features that subtend a single arc minute of visual angle. For the letters “F” and “P” on a Snellen eye chart, this corresponds to a difference of just a few photoreceptors . As we tIf the brain knew the complex eye movement trajectory, then it could realign the retinal responses before processing them further. However, central visual circuits probably do not have access to the eye movement trajectory at a sufficiently fine scale. Fixational eye movements arise from imperfect compensation for head and body movements ,2 and moUnfortunately, visual processing in the retina introduces noise, leaving the brain with uncertainty both about the stimulus shape itself and about the precise trajectory the stimulus traces on the retina. The retina's output neurons—the retinal ganglion cells—are not perfectly reliable in their response to stimulation, and even without stimulation, they fire action potentials at a substantial rate. For brief, small stimuli on a featureless background, the total stimulated retinal response may consist of just a few tens of spikes. The brain must distinguish these spikes from the many hundreds of spontaneous spikes that reflect only noise. The usual remedy would be to accumulate many spikes over time until the signal emerges from the noise; but this is difficult because the fixational eye movements scatter the desired responses across space.Thus we recognize a challenge for visual acuity in the presence of eye movements: To identify the stimulus, the brain needs to know the precise stimulus trajectory; yet to track the stimulus trajectory, the brain needs to identify which neural spikes are stimulated and which are only noise.Presented with this challenge, what strategy could the brain use to achieve the visual acuity that humans exhibit? We will show that naive decodings of retinal spike trains that neglect the eye movements perform poorly at discriminating fine visual features. We derive a significantly better strategy that exploits the fact that eye movements are continuous to estimate the stimulus position on the retina and give greater weight to retinal spikes originating near this position. Surprisingly, we found that this strategy is attainable by a simple neural network whose properties are consistent with functional and anatomical features of primary visual cortex.For concreteness, we choose a simple task to analyze: An observer is asked to discriminate between two tiny oriented bars that span 1 or 2 arcmin of visual angle. In the retina's fovea, this stimulus affects just a few cone photoreceptors, each collecting light from a region about 0.5 arcmin in diameter. Each cone drives approximately one On-type and one Off-type ganglion cell, and conversely, each ganglion cell receives its input from just one cone . This meIt is plausible that the finest human acuity might be limited primarily by the information available in the retina rather than by later constraints or losses. For example, our ability to detect dim lights in absolute darkness is ultimately limited by photon shot noise at the rod photoreceptor. In bright light—the condition considered here—noise introduced by retinal processing greatly exceeds photon shot noise –13. CorrWe now present a strategy for accumulating information about position and orientation of the small stimulus bar on the retina. This strategy decodes the observed spike trains from retinal ganglion cells using prior knowledge about the statistics of those spikes and the statistics of eye movements. The output of the decoder is a moment-to-moment estimate of the bar's orientation.S is at position x, a model retinal ganglion cell at position y fires action potentials with Poisson statistics at the instantaneous time-dependent rate Sr(y − x) depicted in rmax at positions near the stimulus to the background firing rate r0 at large distances. In bright conditions, retinal ganglion cells respond to a contrast of 100% (black on white) with a spike rate of rmax ∼ 100 Hz [r0 ∼ 10 Hz [The decoder assumes a model of retinal ganglion cell spike generation, shown in ∼ 100 Hz . Far fro ∼ 10 Hz ,19.D ∼ 100 arcmin2/s , but is otherwise ignorant of the eye movement statistics; it conservatively assumes that jumps to all stimulus positions are equally likely.Naturally, the decoder that uses the correct diffusion statistics works best, but simulations reveal that it outperforms the two naive decoders by a large margin . For verHow robust is the algorithm to imperfections in implementation? The key parameter that incorporates the statistics of the eye movements is the assumed diffusion constant. As shown above, if the decoder assumes that the eye movements are much faster or much slower than they really are, then the performance degrades substantially. However, between these two extremes, there is a broad range of assumed diffusion constants that causes only a few percent of extra mistakes A. In facEvery time the decoder receives a retinal spike, the estimated stimulus probability rises locally by a factor proportional to the expected stimulated firing rate divided by the background rate , which rFinally, we may ask whether the decoder performance is sensitive to the assumed stimulus shapes. Each retinal spike increases the estimated stimulus probability at all those locations where a stimulus could potentially have caused that spike. If the expected stimuli differ from the true stimuli, then this probability increases over the wrong set of locations, leading to suboptimal performance. To explore this, we set the decoder's expected stimulus shape to be larger than the true shape by various amounts C. EnlargIn summary, the Markov decoder is robust to various parameters that encompass its a priori assumptions about the stimulus. If the decoder allows activity to diffuse at an approximately correct rate, and expects shapes not dramatically larger than the true stimuli, then it can achieve good discrimination performance.Despite the apparent complexity of the differential equation governing the Markov decoder, its dynamics map directly onto a simple neural network with a structure consistent with many known properties of visual cortex. For clarity, we will first introduce a network that estimates the location probabilities for a given stimulus shape, and then show the extension required for shape discrimination.S. The network has three types of neurons: the retinal neurons, a hidden layer of decoder neurons, and an inhibitory neuron. Each neuron in the hidden layer is associated with a spatial location, x, and its activity at time t represents the estimated posterior probability that the stimulus is present at that location, x consists of spikes from retinal locations y, weighted by a spatial receptive field P is simply proportional to P, the solution is an exponential decay that scales P uniformly at all locations, leaving the relative values of the activity unaltered. Thus, lateral excitatory connections are sufficient to implement the diffusion term in the network. For the same reason, the network does not need any representation of the local decay term, Hr(y − x) B; corresFixational eye movements pose a major challenge for vision since they scatter weak signals about fine stimulus features across the retina. We addressed this challenge mathematically by deriving an algorithm that guesses the orientation of a stimulus, given spiking responses from a model retina and prior knowledge about its function. It accomplishes this by collecting and sorting the scattered feature information in a systematic way, weighting retinal spikes according to an estimated probability that those spikes reflect stimulus features and not noise.As described above, the decoder algorithm has a direct mapping onto an abstract neural network, and we will argue that primary visual cortex (V1) has many properties well suited to instantiate this network with real neurons. Specifically, we take the hidden layer neurons in For good performance, these neurons should integrate retinal spikes using linear, oriented receptive fields of the same shape and size as the visual stimuli . We showTo account for fixational eye movements, the neural network must be organized retinotopically so that local stimulus movements correspond to local interactions in cortex. This is, of course, a known property of V1 ,33. BecaEye movements are expected to simply translate visual features, but not rotate them, and these expectations should be built into circuitry. Activity in the model decoder network diffuses across space through lateral excitatory connections between nearby neurons, but only those with similar orientation preferences. In the early visual system, the required iso-orientation facilitation has been observed psychophysically –38, anatAs the eye drifts, the retina moves rigidly in world coordinates. But since the size of cortical receptive fields increases with distance from the fovea ,47,48, fThe Markov decoder requires that the lateral facilitatory interactions induce localized changes in the gain for new input spikes. Such multiplicative gain modulations have indeed been observed in the visual cortex ,53. A nuWith an accelerating nonlinearity and excitatory interactions, this network has a positive feedback loop that would cause the activity to quickly diverge. Normalization will maintain stability, but the normalization must be global and orientation independent so that neural activities can be compared on the same scale. Previously described wide-field divisive normalization –66 can sIn our forced-choice task, the accumulated evidence for the horizontal and vertical stimuli must be compared. This can be accomplished downstream by a final winner-take-all computation in which the total activity in each subnetwork is pooled and then compared . This tyWhereas the input to the network consists of discrete spikes, the network units themselves represent the stimulus probability, which is a continuous variable. This variable might be most simply encoded by the collective firing rate of a cluster of neurons , especiaIn summary, all the key elements of a Markov decoder for short line segments are present in the neural circuitry of primary visual cortex. One essential feature, namely monocular processing, is no longer available beyond V1. We therefore propose that V1 functions as a dynamic network to accumulate information on fine stimulus features in the face of fixational eye movements.We presented psychophysical results indicating that human subjects could reliably discriminate between horizontal and vertical stimuli measuring 1 × 2 arcmin , less than required to fully account for human acuity.Human fixational eye movements are not exactly random walks. Instead, they exhibit some small persistence of velocity on a timescale of 2 ms and antipersistence on a timescale of 100 ms ,73. To eAs discussed above, the Markov decoder is suboptimal because of the temporal blurring of the stimulus before spike generation. The optimal decoder must keep track of all possible histories affecting the current firing rate, rather than only the last stimulus position, and the computational effort rapidly becomes prohibitive. Strategies have been proposed to simplify the decoding of such processes ,75, but Finally, the real visual system enjoys two additional benefits that were not available to the Markov decoder. The first is global image motion: Our human observers viewed the tiny bar stimuli on a white sheet posted within a laboratory scene. As the eye moves, this peripheral background image moves coherently upon the retina, providing additional global motion cues that the brain could perhaps incorporate to improve perception. Second, our model for retinal responses used the most-random spike pattern for a given firing rate, namely a Poisson process. By contrast, real retinal ganglion cells fire more precisely ,12 and cs and transient response duration τ, this occurs when the diffusion constant is s = 0.5 × 1 arcmin2) and biphasic temporal kernels with τ = 35 ms, the predicted optimum of D ∼ 3 arcmin2/s is more than a full order of magnitude smaller than the naturally occurring eye movements of approximately 100 arcmin2/s.One commonly held view is that fixational eye movements actually improve vision by preventing the decay of retinal responses that occurs under static stimuli . For exaD near the value predicted above, and the model acuity is dramatically worse than this optimum when the natural diffusion statistics are used. Natural eye movements are therefore substantially larger than optimal for this fine acuity task, implying that they do indeed present a problem for fine visual acuity that the brain must solve.To explore this further, we computed the Markov decoder's performance as a function of the eye movement diffusion constant . In one The Markov decoder model yields psychophysical and physiological predictions. We argued that fixational eye movements are unknown to the brain, so using an eye tracker to replace the natural fixational eye movements with exogenous jitter movements, such as eye trajectories recorded from a previous trial, should not affect fine acuity, a prediction supported by recent evidence . We alsoThere are two major physiological predictions. First, activity in V1 neurons should locally modulate the gain for feedforward input originating from the retina. Without this modulation, the advantage of using prior expectations is lost. Second, if the neural interactions in V1 are to correctly encode the probabilistic expectations given by random walk eye movement statistics, then the interactions should implement a diffusion operator, which entails that the time delay to reach maximal interaction strength should scale as the square of the interaction distance. This should be observable both directly, as lateral excitatory currents, and indirectly, through the time course of the resulting gain modulation.The essential aspect of the Markov decoder we have described is that information of one type attunes the observer to other, related information. In the present context, the decoder expects that responses to oriented line segments are correlated across space and time due to fixational eye movements, and thus these expected responses are enhanced. Other statistical regularities produce expectations as well. For example, strings of line segments often occur together in contours. Correspondingly, collinear iso-orientation facilitation has been hypothesized to subserve contour integration ,81, and The probabilistic processing of information has generated substantial interest as a general framework for neural computation, often designated “Bayesian computation” due to the use of Bayes' rule in calculating probabilities. Human perception has been shown in several conditions to behave according to this rule –84. ExpeAlthough our mathematical formalism is closely related to previous work, we have made several advances in applying the Bayesian paradigm. First, we identified a concrete biological puzzle of considerable practical importance: how can humans see with high acuity when fixational eye movements rapidly jitter the stimulus over a large area? Second, previous Bayesian computations treated neural signals that were poorly constrained by experiment, so the performance of these computations could be characterized only qualitatively. In contrast, retinal signals are well studied, enabling us to make quantitative comparisons between model and human performance. Third, previous studies predominantly described the formal structure of Bayesian computations, whereas we identified a simple and biologically plausible mapping of the probabilistic calculations onto cortical circuitry.The decoder we have described is optimized for discriminating the orientation of line segments, but human acuity extends to more complex tasks, such as telling “F” from “P.” Within our formalism, optimal discrimination of arbitrary shapes would require receptive fields tuned to those shapes, whereas the early visual system appears to encode oriented edges, with more complex feature selectivity arising only later in higher brain regions. Therefore, this Markov decoder by itself cannot account for discrimination in complex acuity tasks. However, we propose that it functions as a useful preprocessor that reduces the confounding effects of fixational eye movements before passing signals to subsequent cortical regions for high-level processing.If the stimulus contains several lines of multiple orientations, the decoder's output will have several peaks that correspond to the individual oriented segments. These peaks will track the stimulus pattern as it is scanned over the retina. This output can then be processed by subsequent networks tuned to more complex patterns. Simulations show that such a pattern detector identifies an arrangement of oriented bars better when it is provided with the output of a Markov decoder than with signals from similar decoders that fail to properly account for eye movements .Three groups of small horizontal and vertical stimuli like those in S was chosen randomly to be either horizontal or vertical, a random walk trajectory was constructed, and the stimulus light intensity profile was moved along this random walk trajectory; the dynamic light intensity at each retinal position was filtered by a temporal kernel, then passed through a threshold rectifier to yield the instantaneous firing rate; this rate drove an inhomogeneous Poisson generator to produce the spike train for the retinal neuron at that location. We passed these spikes to the Markov decoder implementing We generated model retinal responses for the discrimination task in the following steps: the stimulus orientation 2 array with wraparound boundary conditions, which was sufficiently large for the relevant values of the diffusion constant and the diffusion time, yet small enough for fast simulations.In both the simulations of retinal spike trains and in the Markov decoder, we modeled the fovea as a square lattice of cone photoreceptors. In the human retina, cones are spaced every 0.5 arcmin, and the receptive fields of retinal ganglion cells each consist of a single cone. Correspondingly, the model ganglion cells had square receptive fields separated by 0.5 arcmin. For numerical work, we simulated a 16 × 16 arcminz and a 1 × 2 aspect ratio oriented in either the vertical or horizontal direction. Optical blur was produced by convolving the stimulus with a Gaussian modulation transfer function of diameter 2σ = 0.5 arcmin [x induced an instantaneous spatial light absorption profile at retinal positions y ofa and b. The resultant stimulus profile is shown in The stimulus itself consisted of a rectangle with size 5 arcmin . The stif is the temporal frequency. Eizenman et al. [f−2 dependence for the horizontal component of fixational eye movements, from which we inferred a two-dimensional diffusion constant of D = 100 arcmin2/s. Corroborating results come from direct measurements of squared eye displacement as a function of time lag [D expected from a random walk yielded diffusion constants of the same magnitude, 100 arcmin2/s.We modeled fixational eye movements as a random walk that shifts the stimulus across the retina. The one-sided power spectrum of a one-dimensional random walk is given by n et al. reportedtime lag ; fittingdt, the probability of stepping to a nearest neighbor location is D is the diffusion constant, and a the distance between lattice points. After many such time steps over a finite interval Δt, the probability that the walker has moved a distance Δx horizontally and Δy vertically can be expressed in series form:N is the number of points on a side of the square lattice. For speedy simulations, we chose a constant sampling interval Δt = 0.7 ms and drew independent random walk steps from this distribution; finer temporal sampling produced nearly identical results (unpublished data).We simulated the trajectory of the stimulus as a random walk on a discrete spatial lattice, but continuous in time. After an infinitesimal time interval τ1 = 5 ms, τ2 = 15 ms, n = 3, and ρ = 0.8 for all simulations [ρ = 1 to maximize the performance improvement attributable to eye movements. Finally, this spatiotemporal profile was offset by the background firing rate r0, half-wave rectified to prevent negative firing rates, and scaled so that the maximum possible firing rate was given by rmax. The typical firing-rate parameters we used were r0 = 10 Hz and rmax = 100 Hz unless otherwise specified.The spatial stimulus profile was moved around the model retina according to the random walk. This produced a temporal sequence of light intensities within each retinal ganglion cell's receptive field, which was then convolved with the parameterized biphasic temporal filter Dto prodstimulus F. The paulations except Fy produces a spike at time ty, the diffusion term and calculating the fraction of correct trials, we quantified the performance for this ideal strategy for various parameter sets, as plotted in These estimated posterior probabilities can be displayed as a function of space and time, as in Protocol S1(1.2 MB PDF)Click here for additional data file.

P = 0.03); the risk ratio for ages f = 65 was 1.88 (P = 0.03). Females had significantly better survival than males . For each 100 rads dose of radiotherapy, the risk ratio was significantly decreased by 1% ; for each session of radiotherapy, the risk ratio was significantly decreased by 4% ; for each square centimetre size of surface under radiotherapy, the risk ratio significantly increased . We did not observe a significant difference on survival by histology, anatomical location of tumours, or type of treatment (P > 0.05). Prognosis is extremely poor. © 2001 Cancer Research Campaign http://www.bjcancer.comFactors relevant to the survival of patients with oesophageal cancer under radiotherapy have been studied in northern Iran where its incidence is high. We conducted an analytical study using a historical cohort and information from the medical charts of patients with oesophageal cancer. Out of 523 patients referred to the Shahid Rajaii radiotherapy centre in Babolsar from 1992 to 1996, we followed 230 patients for whom an address was available in 1998. The frequency of prognostic factors among those not contacted was very similar to those included in the study. The data were analysed using survival analysis by the nonparametric method of Kaplan Meier and the Cox regression model to determine risk ratios (RR) of prognostic factors. Survival rates were 42% at 1 year, 21% at 2 years, and 8% at 5 years after diagnosis. Patients aged 50–64 were found to have poorer survival compared with those less than 50 (RR = 1.73,

A study has been carried out to investigate the cellular distribution and levels of glutathione-S-transferase isoenzymes (GST), acidic (pi), basic and neutral (mu), in ovarian tumour biopsies, and to measure GST activity in the same tumour specimens. Two methods of assessing isoenzyme levels (immunohistochemistry and Western blot) were compared. Well-known important clinicopathological features were correlated with response to treatment, overall survival and progression-free survival for each of 97 patients from whom biopsies had been obtained. The glutathione-S-transferase isoenzyme levels were also correlated with overall and progression-free survival, and with the important clinicopathological features. As expected, there was a significant correlation between FIGO stage, histological grade of tumour, amount of residual disease after staging laparotomy, response to chemotherapy, and both overall and progression-free survival. Glutathione-S-transferase isoenzyme levels measured by Western blot were not found to be significantly correlated with any of the clinicopathological parameters tested. Using the immunohistochemistry method of detection there was a correlation between the GST acidic isoenzyme level and the amount of residual disease remaining after initial debulking surgery , and also between the GST acidic isoenzyme level and the type of chemotherapy regimen used. Higher levels of the acidic isoenzyme were present in tumour biopsies taken from the patient group who had received a combination regimen . The neutral and basic GST isoenzyme levels were not significantly correlated with any of the clinicopathological parameters. None of the GST isoenzyme levels were significantly correlated with response to treatment, overall survival or progression-free survival (using either method of detection). Similarly, glutathione transferase activity showed no significant correlation with prognosis or survival.

The first non-gypsy BR identified, 1A-2, resides in cytological region 1A. Using a quantitative transgene system, we show that 1A-2 is a composite insulator containing enhancer blocking and facilitator elements. We discovered that 1A-2 separates the yellow (y) gene from a previously unannotated, non-coding RNA gene, named yar for y-achaete (ac) intergenic RNA. The role of 1A-2 was elucidated using homologous recombination to excise these sequences from the natural location, representing the first deletion of any Su(Hw) BR in the genome. Loss of 1A-2 reduced yar RNA accumulation, without affecting mRNA levels from the neighboring y and ac genes. These data indicate that within the 1A region, 1A-2 acts an activator of yar transcription. Taken together, these studies reveal that the properties of 1A-2 are context-dependent, as this element has both insulator and enhancer activities. These findings imply that the function of non-gypsy Su(Hw) BRs depends on the genomic environment, predicting that Su(Hw) BRs represent a diverse collection of genomic regulatory elements.Insulators are DNA elements that divide chromosomes into independent transcriptional domains. The Drosophila genome contains hundreds of binding sites for the Suppressor of Hairy-wing [Su(Hw)] insulator protein, corresponding to locations of the retroviral gypsy insulator representing the classic Su(Hw)-dependent insulator. Su(Hw) associates with hundreds of non-gypsy regions distributed throughout the genome that differ in sequence and organization from the gypsy insulator. To gain insights into the role of Su(Hw) in genome organization, we defined the properties of the first non-gypsy Su(Hw) binding region identified, 1A-2. Our studies reveal differences in 1A-2 activity, depending on the context tested. We show that 1A-2 is an insulator in enhancer blocking studies but functions as a transcriptional activator within the natural genomic location. Our findings are reminiscent of properties of binding regions that associate with the vertebrate CTCF protein, which have defined insulator, activator, and repressor functions. Finally, our studies indicate that a noncoding RNA gene may contribute to independent transcriptional regulation in the genome.Insulators are conserved genomic elements that define domains of independent transcription. One class of insulators in the Drosophila genome are defined by the binding of the Su(Hw) protein, with the In eukaryotic genomes, neighboring genes often display distinct spatial and temporal patterns of transcription, even though intergenic distances are within the range of enhancer and silencer action. These observations suggest that constraints exist that limit promiscuous interactions between long distance regulatory elements and non-target promoters. Chromatin insulators represent one class of genomic elements that restrict enhancer and silencer action Insulators have been identified based on two functional properties. First, insulators prevent enhancer and silencer modulation of a promoter in a position-dependent manner, such that an enhancer or silencer is blocked only when the insulator is located between these elements and a promoter. Second, insulators protect gene expression from positive and negative chromosomal position effects associated with ectopic placement of genes within genomes, an activity referred to as barrier function. Sequences with one or both of these properties have been identified in most eukaryotic genomes and have been implicated in the regulation of diverse cellular processes, ranging from centromere function in yeast to imprinting in mammals gypsy retrovirus. This versatile gypsy insulator blocks over twenty enhancers active in different tissues and developmental stages, prevents repressive effects caused by Polycomb group complexes and heterochromatin and protects an origin of DNA replication from chromosomal position effects gypsy insulator consists of a cluster of twelve repeats that are bound by the zinc finger Suppressor of Hairy-wing [Su(Hw)] protein gypsy insulator, including Modifier of (mdg4) 67.2 (Mod67.2), Centrosomal Protein of 190 kD (CP190) and Enhancer of 2y [E(y)2]. In general, Mod67.2 and CP190 are required for enhancer and silencer blocking by the gypsy insulator, while E(y)2 has been shown to be required only for barrier function One of the best-characterized insulators resides in the 5′ untranslated region of the Drosophila gypsy regions in the Drosophila genome that have a largely unknown function. The extensive co-localization of the four gypsy insulator proteins at non-gypsy regions has led to the proposal that these represent chromatin insulators. Yet, non-gypsy Su(Hw) binding regions are different in sequence and organization from the gypsy insulator, with the majority of BRs containing single Su(Hw) binding sites (BSs) gypsy insulator were required for robust enhancer blocking gypsy BRs in transgene assays show that most, but not all, interfere with enhancer-activated transcription gypsy regions contain additional elements that assist the insulator function of Su(Hw).The Su(Hw) protein associates with hundreds of non-gypsy Su(Hw) BR identified, named 1A-2, is a cluster of two Su(Hw) BSs located in cytological region 1A (gypsy Su(Hw) BR in the Drosophila genome. Effects of the loss of these sequences on gene expression in the 1A region were determined, leading to the discovery that 1A-2 contributes to transcriptional activation of a novel, non-coding RNA gene. Taken together, our studies demonstrate that 1A-2 has both activator and insulators properties, depending on the context tested. These findings imply that properties of non-gypsy Su(Hw) BRs are influenced by the genomic environment, predicting that Su(Hw) BRs represent a diverse collection of elements with distinct regulatory functions.The first non-egion 1A . Here weFat Body Enhancer (FBE)1-yolk protein (yp)2 -LacZ transgene to define DNA sequences required for 1A-2 enhancer blocking (gypsy insulator FBE1 and the yp2 promoter. Multiple P[F-1A-2(520)-yp2] transgenic lines with single insertions were established. Quantitative β-galactosidase activity assays were completed to define the level of yp2 promoter activity. Protein extracts were isolated from adult females representing several independent lines, and multiple assays were undertaken to establish an average activity unit (aau) for each transgene (P[F-1A-2(520)-yp2] females had low levels of yp2 expression (aau 0.86), similar to levels in P[F-gyp-yp2] females (aau 0.75) and significantly lower than levels found in the control P[FBE1-yp2] females (aau 5.97). We conclude that 1A-2 blocks FBE1, extending the enhancer blocking effects of 1A-2 to a new enhancer-promoter pair.The Su(Hw) BR 1A-2 is a 520 bp element that contains two Su(Hw) BSs blocking , a systeransgene . We founFBE1 and yp2-LacZ (P[F-1A-2(157)-yp2] females showed a strong enhancer block (aau 0.62). As this subregion lacks the CP190 BS P[F-1A-2(79)-yp2] females showed a two-fold weaker enhancer block than 1A-2(157) , whereas P[F-1A-2(78)-yp2] females showed high yp2 activity levels, close to those obtained for the control P[F-yp2] females (aau 5.9 versus 5.97). These data suggest that 1A-2(78) contributes to the blocking effectiveness of the 1A-2 Su(Hw) BSs, but cannot itself block enhancer-promoter interactions.The minimal sequences required for 1A-2 insulator function were determined by generation of transgenic lines carrying transposons with insertion of subregions of 1A-2 between yp2-LacZ . P that carried four copies of 1A-2(78) inserted between FBE1 and the yp2 promoter. Surprisingly, these transgenic females had higher yp2 activity than the control P[F-yp2] females . Transgenic P[F-1A-2(78×4)-yp2] males showed no yp2 activity (data not shown). Based on the retained transcriptional specificity of the P[F-1A-2 (78×4)-yp2] transgene, we conclude that 1A-2(78) is not a general transcriptional enhancer but improves the activity of FBE1. These data imply that 1A-2(78) may possess a general activity that facilitates factor association. To test this postulate, we determined whether 1A-2(78) restored enhancer blocking to a synthetic Su(Hw) BR containing three reiterated gypsy BSs (3R:3) that was previously shown to be inactive in this transgene system P[F- 3R:3-1A-2(78)-yp2] females had low yp2 activity (aau 0.22). These studies show that in the presence of 1A-2(78), 3R:3 became a strong insulator. As previous findings suggest that the effectiveness of enhancer blocking by the Su(Hw) protein is limited by the in vivo accessibility of Su(Hw), we conclude 1A-2(78) is a facilitator that may improve transcription factor binding to chromosomes.We considered two possibilities to account for the contributions made by 1A-2(78). First, these sequences might contain a binding site(s) for a second insulator protein that cooperates with the Su(Hw) BSs for insulator function. Second, 1A-2(78) might improve the activity of the Su(Hw) BSs, perhaps by increasing y-ac region, we evaluated whether the existing annotation reflected the transcriptional potential of this region. These analyses were motivated by the recent studies showing widespread transcription in intergenic regions of the Drosophila genome y-ac intergenic sequences. Sequences corresponding to this EST are located ∼1.4 kb downstream of the y termination signal and transcribed in the same direction as the y and ac genes. Northern analyses of embryonic polyA+ RNA using a radiolabeled probe representing the intergenic EST identified a family of RNAs, with the most abundant species sized at ∼1.6 kb -FLP recombinase and the hs-I-SceI endonuclease transgenes and progeny of this cross were heat shocked to produce the endonucleases. Over 100 resulting females were crossed to 1 w1118y males and homologous recombinants were identified among the offspring of this cross in two ways. First, flies were screened for dark wings, as recombination at the endogenous 1y gene would reconstitute a wild type y transcription unit with all enhancers, whereas progeny with ectopic insertions of the replacement y gene would produce flies with lightly colored wings due to the absent wing enhancer. Second, we conducted genetic analyses to determine whether the +w phenotype was linked to the X chromosome. Five putative homologous recombination lines were established based on dark wing pigmentation. Further genetic analyses showed that in one line, XGL339-23-38, the w marker mapped to the X chromosome, suggesting a correct targeting event. Southern analyses confirmed the structure of the y gene in these flies binding sites, which we called 1A-2′. These sites differ from the Su(Hw) consensus sequence at multiple highly conserved positions RNA accumulation, the gene downstream of ac. A cycle threshold (CT) for each primer set was determined and a corresponding ΔCT was calculated, using the Ras64B CT for standardization. These analyses identified a significant increase in ΔCT for yar within Δ1A-2y and Δ1A-2/Δ1A-2′y samples, relative to Canton S. These data correspond to a 7- and 25-fold decrease in Δ1A-2y embryonic and pupal yar RNA respectively and a 32- and 41-fold decrease in Δ1A-2/Δ1A-2′y embryonic and pupal yar RNA were undertaken to test the semi-quantitative results . In thes yar RNA . These d1A region, we quantified of y, yar, ac and sc RNAs in a v/su(Hw)fsu(Hw) mutant background, using Q-PCR. The vsu(Hw) allele carries a promoter deletion and the fsu(Hw) allele carries a point mutation that produces a full-length protein with an inactivate finger 10 yar RNA was significantly changed in the v/fsu(Hw) mutant background, associated with an ∼21-fold decrease (yar transcription. The absence of expression changes in embryonic RNA may be confounded by an ability of Su(Hw)f to bind to 1A-2 in early embryos. Previous studies have shown that disruption of Su(Hw) zinc finger 10 limits chromosome accessibility, without altering DNA recognition f to bind 1A-2 and activate yar, but that this property is lost during development. We are unable to test yar expression in a su(Hw) null background, as complete loss of Su(Hw) blocks oogenesis. Regardless, our data imply that Su(Hw), along with contributions made by other proteins associated with 1A-2, function as an activator of yar transcription during development.To determine whether the Su(Hw) contributes to expression of genes in the decrease . These dgypsy insulator function predict that the gypsy insulator establishes independent transcriptional domains through cooperation with genomic insulators defined by non-gypsy Su(Hw) BRs. Recent findings indicate that the sequence and organization of non-gypsy BSs differ from the Su(Hw) BR in the gypsy retrovirus gypsy BRs may be distinct from those of the gypsy insulator. We defined the properties of 1A-2, to gain insights into mechanisms of Su(Hw) insulator action.Prevailing models of FBE1-yp2-LacZ reporter system to define the sequence requirements for enhancer blocking by 1A-2(520). Prior application of this system demonstrated that at least four gypsy Su(Hw) sites were needed for robust blocking gypsy insulator (gypsy insulator in vitro binding constants for Su(Hw) for the 1A-2 and gypsy BSs are similar in vivo effectiveness of enhancer blocking by the Su(Hw) protein is related to the accessibility of Su(Hw) BSs. If single or small clusters of Su(Hw) BSs are located in genomic regions of open chromatin, then these regions will demonstrate enhancer blocking, as defined in transgene assays. This proposal implies that genomic context greatly influences the properties of non-gypsy Su(Hw) BRs.We used the quantitative nsulator , 2. A fry and ac genes. Chromatin immunoprecipitation studies demonstrated that 1A-2 is associated with Su(Hw), Mod67.2 and E(y)2 in vivoy and ac genes in the 1A locus y-ac region to evaluate the current accuracy of the genomic annotation of this region. These studies identified a previously unannotated gene, yar, located ∼1.2 kb downstream of the y gene and ∼3.0 kb upstream of ac. Multiple, differentially spliced, polyA+ RNAs are encoded by yar, with the largest translation product predicted to be 75 amino acids, indicating that this is a non-coding RNA gene. Emerging data suggest that non-coding RNAs are abundant in eukaryotes and have a wide repertoire of biological functions, ranging from structural components in protein complexes to regulatory molecules involved in transcription and translation yar has a function. As flies carrying a large genomic deletion that removes sequences upstream of y and extends downstream of ac (− ac−y) are viable and fertile, yar is a non-essential gene.1A-2 is located between the independently regulated 1A locus, we tested the function of 1A-2 and a second, weaker Su(Hw) BR, 1A-2′, on gene regulation, using gene targeting to delete these elements. Our studies represent the first deletional analysis of any non-gypsy Su(Hw) BR in the Drosophila genome. Two targeted deletion lines, Δ1A-2y and Δ1A-2/Δ1A-2′y were established in gene activation Having re-defined the transcriptional profile in the ablished . Levels control , but str(yar RNA . These dgypsy Su(Hw) BRs, genomic context will have an important influence on the properties of CTCF BSs within a given region.The complexity of the transcriptional effects associated with Su(Hw) BRs is reminiscent of regions in mammalian genomes that bind the versatile regulatory protein CTCF. High throughput genomic analyses have identified hundreds of CTCF binding sites within the mouse and human genomes 1A locus are unclear. The discovery of yar provides an alternative explanation to the need for a chromatin insulator. Based on the developmental timing displayed by the 1A genes, we postulate that activation of yar transcription may cause inactivation of ac through transcriptional interference. Similarly, activation of y may repress yar transcription. Although Δ1A-2y and Δ1A-2/Δ1A-2′y flies show reduced yar expression, transcription is not abolished, suggesting that the remaining yar activity may be sufficient to turn off ac. Alternatively, other mechanisms can be considered that might influence enhancer preference, including selectivity of enhancers for certain classes of promoters 1A locus will resolve how transcriptional independence is achieved.The mechanism(s) used to maintain transcriptional autonomy in the http://flybase.bio.indiana.edu.Flies were raised at 25°C, 70% humidity on standard corn meal/agar medium. Description of the alleles used can be found at FBE1-yp2 -LacZ fusion gene BglII site, positioned at −335 relative to the transcription start site (TSS) that was used for insertion of tested 1A-2 fragments. Resulting transgenes were inserted into a P element transformation vector, generating P[F-1A-2(520)-yp2] with the full length 1A-2, P[F-1A-2(157)-yp2] with a 157 bp region of 1A-2, P[F-1A-2(79)-yp2] with two 1A-2 Su(Hw) binding sites, P[F-1A-2(78)-yp2] with the 78 bp 3′ region, P[F-1A-2(78×4)-yp2] with four tandem repeats of the 1A-2 78 bp element and P[F-3R:3(78)-yp2] with a hybrid insertion between a cluster of three tandem repeats of the gypsy Su(Hw) binding sites PPP[y or a 3.5 kb fragment (y+5826 to y+9318 relative to the yTSS) to make Δ1A-2/Δ1A-2′ target]P or P[yΔ1A-2/1A-2′] transgenic (TG) lines, homologous recombinants carrying the hsw gene (Δ1A-2wy and Δ1A-2/1A-2′wy), and homologous recombinants deleted for hsw gene (Δ1A-2y and Δ1A-2/1A-2′y). DNAs were transferred to Nytran and hybridized with a 32P-labeled probe made with ClaI to BglII fragment of y gene . A similar event did not occur in the Δ1A-2/1A-2′y line, therefore a smaller band is seen due to the ∼1.0 kb deletion of the Su(Hw) BSs (6.7 kb band).Southern analysis of (5.15 MB TIF)Click here for additional data file.Figure S2ac, yar, y and Ras64B primers for the number of cycles shown at the right. Ethidium-stained PCR products from each input were analyzed. These studies demonstrated that at the cycle number shown, each primer set produced an increasing amount of product with increasing input. In the semi-quantitative PCR reactions shown in Definition of parameters for semi-quantitative PCR analyses. Indicated volumes of cDNA were used as a template for amplification by the (2.17 MB TIF)Click here for additional data file.Figure S3y, ac and sc mRNA accumulation from RNAs isolated during development from wild type and mutant lines. Individual transcript levels defined by Q-PCR were normalized to Ras64B for amount of input cDNA (ΔCT). A larger ΔCT indicates a reduction in RNA. Error bars indicate standard deviation of values obtained from analyses of three independently isolated RNAs. No significant changes in RNA accumulation relative to wild type were detected.Analysis of RNA accumulation from 1A region genes in wild type and mutant backgrounds. Quantitative real time PCR (Q-PCR) was used to determine levels of (10.6 MB TIF)Click here for additional data file.

Children with an obstetric brachial plexus injury have an elevated risk of long-term impairment if they do not fully recover by the age of 3 months. Persistent nerve damage leads to muscle abnormalities and progressive muscle and bone deformities. Several procedures have been described to treat this severe deformity. We have demonstrated the benefits of the triangle tilt procedure in young children with a mean age of 6.4 years (2.2 to 10.3), yet the treatment of humeral head subluxation secondary to obstetric brachial plexus injury represents a challenge in older pediatric patients. This case report demonstrates the effectiveness of triangle tilt surgery for the treatment of glenohumeral joint deformity in a 12 year old pediatric patient with left sided residual brachial plexus injury. The patient in this study showed noticeable clinical improvements, an improvement in glenohumeral joint dysplasia, and a reduction in humeral head subluxation 2 years after triangle tilt surgery. There was functional improvement 25 months after surgery. The patient's total Mallet score for shoulder function improved from 14 to 20 (of 25). In this case report, we demonstrate that the triangle tilt procedure can be used for older pediatric patients without modification. This observation has provided valuable information and is, to our knowledge, the first documented improvement of a glenohumeral joint deformity in an older pediatric patient. Future studies will be needed to determine the long-term success of triangle tilt surgery in this age group. Children with an obstetric brachial plexus injury have an elevated risk of long-term impairment if they do not fully recover by the age of 3 months.4The SHEAR deformity is associated with glenohumeral deformity, which has been previously described as a combination of glenoid retroversion, joint incongruity, and posterior humeral head dislocation or subluxation.3Several procedures have been described to treat this severe deformity, including open reduction with anterior release,Although a previous publication described the benefits of the triangle tilt procedure in young children with a mean age of 6.4 years (2.2 to 10.3),The patient was a 12-year-old girl with left-sided obstetrical brachial plexus injury. Her injury was surgically treated at a different institution 5 years before triangle tilt surgery. The previous surgery included the release of subscapularis muscle, pectoralis major fractional lengthening, latissimus to infraspinatus tendon transfer, teres major to supraspinatus tendon transfer, and coracoacromial ligament release; there was only marginal improvement in function and no improvement in deformity following these procedures. Physical examination revealed medial rotation contracture of the shoulder with apparently unrecognized SHEAR deformity (grade 4). She could not supinate and had a flaring trumpet sign during hand-to-mouth movements. Computerized tomographic scanning revealed the extent of posterior humeral head subluxation , glenoid retroversion (‐53° from perpendicular to the scapular line), and glenohumeral joint dysplasia (Fig Triangle tilt surgery was performed on the patient. The procedure began with an incision along the medial edge of the superomedial border of the scapula. Soft tissue was dissected from the scapula and the prominent superomedial angle of the scapula was excised with a bone cutter to create a rounded surface. An incision was made over the spine of the scapula and soft tissue dissection exposed the scapular spine, which was cut with an electric saw. The scapula and the acromion process derotated after osteotomy, indicating preoperative twisting and internal rotation caused by the elevated scapula. The bone removed during osteotomy was morselized and placed in the bone defect between the scapular spine and the acromion process. An incision was made over the distal third of the clavicle and the soft tissue was dissected to expose the clavicle. Osteotomy of the clavicle was performed with an electric saw and the distal and proximal clavicle segments were fastened together in semirigid fixation with titanium screws and absorbable suture. The clavicle segments were noted to “twist” relative to each other after the osteotomy, indicating torsion in the clavicle due to scapular elevation. An incision was then made above the posterior glenohumeral joint and careful dissection through the deltoid muscle exposed the posterior glenohumeral capsule. Laxity in the capsule was removed with a circumferential suture in a purse-string fashion. Wounds were closed in multiple layers and the patient was splinted in adduction and supination, with the humerus externally rotated and in a neutral position. The patient was splinted for 6 weeks and then splinted only at night for additional 3 months. Physical therapy was prescribed for 6 months.There was functional improvement 25 months after surgery Fig . The patA major treatment goal in children with obstetric brachial plexus injury is to obtain optimal range of shoulder motion through improved glenohumeral alignment. Shoulder deformities are very common in this patient population and these developmental abnormalities lead to poor function, pain and loss of quality of life beginning as soon as the teen years. Therefore, establishing glenohumeral congruency is a fundamental goal of most brachial plexus functional restorations. Repositioning of the glenohumeral joint to maximize alignment does not only improve function and growth, but has been shown to encourage joint remodeling.During surgery, the distal acromioclavicular triangle returns to a more physiological position when osteotomies of the clavicle and acromion are performed, suggesting that the abnormal bony structures in the shoulder are under significant biomechanical stresses. The plane of the acromioclavicular triangle is “tilted” toward the neutral position, and the humeral head, being related to the distal structures, moves into a more normal position.The triangle tilt procedure has been previously shown as an effective treatment option for children and can be used for adolescents without modification. The procedure can theoretically be applied to patients between the ages of 8 months and 16 years. Triangle tilt is ideally suited for patients who have developed a medial rotation contracture and scapular elevation; if these abnormalities are observed, the surgery is effective in the presence of mild, moderate and severe neurological defects, including complete glenohumeral dislocations and as salvage for failed previous reconstructive surgeries. A nonunion of the clavicle could potentially occur if the clavicle segments do not heal. A complete separation of the acromion process from the clavicle is crucial for success. It is also necessary to splint the patient as described, with adduction in the scapular line, external rotation in the humerus, and supination.The treatment of humeral head subluxation secondary to obstetric brachial plexus injury represents a challenge in older pediatric patients. Triangle tilt surgery is effective in the treatment of older pediatric patients because it directly addresses the bony deformations that occur during childhood. The 12 year old patient in this study showed noticeable clinical improvements, an improvement in glenohumeral joint dysplasia, and a reduction in humeral head subluxation 2 years after triangle tilt surgery. This observation has provided valuable information and is, to our knowledge, the first documented improvement of a glenohumeral joint deformity in an older pediatric patient. Future studies will be needed to determine the long-term success of triangle tilt surgery in this age group.

The kappa-light chain sequence, submitted as the first part of Figure 6, is incorrect. This sequence actually represents an extraneous light chain, produced by the Sp2/0 myeloma cell lines that were used to make the hybridomas that ultimately expressed F1-40. We have since identified a second kappa-light chain in the F1-40–expressing hybridomas which is the actual kappa-light chain for F1-40. No other kappa-light chain has been identified in the F1-40-producing hybridomas. Please view a corrected version here:

Type 2 diabetes is rapidly growing as a proportion of the disease burden in Australia as elsewhere. This study addresses the cost effectiveness of an integrated approach to assisting general practitioners (GPs) with diabetes management. This approach uses a centralized database of clinical data of an Australian Division of General Practice (a network of GPs) to co-ordinate care according to national guidelines.Long term outcomes for patients in the program were derived using clinical parameters after 5 years of program participation, and the United Kingdom Prospective Diabetes Study (UKPDS) Outcomes Model, to project outcomes for 40 years from the time of diagnosis and from 5 years post-diagnosis. Cost information was obtained from a range of sources. While program costs are directly available, and costs of complications can be estimated from the UKPDS model, other costs are estimated by comparing costs in the Division with average costs across the state or the nation. The outcome and cost measures are used derive incremental cost-effectiveness ratios.The clinical data show that the program is effective in the short term, with improvement or no statistical difference in most clinical measures over 5 years. Average HbA1c levels increased by less than expected over the 5 year period. While the program is estimated to generate treatment cost savings, overall net costs are positive. However, the program led to projected improvements in expected life years and Quality Adjusted Life Expectancy (QALE), with incremental cost effectiveness ratios of $A8,106 per life-year saved and $A9,730 per year of QALE gained.The combination of an established model of diabetes progression and generally available data has provided an opportunity to establish robust methods of testing the cost effectiveness of a program for which a formal control group was not available. Based on this methodology, integrated health care delivery provided by a network of GPs improved health outcomes of type 2 diabetics with acceptable cost effectiveness, which suggests that similar outcomes may be obtained elsewhere. There has been a plethora of research on the nature of diabetes and the response of the disease to various treatment regimes, which has led to a broad agreement on the nature of appropriate care for people with diabetes ,2. This While the cost-effectiveness of many diabetes treatments has been assessed e.g. ,6,7) the,7 the6,7There are no published studies on the cost effectiveness of guideline implementation in Australia, though one study assessedThis study addresses the cost effectiveness of a program designed to integrate diabetes care and to improve guideline implementation in an Australian Division of General Practice. Divisions are regional networks of general practices which, among other things, provide a platform for regional approaches to the management of type 2 diabetes in primary health care through the implementation of guidelines-based programs. The purpose of the study is to examine whether a Division-based program, which co-ordinates information and provision of care, improves outcomes for diabetic patients and is cost effective.There are currently 119 Divisions in Australia which vary in their geographic coverage, location, population and numbers of general practices. They have a range of roles including: maintaining and improving the standards of general practice in a region; coordinating care between GPs and other service providers; improving communication between general practice, hospitals, medical specialists and community health services and; taking an active role in the continuum of education from undergraduate through to postgraduate vocational training in general practice .A recent report on the value of the Divisions network found little objective evidence examining the effects of Divisions . The fewAs the study is observational, data are drawn from a range of sources to assess the overall costs and benefits. The perspective taken is of the health system as a whole, including all costs on whomsoever they fall. This encompasses the national tax-funded health insurance scheme which may be considered statutory insurance, voluntary health insurance, and patient out-of-pocket costs.The Southern Highlands Division of General Practice (SHDGP) in New South Wales (NSW) implemented a diabetes program in 1995. All GPs in the SHDGP participate in the program. The GPs remain the case managers for their patients, and the program facilitates case management by provision of information and education to the GPs and by direct service provision to patients referred by the GPs. The Division funds and arranges diabetes education programs, dietitian services and an exercise program, and arranges access to podiatry services.The core of the program is the centralized database of diabetic patients which is regularly updated with clinical information from the general practices. This database, which includes information on care provision as well as clinical indicators such as HbA1c measures, is used to send recall reminders to GPs, to provide regular audit reports to GPs on their adherence to guidelines, and to provide regular and ad hoc clinical alerts. In particular, the Division identifies patients who may be at risk of developing complications, and reports on them to their GPs.The centralized database has been adapted for the diabetes program from a patient information database designed to manage information on cardiac and diabetic patients (the CarDiab database ). While The SHDGP is a rural division with the majority of the population living in three small towns. Its catchment population at the 2001 Census was 48,400 with 16% aged over 65 and 33% under 25. The population is above the median for socio-economic status as measured by the Socio-Economic Index for Australia (SEIFA) prepared by the Australian Bureau of Statistics . The DivA cost-effectiveness analysis of the Southern Highlands Division Diabetes Program is undertaken using a decision-analytic approach. As with many recent studies ,6,25 a sProjections from the UKPDS outcomes model are determined by observed clinical measures both at diagnosis and where available over a post-diagnosis period. The model was used in this study without modification to simulate the progression of diabetes and its complications from time of diagnosis to death, and from a time point which is 5 years after initial participation in the program to death. The model simulates the progression of diabetes under "conventional treatment" within the UKPDS study. "Conventional treatment" is prescribed in the UKPDS as clinic attendance every three months and dietary advice, aimed to maintain fasting plasma glucose below 15 mmol/L without symptoms of hyperglycemia . ConventIt is common practice for models to draw on data from countries other than those which are the subject of their study. The CORE model for example , used daA sample of patients enrolled in the program was selected as outlined below and the average annual incremental cost of managing them in the diabetes program estimated. These costs encompassed both the direct costs of managing the program, and any incremental costs or savings flowing from changes in care for program participants. Four categories of costs were included: the cost of the SHDGP diabetes program; the primary care costs costs arising from adherence to the guidelines for management of diabetes; the cost of pharmaceuticals; and the cost of inpatient hospital services.Differences in costs in three of these categories cannot be directly measured from the Division database. However, it is possible to estimate these costs by comparing costs in the SHDGP with costs for NSW or for Australia as a whole. Cost estimates for managing complications from the UKPDS Outcomes Model are used to provide estimates of the costs of hospital treatment for comparison with the direct estimates available from Australian information.In summary, data from SHDGP patients are used to estimate program impacts on the life years and quality adjusted life expectancy of these patients, and to estimate the costs of diabetes caused complications. These cost estimates contribute to the estimated impact of the program on hospital costs, while the program impacts on life years and QALE are used to estimate cost effectiveness.To convert the estimated annual program costs and the related costs and savings to a 40-year time horizon, the average annual estimates are assumed to be the same each year over the 40-year time frame of the analysis. The cost streams are discounted at five per cent per annum. Although the modelling incorporates both deaths and increased costs per capita due to complications as patients age, it does not address per capita cost changes for pharmaceutical costs or costs of GP compliance with guidelines. If the single year overall treatment savings followed the pattern of the costs of complications, the 40 year total estimate would be only 5 per cent different to the value estimated by assuming constant costs. The dominant factor in the overall costs is the direct cost of the program, which will not increase with patient ageing except at the margin (e.g. dietician costs), but will decline with the deaths of program participants. Allowance for the effect of these deaths on program costs reduces the long term costs by substantially more than any plausible increase in treatment cost effects, but a fixed value approach was taken to ensure that results were conservative.The five per cent discount rate follows the standards used in Australia in assessing pharmaceuticals and medical services for public funding ,30. ThisThe health outcomes for the selected patients are estimated over a 40-year period from diagnosis, using the model of the long-term sequelae of patients with type 2 diabetes in the UKPDS Outcomes model. The measures used are the changes in years of life expectancy and in QALE. The impact on utility of different diabetes related complications used in the model to estimate QALE is based on a study of a UKPDS participants in 1997 .Using National Health Survey data , the numWhile there were 1,087 type 2 diabetic patients included on the database at some time over the program, the number included in the analysis was considerably less than this as:• The UKPDS model is designed to commence at time of diagnosis, so patients who joined the program post diagnosis were excluded;• Clinical advice suggested that patients should participate for around 5 years so that behavioural changes in particular have stabilized ;• Data on all clinical items used in the model were required at both diagnosis and after 5 years. Similar systems report only 50% to 60% of patients with an HbA1c score recorded in any year [As a result of these exclusions, the final sample comprised 74 patients who registered at diagnosis and had complete information both at diagnosis and approximately 5 years after diagnosis.As this group includes only five-year survivors, six additional patients who were randomly selected from among those deceased within five years of joining the program were added to the initial sample. Six patients were added as eight per cent of the total patient group who registered at or near diagnosis died during the following five years.Gaps in the SHDGP data combined with the requirements of the UKPDS model resulted in a sample which could have introduced bias. However, as shown in Table Life years and QALE were estimated over 40 years from diagnosis using the UKPDS Outcome model. Outcomes were first estimated from diagnosis with no constraint, and secondly estimated with the constraints of actual clinical measures after five years of program participation. These two sets of projections gave estimates of life years and QALE saved by program participants.Division administrative costs, including the costs of employing the program manager/diabetes educator, data entry, general administration and IT costs, and the costs of patient access to dietetic services and the exercise program were provided by the Division. The details of these costs are shown at Additional file Administrative costs to practices included maintenance of records and transfer of data to the Division, and the management of patient recall. These costs were estimated by the Division based on consultation with the participating practices and are also shown at Additional file The cost of GP compliance with guidelines, and the flow on costs to pathology testing, ophthalmology etc, were based on data from the Service Incentives Payments (SIP) scheme . SIP payA comparison of prescribing rates for oral antidiabetic agents in the SHDGP with national rates, using publicly available data from the Pharmaceutical Benefits Scheme (PBS), was used to estimate differences in pharmaceutical costs attributable to the program. DetailsThree estimates of cost savings were obtained for hospital services. One estimate was based on the difference between rates and costs of hospitalization for patients with primary ICD-10 diagnosis codes 10–14 (diabetes) residing in the Southern Highlands and in New South Wales overall. These estimates were based on data provided by NSW Department of Health. As these are diabetes-specific codes, they will not include all complications of diabetes. The cost per patient-year for these two groups ($A255 and $A341 respectively) are well below the Australian estimate of around $A600 per patient year [The second estimate applied the percentage reduction in the costs of treating complications attributed to the program from the UKPDS model to an estimate of the average annual cost of hospitalizations for type 2 diabetic patients in Australia . The thiDetails of all costings are shown at Additional file Costs to practices depend on whether electronic or paper systems were used, and were estimated to be between $A30 and $A80 per patient per year. The higher level of practice costs is consistent with previous research , which fThe estimated costs of additional compliance with diabetes treatment guidelines for the SHDGP relative to the rest of Australia are shown in detail in Additional file Estimated costs for treatment of complications over 40 years derived from the UKPDS model, together with 95% confidence intervals, are shown in Table Table Comparing average hospital costs across the relevant ICD-10 codes (codes 10–14) per known diabetic patient in SHDGP with the average across New South Wales provided an estimated net saving of $86 per patient year, consistent with the estimated savings derived from the UKPDS Outcomes model. To be conservative, the figure of $44 saving was used in the cost effectiveness calculations, while the higher $86 figure was used in the sensitivity analyses.The average cost to the PBS per patient year of prescribing of oral anti-diabetic drugs in the SHDGP is approximately $40 less than the national figure. While the estimated $40 savings in prescribing is used to derive the estimated cost effectiveness, a lower bound estimate of zero savings is used in the sensitivity analyses.Table The health outcomes derived from the UKPDS Outcome Model are shown in Table Table The cost-effectiveness ratios resulting from this study are within the generally acceptable limits applied to health care interventions. The only publicly available assessment of limits in Australia shows that drugs are unlikely to be recommended for listing on the PBS if they cost over $A76,000 per life year and unlikely to be rejected if they cost less than $A42,000 per life year . A rangeThree aspects of this study are addressed in assessing the robustness of this main conclusion. Firstly, the five per cent discount rate, while the Australian standard, is at the high end of international standards. Secondly the effect on the conclusion of the range of estimates from the different cost components is tested. Finally, the potential variability in the gain in life years or QALE is considered.If no discounting was applied to costs or outcomes, the improvement in expected life years and QALE from program participation increases , and the percentage savings diminish (from 7.4 per cent to 6.3 per cent). Recalculating Table As shown in Table Finally, the estimated improvements in health outcomes are also subject to estimation error. This variability can be displayed by use of cost effectiveness acceptability curves . PleHowever, the curves show that if a figure of $A42,000 is used Using the maximum estimated cost of the program there is a better than 80 per cent chance the ratio is less than $42,000. Even if the upper limit of the total net costs is doubled, the probabilities of the program being within the $42,000 willingness-to-pay limit are 71% and 68% for life years and QALE respectively. The conclusions are therefore very robust to both the variation of the estimated outcomes and the known limitations in the costing methods.Despite the estimated improvement in health outcomes and reduced hospital costs, the study estimates an increase in the overall net costs from the program. This is consistent with other programs which improve diabetes outcomes,8,9. WhiIt has proved necessary to draw on a wide range of data to estimate the cost impact of the SHDGP diabetes program. While there are limitations in the methods and the data, the use of a range of cost estimates provides considerable robustness to the overall conclusion to be drawn regarding the cost effectiveness of the program.With any program addressing long term chronic diseases like diabetes, it is necessary to use modelling approaches to estimate long term outcomes and costs . As longSome costs and savings are estimated by comparing costs in the SHDGP with those in the state of NSW, or in Australia as a whole. These estimates could be biased as the SHDGP is not the only division to implement a diabetes program. However, a 2002 survey covering 80 per cent of divisions with a diabetes program found onPolicy-makers need to know whether to continue to support and fund organizationally based programs which attempt to integrate care and encourage use of guidelines, but have been put in place without formal control groups. The approach taken here provides a methodology which gives robust answers to questions regarding cost effectiveness, after accommodating the limitations in the data.The SHDGP diabetes program would appear to have made a cost effective contribution to the wellbeing of the diabetes patient in the SHDGP , and as such provides a potential model to be considered in other Divisions. A number of initiatives introduced for GPs in Australia in recent times, like the SHDGP diabetes program, have had as their objective the improvement of care coordination and achievement of more integrated care . In this respect, the US and Australian health care systems may be heading towards a common end point in the longer term (i.e. integrated care) although arriving at that end point by different routes.This study faces the problems inherent in attempting to assess an existing program, with limits to direct data collection and no formal control group. It has been shown, however, that reasonable and robust estimates of cost effectiveness of the diabetes management program can be derived using clinical data from a central database and cost data taken from a range of sources. The results show that a program using a centralized computer-based register, and providing some centralized services, is highly likely to be cost effective although at a positive net cost.This does not suggest that all programs undertaken by all Divisions will be cost-effective. It does however demonstrate both that it is possible to draw robust conclusions about such programs if the net for data collection is cast suitably wide, and that integrated care for diabetic patients through enhanced GP networks can provide value for money.ADGP: Australian Divisions of General Practice ; AIHW: Australian Institute of Health and Welfare; BP: Blood pressure; CHF: Congestive heart failure; FFS: Fee for service; GP: general practitioner; ICD-10: International Classification of Diseases – version 10; LE: Quality adjusted life expectancy; MI: Myocardial infarction; SBO: State Based Organisation ; SEIFA: Socio-Economic Index for Australia; SHDGP: Southern Highlands Division of General Practice; SIP: Service incentive payment; UKPDS: United Kingdom Prospective Diabetes Study.Dr Warwick Ruscoe and Ms Jill Snow declare that they are employees of the Southern Highlands Division of General Practice. All other authors declare that they have no competing interests.All authors contributed to the study design. WR and JS facilitated the compilation of the program data. DR and KG undertook background literature research, IM and DR undertook data analysis and drafted the paper, and JB and BS critically revised the paper. All authors have read and approved this version of the manuscript.The pre-publication history for this paper can be accessed here:Attachment 1Click here for file

The 2-fluoro­phenyl ring is disordered over two orientations with site-occupancy factors of 0.810 (3) and 0.190 (3). The structure contains inter­molecular C—H⋯O hydrogen bonds.In the title compound, C Å b = 11.423 (2) Å c = 18.949 (4) Å V = 1536.5 (5) Å3 Z = 4 Kα radiationMo −1 μ = 0.24 mmT = 173 K 0.36 × 0.34 × 0.28 mm Stoe IPDS-II two-circle diffractometerMULABS; Spek, 2009T min = 0.920, T max = 0.937Absorption correction: multi-scan (10484 measured reflections3531 independent reflectionsI > 2σ(I)3213 reflections with R int = 0.046 R[F 2 > 2σ(F 2)] = 0.034 wR(F 2) = 0.082 S = 0.99 3531 reflections219 parametersH-atom parameters constrainedmax = 0.15 e Å−3 Δρmin = −0.26 e Å−3 ΔρAbsolute structure: Flack 1983, 1491 FrFlack parameter: −0.15 (6) X-AREA used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536809022314/bi2375sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809022314/bi2375Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

A proportionate study was carried out of the causes of death of the 759 Vegetarian Society members whose deaths were recorded in Society records and whose death certificates could be traced. Compared to the general population, a lower proportion of deaths from respiratory diseases and from lung cancer was noted particularly in long-standing members, consistent with the evidence that vegetarians smoke less than the average. The proportion of deaths from colorectal cancer was slightly lower than in the general population but there was no reduction in the proportions of deaths from other diseases that have been linked with meat or fat consumption, such as cardiovascular diseases and breast cancer. The proportions of deaths from stomach cancer and from accidents and violence were greater than expected. The significance of the findings is discussed and also the possible limitations of the proportionate method of analysis in relation to studies of vegetarians.

Enterococcus using qPCR were associated with gastrointestinal (GI) illness among swimmers at freshwater beaches. In this paper, we report on results from three marine beach sites.In the United States and elsewhere, recreational water quality is monitored for fecal indicator bacteria to help prevent swimming-associated illnesses. Standard methods to measure these bacteria take at least 24 hours to obtain results. Molecular approaches such as quantitative polymerase chain reaction (qPCR) can estimate these bacteria faster, in under 3 hours. Previously, we demonstrated that measurements of the fecal indicator bacteria We interviewed beach-goers and collected water samples at marine beaches affected by treated sewage discharges in Mississippi in 2005, and Rhode Island and Alabama in 2007. Ten to twelve days later, we obtained information about gastrointestinal, respiratory, eye, ear and skin symptoms by telephone. We tested water samples for fecal indicator organisms using qPCR and other methods.10-increase in exposure to qPCR-determined estimates of fecal indicator organisms in the genus Enterococcus and order Bacteroidales . Estimates of organisms related to Clostridium perfringens and a subgroup of organisms in the genus Bacteroides were also determined by qPCR in 2007, as was F+ coliphage, but relationships between these indicators and illness were not statistically significant.We enrolled 6,350 beach-goers. The occurrence of GI illness among swimmers was associated with a logThis study provides the first evidence of a relationship between gastrointestinal illness and estimates of fecal indicator organisms determined by qPCR at marine beaches. Enterococcus spp. or Escherichia coli are ordinarily harmless microbes that are commonly found in sewage and other sources of fecal contamination [Enterococcus spp. estimated by qPCR was well-associated with gastrointestinal illness among swimmers at freshwater beaches [It is usually impractical to test recreational waters directly for the many and diverse pathogenic microorganisms associated with human derived sewage. As a result, recreational waters are often monitored for fecal indicator bacteria. Fecal indicator bacteria such as mination . These fmination ,3. Standmination . Moleculmination . We prev beaches ,7.Previous studies found different associations between fecal indicator bacteria measured by culture and swimming-associated illness in marine and fresh waters ,9, possiWe conducted studies at three marine beaches affected by treated sewage discharge from nearby Publicly Owned Treatment Works (POTW). In 2005, we studied Edgewater Beach in Biloxi, Mississippi, and in 2007 we studied Goddard Beach in Goddard Memorial State Park in West Warwick, Rhode Island and Fairhope Municipal Beach in Fairhope, Alabama Figure . Each beData collection procedures for the health survey have been described previously ,7. In brThe study procedures, questionnaires, protocols and consent process were reviewed and approved by the Institutional Review Board of the Centers for Disease Control and Prevention.We considered the following health endpoints consistent with those we previously reported ,7."Gastrointestinal illness" (GI illness) was defined as any of the following: (1) diarrhea (three or more loose stools in a 24-hour period); (2) vomiting; (3) nausea and stomachache; (4) nausea or stomachache, and interference with regular activities (missed regular activities as a result of the illness)."Upper respiratory illness" (URI) was defined as any 2 of the following: sore throat, cough, runny nose, cold, or fever."Rash" was defined as a rash or itchy skin."Eye irritations" were defined as either eye infection or watery eye."Earache" was defined as earache, ear infection, or runny ears.Diarrhea was also considered as a stand alone outcome because it is a commonly used definition of gastroenteritis in population-based surveillance ,13.Participants ill within 3 days before their beach visit were excluded from analysis of the health outcome related to their baseline symptoms.Protocols used for water sample collection have been described . BrieflyEnterococcus spp. [Bacteroidales spp. [Enterococcus and Bacteroidales respectively, by qPCR using previously published protocols [Bacteroides [Clostridium spp. or "Clostridium perfringens group" [fecal Bacteroides" and "Clostridium", respectively. In 2007, we also included a novel, faster test for F+ coliphage based on a culture and latex agglutination assay (CLAT assay), which also distinguishes F+ RNA coliphage and F+ DNA coliphage [Enterococcus spp. using EPA Method 1600 [Enterococcus measured by EPA Method 1600 are reported in colony forming units (CFU) per 100 ml sample and for F+ coliphage in most probable number (MPN) per 100 ml. Samples for EPA Method 1600 and qPCR analysis were filtered within 6 hours of collection. The filters were held at -20°C and shipped overnight to EMSL Analytical (Westmount NJ) on dry ice where DNA extraction and qPCR analyses for Enterococcus, Bacteroidales and fecal Bacteroides were conducted. Frozen DNA extracts were sent from EMSL Analytical to the US EPA in Cincinnati where qPCR analysis was conducted for Clostridium.Water samples were tested for total cus spp. and totales spp. , hereaftrotocols ,14. In 2teroides , and Clos group" , hereaftoliphage . F+ colioliphage . Sampleshod 1600 , a cultuEnterococcus [Bacteroidales [Bacteroides [Clostridium were those of the "Clostridium perfringens group" assay targeting about 34 Clostridium species as reported by Rinttilä et. al. [Clostridium which was performed on a Model 7900 DNA thermal cycler . Both instruments automated the detection and quantitative measurement of the fluorescent signals produced by TaqMan probe degradation during each cycle of amplification.Primer and probe sequences used for the rococcus , Bacteroroidales and fecateroides qPCR ass et. al. . AdditioPCR cycle threshold (CT) measurements of the test sample DNA extracts were compared with those of similarly prepared extracts from calibrator samples containing a known quantity of the target organism cells. Ratios of the target sequences in the test and calibrator samples were converted to estimates of calibrator cell equivalents (CCE) in the test samples . PCR meaΔΔ ) [Δ) and also after corrections using CT values from the salmon reference assays (CCEΔΔ method). See previously published manuscripts [ΔΔ calculation provides quantitative adjustment for partial inhibition [Δ may lead to underestimations [Two basic approaches were used to quantify CCE: "delta delta-CT" (CCEΔΔ ) -7,14, anuscripts ,14,22 anhibition ,22, but The lower detection limit was defined as the upper 95% CT bound of the Y-intercept from the pooled standard curve data that was generated from repeated analyses of serially diluted genomic DNA extracts from the calibrator bacterial strains during the study period. Target sequence concentrations in these genomic DNA extracts were determined as previously described . CT valuOur primary definition of swimming was "body immersion", defined as immersion to the waist or higher. Previously, we observed similar risks of illness for those who immersed their body and those who immersed their head . Non-swi10 fecal indicator organism estimates to represent exposure. We created separate exposure indices based on all samples (daily average), representing an estimate of the overall water quality, and for morning samples to evaluate whether morning water quality measures were associated with illness. For categorical presentations, indicator groups were established according to quintiles (for indicator bacteria), presence/absence (F+coliphage by CLAT) or at the median (F+ coliphage by SPOT). Non-swimmers were considered unexposed to waterborne fecal indicator organisms.We used the mean of the logWe used logistic regression models to quantify and describe the relationship between estimates of fecal indicator organisms and the risk of illness among swimmers. The predictor of interest was the estimate of fecal indicator organisms. Factor variables representing "beach" were included in all models to control for differences in baseline illness. Robust estimates of variance were used to account for non-independence of observations within households -26. CovaFor each analysis, the set of covariates was reduced through a change-in-estimate procedure , where tAdjusted Odds Ratios (AORs) estimated from logistic regression models were used to represent the degree of association between fecal indicator estimates and risk of illness. An AOR of 1 indicates no association or a completely flat slope. AORs with a 95% confidence bound including 1 were considered not statistically significant. For graphical presentations, adjusted probabilities of illness were predicted from logistic regression models holding covariates constant at their mean value.We used Stata version 10.1 for data analysis .We conducted interviews on 70 study days at the three beaches Table . At EdgeEnterococcus CFU (21 CFU/100 ml) and Goddard Beach the lowest (4 CFU/100 ml). Individual samples of Enterococcus CFU ranged from below detection to 3,000 CFU/100 ml. Overall, 142 samples (11.5%) exceeded 104 CFU/100 ml, the EPA recommended single sample maximum for marine beaches [Enterococcus CCE estimated by qPCR were higher than Enterococcus CFU. For all indicators measured by qPCR, estimates of CCEΔΔ were higher than CCEΔ. Bacteroidales CCE were highest among the indicators.We collected and tested a total of 1,242 water samples on study days (Table beaches . IndividFifty-six percent (100/222) of samples at Fairhope Beach and 65% (203/425) of samples at Goddard Beach were positive for F+ coliphage by the 24 hour SPOT test. Fewer samples were positive for F+ coliphage by the CLAT assay. At Fairhope Beach, 4% (8/228) and 14% (14/224) of samples indicated the presence of F+ RNA and F+ DNA coliphage, respectively. At Goddard Beach, 8% (31/425) and 9% (37/423) of samples tested indicated the presence of F+ RNA and F+ DNA coliphage, respectively.ΔΔ and for Enterococcus CFU. For Enterococcus CCE, Bacteroidales CCE and Enterococcus CFU, the crude cumulative incidence of both GI illness and diarrhea increased with increasing levels of exposure and peaked in the highest exposure categories. On days when the daily geometric mean of Bacteroidales CCEΔΔ was highest , approximately 12% of swimmers reported GI illness compared to 6% among non-swimmers and 4% among swimmers on days when Bacteroidales CCEΔΔ was low (< 542 CCE/100 ml). Similar patterns were noted for Enterococcus CFU and CCE.The number and crude (unadjusted) percentage of respondents reporting illness among non-swimmers and swimmers for quintiles of exposure based on daily averages are shown for all subjects in Table Enterococcus and Bacteroidales CCEΔ and CCEΔΔ in the risk of GI illness were also significantly associated with both GI illness and diarrhea. Associations between GI illness and fecal Bacteroidales were generally positive but not statistically significant. Clostridium CCEΔΔ showed a strong statistically significant association with GI illness , Table AORs of illness among swimmers with respect to indicator density are shown for all subjects Table . The ris Figures and 3. Ass Table . MorningEnterococcus CFU were also positively associated with GI illness, but the associations were not statistically significant. None of the associations with non-enteric illnesses were consistently positive the AOR for GI illness with respect to the daily average Enterococcus CCEΔΔ was 8.9 (95% CI: 2.2-37).Associations between GI illness and qPCR CCE appeared to strengthen with more intense or prolonged water exposure, although results were based on few subjects. For example, among those exposed to water greater than 90 minutes (N = 751), AORs were 6.4 (95% CI: 1.2-33) and 7.14 (95% CI: 1.4-37) for associations between Enterococcus CCEEnterococcus and Bacteroidales CCEΔΔ, respectively). Restricting the definition of swimmers to those who immersed their head also had little effect on the results as did using averages of water quality approximately specific to the swimmer's estimated time of day and location of swimming exposure (data not shown).Associations between GI illness and qPCR CCE were robust to many ways of handling and interpreting the data. Allowing qPCR CT values to extend to either 40 or 45 for CCE calculations and using different approaches to impute results for non-detected samples such as Enterococcus or Bacteroidales CCE exposure across the three beaches. Likelihood ratio tests comparing a full model which allowed the slope to vary by beach was no better than a model that allowed a common slope .There was no evidence of systematic differences in the relationships between GI illness and diarrhea and The odds of GI illness was higher among swimmers compared to non-swimmers on days when F+ DNA or F+ RNA coliphage was detected by the CLAT assay or F+ coliphage was detected by the SPOT assay Table . PositivEnterococcus CFU guideline geometric mean value of 35 CFU per 100. On these days, we observed elevated odds of diarrhea, respiratory illness and earache among swimmers compared to non-swimmers reinforced the validity of the results.Enterococcus CFU at these three marine beaches was relatively good. Most other epidemiology studies at marine beaches have reported higher levels of Enterococcus CFU [Enterococcus CFU exposures [Enteroccocus and Bacteroidales CCE and GI illness despite relatively low levels of culturable Enterococcus. This is consistent with our previous findings at freshwater beaches and provides further evidence that fecal indicators estimated by qPCR are a sensitive marker of poor water quality and subsequent health effects among swimmers at beach sites impacted by treated sewage discharge. Compared to the freshwater beach sites we previously studied [Enterococcus CCE were slightly higher and average Enterococcus CFU were lower. The relationship between Enterococcus qPCR CCE and Enterococcus CFU can be influenced by many factors and may vary from beach to beach [Average water quality as measured by eported) -34. A sexposures . Here, w studied , averageto beach . Environto beach -39.Enterococcus CCEΔΔ and GI illness among swimmers was stronger than we reported at freshwater beaches [Enterococcus and GI illness in marine water which the authors suggested may have been due to a greater die off of indicators relative to pathogens in marine waters. We anticipate more detailed comparisons of these results will be the focus of future reports which should also consider baseline (non-swimmer) illness. We observed positive relationships between gastrointestinal symptoms and other fecal indicators, Clostridium, fecal Bacteroides CCE, as well as F+ coliphage, but since associations were not consistently statistically significant among swimmers we cannot make conclusions regarding these indicators.The estimate of the association between 05-1.51) ,41. Our 05-1.51) also obsClostridium perfringens has been suggested for use as an indicator of fecal contamination in tropical environments [ronments , but it ronments . Male-spronments but thisronments .Enterococcus, and three Bacteroidales markers measured by qPCR [Enterococcus [Enterococcus and Bacteroidales measured by qPCR [This study was conducted at beaches in a temperate climate with nearby treated point source sewage discharges and results may not be directly applicable to sites affected by fecal contamination from other types of sources or sites with different climates. Human viruses such as norovirus have been identified as likely contributors to excess GI illness among swimmers at beaches impacted by treated sewage discharges . Some hu by qPCR ). This srococcus ,45, whicrococcus . A study by qPCR . This st by qPCR . Source by qPCR . The res by qPCR .Enterococcus and Bacteroidales CCE in six morning samples were associated with subsequent GI illness among swimmers exposed on that day.We used an observational cohort study design which has been used by numerous others both historically and recently to evaluate the risks associated with recreational water exposures . While swimmers may have been more likely to recall illness than non-swimmers, it is unlikely such a recall bias would occur among swimmers at varying levels of water quality.Some of the health endpoints were non-specific, and may have been affected by recall bias. Broad endpoints accounted for the diverse range of symptoms potentially associated with recreational water exposure but such broad symptoms may obscure more specific effects of water quality and swimming exposure. The associations Rapid, molecular measures of water quality were associated with illnesses among swimmers at marine beach sites located in a temperate climate with nearby treated sewage discharges. The results provide further evidence that such indicators are a marker of GI illness risk at such beach sites.ΔΔ: Calibrator cell equivalents, delta-delta cycle threshold calculation; CCEΔ: Calibrator cell equivalents, delta cycle threshold calculation; CT: Cycle Threshold; CFU: Colony forming units; CLAT: Culture and latex agglutination assay for F+ coliphage; SPOT: 24-hour spot test for F+ coliphage.QPCR: Quantitative polymerase chain reaction; AOR: Adjusted odds ratio; P: P-value; CI: Confidence interval; GI: Gastrointestinal; URI: Upper respiratory illness; POTW: Publicly owned treatment works; CCE: Calibrator cell equivalents; CCEThe authors declare that they have no competing interests.Bacteroides assay. MB conceptualized the study, designed questionnaires and developed study materials. AD conceptualized the study, selected beach sites, and interpreted the results. All authors contributed to writing the manuscript and all authors read and approved the final manuscript.TW led study planning and implementation, data analysis, result interpretation and manuscript preparation. ES led survey and environmental data collection. KB led water sampling design and microbiological analysis. CR conducted microbiological analyses and coliphage testing. EC and RH conducted qPCR analysis and interpreted qPCR results. DL provided expertise on the rapid coliphage CLAT assay. QL conducted and provided input on statistical analyses. RN provided expertise on the Fecal Supplemental information on qPCR assay and CCE calculations.Click here for fileAdditional tables.Click here for file

Response to preoperative radiochemotherapy (RCT) in patients with locally advanced rectal cancer is very heterogeneous. Pathologic complete response (pCR) is accompanied by a favorable outcome. However, most patients show incomplete response. The aim of this investigation was to find indications for risk stratification in the group of intermediate responders to RCT.From a prospective database of 496 patients with rectal adenocarcinoma, 107 patients with stage II/III cancers and intermediate response to preoperative 5-FU based RCT (ypT2/3 and TRG 2/3), treated within the German Rectal Cancer Trials were studied. Surgical treatment comprised curative (R0) total mesorectal excision (TME) in all cases. In 95 patients available for statistical analyses, residual transmural infiltration of the mesorectal compartment, nodal involvement and histolologic tumor grading were investigated for their prognostic impact on disease-free (DFS) and overall survival (OS).Residual tumor transgression into the mesorectal compartment (ypT3) did not influence DFS and OS rates . Nodal involvement after preoperative RCT (ypN1/2) turned out to be a valid prognostic factor with decreased DFS and OS . Persistent tumor infiltration of the mesorectum (ypT3) and histologic tumor grading of residual tumor cell clusters were strongly correlated with lymph node metastases after neoadjuvant treatment (p < 0.001).Advanced transmural tumor invasion after RCT does not affect prognosis when curative (R0) resection is achievable. Residual nodal status is the most important predictor of individual outcome in intermediate responders to preoperative RCT. Furthermore, ypT stage and tumor grading turn out to be additional auxiliary factors. Future clinical trials for risk-adapted adjuvant therapy should be based on a synopsis of clinicopathologic parameters. Multimodal treatment strategies and optimized surgical procedures with total mesorectal excision (TME) led to a significant improvement in rectal cancer therapy within the last 15 years ,7.After preoperative RCT, therapy-induced downsizing effects have widely been described as important prognostic factors ,9. Local(y)pT3a to (y)pT3d. Therefore (y)pT3 category spans the invasion of only a few tumor cells beyond the muscularis propria to a complete infiltration of the mesorectum, nearby reaching the visceral peritoneum or contiguous organs [According to TNM classification , tumor is organs .A risk-adapted stratification of patients after preoperative RCT and TME-based surgery is crucial for adjuvant treatment strategies in individual patients. Currently, a beneficial impact of adjuvant chemotherapy (CT) is discussed controversely ,16. To dIn this study we investigated 107 patients with intermediate local response to preoperative 5-FU based RCT (ypT2/3) and curative (R0) surgery. The aim of this investigation was to clarify the impact of residual tumor infiltration of the mesorectal compartment (≥ ypT3b), nodal status (ypN) and histologic tumor grading on DFS and OS and to evaluate their relevance within an individual risk stratification model in intermediate responders to RCT.This study included patients with locally advanced rectal cancer (stage II/III) and moderate RCT-induced histopathologic tumor regression (TRG 2 and 3 according to the Dworak classification) and conPatients with clinical evidence of distant metastatic disease were excluded from the actual investigation and received individual multimodal treatment.Pretherapeutical staging procedures consisted of rigid rectoscopy, flexible colonoscopy, endorectal ultrasound (ErUS), magnetic resonance imaging (MRI) of the pelvis and computed tomography (CT) scans of chest, liver and pelvis. Staging results were conferred and interdisciplinary discussed before initiation of multimodal treatment. Clinical tumor stages were determined by ErUS, pelvic MRI, and CT scans.Preoperative treatment included fractional radiation with cumulative 50.4 Gy (28 × 1.8 Gy) in 3- or 4-field technique. Concomitant chemotherapy consisted of either 5-Fluorouracil (5-FU) monotherapy in 84 patients or a combined 5-FU + Oxaliplatin regime in 23 patients. Six weeks after completion of neoadjuvant treatment all patients underwent standardized TME-based surgery. Subsequently, postoperative systemic therapy was applied according to the preoperative treatment regimen and the actual study protocol.Quality assessment of the surgical specimens was performed according to the MERCURY criteria and was Pathological staging included ypTNM stage according to the current TME classification, tumor dresidual tumor cells was evaluated after preoperative RCT and subdivided into two categories by a Cox proportional hazards regression model. The ypT and ypN parameters were additionally evaluated in a multivariate analysis.http://www.r-project.org).The distributions of ypN status within the two subgroups of ypT (ypT2/3a and ypT3b-d) were compared by Fisher's exact test. The number of detected lymph nodes between nodal positive and negative patients was compared with the Mann-Whitney-U test. The significance level was set to α = 5% for all tests. All analyses were performed with the free software R rectal cancer received preoperative RCT within the German rectal cancer trials , as detected by manual liver palpation and intraoperative ultrasound. These patients likewise had evidence of residual mesorectal lymph node metastases within the surgical specimen and were excluded from survival analysis.During a median follow-up period of 42 months (range: 4 - 126 month), 9 of the 107 patients died of non-cancer-related disease and were excluded from cancer specific survival analyses. Seventeen (15.9%) patients had cancer relapse, with 15 cases of separate distant metastatic disease and 2 cases of local recurrence combined with synchronous distant metastases. No isolated local recurrence occurred. Three patients failed statistical analyses due to occult synchronous hepatic metastases detected during surgery (ypUICC IV). In summary, 95 patients were included into survival analysis.Patient characteristics, pretherapeuthical staging results and treatment procedures of all 107 intermediate responders to preoperative RCT are presented in Table When comparing pretherapeuthical clinical staging with pathological staging results, RCT-induced T-Level downsizing was achieved in 42% of patients (n = 45). Eight tumors, initially staged as cT4 were downsized to ypT2 (n = 2), ypT3b (n = 2), ypT3c (n = 3) and ypT3d (n = 1). Thirty-seven tumors, previously staged as cT3 were downsized to ypT2 status. Nodal downstaging from cUICC III to ypUICC II stage was achieved in 41% of patients (n = 44).The median number of detected and histopathologically evaluated lymph nodes per specimen was 21 (range: 6 - 79). In 68% of specimens, lymph node yield accounted for ≥ 18 nodes. Fewer than 12 nodes, which is the consensual number according to TNM criteria, were found in a total of 5 specimens (4.7%).In patients with extended lymph node recovery, lymph node metastases were detected more frequently. However, this finding was not statistically significant (p = 0.06). In detail, the median number of lymph nodes found in the ypN0 group was 19 (range: 6 - 79) compared to 24 (range: 7 - 77) in the ypN1/2 group.Of 95 patients included in cancer specific survival analyses, 63 (66.3%) were classified as node negative (ypN0), and 32 (33.7%) patients presented with residual lymph node metastases (ypN1/2) after RCT. Fifty patients (54.3%) had intramural tumor infiltration with a maximal infiltration of ≤ 1 mm beyond the muscularis propria (ypT2/3a). Forty-two patients (45.7%) had advanced ypT status with distinct (>1 mm) tumor invasion into the mesorectal compartment (ypT3b-d).Compared to the ypT2/3a stage, advanced residual infiltration into the mesorectal compartment ypT3b-d) after preoperative RCT was not associated with a significantly decreased DFS and OS Figure . However-d after The probability of cancer relapse and distant metastases was stage-dependent. There was no significant difference within the group of nodal-negative patients with stage I and II disease (ypT2/3a N0 and ypT3b-d N0: 91% and 88%) or within the group of stage III patients (ypT2/3a N+ and ypT3a-d N+: 55% and 67%).Residual mesorectal tumor infiltration (ypT3b-d) - though without immediate impact on survival - was significantly associated with occurrence of metastatic lymph node involvement after preoperative RCT (p < 0.001), which itself is an independent prognostic factor for survival.Histologic tumor differentiation grading after RCT had a significant influence on DFS (p = 0.04), whereas patients with well and moderate tumor differentiation showed a tendency for prolonged OS . Furthermore, histologic tumor differentiation grading after RCT correlated with residual lymph node metastases (p < 0.001) as well as mesorectal tumor infiltration (ypT3b-d) (p = 0.0001).When evaluating the 63 patients with ypN0 status for their pretherapeuthical nodal status (cN), staged by ErUS and MRI, 29% (n = 18) of patients had previous cN0 status and 71% (n = 45) presented with cN+ status. DFS and OS did not significantly differ in patients who initially presented with clinical evidence of mesorectal lymph node involvement but resulted in ypN0 after RCT . Patients with clinically staged III rectal cancers therefore showed no higher risk of cancer relapse and cancer-related death than initially node-negative patients, as long as sterilization of lymph node metastases can be achieved with RCT.Recent results from the randomized multicenter trial CAO/ARO/AIO-94 showed an enhanced local control and sphincter preservation with concurrently decreased toxicity after preoperative long-term RCT compared to postoperative RCT . These rOf 153 patients with stage II/III rectal cancer who received standardized preoperative RCT within randomized clinical trials, pCR as a major response criterion, was achieved in 16% n = 10) of patients. pCR rates vary between 10 and 20% and were associated with a favorable outcome ,10. Neve of patieIt remains unclear which subgroup of patients with intermediate response can be considered as cured after preoperative RCT and subsequent TME surgery. Conversly, it is of enormous clinical interest to know which subgroup necessitates adjuvant systemic therapy.Involvement of circumferential resection margins (CRM) has recently been described as a very strong prognostic factor after preoperative short term radiation . AlthougPrior to implementation of neoadjuvant strategies for rectal cancer, a tumor invasion of ≥ 5 mm into the mesorectal compartment, besides circumferential involvement, was described as a significant prognostic factor . The decWe therefore evaluated the impact of intramural depth of tumor invasion (ypT2) together with minimal (<1 mm) transgression of the muscularis propria (ypT3a) compared to a distinct transmural tumor invasion into the mesorectum . Since patients with ypT3a status show only an extremely marginal infiltration of the mesorectal compartment (<1 mm) we consider them to prognostically belong to the ypT2 group rather than to the tumors with distict mesorectal infiltration. Our results underline this assumption showing an increased incidence of nodal metastases in ypT3b-d patients compared to ypT2/3a patients.In the patients presenting with previous cT3/4 rectal cancers the RCT-induced regression of tumor invasion depth to ypT2/3a status had no impact on prolonged DFS and OS. Thus, residual tumor transgression into the mesorectum after preoperative RCT showed no significant influence on cancer recurrence, providing that complete resection with negative CRM is achieved by adequate TME surgery.Tumor downsizing from the extramural mesorectal compartment into the actual rectal wall therefore seems to be of importance only when tumor-free CRM and R0-resection cannot be guaranteed (former T3d/4 status).In contrast to ypT, nodal status after preoperative CRT (ypN) significantly influenced cancer recurrence and overall survival in stage II/III rectal cancer patients with intermediate response within our investigation. This finding coincides with previous results and supports recent investigations with considerable numbers of patients ,26 but iIn agreement with other authors ,27, we oAnyway, patients with ypN+ status should be considered for upcoming trials with intensified adjuvant CT regimes as this might be more efficient in preventing systemic tumor relapse. Nonetheless, mesorectal tumor invasion (ypT3b-d) was significantly associated with residual lymph node metastases after RCT in our study (p < 0.001). We interpret this finding with a generally lower response to RCT regarding both downsizing of the primary tumor and sterilization of lymph node metastases. This might be due to improved biological behavior and enhanced resistance to RCT in individual cancers. The prognostic impact of mesorectal tumor infiltration remains unclear. We could not show straight effects on tumor recurrence and survival but are well aware that this might be due to the relative small number of patients underlying this investigation.Neoadjuvant RCT has repeatedly been accused of reducing lymph node yield in rectal cancer specimens -31. It hWhile histologic tumor grading in colorectal cancers after primary surgery has been ascertained as a prognostic factor , its proNot unexpectedly, lymph node status displays as the major criterion for therapy stratification after application of preoperative RCT within our study and several recent investigations and might subdivide patients with need of intensified adjuvant treatment from those who can be considered as cured after surgery. In contrast Collette et al. , who repTo date, most patients with positive nodal status after preoperative RCT will intuitively get adjuvant CT. Prospective randomized clinical trials should therefore clarify the impact of adjuvant treatment in patients undergoing preoperative RCT and radical surgery. For ypN0 patients 5-FU based adjuvant CT was shown as a potential overtreatment and had no significant effect on survival ,37.Nevertheless, in our actual study population, 7 patients with ypN0 status developed distant metastases during follow-up. All 7 had poorly differentiated residual tumors (low grade). Poor differentiation of residual tumor cell clusters after RCT and advanced invasion depth turned out to be predictors of lymph node metastases and may be indicators of occult nodal (micro-) metastases in patients classified as ypN0. Both parameters should thus be taken into account in ypN0 patients, particularly in cases of minor lymph node recovery, and might have influence on the decision for adjuvant CT.Although this investigation is based on a homogeneous collective of patients treated within randomized clinical trials with replicable and standardized diagnostic and therapeutic procedures, its principal limitations are the retrospective character and the relatively small number of patients. Thus this study does not want to claim to ultimately answer the question which subgroup of patients need adjuvant CT after preoperative multimodal treatment and subsequent R0-resection. Prospective randomized trials will have to clarify the debatable role of postoperative CT in rectal cancer patients after preoperative RCT and radical TME surgery. The clinicopathologic parameters investigated in this study might give indications to stratify patient groups with lower and higher individual risk of tumor relapse and tumor-related death within future clinical trials.The authors declare that they have no competing interests.TS prepared the study design, assembled and analysed the data and drafted the manuscript. HR carried out the pathological diagnostics of the rectal cancer specimens and reviewed the manuscript. KJ carried out the statistical analyses. HC contributed the radiation therapy data and reviewed the manuscript. LC participated in assembling of the data and reviewed the manuscript. BMG and HB reviewed the manuscript. TL supervised the study and data assembling and critically reviewed the manuscript. All authors read and approved the final manuscript.

Rheumatoid arthritis (RA) is an autoimmune inflammatory disease that mainly affects synovial joints. Biologics directed against tumor-necrosis-factor (TNF)-α are efficacious in the treatment of RA. However, the role of TNF receptor-1 (TNFR1) in mediating the TNFα effects in RA has not been elucidated and conflicting data exist in experimental arthritis models. The objective is to investigate the role of TNFR1 in the synovial lining cells (SLC) and the reticuloendothelial system (RES) during experimental arthritis.in vitro using a nuclear factor-kappaB (NF-κB) reporter assay and in vivo in streptococcal cell wall-induced arthritis (SCW) and collagen-induced arthritis (CIA). Adenoviruses were administered before onset of CIA, and the effect of TNFR1 targeting on the clinical development of arthritis, histology, quantitative polymerase chain reaction (qPCR), cytokine analyses and T-cell assays was evaluated.Third generation of adenovirus serotype 5 were either injected locally in the knee joint cavity or systemically by intravenous injection into the retro-orbital venous sinus to specifically target SLC and RES, respectively. Transduction of organs was detected by immunohistochemistry of the eGFP transgene. An adenoviral vector containing a short hairpin (sh) RNA directed against TNFR1 (HpTNFR1) was constructed and functionally evaluated In vitro, HpTNFR1 reduced the TNFR1 mRNA expression by three-fold resulting in a 70% reduction of TNFα-induced NF-κB activation. Local treatment with HpTNFR1 markedly reduced mRNA and protein levels of interleukin (IL)-1β and IL-6 in SLC during SCW arthritis and ameliorated CIA. Systemic targeting of TNFR1 in RES of liver and spleen by systemic delivery of Ad5 virus encoding for a small hairpin RNA against TNFR1 markedly ameliorated CIA and simultaneously reduced the mRNA expression of IL-1β, IL-6 and Saa1 (75%), in the liver and that of Th1/2/17-specific transcription factors T-bet, GATA-3 and RORγT in the spleen. Flow cytometry confirmed that HpTNFR1 reduced the numbers of interferon (IFN)γ (Th1)-, IL-4 (Th2)- and IL-17 (Th17)-producing cells in spleen.Systemic delivery of Ad5.CMV-eGFP predominantly transduced the RES in liver and spleen. Local delivery transduced the synovium and not the RES in liver, spleen and draining lymph nodes. TNFR1-mediated signaling in both synovial lining cells and the reticuloendothelial system independently played a major pro-inflammatory and immunoregulatory role in the development of experimental arthritis. Rheumatoid arthritis (RA) is a chronic and systemic autoimmune disease that mainly affects synovial joints and is characterized by inflammatory synovitis, ultimately leading to the destruction of cartilage and bone. The central role for tumor necrosis factor-alpha (TNFα) in RA pathogenesis has been extensively demonstrated in experimental arthritis by successful treatment of murine collagen-induced arthritis (CIA) with TNFα antibodies ,2 and deTnfrsf1a (TNFR1) and Tnfrsf1b (TNFR2). The TNF receptors are transmembrane glycoproteins and share only 28% homology, predominantly between their extracellular domains. Both TNFR1 and TNFR2 activate a wide range of proinflammatory signal pathways, leading to activation of nuclear factor-kappa-B (NF-κB) and c-Jun N-terminal kinase, via recruitment of TNF receptor-associating factors . Attenuiewed in . Recent iewed in . In contiewed in ,12.This cell specificity of TNFR1 function is highly relevant to the safety and efficacy of treatments that target TNFα signaling. Scintigraphic imaging of the biodistribution of radiolabeled anti-TNF after systemic administration in RA patients has shown that antibodies accumulate not only in inflamed joints but also in the liver and spleen . HoweverIn this study, we investigated the effects of TNFR1-mediated signaling in synovial lining cells (SLCs) and the reticuloendothelial system (RES) during experimental arthritis. To this end, we used cell-specific RNA interference (RNAi)-mediated silencing of TNFR1 based on adenoviral delivery of a short hairpin RNA (shRNA)-expressing construct.ad libitum. All in vivo studies complied with national legislation and were approved by the local authorities on the care and use of animals.Male 10- to 12-week-old DBA/1J and C57BL/6 mice were obtained from Janvier . During viral experiments, mice were housed in HEPA-filtered individually ventilated cages. The animals were fed a standard diet with food and water Mycobacterium tuberculosis strain H37Ra; Difco Laboratories, now part of Becton Dickinson and Company, Franklin Lakes, NJ, USA). DBA1/J mice were immunized intradermally at the base of the tail with 100 μL of emulsion (100 μg of bCII). On day 21, the mice were given an intraperitoneal booster injection of 100 μg of bCII dissolved in phosphate-buffered saline (PBS). Mice were killed on day 31 by cervical dislocation.Bovine collagen type II (bCII) was dissolved in 0.05 M acetic acid to a concentration of 2 mg/mL and was emulsified in equal volumes of Freund's complete adjuvant injection of 5 μg of streptococcal cell wall (SCW) fragments (rhamnose content) in 6 μL of PBS.eviously . The res2.Mouse embryonic fibroblasts (NIH 3T3) stably transfected with a 5 × NF-κB-luciferase reporter were cultivated in Dulbecco's modified Eagle's medium (DMEM) supplemented with 1 mM pyruvate, penicillin-streptomycin , and 5% fetal calf serum (FCS). Cells were kept at 37°C in a humid atmosphere containing 5% COPfu DNA polymerase and T4 DNA Ligase . All generated constructs were verified by sequencing. The U6 promoter was polymerase chain reaction (PCR)-cloned from mouse genomic DNA into XbaI/SalI sites of pShuttle to give pShuttle-U6 using primers forward 5'-TCTAGAGATCCGACGCCGCCATCTCTA-3' and reverse 5'-GTCGACGTTAACAAGGCTTTTCTCCA-3'. The target sequence for silencing the Tnfrsf1a gene [EMBL:M60468] was ATCTTCGGTCCTAGTAACT (base pairs 1095 to 1113), and we used ACTCATGTCTTGATCAGCT (no complementary sequence in murine genome) as scrambled control sequence. The silencing cassette was constructed using the following oligonucleotides: forward 5'-TG-target-TTCAAGAGA-target reverse complimentary-TTTT-TGCA-3' and reverse 5'-AAAA-target-TCTCTTGAA-target reverse complimentary-CA-3', where the loop and polyA sequences are underlined and bold, respectively. Oligonucleotides (4.5 nM) were mixed in annealing buffer , heated for 5 minutes at 95°C, and gradually cooled to room temperature. Annealed DNA fragments were ligated in HpaI/SalI sites of pShuttle-U6.For cloning, we used Replication-deficient adenoviral vectors (E1/E3 deleted) Ad5.U6-HpTNFR1 and Ad5.U6-HpNS were prepared according to the AdEasy system , with th2 gradient purifications and stored in small aliquots at -80°C in buffer containing 25 mM Tris, pH 8.0, 5 mM KCl, 0.2 mM MgCl2, 137 mM NaCl, 730 μM Na2HPO4, 0.1% ovalbumin, and 10% glycerol. The infectious particle titer (ffu) was determined by titrating vector stocks on 911 indicator cells and measuring viral capsid protein immunohistochemically 20 hours after transduction.Viruses were purified by two consecutive CsCl8 or 107 ffu adenovirus, respectively. One day later, liver, spleen, lung, knee joints, draining lymph nodes, blood, and bone marrow cells (BMCs) were isolated. They were fixated in 4% paraformaldehyde for 4 days for immunohistochemistry (IHC). After decalcification in 5% formic acid, specimens were processed for paraffin embedding. Tissue sections (7 μm) were stained with anti-GFP antibody. For mRNA measurement with reverse transcription-quantitative PCR (RT-qPCR), all parts were isolated.To study which organs are transduced after systemic or local treatment, Ad5.CMV-eGFP was injected into naïve DBA/1J mice intravenously or intra-articularly with 3 × 108 or 107 ffu adenovirus, respectively. For the siRNA (short interfering RNA) hairpin-treated mice, mice were sacrificed 3 days post-transduction, and synovium (i.a.), spleen, and liver were isolated. Development of arthritis in front and hind paws was macroscopically monitored (scores between 0 and 2) until day 31. The macroscopic arthritis score is based on the clinical signs of inflammation in each paw and ankle; the maximum score is 8 (1 for each hind paw and 1 for the ankle). Mice were killed at day 26 or 31 by cervical dislocation. At day 26, synovial tissue explants (i.a.), spleen, and liver (i.v.) were removed. At day 31, ankle and knee joints were removed and fixed in 4% paraformaldehyde for 4 days. After decalcification in 5% formic acid, specimens were processed for paraffin embedding. Tissue sections (7 μm) were stained with hematoxylin and eosin (cell influx) or safranin-O (cartilage proteoglycan depletion). Histological changes were scored in the patella/femur region on five semi-serial sections of the knee joint, spaced 70 μm apart. Scoring was performed by two observers without knowledge of the group, as described before. Histopathological changes were scored using the following parameters. Cartilage depletion, defined as the loss of proteoglycan content, was scored on a scale ranging from 0 to 3 per region, depending on the intensity of staining in the cartilage. Infiltration of cells was scored on a scale of 0 to 3 , depending on the number of inflammatory cells in the synovial cavity (exudate) or synovial tissue (infiltrate). Cartilage erosion was graded on a scale of 0 to 3, ranging from no damage to compete loss of articular cartilage.DBA/1J mice were injected intravenously or intra-articularly 1 day after bCII booster (day 22) with 3 × 10Paraffin sections were stained with rabbit anti-GFP (1:800) overnight at 4°C. After washing, sections were incubated for 1 hour with biotinylated secondary antibody goat anti-rabbit-BIOT (1:400) . After washing, sections were incubated for 30 minutes with Vectastain (1:400) (Vector Laboratories). Thereafter, sections were stained with 3,3'-diaminobenzidine and counterstained with hematoxylin, embedded in Permount .2 for 1 hour in order to separate adherent cells from nonadherent cells. The cells in the adherent cell fraction consisting mainly of macrophages are termed antigen-presenting cells (APCs). Splenic APCs were stimulated for 24 hours with 10 ng/mL TNFα . Cytokine production was analyzed using Luminex multianalyte technology. The Bioplex system in combination with multiplex cytokine kits was used.Spleens were mashed and filtered, and erythrocytes were removed by osmotic shock. After washing, the splenic cell fraction was incubated in RPMI 1640 at 37°C in 5% CO6/mL) for 2 hours in RPMI 1640 (Invitrogen Corporation) supplemented with 10% FCS, penicillin-streptomycin, 1 mM pyruvate, 1 μl/mL Golgiplug inhibitor , 10 ng/mL PMA (phorbol 12-myristate 13-acetate), and 1 μg/mL ionomycin. Thereafter, cells were labeled for 30 minutes at 4°C with antibody TCRβ-FITC (T-cell receptor beta-fluorescein isothiocyanate) (1:200) and CD4-APC (1:100) or their respective isotype control antibodies. Cells were washed and consecutively fixed and permeabilized using cytofix/cytoperm solution (BD Biosciences). Thereafter, cells were incubated with phycoerythrin (PE)-labeled antibodies interferon-gamma (IFNγ)-PE (1:200), interleukin-4 (IL-4)-PE (1:200), or IL-17-PE (1:500) or appropriate isotype controls for 30 minutes at 4°C in PBS containing 1% bovine serum albumin (BSA), 2% FCS, and 0.1% saponin. Analyses were performed on a BD FACSCalibur (BD Biosciences).Total spleen cells obtained as described above were cultured . Cytokines were measured in 50 μL of washout medium. The sensitivities were 5, less than 3, and 5 pg/mL for IL-1β, TNFα, and IL-6, respectively.Synovial tissue explants were incubated for 1 hour at room temperature in 200 μL of RPMI 1640 supplemented with 0.1% BSA, penicillin-streptomycin, and 1% pyruvate. Subsequently, supernatant was harvested and centrifuged for 5 minutes at 1,000 4 cells per well in a Krystal 2000 96-well plate . The day after, cells were transduced with adenovirus at the indicated multiplicity of infection (MOI) in 50 μL of DMEM for 4 hours at 37°C. Two days post-transduction, cells were stimulated with 10 ng/mL recombinant murine TNFα or IL-1β for 6 hours and subsequently lysed in ice-cold lysis buffer . Alternatively, TNFα was antagonized by preincubating cells for 1 hour with 10 μg/mL Enbrel . Luciferase activity was quantified using the Bright-Glo luciferase assay system by adding an equal volume of Bright-Glo to the cell lysate. Luminescence was quantified in a luminometer , expressed as relative light units, and normalized to total protein content of the cell/tissue extracts using a BCA (bicinchoninic acid) protein assay kit .NIH-3T3-5 × NF-κB-luciferase cells were seeded at 5 × 10Synovial and liver tissue was snap-frozen in liquid nitrogen and homogenized using a MagNa Lyser . Total RNA was extracted using TRI reagent . Isolated RNA samples were treated with RNase-free DNase I for 15 minutes. Synthesis of cDNA was accomplished by reverse transcription-PCR using an oligo(dT) primer and Moloney murine leukemia virus reverse transcriptase (Invitrogen Corporation).Gapdh) as a reference gene (ΔCt = Ctgene - CtGapdh).qPCR was performed using SYBR Green PCR Master mix and the ABI 7000 Prism Sequence Detection system in accordance with the instructions of the manufacturer. Primers were designed over exon-exon junctions in Primer Express (Applied Biosystems Inc.) and used at 300 nM in the PCR . P values of less than 0.05 were regarded as significant.Data are represented as mean ± standard error of the mean, and significant differences were calculated using Student Ad5.CMV-eGFP was injected intravenously or intra-articularly 1 day after the bCII booster immunization in mice that had no clinical signs of arthritis. One day later, liver, spleen, lung, blood, BMCs, and synovium of the knee joints were isolated and prepared for IHC or processed for mRNA isolation. As expected, the systemically administered adenoviruses were scavenged by the RES primarily in liver and spleen. IHC detection of eGFP transgene expression, after systemic delivery of adenoviruses encoding for eGFP showed that in liver the Kupffer cells were predominantly transduced and in tΔΔCt) of TNFR1 mRNA levels at MOIs 1 and 10, respectively. Next, we investigated the specificity of the TNFR1-targeting construct (IFNγ), Th2 (IL-4), or Th17 (IL-17) cytokine expression. This was accompanied by a strong decrease (more than fourfold) in mRNA expression of their respective transcription factors . Since both IL-1 and IL-6 have been described as crucial cytokines in T-cell expansion and differentiation [To elaborate on the mechanisms behind HpTNFR1-mediated prevention of CIA, we analyzed proinflammatory gene expression in liver at disease endpoint by qPCR Figure . This shntiation ,22, we mThe pleiotropic biological and immunological activities of TNFα are determined by its cellular localization (transmembrane or soluble) -26 and tThe contribution of TNFR1-mediated signaling in SLCs to joint inflammation was investigated after SCW challenge. In the acute phase, SCW arthritis represents an innate immune response against SCW fragments that is driven by direct activation of macrophages ,39. TNFR+ T cells and autoimmunity. Eriksson and colleagues [Remarkably, we found that TNFR1 silencing in knee joints also protected the ipsilateral ankle joints in CIA mice. While such distal effects have been described before in local gene therapy approaches -45, the lleagues demonstrlleagues . The obslleagues . Alternalleagues -55. Impolleagues . Indeed,Strikingly, systemic treatment with HpTNFR1 ameliorated CIA almost to the same extent as local treatment. We have previously shown that SOCS3 overexpression in splenic APCs ameliorates CIA via a general suppression of Th subsets . SimilarIn a side-by-side comparison, we have demonstrated equal efficacies of local and systemic RNAi-mediated TNFR1-targeting gene therapy in alleviating CIA. Importantly, cell-specific gene therapeutic targeting of TNFR1 clearly modulated proinflammatory effects of TNFα without interfering with protective effects of TNF signaling that have been described in hematopoietic cells ,12. It wSpecific silencing of TNFR1 in SLCs, hepatic and splenic RES by respectively local or systemic delivery of Ad5 virus encoding for small hairpin RNA against TNFR1 revealed a dominant and clear proinflammatory role of TNF signaling in these cells during CIA. Systemic treatment dampened the liver acute-phase response and reduced proliferation of Th subsets in spleen. Local treatment inhibited the proinflammatory cytokine cascade in the joint. Gene therapeutic targeting of TNFR1 may be a promising and safer approach for TNFα blockade in RA patients.APC: antigen-presenting cell; bCII: bovine collagen type II; BMC: bone marrow cell; BSA: bovine serum albumin; CIA: collagen-induced arthritis; Ct: cycle threshold; DC: dendritic cell; DMEM: Dulbecco's modified Eagle's medium; FCS: fetal calf serum; Gapdh: glyceraldehyde-3-phosphate dehydrogenase; HpNS: hairpin non specific; HpTNFR1: hairpin construct targeting tumor necrosis factor receptor 1; i.a.: intra-articular; IFNγ: interferon-gamma; IHC: immunohistochemistry; IL: interleukin; i.v.: intravenous; MOI: multiplicity of infection; NF-κB: nuclear factor-kappa-B; PBS: phosphate-buffered saline; PCR: polymerase chain reaction; PE: phycoerythrin; qPCR: quantitative polymerase chain reaction; RA: rheumatoid arthritis; RES: reticuloendothelial system; RNAi: RNA interference; RT-qPCR: reverse transcription-quantitative polymerase chain reaction; SCW: streptococcal cell wall; SF: synovial fibroblast; shRNA: short hairpin RNA; SLC: synovial lining cell; SOCS3: suppressor of cytokine signaling-3; TCRβ: T-cell receptor beta; Th: T helper; TNFα: tumor necrosis factor-alpha; TNFR: tumor necrosis factor receptor.The authors declare that they have no competing interests.OJA helped to acquire data and contributed to the study design, statistical and data analysis, interpretation of data, and drafting of the manuscript. SV, BTvdB, and MBB helped to acquire data. JG, SA-R, and FAvdL contributed to the study design, statistical and data analysis, interpretation of data, and drafting of the manuscript. WBvdB conceived of the study and helped draft the manuscript. All authors read and approved the final manuscript.Supplemental Methods. Primerdesign.Click here for file

Inter­molecular N—H⋯Cl and O—H⋯Cl hydrogen bonds build up an intricate three-dimensional network.In the title compound, [CuCl DOI: 10.1107/S1600536809046121/dn2503Isup2.hklStructure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:

Fifty patients with operable breast carcinoma underwent fine needle aspiration for cytological examination. The smears were prepared by means of the immunocytochemical method using monoclonal antibodies for the determination of the oestrogen receptors (ER). After surgery the contents of the ER were determined with the traditional biochemical technique. The results of the immunocytochemical method showed 31 positives, two of which disagreed with the biochemical results, 15 negatives and four cases which could not be assessed due to the absence of adequate numbers of cells. The ICA staining for ER was expressed on a semiquantitative basis; there was a significant correlation between this and the values expressed by the biochemical technique, with a coefficient of 0.83, P less than 0.000006.

The Shoulder Pain and Disability Index (SPADI) is a self-administered questionnaire that aims to measure pain and disability associated with shoulder disease. It consists of a pain section and a disability section with 13 items being responded to on visual analogue scales. Few researchers have investigated SPADI validity in specified diagnostic groups, although the selection of an evaluative instrument should be based on evidence of validity in the target patient group. The aim of the present study was to investigate factor structure of the SPADI in a study population of patients with adhesive capsulitis.The questionnaire was administered to 191 patients with adhesive capsulitis. Descriptive statistics for items and a comparison of scores for the two subscales were produced. Internal consistency was analyzed by use of the Cronbach alpha and a principal components analysis with varimax rotation was conducted. Study design was cross-sectional.Two factors were extracted, but the factor structure failed to support the original division of items into separate pain and disability sections.We found minimal evidence to justify the use of separate subscales for pain and disability. It is our impression that the SPADI should be viewed as essentially unidimensional in patients with adhesive capsulitis. The Shoulder Pain and Disability Index (SPADI) is a self-administered questionnaire, designed by Roach and colleagues to measure the impact of shoulder pathology in terms of pain and disability, for both current status and change over time . The queWhile responses to individual items are observable and concrete variables, the concepts they purport to assess when combined are abstract or latent variables, socalled "constructs" . For a mSPADI is one of the shoulder rating scales that has been most extensively studied ,6. ConstThe selection of an evaluative instrument should be based on evidence of reliability and validity in the target patient population . It has Adhesive capsulitis is one of the most common disorders affecting the shoulder and SPADI has been employed in several clinical trials involving this patient category -14. The The study was conducted as part of a larger project regarding adhesive capsulitis and outcome measures for this condition. The Regional Ethics Committee for Eastern Norway granted ethical approval for the project. We prepared a Norwegian version of the SSPADI is a self-administered instrument aiming to measure pain and disability associated with shoulder disease. It consists of five pain and eight disability items. Each item is measured on an 11 cm visual analogue scale, producing figures ranging from 0 to 10. Pain and disability subscale scores are calculated as the mean of the corresponding items on a 0–100 scale, the highest score indicating the most severe pain and disability. The total score is calculated as the average of the pain and disability subscales. If more than two items of a subscale are not responded to, no SPADI score is calculated [r). Agreement between the subscales was investigated with Bland-Altman scatterplots [Descriptive statistics were calculated for the 13 items, the subscales and the total score. Inter-subscale correlation was examined with the Pearson correlation coefficient and the recommendations by Andy Field [All statistical analyses were carried out using the software package SPSS 13.0 for Windowsdy Field .Mean age of the participants was 51.9 years (SD 8), 111 (58%) were female, and median duration of the condition was 7.0 months. 148 (77%) out of the 191 patients responded to all items in the questionnaire. The numbers of respondents for each item with mean scores and 95% confidence intervals for the means are given in Figure Correlation between the subscales was 0.73. Agreement between the subscale scores is visualized in a Bland-Altman scatterplot Figure . The difResults are based on the 148 patients who responded to all items in the questionnaire. The data met the Kaiser-Meyer-Olkin Measure and Bartlett's Test of Sphericity criteria for factor analysis. A one-factor solution explained 48%, a two-factor solution 57% and a three-factor solution 64% of the total variance. Using the eigenvalue criterion, two factors were extracted. Eigenvalues of initial factors are given in a scree plot in FigurThe total proportions of variance for each item explained by the two extracted factors are given in Table According to the rotated two-factor solution, 33% of the total variance was explained by the first factor and 24% by the second factor. Individual item loadings for these factors are given in Table The factor structure identified in this study does not support the original division of the SPADI since the two extracted factors do not seem to delineate clearly between pain and disability subscales. The questionnaire clearly asks the patient to report pain in the first section and difficulty in the last, but it is unclear if the difference is appreciated by the patients. The factor structure revealed in this study is in line with previous reports on the construct validity of the SPADI.Region-specific scales used in rheumatology or orthopedics tend to include items that refer to pain and various aspects of limited functioning associated with activities of daily living. For some scales, the association between pain and function has been shown to be weak, while for others it seems to be stronger . It has Critical to the analysis of the factor structure of a scale is deciding the number of factors to extract before rotation. In this study, two initial factors were extracted according to the eigenvalue criterion, a result that would seem to fit the number of constructs addressed in SPADI.From a biomechanical perspective, it is tempting to label the first factor in the rotated solution "Pain interference" and the second factor "Functional limitation". Patients with adhesive capsulitis in the active stage experience an aggravation of pain when the arm is moved towards the limits of range-of-motion. The disability items that load on the first factor involve movements near (or beyond) end-range of shoulder motion in these patients. Hence it is not surprising that some "difficult" items in the disability section may load on pain. The interpretation would be that disability subscale scores depend on both pain interference and functional limitation.The more pragmatic researcher might prefer to view both factors as "Pain interference" factors, the difference between them being pain interference with higher and lower demand activities, respectively. Variability in item differentiation may reflect clinical phenomena, but interpretational and psychological issues may be as relevant. Considerations regarding scoring procedures also apply.Internal consistency was slightly lower than reported by previous researchers. Cronbach alpha was 0,90 for the total score, compared to Roach 0.95 , Roddey Inter-subscale correlation 0.73) was in line with previous findings (Roach 0.87 , Placzek3 was in The results of this study largely conform with the reports of Roach et al. , PlaczekIt is our impression that the SPADI should be viewed as essentially unidimensional in this study population of shoulder capsulitis outpatients. Patients consider pain to be an essential part of what makes shoulder-related activities difficult, and as a consequence subscale scores tend to reflect the same construct.The authors declare that they have no competing interests.EKT, NGJ and EB–H designed the study. EKT, OME, NGJ and EB–H collected the data. EKT and LS performed the statistical analysis. EKT drafted the manuscript with contributions from LS, OME, NGJ and EB–H. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

Many neurodegenerative diseases are characterized by the conformational change of normal self-proteins into amyloidogenic, pathological conformers, which share structural properties such as high β-sheet content and resistance to degradation. The most common is Alzheimer's disease (AD) where the normal soluble amyloid β (sAβ) peptide is converted into highly toxic oligomeric Aβ and fibrillar Aβ that deposits as neuritic plaques and congophilic angiopathy. Currently, there is no highly effective treatment for AD, but immunotherapy is emerging as a potential disease modifying intervention. A major problem with most active and passive immunization approaches for AD is that both the normal sAβ and pathogenic forms are equally targeted with the potential of autoimmune inflammation. In order to avoid this pitfall, we have developed a novel immunomodulatory method that specifically targets the pathological conformations, by immunizing with polymerized British amyloidosis (pABri) related peptide which has no sequence homology to Aβ or other human proteins. We show that the pABri peptide through conformational mimicry induces a humoral immune response not only to the toxic Aβ in APP/PS1 AD transgenic mice but also to paired helical filaments as shown on AD human tissue samples. Treated APP/PS1 mice had a cognitive benefit compared to controls (p<0.0001), associated with a reduction in the amyloid burden (p = 0.0001) and Aβ40/42 levels, as well as reduced Aβ oligomer levels. This type of immunomodulation has the potential to be a universal β-sheet disrupter, which could be useful for the prevention or treatment of a wide range of neurodegenerative diseases. The diagnostic neuropathological lesions of AD are the accumulation of amyloid β (Aβ) as neuritic plaques and congophilic angiopathy, as well as aggregation of abnormally phosphorylated tau in the form of neurofibrillary tangles (NFTs) In the present study we sought to develop therapeutic immunomodulation through a conformation selective active immunization approach and test it therapeutically in an AD mouse model. This is an approach, which to our knowledge has not been tried previously. In this novel active immunomodulation approach, we used a polymerized British amyloidosis (ABri) related peptide in a predominantly β-sheet, oligomeric form. ABri is a rare form of familial human amyloidosis associated with a missense mutation in a stop codon resulting in the transcription of an intronic sequence, leading to production of a highly amyloidogenic protein with a carboxyl terminus that has no sequence homology to any other native human protein, including Aβ The 13 residue peptide corresponding to the carboxyl terminus of ABri was synthesized on an ABI 430A peptide synthesizer at the Keck peptide synthesis facility at Yale University, CT, using a Vydac C18 preparative column, 2.5×30 cm . Standard protocols for tBOC (tert-butyloxycarbonyl) chemistry were used. The peptide was subsequently cleaved from the resins using hydrofluoric acid and purified by high-pressure liquid chromatography (HPLC) on a Vydac C18 preparative column using linear gradients from 0–70% of acetonitrile in 0.1% trifluoroacetic acid. Mass spectroscopy of the lyophilized end-product was used to verify the expected molecular weight.In order to make the 13 residue ABri peptide immunogenic and to potentially ensure a conformation specific immune response, the peptide was first subjected to controlled polymerization using the following protocol: The peptide was dissolved at 3 mg/ml, in 100 mM borate buffer saline (BBS), pH 7.4. Fresh 1% glutaraldehyde in BBS was prepared and added to the peptide to a final 5 mM glutaraldehyde concentration and incubated in an Eppendorf block shaker at 800 rpm and 56°C for 16 hrs. The solution was then quenched with 0.5 M glycine to make the solution 100 mM in glycine. After five minutes the solution was diluted 1∶3 with BBS, dialyzed against 2 mM BBS overnight at 4°C, aliquoted and lyophilized. To determine the degree of aggregation the original monomeric ABri peptide and polymerized ABri peptide (pABri) were electrophoresed on 12.5% SDS-polyacrylamide Tris-tricine gels under reducing conditions. Western blots were performed with a mouse anti-ABri polyclonal Ab 2O was added to the sample and it was homogenized again. The homogenized material was centrifuged at 3,500 rpm in a Beckman GPR centrifuge and 6 ml aliquots of the supernatant were each layered over 1 ml TBS/0.1%SB3-14 and centrifuged in an Optima Max ultracentrifuge at 75,000 rpm for 2 hours at 20°C. Each pellet was resuspended by sonication in1 ml of 10%NaCl in TBS/0.1%SB3-14, followed by the addition of 6 ml of 10%NaCl in TBS/0.1%SB3-14 and centrifuged at 75,000 rpm for 1.5 hours at 20°C. The pellets were sonicated in 1 ml of 10%NaCl in TBS/0.1%SB3-14 followed by the addition of 6 ml of 10%NaCl in TBS/0.1%SB3-14, layered over 1 ml of 20% sucrose in 10%NaCl TBS/0.1%SB3-14 and centrifuged at 75,000 rpm for 1.5 hours at 20°C. The final pellets were resuspended in TBS/0.1%SB3-14 by sonication prior to use.PHF were purified from the brain of a subject from the New York University Alzheimer's Disease Center brain bank, who fulfilled the National Institute on Aging-Reagan criteria for AD at autopsy by using a modification of a method previously reported K670N/M671L/PS1 M146L (APP/PS1) Tg mice Animal studies were approved by the NYU School of Medicine Institutional Animal Care and Use Committee (protocol 070503-03) and were consistent with the recommendations of the American Veterinary Association. The pABri peptide was dissolved in sterile saline at 1 mg/ml and mixed 1∶1 with Aluminum Hydroxide (Alum) adjuvant . Each mouse received a weekly subcutaneous injection of 100 µl of the preparation for 4 weeks followed by an inoculation a month later and two subsequent bimonthly injections. The last three inoculations used 25 µg of pABri per animal and the ratio of saline to alum ratio was changed to 9∶1. Two groups of 15 APPSensorimotor and cognitive testing were done as previously described A Hamilton-Kinder Smart-frame Photobeam System was used to make a computerized recording of animal activity over a designated period of time. Exploratory locomotor activity is recorded in a circular open field activity chamber measuring (70×70 cm). A video camera mounted above the chamber automatically recorded horizontal movements in the open field in each dimension . Total distance was measured in centimeters (cm) traveled and is defined as sequential movement interruptions of the animal measured relative to the background. The duration of the behavior was timed for 15 min. Results were reported based on distance traveled (cm), mean resting time, and maximum velocity of the animal.This task tests balance and general motor coordination and function integration. Mice were assessed by measuring their ability to traverse a graded narrow wooden beam to reach a goal box specifically examining hind limb function. The mice were placed on a 1.1 cm wide beam 50.8 cm long suspended 30 cm above a padded surface by two identical columns. Attached at each end of the beam was a shaded goal box. Mice were placed on the beam in a perpendicular orientation to habituate, and were then monitored for a maximum of 60 sec. The number of foot slips each mouse has before falling or reaching the goal box was recorded for each of three successive trials. The average foot slips for all four trials was calculated and recorded. Errors are defined as foot slips and recorded both numerically and using Feeney scores. To prevent injury from falling, a soft foam cushion was always kept underneath the beam. Animals that fell off were placed back in their position prior to the fall.The animal was placed onto the rod (diameter 3.6 cm) apparatus to assess differences in motor coordination and balance by measuring fore- and hind limb motor coordination and balance . This procedure was designed to assess motor behavior without a practice confound. The animals were habituated to the apparatus by receiving training sessions of two trials, sufficient to reach a baseline level of performance. Then the mice were tested a further 3 times, with increasing speed. During habituation, the rotor rod was set at 1.0 rpm, which was gradually raised every 30 sec, and was also wiped clean with 30% ethanol solution after each session. A soft foam cushion was placed beneath the apparatus to prevent potential injury from falling. Each animal was tested for three sessions, with each session separated by 15 min, and measures were taken for latency to fall or invert (by clinging) from the top of the rotating barrel.Spatial learning was evaluated using an eight-arm radial maze with a water well at the end of each arm. Clear Plexiglas guillotine doors, operated by a remote pulley system, controlled access to the arms from a central area from which the animals entered and exited the apparatus. After 4 days of adaptation to the maze, water-restricted mice (2 h daily access to water) were given one training session per day for ten consecutive days. We use this relatively long adaptation period as we have found that these Tg AD mice tend to be very anxious and will not run the maze well without adaptation Antibody levels were determined in duplicate on 1∶100 dilutions of plasma using ELISA as described previously 2×800 µm2, and Aβ deposit load was measured in 20 cortical frames per mouse (640×480 µm2 each) chosen randomly. The threshold of the Aβ immunoreactive areas is set so that areas of <5 µm in diameter are not counted. This is done so that small artifactual areas of staining are not counted and intra-neuronal immunoreactivity is also not counted. With the latter caveat, the Aβ burden is defined as the percentage of area in the measurement field occupied by reaction product.Mice were anesthetized with sodium pentobarbital , perfused transaortically with phosphate buffer, and the brains processed as described previously GFAP staining was performed with a primary antibody diluent composed of 0.3% Triton X-100, 0.1% sodium azide, 0.01% bacitracin, 1% bovine serum albumin (BSA), and 10% normal goat serum in PBS, and secondary biotinylated goat anti-rabbit antibody (Vector) reacted for 1 h at 1∶1000 dilution. CD11b immunohistochemistry was performed similarly to that for GFAP staining except that the secondary antibody was goat anti-rat (Vector) diluted 1∶1000. Reactive astrocytosis (GFAP immunoreactivity) was rated on a scale of 0–4. The rating was based on a semiquantitative analysis of the extent of GFAP immuoreactivity (number of GFAP immunoreactive cells and complexity of astrocytic branching), as we have previously published Plasma from vaccinated mice with the highest titer to Aβ1-42 and PHF, as well as the pre-immune (T0) plasma from the same mice (as a control), was used for immunostaining of human tissue. Staining was performed on 8 µm deparaffinzed sections of temporal cortex. Tissue samples were of subjects from the New York University Alzheimer's Disease Center Brain Bank, who fulfilled the National Institute on Aging-Reagan criteria for AD or were age matched controls with no AD related pathology (or other neuropathology) at autopsy. Selected series were double-immunostained with pooled plasma from pABri immunized Tg mice and either PHF-1 mAb (Sigma). The mixture was let stand at room temperature until the solvent was evaporated, and 1 mL of 50 mM TRIS pH 7.2 was added under sterile conditions. The mixture was kept at room temperature for month until clear fibrils could be seen. Electron microscopic examination of this preparation demonstrated it to be a mixture of mainly Aβ1-42 fibrils, and some oligomers (data not shown). The mixture was thoroughly vortexed before aliquoting for absorption. For absorption, 1 mL of a 1∶100 dilution in TBS of an immune serum from successfully vaccinated animals was mixed with 200 µL of the aggregated Aβ 1-42, rotated for 1 hour at room temperature and then overnight (for at least 16 hours) at 4°C. The mixture was centrifuged at 4°C, at 14,000×g for 15 minutes and the supernatant separated and used as absorbed serum for immunohistochemical staining as described above. The pellet composed of aggregated Aβ1-42 was washed twice with 0.5 mL of TBS, centrifuged at 14,000× g for 10 minutes and the supernatants pooled and marked as washes. The pellet was then incubated twice for 5 minutes with 300 µL aliquots of 0.1 M glycine, pH 2.5, vortexed and centrifuged for 10 minutes at 14,000×g. The supernatants were pooled and immediately brought to pH 7.4 with a 1 M TRIS, pH 10 solution, and used as eluted antibodies for immunostaining as described above.2HPO4, 0.05% NaN3), aliquoted, flash-frozen on dry ice and stored at −80°C until used for Aβ measurements.Extraction of Aβ from brain tissue was performed as described The total and soluble Aβ levels were measured using a combination of mouse monoclonal antibody 6E10 (specific to an epitope present on amino acid residues 1 to 16 of Aβ) and two different rabbit polyclonal antibodies specific for Aβ40 (R162) and Aβ42 (R165), in a double-antibody sandwich ELISA as described previously For Western immunoblot analysis, 10% w/v brain homogenates were centrifuged at 25,000 g for 10 min at 4°C, and the supernatants were transferred to clean tubes and stored as previously described posthoc test. Differences between groups in the amyloid burden, Aβ levels within the brain and levels of oligomers, were analyzed using a Student's unpaired two-tailed t-test. Data from the GFAP and CD11b immunostaining quantitation were analyzed by one-way ANOVA followed by a Neuman-Keuls posthoc test. Statistical analysis was done using GraphPad Prism version 5.0 .Data from the radial arm maze were analyzed by two-way repeated measures ANOVA followed by a Neuman-Keuls As determined by SDS-PAGE and Western blotting the freshly dissolved ABri peptide is mainly monomeric with some lower order aggregates of dimers and tetramers , lane 1.In vehicle control mice there were no significant titers to pABri, Aβ1-42 or purified PHF . In the In order to verify that cognitive testing was not confounded by differences in sensorimotor abilities in the ABri vaccinated versus control mice, sensorimotor testing was conducted first. There were no significant difference between the groups in locomotor activity see , traversRadial arm maze cognitive testing showed there were statistically significant differences between the untreated control Tg mice versus the treated Tg mice and wild-type controls . By two-There were significant reductions in the amyloid burden (% area occupied by 4G8/6E10 immunoreactivity) in both the cortex (85% reduction) and hippocampus (65% reduction); p = 0.0001 and p = 0.0002, respectively see . The amySignificant reductions in the biochemically extracted Aβ40 and Aβ42 levels were also noted . In the Plasma (T6) from pABri vaccinated Tg mice gave no immunolabeling in normal, aged brain sections . In AD tt-test, p<0.05; Soluble oligomeric Aβ ligands may account for memory loss and AD neuropathology, thus presenting a significant therapeutic target GFAP immunoreactivity in the cortex and hippocampous in control Tg mice versus the treated Tg mice did not differ significantly, although there was a non-statistically significant trend for a reduction of GFAP immunoreactivity in the cortex of treated Tg mice . As expeCD11b immunostaining was performed. CD11b is a well-established microglial and mononuclear phagocyte marker pABri treated mice did not differ significantly by posthoc testing from wild-type controls, although there was a clear trend for wild-type mice to have less CD11b immunoreactivity. As expected, wild-type mice differed significantly from Tg controls (Neuman-Keuls posthoc test p<0.05 in the hippocampus and p<0.01 in the cortex).In the present study we demonstrate for the first time that immunization in an AD Tg mouse model with a foreign peptide in a polymerized, β-sheet rich form is able through conformational mimicry to induce an immune response to both Aβ42 and PHF. The immunogen we used corresponds to the 13 amino acids of the carboxyl end of the amyloid that is deposited in British amyloidosis, where a missense mutation in a stop codon results in the transcription of a novel intronic sequence The majority of past active and passive immunization studies in mouse models and all the past trials in humans have used an approach where both the normal conformer (sAβ) and the pathological conformer (Aβ) are targeted. This is an important short coming as interfering with normal sAβ will inhibit its physiological functions such as neuroprotection, modulation of long term potentiation and innate immunity Another significant drawback of the current immunization approaches tested in humans is that targeting only Aβ related pathology significantly reduces Aβ plaques without evidence of a corresponding significant behavioral rescue in results presented so far In summary we documented a novel active immunization approach using pABri in a β-sheet rich conformation that targets an abnormal conformation that is shared by aggregated/oligomeric Aβ and PHFs. We hypothesize that this type of immunomodulatory approach may produce interference or disruption of β-sheet structures in multiple neurodegenerative diseases associated with pathologic protein conformers.

Patients with baseline Ntx values ⩾100 nmol mmol−1 creatinine (representing clearly accelerated bone resorption) were 19.48 times more likely to experience a skeletal-related event/death during the first 3 months than those with Ntx <100 (P<0.001). In a multivariate logistic regression model, Ntx was highly predictive for events/death. This study is the first to indicate a strong correlation between the rate of bone resorption and the frequency of skeletal complications in metastatic bone disease. N-telopeptide appears useful in the prediction of patients most likely to experience skeletal complications and thus benefit from bisphosphonate treatment.Relationships between the rate of bone resorption (measured by urinary N-telopeptide (Ntx) excretion) and a range of skeletal complications have been evaluated in patients with metastatic bone disease. A total of 121 patients had monthly measurements of Ntx during treatment with bisphosphonates. All skeletal-related events, plus hospital admissions for bone pain and death during the period of observation, were recorded. Data were available for 121 patients over the first 3-month period of monitoring (0–3 months) and 95 patients over the second 3-month period (4–6 months). N-telopeptide levels were correlated with the number of skeletal-related events and/or death ( Metastatic bone disease presents a major challenge in the management of several common cancers. Tumours of the breast and prostate are particularly likely to metastasise to bone, with up to 70% of patients dying with advanced metastatic disease showing evidence of skeletal involvement at post mortem . SkeletaMetastatic bone disease is associated with a disruption of the normal coupling between bone formation and resorption, typically resulting in net osteolysis leading to loss of structural integrity and subsequent skeletal events. Bone-targeted drug therapy, principally using the bisphosphonates, has been aimed at disruption of this osteoclast mediated bone resorption. Trials carried out over the last decade have provided overwhelming evidence supporting the use of bisphosphonates in reducing the morbidity of metastatic bone disease from across a range of tumour types (Type I collagen is the predominant protein in bone and its breakdown products are being increasingly investigated as markers of bone resorption. A number of studies have shown that collagen breakdown markers are correlated with the presence of metastatic disease. N-telopeptide (Ntx) is a peptide fragment of the N-terminus of type I collagen, and is relatively easy to measure. It appears to be one of the most potentially useful of these markers in metastatic bone disease , were prospectively studied in the Cancer Research Centre in Sheffield, a regional referral centre for patients with bone metastases. All patients were over 18 years of age and had signed informed consent according to local guidelines with the approval of the appropriate Ethics Committee. Patients with lytic, sclerotic and mixed lesions as defined radiologically were included. Patient characteristics are shown in Measurements of the bone resorption marker Ntx were carried out in all 121 patients. The date of the first Ntx measurement was recorded for each patient as the baseline value (month zero). Further measurements were taken at approximately monthly intervals. All 121 patients had Ntx measurements available over at least 3 months or until death if this occurred first. In all, 95 patients were evaluable for at least 6 months. Where possible, patients were followed up for a maximum of 24 months, but the number of patients available to the study decreased considerably over the later months due to progression of disease or return to a routine clinic outside Sheffield.In all, 29 patients also had extra-skeletal metastases at baseline, most commonly affecting the liver, but including lung and lymph node involvement. All patients in the study received bisphosphonate therapy and 93 patients had not received any such treatment before the first Ntx measurement. Most patients (75) were treated with oral clodronate (1600 mg); other treatments included IV pamidronate, 90 mg (29 patients), IV clodronate, 1500 mg (eight patients) and IV zoledronic acid, 4 mg (nine patients). Patients were treated with endocrine or chemotherapy treatments as clinically indicated.The bone resorption was assessed approximately monthly by measurement of urinary crosslinks in an early morning, second voided urine sample, collected on the day of outpatient attendance and stored at −20°C for later analysis. These measurements were made using a chemiluminescence assay for the Ntx using a Vitros ECI analyser and female controls in the regional population, not known to have bone disease or to be taking drugs known to affect bone metabolism. None had had recent fractures. The resultant Ntx normal range used in our centre was: male 16–107 nmol mmol−1), spinal cord or nerve root compression, symptomatic radiographically confirmed pathological fractures, orthopaedic surgery to bone, hospital admissions for control of bone pain and/or death due to metastatic bone disease. It was considered important to include death as a skeletal complication, as patients with the worst prognosis were more likely to die early either before or as a consequence of a particularly catastrophic skeletal event. Routine plain radiographs were not obtained, therefore excluding the detection of asymptomatic fractures. As skeletal-related events may be inter-related , the primary, more conservative analysis took into account only the first event in any 21-day period. However, the total number of events, not taking account of the 21-day window, was also recorded.For all patients, any skeletal complications occurring after the initial Ntx measurement were recorded. Skeletal complications were defined as radiotherapy to bone, hypercalcaemia . Since this study was primarily concerned with relationships to one or more events, the remainder of the analyses refer to the data with the 21-day window applied.r) is 0.62 (P<0.001). A similar plot for the 0–3-month period using the mean Ntx during the first 3 months instead of Ntx at baseline was also strongly correlated with the number of skeletal complications . However, the single baseline Ntx is more clinically useful as it enables prediction for events over the subsequent three months.Figure 2A−1 creatinine, corresponding approximately to the normal male and premenopausal female levels; 50–100 nmol mol−1 creatinine, corresponding closely to the upper normal range for postmenopausal women; 100–200 nmol mol−1 creatinine, defining a group with moderately accelerated bone resorption; and >200 nmol mol−1 creatinine, representing very rapid bone resorption. P<0.001; test of association). Although the data are not shown, a significant association between baseline Ntx and the occurrence of a skeletal complication was also observed (P<0.001) when death was not included as a complication.Interpretation of the predictive value of Ntx as a continuous variable is difficult, and therefore the Ntx values were grouped. Four groups of Ntx values were defined: 0–50 nmol molP=0.80, 0.84 and 0.76, respectively), while baseline Ntx was highly significant (P<0.001), both in the unadjusted and the adjusted analyses. Patients with a baseline Ntx >100 nmol mmol−1 creatinine were 19.48 times more likely to experience a complication over the subsequent 3 months than patients with ‘normal’ baseline Ntx values (<100 nmol mmol−1 creatinine).Both univariate and multivariate logistic regression models were fitted to the data with any skeletal complication as the dependent variable. With univariate analysis based on the baseline Ntx value, the model correctly predicted 41 (84%) of the 49 patients who would experience a skeletal complication over the 3-month period. In the multivariate analysis, the factors included in the model were age, sex, cancer type and the categorical values of baseline Ntx. Again, the model correctly predicted 41 (84%) of the 49 patients with skeletal complications. The factors age, sex and cancer type did not significantly affect the chances of a patient having a skeletal complication (P<0.001), and the multivariate logistic regression model correctly predicted 28 (80%) of the 35 patients who experienced a skeletal complication during months 0–3. Age, sex and cancer type did not contribute to the multivariate model .In all, 28 patients had received bisphosphonate therapy prior to monitoring of Ntx levels in this study. However, the associations described above between baseline Ntx and skeletal complications were very similar when these patients were excluded. The adjusted odds ratios for the 93 bisphosphonate naïve patients are shown in P<0.001). A similar plot for the data using the mean Ntx measurements from months 4, 5 and 6, instead of Ntx at 3 months, also showed a highly significant relationship.P<0.001). As in the initial 3-month time period, patients with a baseline Ntx>100 nmol/mmol creatinine were at significantly higher risk of subsequent complications. The univariate and multivariate logistic regression models correctly predicted 20 (65%) and 18 (58%) of the 31 patients, respectively, who experienced a skeletal complication during months 4–6. The factors age, sex and cancer type were not statistically significant in the multivariate logistic regression model .−1 creatinine and who therefore had scope for a biochemical response defined as >50% reduction in Ntx level. Progression was defined as >50% increase and no change as between 50% reduction and 50% increase and 11 out of 82 (13%) of the 3-month periods of patient observation with and without an event/death, respectively.For patients monitored for more than 6 months, the numbers of patients for whom results were available decreased progressively from 47 for 7–9 months to three for 22–24 months. There were relatively few skeletal complications and the majority of patients had Ntx values in the normal range, reflecting the previous observation that elevated Ntx is associated with poor prognosis. . The beneficial effects of anticancer treatments and bisphosphonate therapy, as well as the attrition of the worst prognosis patients, probably explain the lower event rate in the second (4–6 months) time period.−1 creatinine levels of Ntx, respectively. A more cost-effective use of bisphosphonates might be to reserve them until patients have Ntx levels above 100 nmol mmol−1 creatinine and adjust the dose and schedule to maintain a normal rate of bone resorption.Overall, bisphosphonates reduce the frequency of skeletal events by 25–40% and prioP=0.07). When disease progression was included in the analysis in the above study, the association with Ntx did reach statistical significance (P=0.03). Although these data represent only a small number of patients, they also suggested that normalisation of bone resorption should be the goal in reducing fracture rate.The current work is consistent with the study by The conclusions of the current study in patients with metastatic bone disease parallel those from studies of bone markers in bone loss due to osteoporosis. In one of the most comprehensive studies, nine bone turnover markers were measured in 375 women aged between 50 and 85 years and serum measurement avoids complex urine collection and creatinine correction. A recent study of ibandronate in multiple myeloma (Large, multicentre trials in metastatic bone disease with the potent bisphosphonate, zoledronic acid have recently been completed. Using the principles and concepts developed in the present study, we are currently analysing the marker and skeletal event data from these trials, to further assess the role of markers in prediction of skeletal complications and determining its value in routine clinical practice.Further work will also be necessary to demonstrate that patients who normalise their Ntx level following bisphosphonate therapy, experience fewer skeletal events than those who do not normalise. Nevertheless, the clear conclusion of the present work that Ntx levels in the normal range are associated with a much-reduced incidence of skeletal events, together with corresponding previous findings for pain and quality of life, provide strong evidence that normalisation of bone resorption should be a major aim of therapy. This also adds weight to the argument that bone resorption measurements should become a routine part of management of patients with metastatic bone disease.

The advent of Internet-based self-help systems for common mental disorders has generated a need for quick ways to triage would-be users to systems appropriate for their disorders. This need can be met by using brief online screening questionnaires, which can also be quickly used to screen patients prior to consultation with a GP.To test and enhance the validity of the Web Screening Questionnaire (WSQ) to screen for: depressive disorder, alcohol abuse/dependence, GAD, PTSD, social phobia, panic disorder, agoraphobia, specific phobia, and OCD.A total of 502 subjects (aged 18 - 80) answered the WSQ and 9 other questionnaires on the Internet. Of these 502, 157 were assessed for DSM-IV-disorders by phone in a WHO Composite International Diagnostic Interview with a CIDI-trained interviewer.P < .001) higher means on the corresponding validating questionnaire than negative WSQ “diagnosis”. WSQ sensitivity was 0.72 - 1.00 and specificity was 0.44 - 0.77 after replacing three items and adding one question for specific phobia. The Areas Under the Curve (AUCs) of the WSQ’s items with scaled responses were comparable to AUCs of longer questionnaires.Positive WSQ “diagnosis” had significantly (The WSQ screens appropriately for common mental disorders. While the WSQ screens out negatives well, it also yields a high number of false positives. The thriving development of Internet-based self-help aids for partThe screening must be brief, as subjects will undergo screening more readily if it is short, quick , and easParticipants were recruited (between May and December 2007) from the general Dutch population by using Internet banners . The advertisements linked to a Web page containing information about common mental disorders, Internet treatment and this study, an application form, and a link to the questionnaires. Subjects were asked to input their name and email address, so they could be identified and added to the data pool only once.We specifically targeted adults (18 years of age or older) with Internet access and who felt anxious, depressed, or thought of themselves as drinking too much alcohol. We targeted a population with a high rate of common mental disorders as the kind likely to use the WSQ in the future. Since this population can only illuminate false negative and true positive rates, we needed controls to test those rates. Therefore, we also recruited 20 undergraduate psychology students who were not required to have symptoms, using banners at the VU University’s students’ Web page seeking participants for VU studies.We excluded people reporting a high suicide risk ; they were advised to contact their GP. To raise the response rate, participants were told in advance that completers of the screening questionnaires would be offered a self-help book for common mental problems. Students received academic credit for participating. The study protocol was approved by the Medical Ethics Committee at the VU Medical Centre in Amsterdam, Netherlands.Our study tested the WSQ’s validity and consisted of two parts :Completion of 10 sets of questions: Internet demographic questions, the WSQ, and other questionnaires for common mental disorders: Center for Epidemiological Studies Depression scale (CES-D ), GeneraA DSM-IV-diagnostic phone interview with a Composite International Diagnostic Interview (CIDI)-trained interviewer version 2.1 ) to asseIn all, 687 people applied for the study, of whom 185 (27%) were excluded because they represented a high suicide risk (n = 5); there was no written informed consent (n = 22); or they refused to participate (n = 158). This left 502 participants, of whom 389 consented to a diagnostic phone interview, but 232 (60%) of those 389 either could not be contacted (n = 227) or refused (n = 5), leaving 157 participants who were phoned by a CIDI-trained interviewer within a mean of 13 days.If participants had never experienced a traumatic event, they skipped the IES; if they had never drunk alcohol, they skipped the AUDIT; and if they had never suffered a panic attack, they skipped the PDSS-SR. Those who completed the screening questionnaires and gave informed consent entered the study. The WSQ for common mental disorders has 15 sWSQ Q2 for depression, from CIDI ,WSQ Q4, 8, 9, 10, and 12 , andWSQ Q13 and 14 .Three questions of the original WSQ reached either low specificity or low sensitivity. To enhance validity, we used logistic regression analysis to determine whether other items from appropriate questionnaires could replace these WSQ-items. We amended three questions using items for GAD for panThe Dutch version of the CES-D has 20 sWe translated the GAD-7 into DutThe Dutch version of the PDSS self-repThe Dutch version of the FQ detects The IES assessesWe used the Dutch 10-item severity subscale of the YBOCS ,17. EachThe Dutch version of WHO’s self-rated AUDIT identifiWe used the Lifetime version 2.1 of the CIDI in its DTo establish whether WSQ scores differed significantly between subjects with positive and with negative screen results, we conducted t-tests on the mean and standard deviation of each screening instrument separately. In the sub-sample that had a diagnostic interview, we performed chi-square tests to ascertain whether WSQ scores differed between subjects with and without DSM-IV disorders.We calculated sensitivity and specificity, and positive and negative predictive values, for each WSQ subscale regarding its corresponding DSM-IV disorder . Sensitivity is the probability that a person who has a disorder is screen positive. Specificity is the probability that a person not suffering from a disorder is screen negative. There is no consensus of what levels of sensitivity and specificity are acceptable, as they depend on the test’s aim, costs, and benefits . The WSQFor WSQ questions which turned out to have unacceptable sensitivity or specificity, we replaced them with relevant items from the appropriate screening questionnaire. To find which items best predicted the chance of detecting a diagnosis, we used logistic regression analyses (Forward Likelihood Ratio method). We replaced items only if they improved validity. We calculated the Area Under the Curve (AUC) for the WSQ’s scaled and dichotomous response options and its appropriate screening questionnaires. The AUC (the sum of sensitivity versus [1 – ] specificity) measures a scale’s accuracy; it equals the probability that a randomly chosen case will score higher than a randomly chosen non-case . AUCs ofOur analyses used diagnoses reached within the last 6 months. MDD, Dyst, and MinD were combined into the category depressive disorder. For all analyses we used SPSS version 15.0 for Windows.The total sample (N = 502) had a mean age of 43 years , and 285 (57%) of the subjects were female. Of the 157 subjects who had a CIDI interview, the mean age was 43 . Of these, 89 (57%) were female, and 107 (68%) subjects met DSM-IV criteria for any current depressive disorder, anxiety disorder, and/or alcohol abuse/dependence. A total of 67 (43%) subjects had more than one diagnosis .P < .001) on the corresponding validating questionnaire than those who scored “No” for that WSQ “diagnosis”. For the three WSQ subscales, GAD, OCD, and panic, validity was below threshold levels of 0.70 for sensitivity and 0.40 for specificity, so we replaced those with relevant items from the appropriate screening questionnaires . This improved sensitivity or specificity. The WSQ subscale-specific phobia had an unacceptably low sensitivity (0.60), but we did not replace it with an item from the appropriate screening questionnaire as that did not improve sensitivity or specificity.Based on the log-likelihood ratio statistic, using logistic regression analyses, we added three categories of the specific phobia question, “Are you scared of …?”. These categories were (1) animals, (2) specific situations, and (3) medical issues, which improved the sensitivity of the WSQ subscale for specific phobia but not for specificity .P < .001 level except for specific phobia (P = .003). Compared to the corresponding CIDI DSM-IV diagnoses, the AUC for the WSQ subscales with scaled responses were similar to the AUC of the longer questionnaires, ranging from an AUC of 0.76 for the WSQ subscale panic versus an AUC of 0.70 of the PDSS-SR, to an AUC of 0.81 for the WSQ subscale OCD versus an AUC of 0.85 for the YBOCS. The AUC for the dichotomous WSQ’s subscales of panic with agoraphobia and agoraphobia were similar to the AUC of the longer, scaled questionnaires , but not for the WSQ dichotomous subscales of depression, social phobia, and PTSD .As expected, students compared to non-students had significantly lower scores on the WSQ subscales for depression (P = .004), alcohol (P < .001), GAD (P < .001), OCD (P < .001), panic (P < .001), and panic with agoraphobia (P = .004).Demographic variables did not differ significantly between subjects who had a CIDI diagnostic interview and those who did not. However, those who had a CIDI interview scored significantly lower on one WSQ subscale , on the CES-D (P = .05), and on the FQ social-phobia subscale (P = .03).It takes about two minutes to complete the WSQ to detect common mental disorders. The WSQ quickly detects clinically-relevant mood, anxiety, and alcohol-related problems and so can guide Internet users to Internet-self-help modules appropriate for their problem, or quickly screen patients prior to consultation with a GP. This measure can also be used in more homogeneous samples to screen out people with co-morbid disorders. The WSQ turned out to be a valid screener for social phobia, panic disorder with agoraphobia, agoraphobia, OCD, and alcohol abuse/dependence , and appropriate for depressive disorder, GAD, PTSD, specific phobia, and panic disorder (without agoraphobia) in our study population. Interestingly, the AUC’s of the WSQ’s scaled single items, and some of the dichotomous items, were comparable to the AUC’s of the longer questionnaires, supporting our conclusion that short questionnaires, sometimes with just one item, can be as valid as longer ones. This is in line with previous studies -43.Compared to psychometric properties of other online screening questionnaires ,10 (sensAlthough WSQ’s false positives do not have a diagnosis, they might have symptoms of depression, anxiety, or alcohol problems, since they have elevated scores on the relevant screening questionnaires.One limitation of our study is that the CIDI-diagnosis live phone interviews were not taped, so inter-rater reliability could not be calculated. Second, subjects always completed the WSQ on the Internet before the other screening questionnaires, so order effects could not be ruled out. Third, though sensitivity and specificity do not depend on prevalence of the disorders in the population, the PPV and NPV do; consequently, the values we found might not generalize to situations where prevalence is different. Fourth, it is not known how representative our self-recruited participants are of Internet self-help applicants. Fifth, subjects who had a CIDI interview had significantly less social phobia on that WSQ-subscale than those who did not, so the WSQ-social-phobia results might be less generalizable to other populations. Sixth, as described earlier, 6-month prevalence rates of DSM-IV diagnoses were used, whereas the WSQ assesses current symptoms. Ideally, the WSQ should be validated against concurrent DSM-IV diagnoses. Seventh, norms are unavailable for acceptable levels of sensitivity and specificity which depend on the test’s aim, costs, and benefits . As the Despite its limitations, the WSQ is a useful and quick Internet screening tool to detect people likely to have common mental disorders.Many false positives were found for WSQ subscales GAD, panic, specific phobia, and PTSD, while far fewer false positives were found for alcohol abuse/dependence, social phobia, panic disorder with agoraphobia, and OCD. The high rate of false positives may, for some questions, be due to a lack of clarity or classification criteria. Future research which enhances clarity of questions and classification criteria is needed to improve the predictive power of the WSQ.

To compare nondestructive in vivo and ex vivo micro-computed tomography (μCT) and ex vivo dual-energy-X-ray-absorptiometry (DXA) in characterizing mineralized cortical and trabecular bone response to prostate cancer involving the skeleton in a mouse model.In vivo μCT was performed before and 10 weeks after implantation of human prostate cancer cells (MDA-PCa-2b) or vehicle into SCID mouse femora. After resection, femora were imaged by nondestructive ex vivo specimen μCT at three voxel sizes and DXA, and then sectioned for histomorphometric analysis of mineralized bone. Bone mineral density (BMD), trabecular parameters and mineralized bone volume/total bone volume (BV/TV) were compared and correlated among imaging methods and histomorphometry. Statistical tests were considered significant if P<0.05. Ten weeks post inoculation, diaphyseal BMD increased in the femur with tumor compared to the opposite femur by all modalities . Diaphyseal BMD by in vivo μCT correlated with ex vivo 31 and 16 µm μCT and histomorphometry BV/TV . DXA BMD correlated less with bone histomorphometry and DXA did not distinguish trabeculae from cortex. By in vivo and ex vivo μCT, trabecular BMD decreased as opposed to the cortex. Unlike BMD, trabecular morphologic parameters were threshold-dependent and when using “fixed-optimal-thresholds,” all except TbTh demonstrated trabecular loss with tumor and correlated with histomorphometry .Prostate cancer involving the skeleton can elicit a host bone response that differentially affects the cortex compared to trabeculae and that can be quantified noninvasively in vivo and nondestructively ex vivo. Prostate carcinoma is the most frequently diagnosed visceral cancer and the second most common cause of cancer-related death among American men Because of the low levels of bone metastasis with prostate cancer models Dual-energy X-ray absorptiometry (DXA) is commonly used clinically to measure bone mineral density BMD μCT provides three-dimensional (3D) representations of bones and is now available at various resolutions We compared the ability of in vivo μCT, ex vivo specimen μCT, and ex vivo DXA to characterize mineralized cortex and trabeculae in a mouse model of prostate cancer involving bone.MDA-PCa-2b human prostate cancer cells were grown Eight-week-old male severe combined immunodeficient (SCID) mice (n = 14) were purchased from Charles River Laboratories and housed in specific-pathogen-free conditions. They were cared for in accordance with guidelines set forth by the Association for Assessment and Accreditation of Laboratory Animal Care and the U.S. Public Health Service Policy on Humane Care and Use of Laboratory Animals. The University of Texas M. D. Anderson Cancer Center's Institutional Animal Care and Use Committee approved all studies.5 MDA-PCa-2b cells For in vivo imaging procedures, SCID mice were anesthetized by inhalation of 2% isoflurane. The femora (n = 14 mice) were first scanned using in vivo μCT as described below. After baseline imaging, 5×10Ten weeks after tumor inoculation, the femora were again imaged in vivo by μCT (n = 11). The animals were euthanized and the femora were removed. The disarticulated femora without muscle were fixed in formalin and stored in 10% ethanol for ex vivo specimen μCT and ex vivo DXA. The femora were then processed for bone histomorphometry.For in vivo scans, SCID mice were imaged supine using a μCT scanner at a 91-µm isotropic voxel size . The scanner has a fixed tungsten anode with a focal spot size of 50×30 µm. Images of the femora were acquired at an isotropic voxel size of 91×91×91 µm using the following scan parameters: 80 kVp, 450 µA, 100 msec per frame, and 3 frames per view.3) of each femoral diaphysis. For this calculation, a standard measuring cylinder (2.5×2.5×5 mm) was placed so that its bottom was 1.5 mm above the bone's growth plate. BMD was calculated for the right and left femora, and the absolute difference in BMD values between the right and left femora was determined. Another cylinder (1.5×1.5×0.6 mm) was centered in all three planes within the metaphysis with the bottom at the beginning of the growth plate for the measurement of BMD and trabecular morphometric parameters. These parameters were measured at fixed thresholds and at automatic thresholds of mineralized bone. The BMD, TbTh, TbN, TbSp, and BV/TV obtained by μCT were correlated with the values obtained by bone histomorphometry. “Optimal threshold” was defined as the threshold that resulted in maximum correlation between the trabecular parameter by μCT and that by bone histomorphometry.A calibration standard was positioned in the field-of-scan view to enable the conversion of Hounsfield units (HU) into BMD values. MicroView software was used to view the images and calculate the BMD . This scanner has a cone-beam volume CT system that uses a tungsten source X-ray tube operating at 80 kV and 80 µA. The object in the scanner is rotated in 0.4-degree increments on a holder between the X-ray source and charge-coupled device-based detector. Each bone specimen required approximately 4 hours for data acquisition. After raw images were normalized and defective detector pixels were corrected, a low-resolution scout volume was reconstructed using a modification of the method used by Feldkamp et al. 2). Because the trabeculae were not distinguishable from cortical bone, trabeculae were not analyzed with DXA.Matched left and right femur pairs from the 11 SCID mice were scanned ex vivo in a sagittal plane using a DXA scanner . A rectangular (2.5×5 mm) region of interest that encompassed the diaphysis was placed over each femur to obtain the BMD for bone histomorphometry measurements. The three histologic sections per femur were analyzed after Von Kossa staining for mineralized bone Linear regression was performed to analyze correlations between values obtained from in vivo and ex vivo μCT, DXA, and bone histomorphometry studies using Excel software . Student's t-test (two-sided) was used to compare values between the right and left femora. Pearson's correlation coefficient was calculated for differences between imaging techniques, and Fisher's Z transformation of the correlation coefficient was employed using SAS software . For all tests, P<0.05 was considered significant.3. Ten weeks after tumor inoculation, the BMD of the femora with tumors increased (P<0.003), with a MAD of 65.91±57.6 mg/cm3. Results were concordant between in vivo μCT and ex vivo specimen μCT with voxel sizes of 31-µm and 16 µm . The variations in standard deviations are due to biologic differences in tumor growth and host response in individual animals, yet significant differences (P<0.01) were noted. Representative images show that all methods demonstrated host bone response to the prostate cancer , and TbTh (3). μCT performed at each voxel size had individual narrow ranges for best thresholds for maximum correlation of trabecular parameters when compared to bone histomorphometry and these narrow ranges overlapped for TbN, BV/TV, and TbSp. At all voxel sizes and thresholds, μCT-derived TbTh did not correlate well with TbTh by bone histomorphometry , likely because the small size of trabeculae caused volume-averaging artifacts.Because trabeculae were located primarily in the metaphysis, we focused on the metaphysis for trabecular assessments. We compared trabecular BMD and morphometric parameters obtained by in vivo or ex vivo μCT at different thresholds with bone histomorphometry. Thresholding did not affect trabecular BMD obtained using in vivo or ex vivo μCT, but did affect μCT-derived morphometric parameters such as TbN, BV/TV, TbSp (Table 2). The automatic threshold ranged from 550 to 975 HU in the left femora and 350 to 1250 HU in the right femora, and the values varied between animals and voxel sizes. Similarly, the maximum gray-scale threshold values ranged from 706 to 855 HU in the left femora and 744 to 915 HU in the right femora, and these values also varied between animals and voxel sizes. Correlations between μCT and histomorphometric TbN, BV/TV, and TbSp values were higher using fixed optimal thresholds than using automatic thresholds (Table 2). Trabecular parameters derived using optimal thresholds correlated among in vivo and ex vivo μCT (Table 4), and among in vivo or ex vivo μCT and histomorphometry (Table 2). Although we did not find good correlations between TbTh values obtained by μCT and bone histomorphometry, TbTh correlated moderately between in vivo and ex vivo μCT at 16, 31, or 8-µm voxel sizes, and among ex vivo μCT at the three voxel sizes (Table 4). Therefore, we used fixed optimal thresholds at different voxel sizes to compare trabecular parameters on μCT with those on bone histomorphometry.The automatic threshold or maximum gray-scale threshold usually did not return the optimal threshold (Table 3). The BMD of the trabeculae at the metaphyses was highly correlated between in vivo μCT and ex vivo μCT at all voxel sizes (Table 1).In vivo and ex vivo μCT demonstrated decreases in the BMD of the metaphyseal trabeculae in femora with tumors compared to control femora at all voxel sizes . With automatic or optimized thresholds, correlations of trabecular parameters by μCT and bone histomorphometry trended toward increasing as the voxel size decreased from 91 µm to 8 µm , but the correlations were low (data not shown). Ten weeks after inoculation, a significant difference in all trabecular parameters except TbTh was seen between left and right femora on in vivo μCT and ex vivo μCT at all voxel sizes using optimal thresholding, concordant with histomorphometry. There were decreases in TbN and BV/TV, and increase in TbSp in femora with tumors compared to control femora by in vivo μCT or ex vivo μCT at all voxel sizes using optimal thresholding, consistent with overall trabecular loss. This was not seen with automatic thresholding for TbN and BV/TV by in vivo μCT or ex vivo at 31 µm or with TbSp by in vivo or ex vivo μCT at any voxel size; this result demonstrates the importance of using fixed optimal thresholding instead of automatic thresholding. Fixed optimal thresholding demonstrated that prostate cancer involving bone altered trabecular morphology.Trabeculae appeared better defined with decreasing voxel size of μCT, and trabecular thinning, thickening, and loss could be identified and3.Prostate cancer involving the skeleton results in a host bone response that can be quantified by in vivo and ex vivo μCT in a mouse model. Although there was heterogeneity in the trabeculae affected by cancer , overall there was trabecular loss in femora with tumor as exemplified by decreased TbN, BV/TV, and BMD, as well as increased TbSp; in contrast, diaphyseal cortex thickened. In addition to the effect of growth factors, data with the current mouse model suggest that a likely mechanism for the findings is tumor-induced loss of trabecular bone that causes both a trabecular bone reaction and cortical thickening to stabilize the loss of mechanical strength of the bone. This may be further tested in future studies. Findings also suggest that it is important to assess both cortical bone and trabecular bone since these may be discordant, especially in cancer. This suggests that it will become important to evaluate trabecular parameters as spatial resolution of clinical CT improves to a degree that allows such assessment.We compared the abilities of three imaging methods to evaluate bone response to tumor: in vivo μCT, ex vivo specimen μCT and ex vivo DXA. All three imaging methods were able to distinguish BMD increases in the diaphyses, consisting primarily of cortical bone, of the femora with tumors. Compared to μCT-derived BMD, DXA-derived BMD had a lower coefficient of correlation with bone histomorphometry. This is consistent with findings by Barou et al. who also noted lower correlation between DXA and bone histomorphometry in a rat model In vivo or ex vivo μCT trabecular morphometric parameters correlated well with bone histomorphometry. Most μCT studies of bones have used samples from rats In contrast to assessment of BMD, where thresholding was not a factor, the choice of thresholding significantly affected the assessment of trabecular morphometric parameters. Automatic thresholding and maximum gray-scale thresholding led to variability in morphometric values between animals and the femora with and without tumors. Further, neither correlated well with trabecular parameters as assessed by histomorphometry. In comparison, correlations of morphometric trabecular parameters by histomorphometry with μCT were high using a fixed “optimal threshold”. We found that μCT at each voxel size had a separate “optimal” fixed threshold. To our knowledge, these findings have not been reported previously. Supporting our data, Ruegsegger et al. The results of this study using μCT to quantitatively characterize the mineralized component of mouse femora may be applicable to other studies of bones in small animals and humans. For example, one may evaluate bone response to strategies aimed at prevention or treatment of prostate bone metastases, primary bone tumor, or metastases from other primary tumors. The results also have the potential to be generalized to other bone models, such as metabolic bone disease.Clinical multi-slice CT scanners are approaching resolutions fine enough for assessing trabeculae. Our data imply that each voxel size used will require optimization of thresholding. Automatic thresholding or maximum gray-scale thresholding will need validation because they may be too variable to achieve consistent results clinically. A fixed optimal threshold may be superior for assessing morphometric parameters. Because 70% of the effects of metabolic bone disease are first reflected in the trabeculae and only 30% in the cortex In vivo μCT enables noninvasive, longitudinal assessment of mineralized bone. Ex vivo specimen μCT enables nondestructive assessment of mineralized bone enabling further study, for example, by histology. With appropriate thresholding, in vivo and ex vivo μCT can be used to quantify host response of both cortical and trabecular mineralized bone to prostate cancer involving the skeleton, and such a response may be different between these two mineralized bone compartments.

Timely identification of pathogens is crucial to minimize mortality in patients with severe infections. Detection of bacterial and fungal pathogens in blood by nucleic acid amplification promises to yield results faster than blood cultures (BC). We analyzed the clinical impact of a commercially available multiplex PCR system in patients with suspected sepsis.® SeptiFast® (SF) Test at a tertiary care centre. For samples with PCR-detected pathogens, the actual impact on clinical management was determined by chart review. Furthermore a comparison between the time to a positive blood culture result and the SF result, based on a fictive assumption that it was done either on a once or twice daily basis, was made.Blood samples from patients with presumed sepsis were cultured with the Bactec 9240™ system and aliquots subjected to analysis with the LightCyclerOf 101 blood samples from 77 patients, 63 (62%) yielded concordant negative results, 14 (13%) concordant positive and 9 (9%) were BC positive only. In 14 (13%) samples pathogens were detected by SF only, resulting in adjustment of antibiotic therapy in 5 patients . In 3 samples a treatment adjustment would have been made earlier resulting in a total of 8 adjustments in all 101 samples (8%).The addition of multiplex PCR to conventional blood cultures had a relevant impact on clinical management for a subset of patients with presumed sepsis. Early adequate antibiotic treatment improves the outcome of patients with sepsis -5. Even Additionally, the likelihood of a positive result in conventional culture methods can be reduced by concomitant or prior antibiotic treatment. Amplification of bacterial and fungal nuclear acids directly from blood specimen is a newly established detection method for pathogens. Tests based on this method may improve clinical care by shortening the time to a positive result and by being more independent of antibiotic pre-treatment. The impact of these methods on therapeutic decisions and outcome has not yet been studied.We compared the results of a standard BC system with those of a commercially available polymerase chain reaction (PCR) based system in routine clinical management.Primary goal of the study was to determine if results from the additional PCR based system led to different therapeutic decisions than the results from BC alone.Secondary goal was to assess the concordance of both methods and time saving effects with the use of a PCR-based test.® SeptiFast® (SF) Test; Roche Diagnostics, Mannheim, Germany) was offered as an add-on diagnostic tool free of charge supplemental to standard BCs taken in patients with presumed sepsis at the Regensburg university medical centre during an eight months period (July 2006 – March 2007). The test was made available to all departments treating patients with sepsis by the microbiology department. The decision to use the additional test was solely made by the treating clinician.A commercially available molecular based test system were inoculated directly with 10 ml blood each and delivered to the microbiology department together with the aliquot for analysis with the SF. Blood cultures were incubated for 7 days. The SF-test was provided free of charge by the manufacturer.2 < 32 mmHg, white blood cell count ≥ 12,000 or ≤ 4,000 cells/mm3)) and by the data provided for the test application. Immunosuppression was defined as being post organ-transplant, receiving chemotherapy for malignant disease or receiving high dose prednisolone (>20 mg/day). Those with chronic disease predisposing for infections such as chronic liver disease or alcoholism were not counted as such. Antibiotic pre-treatment was defined as having received any antibiotic therapy within 24 hours before specimen collection. Multiple samples per patient were allowed, if the times of blood collection were at least 48 hours apart.A retrospective analysis of the test results and clinical data was performed. Clinical data were extracted by chart review Treatment adjustment not necessary ; 2) Treatment adjustment necessary due to lacking coverage of empirical therapy.In order to examine possible time saving effects of the molecular based analysis, time to results of BCs was compared to the time of SF results. At our institution BC results are reported to the treating physician by telephone call from 8 am to 7 pm Monday-Friday and 9 am – 4 pm on weekends and holidays. A complete report including antibiotic resistance testing results is faxed and sent by mail. Due to the experimental status of the SF-test, the results were not available on a daily basis. Therefore a virtual once and twice daily analysis Monday-Friday was assumed in order to achieve comparable time frames. For the once daily simulation results were assumed to be available by 2 pm if received by 8 am in concordance with the turnaround times reported for the test. In the twice daily setting results were assumed to be available by 2 pm if SF samples were received by 8 am, if received by 1 pm results were assumed to be available at 7 pm. We then compared the time from drawing the blood samples to the time a first positive BC result was reported and the virtual SF result time.® and SPSS® .Data collection and statistical analysis were performed using Microsoft Office AccessDue to the retrospective and non-interventional design of the analysis approval of the local ethics committee was not required according to the guidelines of our hospital.In the study period 101 samples of 77 patients were examined. The median age of the patients was 55 years Table . In-HospEnterococcus faecium, while the number of coagulase-negative Staphylococci (CNS) was lower with SF. All differences were not statistically significant (p > 0.05).In 39 samples (38%) pathogens were identified from either BC or SF (Table Fourteen of 101 samples (13%) were concordant positive in SF and BC systems. Sixty-three (62%) were negative in both methods. Thus a concordant result was seen in 77% of all samples. In 13 samples with a negative BC, pathogens were identified by SF Table . In addiCandida species). Enterococcus faecium infection was more often diagnosed in the SF (n = 7) test compared to BC (n = 3), although neither difference was statistically significant.Fungal pathogens were detected more frequently with the SF-test when present in other clinical isolates .In 9 samples with positive BC the SF-test yielded negative results Table . ListeriThe median time to obtain the result of the SF analysis was determined to be 18 hours, with a minimum of 6.75 hours and a maximum of 74 h (samples collected at the beginning of the weekend) in the twice daily situation, with a median time of 26,25 hours, a minimum of 6,75 hours and a maximum of 79 hours assuming a once daily analysis.In samples with both BC and SF positive a change in therapy would not have been necessary in 11 of the 14 cases Table . For oneThree samples of 3 different patients could be identified where a treatment adjustment was deemed necessary. In one case an antifungal drug was not included in the empiric regimen; in two other cases vancomycin was necessary additionally. The median time from specimen collection to the SF result was 27 hours in the once daily and 18 hours in the twice daily setting in all BC and SF positive samples. The SF median time in the 3 samples that resulted in treatment adjustments was 21.5 hours for both scenarios compared to 29 hours median time for BC for these individual cases.Compared to the BC results of those samples this yields a time saving of a median of 21 hours.Enterococcus faecium and vancomycin was recommended as an additional drug.In samples with BC negative and SF positive results a treatment adjustment was not deemed necessary in 8 of 13 samples Table , Table 8Taken together, based on our proposed virtual time frame in which SF results would have become available, in 8 of 27 samples an adjustment of therapy would be triggered by the SF results. Three of those would have been made earlier while 5 would have been missed by conventional BC. Thus the use of the SF-test had clinical consequences in 8% (8 of 101) of all analysed samples.As treatment recommendations were made post-hoc based on the clinical data available at the time of the diagnostic results, we also looked at the actual clinical courses. In all but one sample the treating clinicians had decided in accordance with our post-hoc recommendations.In 39/101 samples from patients with suspected sepsis pathogens were identified with either the use of BCs or a PCR-based test for the identification of bacterial and fungal pathogens in whole blood (SF-test).Concordance for positive and negative results between BC and SF (77%) was comparable to other studies ,10.Enterococcus faecium were identified compared to BC. In contrast, fewer CNS specimens were identified by SF compared to conventional blood cultures.With the BC results only, we identified positive results in 21% of all samples in comparison to 27.4% with the SF-test. With SF more fungal pathogens and more One important question is if these pathogens additionally detected by either SF or BC are clinically relevant or if there are merely "innocent bystanders", i.e. the important discrimination between contamination, colonisation or true infection. In our patient cohort most pathogens detected only by SF were also present in other specimens of the same patient suggesting a clinical relevance. These results are in concordance with other studies where 12 of 14 respectively 31 of 42 pathogens additionally detected by PCR were present in other samples of the same patient ,10.CNS were rarely detected by the SF-test in our collective, as the SF-test tries to omit positive results due to contamination. This is in accordance with one other study, presenting 102 patients without signs of infection with 19.6% positive BC and no CNS by SF . In our Our study showed that the use of SF in addition to BC led to the identification of more pathogens. If this was influenced by concomitant antibiotic therapy could not be addressed in our study, as 82% of the patients were already on treatment at specimen collection.Our assumed twice daily analysis for the SF-test would have led to a median time to final results of 18 hours. Compared to usual turnaround times for BC results, this yields a clear time advantage for the SF-test. Immediate processing of specimens could further shorten the time to final results to 6.5 h . If thisAdditional pathogens were identified in 5 cases and in 3 samples the rapid SF-test would have led to earlier adjustment of antibiotic therapy. In total the use of the test would have resulted in therapeutic consequences in 8 (8%) patients.On the other side, 9 pathogens were not detected by SF. One of them is not included in the PCR portfolio, thus no conclusions can be drawn regarding sensitivity. Alarming is the failure of detection of S. pneumoniae, even if this could be attributed to a software problem that was solved in newer software versions. With regard to the missed polymicrobial infections it is unclear why these were not detected by SF. A possible explanation might be the competitive growth in vivo that does not allow both pathogens to reach a level resulting in a positive SF test.All detection failures and the necessity of antibiotic resistance testing underline the importance of using the SF test additionally to standard BC.If therapeutic adjustments initiated by the SF-test have an impact on the survival of patients with sepsis could not be determined in this study. Studies indicate that patients do not have a benefit from changes in antibiotic therapy if the initial empiric therapy did not cover the causative pathogen . As thosInvasive fungal infections have an especially high mortality ,12,13. SThe cost benefit of the SF may differ in different clinical situations or patient populations. Special equipment and specially trained personnel are necessary to perform the test. The cost of individual tests will be influenced by the intended turnaround time as well as by the availability outside normal working hours. Cost and cost-effectiveness analyses will have to be done for different scenarios.Our study had several limitations. Only 80% of the patients presented with two or more SIRS criteria at the time of the specimen collections. But as the rate of immunosuppressed patients was high, a high index of suspicion was present in the remaining 20%. Additionally, it was a non-randomized study, where the decision to use the additional test was solely taken by the treating clinician. Thus a selection bias has to be assumed that may influence the rate and types of pathogens found in our samples. Further, it is a single centre study with a small study size, thus possibly limiting the generalisability of the results. Nevertheless the design of our study may mirror clinical reality more exact than randomized controlled trials. The patients' characteristics in our study are well comparable to those of patients from sepsis studies or cohorts, including one at our institution .Our study shows that the use of a rapid molecular diagnostic test for the identification of bacterial and fungal pathogens may lead to a higher rate of early adequate antibiotic therapy in approximately 8% of patients with suspected sepsis. Due to the small sample size and the design of our study cost effectiveness analyses were not feasible. They are warranted in further studies.The authors declare that they have no competing interests.CD participated in the design and coordination of the study, the clinical data acquisition and drafted the manuscript.BE participated in the design of the study and helped draft the manuscript.SS participated in the clinical data acquisition and helped draft the manuscript.HJL participated in the design of the study.UR participated in the design of the study and carried out the PCR.SB participated in the coordination of the study, performed the statistical analysis and helped draft the manuscript.All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2334/9/126/prepub

Mathematical models containing only the significant terms were generated for each response parameter using multiple linear regression analysis and analysis of variance. Both the formulation variables exerted a significant influence (P <0.05) on Y1 whereas the cellulose acetate butyrate level emerged as the lone factor which significantly influenced the other response parameters. Numerical optimization using desirability approach was employed to develop an optimized formulation by setting constraints on the dependent and independent variables. The experimental values of Y1, Y2, Y3, Y4, Y5, and Y6 for the optimized formulation was found to be 92.86±1.56% w/w, 29.58±1.22%, 48.56±2.56%, 60.85±2.35%, 76.23±3.16% and 95.12±2.41%, respectively which were in close agreement with those predicted by the mathematical models. The drug release from microcapsules followed first order kinetics and was characterized by Higuchi diffusion model. The optimized microcapsule formulation developed was found to comply with the USP drug release test-1 for extended release propranolol hydrochloride capsules.A central composite design was employed to produce microcapsules of propranolol hydrochloride by o/o emulsion solvent evaporation technique using a mixture of cellulose acetate butyrate as coat material and span-80 as an emulsifier. The effect of formulation variables namely levels of cellulose acetate butyrate (X Sustained release Multi-particulate systems offer many advantages over single unit modified release systems. Some of the commonly reported advantages of multi-particulate systems include suitability for drug combinations, suitability for incompatible drugs, release of drug at different rate, reproducibility of gastric emptyingThe current investigation was undertaken to systematically analyze the effect of different formulation variables on the microcapsule properties using a response surface methodology and finally develop an optimized formulation with desirable features. Cellulose acetate butyrate, a commonly employed as a coat material in microencapsulation was used as a rate controlling polymer whereas span-80 was used as an emulsifier to stabilize the o/o emulsion produced.Propranolol hydrochloride was generous sample from Zydus Health Care Ltd., Bangalore, India. Cellulose acetate butyrate was purchased from Rolex chemical industries, Mumbai, Span-80, potassium dihydrogenorthophosphate, disodium hydrogenorthophosphate and sodium hydroxide were purchased from S. D. Fine Chemicals, Mumbai. All other chemicals and regents used were of analytical grade.1) and the concentration of span used during emulsification (X2) were the two independent variables analyzed. The dependent variables investigated were percent encapsulation efficiency (Y1), and the drug release at 1.5h (Y2), 4h (Y3), 8h (Y4), 14h (Y5) and 24h (Y6). The selected factor combinations indicating the actual and coded levels as per the design are represented in A rotatable central composite design was employed to produce controlled release microcapsules of propranolol hydrochloride by o/o emulsion solvent evaporation techniqueDrug loaded CAB microcapsules were produced by o/o emulsion solvent evaporation techniqueg) and standard deviation (σg) were computed by fitting the number distribution data into log normal plots.The projected diameter of a total of 200 microcapsules from each batch was determined by optical microscopy. The geometric mean diameter to extract the drug. The resulting dispersions were filtered, suitably diluted and assayed at 290 nm in a Shimadzu 1700 UV/Vis spectrophotometer . The percent drug content and percent microencapsulation efficiency of different batches of microcapsules was calculated from the assay values using a standard curve prepared in the same solvent.in vitro dissolution studies of the microcapsules were performed for a period of 24 h in USP XXIII dissolution rate test apparatus-1 Ltd., Mumbai, India) following USP drug release test-1The The targeted response parameters were statistically analyzed by applying one-way ANOVA at 0.05 level in Design-Expert® software 0 is the intercept; β1 to β5 are the regression coefficients. X1 and X2 stand for the main effects; X1 X2 is the interaction between the main effects; X12 and X22 are the quadratic terms of the independent variables that were used to simulate the curvature of the designed sample space. Predictor equations containing only the significant terms were generated using a backward elimination procedure. A numerical optimization procedure using desirability approach was used to locate the optimal settings of the formulation variables in view to obtain the desired responsewere generated for each response parameter using multiple linear regression analysis (MLRA) and analysis of variance (ANOVA). Y stands for the level of the measured response; βSEM photomicrographs under lower magnification (40 X) indicated that the microcapsules were discrete, spherical and uniform in shape . Higher The number distribution data of different batches of microcapsules obtained from optical microscopy indicated a log normal distribution with the geometric mean diameters ranging between 398.10 μm and 912.01 μm. The microcapsule size was found to increase with increased polymer loads and decrease with increases Span-80 concentrations. The increase in the microcapsule size with increase in the polymer levels can be attributed to the increase in the viscosity of the polymer solution as a consequence of increased polymer concentrations at higher polymer levels. Span-80 by its emulsifying actions was found to reduce the emulsion droplet size during emulsification and thereby the microcapsule size.The microencapsulation efficiency was found to depend on the initial polymer loads and the concentration of Span-80 employed during emulsification. The high values of the encapsulation efficiencies justifieThe drug released at different time intervals from model formulations are displayed in A initial rapid drug release in pH 1.2 (86.76±2.32%) was observed with the formulations representing axial point A1 which released most of the drug within 4 h of dissolution. This could be due to the lowest CAB setting (33.79% w/w), which leads to more drug being retained on the surface. The evidence of the burst release from the formulations A3 and A4 and their inability to sustain the drug release beyond 8 h of dissolution suggested that the intermediate polymer settings (55% w/w) might not sufficiently prevent the initial rapid drug release and prolong the drug release considerably. The formulations representing axial point A2 that had the highest polymer load (76.21%) was successful in controlling the drug release for the entire dissolution period of 24 h with out initiating a rapid release phase.To determine the lack of fit from the generated mathematical model, five replicates of the formulations representing the center points (C1 to C5) were included in the design to determine the pure error due to the experimental procedures. Clustering and overlapping of the release profiles indicated that the errors caused by the experimental procedures were negligible in generating a meaningful data fitment for the response parameters. All the center points were characterized by an initial rapid release and were only successful in sustaining the drug release for a period of 8 h. Of the 13 design points, formulations F2, F4 and A2 were found to comply with the USP drug release test-1 for extended release propranolol hydrochloride capsules. Higher polymer loads (> 70% w/w) in these batches resulted in better encapsulation of the drug and decreased the amount of surface drug. This in turn was found to minimize the burst release and simultaneously prolong the drug release for 24 h.2 Y3, Y4, Y5 and Y6 was found to be significant (The linear models generated for the release parameters Ynificant and indi-1/2 with the R2 values of 0.975±0.005, 0.988±0.006 and 0.977±0.004, respectively. The kinetics of drug release from microcapsules was found to follow first order kinetics as the plots of log concentration of drug retained versus time were linear. The values of the first order rate constants for the batches F2, F4 and A2 were found to be 0.010±0.01, 0.11±0.02 and 0.09±0.01 h-1 with the R2 values of 0.924±0.003, 0.918±0.004 and 0.971±0.006, respectively.The mechanism of drug release from these three batches was characterized to be diffusion controlled as plots of percent cumulative drug release versus square root of time was found to be linear. The values of the Higuchi rate constants for the batches F2, F4 and A2 were found to be 18.01±0.52, 19.01±0.034 and 19.05±0.066 hA numerical optimization technique using the desirability approach was employed to develop a new formulation with the desired responses. An optimized formulation was developed using 70% w/w of CAB and 30% w/w of propranolol hydrochloride using 1.00% w/w span-80 during emulsification. The optimized formulation was evaluated for microencapsulation efficiency and drug release at different time intervals. The optimized formulation developed was found to comply with the USP drug release test-1. A o/o emulsion solvent evaporation technique has been successfully employed to produce cellulose acetate butyrate microcapsules of propranolol hydrochloride with high encapsulation efficiency and desirable release profiles. Both the formulation variables analyzed exerted a significant influence on the encapsulation efficiency whereas the polymer levels emerged as the lone factor, which influenced the drug release. The optimized microcapsules formulation developed employing desirability approach exhibited a drug release that complied with the USP drug release test-1 and also demonstrated high encapsulation efficiency. The results obtained indicate that response surface methodology can be successfully used to quantify the effect of several formulation variables and develop an optimized formulation thereby minimizing the number of experimental trials and cutting down the formulation development cost.

Anxiety symptoms are relatively common among children and adolescents and can interfere with functioning. The prevalence of anxiety and the relationship between anxiety and school performance were examined among elementary, middle, and high school students.Samples of elementary , middle , and high school children were recruited from four public schools in a predominantly middle-class community in Catania, Italy. Children completed the Multidimensional Anxiety Scale for Children (MASC). T-scores were computed for the MASC total scores, and considered to be in the anxious range if 65 or above. Current academic grades were obtained from school records.2 = 7.8, df = 2, p < 0.05), and was 14.1% among students with insufficient grades, 9.4% among those with sufficient grades, and 3.9% among those with good or very good grades .Of the 478 children, 35 (7.3%) had a MASC T-score in the anxious range. The rate of children in the anxious range was 2.3% in elementary, 7.9% in middle, and 15.9% in high school (χIn this community sample of children and adolescents attending elementary through high school, the prevalence of abnormally high self-reported levels of anxiety increased in frequency with age and was negatively associated with school performance. Anxiety disorders constitute the most common type of psychiatric disorders in childhood. There is, however, considerable variability in the estimated prevalence of these disorders. Based on direct interviews of both children and parents, a three-month rate of 5.7% has been reported among children 9–13 years-old , and a sIncreasing attention in recent years has been given to "sub-threshold anxiety," namely anxiety which is below the clinical threshold. Indeed, variation of anxiety symptomatology within populations can be better captured using a spectrum approach according to which anxiety is viewed as a continuum of severity encompassing normal as well as pathological behaviour, rather than a disorder based on an arbitrarily derived threshold ,5.Anxiety symptoms are extremely common in childhood and adolescence, and can negatively interfere with general well-being, social life, academic performance, and development of social skills -12. AnxiThe available data on the link between anxiety and impaired school performance come mainly from clinically referred samples or from surveys of children who had experienced academic failure . Little More specifically, the study examined a) the levels of self-reported anxiety symptoms in children and adolescents across different developmental ages (8–16 years) from elementary school through high school and b) the possible association between self-reported anxiety symptoms and school performance. Based on previous reports, it was hypothesized that anxiety would be more prevalent in adolescence than in childhood, and that greater anxiety would be associated with poorer academic achievement.Children (age 8–16 years) were recruited from four public schools, including two elementary schools, one middle school, and one high school in a predominantly middle-class urban community in Catania, Sicily . There were no differences in socio-economic status among the three groups of students. All subjects were Italians. All the contacted schools agreed to participate in the study. The study was approved by the educational board of each school. Overall, 75% of parents of eligible students agreed to participate and all of them gave written informed consent for their children. Only 85% of the high school students returned a completed rating scale. Therefore, the overall final sample consisted of 478 children, age 8–16 years, 222 males (46.3%) and 256 females (53.6%).The sample included the following three groups according to school level and age:1) Elementary School 2) Middle School 3) High School The data were collected between October 2003 and March 2004.Self-reported anxiety symptoms were assessed using the Multidimensional Anxiety Scale for Children (MASC). This is a 39-item 4-point Likert-style self-report scale with well documented psychometric properties . The MASThe MASC was administered in school to groups of 25 or fewer students. To minimize the influence of individual differences in reading ability, the items were read aloud by an examiner prior to each student completing the questionnaire on her/his own. The examiner was available during the group administration to answer any requests for clarification from the children and to ensure that each child worked independently on her/his questionnaire.School performance was measured according to the overall grade for each child reported in the official school record at the end of the second quarter of the academic year (ending in March).Grades were based on a 10-point scale:1 Very good (≥ 8/10)2 Good (= 7/10)3 Sufficient (= 6/10)4 Insufficient (<6/10)The teachers' judgment was not taken into account; the global rating for each student was derived from the mean of grades reached in each subject.2 test was applied to analyses of categorical data, such as rates of children with a clinically significant level of anxiety (MASC ≥ 65) and the association between rates of abnormal anxiety and school grades. Continuous variables were compared across categorical variables using Student's t-test or Analysis of Variance (ANOVA). When the omnibus ANOVA was significant, post-hoc contrasts between pair of groups (Tukey-Kramer HSD) were conducted.The MASC total and subfactor raw scores were converted into standard T-scores using the MASC Profile forms for males and for females . T-scoreAll statistical analyses were conducted on JMP software. A P value of < .05 was used as the threshold for statistical significance. Bonferroni corrections were applied to p's when multiple comparisons were made.The demographic characteristics of students and their MASC scores are presented for the elementary, middle and high school participating students in Table MASC total scores did not differ significantly among elementary, middle, and high school students Table . Signifi2 = 7.8, df = 2, p < 0.05). There were no gender differences in the rates of abnormal scores .Using the standard MASC cut-off of ≥ 65 in the whole sample, 35 subjects (7.3%) had a pathological level of anxiety and the rate increased from 2% (N = 3 out of 131) in the elementary school group to 7.8% (N = 21 out of 267) in the middle school group and 13.0% (N = 11 of 80) in the high school group and poorer academic grades Table . In the 2 = 11.68, df = 2, p < 0.01).Finally, among high school students, all subjects with self-reported anxiety symptoms scores in the anxious range except for one (10/11) had a poor school performance. Across the entire sample, 14.1% (N = 13) of the 92 children with insufficient grades had a MASC total T-score ≥ 65, as compared to 9.4% (N = 12) of the 128 children with sufficient grades and 3.0% (N = 10) of the 258 with good or very good grades .The results of this study, which utilized a community sample of students 8–16 years old, provide evidence of a statistically significant association between high levels of self-reported anxiety symptoms and poor academic performance among students 8–16 years of age. Children with MASC scores considered in the anxious range were more likely to have school grades in the insufficient range (37.1%) than children with scores of 65 or below 17.9%). Our results are in line with those of two previous longitudinal studies .9%. Our . IalongoThe relationship between self-reported anxiety symptoms and school performance is complex and results from heterogeneous interactions among several factors that include socio-economic status, familiar influences, and individual affective and cognitive profile. School difficulties can be a cause or consequence of affective symptoms and this bi-directional relationship contributes to the maintenance of anxiety and might lead to poor adaptation as well as psychopathologic risk -32. The Interestingly, in our study, subjects with poor school performance did not display, as a group, a level of self-reported anxiety symptoms higher than subjects with better academic grades. This result might indicate that anxiety interferes with school functioning only when an abnormal anxiety level is reached, whereas within the "normal" range, being more anxious does not automatically imply worse school functioning and indeed may to a certain extent be motivating and enhancing to academic performance . Of noteAnxiety is not the only psychiatric disorder that is associated with impairment of school performance. In the United States, subjects with any psychiatric disorder account for 14.2% of high school dropouts and 4.7% of college dropouts . A wide Comparing the two genders for anxiety symptoms, we found that the level of social-phobic and physical symptoms were higher in females than males among students from high and, to lesser extent, middle schools. In contrast, no gender differences were found among primary school students. Our results are in line with previous studies of adolescents that reported higher social anxiety and physical symptoms among females ,43. AlthResults from the current report should be interpreted in the context of several important limitations. The study sample, although representative of the community from which it was drawn, may not necessarily be representative of the general population. The data collected were limited to self-rated anxiety and did not include a comprehensive assessment of other possible symptoms of behavioural or emotional disturbances, such as conduct problems, mood disorders, or substance abuse. The limitation of self-report data is particularly important for the assessment of anxiety among primary school students, because correspondence between informants has been found to be consistently low in this age-range. Family socio-economic status was not formally assessed, even though the community where the study was conducted was quite homogeneous and predominantly middle-class. Finally, longitudinal data are necessary to correctly evaluate the development of anxiety symptoms and their consequences during the life-span.In conclusion, this study showed that the prevalence of anxiety symptoms increased with age and that high levels of anxiety were negatively associated with school performance in a community sample. Studies to evaluate whether successful resolution of anxiety symptoms result in improved school performance are warranted.The author(s) declare that they have no competing interests.LM designed the study, collected the data, performed statistical analysis and drafted the manuscript.MCS, EP and VGD, collected the data and assisted in design of the study.FD and BV commented and participated in the interpretation of data.All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

Nasopharyngeal carcinoma (NPC) is a distinct type of head and neck cancer. Approximately 70% of patients with newly diagnosed NPC present with locally advanced disease. Phase III clinical trials support the addition of chemotherapy to radiotherapy for the initial treatment of these patients. Once metastatic disease develops, practices become varied. Further experience needs to be gained with both targeted therapies and immunotherapy to gauge whether they will improve treatment outcomes in NPC. Nasopharyngeal carcinoma (NPC) is a distinct type of head and neck cancer that differs from other malignancies of the upper aerodigestive tract with respect to epidemiology, pathology, clinical presentation and responses to treatment. Outside of endemic areas such as Southeast Asia, this type of tumour is extremely rare with an incidence of less than 1/100 000 . However, a treatment-related toxic death rate of 8% was encountered in the neoadjuvant therapy arm in this multicentre trial. In a small trial, Hareyama et al randomised 80 patients to two cycles of cisplatin and 5-fluorouracil administered prior to RT vs RT alone. Trends towards improved 5-year DFS and OS were demonstrated in the neoadjuvant therapy arm, but statistically significant differences were not achieved after a median follow-up period of 49 months. In their initial reporting after a median follow-up duration of 30 months, Chua et al showed similar results with their neoadjuvant combination of cisplatin and epirubicin. Again, trends towards improved OS and DFS were seen in the neoadjuvant therapy arm, but the results were not statistically significant. Lastly, Ma et al compared two to three cycles of bleomycin, cisplatin and 5-fluorouracil followed by RT to RT alone and showed a statistically significant prolongation of DFS in the chemotherapy group (59 vs 49% at 5 years). A trend towards OS was observed in the neoadjuvant arm of the trial. Updated combined data from these two latter trials (vs 43%) favouring the neoadjuvant therapy arm, but not in 5-year OS (62 vs 58%). Reductions in both locoregional and distant failures were observed. Although it has been suggested by the trends, to date, no statistically significant OS advantage has been documented in a phase III randomised trial using neoadjuvant chemotherapy followed by RT.Four trials have assessed the role of neoadjuvant chemotherapy followed by RT vs RT alone staging system, all 284 patients had either stage III or IV disease. Patients randomised to the concurrent chemotherapy arm of the study received two cycles of cisplatin mixed with 5-fluorouracil administered as a 96-h continuous infusion during weeks 1 and 5 of RT. The 5-year OS rates for the chemotherapy arm were 72% compared with 54% in the control arm; the 5-year DFS rates were 72 vs 53%, respectively. Both comparisons were statistically significant. In a similar study, Chan et al randomised patients to adjuvant weekly low-dose cisplatin and standard RT vs RT alone. Over 90% of their patients were Ho tumour stage III or IV. The 2-year DFS in the chemotherapy arm was 76% compared to 69% in the RT alone group, which did not achieve statistical significance, and OS was not reported in the initial analysis after a follow-up period of 33 months. Updated data from the vs 52% and 5-year OS of 70 vs 59%, both reaching borderline statistical significance , in favour of the concurrent chemoradiotherapy arm. Reclassification of the 350 patients on this trial using the 1997 AJCC staging system revealed that over 70% were of stage III and IV. Subgroup analysis demonstrated that patients with T3 and T4 disease derived the most benefit. Based on these two randomised trials, patients with advanced locoregional NPC benefit from concurrent chemoradiotherapy over RT alone.Two trials have compared concurrent chemotherapy and RT The first published randomised trial in locoregional NPC compared adjuvant chemotherapy after RT to RT alone stage I histology (keratinising squamous cell carcinoma). A phase III randomised trial using a similar chemotherapy and RT plan has been completed, with enrolment restricted to patients with WHO type IIa (nonkeratinising squamous cell carcinoma) and IIb (undifferentiated carcinoma) histologies was used as the concurrent chemotherapy agent, while the adjuvant chemotherapy protocol consisted of alternating cycles of cisplatin/5-fluorouracil with vincristine/bleomycin/methotrexate. Although a trend towards improved DFS and OS was noted with the addition of concurrent chemotherapy, it did not reach statistical significance at 3 years. In assessing distant metastases rates, a significant reduction was attributable to concurrent chemotherapy. In this study, adjuvant chemotherapy did not improve outcome.In addition to the three trials mentioned above, which compared concurrent chemoradiotherapy plus adjuvant chemotherapy Based on published randomised trials that addressed the value of adding chemotherapy to RT in locally advanced NPC, several conclusions may be drawn. It is important to note that these trials were completed over a 16-year time span (1988–2004) in different geographic areas. As such, several tumour staging systems and improved diagnostic techniques have been utilised, which might have contributed to a phenomenon of stage migration is required; however, better technical accuracy of RT delivery can also improve upon disease control. In 1998, the use of three–dimensional (3D) intensity-modulated RT (IMRT) for NPC was implemented at the Memorial Sloan-Kettering Cancer Centre. Initial treatment reported an increased target dose delivery from 67.0 to 77.3 Gy with IMRT as compared to conventional treatment methods. Dose to normal structures such as the spinal cord, mandible, temporal lobes and parotid glands all decreased with IMRT RT for NPC. Up to 97% of treated patients have reported xerostomia as a complication of therapy , vascular endothelial growth factor (VEGF), c-KIT and c-erbB-2 (HER2). To date, no reports of mutational analyses of any of these molecular targets have been published.A retrospective study was performed to assess the correlation between the expression of EGFR and treatment outcome in patients with advanced stage disease in patients whose histology showed nonkeratinising or undifferentiated carcinoma. These cases were associated with a trend towards a better survival. Whether or not a potential therapeutic role for inhibitors of c-KIT such as imatinib mesylate exists remains unknown at the present. In this same cohort of patients, HER2 overexpression was uniformly negative. This result differs from a Hong Kong study of 78 Chinese patients with undifferentiated NPC (in situ hybridisation (FISH) analyses of HER2 in 45 cases of NPC. While 33% of patients had HER2 expression in tumour samples by immunohistochemical staining, this did not correlate with clinical outcome, and no significant alterations in gene copy number of HER2 was detected by FISH was undertaken in EBV-positive patients with advanced NPC. CTL were generated and then infused into 10 patients. Four patients treated in remission remained disease free 19–27 months after infusion. Of six patients with refractory disease, two had complete responses, one had a partial response, one had stable disease and two had no response (Based on the above data, a clear role for concomitant chemoradiotherapy followed by adjuvant chemotherapy has shown statistically significant improvement in OS and DFS for all histological types of locally advanced NPC. Neoadjuvant chemotherapy followed by concurrent chemoradiotherapy would be a reasonable variation, since the maintenance of chemotherapy dose intensity may be optimal using such a sequence. Further treatment questions arise in the management of local and distant failures. Intensity-modulated RT proves to be an improvement in RT delivery, and in several phase II studies has initially translated into better locoregional control and reduced toxicities. In cases of recurrent or distant disease, the standard of care is diverse.Given the complex nature of this disease and the high risk for development of distant failures, new treatment regimens need to be developed for these patients. Exploration of the role of targeted agents such as inhibitors of EGFR, VEGF, c-KIT and HER2 are necessary. Adoptive immunotherapy with EBV-specific CTL awaits further exploration. Certainly, the treatment strategies for NPC will continue to change and evolve as a better understanding is gained of the molecular and immune mechanisms that drive this disease.

Molecular Epidemiology of Dengue Virus Strains from Finnish Travelers We characterized 11 dengue virus (DENV) isolates obtained from Finnish travelers during 2000–2005 using monoclonal antibodies and phylogenetic analysis. The analysis of DENV isolated from travelers contributes to the global picture of strain distribution and circulation. The isolates included all serotypes, including a DENV-2 isolate from Ghana. Flavivirus. Dengue is regarded as the most significant arboviral disease in the world. Disease incidence and prevalence are rising in dengue-endemic areas, and travelers are increasingly affected. The disease can vary from asymptomatic to febrile disease, classic dengue fever, or complications such as dengue hemorrhagic fever or dengue shock syndrome. Several virus- and host-specific factors have been suggested to correlate with severe disease outcomes, which are mostly associated with secondary infections (Dengue viruses (DENV 1–4) are mosquito-borne members of the family Flaviviridae, genus Patients returning from dengue-endemic areas with fever and other symptoms compatible with dengue were treated mainly at university hospitals in Finland. Because of clinical suspicion, serum samples were tested for antibodies to DENV at Helsinki University Central Hospital Laboratory. The diagnosis was based on detection of immunoglobulin (Ig) M in the acute- or convalescent-phase sample or on a 4-fold IgG titer rise in paired serum specimens in an in-house IgG immunofluorescence assay (IFA), and IgM-enzyme immunoassay . For this study, serum specimens from all patients were aliquoted and stored at –70ºC.<320 (IFA) were chosen for virus isolation (n = 40). Virus isolations were done simultaneously in 2 cell lines: in Vero E6 cells (ATCC CRL-1586) grown in minimal essential medium at 37°C and 5% CO2, and in C6/36 Aedes albopictus cells (ATCC CRL-1660) grown in Leibowitch L-15 medium at room temperature. Cells in 25-cm2 flasks were incubated with 50 μL of patient serum for 1 hour and observed for 24 days for cytopathic effects (CPEs). When CPEs were evident, cells were harvested for IFA, and RNA was extracted from supernatants for reverse transcriptase–PCR (RT-PCR). In the absence of CPEs, cells were subcultured after 7 days into 75-cm2 culture flasks and studied by IFA on days 7 and 24.From patients with dengue diagnosis, acute-phase serum specimens with IgG titers In IFA, the cells were stained with a DENV-positive serum and DENV–type-specific monoclonal antibodies (MAbs) or strains that grew only in C6/36 cells (n = 5). Two of the DENV-3 isolates (2 and 7) were detectable considerably earlier in Vero E6 than in C6/36 cells. DENV-1 isolates showed 2 distinct growth patterns; isolates 4 and 8 grew only in C6/36 cells, and isolates 3 and 11 grew in both tested cell lines .All isolates were successfully serotyped with the RT-PCR of Lanciotti et al. . Phylogenetic analysis was performed by the neighbor-joining method with a Kimura 2-parameter model using MEGA3 software version 3.1 , and directly sequenced. When necessary, the envelope gene was amplified using previously described primers using ClPhylogenetic analyses showed tThe DENV-3 isolates represented genotype III . Isolate,,Studies on imported DENV have provided interesting insights to the global picture of circulating strains had distinct antigenic properties when cultured in mammalian or mosquito cells. Whether this strain represents MAb-escape properties requires further studies.The phylogenetic grouping of the isolates was consistent with the travel history of the patients in most cases. However, isolate 11 (DENV-1) from India clustered with a genotype III strain isolated a year earlier from the Seychelles, which suggested strain transfer between these countries.Phylogenetic analysis of isolate 9 (Ghana 2005) showed that it could be grouped with other African isolates of the cosmopolitan genotype . To our The 11 DENV isolates represent a random sample from different geographic locations. Three strains were isolated from travelers returning from Sri Lanka, first in 2000 (DENV-4), followed by isolates in 2003 (DENV-2) and 2004 (DENV-3). These strains demonstrate extensive DENV serotype cocirculation.Dengue virus (DENV) sequences used in the phylogenetic analysis of isolates from Finnish travelers, 2000–2005*

WHO-ART and MedDRA are medical terminologies used for the coding of adverse drug reactions in pharmacovigilance databases. MedDRA proposes 13 Special Search Categories (SSC) grouping terms associated to specific medical conditions. For instance, the SSC "Haemorrhage" includes 346 MedDRA terms among which 55 are also WHO-ART terms. WHO-ART itself does not provide such groupings. Our main contention is the possibility of classifying WHO-ART terms in semantic categories by using knowledge extracted from SNOMED CT. A previous paper presents the way WHO-ART term definitions have been automatically generated in a description logics formalism by using their corresponding SNOMED CT synonyms. Based on synonymy and relative position of WHO-ART terms in SNOMED CT, specialization or generalization relationships could be inferred. This strategy is successful for grouping the WHO-ART terms present in most MedDRA SSCs. However the strategy failed when SSC were organized on other basis than taxonomy.We propose a new method that improves the previous WHO-ART structure by integrating the associative relationships included in SNOMED CT.The new method improves the groupings. For example, none of the 55 WHO-ART terms in the Haemorrhage SSC were matched using the previous method. With the new method, we improve the groupings and obtain 87% coverage of the Haemorrhage SSC.SNOMED CT's terminological structure can be used to perform automated groupings in WHO-ART. This work proves that groupings already present in the MedDRA SSCs (e.g. the haemorrhage SSC) may be retrieved using classification in SNOMED CT. WHO-ART and MedDRA are the terminologies used in pharmacovigilance for case report coding and statistical data analysis. The generation of new knowledge on adverse drug reactions depends on the structure of the terminology. On the one hand, terminologies require terms as specific as possible in order to allow precise coding. On the other hand, signal detection commonly requires similar conditions to be recognized together in order to identify drug related problems -3. In otMedical problem oriented groupings have been manually introduced in MedDRA. Special search categories (SSC) are sets of MedDRA preferred terms related to a specific medical condition, for example "Upper gastro-intestinal bleeding conditions" or "Haemorrhage conditions". Recently, Standard MedDRA Queries (SMQ) replaced the SSCs. The SMQs have the same utility as the SSCs and are also manually defined.WHO-ART does not provide such groupings of terms. The WHO-ART terminology has a hierarchical structure with restricted multiple inheritance, to avoid double counting of the same case through common drug surveillance (e.g. if the WHO-ART term corresponding to a drug safety report would be located in more than one unique category). The hierarchical structure is organized on three levels, but most of the terms appear on the first two levels as the second hierarchical level does not exist for two thirds of the coding terms. Sometimes terms with different levels of generalization may be siblings. As a consequence, grouping similar terms based on WHO-ART hierarchy will provide either very large clusters or very small ones not allowing tuning the focus of statistical analysis on specific or specifically related medical conditions.is a "Thrombosis"). Then, based on synonymy and relative position in SNOMED CT [In a previous paper we described a method for grouping WHO-ART terms related to common medical conditions . The genNOMED CT , two WHOIn this previous experiment, we compared the MedDRA SSC (restricted to WHO-ART terms) to the groupings obtained automatically by classification based on the formal definitions of WHO-ART terms. WHO-ART terms present in SSCs were automatically retrieved. We were able to create grouping classes. For example, the medical search term "Disorders of Pregnancy" was automatically filled with several WHO-ART terms amongst which "Abortion", "Eclampsia", "Hydramnios", "Uterine atony" and "Uterine spasm". Most WHO-ART terms included in the MedDRA SSCs were automatically retrieved. However we found some drastic limitations due to the fact that these groupings are based only on a generalization – specialization relation and therefore limited to the high level grouping classes that the editors of SNOMED CT considered relevant (e.g. "Pain related disorders" but not "Pain located in digestive structure disorders"). For example, none of the 55 WHO-ART terms in the Haemorrhage SSC were found .Consequently, the method needs to be improved to take into account groupings that rely also on associative relations such as "has location", "has morphology" or "has causative agent". A great effort has been done to make the meaning of medical concepts in SNOMED CT explicit for computers and this work is continued with every new release of SNOMED CT. For instance, all the pathologies associated to an inflammatory morphology are linked by the "has morphology" relation to the "Inflammation" concept. In the SNOMED CT hierarchy, the meaning of inflammation is furthermore divided in subclasses corresponding to different types of inflammation .The objective of this work is to enrich the formal definitions of the WHO-ART terms by taking into account associative relations. We propose a Description Logic model corresponding to the following requirements:1. The model should be populated with automatically extracted knowledge.2. Classification of the model should retrieve clusters of medically related terms on given criteria.We first describe the SNOMED-CT and WHO-ART terminologies. Then we present the logic description model for description of WHO-ART terms and the query mechanism. After presenting results of groupings using the new method we finally discuss the methodology to use for automated grouping and give an appraisal of the results.Our material includes the WHO-ART (2004 third quarter) and the SNOMED CT terminologies. SNOMED CT is available through UMLS (2005AA).WHO-ART is organ1) The included terms (IT) and preferred terms (PT) level, which is recommended for the coding of adverse drug reactions (ADRs) and detailed drug safety statistical analysis.2) High level term is a first grouping level. Only 31.3% of PTs are grouped in high level terms classes (HLT). The remaining PTs (68.7%) are linked directly to a system organ class (SOC). For example, the preferred term "Cardiomyopathy" is linked to the "Myo endo pericardial valve disorders" and "Body as a whole general disorders" SOCs.3) At the most general level, PTs are grouped according to 32 system organ classes (SOC). SOCs group terms according to anatomy and/or public health medical problems (e.g. "Neoplasm").The SOCs level is used for periodical statistical surveillance of national or international regulatory authorities. Under the SOC level, the polyhierarchy is forbidden in order to avoid double counting of an adverse reaction event. However a WHO-ART term can appear in up to three SOCs (one primary and two secondary).As said earlier, clusters based on the native WHO-ART terminological structure lead either towards very large semantic clusters (an average of 58 terms for SOCs) or very specific, granular ones (an average of 4 terms for HLTs).SNOMED CT has a polyhierarchical structure and a large coverage of the medical domain principles. The Web Ontology Language (OWL DL) is a standard for knowledge representation that facilitates high machine interpretability. OWL provides existential quantification that allows one to describe, for example, the concept of "ADRs having a haemorrhage morphology" as "hasMorphology some Haemorrhage". Here, "hasMorphology" has the function of a role with "Haemorrage" as its role filler. The existential quantifier means that for each individual object that instantiates the expression "hasMorphology some Haemorrhage" there is at least one instance of the concept Haemorrhage related by the relation hasMorphology. For building the ontology, we have used Protégé as one of the most actively developed OWL enabled ontology editors , togetheIn this section, we first present the main idea of our approach. It is centred around the synonymy relationship and the exploitation of the SNOMED CT hierarchy to support the reasoning process. Secondly, we present a methodology for acquiring formal definitions of WHO-ART terms and for querying the resulting model.A subsumes a concept B if and only if all the possible instances of B are also instances of A. The subsumption mechanism is preserved by the relationship "is synonymous". Therefore, if A "is synonymous" with a, B "is synonymous" with b and a subsumes b the inference engine will conclude that A subsumes B belong already to a hierarchy. The hierarchical relations in SNOMED CT induce a discriminative property to the synonymy relation. Based on that, the defined WHO-ART concepts can be placed in a hierarchy . Here, a concept is build based on the synonymy relation between terms coming from different source vocabularies. In our ontology, the synonymy relations are those extracted from UMLS .Sometimes terms not considered synonymous by the SNOMED CT editors can be part of the same UMLS concept . This is due to the fact that SNOMED CT is more granular than most of the UMLS sources.Within the UMLS Metathesaurus, a WHO-ART term has a small number of SNOMED CT synonyms. An ideal synonymy relation would be a "one-to-one" relationship between a WHO-ART concept and a SNOMED CT concept. The "one-to-one" or "one-to-few" relationship is very important in our model where the discriminative power is given by the SNOMED CT hierarchy Figure .a synonym to b then a ≡ b as well as (a ⋂ b) ≡ (a ⋃ b).Ensuring consistent synonymy across millions of concepts in the UMLS Metathesaurus is difficult and depending on use sometimes not appropriate . SeveralIn the present work, we use "OR" between SNOMED CT synonyms of the same WHO-ART term in order to capture all the meanings of a WHO-ART concept in the formal definition.grouping classes), however limited to the ones that the editors of SNOMED CT considered relevant .The methodology is organized in three steps. During the first step, the synonymous SNOMED CT terms are extracted from the UMLS Metathesaurus and linked to corresponding WHO-ART concepts. The first step is fully described in our previous work and has associative relations). When a large amount of concepts are related to one or few concepts, the associative relations have a grouping role . Combining the associative relations and the primitive grouping concepts (e.g. inflammation) is a very flexible way to get different situation-tailored clusters of terms that can be very useful for data retrieval.The synonym-based ontology is used as a starting point for the addition of the associative relationships raises the question of what logical operator to choose to relate them. We chose the "AND" operator in order to create a multiple inheritance . This choice is motivated by the fact that "AND" is computed as an intersection operation on sets and that the subsumption is inferred based on the strict inclusion operator on sets. An intersection of sets will always be composed by fewer or the same number of elements than the union (e.g. "OR"). In our ontology a more restricted (e.g. "AND") concept is more probable to be STRICTLY included in a grouping concept. This allows the grouping of WHO-ART concepts using the SNOMED CT concepts as grouping criteria.In our model, we have used only the relations "has finding site" and "has associated morphology" which are both extracted from SNOMED CT. The other SNOMED CT associative relations are not of any interest at this time in our model. For each WHO-ART concept a formal definition is automatically generated as follows:Cwho complete(is_syn some (Csnmct or Csnmct or ....))or (has_finding_site some (Csnmct and Csnmct and ....))or (has_associated_morphology some (Csnmct and Csnmct and ....))Cwho is a WHO-ART concept and Csnmct is a SNOMED CT concept.In the previous definition, For example, the formal definition of "GastGastritis complete(is_syn some (SNMCT:Gastritis))or (has_finding_site some (SNMCT: Stomach_structure))or (has_associated_morphology some (SNMCT:Inflammation))Gastritis acute complete(is_syn some (SNMCT:Acute_Gastritis))or (has_finding_site some (SNMCT:Stomach_structure))or (has_associated_morphologysome (SNMCT:Acute_Inflammation))Given the fact that the "Gastritis acute" is subsumed by "Gastritis" and "Inflammation acute" is subsumed by "inflammation" in SNOMED CT, the reasoning process will classify WHO-ART corresponding terms "Gastritis acute" as a subclass of "Gastritis".Making queries on the presented model raises the problem of managing missing data, precisely missing role fillers.In this work, we are filling our model with automatically extracted information and we assume that the formal definitions are not complete. By choosing this way to write the formal definitions we are taking full profit from the open world assumption (OWA). Roughly speaking, we are telling to the inference engine that the defined concept has the properties we are asserting but also that it can have any other property. In OWA, this notion is expressed by "nothing" meaning that the logical value is unknown and being equivalent with the empty set in the set theory. The empty set will be subsumed by any class. In a closed world system anything unknown to the system gets the value "false".For example, the "obesity" term has no fillers for the relations "has morphology" and "has localisation". The reasoner will assume "nothing" as filler.owl:thing) is given by default each time a WHO-ART concept does not have a filler for a relationship. In other words, any restriction on the relationship is removed and we are asserting that the object is somewhere in the model.In our context, a restriction to "anything" all digestive inflammations will be defined as Figure :Digestive inflammations(is_syn some (owl:thing))or (has_finding_site some (SNMCT:Digestive_structure))or (has_associated_morphology some (SNMCT:Inflammation))owl:thing It does not mean that the "Digestive inflammations" class subsumes all the classes in the ontology. In fact, it will subsume the concepts synonymous to owl:thing located in some kind of digestive structure and which has some kind of inflammation as their associated morphology.In the above definition, the query "Digestive inflammations" is synonymous with owl:thing, this will lead to false situations.To illustrate this point, we can easily find a class defined as synonymous to something, which would have an associated inflammatory morphology but which would not be located in a digestive structure (e.g. "Vasculitis"). It is obvious that this class will not be included in "Digestive inflammations", but in another defined clustering concept. If we do not systematically define the missing fillers as For instance, without a value for "has finding site" and "has associated morphology", "Obesity" would be subsumed by "Digestive inflammations".Obesity complete(is_syn some (SNMCT:Obesity or SNMCT:Obese))The figure Using the technique presented in the previous sections, 85.9% of WHO-ART terms were successfully mapped through UMLS to one or more SNOMED CT synonyms.The ontology contains 8,454 classes including 1,597 defined classes involving 4,482 existential assertions. The primitive concepts hierarchy represents 1.9% of SNOMED CT . It takes an average time of 4 minutes for RacerPro to classThe resulting WHO-ART structure is evaluated against the SSCs built by MedDRA (7.1) editors )or (has_finding_site some (owl:thing))or (has_associated_morphology some (SNMCT:Hemorrhage)).We obtain a class containing 46 of the 55 WHO-ART concepts mapped to corresponding MedDRA Hemorrhage SSC concepts, 3 are not mapped (14% of WHO-ART terms are not mapped to SNOMED CT) and the remaining 6 are concepts for which the relation to "Hemorrhage" is not in SNOMED CT.There are 66 WHO-ART terms regrouped in this class. The false positives include terms like "Duodenal ulcer hemorrhagic and perforated", "Colitis hemorrhagic", "Purpura" or "Hemorrhage in pregnancy" that are in different forms in the original MedDRA SSC's and that were not mapped correctly as they have different lexical forms in the original MedDRA SSCs.The "Hemorrhage" example shows a preliminary validation of the method. In the same way, we plan to create other query classes as long as they can be characterized using the primitive grouping concepts and associative relations.Cimino argued that terminologies should comply with desiderata such as formal definitions and polyhierarchy . This paThis is achieved by reusing an existent resource rather tBased on the hierarchy of SNOMED CT only, we had obtained relevant grouping compared with SSCs . Yet theThe 85.9% success of the mapping step is still insufficient but could be naturally improved since the UMLS Metathesaurus is reviewed and updated regularly. To improve this percentage independently of the review frequency of the UMLS, we consider investigating approximate matching by browsing other terminologies in UMLS. In further work NLP techniques will be considered also.The mappings provided by UMLS present some limitations; terms can be considered synonymous although they reside on different axes in SNOMED CT .is_a" relations.The synonym-based method was successful for the SSCs that have corresponding classes in SNOMED CT (e.g. "Pain" mapped to "Disorder characterized by pain"). The presented method improved the results for the other SSCs such as "Haemorrhage", where the groupings rely more on associative relations than on "The resulting terminological resource can be considered an evolving one as it allows queries that could give feedback on synonymous and associative relationships. For example, for "Menorrhagia" that has not been found in the "Hemorrhage related" class one can easily add "Hemorrhage" as object for the "has associated morphology" relation.UMLS already interconnect medical terminologies and allows performing transcoding and mappings between almost all of the medical terminologies actually in use. The internal organisation, more precisely the rapports that the authors establishes between the concepts in all these terminologies meets the most frequent statistical data analyses needs. As some of these data aggregation requirements are common between different medical fields, the queries (i.e. term groupings) can be performed not only by using the coding terminology but also the terminologies related to the one used to code data. This strategy is greatly helped by UMLS that allows in a very simple way to transcode data.In this work, we showed that SNOMED CT terminological structure can be used to perform automated groupings in WHO-ART. This work proves that groupings already present in the MedDRA SSCs (e.g. the haemorrhage SSC) may be retrieved using classification in SNOMED CT.Further work will test the assumption that SNOMED CT can increase the chances to find earlier drug safety signals from case reports differently coded but reporting on a same medical issue. Moreover, this technique can be very useful to refine a terminology structure, to audit it and propose improvements like for example add terms for concepts that are not represented or detect incoherence.IA: built the resource, performed the classification algorithm and wrote the first draft of this paper.CB: performed an initial appraisal of the WHO-ART and MedDRA terminologies that showed the interest of building formal definitions for pharmacovigilance.CB, MCJ: The three authors participated in the initial design of the study, in the review of the results and the editing of the article.

Using non-steroidal anti-inflammatory drugs (NSAIDs) as a case, we used Taiwan's National Health Insurance (NHI) database, to empirically explore the association between policy interventions and drug expenditures, utilization, and market structure between 2001 and 2004.All NSAIDs prescribed in ambulatory visits in the NHI system during our study period were included and aggregated quarterly. Segmented regression analysis for interrupted time series was used to examine the associations between two price regulations, two new drug entries (cyclooxygennase-2 inhibitors) and the rofecoxib safety signal and expenditures and utilization of all NSAIDs. Herfindahl index (HHI) was applied to further examine the association between these interventions and market structure of NSAIDs.New entry was the only variable that was significantly correlated with changes of expenditures and market structure of the NSAIDs market in the NHI system. The correlation between price regulation and information shock (p = 0.31) and drug expenditure were not statistically significant. There was no significant change in the prescribing volume of NSAIDs per rheumatoid arthritis (RA) or osteoarthritis (OA) ambulatory visit during the observational period. The market share of NSAIDs had also been largely substituted by these new drugs up to 50%, in a three-year period and resulted in a more concentrated market structure (HHI 0.17).Our empirical study found that new drug entry was the main driving force behind escalating drug spending, especially by altering the market share. Over the past decades, the worldwide pharmaceutical market has become characterized by persistent increase in expenditures . This haDrug price regulation policies have been investigated in previous studies, although the association between price regulation and drug spending is questioned ,7. AlthoSimilarly, existing evidence regarding new technologies usually focuses on their potential economic burden but ignores their market impact. New technology entries are never a single market event. Instead, new technologies diffuse into the market. As a result, it is important to establish a longitudinal evaluation of the diffusion of new drugs into a medical care system. This allows policy makers to monitor patients' access to new drugs and contain unnecessary expenditures. However, unlike innovation within other markets -12, studThe purpose of this study, therefore, was to use Taiwan's National Health Insurance (NHI) database, to empirically explore the association between policy interventions and drug expenditure, utilization, and market structure across time frame. For the purpose of this study, the particular pharmaceutical market we chose was that of the non-steroidal anti-inflammatory drugs (NSAIDs) and cyclooxygennse-2 (COX-2) inhibitors, and the time frame was a 4-year time period, 2001-2004.Our data were drawn from the 2001-2004 NHI databases, a nationally, population-based claims database. There're several advantages of using Taiwan's NHI database to quantSecond, under the single-payer system of NHI, Taiwan has established a national formulary (positive list), which includes all drug products subject to reimbursement by NHI. This detailed list of drug formulary allows the researcher to provide information on prescriptions of each NSAIDs product dispensed to their beneficiaries and associated cost paid by the NHI at the level of product.We provided quarterly data between January 2001 and December 2004 on all our analyses. In our analyses, we aimed to track two price regulations that could affect the use and costs of NSAIDs: the price regulation implemented in April 2001 (the second season (S2) of 2001; 2001S2) and March 2003 (2003S1). In, Taiwan, the NHI imposes direct price controls on drugs by fixing the reimbursement prices product by product. Every one or two year, the NHI implements the price regulation to re-set the reimbursement price of each product. The association between NHI's reimbursement of two COX-2 inhibitors, the entries of these new NSAIDs, in April 2001 (2001S2) and July 2001 (2001S3) and changes of drug expenditure were also of concern. According to NHI's Principles on Drug Reimbursement Price Approval , a new dAll NSAIDs prescribed in ambulatory visits in the NHI system during our study period were included. In Taiwan, NSAIDs could be prescribed by physicians to patients who needed it (approved indications from common pain to arthritis) and covered by the NHI program, patients could then get NSAIDs without out-of-pocket payment. As a result, the NHI database could capture the use and cost of NSAIDs.For each NSAIDs prescribed, the pharmacy record of NHI databases included drug codes (a 10-digit coding system that uniquely identifies product reimbursed by the NHI), dosages, quantities, starting date (date prescription was dispensed) and prescription duration to track all necessary information. For those who took any of these medicines, the NHI databases also provided information allowing one to track the indications of their treatment.Firstly, we calculated the aggregated mean quarterly drug cost (reimbursement price multiply quantities filled) and volume (converted into defined daily dose (DDD)) according to the World Health Organization definitions ) of all Segmented regression analysis for interrupted time series was used to determine the significance of the differences in slopes over time due to four interventions: (1) price regulation I , (2) new entry , (3) price regulation II , and information shock . While the pre-intervention segment serves as the control for the post-intervention segment, segmented regression analysis for interrupted time series data provides a credible methodological approach to measure the effect attributable to a specific event in time, i.e. the implementation of an intervention . Proper In order to describe market share of all NSAIDs products over time, we categorized these products based on their reimbursement price. For those prices in 75%, 25-75%, and 25% quartile of total products, we defined them as high-priced, medium-priced, and low-priced NSAIDs, respectively. The category was then used to describe the change of market share of NSAIDs during our study period. In addition, we separated two COX-2 inhibitors from high-priced NSAIDs to further clarify their net effect as a new technology on change of market share of NSAIDs. We then applied Herfindahl index of concentration to further estimate the effect of policy interventions on market structure of NSAIDs over time. In general, Herfindahl indices between 0.10 and 0.18 define the market to be moderately concentrated and indices above 0.18 to be concentrated. As the market concentration increases, competition decrease and the chances of monopoly increase.Cost of NSAIDs per RA or OA ambulatory visit varied over the period of study. The mean quarterly cost increased approximately 30% from NT 217.40 to NT 285.40 (currency exchange rate is approximately NT33 to US1) at the end of 2004. The cost dropped immediately by almost 20% after the price regulation was introduced in April 2001 (2001S2), although the negative change was not significant (p = 0.62). This decrease was short-lived, however, after the adoption of two COX-2 inhibitors. The cost has significantly increased 40% after adopting the COX-2 inhibitors . The second price regulation did not stop the trend . However, the expenditure declined when rofecoxib, one of the new entries, was withdrawn from the market and adoption of two COX-2 inhibitors (p = 0.82). A 7% increase of NSAIDs volume, from 13.74 DDDs (2003 S1) to 14.68 DDDs (2003 S2) was observed sooner after the introduction of the second price regulation in March 2003 (2003 S1) indicating a higher utilization in response to the lower price reimbursed. However, this change was short-lived because the long-term change after the implementation of second price regulation was not statistically significant (p = 0.05) across our observational period. This NSAIDs market, however, was changed after the introduction of two COX-2 inhibitors (celecoxib and rofecoxib). The market share of these products had been largely substituted by celecoxib and rofecoxib up to 26.92% and 19.68%, respectively, in a three-year period (from 2002 S2 to 2004 S3). Celecoxib, the pioneer COX-2 inhibitor, appeared to have the first-mover advantage in Taiwan's NHI system after its listing into the NHI's benefit coverage and continued to increase thereafter. Its competitor, the follower COX-2 inhibitor (rofecoxib), however, did not follow the same diffusion pattern as celecoxib. It took about two years to reach its market share to 20.22% (2003 S4) after its listing and sustained a 5% market share gap to celecoxib thereafter. Overall, the combined effect of new entries had taken about 50% (2004 S3) of the market originally taken by other high-priced NSAIDs. The information shock due to rofecoxib's withdrawal, yet, was a good opportunity to celecoxib (market share of celecoxib from 26.92% to 36.30%) and other high-priced NSAIDs (market share from 48.01% to 57.60%) because they immediately took the market originally taken by rofecoxib . In the entire 4-year period drug cost per RA/OA visit increased approximately 30% and we have found that new entry could be the main driving force that impacts the pharmaceutical market most in Taiwan even under policies of price regulation. The fact that market entry of COX-2 inhibitors was associated with nearly a one-third increase in the cost per visit raises concerns about the comparative value of new drugs, especially in therapeutic area where some might question whether the new drugs are truly distinguished from older therapies.This study captured the market changes from two price regulations implemented by the Bureau of NHI. However, the association between these regulations and the market changes was very short-lived, especially under the driving force of entries of new COX-2 inhibitors. In Taiwan, price regulations were based on results of an annually survey of market price and volume. The "reference pricing" or "generic grouping" techniques were also used to reduce the price variation among products with similarity of active ingredients. Using 1996-2003 NHI's claim data, Lee et al has repoThis study, using NSAIDs as a case, has tried to reveal a more detailed picture of changes in drug expenditure, utilization, and market structure after price regulations. Although the two price regulations used similar concepts and techniques, their impacts are different. The second price regulation implemented on March, 2003 (2003S1), however, did not significantly changes NSAIDs expenditure. Instead, it was associated with a substantial change of the NSAIDs volume prescribed for RA/OA treatment. Market redistribution may have resulted from providers' replacing products under price regulation with other more profitable products. Alternately, the resulting prescription volume increases may have canceled the changes due to price regulation in a short period.Of great value, this study elucidates how new drugs diffuse into the medical care system, how they begin to substitute for existing products, and how they change the cost of treatment. It is evident from our empirical analysis that the first new entry, celecoxib, diffused rapidly and took less than one year to reach to its plateau of market share after its being listed in NHI's drug benefit coverage. Its competitor, the follower COX-2 inhibitor (rofecoxib), although having a disadvantaged diffusion pattern as compared to celecoxib, continuously and steadily increased its market share. Overall, the two new entries took up about 50% (2004 S3) of the market originally held by traditional NSAIDs. This sizable substitution of new drugs for traditional ones shows the potential of a generous health care system in providing better access to new drugs for their beneficiaries by encouraging the adoption and use of expensive medical technology.The changes of drug expenditure after the market entry of COX-2 inhibitors was very large in Taiwan, the cost of NSAIDs per RA or OA ambulatory visit increased by 40% following the approval of the new drugs. The magnitude of this increase is very high when compared to the overall trend in drug cost increase per ambulatory visit in the NHI system during our study period (drug cost per ambulatory visit NT 220 (yr 2001) and NT 257 (yr 2004), increased by 16.8%) . The BurThe safety of new drugs is another on-going health policy concern, especially when they start being rapidly adopted once they are covered by a national insurance program. There have been several new drugs withdrawn from the market due to severe adverse drug reactions not noticed in the pre-marketing stage. Our study drug, rofecoxib, is one of the most significant examples. The information shock due to rofecoxib's withdrawal was followed by a 6% decline in the cost for RA/OA treatments (NT 304.06 (2004 S3) vs. NT 285.24 (2004 S4)). In the short run, there was only a slight change in drug cost, however. This intervention is more clinically relevant than other ones since the patients' and physicians' perception of the COX-2 inhibitors for RA/OA treatments is expected to be altered. We believed further studies on this issue would be of great benefit to policy makers in managing drug safety signals.Data and design limitations may affect the extent to which the results of this study can be generalized. Although we have specified three important policy interventions and applied segmented regression analysis for interrupted time series to examine changes of drug expenditure and volume after the implementation of interventions, we could not control unobserved exogenous factors. Therefore, our findings could only present an association rather than a causality effect between implementation of interventions and changes of drug expenditure or utilization. Due to data limitation, we could only evaluate the short-term change after the release of information of drug safety . Thus, our aggregated estimate may reveal the change due to the withdrawal event rather than the information on pharmaceutical market. Data were lacking on which to base the differences between reimbursement price and real market price of NSAIDs drugs. As a result, our estimate may not reflect the actual cost and dynamics of the pharmaceutical market. Another limitation is that we assumed that the traditional NSAID and COX-2 inhibitors (new generation of NSAIDs) had identical therapeutic markets, while COX-2 inhibitors may not just be used to replace traditional NSAIDs but they may also be used to increase demand.To our knowledge, our study may be the first study to provide a detailed empirical picture of how policy interventions change the drug market. We have found that any correlation between price regulation and a decrease in drug expenditure appeared to be short-lived, especially under the influence of new entry. This study elucidates how new drugs diffuse into the medical care system, how they begin to substitute for existing products, and how they affect the cost of treatment. For policy makers of health insurance program, a scheduled surveillance for each new entry is therefore suggested to provide a cost-effective treatment to their beneficiaries and constrain escalating expenditure.The authors declare that they have no competing interests.WFH, FY H, and YWT were responsible for development of the study concept and design and the preparation of the manuscript. FYH contributed to data acquisition and statistic analysis. All authors participated in the analysis and interpretation of the data of the manuscript. This manuscript has been read and approved by all authors.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6963/10/218/prepub

A large number of cells containing subunit a of blood coagulation Factor XIII (FXIII) was detected by immunoperoxidase staining in lymph nodes with Hodgkin's disease. These relatively large, multipolar, mononuclear cells were often found in the immediate vicinity of malignant Hodgkin's cells. Intensive characterization of these cells carried out by immunofluorescent and enzymecytochemical techniques in double- and triple-labelling systems on the same sections clearly demonstrated that they represent tumour-associated macrophages (TAMs). FXIII containing-cells showed alpha-naphtyl acetate esterase (ANAE) positivity, and were labelled by monoclonal anti-Leu M3 antibody, a monocyte/macrophage marker, but not at all or only very weakly by anti-HLA-DR. Neither alkaline phosphatase (ALP) nor adenosine triphosphatase (ATPase) activity could be detected in these cells and surprisingly, they were consistently negative for acid phosphatase (AcP) as well. The presence of FXIII subunit a in tumour-associated macrophages suggests that this cell type might have an important role in the stabilization of fibrin deposits around tumour cells.

The investigations reported in this paper aim to exploit tumour necrosis factor (TNF)-induced vascular changes in an attempt to increase the tumour uptake of specific monoclonal antibody. The vascular permeability to monoclonal antibody of a human tumour xenograft increased 2.6-fold by 1 h post injection of 2.5 x 10(3) U of TNF, although this effect was lost by 3 h. The normal tissues also demonstrated increased vascular permeability to IgG, but to a lesser extent. Liver permeability increased 1.5-fold at 1 h but returned to the control value by 6 h. Lung permeability increased 1.4-fold at 1 h post injection and returned to normal by 3 h. Muscle values were not significantly increased compared with controls. The blood activity was cleared more quickly in the TNF-treated mice . This was probably due to the increased vascular permeability in normal organs of treated mice. At 1 day and 3 days post injection, the tumour uptake of the specific, but not the control, antibody was significantly increased by 25% and 29% respectively. This resulted in an increase in the area under the tumour activity curve, and therefore tumour radiation dose, of 25% in treated compared with control mice. In addition, a consequence of the faster blood clearance of the isotope in the TNF-treated mice was a reduction in the area under the blood activity curve of 12%, thereby reducing systemic toxicity. The increase in vascular permeability to IgG following TNF injection resulted in both specific and control antibodies having improved access to the tumour antigens, and a transient increase in uptake was observed. Only in the case of the specific antibody was the increase maintained, since this antibody binds to the available antigenic sites, whereas the control antibody was cleared from the tumour without binding. No evidence of tumour necrosis was observed at the TNF doses given, nor was there any toxicity to the mice.

It has been demonstrated that ambient particulate matter (PM) can act as an adjuvant for allergic sensitization. Redox-active organic chemicals on the particle surface play an important role in PM adverse health effects and may determine the adjuvant effect of different particle types according to their potential to perturb redox equilibrium in the immune system.We determined whether the adjuvant effect of ambient fine particles versus ultrafine particles (UFPs) is correlated to their prooxidant potential.We have established an intranasal sensitization model that uses ambient PM as a potential adjuvant for sensitization to ovalbumin (OVA), which enhances the capacity for secondary OVA challenge to induce allergic airway inflammation.N-acetyl cysteine was able to suppress some of these sensitization events.UFPs with a greater polycyclic aromatic hydrocarbon (PAH) content and higher oxidant potential enhanced OVA sensitization more readily than did fine particles. This manifests as enhanced allergic inflammation upon secondary OVA challenge, leading to eosinophilic inflammation and mucoid hyperplasia starting at the nasal turbinates all the way down to the small pulmonary airways. The thiol antioxidant The adjuvant effects of ambient UFP is determined by their oxidant potential, which likely plays a role in changing the redox equilibrium in the mucosal immune system. Ambient particulate matter (PM) exposure as a result of fossil combustion activity and vehicular traffic is associated with increased cardio-respiratory morbidity and mortality . This inPM adjuvant effects have been demonstrated in both animal and human studies . AlthougH1) and increase in T helper 2 (TH2) immunity in the respiratory tract . Organicimmunity . This let effect , 2003b. 1 and IgE in the blood. We also used morphometric analysis of mucosubstances and eosinophils to show that the allergic sensitization leads to an allergic inflammatory response in both upper and lower airways. Finally, we measured IL-5 and IL-13 production as signature cytokines for TH2 allergic inflammatory responses. We found that the enhanced in vivo adjuvant effects of the concentrated ambient UFP correlate with a higher in vitro oxidant potential and higher content of redox-cycling organic chemicals.In this study, we used a murine intranasal sensitization model and a precise amount of size-fractionated ambient PM collected by particle concentrators in the Southern California Particle Center to determine how this concentrated PM may contribute to an adjuvant effect through intranasal administration in a murine OVA sensitization model . This mohttp://www.ehponline.org/docs/2009/0800319/suppl.pdf) for information.See Supplemental Material (available online at http://www.ehponline.org/docs/2009/0800319/suppl.pdf)].We used the Versatile Aerosol Concentrator Enrichment System (VACES) to collect ambient atmospheres composed of PM < 2.5 μm as well as PM < 0.15 μm in downtown Los Angeles . The colN-acetyl cysteine (NAC) at a dose of 320 mg/kg through intraperitoneal injection 4 hr before each of the intranasal instillations on days 1, 2, 4, 7, and 9. We have previously demonstrated the anti-oxidant properties of this agent in animal and in vitro studies . Mice were housed under standard laboratory conditions approved by the University of California at Los Angeles (UCLA) Animal Research Committee. We used endotoxin-free OVA as the allergen for allergic sensitization. On day 1, mice in the PM exposure group received intranasal instillation of 0.5 μg of the PM suspension in a total volume of 50 μl. Mice in the OVA-only and control groups received the same volume of saline alone. On day 2, animals in the PM exposure groups received intranasal instillation of 0.5 μg PM together with 10 μg OVA, whereas those in the OVA and control groups received OVA and saline only. Intranasal instillations were repeated on days 4, 7, and 9. In a different experiment, we administered the thiol antioxidant studies . After a studies , and sac1 (OVA-IgG1) and IgE (OVA-IgE) by enzyme-linked immunosorbent assay (ELISA) collections and differential BAL cell counts as previously described . The rig (ELISA) . Quantifhttp://www.ehponline.org/docs/2009/0800319/suppl.pdf). Nasal and lung tissues were prepared for morphometry and immunocytochemistry as described in detail in the Supplemental Material (available online at http://www.ehponline.org/docs/2009/0800319/suppl.pdf).Tissues were removed from the nasal and intrapulmonary axial airway sections as shown in Supplemental Material, Figure 1 (available online http://www.ehponline.org/docs/2009/0800319/suppl.pdf)] (http://www.ehponline.org/docs/2009/0800319/suppl.pdf) describes the methods in detail.Quantitative analyses of stored muco-substances and eosinophils in the surface epithelium lining of the maxilloturbinates in the proximal nasal section T1 and of the proximal and distal axial airways in the lung were estimated using computerized image analysis and standard morphometric techniques, as previously reported . SupplemWe used heme oxygenase-1 (HO-1) protein expression in the murine macrophage cell line (RAW 264.7) as a biological oxidative stress marker that reflects the prooxidant potential of concentrated ambient PM , 2003b. We determined the abiotic assessment of the oxidant potential of CAPs by the dithiothreitol (DTT) assay. This assay quantitatively measures superoxide production by redox cycling organic chemicals such as quinones . We havehttp://www.ehponline.org/docs/2009/0800319/suppl.pdf) .t-test was used to distinguish between pairs of groups. We considered p < 0.05 statistically significant. Pearson correlation coefficients were calculated to examine associations between the oxidant potential and the chemical content of PM near Interstate highway 110 and used them in an OVA intranasal instillation model. In the initial setup, the mice received saline, OVA (10 μg), or OVA (10 μg) plus UFP (0.5 μg) for allergic sensitization. To exclude the possibility that the nanosized carbon core of the UFP was promoting the adjuvant effect, we also used an equivalent amount of ultrafine carbon black particles (CB) as a control. BAL analysis showed that both UF#1 and UF#2 were quite effective in enhancing OVA sensitization. Compared to saline, OVA alone, CB alone, or CB plus OVA, UFP plus OVA induced a statistically significant increase in the BAL eosinophil count and IgE (OVA-IgE) in the plasma . The principal pathologic changes were mucous cell metaplasia/hyperplasia of airway epithelium accompanied by a mixed inflammatory cell infiltration in the underlying lamina propria (http://www.ehponline.org/docs/2009/0800319/suppl.pdf)]. Morphometric determination of numeric cell density showed a significant increase of eosinophils at the nasal mucosa biopsy sites [http://www.ehponline.org/docs/2009/0800319/suppl.pdf)].We determined the extent of the allergic sensitization by nasal and pulmonary histopathology and airway morphometry. Only mice exposed to the UFP/OVA combination exhibited allergic inflammation in the nasal mucosa . These c propria The infiThe nasal mucosa and BAL changes were accompanied by histologic evidence of eosinophil and mononuclear cell infiltration around small airways in OVA/UFP-sensitized mice . SimilarMice exposed to OVA only exhibited definitive but milder epithelial and inflammatory alterations in the large-diameter, preterminal and small-diameter, terminal bronchioles . Moreove1 and IgE antibody production. We obtained similar results with UF#2 ] (http://www.ehponline.org/docs/2009/0800319/suppl.pdf)] (a]pyrene (BaP) that can be metabolically converted to redox cycling quinones such as the benzo[a]pyrene quinones (BaP-Q). To determine whether the observed adjuvant effect can be correlated to differences in the oxidative stress potential of the UFP and < 2.5 μm collections, we performed abiotic and biotic assays that reflect their oxidant potential (p < 0.05). Calculation of the Pearson correlation coefficient confirmed that the higher PAH content of UFP correlates with HO-1 and DTT results ] . The PAHpl.pdf)] . For insotential . HO-1 exotential , 2003b. otential . We baseotential . This as results , Table 1 results .1 responses, the UFP-only collection (UF#1) was associated with significant adjuvant effects (http://www.ehponline.org/docs/2009/0800319/suppl.pdf).UF#1 differed significantly from F/UF#1 in its adjuvant effects in our intransal sensitization model . Althoug effects . Similar effects . For a din vivo (H2 cytokines (IL-5 and IL-13) as well as several other proinflammatory mediators on OVA challenge 1A1, CYP2E1, NADPH quinone oxydo-reductase-1, and glutathione S-transferasepi 1 and mu 3 in human alveolar macrophages, suggesting the formation of biologically reactive metabolites and the role of carbonaceous core of PM as a physical carrier (in vivo so as to skew the immune response to TH2 cytokine production (in vivo PM effects. Although the tenets of the hierarchical oxidative stress model still needs to be confirmed in vivo, the biological significance of oxidative stress in PM adjuvant effects was previously confirmed by the use of NAC (1 production (Organic chemical compounds such as oxy-PAHs and quinones are relevant organic chemical species in terms of PM redox chemistry and ROS generation . A recen carrier . Quinone carrier . Althoug carrier . These p carrier . That leoduction . In conte of NAC . We furtoduction .The physical and chemical properties of UFP play important roles in particle deposition in the respiratory system and translocation to the extrapulmonary tissues . The smaH2 differentiation through an impact on DC signaling pathways (H1 responses (Little is known about the immunologic basis for PM adjuvant effects. Prooxidative PM can skew the immune response toward Tpathways . One exppathways . This ispathways . Anotheresponses . Similaresponses .in vivo model system for studying the adjuvant effect of ambient PM on allergic sensitization. This model demonstrates that ambient UFPs, but not F/UF, can act as an adjuvant to promote TH2 polarization and to enhance allergic sensitization. The adjuvant effect of UFP is premised on redox chemistry, which is closely related to the prooxidative organic chemical content on these particles.In summary, we have established a highly sensitive

N—H⋯O hydrogen bonding is present in the crystal structure.In the crystal structure of the title compound, [Cu(C DOI: 10.1107/S1600536809004577/xu2458Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

CONSTANS, CONSTANS-LIKE, TOC1) domain.The plant circadian clock has at its core a feedback loop that includes TIMING OF CAB2 EXPRESSION 1 (TOC1). This protein has an as of yet unknown biochemical activity. It has been noted that the extreme amino-terminus of this protein is distantly related in sequence to response regulators (RR), and thus TOC1 is a member of the so-called pseudo response regulator (PRR) family. As well, the extreme carboxy-terminus has a small sequence stretch related to the other PRRs and CONSTANS (CO)-like proteins, and this peptide stretch has been termed the CCT (for To extend further our understanding of the TOC1 protein, we performed a ROSETTA structural prediction on TOC1 orthologues from four plant species. Phylogenetic interpretations assisted in model construction.From our models, we suggest that TOC1 is a three-domain protein: TOC1 has an amino-terminal signaling-domain related to response receivers, a carboxy-terminal domain that could participate both in metal binding and in transcriptional regulation, and a linker domain that connects the two.The models we present should prove useful in future hypothesis-driven biochemical analyses to test the predictions that TOC1 is a multi-domain signaling component of the plant circadian clock. In cignaling ,21,22. TCONSTANS, CONSTANS-LIKE, TOC1) in the carboxy-terminus . As. As63]. cription ,15-18,242+ oscillates with an evening peak close to the time that TOC1 is most abundant [TOC1 [2+ interacts with TOC1 posttranslationally, an idea that is consistent with the fact that calcium rhythms are unaffected in the toc1-1 mutant [2+ signal. If true, TOC1 could generate this function by direct interaction with Ca2+. A direct test of Ca2+-binding to TOC1 seems a plausible experiment to implicate this protein as a sensor for the circadian levels of Ca2+. From there, it would be of interest to test TOC1 binding to HAP factors, and test the role of Ca2+ in supporting or attenuating this binding.What could be the function of module III in TOC1? It is intriguing that the concentration of cytosolic Caabundant ,29. cAMP1 mutant . This caHow likely are the TOC1 models we present to be correct? This is difficult to assess. In fact, the community standard to answer this question requires the actual structure to be determined . In the e.g. Ca2+ or a redox signal) and that this is part of a transcription complex declare that they have no competing interests.EK, HS, MP and SJD performed the work. EK and SJD wrote the paper.Structural file. Structure of AtTOC1_dom1Click here for fileStructural file. Structure of AtTOC1_dom2Click here for fileStructural file. Structure of AtTOC1_dom3Click here for fileStructural file. Structure of CsTOC1_dom1Click here for fileStructural file. Structure of CsTOC1_dom2Click here for fileStructural file. Structure of CsTOC1_dom3Click here for fileStructural file. Structure of LjTOC1_dom1Click here for fileStructural file. Structure of LjTOC1_dom2Click here for fileStructural file. Structure of LjTOC1_dom3Click here for fileStructural file. Structure of McTOC1_dom1Click here for fileStructural file. Structure of McTOC1_dom2Click here for fileStructural file. Structure of McTOC1_dom3Click here for file

In recent years large-scale computational models for the realistic simulation of epidemic outbreaks have been used with increased frequency. Methodologies adapt to the scale of interest and range from very detailed agent-based models to spatially-structured metapopulation models. One major issue thus concerns to what extent the geotemporal spreading pattern found by different modeling approaches may differ and depend on the different approximations and assumptions used.We provide for the first time a side-by-side comparison of the results obtained with a stochastic agent-based model and a structured metapopulation stochastic model for the progression of a baseline pandemic event in Italy, a large and geographically heterogeneous European country. The agent-based model is based on the explicit representation of the Italian population through highly detailed data on the socio-demographic structure. The metapopulation simulations use the GLobal Epidemic and Mobility (GLEaM) model, based on high-resolution census data worldwide, and integrating airline travel flow data with short-range human mobility patterns at the global scale. The model also considers age structure data for Italy. GLEaM and the agent-based models are synchronized in their initial conditions by using the same disease parameterization, and by defining the same importation of infected cases from international travels.R0, and on the fact that the metapopulation model consistently yields a larger incidence than the agent-based model, as expected due to the differences in the structure in the intra-population contact pattern of the approaches. The age breakdown analysis shows that similar attack rates are obtained for the younger age classes.The results obtained show that both models provide epidemic patterns that are in very good agreement at the granularity levels accessible by both approaches, with differences in peak timing on the order of a few days. The relative difference of the epidemic size depends on the basic reproductive ratio, The good agreement between the two modeling approaches is very important for defining the tradeoff between data availability and the information provided by the models. The results we present define the possibility of hybrid models combining the agent-based and the metapopulation approaches according to the available data and computational resources. Computational approaches for the detailed modeling of epidemic spread in spatially-structured environments make use of a wide array of simulation schemes ,2. In reComparing different models is often a hard task. While on one side one would like to assess the role of the differences inherent to each of the modeling frameworks, it is important to establish a common ground between the two frameworks in order to discount unwanted effects due to different parameterization (see for example the discussion of the estimation of the reproductive number for the SARS epidemic obtained from a variety of models in Ref. ). An attHere we provide for the first time a side-by-side comparison of the results obtained at the level of a single country by using state-of-the-art structured metapopulation and agent-based models developed independently and employed in previous works to analyze pandemic events ,24,25,27For the sake of clarity we compare the two models in a clean synthetic experiment of a hypothetical pandemic event for which we assume the same parameterization with regards to the modeling aspects that the models share, such as disease progression and initial conditions. The country used for the study is Italy, a large European country that provides the necessary geographic and population heterogeneity to assess the models' performance in the case of highly-structured populations. The two approaches access different granularity levels and we use as a comparison the finer spatial resolution accessible by both models. This allows us to analyze 39 major subpopulations and project data at the administrative level of municipality.We find that both models, despite the difference in the data integration and model structure, provide epidemic profiles with spatio-temporal patterns in very good agreement. The epidemic size profile shows an expected overall mismatch of 5-10% depending on the reproductive rate, which is induced by the homogeneous assumption of the metapopulation strategy. Breaking down data at the level of age-structured compartments shows that both models provide very similar results with the exception of the elderly population (60 + age bracket), which show larger epidemic sizes in the metapopulation approach. The good agreement of the two approaches reinforces the message that computational approaches are stable with respect to different data integration strategies and modeling assumption. On the other hand, the agent-based model approach may access information not available to the coarser metapopulation approach, and relevant for individually based or targeted intervention measures. This is at the price of a higher computational cost and the availability of fine resolution data, whereas the metapopulation approach is less dependent on detailed data and is computationally cheaper. The presented results hint to the possibility of combining the two methodologies in order to devise multiscale approaches that use the data parsimony of the metapopulation approaches at the global level and the high resolution of the agent-based model in specific locations of interest where detailed data are available.The considered agent-based model is a stochastic, spatially-explicit, discrete-time, simulation model where the agents represent human individuals. The infection can spread among individuals through contacts with household members, school and workplace colleagues, and by random contacts with the general population ,6. One oPopulation data for Italy — 56,995,744 individuals — is obtained from the census of 2001 contacts with infectious members of the household, (2) contacts with infectious individuals working in the same workplace or attending the same school, and (3) random contacts with infectious individuals in the population. While we assume homogeneous mixing in households, schools and workplaces, random contacts in the general population are assumed to depend explicitly on distance. Specifically, the contribution to the force of infection determined by an infectious individual k is weighted by the following kernelof being infected, where Δdik. Parameters a and b were optimized by employing Eq. (3) for generating a synthetic population of commuters such that the resulting probability density function of travel distances matches that obtained by using the gravity model of Eq. (1). The estimated parameters are a = 3.8 km and b = 2.32. As in [a decreasing function of the geographical distance 2. As in ,8,9, thel of Eq. . The estωjl, represents the number of passengers flying between airports j and l, accounting for 99% of worldwide traffic. Each airport is associated to a geo-referenced census area as obtained from a Voronoi tessellation on the population database [39 distinct areas (subpopulations) that define the metapopulation structure we use. A schematic illustration of the model and of the layers considered is reported in Figure The Global Epidemic and Mobility (GLEaM) model is based on a metapopulation approach -21 in whdatabase . GLEaM idatabase . National commuting data available at administrative levels are then mapped into the geographic census areas obtained from the tessellation procedure ,33,34. Ij the number of passengers traveling on each connection j → l at time t defines a set of stochastic variables that follow a multinomial distribution [R0 is determined by the largest eigenvalue of the modified next generation matrix. The full derivation of the epidemic model and its implementation is reported in the Additional File GLEaM is fully stochastic and can simulate the long-range mobility of individuals from one subpopulation to another subpopulation by means of the airline transportation network in a manner similar to the models presented in Refs. -25. In pribution . The calribution . Short-rribution ,41. The ribution . In thisS), latent (L), asymptomatic infectious (Ia), symptomatic infectious (I), and permanently recovered/removed (R) and enter the recovered compartment at rate μ. We fix the average latency period ε-1 = 2 days and the average infectious period μ-1 = 3 days [pa = 0.33 [rβ = 0.5. In addition, both models assume that clinical disease affects individual behavior. GLEaM assumes that symptomatic individuals avoid traveling with probability 1- pt = 0.5 [R0) which is defined as the average number of infected cases generated by the introduction of a typical infectious person into a fully susceptible population [R0 = βμ-1(1 - pa + rβpa) if the age structure is not considered. In the case of the agent-based model, it is computed asA susceptible individual in contact with a symptomatic or asymptomatic infectious person can contract the infection and enter the latent compartment where he is infected but not yet infectious. The transmission occurs at different rates that take into account the reduced infectiousness of asymptomatic individuals and additional effects, e.g. those induced by absenteeism that are considered in the agent-based model and (3). The correct value should be in between the prediction of the models, as supported by the fact that the difference between the models decreases as and (3).TGLEaM and TAB of the metapopulation and agent-based models, respectively. The difference (TGLEaM - T AB) is expressed in days and calculated for each pair of stochastic realizations. Figure R0 explored. We consider both negative and positive differences corresponding to one model anticipating the other or vice versa. GLEaM more likely reaches the peak later than the agent-based model, with a most probable delay of about 2-4 days, explaining the very good agreement in the timing observed in Figure R0, being -3 to 8 days for R0 = 1.5 and -2 to 6 days for R0 = 2.3, showing how higher transmission scenarios would lead to more synchronized epidemics in the two models.The peak delay between the two models is defined as the absolute difference between the activity peak time R0 = 1.9, whereas additional results for the other two values explored are reported in the Additional File Given the high spatial definition of both models, it is possible to further investigate differences in the observed epidemic patterns by looking at the results obtained in different spatial regions of Italy. In particular, we focus on the geographical census areas defined in GLEaM and aggregate the simulation results of the agent-based model from the scale of municipalities to the scale of the geographical census areas. Figure Results in Figure By increasing the spatial resolution even further, it is possible to monitor the geotemporal spread of the disease at the level of the 8,101 municipalities in the country. The results by GLEaM at the level of the geographic census areas are mapped into the administrative boundaries of the municipalities to be comparable with the simulation results produced by the agent-based model. The observed epidemic pattern is shown in Figure R0 investigated. In all cases the agreement is higher in the younger age classes , and deviations start to be more pronounced for the young adult, adult, and older age classes. However, as seen before when considering all age classes, deviations are reduced by the increasing values of R0. The largest deviations observed are in the 60+ age class, with 28% against 16% of the average epidemic size obtained for R0 = 1.5 with GLEaM and with the agent-based model, respectively; 40% against 27% for R0 = 1.9; and 49% against 35% for R0 = 2.3. This is indeed the age class with the most marked difference in household structure and workplace habits that cannot be taken into consideration in the metapopulation level, thus generating the largest discrepancy between the two models.The age structure of GLEaM comprises 6 classes of age, namely 0-5, 6-12, 13-19, 20-39, 40-59, and 60 + years old. Results on the incidence by age as obtained by the agent-based model have been aggregated according to the age structure of GLEaM, which allows us to compare the simulations' results broken down by age classes. Figure We studied a structured metapopulation model and an agent-based model to provide a side-by-side comparison of the modeling frameworks and assess the epidemic predictions that they can achieve. Starting from a shared parameterization of the disease progression and using identical initial conditions, we investigated and quantified similarities and differences in the results at different scales of resolution, and related those to the assumptions of the frameworks and to their integrated data. We found the two models to display a very good agreement in the timing of the epidemic, with a very limited variation in the time of the simulated epidemic activity peaks. In the metapopulation approach the fraction of the population affected by the epidemic is larger (by 5% to 10%) than in the agent-based approach. This difference is due to the assumption of homogeneity and thus the lack of detailed structure of contacts (besides the age structure) in the metapopulation approach with respect to the agent-based approach.Our results highlight advantages and disadvantages of using the two approaches. On one side the detailed mobility networks considered in the metapopulation scheme provide an accurate description of the spreading pattern of the unfolding epidemic, identifying the major channels of transportation responsible for spreading the disease at the global level and quantifying the seeding events. On the other side, detailed estimations of the impact of the disease at a more local level are hampered by the lower level of detail contained in the metapopulation modeling scheme. The agent-based approach is extremely detailed but suffers from the difficulties in gathering high confidence datasets for most regions of the world. The good match between the two approaches in predicting the geotemporal spreading pattern of an epidemic demonstrates the feasibility of a hybrid approach that combines and integrates the two modeling schemes. Thanks to the heterogeneity of the transportation network, the spatio-temporal spread of an epidemic could be predicted at the global scale by employing a metapopulation approach. Taking advantage of the explicit representation of individuals in the model, the impact at a more local scale and the effects of individually-targeted interventions in specific areas could be predicted by employing an agent-based approach.AV is consulting and has a research agreement with Abbott for the modeling of H1N1. The other authors declare no competing interests.All authors have contributed to conceive, design and carry out the study and draft the manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2334/10/190/prepubSupplementary information comparing large-scale computational approaches to epidemic modeling: Agent-based versus structured metapopulation models. A single pdf file 22 pages, the figures are embedded in the pdf.Click here for file

The Internet, created and maintained in part by third-party apomediation, has become a dynamic resource for living with a chronic disease. Modern management of type 1 diabetes requires continuous support and problem-based learning, but few pediatric clinics offer Web 2.0 resources to patients as part of routine diabetes care. To explore pediatric practitioners’ attitudes towards the introduction of a local Web portal for providing young type 1 diabetes patients with interactive pedagogic devices, social networking tools, and locally produced self-care and treatment information. Opportunities and barriers related to the introduction of such systems into clinical practice were sought. Twenty clinicians from two pediatric diabetes teams participated in the user-centered design of a local Web 2.0 portal. After completion of the design, individual semi-structured interviews were performed and data were analyzed using phenomenological methods. The practitioners reported a range of positive attitudes towards the introduction of a local Web 2.0 portal to their clinical practice. Most interviewees were satisfied with how the portal turned out, and a sense of community emerged during the design process and development of the portal’s contents. A complementary role was suggested for the portal within the context of health practice culture, where patients and their parents would be able to learn about the disease before, between, and after scheduled contacts with their health care team. Although some professionals expected that email communication with patients and online patient information would save time during routine care, others emphasized the importance of also maintaining face-to-face communication. Online peer-to-peer communication was regarded as a valuable function; however, most clinicians did not expect that the portal would be used extensively for social networking amongst their patients. There were no major differences in attitudes between different professions or clinics, but some differences appeared in relation to work tasks. Experienced clinical practitioners working in diabetes teams exhibited positive attitudes towards a Web 2.0 portal tailored for young patients with type 1 diabetes and their parents. The portal included provision of third-party information, as well as practical and social means of support. The practitioners’ early and active participation provides a possible explanation for these positive attitudes. The findings encourage close collaboration with all user groups when implementing Web 2.0 systems for the care of young patients with chronic diseases, particularly type 1 diabetes. The study also highlights the need for efforts to educate clinical practitioners in the use of Web publishing, social networking, and other Web 2.0 resources. Investigations of attitudes towards implementing similar systems in the care of adults with chronic diseases are warranted. For individuals with a chronic health problem, the Internet has evolved from being a source for medical information retrieval Web 1.0) to being a dynamic resource for living with a chronic disease, one that is created and maintained in part by third-party apomediation (Web 2.0) .0 to bei. The broThe Web 2.0 and open health service organization perspectives are equally applicable to the modern management of type 1 diabetes, since both possess a common denominator of focus on continuous support and problem-based learning ,8. For mThe benefits of electronic communication used by patients with diabetes, their relatives/caregivers, and health professionals were recently reviewed . AlthougIn light of these findings, it could be questioned why there are only a few Web 2.0 systems in routine clinical use in diabetes care -25. At lThe specific aim of the study is to explore health care practitioners’ attitudes towards the introduction of a local Web 2.0 system tailored to young type 1 diabetes patients and their parents, and to seek opportunities and barriers related to introduction of such systems into clinical practice.In Sweden, all children and adolescents with diabetes are treated by hospital-based pediatric diabetes teams consisting of nurses, nurse specialists, physicians, dieticians, social welfare officers, and/or clinical psychologists . CliniciDuring the spring of 2006, the research group and the two participating diabetes teams launched an Internet portal with specific diabetes-related information and social networking functions for patients and parents . Social Before launch, the portal gradually developed from a design model to the Web 2.0 prototype piloted in 2005 . Thus, tThrough participation in previous user meetings, elaboration work, and individual test use, the interviewees had been informed about the design and functions of the portal. The present study was conducted as a baseline measure before the clinicians started using the portal in their routine practice. The interviewees (with one exception) had not met any patients or parents whom they knew had used the portal.Considering the explorative aim of the study, we used an inductive approach to construct an interview guide with questions we believed would provide information concerning the research issues. The guide asked questions about general attitudes towards using information technology in health care, related computer skills and use of computer aids at work, perceived possibilities and motivation to participate in the elaboration of the portal, and expected consequences for clinicians and patients, both pro and con.Of the 23 active members of the two diabetes teams, 20 were interviewed, including seven doctors, eight nurse specialists in diabetes, one nurse, two dieticians, and two social welfare officers. Two members of the research group and one person who did not agree to the interview were excluded. The interviewees had been working at the clinic for eight years on average (ranging from 1-24 years), and the majority were female. After participants gave their informed verbal consent, audio-recorded qualitative telephone interviews were conducted in August and September 2006. The interviews were semi-structured. The interviewees could raise issues themselves, and they were given time to develop answers in response to their interviewer. Follow-up questions were asked in an attempt to receive more in-depth answers. On average the interviews lasted for 30 minutes.We analyzed the interviewees’ experiences within the context of culture using a recent form of phenomenology developed in American nursing studies . The intIn order to structure the data, the tapes were transcribed verbatim. The interviewer read the transcriptions while listening to the audio-recorded interviews and made a few corrections. Throughout the analysis, each of the staff categories, namely doctors, nurses, dieticians, and social welfare workers, was considered separately. First, the interviewer broadly categorized the issues that were discussed, which to a large extent comprised the research questions. Next, she coded all text in the categories line by line according to substantive content , and theAll interviewees reported previous computer and Internet use at home and at work. In most cases, the attitude toward extended use of computers was positive. Problems were attributed to becoming familiar with the portal, implying that interviewees thought they needed to learn more about the workings of the portal. No major differences in attitudes towards using computers, the Internet, or a Web 2.0 portal were found between the different staff categories or clinics, although some differences were observed concerning obstacles to, and opportunities for, using the portal as a means of support in their work. All interviewees participated in the collection of information materials for the portal, including the development of texts and the review of texts written by others. Limited time, lack of skills in Web design, and insufficient information about the writing process were reasons why some interviewees expressed dissatisfaction with their contributions. The respondents participated in accordance with their skills, and no one reported that the work overwhelmed them. Most interviewees were satisfied with the way the portal turned out, and one interviewee said, “I don’t think we’ve ever done things this way and I think it was really nice that so many could be involved in it”.Thus, despite different experiences with the writing process, a sense of community was reported after working with the site. Moreover, the clinicians were confident that the portal’s use in diabetes care would extend beyond the clinics, in addition to being a part of the internal routine of the clinics. Interestingly, most interviewees reported being prepared to keep working on the development of the portal and expected to maintain an active role, as expressed by the following participant:Well, if it’s something we’re going to work with in the future, then of course I want to be involved and participate in it, of course, but ... in some way or another ... so that it seems practical to me too.Expectations varied regarding the impact a Web 2.0 portal would have on the everyday lives of patients and their families. Several interviewees offered optimistic comments:I think it will probably be of great importance to patients to be able to gain access to information so easily .... And anyway, most children and adolescents are familiar with the Internet today ....Others were less hopeful concerning the use of Web 2.0 services. One reason for this was that parents and adolescents were presumed to have different needs, and it might therefore be difficult to design the portal so that it would appeal to all users. Another perceived risk was that only those who were already well informed would use the portal. In accordance with the low expectations of some of the interviewees, others felt that those who were not very interested in Web services in the first place would not become more interested just because of the introduction of new media. One interviewee said, “Many of our patients aren’t very interested in reading at all ... and then when this reluctance is combined with something new, well I don’t know, it’s a problem”.Speculating on the prospects for success of the Web 2.0 portal, clinicians were of the opinion that simply providing information on a website might not be enough to enable all patients or their families to integrate the information available there and increase their self-efficacy. One interviewee explained it this way:And I think there are so many different factors that make it possible for a person to take in information, and I mean ... how the person feels and what things are like in the family, and how easy it is for the person to understand and, well, there’s a lot contributing to what support the person has from those around him.Accordingly, peer-to-peer communication online was specifically noted as being a key function of the portal, since contact between peer families could facilitate living with diabetes, as was suggested by one interviewee who commented that, “Maybe they ... will receive good suggestions from other patients, if they have an opportunity to discuss it”.A few interviewees emphasized the importance of maintaining some professional control over the site in order to reduce the risk of communicating harmful advice or passing along incorrect references concerning the management of diabetes. One interviewee expressed concern over the risk of young people revealing too much personal information about themselves and then regretting it later.Despite the proposed benefits, most interviewees did not expect that the portal would initially be used very much for peer-to-peer contact. Some interviewees thought that social networking functions would probably be most appreciated by the parents of young children with problems, since they were expected to require more support. Others thought that adolescents would be the most frequent users, since they are the group most familiar with the media. One interviewee said that, “A young person may have a lot of questions he might not want to talk about with either his parents or the diabetes nurse, but he may be willing to talk with a friend who’s in the same situation”.However, some interviewees thought that teenagers would ask for the ability to make peer-to-peer contact and then decide against doing so:But even when you arrange something, they don’t always come anyway .... You have to catch adolescents on the run in some way.A common idea which emerged from the interviews was that access to a properly updated portal might encourage some patients to take an active role in learning more about their disease by searching for news and extending their search to other websites. One person said, “It can be a way to get information about things a person doesn’t get around to asking the doctor about, and I think that can be good”.not ask for, and they took different circumstances into consideration. “You can hear how they feel from their voices and the like,” one interviewee said. Thus, direct contact helped staff to provide personalized advice that was adapted to the receiver’s needs at a particular point in time. A possible outcome of this is expressed in the following: “My idea would be maybe to add more information-based questions on this site [the portal] and answer questions about treatment over the telephone”.Another view expressed in the interviews was that, during face-to-face interaction and telephone contact with team members, patients received more complete information, since they could ask questions and receive their answers directly. Team members also provided information the patient did Different complementary ways of providing information are described below:They can read and take in information, and they can get it when they want it and at the pace they want, and if they wonder about something more, they can supplement that information by calling or asking questions at their next visit here. I think that’s good.Most interviewees presumed that all families had a computer and Internet access, and that it was natural for families to get and provide information about diabetes online. However, one interviewee stressed the following:This can’t be the only method available ... so that if you need to get information, you have to do it yourself, and you have to do it on the Internet, period.If everyone does not have access to the information, the portal is not a common source of information, and if the portal should become the primary source of information, this might have negative consequences for those without Internet access.Other reasons for caution that were mentioned by interviewees were the risk that patients would find information that frightened rather than motivated them; that they would develop false hopes about their chances of getting rid of their disease; or that some parents might “escape” into technical information on the Internet when they could not bear the fact that their child had a serious disease. Another risk identified was that patients could believe they were so well informed by the portal that they would not keep appointments with the diabetes team, or they would try their own treatment and fail.According to most of the interviewees, one important function of the Web 2.0 portal was that it facilitated closer interaction between diabetes teams and families. In particular, it was expected that patients having long-term experience with diabetes would be more comfortable asking certain questions via the Internet and that the portal could even stimulate families to contact team members. According to the following interviewees:If you feel uncertain and don’t even want to call and make contact to find out what a staff member can do to help, then you can log on to this site so that you can get information you may need. At the very least, you can make contact.It’s not only the case that there’s a child that has diabetes. There’s a mother and a father who have jobs and take part in leisure-time activities, and maybe there are siblings. They have a very full schedule. They might not be able to reach us during the day when we’re here, but when they come home in the evening and things have calmed down, maybe they can send a message or a question, or maybe say that they need some [diabetes] device.However, several interviewees also pointed out that it was unclear whether current legislation permitted email contact with patients, while others were uncertain about this but expected email communication to be safe. One interviewee stated, “I can do my banking online, so I certainly should be allowed to communicate with patients.Other expected benefits of the portal were more traditional Web 1.0 functions . Newly updated diabetes information would be available to families at any time . Options for repeating information received in person at the clinic, as well as for updating old information, were also mentioned. For instance, children with early onset diabetes need to learn about their disease while growing up in order to become independent, since when they are young, their parents have more knowledge about the disease. The interviewees also emphasized, however, that the purpose of Web information was not to have families take on the responsibility of obtaining all information by themselves.Since the information on the portal available from each respective diabetes team was identical to information provided at the clinic, it was described as “familiar”. Several interviewees expressed that a locally shared source of reliable information, such as references to verified websites, would be a great support to their work with patients, assuming that it was regularly updated. It could also be used by new team members or other staff, as commented on in the following: “I think this is a function the portal could provide to make it easier for those who don’t work much with diabetes. That function would be to provide advice that doesn’t deviate too much from what they receive from the diabetes team”.Conformity of information could create a sense of security for families and also for relatives, friends, and school staff who want information. It was also thought that better informed patients would interact more often by asking more questions that would stimulate clinicians to keep up to date with news about diabetes care. Supplying patients with information about the responsibilities of the clinic was perceived as a challenge to the diabetes team: “For us it can also be a way to be a little more on the ball because it’s out there in public view”.Another expected benefit of the Web 2.0 portal was its use in support of routine clinical checkups. The portal was described as a means of achieving a more informative and effective clinical encounter, which touches on the topic of time. Lack of time and how to deal with this problem was an issue often raised during the interviews. Several interviewees expected the portal to save time in the execution of some routine tasks and when providing general information. A few interviewees related the following:I thought it sounded good because it could supplement what we don’t have time for during visits to the clinic .... instead of having to call ....Most interviewees thought that extended use of email would save time and increase flexibility. Since patients need to be able to talk with a health care worker in acute situations, email was not perceived to be the best option in every situation. In addition, one interviewee stated that he did not want to be unexpectedly overwhelmed by email:I want to know when my contact with patients will take place as I would if, for example, I had fixed email hours. Currently, we have fixed telephone times.We found that pediatric practitioners reported a range of positive attitudes towards the introduction of a local Web 2.0 portal for young diabetes patients in their clinical practices. This is in contrast to attitudes of “resistant compliance” to computers in routine work reported in some other settings ,36. The As diabetes treatment largely consists of daily self-care, enhanced patient education and support remain essential to pediatric practitioners’ efforts to improve quality of care ,13,30,31Constructive attitudes could also be attributed to the fact that a local Web 2.0 portal was perceived as potentially beneficial for both patients and staff. Other studies have indicated that two significant outcomes of using a Web 2.0 portal in routine care are the empowerment of patients and facilitation of work due to time-saving, simplified routines ,38. ConfPractitioners expressed an open attitude and positive expectations towards the idea of more informed patients and parents, as well as the support of apomediation in online peer networks. However, they also expressed doubt concerning the progress and actual use of this section of the portal. Internet support groups have, however, reportedly improved parents’ relationships with their children with special needs . In addiWith regards to the issue of control, practitioners seemed to accept the loss of direct control over information when patients began to inform themselves by using apomediators online. Modern diabetes care involves teamwork which aims at developing empowered and well-informed patients. Participation in, openness to, and problem-based learning about the discipline of self-care have been regarded for many years as essential elements of pediatric diabetes care ,30,31. IBecause it is difficult to design a website that will attract patients and parents with different proficiency and preferences, some interviewees feared that the site might be used primarily by those who were already well informed. This perceived risk seemed to stimulate the clinicians desire to “keep the site alive”, and they expected that this would result in new work tasks . Importantly, some pointed out that the portal cannot replace personal contact. They emphasized that individualized telephone contact or face-to-face interaction, particularly in emotionally difficult situations and when complex issues are involved, will remain necessary. Finally, another source of anticipated loss of control was that, with the clinicians’ work routines available online, patients could more efficiently question the clinicians’ planning of services.This study has some important limitations that need to be taken into account when interpreting the results. The study does not provide information about the attitudes of care teams, other than those involved during the design process. It is not possible, based on the data, to predict if the specific functions of the Web 2.0 portal will produce benefits during routine use, even though the practitioners in this study thought that the disadvantages, if any, would be outweighed by the advantages. In addition, because the study was performed using qualitative methods for data collection and analysis, it is not possible to quantify the attitudes observed. For instance, both generally positive attitudes and attitudes which expressed some doubt regarding the support of apomediation were recorded, but this study cannot quantify the proportions of these views. A strict, independent categorization of data by a second researcher might have further strengthened the validity of the results.For future research, larger studies are warranted which would take into account the views of practitioners, as well as diabetes patients and their families, on the routine use of Web 2.0 portals, and such studies should include the collection of both qualitative and quantitative data. Investigation of attitudes towards implementing similar systems in the care of adults with chronic diseases are needed as well. Little is known regarding predictors for success . As every patient community has its own characteristics and needs, there is probably no such thing as a “one size fits all” model. Finally, the extent to which increasingly well-informed patients might stimulate creative dialogues remains to be explored, whether these take place between patients and care teams or within care teams themselves, with the aim of attaining coherent views and increased quality of care .We found a range of positive attitudes towards the introduction of a local Web 2.0 portal and perceived benefits for patients of experienced clinical practitioners working with young diabetes patients. These findings contrast with previous reports and may hypothetically be associated with the early and active involvement of clinicians and their patients in the development work.The implications of the results for future implementation of Web 2.0 systems in health care include the need for education of clinical practitioners in the use of Web 2.0 and the understanding that collaboration with all user groups is beneficial for developing the site. The findings are encouraging for the development and implementation of Web 2.0 resources as part of the care of young patients with chronic diseases, in particular those suffering from type 1 diabetes. There might also be important implications for the care of adult patients with diabetes and for other diagnosis groups as well.

Cornelia de Lange syndrome (CdLS) is a rarely seen multisystem developmental disorder syndrome characterized by facial dysmorphia , upper-extremity malformations, hirsutism, cardiac defects, growth and cognitive retardation, and gastrointestinal abnormalities. The features of this disorder vary widely among affected individuals and range from relatively mild to severe. Early in life, the distinctive craniofacial features in mild de Lange syndrome may be indistinguishable from the severe phenotype. We present here a case of newborn with CdLs. Cornelia de Lange syndrome (CdLS), also called Brachmann-de Lange syndrome, is a multiple congenital anomaly syndrome characterized by a distinctive facial appearance, prenatal and postnatal growth deficiency, psychomotor delay, behavioral problems, and malformations of the upper extremities. Cardiac defects and gastrointestinal anomalies are common, and many additional physical features occur, including myopia, palatal abnormalities, genitourinary abnormalities, congenital diaphragmatic hernias and hearing loss. Facial dysmorphism includes arched eyebrows, synophrys, short nose with anteverted nares, long philtrum, thin upper lip, and micrognathia ,2. The mA one-day old female newborn was referred to our hospital with the complaints of seizure and multiple congenital anomalies. She was the only child of a non-consanguineous marriage, born of a 37 weeks gestation normal vaginal delivery. On physical examination he had arched like confluent eyebrows and well-defined, long curly eyelashes, low anterior and posterior hairline, short neck, depressed nasal bridge, down-turned angles of the mouth and thin lips, cleft palate, microcephaly, excessive body hair figure , 2, and Laboratory analysis including complete blood count, biochemical parameters and urinalysis were normal. Transthoracic echocardiography showed patent foramen ovale and patent ductus arteriosus. Cranial magnetic resonance imaging was normal. Chromosomal analysis was done on peripheral blood lymphocytes according to conventional techniques. The analysis revealed a normal female karyotype .The features of this disorder vary widely among affected individuals and range from relatively mild to severe. Based on the clinical variability in CdLS, Van Allen et al. proposedMutations in the NIPBL, SMC1L1, and SMC3 genes cause CdLS. In 2004, two independent groups ,8 found Genotype-phenotype correlations in the study of Gillis et al. and Yan The clinical phenotype of our patient is concordant with the classical type CdLS Table . AnalyseWe present one case of CdLS of neonatal diagnosis that we consider of interest due to the importance of an early recognition of the clinical condition for the family advice and the medical aid and for an appropriate development. Cornelia de Lange syndrome is a rare but well characterized syndrome. The key diagnostic features are the distinctive facial features, limb anomalies and growth retardation.Written informed consent was obtained from the patient for publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.The authors declare that they have no competing interests.HU, DAS, KK contributed to writing and preparation of manuscript. MU conveived the case report. All authors read and approved the final manuscript.

Primary hyperparathyroidism (pHPT) is a common disease that often remains undetected and causes severe disturbance especially in postmenopausal women. Therefore, national recommendations promoting early pHPT detection by plasma calcium (P-Ca) have been issued in Sweden. In this study we aimed to investigate variation of P-Ca analysis between physicians and health care centres (HCCs) in primary care in county of Skaraborg, Sweden.In this cross sectional study of patients' records during 2005 we analysed records from 154 629 patients attending 457 physicians at 24 HCCs. We used multilevel logistic regression analysis (MLRA) and adjusted for patient, physician and HCC characteristics. Differences were expressed as median odds ratio (MOR).HCC 1.65 [1.44-2.07]) and physicians (MORphysician 1.95 [1.85-2.08]). The odds for a P-Ca analysis were lower for male patients (OR 0.80 [0.77-0.83]) and increased with the number of diagnoses (OR 25.8 [23.5-28.5]). Sex of the physician had no influence on P-Ca test ordering (OR 0.93 [0.78-1.09]). Physicians under education ordered most P-Ca analyses (OR 1.69 [1.35-2.24]) and locum least (OR 0.73 [0.57-0.94]). More of the variance was attributed to the physician level than the HCC level. Different mix of patients did not explain this variance between physicians. Theoretically, if a patient were able to change both GP and HCC, the odds of a P-Ca analysis would in median increase by 2.45. Including characteristics of the patients, physicians and HCCs in the MLRA model did not explain the variance.There was a substantial variation in number of P-Ca analyses between both HCCs (MORThe physician level was more important than the HCC level for the variation in P-Ca analysis, but further exploration of unidentified contextual factors is crucial for future monitoring of practice variation. Primary hyperparathyroidism (pHPT) is a common disease that often remains undetected and causes severe disturbance especially in postmenopausal women. Therefore, national recommendations promoting early pHPT detection by plasma calcium (P-Ca) have been issued in Sweden ,2. In thpHPT is a potentially serious condition leading to increased morbidity and mortality from cardiovascular disease and cancEven though previous studies indicate that the frequency of P-Ca analyses differs between health care centres (HCC) the undeThe aim of this study was to investigate the relative importance of the different levels in the health care organization for P-Ca analyses using the Skaraborg Primary Care Database (SPCD). Identification of factors contributing to the variation can be of relevance for planning interventions for an optimal frequency of P-Ca analyses and for evaluating the national recommendations.Skaraborg is a rural area in Sweden and comprised 255 758 inhabitants in 2005. The public primary care is a part of the Västra Götaland region and serves 97% of the population (n = 247 985). All the HCCs (n = 24) use the same computerised medical record, ProfDoc Journal III facilitating data extraction. SPCD has been created containing encrypted data from patients and caregivers from all HCCs. The database contains patients' age, sex, diagnoses, laboratory analyses, and drug prescriptions. The HCCs' laboratory facilities are accredited by SWEDAC (the Swedish Board for Accreditation and Conformity Assessment). The validity of the information in the database has recently been audited and judged to be mostly appropriate but varying with type of diagnosis aIn order to control for compositional confounding at the patient level we included an individual risk score for P-Ca-analysis. The inclusion of this variable did not explain the variation between physicians and between HCCs. Further, our empirical analysis found that the sex of the physician had no influence on P-Ca test ordering, in contrast to a study from Israel where female physicians ordered more test . Older aAs explained in previous studies ; the meaThe risk for selection bias is low since this study is based on a large sample from a primary care area serving 97% of the population. Moreover, as this study is a retrospective database study, the ordering of analyses is not influenced by the study. A limitation of the study is that the frequency of ICD coded patient visits varies both between HCCs and according to diagnosis [Different views of the reason for screening could also affect the result. However national recommendations are well known in Swedish primary care ,2 thus tIn this study only the variables available in the SPCD database were included. In previous studies, other characteristics of the physician, such as attitude to risk taking and involvement in development of guidelines, explained parts of the higher level variance .We found that there was variation between physicians and between HCC in ordering of P-Ca analysis, which is in line with previous studies . HoweverNational recommendations in Sweden have been issued to increase the frequency of P-Ca analyses to detect more patients with pHPT. There is a substantial variation in number of P-Ca analyses primarily between physicians but also between Health Care Centres. Female sex of the patient and increasing number of diagnoses is associated with higher propensity of P-Ca analysis. Physicians under education order most P-Ca analyses and locum least, but sex of the physician has no influence.The authors declare that they have no competing interests.SD conceived the study, drafted the manuscript, responded to the reviewer comments and critically revised the manuscript. PH conceived the study, participated on the design of the study, performed multilevel analyses and interpretation of data responded to the reviewer comments and critically revised the manuscript. HO participated on the design of the study, supported PH in the performance of the multilevel analyses and interpretation of data. RE conceived the study and critically revised the manuscript for important intellectual content. JM participated in the design of the study and interpretation of data and critically revised the manuscript for important intellectual content. KBB Conceived the study, drafted the manuscript, responded to the reviewer comments and critically revised the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2296/11/43/prepubAll the variables in the risk score equation. We selected ICD-10 coded diagnoses and symptoms associated with pHPT. A risk score for a P-Ca analysis was created with stepwise logistic regression based on age, concomitant diagnosis and drug treatment. Total number of patients 154 629.Click here for file

Transcriptome variability is due to genetic and environmental causes, much like any other complex phenotype. Ascertaining the transcriptome differences between individuals is an important step to understand how selection and genetic drift may affect gene expression. To that end, extant divergent livestock breeds offer an ideal genetic material.We have analyzed with microarrays five tissues from the endocrine axis of 16 pigs from both sexes pertaining to four extreme breeds . Using a Bayesian linear model approach, we observed that the largest breed variability corresponded to the male gonads, and was larger than at the remaining tissues, including ovaries. Measurement of sex hormones in peripheral blood at slaughter did not detect any breed-related differences. Not unexpectedly, the gonads were the tissue with the largest number of sex biased genes. There was a strong correlation between sex and breed bias expression, although the most breed biased genes were not the most sex biased genes. A combined analysis of connectivity and differential expression suggested three biological processes as being primarily different between breeds: spermatogenesis, muscle differentiation and several metabolic processes.These results suggest that differences across breeds in gene expression of the male gonads are larger than in other endocrine tissues in the pig. Nevertheless, the strong presence of breed biased genes in the male gonads cannot be explained solely by changes in spermatogenesis nor by differences in the reproductive tract development. It is well known that variability at the transcriptome is in part due to genetic causes, much like any other complex phenotype, e.g., . Thus, tAlthough the differences between tissues and across development stage transcriptomes is a well known fact -4, the vIn order to study the impact of breed differentiation on the pig's transcriptome, we have analyzed the breed and sex differences across different tissues. Among tissues that are of interest, those involved in the different endocrine axes stand out as a promising choice, considering their fundamental biological role and that their transcriptomes have not been widely analyzed. Here we report a detailed microarray analysis of five tissues that make up two main endocrine axes, the HPTA and HPT axes, plus fat tissue, in four highly divergent porcine breeds. Both HPTA and HPT axes are highly influential endocrine axes and, we conjectured, must be responsible for at least some of the large phenotypic differences between breeds caused by artificial selection in livestock, e.g., in fat content.The tissues sampled were hypothalamus (HYPO), adenohypophysis (AHYP), thyroid gland (THYG), gonads (GONA) from both sexes, males (GONAM) and females (GONAF), and back fat tissue (FATB). Some of their primary endocrine roles are in Additional file 2), i.e., the variance of the effect divided by the total variance. We and others /SD [(PSg1 - PSg2)|y] where subscripts 1 and 2 refer to males and females, respecively. Similarly, the j-th breed z-score for g-th probeset is defined as zgj = E(PBgj|y)/SD(PBgj|y). A rough measure of how much the expression varies across breeds is computed as the standard deviation of the breed Bayesian z-scores, i.e., for probeset g SDzbreed, g = hclust R function. The distance chosen was one minus the Pearson correlation (r) across variables, this distance is bound between 0 (r = 1) and 2 (r = -1).Bayesian methodology offers several advantages over more traditional least square or maximum likelihood approaches and these will not be discussed here ,31. It satistics . We obtad probesets are either breed or sex biased, and, among them, a subset of nOBS probesets belong to module j. In addition, suppose that nj is the total number of probesets in the module j. The expected number of probesets in the module is simply nEXP = nd × nj/12,000 . This value is corrected when not all nd probesets are among the 12,000 employed for the module analysis. We computed the chi-squared statistics, (nOBS - nEXP)2/nEXP, and the associated P-values. We did this for each module and tissue separately.As genes function in concerted action, which is best described by networks, we studied differential connectivity and checked whether most differentially expressed genes belonged to a specific group of highly co-regulated genes (a module). To do that, we characterized the number of modules using the approach in employinGene ontologies and GO over representation were analyzed with onto-tools .r2 = 0.97).Hormonal concentrations were measured in duplicate in plasma using commercial testosterone , estradiol and progesterone EIA kits . All assays were conducted following the manufacturer's protocol. The assays were validated for pig plasma by demonstrating that serial dilutions of plasma were parallel to the displacement curve for the reference standards. Hormone standards spiked with pig plasma produced accurate results of hormone recovery is also available on request. Contact the author for details.DU: Duroc pig breed; FDR: False Discovery Rate; GO: Gene Ontology; HPT: hypothalamic-pituitary-thyroid axis; HPTA: hypothalamic-pituitary-gonadal axis; IB: Iberian pig breed; GCRMA: GC Robust Multiarray Average; LW: Large White pig breed; QRT-PCR: Real Time Quantitative Reverse Transcription Polymerase Chain reaction; SD: standard deviation; UPGMA: Unweighted Pair-Group Method with Arithmetic Mean; YL: Youli pig breed.All carried out research; MPE conceived research, analyzed data and wrote the manuscript; MLB supervised dissection and co-wrote the manuscript. All authors read and approved the final manuscript.Tissues sampled.Click here for fileComplete list of sex z-scores for every tissue. HYPO: Hypothalamus; AHYP: adenohypophysis; THYG: thyroid gland; GONA: gonads; FATB: backfat. Yellow underlined probesets correspond to the 100 most sex biased in each tissue.Click here for fileOver represented Gene Ontology (GO) categories among the 1700 most sex biased genes in gonads.Click here for fileMeans (SD) of the standard deviations of breed Bayesian z-scores.Click here for fileComplete list of breed z-scores in each tissue. LW: Large White; DU, Duroc; YL, Youli; IB, Iberian; HYPO: Hypothalamus; AHYP: adenohypophysis; THYG: thyroid gland; GONA: gonads; FATB: backfat; SD, standard deviation of breed z-scores for each breed and tissue.Click here for file

AQP5 mRNA and protein expression in KC and non-KC corneal tissues using a combination of techniques.Keratoconus (KC) is a common progressive corneal disease characterized by excessive stromal thinning, central or paracentral conical protrusion, and disruptions in Bowman’s layer. The etiology of KC is largely unknown, and a combination of genetic and environmental factors is believed to play a role in the origin of the disease. Recently, the absence of transcripts of the water channel, aquaporin-5 (AQP5), was demonstrated by reverse-transcription polymerase chain reaction (RT–PCR) in KC tissues and was proposed as a possible marker for KC. In this study, we sought to evaluate AQP5 transcript and protein expression patterns was performed by means of real time RT–PCR, immunohistochemistry, immunocytochemistry, and flow cytometry methods. Cell culture was performed to identify AQP5 protein expression in KC epithelial cells.A total of 69 samples of corneal tissue were analyzed including 39 corneal buttons from patients with advanced KC, 16 samples of non-KC corneal epithelium belonging to patients who underwent surface refractive surgery, 12 sclerocorneal rims obtained from healthy donor subjects, and two healthy corneal buttons. Determination of AQP5 mRNA was expressed with no significant differences between KC and non-KC tissues. Moreover, AQP5 protein expression analysis did not reveal differences in protein levels and/or cell location among KC and non-KC tissues. Interestingly, AQP5 expression continues for up to 21 days in the isolated KC corneal epithelial cells.AQP5 expression.Our results do not support a role for AQP5 in KC etiopathogeny or as a disease marker. Genetic background differences or a distinct pathogenetic KC cascade specific to the analyzed population could account for the dissimilarities observed in KC-related Keratoconus (KC) is a heterogeneous disorder in which the cornea assumes a conical shape as a consequence of a gradually progressive non-inflammatory thinning of the corneal stroma. Corneal thinning in KC individuals induces irregular astigmatism, myopia, and central or paracentral conical protrusion. The calculated incidence of KC is between 1 in 500 and 1 in 2,000 individuals in the general population . The etiAQP5) gene is normally expressed in corneal epithelial cells where it is presumably involved in fluid elimination as supported by the observation that Aqp5 null mice exhibit abnormalities in both corneal thickness and corneal epithelial water permeability . This result is in agreement with those reported by Rabinowitz et al. [AQP5 mutations in DNA from KC corneas.Altogether, these data indicate that an abnormality in AQP5 mRNA or protein is not likely involved in KC physiopathology. In addition, to determine the possibility of z et al. who did In our study, AQP5 staining by immunohistochemistry revealed a punctate rather than a membrane-associated epithelial pattern. This pattern is identical to that reported previously . An inte

The photosynthetic organelle (plastid) originated via primary endosymbiosis in which a phagotrophic protist captured and harnessed a cyanobacterium. The plastid was inherited by the common ancestor of the red, green (including land plants), and glaucophyte algae . Despite the critical importance of primary plastid endosymbiosis, its ancient derivation has left behind very few “footprints” of early key events in organelle genesis.To gain insights into this process, we conducted an in-depth phylogenomic analysis of genomic data (nuclear proteins) from 17 Plantae species to identify genes of a surprising provenance in these taxa, Chlamydiae bacteria. Previous studies show that Chlamydiae contributed many genes (at least 21 in one study) to Plantae that primarily have plastid functions and were postulated to have played a fundamental role in organelle evolution. Using our comprehensive approach, we identify at least 55 Chlamydiae-derived genes in algae and plants, of which 67% (37/55) are putatively plastid targeted and at least 3 have mitochondrial functions. The remainder of the proteins does not contain a bioinformatically predicted organelle import signal although one has an N-terminal extension in comparison to the Chlamydiae homolog. Our data suggest that environmental Chlamydiae were significant contributors to early Plantae genomes that extend beyond plastid metabolism. The chlamydial gene distribution and protein tree topologies provide evidence for both endosymbiotic gene transfer and a horizontal gene transfer ratchet driven by recurrent endoparasitism as explanations for gene origin.Candidatus Protochlamydia amoebophila UWE25 is an endosymbiont of Acanthamoeba and likely represents the type of endoparasite that contributed the genes to Plantae.Our findings paint a more complex picture of gene origin than can easily be explained by endosymbiotic gene transfer from an organelle-like point source. These data significantly extend the genomic impact of Chlamydiae on Plantae and show that about one-half (30/55) of the transferred genes are most closely related to sequences emanating from the genome of the only environmental isolate that is currently available. This strain, The origin of the photosynthetic organelle (plastid) in eukaryotes occurred via the capture and enslavement of a cyanobacterium (primary endosymbiosis) Chlamydia trachomatis and UWE25 to plant homologs Here we use phylogenomics to search for genes contributed to Plantae by a surprising source, Chlamydiae bacteria. These prokaryotes are well known as obligate intracellular vertebrate pathogens and encode a unique gene, the ADP/ATP translocase to parasitize energy from the host. This gene is shared by Chlamydiae, Rickettsiales, microsporidians, and photosynthetic eukaryotes. Phylogenetic analysis has demonstrated a chlamydial origin of the plastid-targeted ADP/ATP translocator in algae and plants e.g., . InteresCyanidioschyzon merolaeThe most complete analysis to date of the Chlamydiae-Plantae connection is a phylogenomic study that, as reported, found at least 21 genes of chlamydial origin among the 4,771 predicted proteins in the genome of the extremophilic red alga vis a vis Huang and Gogarten Chlamydia-like cells with the Plantae ancestor that extends beyond plastid establishment. The association may have been one of recurrent infections by one or more specific endoparasite(s) of the Plantae host, as occurs in modern-day environmental Chlamydiae and their eukaryotic hosts Here we reexamine the evolutionary relationship between Chlamydiae and Plantae genes using a phylogenomic approach that incorporates predicted proteins from 17 Plantae genomes to query >500 eukaryotic and prokaryotic genomes in a local database. We use our recently developed automated tree-sorting tool PhyloSort Chlamydia-like source and 20 were shared by at least red and green algae, thereby suggesting their ancient origins in the Plantae see . An expaChlamydomonas and Volvox) and another from Chlamydiae in red algae, chromalveolates, and prasinophytes . This tree is likely explained by differential gene loss in green algae with red and prasinophyte algae retaining the Chlamydiae gene and green algae the cyanobacterial copy. A third example of the types of genes we found is glgA (glycogen synthase) that is shown in Candidatus Protochlamydia amoebophila UWE25; RB = 69%, PB = 75%) and another that is shared by many greens and is derived from an unknown prokaryotic source. Both genes function in the chloroplast. This is the second gene of chlamydial origin that is involved in a carbohydrate metabolic process in which only the C-terminal domain was of Chlamydiae origin. This suggests the fusion of a eukaryotic and a prokaryotic sequence gave rise to these genes. Finally, a number of proteins were identified that showed Plantae-Chlamydiae monophyly but fell below the 50% bootstrap threshold. These trees were not counted in our final tally but may in the future turn out to also be of chlamydial origin.Although the origin of the 55 Chlamydiae-like genes in Plantae may appear to be most easily explained by a long-term endosymbiotic association between these prokaryotes and the host, it is also worth considering whether these sequences may have arisen from multiple Chlamydiae sources and could simply reflect a long history of endoparasitism. For example, even though many (20) of the Chlamydiae-like genes were present in both red and green algae , others were detected only in red algae (3) and glaucophytes (1). This pattern could be explained either by wholesale gene loss in Plantae lineages or multiple HGTs in these taxa. Speaking against the latter scenario is the apparent absence of Chlamydiae endoparasites in extant algae and plants, although this certainly may not have been the case ca. 1 billion years ago when Plantae radiated et al.et al.tra genes in UWE25 of proteobacterial origin and they proposed these could play a role in conjugative DNA transfer. The Chlamydiae genes that survived in the nucleus of Plantae either replaced host proteins or provided novel functions and were therefore retained, whereas the majority of the endoparasite genes that were potentially transferred were lost over time. If the Chlamydiae-like cell was in fact a bona fide organelle then its loss would have precipitated the decay of many genes that served this compartmental function. This explains why the Chlamydiae contribution to Plantae algal nuclear genomes pales in comparison to that of the permanent cyanobacterial endosymbiont, i.e., ca. 1,000–1,500 Plesiocystis pacifica SIR-1 interrupted the Chlamydiae+Plantae clade and we interpret these also as examples of HGTs into the “contaminating” taxa.The presence of a type IV secretion system (TFSS) in the sequenced genome of UWE25 that is missing in pathogenic strains provides a mechanism by which environmental Chlamydiae DNA could integrate into the host genome IR-1 see . This geHere we apply our knowledge of Chlamydiae gene transfers and other aspects of plastid evolution to propose a model for the origin of this organelle. We assume that in the phagotrophic Plantae ancestor, diverse bacteria were captured with many cyanobacteria retained for harvesting fixed carbons, whereas others were digested. It is therefore easy to imagine that over time prey DNA integrated via non-homologous recombination into the host genome. An analogous process operates in modern-day eukaryotes when organelles undergo degradation, thereby increasing the rate of DNA integration into the nuclear genome This scenario could change however if some randomly activated prey genes in the host nucleus were selected and fixed in the population Once these pivotal events had taken place, the path was paved for the subsequent evolutionary innovations that characterize canonical plastids such as the TOC-TIC translocons, the origin of import signals at the N-terminus of many nuclear-encoded plastid targeted proteins, extensive EGT, and outright endosymbiont gene loss resulting in highly reduced plastid genomes using reciprocal BLAST against a 17-species Plantae database derived from complete genome and EST data . The Plantae included 7 green algae and land plants , 8 red algae , and 2 glaucophytes . This search identified 16,173 candidate proteins.To identify genes of putative Chlamydiae origin in Plantae we first screened 12,061 predicted proteins from seven Chlamydiae genomes (−10 and distance trees were generated using neighbor-joining (NJ) with Poisson distance correction and 100 replicates of a bootstrap analysis. We then used our recently developed tree topology search tool PhyloSort to identify all NJ trees that showed the monophyly of Chlamydiae and Plantae . PhyloSort is used to search for user-specified subtrees that contain a specified monophyletic group. Because a genome-wide analysis produces a significant number of trees that share multiple genes due to multiple gene copies and gene families, PhyloSort provides an estimate of the number of unique gene families by clustering the trees that contain overlapping genes to summarize these families. Using PhyloSort and a minimum threshold value of 50% bootstrap support we found 345 trees that fulfilled this topological criterion. These 345 alignments were then used for a second round of phylogenetic analysis using bootstrap (100 replicates) maximum likelihood (ML) phylogeny inference with RAxML using the hill-climbing algorithm and the WAG substitution model, the PROTGAMMA (+Γ) implementation with 4 discrete rate categories and starting from a random tree. The ML method was used to verify the results of the less robust NJ analysis and reduced the set of target trees to 291. Clustering of the RAxML bootstrap trees using PhyloSort resulted in a “unitree” set of 68 phylogenies each of which was manually inspected to verify the topology.Thereafter, we used PhyloGenie Plantae homologs of the 68 Chlamydiae proteins were then used to query a final data set that included all previous data but with the addition of excavate and other protist partial EST data downloaded from GenBank dbEST Table S1The list of 55 genes of Chlamydiae-like origin that were found in the 17 Plantae genomes analyzed in this study using phylogenomic methods. Shown are the tree IDs, the source of the sequences, the GI/accession numbers in the source database, the gene annotations in that database, the Arabidopsis homolog GI numbers and putative functions, the Chlamydiae homolog GI numbers and putative functions, the minimum bootstrap value that unites Chlamydiae and Plantae in each protein tree, the distribution of the genes in Plantae , the results of targeting predicitions using 5 different programs, our inferred predictions for cellular localization, and the phylogenetic position of UWE25 in each protein tree .(0.33 MB PDF)Click here for additional data file.Table S2The 55 RAxML bootstrap trees that were identified by our phylogenomic analysis to support the monophyly of Chlamydiae and Plantae . The tree ID see precedes(1.56 MB PDF)Click here for additional data file.Table S3Complete set of taxa present in our local genome database that was used to search for chlamydial genes in Plantae.(0.24 MB PDF)Click here for additional data file.

Genomic analysis will greatly benefit from considering in a global way various sources of molecular data with the related biological knowledge. It is thus of great importance to provide useful integrative approaches dedicated to ease the interpretation of microarray data.Here, we introduce a data-mining approach, Multiple Factor Analysis (MFA), to combine multiple data sets and to add formalized knowledge. MFA is used to jointly analyse the structure emerging from genomic and transcriptomic data sets. The common structures are underlined and graphical outputs are provided such that biological meaning becomes easily retrievable. Gene Ontology terms are used to build gene modules that are superimposed on the experimentally interpreted plots. Functional interpretations are then supported by a step-by-step sequence of graphical representations.When applied to genomic and transcriptomic data and associated Gene Ontology annotations, our method prioritize the biological processes linked to the experimental settings. Furthermore, it reduces the time and effort to analyze large amounts of 'Omics' data. Genome-wide analyses provide an unprecedented amount of data leading to new interpretation challenges. Classical microarrays can monitor the expression of potentially all genes within a cell or a tissue sample. More recently, new applications have been developed. They include chromatin-immunoprecipitation-chip (ChIP-on-Chip), analysis of alternative splicing (Exon array), characterization of the methylome, polymorphism genotyping (SNP array), copy-number measurements (CGH array) and genome resequencing . A grIn a multidimensional exploratory approach, a microarray data set is usually analyzed by multivariate analysis (MVA) among which Principal Components Analysis (PCA) is the most used. PCA is well adapted to the framework of 'Omics' data as it can handle data sets with much more variables (genes) than samples (arrays). To analyze simultaneously several data sets, the proper way is to use MVA's dedicated to the analysis of multi-way data tables; the method of reference being the generalized canonical analysis (GCA) . In the et al. , where each Kj corresponds to an 'Omics' data table. Firstly, separate analysis are performed by principal components analysis (PCA) on each group j of variables. Secondly, a global analysis is carried out: each variable belonging to a group j is weighted by 1/Kj. The rationale of the scaling is that information that is common to the data tables emerges. Besides no data table can, by itself, generate the first dimension of the global analysis. The first dimension's variance of each data table is then equal to one. In such way, MFA provides a balanced representation of each individual according to the joint data table K, but also a partial representation of each individual according to each of the group j of variables. The corresponding graphical displays are read as for PCA. The partial individual ij is on the side of the variables of the group j for which it takes high values, and on the opposite side of the variables of the group j for which it takes low values. Partial representations of a same individual are all the more close that they do express the same information. And, the balanced representation of an individual i is located in the exact barycenter of the points {ij, j = 1,..., J}. Each category is represented by the center of gravity of the cloud of all its constituting individuals. The representation of the variables is used to describe the dimensions as in PCA. MFA provides also a representation of each matrix of variables (Groups Representation) that allows the visualization of specific and common structures. Consequently, it is possible to get an overall picture of the common structure emerging from the Kj.We consider the merged data set: i. Each n × pi, where n is the number of tumors and pi is the number of genes associated with the BP i. We then used one feature of MFA that consists in the addition supplementary groups of variables. These supplementary groups of variables do not participate to the construction of the dimensions. This is essential since a gene belonging to several biological processes would have more importance in the analysis if the groups were active. This feature lies as MFA could be seen as a particular generalized canonical analysis where the general variables are related to the sets of variables as strongly as possible in the sense of the Lg measure (instead of the multiple correlation coefficient R2). The Lg measure between one numerical variable z and a set of variables vk, k = 1,..., Kj} is defined by the inertia of all variables vk projected upon z. If Lg = 0, the variable z is not correlated to any variable of the set Kj. Due to the MFA weighing, 0 ≤ Lg ≤ 1 and Lg = 1 when z is the first principal component of Kj. Let Fs be the dimension of rank s provided by MFA performed on K. The projection of the Wi is a a (I × I) matrix the coordinates are always comprised between 0 and 1, and (ii) a small distance between two groups along the principal component of rank s means that these two groups include the structure expressed by Fs each one with the same intensity. This representation of the groups is made available by means of a graphical display of the By integrating biological knowledge, we want to identify the biological processes that best reflect the molecular changes characterizing the conditions under study. From a biological point of view, a biological process can be seen as a module of genes (set of genes with related molecular data); from a statistical point of view, a biological process can be seen as a group of variables. We formalized the BP modules as MDT interpreted and analyzed the data, provided drafting of the article, collected and assembled the data. Statistical methodology were defined by SL, FH and MDT. GO modules were computed by MA and MDT. R package FactoMineR has been developped by FH and SL. The biological interpretation was performed by MDT, MA and JM. SL, FH and JM supervised this study and contributed to continuous discussions. All authors have read and approved the final manuscript.

Anguilla with 16 species plus three subspecies) spend most of their lives in freshwater during their catadromous life cycle. Nevertheless, because their spawning areas are located offshore in the open ocean, they migrate back to their specific breeding places in the ocean, often located thousands of kilometres away. The evolutionary origin of such enigmatic behaviour, however, remains elusive because of the uncertain phylogenetic position of freshwater eels within the principally marine anguilliforms. Here, we show strong evidence for a deep oceanic origin of the freshwater eels, based on the phylogenetic analysis of whole mitochondrial genome sequences from 56 species representing all of the 19 anguilliform families. The freshwater eels occupy an apical position within the anguilliforms, forming a highly supported monophyletic group with various oceanic midwater eel species. Moreover, reconstruction of the growth habitats on the resulting tree unequivocally indicates an origination of the freshwater eels from the midwater of the deep ocean. This shows significant concordance with the recent collection of mature adults of the Japanese eel in the upper midwater of the Pacific, suggesting that they have retained their evolutionary origin as a behavioural trait in their spawning areas.Of more than 800 species of eels of the order Anguilliformes, only freshwater eels (genus This resulted in the diversification of freshwater eels to include temperate species that make long migrations back to their tropical spawning areas. This argument is consistent with the figure 1b).The long spawning migrations of the catadromous anguillid eels from freshwater to far out in the ocean have fascinated scientists for almost a century e.g. , but thefigure 1The hypothesis of a sea water origin of the freshwater eels seems certain following a compelling argument by In this study, we conducted a phylogenetic analysis based on the whole mitogenome sequences of 58 species (including 31 newly determined sequences) representing all of the 19 families of the Anguilliformes (including the four ‘saccopharyngiform’ families), plus two outgroups, to address the evolutionary origin of the freshwater eels in a phylogenetic context. The resultant tree topology explicitly demonstrates that the freshwater eels form an exclusive clade with diverse oceanic midwater species placed in six families. This surprising discovery offers a new perspective on the evolutionary origin of the freshwater eels and may provide novel insights into the evolutionary process of their unique catadromous migrations.2.We assembled whole mitogenome sequences from 56 anguilliforms representing all 15 anguilliform families, plus all four saccopharyngiform families currently recognized . BecauseMitogenome sequences from the 56 anguilliforms plus two outgroups were arranged into the typical gene order of vertebrates, aligned with MAFFT v. 6 , and thexML v. 7.2.4 (Γ) model of sequence evolution (the model recommended by the author) with 1000 bootstrap replicates (−f an option in RAxML).Unambiguously aligned sequences were divided into five partitions and the dataset was subjected to the partitioned maximum-likelihood (ML) analysis using RAv. 7.2.4 . The besesquite v. 2.6 bootstrap probabilities BPs; . Althougp > 0.99).Apparently, the higher level classification of the anguilliforms requires substantial revision based on more extensive taxon and character sampling. Significantly, however, the present ML tree unequivocally places the freshwater eels at the top of the anguilliform phylogenies and they are nested within a more comprehensive monophyletic group (clade A) supported by 100 per cent BP. Other than the freshwater eels, clade A comprised the four saccopharyngiform families and two congroid families (Nemichthyidae and Serrivomeridae), with these six families containing 47 species placed in 10 genera . Intereset al. How can we explain why this apparent evolutionary shift of the freshwater eel life history from the oceanic midwater to freshwater occurred? These two environments are remarkably different and require fishes to be adapted to very different ecological and physiological constraints. One possibility is that in tropical regions at the time of the divergence of anguillids, there was a productivity gradient between freshwater and marine environments as hypothesized by Regarding the characteristics of the first freshwater eels, it should be noted that the present ancestral character reconstruction is based on the traits of the extant species and thus it does not specify the character state between nodes B and C . If therAnguilla japonica, at depths of about 220–280 m in the western North Pacific (The closest relatives of anguillid eels found in this study are the mesopelagic eels of the Nemichthyidae and Serrivomeridae that spawn in the open ocean, with their larvae mixing in the ocean surface layer with those of anguillids (

The increased understanding of the molecular basis of oral cancer has led to expectations that correction of the genetic defects will lead to improved treatments. Nevertheless, the first clinical trials for gene therapy of oral cancer occurred 20 years ago, and routine treatment is still not available. The major difficulty is that genes are usually delivered by virus vectors whose effects are weak and temporary. Viruses that replicate would be better, and the field includes many approaches in that direction. If any of these are effective in patients, then gene therapy will become available in the next few years. Without significant advances, however, the treatment of oral cancer by gene therapy will remain as remote as the legendary pot of gold at the end of the rainbow. Recent research into oral cancer has revealed a large amount of information about the nature of the disease. The details of many of the genetic changes are now available, raising the possibility that they could be reversed and that the growth of the tumors could be prevented. At the same time, information has accumulated about the oral viruses that could be used as delivery systems for the new treatments. Efforts to treat oral cancer in this way have thus been in progress for over 20 years. Despite this there is still no scientific evidence that oral cancer in humans can be managed by any form of genetic manipulation, or by the use of any viral vectors. Nevertheless, interest in the subject is maintained by promising advances in animals and by the unfortunate lack of progress in competing fields such as chemotherapy. This review surveys the most promising aspects of gene therapy that have emerged in the last two decades, and attempts to identify the areas in which the most effort should be invested.In many cases of oral cancer some genes are defective, and replacing them with a normal variant is an obvious therapeutic strategy. The gene that has attracted most attention is p53, which is defective in about 50% of cases. Efforts to replace p53 have existed for 20 years, starting in cell culture and advancing through animal studies to phase I clinical trials . The resAnother approach to therapy consists of suppressing genes that have become defective or are overexpressed. There are numerous examples of such genes, including regulators of apoptosis , genes fMany anti-cancer drugs can be delivered as inactive precursors, and be activated by enzymes that are encoded by specific genes. If such genes can be provided to tumor cells only, then systemic delivery of the drug precursor could lead to an effective anti-tumor effect without side effects in other tissues. The most popular example of this approach has been to provide the gene for thymidine kinase from herpes simplex virus type 1 (HSV-1) to cells or tumors, followed by the pro-drug ganciclovir . AnotherAlthough there are several non-viral methods of transferring genes to oral cancer cells, it is generally accepted that viruses provide the most efficient form of transfer. Early experiments used viruses that were mutated so as to prevent their replication, but more recent work has focused on viruses that can replicate in specific tumor cells.Early efforts at gene transfer were impeded by concerns that the virus vectors might cause infections or malignancies in the recipients. To prevent this, the vectors were prevented from replicating by removal of essential genes. The resulting viruses were still able to transfer marker genes to cells, but since they did not spread the markers were soon lost ,10. CleaA more efficient way to deliver toxic or therapeutic genes is in a virus that can replicate in a tumor cell but can not replicate in any other kind of cell. In the case of HSV-1 this can be achieved by deletion of viral genes that contribute to either neurotoxicity or to replication in normal cells, such as the genes gamma-1-34.5 and ribonucleotide reductase respectively. A viral mutant that lacks both of these genes and has been widely tested is named G207 . Other mAdenoviruses can also be manipulated to limit the tissues in which they replicate. An early example was the adenovirus Onyx015, which has a deletion of the E1B gene that increases its tumor specificity. This virus was tested in early clinical trials, and appeared to show a therapeutic effect in about 14% of patients . FurtherA different approach to change the tissue specificity of a virus is to replace the promoter of an essential gene with a promoter that is particularly active in specific tumors. Gene promoters that have been tested include those from liver , from soAlthough earlier concerns about the safety of viral vectors are now seen as having been exaggerated, there are still potential side effects. Widespread publicity has been given to a fatal reaction to a high dose of adenovirus in a trial of gene therapy for a liver enzyme deficiency , as wellThe effectiveness of conditionally-replicating viruses can be increased still further by arming them with genes that encode toxic functions. Recent examples of such genes include those that encode cytokines such as GM-CSF and thosAll of the viruses that have been used for experimental gene therapy are as antigenic as the wild type viruses, and thus they are can stimulate immune responses that affect their function. To prevent this, various efforts have been made to suppress immunity and increase the effects of the virus.Cyclophosphamide increases the anti-tumor effect of HSV-1 in rodent models of glioblastoma multiforme, and this has been attributed to reductions in complement and natural antibody which normally act together to reduce the replication of the virus ,29. In tFor oral cancers there are few data available on the role of the immune response in the effects of oncolytic viruses. We have tested the effects of HSV-1 on oral cancers in strains of mice that lacked several different components of innate and acquired immunity. The virus was no more effective in any strain , which iThe failure of viruses to spread through solid tumors might be due, in part, to the density of the tissue. In that case, any approach that loosens the tissue might allow more of the tumor to become infected. The injection of proteases such as collagenase or trypsin into experimental glioblastomas before injection of an adenovirus has led to better therapeutic result in one study . The enzIt is a standard practice in cancer therapy to combine two or more agents, because this often produces an additive or synergistic anti-tumor effect. If the side-effects of the agents are different, then this approach can minimize the unwanted effects of treatment. A similar approach has been investigated in the use of oncolytic viruses Table 12,38-4-438-46. Surprisingly, there is little or no acknowledgement among those who have used it that the combination of viruses and cytotoxic drugs should, in fact, be expected to fail. Viruses almost always replicate better in cells that are healthy and growing rapidly. Therefore any cytotoxic drug should reduce the effects of a virus rather than enhance them, and combinations should be less effective than either agent alone. One reason that such combinations can be effective might be that they have been demonstrated only in mutant viruses that lack some essential function. The drug might stimulate the tumor cells to express that function and complement the viruses deficiency. For example, some drugs induce DNA repair functions including the expression of the gene GADD34 that can substitute for the viral gene gamma-1-34.5 . In otheMany approaches to gene therapy of oral cancer now exist in the laboratory, and some have been tested in human patients. However, there seems to be no evidence so far that any gene therapy approach can be expected to be as good or better than conventional approaches to treatment. This is largely due to the lack of any model in which the virus replicates and spreads until the entire tumor is infected and all cells are destroyed. The field, nonetheless, continues to advance and new approaches are continually being brought forward for evaluation. Thus we can expect much more data to emerge over the next few years.Gene therapy is sometimes seen as the pot of gold at the end of the rainbow. However, it must be remembered that not only are rainbows intangible, but the very existence of leprachauns and the pot of gold that they hide at the end is seriously doubted. Whether gene therapy belongs in the same category is unknown and significant improvements are needed to prevent the topic from fading into the category of appealing legends.The author declares that they have no competing interests.

De novo telomere addition is rare in wild-type, sgs1Δ, or exo1Δ cells. In sgs1Δ exo1Δ, repair by GC is severely inhibited, but cell viaiblity remains high because of new telomere formation. These data suggest that the extensive 5′ to 3′ resection that occurs before the initiation of new DNA synthesis in BIR may prevent efficient maintenance of a Rad51 filament near the DSB end. The severe constraint on 5′ to 3′ resection, which also abrogates activation of the Mec1-dependent DNA damage checkpoint, permits an unprecedented level of new telomere addition.In budding yeast, an HO endonuclease-inducible double-strand break (DSB) is efficiently repaired by several homologous recombination (HR) pathways. In contrast to gene conversion (GC), where both ends of the DSB can recombine with the same template, break-induced replication (BIR) occurs when only the centromere-proximal end of the DSB can locate homologous sequences. Whereas GC results in a small patch of new DNA synthesis, BIR leads to a nonreciprocal translocation. The requirements for completing BIR are significantly different from those of GC, but both processes require 5′ to 3′ resection of DSB ends to create single-stranded DNA that leads to formation of a Rad51 filament required to initiate HR. Resection proceeds by two pathways dependent on Exo1 or the BLM homolog, Sgs1. We report that Exo1 and Sgs1 each inhibit BIR but have little effect on GC, while overexpression of either protein severely inhibits BIR. In contrast, overexpression of Rad51 markedly increases the efficiency of BIR, again with little effect on GC. In A chromosomal double-strand break (DSB) poses a severe threat to genome integrity, and budding yeast cells use several homologous recombination mechanisms to repair the break. In gene conversion (GC), both ends of the DSB share homology to an intact donor locus, and the break is repaired by copying the donor to create a small patch of new DNA synthesis. In break-induced replication (BIR), only one side of the DSB shares homology to a donor, and repair involves assembly of a recombination-dependent replication fork that copies sequences to the end of the template chromosome, yielding a nonreciprocal translocation. Both processes require that the DSB ends be resected by 5′ to 3′ exonucleases, involving several proteins or protein complexes, including Exo1 and Sgs1-Rmi1-Top3-Dna2. We report that ectopic BIR is inhibited independently by Sgs1 and Exo1 and that overexpression of Rad51 recombinase further improves BIR, while GC is largely unaffected. Surprisingly, when both Sgs1 and Exo1 are deleted, and resection is severely impaired, half of the cells acquire new telomeres rather than completing BIR or GC. New telomere addition appears to result from the lack of resection itself and from the fact that, without resection, the Mec1 (ATR) DNA damage checkpoint fails to inactivate the Pif1 helicase that discourages new telomere formation. To maintain cell viability and preserve genomic integrity, cells employ multiple pathways of homologous recombination (HR) to repair DSBs in vivo molecular biological experiments indicate that the early steps of GC and BIR are shared Genetic and sgs1Δ cells Following resection, Rad51-mediated strand invasion of the donor template occurs with similar kinetics, but the initiation of DNA synthesis at the 3′-end of the invading strand is greatly delayed in BIR as compared to GC SGS1 or EXO1 increases the efficiency of BIR whereas overabundance of Sgs1 or Exo1 strongly inhibits it. Overexpression of Exo1 also inhibits GC. Deletion of other non-essential factors responsible for DNA resection, TEL1 or SAE2, modestly increases the efficiency of BIR whereas deletion of MRX impairs BIR. Additionally, we find that overexpression of Rad51 markedly improves the efficiency of BIR but has little effect on GC. Finally, we show that Sgs1 and Exo1 redundantly prevent remarkably efficient de novo telomere addition at broken chromosome ends, a pathway dependent on both telomerase and Sae2.To better understand the role of Sgs1 in BIR, we examined mutations of non-essential genes that either cooperate or act redundantly with Sgs1 in many of its roles in DNA metabolism, including DNA resection. Here we show that deletion of Saccharomyces cerevisiae strain JRL346. A galactose-inducible HO endonuclease is expressed to induce a DSB at a modified CAN1 locus approximately 30 kb from the telomere in the non-essential terminal region on Chromosome V (Ch V) . A 3′ portion of the gene (denoted as AN1) with 1,157 base pairs of shared homology to CA on Ch V was introduced in the same orientation into Ch XI, 30 kb from its telomere. Prior to HO induction, these cells are canavanine-resistant (CanR) because CAN1 is disrupted. Completion of BIR results in a non-reciprocal translocation that duplicates the donor sequences and the more distal part of the left arm of Ch XI, thus restoring an intact CAN1 gene. These cells become canavanine-sensitive (CanS) and hygromycin sensitive (HphS). About 20% of cells are viable with 99.85% of these cells repairing by BIR and a small fraction by nonhomologous end-joining (NHEJ). The efficiency of BIR repair allows us to physically monitor the kinetics of repair by PCR, Southern blot and pulse-field gel electrophoresis (PFGE), as described in To study BIR we used the haploid V (Ch V) . The HO URA3 to the other end of the break . The insertion of the URA3-1 sequences also deleted 376 bp in the middle of the CAN1 so there is a gap between the homology shared by the two DSB ends created by HO cleavage (CA-URA3-1) with the donor sequences on Ch XI (AN1). Repair by GC results in restoration of the CAN1 gene, rendering cells CanS, but, unlike BIR, the Ch V arm distal to the cut site is retained. When there is a second end of homology to a DSB break, the cell strongly favors GC over BIR To compare the effects of mutations on GC, we used the isogenic strain JRL475 . The GC sgs1Δ cells after inducing a DSB . In contrast, deleting subunits of the MRX complex, mre11Δ or rad50 Δ, decreased viability nearly 2 fold (both p = 0.003) . The effTEL1 would affect BIR. Similar to sae2Δ, deletion of TEL1 resulted in a small but statistically significant increase in viability (p = 0.008) . Complemexo1Δ has a minimal impact on 5′ to 3′ resection sgs1Δ, deletion of EXO1 (p = 0.001) increased viability nearly 1.5 times compared to wild type whereas in pGAL::EXO1 the efficiency of BIR decreased 10 fold (p<0.001) (exo1 mutations that are required for exonuclease activity (SGS1 or EXO1 (Plamids overexpressing Sgs1 pYES2-SGS1 p<0.001) . Overexpp<0.001) . The stractivity . As showactivity . The inc or EXO1 . When te or EXO1 .RAD51 was expressed under the ADH1 promoter (pDBL(RAD51)) PGK promoter (pSJ5). Strikingly, overexpressing RAD51 in wild type cells caused a 2.5-fold increase in viability (p<0.001) when expressed under control of either promoter . Although TEL1 and SAE2 moderately inhibit BIR and are involved in DNA resection like SGS1 and EXO1TEL1 did not cause new telomere additions at the DSB when ablated in combination with sgs1Δ or exo1Δ nor did deletion of SAE2 in combination with exo1Δ on 12 independent CanR HphS colonies, comparing them to the starting strain and a survivor that repaired by BIR (CanS HphS) (R HphS survivors (lanes 1–11) have a smaller chromosome than the starting (ST) strain or one repaired by BIR (B). We confirmed by Southern blot that the band remaining at the original position of Ch V is Ch VIII, which is approximately the same size as Ch V in this strain background (data not shown). One CanR HphS colony (lane 12) increased in size from the original strain. These data indicate the CanR colonies are not due to mutations in a restored CAN1 gene, and are therefore not repaired by BIR nor by NHEJ that could have deleted a small region including HPH. To confirm that none of the CanR HphS colonies were repaired by BIR, we probed with the MCH2 probe that hybridizes proximal to the telomere on Ch XI . The ethnS HphS) shows thon Ch XI . The MCHR HphS colonies, we next probed the blot with a CAN1 probe that hybridizes to the donor sequences on Ch XI and just proximal (1 kb) to the cut site on Ch V . This result indicates that at least 1 kb of sequence was deleted in the 9 other CanR HphS survivors. To determine approximately how much sequence was deleted in the other CanR HphS colonies we probed the Southern blot with a NPR2 probe that specifically hybridizes to Ch V 4 kb proximal to the cut site . Thus, there is still a brief activation of DSB-induced cell cycle arrest but much shorter than when extensive resection activates Mec1.To verify that that the DNA damage checkpoint was impaired by the lack of normal 5′ to 3′ resection of the DSB ends we microscopically monitored the length of the cell cycle of individual cells plated on YEP-Gal to induce HO endonuclease, from the time that an unbudded G1 cell formed a bud until the dumbbell-shaped mother-daughter pair formed the next bud Rsgs1Δ exo1Δ colonies found in the BIR assay, the CanR colonies in the GC assay appear to be chromosome truncations with de novo telomere formation. PCR analysis showed that the broken chromosomes were truncated at different points proximal of the DSB and Exo1 act in the same pathway, but since the sgs1Δ exo1Δ double mutant has such distinctly different phenotypes from sgs1Δ or exo1Δ it is difficult to know precisely why the double mutant does not show an increase in BIR similar to that seen when Rad51 is overexpressed in sgs1Δ or exo1Δ alone. We note also that other proteins responsible for 5′ to 3′ DNA resection, Sae2 and MRX, do not inhibit BIR in the same fashion; but the behavior of sae2Δ or mre11Δ may be explained by their other important roles in other steps in HR In this work we show that the RecQ family helicase, Sgs1, and the Exo1 exonuclease negatively regulate BIR to maintain genomic integrity. From the observation that the efficiency of BIR was no greater in in vitro for the human Sgs1 homolog, BLM In vivo it is clear that the Sgs1 helicase can dismantle strand annealings and strand invasions if the heteroduplex DNA contains mismatches Sgs1 and Exo1 likely do not act in precisely the same way in inhibiting BIR. Sgs1-mediated inhibition of BIR may involve unwinding of a nascent strand invasion D-loop, as demonstrated Rather than acting on D-loop stability, Exo1 may act on the assembly of the BIR replication fork. In response to DNA damage or defective checkpoint activation, Exo1 has also been shown to process stalled replication forks and resect nascent strands exo1Δ by itself has little visible effect on resection. Overexpression of Rad51 is apparently unable to suppress the consequences of overexpressing Exo1 or Sgs1. It is important to note that Exo1 overexpression is only effective if nuclease activity is preserved; at least some of Exo1's functions in meiosis are independent of nuclease activity . Increasing homology in our assay does not suppress these effects but further increases in homology may do so, as noted above.A unifying hypothesis would be that BIR is severely limited if resection of the DSB ends is too extensive. There is a limited amount of Rad51 in the cell , enough to cover continuously about 10 kb of ssDNA It is possible that overexpressing Rad51 could ensure that the 3′-ended single-stranded DNA was better protected against degradation over the long time required to enact BIR, as previously suggested sgs1Δ exo1Δ double mutant, it is possible that the more severe defect in GC is attributable to the need to resect more than 1 kb of intervening sequence before the “1” end of homology would be single-stranded must be attributable to the elimination of vigorous resection in the double mutant strain, but it is also likely that the failure to activate the Mec1 DNA damage checkpoint also plays a key role. Recently, Makovets and Blackburn sgs1Δ exo1Δ block resection and that prevents Mec1 activation, new telomeres should increase. However, in the assay used by Makovets and Blackburn MEC1 compared to sgs1Δ exo1Δ cells. Hence, it is likely that the 40–50% level of de novo telomere formation we find reflects both the failure to activate Pif1 when the checkpoint is not strongly activated and the severe block on resection itself.Strikingly, Sgs1and Exo1 also redundantly inhibit new telomere formation. In a previous study de novo telomere formation does not require the recruitment of the MRX-Tel1 complex, as a tel1Δ mutant does not affect the formation of new telomeres in an sgs1Δ exo1Δ strain. When resection is blocked by deletion of SAE2 in sgs1Δ exo1Δ cells, new telomeres are absent. The fact that new telomeres were added as far as 4 kb from the DSB site indicates that there is a residual resection activity that–over a period of perhaps many hours–can chew away the chromosome end and expose sites suitable for new telomere addition. However, we show that the MRX-asociated endonuclease SAE2 is required for de novo telomere formation.Apparently In this work we have expanded our understanding of the genetic relationships of factors that negatively regulate BIR. Furthermore, we have provided evidence for a novel repair pathway that is redundantly impaired by Sgs1 and Exo1. Understanding the interplay of these factors in response to DNA damage and uncovering the molecular details of signaling between them to maintain genomic integrity will be an area of much future research.LEU2 marker with a leu2::hisG construct from pNKY85 HMRa-stk gene was then knocked out with an hmr::ADE3 fragment generated by PCR with mixed oligos to generate JRL346. All strains used to study BIR are isogenic to JRL346 and were created by standard gene disruption methods and confirmed by PCR unless otherwise stated HPH cassette CAN1 ORF at nucleotide 1,146 to create strain JRL017 . JRL017 was then modified by transforming in a hphmx::URA3 “marker swap” cassette can1,1-1446::HOcs::URA3::AVT2). To introduce another 2,404 bp of homology to the donor, the can1,1-1446::HOcs::URA3::AVT2 region with Ch V sequences 29,146 to 32,976 was amplified from JRL472 and integrated distal to the HO cut site into Ch V in strain JRL346 to generate JRL475 . As a result, there are Ch V sequences 33,177–32,020 shared between the donor and sequences proximal to the break, Ch V sequences 31,644–29,240 shared between the donor and sequences distal to the break and a 376 bp gap of homology. All mutant strains were created by standard gene disruption methods and confirmed by PCR. Plasmid pSJ5 was constructed by subcloning a XhoI-NotI fragment containing the RAD51 ORF under the PGK promoter form pNSU256 The wild type JRL346 was derived from JRL092 LEU2 marker with a leu2::hisG construct from pNKY85 HMRa-stk gene was then knocked out with an hmr::ADE3 fragment generated by PCR with mixed oligos to generate JRL346. All strains used to study BIR are isogenic to JRL346 and were created by standard gene disruption methods and confirmed by PCR unless otherwise stated HPH cassette CAN1 ORF at nucleotide 1,146 to create strain JRL017 . JRL017 was then modified by transforming in a hphmx::URA3 “marker swap” cassette can1,1-1446::HOcs::URA3::AVT2). To introduce another 2,404 bp of homology to the donor, the can1,1-1446::HOcs::URA3::AVT2 region with Ch V sequences 29,146 to 32,976 was amplified from JRL472 and integrated distal to the HO cut site into Ch V in strain JRL346 to generate JRL475 . As a result, there are Ch V sequences 33,177–32,020 shared between the donor and sequences proximal to the break, Ch V sequences 31,644–29,240 shared between the donor and sequences distal to the break and a 376 bp gap of homology. All mutant strains were created by standard gene disruption methods and confirmed by PCR. Plasmid pSJ5 was constructed by subcloning a XhoI-NotI fragment containing the RAD51 ORF under the PGK promoter form pNSU256 The wild type JRL346 was derived from JRL092 Logarithmically growing cells grown in YEP+2% Raffinose, or the appropriate drop-out media +2% Raffinose, were plated on either YEPD or YEP-Gal, and grown into colonies. Colonies were counted and were then replica plated onto plates containing either canavanine or hygromycin to confirm repair occurred by BIR. Experiments were performed at least 5 times for each strain unless otherwise indicated. To determine the statistical significance between strains the student's t-test was used .Strains were grown in YEP+2% Raffinose to a cell density of 3×10e6 to 1×10e7 cells/mL. A 50 mL aliquot of cells was removed for the zero time point. Freshly made galactose was added to final concentration of 2% to induce HO expression. Cell aliquots were taken at the indicated time points throughout the time course.sgs1Δ and exo1Δ strains. For all other strains tested, at least three PCR reactions from two experiments were performed. The technical replicates from each biological experiment was first averaged and then the technical averages were averaged among the two experiments to obtain a biological average. Data were graphed as the biological averages normalized to the maximum product obtained by amplifying DNA from a strain that has repaired the DSB by BIR. Error bars represent the data range between the biological averages.PCR analysis of BIR was performed as previously described sgs1Δ exo1Δ CanR HphS repaired colonies were performed as described Repair is also measured by Southern blot that detects approximately the first 3 kb of new DNA synthesis was performed as previously described Figure S1LEU2 gene on Chromosome V (Ch V) in which the 3′ end portion of the gene is deleted, the remaining sequences are represented as LE. The donor sequences are the endogenous LEU2 gene on Ch III. Repair of the DSB only occurs by BIR resulting in duplication of the LEU2 gene and the distal sequences on Ch III. (B) Efficiency of BIR as measured by viability following a DSB in wild type (WT), sgs1Δ, or sgs1Δ cells complemented with a plasmid expressing the sgs1-hd allele (psgs1-hd).The helicase-domain of Sgs1 is required to inhibit BIR. (A) In this assay to study BIR, an HO cut site is integrated into an ectopically located (0.21 MB TIF)Click here for additional data file.Figure S2EXO1 inhibits BIR. Kinetics of repair are shown for PCR assays of BIR induced in cycling wild type (WT) and GAL::EXO1 cells. Data are the mean ±data range.Overexpression of (0.13 MB TIF)Click here for additional data file.Figure S3sgs1Δ exo1Δ cells. Kinetics of repair are shown for PCR assays of BIR induced in cycling wild type (WT) and sgs1Δ exo1Δ cells. Data are the mean ± data range for two experiments.The efficiency of BIR is not increased in (0.16 MB TIF)Click here for additional data file.Figure S4of de novo telomere formation by PCR in sgs1Δ exo1Δ CANR survivors from the GC assay. (A) PCR analysis of a starting strain prior to DSB induction (ST), CanS colony that has repaired by HR (S), and ten CanR colonies (R1–R10) with primers that amplify sequences approximately 7.7 kb proximal to the break. (B) PCR with primers that amplify sequences approximately 2.2 kb proximal to the break. (C) PCR with primers that amplify sequences approximately 1 kb proximal to the break. (D) PCR with primers that amplify sequences approximately 250 bp proximal to the break. (E) PCR with a Ch V-specific primer that amplifies all colonies indicated and primer CA16, a telomere-specific primer.Marking of the breakpoint and detection (1.41 MB TIF)Click here for additional data file.Table S1The effect of varied mutants on the efficiency of BIR. The viability of cells that could repair a DSB by BIR as shown in (0.07 MB DOCX)Click here for additional data file.

Objective: The purpose of this study was to assess the effect of several maternal variables on the serologic response following the treatment of syphilis in pregnancy. Methods: A 5-year chart review identified 95 patients coded with syphilis at Hermann Hospital. Inclusion criteria were 1) serologically confirmed syphilis infection during the index pregnancy, 2) complete treatment during the index pregnancy, and 3) minimum of one follow-up rapid plasma reagin (RPR) titer. Forty-nine of 95 patients met the inclusion criteria. Treatment response was evaluated by comparing each post-treatment titer of a patient to her pretreatment titer. Each comparison was considered an “observation.” Each observation was classified as either a positive response (≥4-fold titer decline) or a negative response (<4-fold titer decline). Maternal variables assessed included 1) prior history of syphilis untreated or incompletely treated prior to the index pregnancy, 2) gestational age, 3) titer level, 4) unknown duration, 5) positive response at 1 month, 6) positive response at 2 months, 7) positive response at >3 months, and 8) race. Results: A positive response following treatment was significantly more likely if there was no prior history of syphilis or if there was a high initial RPR titer (>32). Only 33/54 (61%) observations at or greater than 3 months had a positive response. Conclusions: Our study suggests that an absence of a history of syphilis and an initial high RPR titer are predictive of a positive response following appropriate treatment. Given the low percentage of observations with a positive response at 3 months, we speculate that we may be undertreating our pregnant patients with syphilis infection.

In the last decade, the availability of gene sequences of many plant species, including tomato, has encouraged the development of strategies that do not rely on genetic transformation techniques (GMOs) for imparting desired traits in crops. One of these new emerging technology is TILLING , a reverse genetics tool, which is proving to be very valuable in creating new traits in different crop species.To apply TILLING to tomato, a new mutant collection was generated in the genetic background of the processing tomato cultivar Red Setter by treating seeds with two different ethylemethane sulfonate doses (0.7% and 1%). An associated phenotype database, LycoTILL, was developed and a TILLING platform was also established. The interactive and evolving database is available online to the community for phenotypic alteration inquiries. To validate the Red Setter TILLING platform, induced point mutations were searched in 7 tomato genes with the mismatch-specific ENDO1 nuclease. In total 9.5 kb of tomato genome were screened and 66 nucleotide substitutions were identified. The overall mutation density was estimated and it resulted to be 1/322 kb and 1/574 kb for the 1% EMS and 0.7% EMS treatment respectively.The mutation density estimated in our collection and its comparison with other TILLING populations demonstrate that the Red Setter genetic resource is suitable for use in high-throughput mutation discovery. The Red Setter TILLING platform is open to the research community and is publicly available via web for requesting mutation screening services. Solanum lycopersicum) is one of the most important vegetable plants in the world. Its fruits are end products both for the fresh market and food processing industry. Tomato presents a relatively small genome highly syntenic to others economically important Solanaceae species and was selected as a reference species for sequencing a Solanaceae genome. In addition to the availability of a number of genomic resources, including transcriptome [Tomato and aponicus , drosophaponicus ).In the present paper we report the construction of a high-quality tomato genetic mutant reference collection which could be used for both forward and reverse genetic studies. We have developed such a population by mutagenizing the processing tomato variety Red Setter with EMS and establishing an associated phenotype database, LycoTILL, and a TILLING platform. The database also serves as a portal for users to request materials or TILLING experiments.20) with respect to untreated control seeds. The second mutant tomato population was produced by treating 12,000 seeds with 1% EMS (LD49). Out of the 23,000 treated seeds, 13,000 seedlings were grown to fruit maturity in controlled conditions and M2 seeds were collected from individual M1 plants from different plant internodes. In total we collected 6,667 distinct M2 seed stocks, among which 4,741 and 1,926 M2 seed stocks were obtained with 0.7% and 1% EMS treatment respectively. For the production of M3 seed stocks, three seeds per M2 family were sown in nursery, grown to fruit maturity in open field and M3 seeds harvested from individual M2 plants. In total we collected 5,508 M3 seed stocks , the leaf morphology 341), the habit (380) and the plant size (307) classes. In Figure , the habhttp://www.agrobios.it/tilling/index.html[In order to manage and integrate the recorded phenotypic data, we implemented the database LycoTILL. LycoTILL was developed according to a relational database system, interconnecting three main modules: lines, class and subclass of phenotypes. The database interrogation can be done according to the phenotypic catalog, previously reported, or by plant code number (plant name) or family name. The result displays all the collected phenotypic information as well as photos of the mutant lines. LycoTILL, that is an evolving database, is publicly accessible through the web interface: ndex.html.RIN) and green ripe (Gr) genes involved in the ripening of tomato fruit, rab11 GTPase (Rab11a) and expansin 1 (Exp1) genes related to the tomato softening control, polygalacturonase (PG) gene involved in the cell wall hydrolysis, and lycopene beta cyclase (Lcy-b) and lycopene epsilon cyclase (Lcy-e) involved in the carotenoid biosynthesis pathway.To set up the tomato TILLING platform, DNA samples were prepared from 5,221 M3 families corresponding to 3,924 and 1,297 families obtained by treatment with 0.7% and 1% EMS respectively. The selection of M3 families was based on the M3 seed abundance, 287 families were discarded due to their low seed set. DNA samples were organized in pools of 8 M3 families. To validate the 0.7% and the 1% EMS Red Setter TILLING platforms and to estimate the mutation density of the populations, we chose seven genes involved in fruit quality traits. In particular we analysed ripening-inhibitor combIn total 9.5 kb of tomato genome were screened and 66 induced point mutations were identified Table of whichet al. [et al. [We calculated the mutation density in the seven targeted genes Table accordinet al. and Green [et al. . We estiThe optimization of mutagenesis is a critical parameter in establishing a good mutant collection for forward and reverse genetic studies. In order to balance maximum mutation density with an acceptable plant survival rate we decided to utilise two different doses of EMS, 0.7% and 1%. A strict correlation was observed between the EMS doses and the toxicity, the mutation density obtained and the frequency of phenotype alterations. At 1% EMS the plant fertility rate was 41% less than the plant treated with 0.7%. In contrast, the 1% EMS yielded 1.78 fold more mutations per genome than 0.7% treated plant. At the phenotype level, 60% of the mutant phenotypes scored in the M2 generation were derived from the 1% EMS treated seeds.Arabidopsis, maize, wheat and pea, more than 99% of identified mutations are GC/AT transition [In the TILLING screens we analysed seven genes and discovered a total of 66 induced point mutations. The spectrum of expected mutations in an EMS-treated population is essentially GC/AT transition because of the frequent alkylation of guanine residues by EMS . In Arabansition ,19,20,24ansition ,23. In cIn order to rule out the probability that natural polymorphisms, introduced through pollen or seed contamination, could be responsible for the non-GC/AT changes observed in our mutant populations, we analysed the natural sequence variation of the tilled genes using BLAST analysis [Additional file Based on this we speculate that tomato might differ from other plant species in its mutagenic response to EMS doses. Moreover, we think that the choice of ENDO1 enzyme was fundamental in the detection of all types of changes that we observed in our mutant populations. For its high specificity in recognizing mismatches at the same rate we couldThe TILLING screening performed on seven tomato genes permitted the calculation of the mutation density in the two mutant Red Setter populations. We estimated the mutation density at 1 mutation/322 kb in the 1% EMS and 1 mutation/574 kb in the 0.7% EMS Red Setter population. The mutation densities calculated in the 1% and 0.7% EMS Red Setter populations are 2.3 and 1.2 times respectively higher than one mutation every 737 kb reported by Gady et al in the 1This comparison demonstrate that our populations have a higher number of mutations respect to those so far available and published for tomato. The high mutation density of our populations, especially for the 1% EMS one, increases the size of allelic series that can be obtain and reduces the population size that needs to be screened.Arabidopsis [et al. [Comparing the mutation densities estimated in the 1% and 0.7% EMS Red Setter populations with those described in other plant species results that they are 1.9 and 3.4 times respectively lower than one mutation per 170 kb reported previously for bidopsis and ricebidopsis and 2.2 [et al. .So far higher mutation densities were observed only in tetraploid wheat (1/40 kb) and hexaploid wheat (1/24 kb) . It's liA mutant population is considered saturated with at least a single "hit" in every gene . In the We have developed a new genetic resource in the tomato Red Setter genetic background by means of EMS mutagenesis. The mutant collection is organized as such that it could be used for both forward (EMS saturated mutant collection and the associated phenotypic database) and reverse (high-throughput TILLING platform) genetics in tomato, for both basic science or crop improvement.The Red Setter TILLING platform is open to the scientific community to request TILLING screenings in genes of interest and to obtain material.via database that also serves as portal for user need. In addition to our platform, at present, other tomato TILLING platforms are publicly accessible via web for requesting TILLING services (http://urgv.evry.inra.fr/UTILLdb and http://tilling.ucdavis.edu/index.php/TomatoTilling). All the available tomato TILLING platforms, including the Red Setter one, utilise mutant collections generated in different genetic backgrounds and with different EMS doses which increase the chance of obtaining a larger spectrum of alleles. Thus, it is of interest for the scientific community to have different tomato TILLING resources for the possibility of identifying a greater number of mutations of interest.These services can be requested Tomato seeds (cv Red Setter) were treated with two different concentrations (0.7% and 1%) of the chemical mutagen EMS (ethylmethane sulfonate) for 18 h at RT with gentle shaking. The seeds were then thoroughly washed, dried and sown in compost in 96 well seed trays which allowed an accurate determination of germination frequency.Control seeds, those not exposed to EMS treatment, were treated in the same manner.M2 seeds: for the M2 seed production, M1 plants were grown according to standard tomato agronomic practice and at the end of the fruit-ripening phase, M2 seeds were collected from individual M1 plants and kept separate.M3 seeds: 3 seeds belonging to each mutant M2 family were sown in 96 well seed trays and the corresponding seedlings transplanted in open field. M3 seeds were collected from single M2 plants.et al. [Phenotype scoring was performed at different developmental stages from seed germination through fruit ripening and seed harvest. Each mutant candidate was characterized according to 17 classes and 51 subclasses which are reported in Table et al. .Data were collected using a hand-held Asus MyPal 730w while pictures were taken by using the Nikon Coolpix 4500 digital camera.The phenotype database was developed using MySQL as a relFor each M3 family, the genomic DNA was extracted from four young leaves collected from four different plants of the same family. The leaf samples were collected in 96-well plates and the DNA was isolated by using DNeasy 96 Plant Kit . The quantification of extracted DNA was carried out on a 0.8% agarose gel using λ DNA as a concentration reference. Genomic DNA samples were then diluted tenfold and pooled eightfold to obtain the working material.®, Lincoln, NE, USA) respectively were employed for the second PCR [PCR amplification was based on nested-PCR and was carried out using two couples of target-specific primers. 4 ng of pooled genomic DNA was used for the first PCR and forward-strand primers and reverse-strand primers 5'-end labelled with IRDye 700 and IRDye 800 dye and gel images were analysed using Adobe Photoshop software .Mutation detection was performed as previously described . ElectroAfter discovery, mutations were validated by sequence analysis.The mutation frequency for each amplicon was calculated as previously described . For theBLAST: Basic Local Alignment Search Tool; CODDLE: Codons Optimized to Discover Deleterious Lesions; ctrl: control; EMS: ethylmethane sulfonate; LD: Lethal Dose; NCBI: National Center for Biotechnology Information; RT: Room Temperature; SIFT: Sorting Intolerant From Tolerant; TILLING: Targeting Induced Local Lesions IN Genomes.The authors declare that they have no competing interests.FCa planned and headed the development of the mutant populations. AP and GS took care and visually phenotyped the mutant populations; OD set up the LycoTILL database; SM extracted the DNA; SM, FP and GM did TILLING screens and analysis; AB supervised the TILLING platform set up in Evry; FCe and FCa co-directed the TILLING project in M. Agrobios; FCa and SM were responsible for drafting and revising the manuscript with contributions from co-authors.All authors read and approved the final manuscript.Nucleotide alignment. Additional data file Expansin1 gene. This analysis shows that the identified induced point mutations are not part of natural variability.Click here for file

Considerable interest has been aroused in recent years by the well-known notion that biological systems are sensitive to visible light. With clinical applications of visible radiation in the far-red to near-infrared region of the spectrum in mind, we explored the effect of coherent red light irradiation with extremely low energy transfer on a neural cell line derived from rat pheochromocytoma. We focused on the effect of pulsed light laser irradiation vis-à-vis two distinct biological effects: neurite elongation under NGF stimulus on laminin-collagen substrate and cell viability during oxidative stress.2) and at an extremely low dose (0.45 mJ/cm2). Neurite elongation was measured over three days in culture. The effect of coherent red light irradiation on cell reaction to oxidative stress was evaluated through live-recording of mitochondria membrane potential (MMP) using JC1 vital dye and laser-confocal microscopy, in the absence (photo bleaching) and in the presence (oxidative stress) of H2O2, and by means of the MTT cell viability assay.We used a 670 nm laser, with extremely low peak power output (3 mW/cmWe found that laser irradiation stimulates NGF-induced neurite elongation on a laminin-collagen coated substrate and protects PC12 cells against oxidative stress.These data suggest that red light radiation protects the viability of cell culture in case of oxidative stress, as indicated by MMP measurement and MTT assay. It also stimulates neurite outgrowth, and this effect could also have positive implications for axonal protection. Considerable interest has been aroused in recent years by the well-known notion that biological systems are sensitive to visible light. This interest has generated research and technical development in different directions, including basic science and medical applications. A strong impulse to this old idea was given by the introduction of lasers as a light source, which offers many benefits, as a laboratory and clinical tool, such as mono-chromaticity and the possibility of transport by means of fibres. In fact, therapeutic applications of low level lasers in many medical conditions involving not only skin ,2 have eLLLT has been shown to modulate biological processes, depending on the power density, wavelength, and frequency, and to have positive effects on wound healing, on improving angiogenesis, on muscle regeneration and diabetic wounds repair ,4 Moreov2). We focused on the effect of pulsed light laser irradiation in two distinct biological effects: neurite elongation under NGF stimulus on a laminin-collagen substrate and mitochondria membrane potential and activity under basal conditions and after oxidative stress. The latter experiment was performed in living cells using the live dye JC1 and single fluorescence laser microscopy [Also in view of the clinical application of visible radiation in the far-red to near-infrared region of the spectrum there iscroscopy .Rat pheochromocytoma cell line 12 (PC12) was cultured in DMEM (GIBCO) supplemented with 10% horse serum (GIBCO), 5% FBS (GIBCO), 2 mM glutamine, 100 units/ml penicillin, and 100 μg/ml streptomycin at 37°C in a 5% CO2, incubator. In order to study neuritis elongation, cells were seeded at 5 × 10*3 cells/well on 24 multi-well plates and differentiated by treating with NGF . Oxidative stress and laser treatment were performed 24 h after seeding. For JC-1 assay cells were seeded at 5 × 10*4 cells/well on a chambered cover glass coated with Poli-L-Lisyne. Oxidative stress and laser treatment were performed 24 h after seeding. Coverslips or culture wells were first coated with collagen and then recoated with laminin .A SANYO DL3149-055A diode laser was used for irradiation Fig. . The tecThe following emission modes were used: MOD 1 = Square Wave Pulsed at 100 Hz Duty Cycle (DC) 1%; MOD 2 = Double Square Wave Pulsed 100 Hz DC 1% + 1 Hz DC 50%. The exposure time, controlled by a microprocessor, was 20 sec or 15 min. Mean Power, Power Density or Fluence, Total Energy and Energy Density in the different emission modes and exposure times are reported in Table 1The schemes used for laser irradiation in the different experiments are reported in Fig. 2O2 was added to each well immediately before laser treatment. Cells were then exposed to laser irradiation for 20 sec or 15 min.In order to challenge cells with an oxidative stress, 10 μl H2O2 supplementation, growth medium was replaced with 500 μl of OPTI-MEM serum medium without phenol red (GIBCO) and MTT-stock solution (diluted in PBS) was added to each well to give a final concentration of 0.5 mg/ml. After 3 h of incubation at 37°C, the formazan crystals formed were dissolved with 500 μl 10% Triton X-100 in 0.1 N HCl/isopropanol. The absorbance value was measured at 570 nm .MTT assay is a biochemical cell viability test based on the ability of the mitochondria to reduce the tetraziolium salt 3--2,5-diphenyl tetrazolium bromide to formazan . FifteenCells were seeded as described above; serum freshly made with NGF was changed every 3 days and a single laser pulse was performed every day. Every days, after laser irradiation, pictures of living cells were taken with an inverted Olympus IX70 microscope. For each time and laser irradiation schema, 2 different wells were analyzed. For each well 5 frames were captured (20× objective) for a total of 150 cells for each time point. Cells with neurites were defined as those bearing a process twice as long as the cell body length. Neurite length was measured using Image Pro Plus software .25%, 60% humidity). Cells seeded on a chambered cover glass for 24 h were incubated 15 min with Mito-PT solution (1× Mito-PT in serum free medium) at 37°C in a CO2 incubator and then washed once with DMEM. Cells in serum-free medium were exposed to oxidative stress and laser irradiation (see above). For time-lapse analysis of vital mitochondria staining with JC-1 cells were excited with Ar laser (488 nm) and observed with a 560 nm filter. The focus plane was set up to include both nucleus and cytoplasm. Acquisition started immediately after H2O2 addition, at the same time as laser exposure, and images were taken at 120 sec time intervals for 15 min with a PLAN APO 60X/1.35/oil objective and ×2 zoom (image size 800 × 600). Red laser exposure lasted for 20 sec or 15 min. Each cell included in the frame limit was processed with the FluoView Time Course software, and 15–20 cells were analyzed in each experimental session. Briefly, the mean intensity on a scale ranging from 0 (black) to 4095 (white) was measured each time using the fast XY acquisition mode (scan speed: 1.08 s/scan). Measurements for photo bleaching were also performed in the same experimental session. The time-dependent variation of fluorescence intensity from 120 to 960 sec was then calculated for each cell in the absence (photobleaching) and in the presence (oxidative stress) of H2O2 and these single cell values were used for statistical analysis.Mitochondrial Membrane Potential was detected using the MitoPT™ Kit incorporating the JC-1 cationic dye. JC-1 was reconstituted in DMSO (100× stock solution), stored at -20°C and used for experiments as 1× solution in serum free medium. Mitochondrial permeability transition events were recorded using time lapse software in a confocal laser scanning microscope (CLSM) GMBH) mounted on an inverted microscope (Olympus IX81) equipped with Ar (λ = 488 nm), Green-HeNe (λ = 543 nm) laser and incubator for Ar laser was 105 μm. The Ar laser was used at 40–50% of maximum power, resulting in 4–5 mV energy transfer/observation.Descriptive statistics are expressed as mean + SEM. One-way ANOVA and post-hoc Tukey's Multiple Comparison Test, and Student's t test were used to compare experimental groups. Results were considered significant when the probability of their occurrence due to chance alone was less than 5%.PC12 cells, when they adhere to the substrate, begin differentiation by emitting branched neurites Fig . As soonIn order to evaluate the effect of coherent red light irradiation on cell reaction to oxidative stress, we used two well validated tests, one measuring the mitochondria membrane potential in live cells (by JC-1 fluorescence dye), and one measuring cell viability through a mitochondria-dependent assay .2O2 to the medium. Micrographs in Fig. 2O2 exposed specimens at the beginning and end of the observational time. Results from a typical experiment reporting fluorescence intensity values over the observational time in the absence of H2O2 and in the presence of H2O2 (oxidative stress) are reported in Figs. 2O2 is 248 ± 29 , and in the presence of H2O2 is 502+41 , thus confirming ongoing oxidative stress in the cells . The difference between the intensity values at the beginning (120 sec) and end (960 sec) generate the ΔΨ values reported in graphs G and H, where the effect of a single 20 sec laser light irradiation, and of 15 min laser light irradiation, respectively, are reported. Both MOD1 and MOD2 irradiation decreases ΔΨ after H2O2 to control (-H2O2) values, thus suggesting a protective effect of red light radiation on early mitochondria potential variation due to oxidative stress.JC-1 ,15 is a 2O2 in PC12 cells exposed to laser irradiation by means of MTT assay and at an extremely low dose (0.45 mJ), 75% of which reached the cells in the culture. This λ corresponds to one of the four suggested "active zones" (peak positions between 667.5 and 683.7 nm) for the investigation of cellular mechanisms of phototherapy . The tot2), that is 2000–40000 times higher than energy transfer used in our experimental conditions, so that comparison with our results is not possible. In vivo neurite outgrowth is a contact-dependent process. The regulation that we obtained using an extremely low energy transfer could result from a different synthesis and/or membrane distribution of adhesion molecules, which binds laminin (e.g. integrins). The light is in fact able to regulate both short and long term processes involved in cell contact. Low-power laser light irradiation (632 nm) is able to rapidly remodel cytoskeleton and adhesion structures [PC12 cells express NGF receptors and, under NGF stimulation, the proliferation rate decreases and neural differentiation takes place . Cell grructures , whereasructures . Further2O2 exposure is prevented by both short (20 sec) and long (15 min) photoirradiation. Twenty-sec irradiation results in cell viability protection.The primary events in cells exposed to visible to near-IR radiation are believed to occur in mitochondria ,7, where2O2. H2O2 is widely regarded as a cytotoxic agent leading to oxidative stress and mitochondrial dysfunction, whose levels must be minimized by the action of antioxidant defence enzymes [2O2 in the μM range induces a decrease in the mitochondrial transmembrane potential and cytosolic accumulation of the mitochondria cytochrome c, indicating impairment of mitochondrial membrane permeability and reduced cell viability at 4 hr [A direct beneficial effect of 20 s and 1 min photomodulation using a light emitting diode at 670 nm has been demonstrated in primary neurons exposed to the toxin KCl. This effect has been attributed to the up-regulation of cytochrome c oxidase, which leads to increased energy metabolism and, thus, neuroprotection . Microar enzymes ,40. Expo at 4 hr .2O2. Our results demonstrate that 670 nm laser light treatment is neuroprotective and stimulates neural maturation, thus providing additional evidence that red-near-IR light might represent a potential, novel, non-invasive, therapeutic intervention for the treatment of numerous diseases [We found that laser irradiation affects the in vitro maturation of PC12 cells by stimulating NGF-induced neurite elongation on a laminin-collagen coated substrate. Moreover, coherent light irradiations have a protective effect on oxidative stress induced by Hdiseases .Alessandro Giuliani, Alessandro Massella, Luciana Giardino, Laura Calzà, declare that they have no competing interest.Authors Luca Lorenzini: I do received reimbursements from RGM for the partecipation to two short coursesAuthor Michele Gallamini: BioliteLp020® is a device developed by RGM SpA in close cooperation with La Colletta Bioengineering Center in Genoa Italy. The device is Patented.Author Within the framework of a R&D Program co-funded by RGM SpA to verify Biolite effectiveness, in the past years several animal and lab tests have been conducted by the Pathophysiology Center for the Nervous System at Bologna University with the cooperation of the RGM SpA R&D.The results of the tests have promoted a further expansion of the program to investigate the modifications of the Extracellular Matrix.RGMD SpA has been established in 2008 to take over and expand the Medical Devices Activities formerly carried out by RGM SpA.The new research program – codenamed MEDTECH – will be carried out during three years by RGMD SpA in close cooperation with several major Italian Research Centers among which a lead part is played by the BioPharmaNet-Dimorfipa of the High-Technology Laboratory Net at Bologna University.The program is enjoying a substantial grant from the Italian Ministry of University and Research and is aimed both• to set up novel diagnostic tools capable to detect and decode physical ECM modifications, and• to further develop physical means capable to induce ECM modifications as a primary effects to promote therapeutic effects.An increasing role of the R&D Department of RGMD SpA in all research activities is currently planned.Alessandro Giuliani, Luca Lorenzini, Michele Gallamini, Massella Alessandro, Luciana Giardino, Laura Calzà, declare that they haven't any non-financial competing interests.Authors AGparticipated in the design of the study, caried out the experimental part on cell culture, MTT and JC-1 assays, and drafted the manuscript. LLpartecipated in the laser exposure and JC-1 assay. MGparticipated in the design of the study and provided the exposure system. AMpartecipated in the MTT assay. LGparticipated in the design of the study and performed the statistical analysis. LCconceived of the study, and participated in its design and coordination and helped to the final version of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

Using whole-genome-fragment phage display libraries, Hana Golding and colleagues identify the viral epitopes recognized by serum antibodies in humans who have recovered from infection with H5N1 avian influenza. Transmission of highly pathogenic avian H5N1 viruses from poultry to humans have raised fears of an impending influenza pandemic. Concerted efforts are underway to prepare effective vaccines and therapies including polyclonal or monoclonal antibodies against H5N1. Current efforts are hampered by the paucity of information on protective immune responses against avian influenza. Characterizing the B cell responses in convalescent individuals could help in the design of future vaccines and therapeutics.To address this need, we generated whole-genome–fragment phage display libraries (GFPDL) expressing fragments of 15–350 amino acids covering all the proteins of A/Vietnam/1203/2004 (H5N1). These GFPDL were used to analyze neutralizing human monoclonal antibodies and sera of five individuals who had recovered from H5N1 infection. This approach led to the mapping of two broadly neutralizing human monoclonal antibodies with conformation-dependent epitopes. In H5N1 convalescent sera, we have identified several potentially protective H5N1-specific human antibody epitopes in H5 HA[(-10)-223], neuraminidase catalytic site, and M2 ectodomain. In addition, for the first time to our knowledge in humans, we identified strong reactivity against PB1-F2, a putative virulence factor, following H5N1 infection. Importantly, novel epitopes were identified, which were recognized by H5N1-convalescent sera but did not react with sera from control individuals .This is the first study, to our knowledge, describing the complete antibody repertoire following H5N1 infection. Collectively, these data will contribute to rational vaccine design and new H5N1-specific serodiagnostic surveillance tools. Every winter, millions of people catch influenza, a viral infection of the airways. Most recover quickly but seasonal influenza outbreaks (epidemics) kill about half a million people annually. These epidemics occur because small but frequent changes in the viral proteins (antigens) to which the human immune system responds mean that an immune response produced one year by infection or through vaccination provides only partial protection against influenza the next year. Influenza viruses also occasionally appear that contain major antigenic changes. Human populations have little or no immunity to such viruses , so they can start deadly global epidemics (pandemics ). Worryingly, the last influenza pandemic occurred in 1968 and many experts fear that another pandemic is now overdue. The trigger for such a pandemic, they think, could be the avian (bird) H5N1 influenza virus, which first appeared in 1996 in a goose in China. The name indicates the types of two major influenza antigens present in the virus: H5N1 carries type 5 hemagglutinin and type 1 neuraminidase.H5N1 has caused about 400 confirmed cases of human influenza and more than 250 deaths in the past decade but it has not started a human pandemic because it cannot pass easily between people. However, it could possibly acquire this ability at any time, so it is a priority to develop both vaccines that will provide protection against a pandemic H5N1 viral strain, as well as antibody-based antiviral therapies for people not protected by vaccination . To do this, scientists need to know how the human immune system responds to the H5N1 virus. In particular, they need to know which parts of the virus the immune system can detect and make antibodies against. In this study, therefore, the researchers characterize the specific antibody responses found in people recovering from infection with H5N1.The researchers made several “genome-fragment phage display libraries”, collections of bacterial viruses (phages) engineered so that each phage makes one of many possible short pieces (polypeptides) of a nonphage protein. Such “libraries” can be used to investigate which fragments are recognized by antibodies from a given source. In this case, several libraries were made that contained fragments of the genome of the H5N1 strain responsible for an outbreak of human influenza in Vietnam in 2004–2005 (A/Vietnam/1203/2004). The researchers used these libraries to analyze the antibodies made by five Vietnamese people recovering from infection with A/Vietnam/1203/2004. H5N1 convalescent blood samples, the researchers report, contained antibodies that recognized small regions (“epitopes”) in several viral proteins, including hemagglutinin, neuraminidase, a structural protein called M2, and a viral protein called PB1-F2 that is partly responsible for the severity of H5N1 infections. Several of the novel epitopes identified were not recognized by antibodies in blood taken from people recovering from infection with other influenza viruses. The researchers also used their phage display libraries to analyze two neutralizing human monoclonal antibodies generated from patients infected with A/Vietnam/1203/2004 . Importantly, both of the neutralizing monoclonal antibodies recognized “noncontinuous conformation-dependent epitopes”—protein sequences that are not adjacent to one another in the polypeptide sequence of the protein, but that lie close together in space because of the way the protein is folded up.Although some aspects of the antibody repertoire produced in people exposed to the H5N1 influenza virus may have been missed in this analysis, these findings provide important and detailed new information about how the human immune system responds to infection with this virus. In particular, they show that people recovering from H5N1 infection make a diverse range of antibodies against several viral proteins for at least six months and identify specific parts of H5N1 that may be particularly good at stimulating a protective immune response. This information can now be used to help design vaccines against H5N1 and antibody-based therapies for the treatment of H5N1 infections, and to develop new tools for monitoring outbreaks of avian influenza in human populations.http://dx.doi.org/10.1371/journal.pmed.1000049.Please access these Web sites via the online version of this summary at PLoS MedicinePerspective by Malik PeirisThis study is further discussed in a influenza for patients and professionals, including specific information on avian and pandemic influenza The US Centers for Disease Control and Prevention provides information for about influenza and on H5N1 avian influenza , and a global timeline about H5N1 avian influenza infection in birds and peopleThe World Health Organization provides information on UK Health Protection Agency provides information on avian, pandemic, and epidemic influenzaThe influenza and bird flu (in English and Spanish)MedlinePlus provides a list of links to other information about The recent spread of highly pathogenic (HP) H5N1 avian influenza viruses (AIV) among poultry and transmission of these viruses to humans raised concerns of a potential influenza pandemic. In preparation for such an event, world-wide efforts are under way to test and stockpile preventive vaccines, antiviral drugs, and passive immune therapies Such efforts could be greatly enhanced by understanding the immune responses of individuals who survived H5N1 virus infection. Recently, human monoclonal antibodies (MAbs) were generated from patients in Vietnam and Turkey who had recovered from H5N1 infections However, there are significant gaps in our knowledge of antibody epitopes against H5N1 viruses, especially in humans, and only a few epitopes have been identified in proteins other than the haemagglutinin (HA) To address these gaps we have constructed whole-genome–fragment phage display libraries (GFPDL) expressing all the open reading frames of H5N1 A/Vietnam/1203/2004. The H5N1 GFPDL were used to identify recognition sites of antibodies in convalescent sera obtained from five Vietnamese individuals with a history of H5N1 infection and two H5-specific neutralizing MAbs derived from two of these survivors.Serum samples from five patients who survived H5N1 infection in Vietnam were obtained at one time point within 2–6 mo following H5N1 infection in 2004 and were previously described cDNA corresponding to all eight gene segments of the A/H5N1/Vietnam/1203/2004 were generated from RNA isolated from egg-grown virus strain, and were used for cloning. fSK-9-3 is a gIIIp display-based phage vector where the desired polypeptide can be expressed as gIIIp fusion protein.Phage display libraries were constructed individually for HA and neuraminidase (NA) genes (referred to as HA-NA) and the rest of the six gene segments , referred to as FLU-6. Purified DNA containing equimolar ratio of HA and NA (HA-NA) or of the six genes (FLU-6) were digested with DNase shotgun cleavage kit (Novagen) per manufacturer's instructions, to obtain DNA fragments in the size range of 50–200 and 200–1,000 bp for each of the two gene segment pools. Detailed methodology for library construction was described previously Four libraries were constructed: fSK9-3 H5Viet-HA-NA (50–200 bp), fSK9-3 H5Viet-HA-NA , fSK9-3 H5Viet-FLU-6 (50–200 bp), and fSK9-3 H5Viet-FLU-6 .A random linear dodecapeptide phage display library (Ph.D-12), wherein the displayed peptides (12-mer) are expressed fused to the N terminus of gIII protein was purchased from New England Biolabs.Prior to panning of GFPDL with plate-bound polyclonal serum antibodies, serum components, which could nonspecifically interact with phage proteins, were removed by incubation with UV-killed M13K07 phage-coated Petri dishes. Subsequent GFPDL affinity selection was carried out on antibody-coated wells as well as in-solution (with Protein A/G).10 phages (of the Influenza H5 GFPDL) in 500 µl PBST containing 1% BSA were preincubated with 200 µl of 50% Ultralink Protein A/G slurry (Pierce) for 1 h at room temperature (RT) on end-to-end shaker. Following brief centrifugation, 500 µl of supernatant was removed and was added to 5 µg of human anti-H5N1 MAb or 100 µl of VCSM13-preadsorbed human serum (in 1% BSA-PBST), and incubated for 1 h at RT on end-to-end shaker, followed by 200 µl of 50% Ultralink Protein A/G slurry (Pierce) on end-to-end shaker at RT for 1 h. The unbound phages were removed in ten washes with PBST followed by three washes with PBS. The bound phages were eluted by addition of 800 µl of 0.1 N HCl (adjusted to pH 2.2 with glycine and BSA), and incubated for 10 min at RT on end-to-end shaker. The eluates were collected and neutralized by adding 64 µl of 2 M Tris solution. Panning on coated strips has been detailed in For in-solution panning, 10Biotinylated peptides (1 µg/well) were captured onto wells coated with 500 ng of streptavidin. After blocking with PBST containing 2% milk, serial dilutions of human serum in blocking solution were added to each well, incubated for 1 h at RT, followed by addition of 2,000-fold dilution of HRP-conjugated goat anti-human IgG-Fc specific antibody, and developed by 100 µl of OPD substrate solution. Absorbance was measured at 490–492 nm. As negative controls, peptides derived from HIV and human CCR5 were used.6 was coupled to a GLC sensor chip using amine coupling with 40 resonance units (RU) in the test flow cells. Samples of 60 µl of freshly prepared antibody at various concentrations were injected at a flow rate of 30 µl/min (120-s contact time). Flow was directed over a mock surface to which no protein was bound, followed by the HA [(-10)-223]-His6 coupled surface. Responses from the peptide surface were corrected for the response from the mock surface and for responses from a separate, buffer only, injection. MAb 2D7 (anti-CCR5) was used as a negative control antibody in various binding experiments. Binding Kinetics for the MAbs and the data analysis was performed using BioRad ProteON manager software (version 2.0.1). Affinity measurements were calculated using the Langmuir with Mass transfer algorithm.Steady-state equilibrium binding of MAb FLA5.10, and FLD21.140 was monitored at 25°C using a ProteOn surface plasmon resonance biosensor (BioRad Labs). The HA [(-10)-223]-HisPrior to panning of GFPDL, 500 µl of 10-fold diluted pooled serum antibodies from H5N1 survivors were adsorbed by incubation with H5N1 (HA+NA) GFPDL phage-coated Petri dishes. To ascertain the residual antibodies specificity, an ELISA was performed with wells coated with 200 ng/100 µl of recombinant H5 HA . After blocking with PBST containing 2% milk, serial dilutions of human serum (with or without adsorption) in blocking solution were added to each well, incubated for 1 h at RT, followed by addition of 2,000-fold diluted HRP-conjugated goat anti-human IgG-Fc specific antibody and developed by 100 µl of OPD substrate solution. Absorbance was measured at 490–492 nm.6 (or shorter HA1-derived peptides) or to control GST-His6 protein, and incubated for 1 h at RT. Ni-NTA Sepharose beads were added for 20 min at RT on end-to-end shaker, to capture the His-tagged peptides and the antibodies bound to them, followed by a brief centrifugation. Supernatants containing the unbound antibodies were collected. The pelleted beads were washed five times with PBST, followed by two washes with PBS. Sepharose-peptide–bound antibodies were eluted by incubating beads with 500 µl of 0.1 N HCl (adjusted to [pH 2.2] with glycine and BSA), for 10 min at RT on end-to-end shaker. The eluates were collected and neutralized by adding 40 µl of 2 M Tris solution. In some cases, the serum adsorption was performed using biotinylated peptides, which were captured using streptavidin-coupled magnetic beads.Five-fold diluted immune serum (from sheep or ferret) (500 µl) was added to 0.5 mg of purified HA [(-10)-223]-HisViral-neutralizing activity was analyzed in a microneutralization assay on the basis of the methods of the pandemic influenza reference laboratories of the US Centers for Disease Control (CDC) Following the outbreak of H5N1 AIV in humans in Vietnam (2004–2005), in which 13/18 patients died 6 to 2.6×107 phages . The ins7 phages . PCR ana7 phages .129S). Direct binding of FLA5.10 to a chemically synthesized peptide (5.10-101) and a mutated version of the peptide (5.10-101-L/A) confirmed that L129 is a critical contact residue [(-10)-223] were selected that included part of the receptor binding site (RBS) preceded by an N-terminal sequence . This HA residue . Importa residue .GFPDL panning with MAb FLD21.40 identified a large segment (HA 32–320) including the entire RBS. Subsequent panning with RPL narrowed the putative epitope to two aa clusters, 121-SWS-123 and 164-YNNT-167, which were separated by 40 aa in the linear sequence . ImportaEscherichia coli. This protein fragment captured on a biosensor chip was used to determine the binding kinetics of FLA5.10 . Such a difference in binding affinities may predict higher avidity of binding to virus in vivo for FLD21.140, and could contribute to its ability to protect mice against clade 2 viruses. Therefore, both specificity and avidity could be factors in heterologous protection.To confirm that the HA segments identified using influenza GFPDL can be recognized by neutralizing human MAbs independent of phage presentation, the H5 HA [(-10)-223] peptide was expressed and purified from FLA5.10 and FLD2 FLA5.10 . SurprisThe successful use of the GFPDL/RPL in elucidating the conformation-dependent epitopes of two human MAbs provided proof of concept for this approach. Next, it was important to establish if such antibodies are represented in the polyclonal sera of individuals who had recovered from H5N1 virus infection, and to identify other antibody specificities that may have contributed to virus clearance.Convalescent sera from five H5N1 patients, obtained between 54 and 182 d following hospital admission, were analyzed using the A/Vietnam/1203/2004 GFPDL. We first demonstrated the capacity of the GFPDL to adsorb, at a minimum, 85% of HA-specific antibodies in the pooled convalescent sera, as determined by binding to recombinant H5 HA in ELISA , confirmE. coli and used in ELISA with individual convalescent sera were lower than for earlier convalescence sera . Interest-test analyses revealed that the binding to the H5N1 HA peptides were significantly different (p<0.05) between the H5N1 convalescent sera and the plasma from unexposed US and Vietnamese controls revealed that the ELISA reactivities against most of the H5N1 peptides were significantly different (p<0.05) between the convalescent sera and the plasma from unexposed US and Vietnamese controls, with the exception of binding to selected peptides derived from PA, NP, and M1 (p>0.05 are shown in bold in Panning of GFPDL (FLU-6) expressing inserts from the internal viral proteins with theThe M2 ectodomain (M2e) was postulated to contribute to protective immune responses PB1-F2 is a 90-aa protein encoded by the PB1 gene. It was identified as a potential virulence factor in the 1918 pandemic H1N1 strain, and in the HP H5N1 (HK/97) viruses 6 did not adsorb any neutralizing activity. Additionally, none of the shorter peptides within the HA [(-10)-223], alone or in combination, adsorbed any neutralizing activity. Similar results were obtained with sera from ferrets infected with wild-type A/Vietnam/1203/2004 (H5N1) virus -223] to block viral neutralization using hyperimmune sheep sera raised against the reassortant A/Vietnam/1203/04 × PR8 virus that had a titer of 1∶640 in a microneutralization assay using the rgA/Vietnam/1203/2004 virus . After iGFPDL are a powerful tool to decipher all the primary antigenic sites in influenza viruses following natural exposure or vaccination. Previously, this approach led to the development of HIV-SELECTEST for differential diagnosis of HIV infections in vaccine recipients Previously, murine MAbs and escape mutants were used to map binding sites on the structures of human influenza HA Elucidating the repertoire of influenza-specific human antibodies against all the viral proteins is desired for understanding virus-host interactions and identifying new targets for protection. To that end, we used influenza GFPDL to unravel the antibody specificities of five H5N1-recovered individuals and to map the epitopes of two neutralizing MAbs derived from their memory B cells. Our main findings were: (1) H5N1 convalescent sera contained highly diverse antibody specificities against HA1, HA2, NA, and internal proteins of the virus for at least 6 mo; (2) two human MAbs, which were protective in mice, recognized conformation-dependent nonlinear epitopes in large HA1 fragments that encompass the RBS; (3) the HA1[(-10)-223)] protein showed high avidity binding to the two human MAbs and adsorbed a significant proportion of the neutralizing activity of polyclonal anti-H5N1 sheep and ferret sera; (4) strong antibody reactivity against the NA catalytic site and M2e were identified; (5) convalescent sera bound PB1-F2 peptides providing evidence that this protein is expressed during acute H5N1 infection; (6) sera from 20 Vietnamese adults with no history of H5N1 infection, and from ten US human influenza-confirmed infections, revealed very low reactivity to most of the H5N1 epitopes.129S change was reported in clade 2 H5N1 viruses from China and Southeast Asia in 2002–2005 Deciphering the epitopes of the H5-specific human MAbs explained the restricted neutralization pattern of FLA5.10 compared with FLD21.140. MAb FLA5.10 binding requires L129, a critical amino acid within the RBS. A LPanning of GFPDL (HA+NA) with sera from individuals who had recovered from H5N1 virus infection revealed broad antibody reactivity against both HA1 and HA2 domains, including the large HA1 fragments bound by the protective human MAbs. Epitope profiling of HA led to identification of six antigenic clusters (I–VI). HA antigenic sites “a–e” were defined primarily using mouse monoclonal antibodies that are encompassed in clusters-I and -II, described in this study.A recent paper by Throsby et al., describes heterosubtypic neutralizing MAbs that cross react against H5N1 and H1N1 Among the H5N1 convalescent plasma, most ELISA reciprocal titers were lower in the 6-mo postinfection sample. However, HA2 peptide (H5-HA-2838-2866) located in the membrane proximal domain was strongly recognized by all convalescent sera , but didThis study also identified a strong binding by the H5N1 convalescent sera to a 178-aa fragment containing the NA catalytic site that has not been reported previously. This NA segment was not recognized by US control sera with high HI titers against H1N1. Therefore, we did not find evidence that repeated exposure to human H1N1 influenza viruses elicits high-titer antibodies against the heterologous avian N1 NA, as was previously predicted http://www.flu.lanl.gov). Also, similar GFPDL analyses using the pooled sera from 20 control H5N1-uninfected Vietnamese females did not select any phage-displaying peptide sequence from the M2 region. This result suggests that strong antibody response is generated against M2e following primary infection with HP H5N1 strain. Thus, the contribution of M2e antibodies to viral clearance after H5N1 infection should be further evaluated.Studies in mice have shown that serum anti-M2e antibodies can reduce virus replication and death. Currently, M2 is being evaluated as a component of several “universal vaccines”PB1-F2, a recently discovered proapoptotic influenza-A viral protein, contributes to viral pathogenesis in mice The use of GFPDL to decipher the complete B cell repertoires in AIV-exposed individuals is limited by the fact that all protein segments are expressed in a bacterial system. Therefore, epitopes that are strictly dependent on post-translational modifications or on the multimeric forms of influenza proteins in the native structure might have been missed in our analyses. In spite of these limitations, the use of GFPDL led to new insights into the repertoire of anti-influenza antibodies following H5N1 virus infection and of epitopes that may contribute to resolution of avian influenza infections and could be incorporated into future vaccines. Finally, conserved epitopes recognized by sera from convalescent individuals may be useful for monitoring outbreaks of avian influenza.Figure S1The complete H5N1 A/Vietnam/1203/04 proteome sequence was constructed by linking the 11 proteins (protein names are shown within the proteome sequence) coded by the eight gene segments derived from wild-type A/Vietnam/1203/2004 viral RNA grown in embryonated chicken eggs. The predicted glycosylation sites (NXT/NXS) in HA are underlined.(0.04 MB DOC)Click here for additional data file.Figure S2E. coli transformants following electroporation. (B) Sequence diversity of inserts in complete H5N1 gene-fragment phage display library. 190 colonies from each library were subjected to PCR-based sequencing. Representative alignment of A/Vietnam/1203/2004 genome sequence with inserts in combined (fSK9-3 H5Viet-HA-NA [50–200 bp] and fSK9-3 H5Viet- FLU-6 PB2-NS [(50–200 bp]) gene-fragment phage display library is shown. Arrow indicates the orientation of inserts. Similar distribution of inserts was found for the fSK9-3 H5Viet-HA-NA and fSK9-3 Viet- FLU-6 PB2-NS . All open reading frames of the influenza-coded proteins were represented in the GFPDL with good representation of smaller and larger inserts in both the transfected bacteria and the phage libraries.Construction of H5N1 A/Vietnam phage display libraries: size and insert distribution. (A) Four phage display libraries for the H5N1 strain A/Vietnam/1203/2004 were constructed: fSK9-3 H5Viet-HA-NA (50–200-bp inserts); fSK9-3 H5Viet-HA-NA ; fSK9-3 H5Viet-FLU-6 (50–200-bp inserts) ; and fSK9-3 H5Viet- FLU-6 PB2-NS . Each library size was calculated by plating serial dilutions of (0.75 MB EPS)Click here for additional data file.Figure S3Binding of MAb FLA5.10 to peptide 5.10-101 (identified using RPL panning) compared with mutated peptide 5.10-101-L1A in ELISA. Both biotinylated peptides were captured on streptavidin-coated plates and reacted with serial dilutions of FLA5.10. Leucine to alanine substitution resulted in >98% loss of FLA5.10 binding.(0.37 MB EPS)Click here for additional data file.Figure S4Adsorption of anti-HA antibodies in convalescent sera from survivors of H5N1 infection using the H5N1 GFPDL. Pooled sera from five H5N1 survivors were adsorbed with H5 (HA+NA) GFPDL. Binding to recombinant HA protein is shown before (circles) and after (triangles) GFPDL-adsorption.(0.38 MB EPS)Click here for additional data file.Table S1Frequency of selected phage clones using H5N1 GFPDL after panning with sera from five H5N1-Vietnam infection survivors. Three rounds of affinity selection were performed on pooled sera using each of the four GFPDL under both conditions (antibody coated beads and in-solution). 48 clones were sequenced in each panning round, resulting in sequencing of 2,304 total clones. The peptide sequences displayed on the phage surface and the corresponding frequencies for these phage displayed sequences are shown. Each peptide name indicates the H5N1 protein name and the amino acid numbers corresponding to the complete proteome sequence shown in (0.14 MB DOC)Click here for additional data file.Table S2t-test was performed for each peptide reactivity using the end-point titers for the control sera , compared with the end-point titers of the five H5N1-convelescent samples . p-Values appear in the right column.ELISA reactivity of sera from ten individuals with culture-confirmed seasonal influenza infections during the 2006–2007 seasons. End-point antibody titers (based on 5-fold dilutions starting at 1∶100) are reported for US 1–10 against the identical H5N1-Viet peptides used in (0.15 MB DOC)Click here for additional data file.

Children with Down syndrome (DS) have an increased risk of childhood acute leukemia, especially acute megakaryoblastic leukemia (AMKL) also called acute myeloid leukemia (AML) type M7. Here four yet unreported infants with such malignancies are reported.An unbalanced translocation involving chromosome 1 was identified by GTG banding in all cases. These were characterized in more detail by molecular cytogenetic approaches. Additional molecular analysis revealed in three of the four cases mutations in exon 2 of the GATA binding protein 1 (globin transcription factor 1), located in Xp11.23.Our results corroborate that abnormalities of chromosome 1 are common in DS-associated AMKL. Whether this chromosomal region contains gene(s) involved in hematopoietic malignant transformation remains to be determined. Among congenital disorders, Down Syndrome (DS) is one of the most common, affecting 1/800 – 1/1000 live births. Children with DS have an increased risk of childhood acute leukemia (AL) when compared to the general pediatric population under 4 years of age .Several reports have now suggested that mutations in the hematopoietic zinc-finger transcription factor gene GATA1, which is essential for proper development of erythroid cells, megakaryocytes, eosinophilis and mast cells, could be an initiating event in DS leukemogenesis ,4. BesidOverall, children with DS are uniquely predisposed to clonal disorders affecting the megakaryocyte lineage. At birth, they can present hematopoiesis characterized by pancytopenia and a myelodysplastic syndrome (MDS) can be diagnosed. Some authors describe that this condition develops to TMD (= transient myeloid disorder) also called transient leukemia (TL) . Even thHere four children with as DS-AML were studied for presence of mutations in GATA1, GTG banding and molecular cytogenetic studies. Besides that 3/4 cases had a GATA1 mutation also 3 of them were associated with an unbalanced rearrangements of chromosome 1.Between 2005 and 2006, four DS children with history of MDS were referred to the cytogenetic department at Instituto Nacional de Câncer (INCa) of Rio de Janeiro, Brazil. The clinical data, including outcome, as well as molecular and (molecular) cytogenetic results are summarized in Tab. The infants were 11 to 20 months old. In all four cases the initial diagnosis was established by cell morphology, cytochemistry and immunophenotyping analysis as standardized procedures . Case 1 At present (September 2008), only 2 patients are alive and in complete remission (cases 2 and 3). Patient with #1 died due to a relapse and #4 was in remission, but died of bronchial aspiration.It is well known that DS-children are predisposed to clonal disorders affecting the megakaryocyte lineage . Also TMGATA 1 mutation in exon 2 could not be detected for case 1, but were present in the other 3 cases . These findings are important to show the involvement of this gene in our cases with DS-AMKL [Chromosomal breakpoints detected in banding cytogenetics were confirmed and refined by molecular cytogenetics. Interestingly, three of the four cases (cases 1–3), break-events took place in the chromosomal region 1q31 to 1q32. In case 4 also chromosome 1q was involved in a rearrangement – here the breakpoint could not be refined by molecular cytogenetics due to lack of material. Recently, it has been shown that chromosomal aberrations could provide important clues to the genetic events associated with the transformation of a pre-leukemic, possibly GATA1 positive clone. The aberrations found for the 1q31~32 region, especially duplication, are in concordance with previous reports of DS-AML with GATA1 mutations . Also paOverall, our results, support evidence that genes located at region 1q31 and 1q32 are responsible for secondary or even primary mechanisms for the origin of AMKL in DS. Further gene-hunting studies in this region have to be performed to elucidate the pathogenetic mechanisms of the long arm of chromosome 1 in DS-AML.Karyotypes of BM cell were obtained at the time of AMKL diagnosis for all four cases [See Figure To detect possible cryptic chromosomal changes multiplex fluorescence in situ hybridization (M-FISH) and (muldHPLC (denaturating high performance liquid chromatography) technique and direct sequencing were done to detect and characterized possible GATA1 mutations .The Ethical Committee of Rio de Janeiro, Brazil) approved this study (CONEP #12087).The authors declare that they have no competing interests.MdSPdO, EMSdV and AMdS provided the bone marrow samples of the 4 cases and their clinical history. MLMS, AFdF, MTdS, EA, DRNG and ScR, did the cytogenetic work up and analysis of the probes and the karyotype interpretation. HM and TL did the FISH and further MCB-analysis. All coauthors have been involved in drafting the manuscript. EA, TL, MLMS and HM revised it critically for important intellectual content.

Although feedback on performance is generally thought to promote perceptual learning, the role and necessity of feedback remain unclear. We investigated the effect of providing varying amounts of positive feedback while listeners attempted to discriminate between three identical tones on learning frequency discrimination.Using this novel procedure, the feedback was meaningless and random in relation to the listeners' responses, but the amount of feedback provided (or lack thereof) affected learning. We found that a group of listeners who received positive feedback on 10% of the trials improved their performance on the task (learned), while other groups provided either with excess (90%) or with no feedback did not learn. Superimposed on these group data, however, individual listeners showed other systematic changes of performance. In particular, those with lower non-verbal IQ who trained in the no feedback condition performed more poorly after training.This pattern of results cannot be accounted for by learning models that ascribe an external teacher role to feedback. We suggest, instead, that feedback is used to monitor performance on the task in relation to its perceived difficulty, and that listeners who learn without the benefit of feedback are adept at self-monitoring of performance, a trait that also supports better performance on non-verbal IQ tests. These results show that ‘perceptual’ learning is strongly influenced by top-down processes of motivation and intelligence. Practice may not “make perfect”, but it can certainly improve skills and abilities, including the ability to detect or discriminate a variety of sensory stimuli, a process known as perceptual learning. Knowledge of results, or information on task performance would seem to be a necessary component for learning. However, in perceptual learning the importance of, or even the need for performance feedback is a controversial topic Under some circumstances, feedback on performance does not appear to be necessary for successful learning We have previously reported robust learning on an ‘impossible’ auditory frequency discrimination training task that used identical stimuli Two other explanations that can reconcile our findings In the study reported here we explored the effect of positive performance feedback on learning an impossible auditory frequency discrimination task. Positive feedback was provided randomly on either 10% or 90% of the trials, and compared with a no-feedback condition and previous data We investigated perceptual learning on an auditory discrimination task using a novel design that allowed us to manipulate the amount of feedback independent of other aspects of the training task. Pure tone frequency discrimination (FD) was measured before and after FD training where th2(4) = 9.9; p = 0.041).Listeners in each training group were divided into three learning subgroups ; learnerAlthough learning was not found in either the 90% or NF groups , and theIQ has been suggested to be causally linked to a form of pitch discrimination (auditory ‘inspection time’) Our findings provide new insights into the role that both feedback and individual abilities play in learning. Using a large sample, we have shown that feedback can have multiple effects on learning the same task. Individual differences cannot be addressed when the sample is too small, a problem of many previous studies and possibly one of the root causes of the varied conclusions found in the literature Various models derived from studying the behaviour of neural networks have been proposed to account for learning. Unsupervised learning (sometimes referred to as ‘Hebbian’ learning) models describe the process as being driven by bottom-up, feed-forward processing, independent of external feedback or reinforcement Applying these models we would make two different predictions for the present study. If the learning was unsupervised, we would predict that there would be no group differences in learning because unsupervised learning is independent of external feedback. In contrast, we found significant effects of external feedback on learning. Since the task was impossible the feedback was meaningless – it could not have been informative about correctness of listeners' responses, and could therefore not have been used as a teacher signal, ruling out supervised learning as an explanation for the results of our study. The same line of reasoning was followed in interpreting the results of feedback manipulation in a visual vernier acuity task ‘Hybrid’ learning models have also been proposed to account for perceptual learning in previous studies. Most notably, a supervised Hebbian learning model was proposed to explain why feedback may be necessary in some cases but not others The presence of easy trials may not be sufficient to generate internal feedback that can drive learning A second type of hybrid model that nicely accounts for the results of feedback manipulation in vision Like the recurrent supervised model discussed above People may become unmotivated when performing a training task for several reasons. Firstly, they can become bored and unmotivated when the trained task presents no challenge, such as when frequency discrimination is trained with a large frequency difference at which performance is at ceiling Very little positive feedback (e.g. 10%) corresponds with the perceived difficulty of the task. The internal evaluation of the accuracy of performing the task can then be reinforced. On the other hand, there is a marked discrepancy between the internal evaluation of performance and external feedback when listeners who find the task very difficult receive a lot of positive feedback (90%). Listeners who unlearned when receiving 90% feedback may have perceived a mismatch between task difficulty and feedback, and may have stopped relying on external feedback, realising it didn't provide helpful information A recently published study The group who received no feedback showed a similar lack of overall learning and a similar proportion of unlearners to the 90% feedback group, but the unlearners in the NF group were characterized by having poorer average performance thresholds and lower NVIQ. Problem-solving in everyday life does not always occur in conjunction with feedback about the solution or the correctness of the decision made. People who are able to apply themselves to challenging problem solving, whether they are given feedback on the correctness or level of their performance or not, are more likely to perform well on IQ tests, and in particular problem-solving tests such as the Matrix Reasoning subtest. The relationship between the ability to learn a task in the absence of feedback may therefore be related to the ability to monitor performance without external feedback, which may also be responsible for developing excellent problem-solving skills. This interpretation is compatible with studies of self-regulation in children. Self-regulation is defined as the ability to modify behaviour according to task demands in the context of the ability to delay gratification as well as the ability to ignore distracters when performing the task, and may thus be similar to the self-monitoring we describe here. Children with higher IQ show better self-regulation and are better able to sustain their superior performance on a difficult task than children with average IQ Whereas most individuals can successfully monitor performance internally to employ the best strategy for the task and can therefore learn with or without feedback, others are not able to do so optimally and need external feedback to boost performance and to keep them motivated and on-task. The feedback can only fulfil this function when it matches the expectations derived from the perceived difficulty of the task. These findings highlight the importance of individual differences in understanding the cognitive processes that drive and support perceptual learning and, from an applied perspective, the need to take individual strengths or weaknesses into account when designing training programmes for a variety of applications.One-hundred and six adults aged 18–40 were recruited from the University of Nottingham student population and from the general public and were paid an inconvenience allowance for their participation. All participants had normal hearing , except one participant who had mild hearing loss at 4 kHz in the right ear (35 dB HL) but was included in the study since pure-tone thresholds at all other frequencies (including those used in the experiment) were in the normal range (⇐20 dB HL).The research protocol was approved by the Nottingham Research Ethics Committee. Informed written consent was obtained from all participants.The study protocol consisted of a pre-test phase, a post-test phase and a training phase . All tesStimuli for both testing and training consisted of 100 ms tones (including 10 ms raised cosine ramps) presented with an inter-stimulus interval of 500 ms. In the test phases, standard tones had a frequency of 1000 Hz and target tones were varied adaptively. In the training phase, there was no frequency difference between standard and target tones so that all tones had a frequency of 1000 Hz. Stimuli were presented diotically using Sennheiser HD-25-1 headphones at 60 dB SPL.One frequency-discrimination (FD) threshold assessment of 30 trials confirmed that the training groups were well matched on pre-test thresholds  = 0.016; p = 0.98).During the training phase, all tones were identical (ΔF = 0%) but listeners were instructed to perform the same discrimination task as that in the pre-test phase and choose the sound that was different. In two groups, positive feedback was provided on some trials such that listeners believed their response was correct. Listeners in the first training group (90%) received positive feedback on 90% of the trials, randomly picked by the software running the experiment. A second training group (10%) received positive feedback on 10% of the trials. Listeners in the final group (NF) received no feedback; they were informed prior to the first training block that they would not be receiving any feedback for that part of the session.The Matrix Reasoning subtest of the Weschler Abbreviated Scale of Intelligence WASI was admiOf the 106 participants recruited for this study 12 were excluded from statistical analysis because the psychometric function fitted to their pre- or post-test probe data had very shallow slopes (⇐0.10), which render the threshold estimates for these probes unreliable. Four participants were excluded from the 90% group (1 based on pre-test and 3 on post-test thresholds); three from the 10% group ; and five from the NF group (4 pre-test and 1 post-test), leaving 32 in the 90% group, and 31 each in the 10% and NF groups.FD threshold data (in Hz) were log-transformed, and all statistical analyses were carried out on the log-transformed data. A mixed-model analysis of variance (ANOVA) which allows for heterogeneity of variance was used to investigate the group data because the equality of variance assumption was not met by the data set . Non-verbal IQ was included as a covariate in the model.Learning subgroup analysis was carried out on the mean of pre- and post-training DLFs rather than the learning index (difference between pre- and post-training DLFs) because the former is statistically independent from the subgroup factor whereas the latter is not uncorrelated with the mean of pre- and post-training DLFs).The figures include an additional group (33%) which was collected in a previous study with 33% positive feedback Click here for additional data file.

The crystal structure exhibits weak inter­molecular C—H⋯O hydrogen bonds, which link the mol­ecules into zigzag chains along the b axis.The title compound, C Å b = 9.3787 (19) Å c = 16.575 (3) Å V = 1290.4 (5) Å3 Z = 4 Kα radiationMo −1 μ = 0.48 mmT = 296 (2) K 0.33 × 0.27 × 0.17 mm Rigaku R-AXIS RAPID IP area-detector diffractometerABSCOR; Higashi, 1995T min = 0.857, T max = 0.922Absorption correction: multi-scan (20457 measured reflections2403 independent reflectionsI > 2σ(I)1506 reflections with R int = 0.051 R[F 2 > 2σ(F 2)] = 0.036 wR(F 2) = 0.075 S = 0.77 2403 reflections145 parametersH-atom parameters constrainedmax = 0.21 e Å−3 Δρmin = −0.14 e Å−3 ΔρAbsolute structure: Flack 1983, 691 FriFlack parameter: 0.00 (9) RAPID-AUTO used to solve structure: SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL.Data collection: 10.1107/S1600536808011902/cv2400sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536808011902/cv2400Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Lactococcus lactis was grown at steady state in continuous cultures at different growth rates, and proteomic and transcriptomic data were thoroughly compared. Ratios of mRNA to protein were highly variable among proteins but also, for a given gene, between the different growth conditions. The modeling of cellular processes combined with a data fitting modeling approach allowed both translation efficiencies and degradation rates to be estimated for each protein in each growth condition. Estimated translational efficiencies and degradation rates strongly differed between proteins and were tested for their biological significance through statistical correlations with relevant parameters such as codon or amino acid bias. These efficiencies and degradation rates were not constant in all growth conditions and were inversely proportional to the growth rate, indicating a more efficient translation at low growth rate but an antagonistic higher rate of protein degradation. Estimated protein median half-lives ranged from 23 to 224 min, underlying the importance of protein degradation notably at low growth rates. The regulation of intracellular protein level was analysed through regulatory coefficient calculations, revealing a complex control depending on protein and growth conditions. The modeling approach enabled translational efficiencies and protein degradation rates to be estimated, two biological parameters extremely difficult to determine experimentally and generally lacking in bacteria. This method is generic and can now be extended to other environments and/or other micro-organisms.This genome-scale study analysed the various parameters influencing protein levels in cells. To achieve this goal, the model bacterium Lactococcus lactis on a limited number of mRNA-protein couples but keeping in mind that this approach could be extended to other micro-organisms and biological phenomena. We have exhibited that mathematical modeling associated to experimental steady-states cultures is a powerful tool to understand microbial physiology.This work is in the field of systems biology. Via an in-depth comparison of proteomic and transcriptomic data in various culture conditions, our objective was to better understand the regulation of protein levels. We have demonstrated that bacteria exert a tight control on intracellular protein levels, through a multi-level regulation involving translation but also dilution due to growth and protein degradation. We have estimated translational efficiencies and protein degradation rates by modeling. These two biological parameters are extremely difficult to measure experimentally and have not been previously determined in bacteria. We have found that they are growth rate dependent, indicating a fine control of translation and degradation processes. We have worked with the small genome bacterium To achieve this purpose, transcriptomic and proteomic analyses were performed with cells from the same culture. Transcriptomic data were already available The aim of this study was to analyse the control of intracellular protein level taking into account all the parameters of this control, in a prokaryotic organism, the model of lactic acid bacteria, L. lactis was grown in continuous culture at different growth rates in the conditions previously described i.e. 0.09, 0.24 and 0.47 h−1: the lowest growth rate (μ = 0.09 h−1) was chosen as reference. Despite the small size of the L. lactis genome , translation and more specifically ribosomal proteins , enzymes related to fatty acid and phospholipid metabolism , two proteins involved in cell division , and some proteins associated with purine, pyrimidine, nucleoside and nucleotide metabolism .Proteome profiles differed between the various stress-related proteins. On one hand, the two chaperones DnaK and GroEL, the superoxide dismutase associated to oxygen stress SodA, and DpsA, were found in higher quantity, while on the other hand, the cold shock associated protein CspE, ClpC and the adaptation related peroxidase Tpx, had decreased levels in response to growth rate increase. Besides those opposite punctual regulations, other proteins encoding important functions involved in stress protection such as ATPases or peptidases (excepting PepP), were present at constant levels, independently of the growth rate. This lack of general tendency observed here at proteomic level was also observed at transcriptomic level −1) as reference /k″) and k′ represents the translation efficiency. At steady state, the various concentrations are expected to remain constant, the time derivative of the protein concentration is equal to zero and the previous equation can be simplified and reorganized as follows:Rates of mRNA translation or protein degradation/dilution are assumed to be not constant and related to mRNA or protein concentration respectively. Biological rates were expressed as first order kinetics of their substrate concentration as previously postulated in In the chemostat cultures at the various growth rates, cells are at steady state; similarly, during the exponential growth phase, cells are physiologically stable and are also considered to be at steady-state 2), which is consistent with the visual observation of the various curves (not shown). For each mRNA–protein couple the reliability of the two estimated constants α and β was evaluated by their associated R2. All regression coefficients are listed in 2) associated to this model was 0.83±0.04. Finally, the consistency of our modeling approach was checked when removing the data of the batch exponential growth phase from the analysis. A high mean R2 of 0.77±0.12 was still obtained using chemostat data exclusively. On the contrary, data not at steady state coming from other growth phases in batch cultivation could not be included. Indeed when taking into account mRNA/protein values during growth deceleration or during stationary phase, R2 was strongly affected and dropped to 0.21±0.03 and 0.24±0.04 respectively.The mRNA/protein ratios were thus linked to the growth rate (μ) through a polynomial function of order two (μE coli2 (3) had generally lower R2 (only 48 couples with R2≥0.90 compared to 130 with concentrations), indicating the modeling approach with abundances was less satisfactory than with concentrations.The model (1) states that translation rate is proportional to the concentration of mRNA species which assumes that translation is mRNA-limited. An alternative hypothesis, would be the saturation of the ribosome with mRNA, as previously postulated in 2≥0.90 (130) were retained for further analyses , but also MurF, involved in parietal structure, YtgH, which is homolog to Staphylococcus aureus alkaline stress protein E. coli universal stress protein Usp E. coli homologue is involved in copper resistance E. coli are involved in oxygen and copper stress responses L. lactis may limit degradation of stress-related proteins so as to maintain a minimal pool ready to use in case of emergency, which is biologically relevant.Due to the restricted size of the dataset but also to the non-uniform distribution of detected proteins in the various functional categories, it was not possible to use statistical tests to rigorously determine functional enrichments in extreme values of k′ or k″. However, among the 15 genes that are translated the most efficiently with associated p-values lower than 0.05 were considered as significant. The codon adaptation index (CAI) positively correlates with k′ (RSpearman = 0.57). Since CAI directly reflects translation efficiency during the elongation step L. lactis proteins. This amino acid bias, together with the codon bias (CAI), shows that translation efficiency is strongly dependent of the gene sequence. This optimized functioning state is probably the result of a long evolutionary process. Finally it was found that translation efficiency is affected by protein length: the longer the protein, the more k′ decreases (RPearson of −0.18). This negative correlation with length has already been reported for yeast S. cerevisiaeBiological determinants of translation efficiency and protein stability were investigated through correlation studies. Correlations providing a Spearman coefficient . The values of ρt were used to elucidate the nature of the control and are given in supplementary data .The term ary data . If ρt≤0S. cerevisiae but these ratios remained constant between the two studied conditions, i.e. a rich and a poor media S. cerevisiae were estimated to be 0.46 and 0.35 h−1 respectively in a rich and a poor media . Thus it is postulated that the growth rate difference between these two conditions was too small to induce changes in mRNA/protein ratios.The comparison of mRNA and protein ratios revealed a strong heterogeneity among genes but also for a given gene, at different growth conditions. Variability among genes has recently been reported for the model yeast L. lactis is consistent with the results obtained for the yeast, though translation efficiencies have been calculated differently L. lactis, the growth-rate dependant variations in translation efficiency are probably not related to changes in the amount of intracellular ribosomes if the constant ratio between mRNA and ribosomal RNA . Moreover, the degradation rate is even higher than dilution rate at low growth rate . ConsideL. lactis on a limited number of mRNA - protein couples (171). It will be possible in the future to broaden these couples since other proteomic methodologies, such as the APEX technology via chemostat cultures, but such growth rate modifications are also encountered in nature when cells have to face new environments. In this case, the adaptation process involves growth rate adaptation as well as other specific metabolic adaptations. It remains to be determined how the protein control is exerted in such natural environment.With this modeling approach, we have estimated translational efficiencies and protein degradation rates. These two biological parameters are extremely difficult to measure experimentally and have even never been previously determined in bacteria. The method was based on an in depth comparison of proteome and transcriptome data and was developed with the small genome bacterium Lactococcus lactis ssp. lactis IL1403, whose genome has been entirely sequenced −1 during anaerobic chemostat cultures (under nitrogen atmosphere and regulated pH) on a chemically defined medium limited by isoleucine concentration. For each steady-state, samples have been harvested in at least quadruplicate with a minimum delay of five doubling time between each sampling.33P) and hybridized on nylon membrane as previously described L. lactis . Since the amount of RNA to perform transcriptomic analysis is maintained constant in order to avoid retro-transcription labelling bias, these RNA yield changes are completely hidden by the technology.Transcriptomic data (geo platforms GSE10256 −1 respectively). Thus, it can be deduced that the ratio mRNA/total RNA was constant and assuming that ribosomal RNA is the major component of total RNA we can postulate that the fraction mRNA/ribosomal RNA is independent of the growth rate.The total raw intensity of the membrane without any normalisation represents the amount of mRNA in the RNA sample used for transcriptomic analysis (10 µg). This total intensity was constant at each growth rate and lower than the saturation threshold was determined with the Coomassie protein assay reagent using bovine serum albumin as standard and was included between 1 and 2 mg/mL. The cytosolic fraction was aliquoted and stored frozen at −20°C.For each condition, three repetitions were performed with independent cultures, extractions and electrophoresis. Bacteria were harvested from the cultures and cell pellets were washed twice with ice-cold 200 mM Na-phosphate, pH 6.4 and re-suspended in 4 ml of 20 mM Na-phosphate buffer, pH 6.4, 1 mM EDTA, 10 mM tributylphosphine, a cocktail of protease inhibitors 20-fold diluted and catalase 40 U/ml to limit isoform formation. The cell suspension was transferred to the pre-cooled chamber of a BASIC Z cell disrupter and was subjected to a pressure of 2,500 bars. The suspension was centrifuged at 5,000×A volume of cytosolic fraction corresponding to 350 µg or 500 µg (for basic gels) of proteins was incubated with nuclease for 30 min at 37°C and then chilled on ice and precipitated with 75% (vol/vol) methanol. The protein pellet was resuspended in 500 µL (for pH 4.5–5.5 and 5–6 gels) or 100 µL (for pH 6–11 gels) of isoelectric focusing (IEF) buffer 1, consisting of 7 M urea, 2 M thiourea, 4% CHAPS{}, 100 mM dithiothreitol or 4 mM tributylphosphine and DeStreak (for basic gels), and 0.5% pH 4.5 to 5.5 or 5 to 6 or 6 to 11 immobilized pH gradient (IPG) buffer . The sample was loaded on 24 cm pH 4.5 to 5.5 or 5 to 6 IPG strip which was previously rehydrated at 50 V for 11 h. IEF was carried out for 65,000 V.h at a maximum of 8,000 V, using the Protean II IEF cell . Analysis of basic proteins was performed with 18 cm pH 6–11 IPG strip. After passive rehydration of the strip in buffer 1, the protein sample was loaded on sample cups and IEF was carried out for 20,000 V.h at a maximum of 3,500 V using the IPGphor device . Before the second dimension, IPG strips were incubated for 15 min with shaking in 150 mM Tris-HCl pH 8.8, 0.1% w/v SDS. The IPG strip was then positioned on sodium dodecyl sulfate-polyacrylamide gels, using 1% low-melting-point agarose in 150 mM Tris-HCl, pH 8.8. Second-dimension electrophoresis was performed on 12% polyacrylamide gels (24 by 20 by 0.1 cm) in 25 mM Tris, 192 mM glycine, 0.1% sodium dodecyl sulfate, pH 8.3, using the Ettan-Dalt II apparatus. Electrophoresis was run at 1 W/gel for 16 h at 15°C. The gels were stained with BioSafe colloidal Coomassie blue (Bio-Rad) for 1 h and destained with three successive washes in deionized water.Images files were recorded at 65536 gray levels (16 BitsPerPixel). Image manipulation and analysis were performed with Samespot V2 software (Nonlinear Dynamics). Protein abundances were given using arbitrary units which correspond to spot volumes and which were calculated as follows: spot area x spot pixel intensity - background intensity.http://prospector.ucsf.edu) either on an L. lactis-specific protein database.Protein identification was carried out at the PAPPSO platform using MALDI-TOF mass spectrometry (MS). Protein spots were excised from Coomassie blue-stained gels and in-gel digested with trypsin. Gel pieces were placed in Eppendorf tubes and washed with 30 µL 25 mM ammonium carbonate, 50% acetonitrile. The supernatants were discarded and gel pieces were dried at 37°C for 15 min. The gels were rehydrated with 20 µL 50 mM ammonium carbonate containing 100 ng of porcine trypsin . The solutions were incubated overnight at 37°C. The supernatants containing peptides were directly analyzed by MALDI-TOF Mass spectrometry on a Voyager DE STR Instrument . The α-cyano-4-hydroxycinnamic acid matrix was prepared at 4 mg/mL in 0.1% TFA, 50% acetonitrile. An equal volume (1 µL) of matrix and sample were spotted onto the MALDI-TOF target plate. Spectra were acquired in the reflector mode with the following parameters: 2,000 laser intensity, 20 kV accelerating voltage, 62% grid voltage, 120 ns delay. The mass gates used were 840–3500 Da. Internal calibration was performed by using the trypsin peptides at 842.5 and 2,211.1 Da. Database searches were conducted with the MS-Fit software connected to a linear ion trap mass spectrometer by a nanoelectrospray interface to realize the separation, ionisation and fragmentation of peptides, respectively. The supernatant of trypsin hydrolysis was transferred to a new tube and the gel pieces were extracted with a) 25 µL of buffer B (50 mM ammonium carbonate) and b) two times buffer C (Formic acid 0.1% acetonitrile 50%). For each extraction, the gel pieces were incubated for 15 min at room temperature while shaking. The supernatants of each extraction were pooled with the original trypsin digest supernatants and dried for 2 h in a Speed-Vacuum concentrator. The peptides were then re-suspended in 25 µL of precolumn loading buffer (0.08% TFA and 2% ACN in water). LC-MS/MS analysis was performed on an Ultimate 3000 LC system connected to linear ion trap mass spectrometer by nanoelectrospray interface for separation, ionisation and fragmentation of all peptides. Four µL of tryptic peptide mixtures were loaded at flow rate 20 µL/min onto precolumn Pepmap C18 . After 4 min, the precolumn was connected with the separating nanocolumn Pepmap C18 and the gradient was started at 300 nL/min. All peptides were separated on the nanocolumn using a linear gradient from 2 to 36% of buffer B, over 18 min. Eluting buffer A: 0.1% Formic acid, 2% acetonitrile and eluting buffer B: 0.1% Formic acid, 80% acetonitrile. Including the regeneration step, each run was 50 min in length. Ionization was performed on liquid junction with a spray voltage of 1.3 KV applied to non-coated capillary probe . Peptides ions were analysed by the Nth-dependent method as follows: (i) full MS scan (m/z 300–2000), (ii) ZoomScan (scan of the 3 major ions), (iii) MS/MS on these 3 ions with classical peptides fragmentation parameter: Qz = 0.25, activation time = 30 ms, collision energy = 40%. Proteins identifications were performed with Bioworks 3.3 software. The raw data were converted and filtered in peak lists with default data generation parameters for LTQ mass spectrometer. All peak lists of precursor and fragment ions were matched automatically against a Raw spot volumes were normalized by the mean intensity of the corresponding gel. A total of 542 spots corresponding to 352 different proteins were detected. Some of the spots corresponded to proteins mixture and were not considered. The intensities of spots corresponding to protein isoforms in a same gel were summed so as to represent the level of a single protein independently of post-transcriptional modifications. 15 proteins identified both on 4.5–5.5 and 5–6 pH ranges displayed very different amounts. We considered that the best protein level estimation was given by the highest signal.Since total protein concentrations remain stable whatever the growth rate (42±6 g protein per 100 g cell dry weight), the abundance data are considered to be equivalent to concentrations. Ratios were calculated using the slowest growth phase as a reference. The statistical significance of ratios were evaluated using Student test and False Discovery Rates Click here for additional data file.Table S2Regulatory coefficients calculated between the different growth rates(0.16 MB XLS)Click here for additional data file.

Escherichia coli (E. coli) O157:H7 in theenvironment is a major concern to vegetable and fruit growerswhere farms and livestock production are in close proximity. Theobjectives were to determine the effects of preplant fumigationtreatment on the survival of E. coli O157:H7 in two soils and theeffects of indigenous bacterial populations on the survival ofthis pathogen. Real-time PCR and plate counts were used toquantify the survival of E. coli O157:H7 in two contrasting soilsafter fumigation with methyl bromide (MeBr) and methyl iodide(MeI). Ten days after fumigation, E. coli O157:H7 counts weresignificantly lower (P = .0001) in fumigated soils than in thenon-fumigated. Direct comparison between MeBr and MeI within eachsoil indicated that these two fumigants showed similar impacts onE. coli O157:H7 survival. Microbial species diversity asdetermined by DGGE was significantly higher in clay soil thansandy soil and this resulted in higher initial decline inpopulation in clay soil than in sandy soil. This study shows thatif soil is contaminated with E. coli O157:H7, fumigation alone maynot eliminate the pathogen, but may cause decrease in microbialdiversity which may enhance the survival of the pathogen.Persistence of E. coli O157:H7 to vegetable crops. In most management schemes, fumigants are used for the control of plant pathogens, nematodes, and weeds before high-value cash crops such as strawberry and tomato are planted. Outbreaks of E. coli O157:H7 infections historically have been associated with consumption of undercooked ground beef; however, many recent outbreaks have resulted from consumption of contaminated raw vegetables, including lettuce [E. coli O157:H7 is of particular concern because ingestion of relatively few cells can cause illness [. E. coli O157:H7 can survive for 60 to 120 days in water and in soil, and under dry and acidic conditions [Appropriate management of farm waste such as manure is critical in controlling the spread of pathogens such as lettuce . Althoug illness . E. coliThe steps in the production chain that have the greatest potential for pathogen contamination are soil preparation (use of uncomposted manures) and planting and growing –8. PreveE. coli O157:H7 in the environment [E. coli O157:H7 in soils contaminated with the pathogen. To accomplish these objectives, a preliminary study was conducted to determine the survival of the pathogen in both autoclaved and nonautoclaved soils at different concentrations of the pathogen. For our main objectives, both plate count and real-time PCR approaches were used to determine the survival of E. coli O157:H7 in the two soils. In the absence of known phytopathogens, many crops have exhibited an increased growth response when planted into soil that had been fumigated with MeBr at the rironment , 14. TheE. coli O157:H7 (pGFP) strain 72 was kindly provided by Dr. Pina Fratamico of USDA-ARS [Stx1 and Stx2 and the pGFP expressing green fluorescent protein (GFP) and ampicilin resistance. E. coli O157:H7 was cultured at 37°C overnight in modified Tryptic Soy broth (mTSB) supplemented with 100 μg of ampicillin ml−1 . Cells were harvested by centrifugation at 3500 X g for 10 min and resuspended in phosphate buffered saline (PBS) to a concentration of ~108 CFU ml−1. Bacterial strains (except strain 72) used to determine the specificity and sensitivity of PCR assays were obtained from the National Animal Disease Center and were cultured on Luria-Bertani (LB) broth agar and Sorbitol MacConkey (SMAC) agar plates at 37°C.−3 with 3.7% sand, 49.1% silt, and 47.2% clay. The sandy soil has a bulk density of 1.67 Mg m−3 with 99.1% sand, 0.20% silt, and 0.70% clay. The moisture content of the clay soil was 4.02 % and that of sandy soil was 5.32%, before both were increased to about 12% at the start of the experiment. The pH of sand was 6.85 and that of clay was 7.45. Each soil (100 g dry wt) was placed in 150 ml beakers (18 beakers of each soil type) and the soil was autoclaved for 1 h, cooled for 24 h, and autoclaved again before use for the study. Eighteen beakers of each soil type were also kept unautoclaved for comparison. Inoculums were made in PBS and added to the appropriate soil beaker by spraying and mixing 10 ml of the culture mixture with a spray bottle on the surface of 100 g of soil to obtain the following inoculums concentrations in triplicate: 101, 103, 104, 106, 108, and 0 for both autoclaved and unautoclaved soils.Serial dilution was made with 10 g portion of each soil for the enumeration of bacteria. Both the clay and sandy soils were treated the same. Soils were mixed for 5 min with sterile specula to homogeneously distribute the E. coli O157:H7, and covered with foil and incubated at 20° C in the growth chamber for the duration of the experiment. E. coli O157:H7 population was determined by plating on Tryptic soy agar plates containing 100 μg of ampicillin ml−1 (TSA-A) at days 0 (inoculation), 1, 3, 5, 10, 20, 30, 40, 50, and 60. The GFP-labeled E. coli O157:H7 colonies were counted under an UV light.Clay soil and sandy soil (dello loamy sand) were collected from Mystic Lake dry bed and the Santa Ana River bed, respectively, and treated as described by Ibekwe and Grieve . The cla8E. coli O157:H7. Bacteria were inoculated into the irrigation lines with a Cole-Parmer HPLC pump and delivered through PVC pipes to each tray with five surface drip lines. The five drip lines delivered about 106 CFU g−1E. coli O157:H7 at time zero. Soil samples were collected on the day of inoculation for community analysis, E. coli O157:H7(pGFP) concentration and heterotrophic plate counts. After the initial sample collection, trays were manually covered with a virtually impermeable plastic film; 0.038 mm Hytibar film and fumigants were applied. The fumigant methyl iodide was purchased from Chem Service and methyl bromide (MeBr >99% purity) was obtained from Great Lakes Chemical Company . Plastic trays (58.2 × 43.2 × 18.5 cm) were filled with approximately 40 kg of soil. The soils were irrigated with approximately 2.2 ×10 http://www.cdpr.ca.gov/). To avoid the emission of fumigants to the growth chamber, syringes were used to inject fumigant (MeBr-gas and MeI-liquid) into the trays; injection ports covered immediately with duct tape and left in the growth chamber for 10 days. After 10 days, trays were moved outside and the Hytibar film was removed. Trays remained outside in an area covered with barb wires, opened and aerated for 2 days before they were moved back to the growth chamber for the continuation of the experiment. At this point, a total of 14 days has elapsed since fumigation, and soil samples were collected for E. coli O157:H7(pGFP) concentration, bacterial diversity, and heterotrophic plate counts. Fumigant rates and application methods were selected according to the recommended field application rate for each chemical by California Department of Pesticide Regulation .Soils were irrigated with 50% Hoagland solution in the tH) to compare changes in diversity of microbial communities within all treatments at each time [Community DNA was extracted from 0.5 g soil with the Ultra Clean Soil DNA Kit according to the manufacturer's protocol and stored at −20° C. A 236-bp DNA fragment in the V3 region of the small subunit ribosomal RNA genes of eubacteria was amplified by using primer set PRBA338f and PRUN518r . The comPi = ni/N, ni is the height of peak, and N is the sum of all peak heights in the curve.E. coli O157:H7, grown for 12 h at 37°C and extracted with the Qiagen tissue kit . DNA extracted from O157:H7 was used for the construction of standard curve and for the determination of detection limits of the E. coli by real-time PCR. Total bacterial DNA was extracted from soil with the Ultra Clean Soil DNA Kit as stated above and stored at −20°C. Primers and probes used for the detection and quantification of the stx1, stx2, and the eae gene in E. coli O157:H7 were as described [μl volume containing 200 μM of dNTPs, 2 μl of genomic DNA from each concentration, 2.5 U of AmpliTaq Gold polymerase, 5 μl of 10X TaqMan buffer , 0.3 μM of each primer, 0.1 μM of probe, and 3.5 mM of MgCl2. Genomic DNA purified from E. coli O157:H7 was used as a template for the positive control and no template for negative control. PCR was performed using the following cycle conditions: denaturation at 95°C for 10 min, 50 cycles of 94°C for 20 s, 55°C for 30 s, 72°C for 40 s, followed by a 5 min extension at 72°C and a hold at 4°C. Standard curves generated from plotting the threshold cycle (CT) versus log10 of starting DNA quantities (pg) were used for determining the detection limit of the assay. Optimization of the multiplex assay was done as previously discussed [−1/slope)−1. Reaction with 100% efficiency generated a slope of –3.32.Genomic DNA Was Isolated from pure culture of escribed , 22. Reaescribed . Brieflyiscussed , 22. AmpE. coli O157:H7 concentrations were converted to log CFU g−1 for regression analysis. Statistical analyses were done with the general linear model (GLM) procedure of the Statistical Analysis System [E. coli O157:H7 population size of all individual samples were plotted over time after inoculation, and analyzed by regression analysis [10 values and survival curves were obtained by plotting the logarithm of survivors against the treatment time. The survival data were fitted to a biphasic model as proposed by Coroller et al. [N is the number of survivors, N0 is the inoculums size; t is the time; p is the shape parameter, when p > 1 a convex curve is observed; when p < 1 a concave curve is observed, when p = 1 a linear curve is observed. The scale parameter, δ, represents the time needed for first decimal reduction. f, varying from 0 to 1, is the fraction of subpopulation 1 in the population. Another parameter, α, varying from negative infinity to positive infinity, is obtained by logit transformation of f as shown in equation 2. The strong correlation between the scale (δ) and the shape (p) parameters makes it possible for the double Weibull model to fit most of the shapes of deactivation curves. Additionally, when δ1 = δ2, the double Weibull model can be simplified into a single Weibull model, and the survival curve can be described by only three parameters. A very important and useful parameter, time to detection limit (Td) can also be calculated when using GInaFiT to fit the experimental survival data.s System . The popanalysis . Plate cr et al. , 24 withr et al. :(2)N(t)E. coli O157:H7 in sandy and clay soils was first determined in the two soils used for this study. This was done to determine the influence of indigenous microorganism on the survival of E. coli O157:H7 in autoclaved and unautoclaved soils. Data from the survival study showed that within the first 7 days E. coli O157:H7 populations decreased by ca. 0.24 log10CFU g−1 in the 104 dilution and by 0.67 log10CFU g−1 in the 108 dilution for the unautoclaved soil , delta (δ), and the shape parameter-p) were calculated from equation might largely be attributed to the faster decline of subpopulation as shown with smaller δ1 dominated the cell population, leading to a slower and steadily decline of the cell concentration as the curves showed little or no decline. After the first 10 days, E. coli O157:H7 populations in unautoclaved soil declined considerably more rapidly than in autoclaved soil below the detection limits of 102 CFUg−1 soil. After 60 days, the concentration of E. coli O157:H7 in the 104 dilution was undetectable by plate count, and there was a 6.18 log10CFU g−1 reduction for the 108 dilution. Survival of pathogen was greater in the sandy soil (P = .05) than clay unautoclaved soil within the first 7 days . Mean comparison by days and methods were used to determine the impact of fumigants on the survival of E. coli O157:H7 in the two soils after fumigation in fumigated soils than the control clay soil at the recommended application rate. During the rest of the study, there were no significant differences on the effect of the two fumigants on the pathogen, except on day 36 (P = .046) where the effects varied. Real-time PCR analysis showed that 10 days after fumigation, E. coli O157:H7 concentration in non-fumigated soils was significantly higher (P = .002) in sandy soil than clay soil. There were no significant differences (P = .56) in pathogen concentration during day 23 when real-time PCR was used for the analysis. The same effect was observed during day 36 and 50 (data not shown). Direct comparison between MeBr and MeI within each soil showed that neither had significant greater impact on E. coli O157:H7. Before the enumeration of migation . Since o2 CFU g−1 during the experiment due to earlier onset of tailing at about 35 days using real-time PCR. Also, both soils showed that it took less than a day to inactivate the first log10 of microbial population in most of the fumigated samples. The majority of the survival curves showed aE. coli O157:H7 in clay and sandy soils after fumigation was model by fitting the experimental data into the survival functions were calculated when they were inoculated into the same soil did not differ significantly between survival curves in sandy soil irrespective of fumigants or no fumigant. The same effect was observed in clay soil, indicating that the model is suitable to fit survival curves of E. coli O157:H7 in an array of different soils.Effects of soil types on the survival unctions . Similar Figures . HoweverP ≤ .05) of fumigants as determined by the Shannon-Weaver index of diversity between clay and sandy soil (P = .0003) in sandy soil than in clay soil at the recommended application rate. The same effect was observed with MeI fumigated soil. Bacterial communities were not different at week three (P = .13), week four (P = .06), and week five (P = .11). However, at week seven there was a significant (P = .0001) shift in microbial community structure as determined by diversity index with all the treatments was positively correlated with survival of E. coli O157:H7 in sandy soils and in clay soil using the plate count method . Using data from real-time PCR analysis, survival of E. coli O157:H7 were positively correlated with microbial diversity in both clay and sandy soils (data not shown).DGGE analysis of 16S rRNA fragments was used to examine the effects of MeBr and MeI on soil microbial communities during week 1 to7 after fumigation. The most drastic effect occurred on the first week of the experiment where there was a significant effect . Our study is in agreement with Jiang et al. [E. coli O157:H7 from an unautoclaved soil were only detected by enrichment culture, and survived for longer period of time at 15°C than 21°C. This suggests that there was a small population of cells that have survived in the soil under different environmental stress. The long-term survival of this pathogen in the environment has been reported by many authors [E. coli O157:H7 can survive in fumigated soils for over 60 days due to long-term persistence of a small percent of the population.Before the start of this experiment, a preliminary study was conducted in autoclaved and unautoclaved soil to determine the influence of indigenous soil microorganisms on the survival and growth of Figures . The antg et al. who show authors , 27–31, E. coli O157:H7 can survive longer in sandy soil than in clay soil during a short term experiment. However, populations persisted longer in clay than in sandy soil during a long-term study. Our results showed that E. coli O157:H7 survived longer than 60 days in both soils. Others have reported survival of more than 54 days in manure amended soil [E. coli O157:H7 survival times of between 154 and 217 d in soils amended with inoculated compost [6  CFU g−1). Also, during our preliminary experiment with E. coli O157:H7 with population of lesser than 104  CFU g−1, survival of the pathogen was less than seven days. This is in agreement with Franz et al. [2  CFU g−1). Therefore, the survival of E. coli O157:H7 in the environment may depend on the initial concentration at the beginning of the experiment. Our study showed that ded soil , 32–34 aded soil , 35, and compost . This stz et al. that monE. coli O157:H7. The survival curves generated from our study in most cases showed a convex fitting, indicating changes in biological stress over time. The model is sufficiently flexible to account for different survival patterns and has been previously used to model thermal inactivation of Listeria monocytogenes in sucrose solutions of various water activities [ E. coli O157:H7 in manure amended soil [E. coli O157:H7 in soil. They pointed out that even though the Weibull model is an empirical model, it can be linked to physiological properties at population level and that the population is heterogeneous with respect to the stress encountered in the soil. These authors noted that a convex curve would mean that the remaining cells become increasingly susceptible to stress, and the cells are therefore subjected to more damages with time. A linear survival curve means that inactivation does not depend on time or other biological activities and the concave survival curve means that sensitive members of the population are rapidly eliminated and that the sturdier survivors remain. In this study, we used the double Weibull model, which is the cumulative form of the underlying distribution of individual inactivation kinetics, and it was a suitable model for describing the decline of tivities and the ded soil . Franz eded soil ; Van Boeded soil ; Peleg, ded soil discusseE. coli O157:H7 in clay soil may be influenced by interaction between soil particles in the clay particle sizes that provided niches for the pathogen and moisture/nutrients within the niches. Other factors that contributed to the survival of pathogen in soil were soil microbial diversity. Recently, the effects of E. coli O157:H7 was assessed in a loamy sand soil obtained from species-rich grassland, in which the microbial community composition had been modified by progressively enhanced fumigation depths [E. coli O157:H7 in the soils with modified community structures due to fumigation was clearly consistent with the hypothesis that within the single selected habitat (soil), which was relatively unaffected with respect to abiotic conditions like pH, moisture and soil chemical conditions, microbial community structure was the main determinant of the survival of the pathogen. With the present study we found that the values of the log reduction time and the shape parameter of the double Weibull model were higher for clay soils compared to sandy soils. This means that with sandy soils the initial rate of decline of E. coli O157:H7 was faster than in clay soil. E. coli O157:H7 was more vulnerable to mortality during the first few weeks in the sandy soil than in clay soil. Finer-textured (clayey) soils result in prolonged survival of introduced bacteria compared with coarser-textured (sandy) soils because of higher availability of protective pore spaces against feeding by soil fauna like protozoa [E. coli O157:H7 numbers in the sandy soils compared with the loamy soils, but survivors are increasingly more sturdy compared with survival in the clay soils. The implication of long-term survival of this pathogen in the environment may involve the recontamination of the environment after the initial contamination event from few surviving strains.Longer persistence of n depths . The autprotozoa . This coE. coli O157:H7 was significantly lower in fumigated soils than the control at the normal application rate during the first 2 weeks of the experiment [E. coli O157:H7 at the normal application rate.periment . Howeverperiment . However

The growth inhibitory effects, the reduction of [3H]-TdR incorporation and the perturbation of the cell cycle induced by the new agent mitozolomide on the M14 human melanoma cell line and on the SW626 human ovarian cancer cell line were compared to those produced by BCNU. Flow cytometry showed an interesting difference: at the high concentration mitozolomide induced an accumulation of cells in S middle and S late-G2-M phase of the cell cycle whereas BCNU caused only a block in S late-G2-M. Further studies were aimed at investigating the susceptibility of freshly isolated human ovarian cancer cells to pharmacologically reasonable mitozolomide concentrations. Only in one out of 16 primary cultures of human ovarian cancers was mitozolomide able to induce cell cycle perturbation, suggesting that ovarian carcinoma cells may not be sensitive to this drug.

The alkylphospholipid analog miltefosine (hexadecylphosphocholine) is a membrane-directed antitumoral and antileishmanial drug belonging to the alkylphosphocholines, a group of synthetic antiproliferative agents that are promising candidates in anticancer therapy. A variety of mechanisms have been suggested to explain the actions of these compounds, which can induce apoptosis and/or cell growth arrest. In this review, we focus on recent advances in our understanding of the actions of miltefosine and other alkylphospholipids on the human hepatoma HepG2 cell line, with a special emphasis on lipid metabolism. Results obtained in our laboratory indicate that miltefosine displays cytostatic activity and causes apoptosis in HepG2 cells. Likewise, treatment with miltefosine produces an interference with the biosynthesis of phosphatidylcholine via both CDP-choline and phosphatidylethanolamine methylation. With regard to sphingolipid metabolism, miltefosine hinders the formation of sphingomyelin, which promotes intracellular accumulation of ceramide. We have demonstrated for the first time that treatment with miltefosine strongly impedes the esterification of cholesterol and that this effect is accompanied by a considerable increase in the synthesis of cholesterol, which leads to higher levels of cholesterol in the cells. Indeed, miltefosine early impairs cholesterol transport from the plasma membrane to the endoplasmic reticulum, causing a deregulation of cholesterol homeostasis. Similar to miltefosine, other clinically-relevant synthetic alkylphospholipids such as edelfosine, erucylphosphocholine and perifosine show growth inhibitory effects on HepG2 cells. All the tested alkylphospholipids also inhibit the arrival of plasma-membrane cholesterol to the endoplasmic reticulum, which induces a significant cholesterogenic response in these cells, involving an increased gene expression and higher levels of several proteins related to the pathway of biosynthesis as well as the receptor-mediated uptake of cholesterol. Thus, membrane-targeted alkylphospholipids exhibit a common mechanism of action through disruption of cholesterol homeostasis. The accumulation of cholesterol within the cell and the reduction in phosphatidylcholine and sphingomyelin biosyntheses certainly alter the ratio of choline-bearing phospholipids to cholesterol, which is critical for the integrity and functionality of specific membrane microdomains such as lipid rafts. Alkylphospholipid-induced alterations in lipid homeostasis with probable disturbance of the native membrane structure could well affect signaling processes vital to cell survival and growth. Alkylphospholipid (APL) derivatives are novel cytostatic agents that, in contrast to most of the currently used chemotherapeutic drugs, do not target DNA or the cytoskeleton but act at the cell membrane . There icis double bond and perifosine presents a piperidine moiety instead of the choline head group [Miltefosine is a representative member of a second generation of the synthetic APL family, being the prototype of the first generation edelfosine. In an attempt to improve antitumor activity with reduced side effects, erucylphosphocholine and perifosine appeared Figure . Comparead group . A wide ad group , whose aad group , the uptad group and the ad group ,18, beinad group , alteratad group , phosphoad group or phospad group , lipid-sad group ,24 and pad group ) has ledThis review will mainly focus on the actions of miltefosine in the human hepatoma HepG2 cell line, a well-established model to examine hepatic lipid transport and metabolism, with emphasis on the alterations caused by miltefosine in the homeostasis of phospholipids and cholesterol. Additionally, the effects of other APLs with potential clinical relevance, such as edelfosine, erucylphosphocholine and perifosine will be also described.Preliminary studies in our laboratory demonstrated that nontoxic concentrations of miltefosine exert an antiproliferative effect on cultured HepG2 cells; e.g., a concentration of 50 μM miltefosine for 48 h caused a decrease in the number of cells, without a significant loss of viability, in the presence of serum. These findings agree with those encountered in MDCK , HeLa 2 and otheOur research group and otheIt is noticeable that induction of apoptosis by distinct APLs in lymphoma cells occurs through inhibition of CTP:phosphocholine CT after internalization via raft-mediated endocytosis ,33. SincIncubation of HepG2 cells with miltefosine was also shown to increase the de novo biosynthesis of triacylglycerol (TAG) and PtdEtn . The comLeishmania donovani promastigotes [N-methyltransferase activity [Concerning the synthesis of PtdEtn, we analyzed the water-soluble intermediates and final product, PtdEtn, of the CDP-ethanolamine pathway and found that miltefosine causes a modest increase in the incorporation of radiolabeled ethanolamine into CDP-ethanolamine and PtdEtn and a decrease in ethanolamine phosphate, which might be interpreted in terms of a stimulation of CTP:phosphoethanolamine CT activity, the rate-limiting enzyme of this metabolic pathway. Even though these changes might be attributed to miltefosine stimulating the synthesis of PtdEtn in HepG2 cells, the effect was quite slight, the radioactivity in PtdEtn increasing by only 10% compared to controls . It has stigotes . Since Pactivity . These rThe uptake of radioactive serine into phosphatidylserine (PtdSer) and other phospholipids remained unchanged by miltefosine and neither was the activity of either PtdSer synthase or mitochondrial PtdSer decarboxylase (to give PtdEtn) altered, demonstrating that the biosynthesis of PtdSer is unaffected by miltefosine in HepG2 cells . TreatmeWith regard to sphingolipid metabolism, we found that exposure of HepG2 cells to miltefosine produces a marked time-dependent inhibition of sphingomyelin (SM) synthesis, using radiolabeled palmitate as exogenous substrate . An accuKeeping a strict balance in the composition and relative proportions of phospholipids is of vital importance to the integrity of the cell membrane. Hence, it is worth emphasizing that early miltefosine treatment may affect lipid homeostasis and hereby cell membrane function by decreasing the synthesis of choline-bearing phospholipids, that is, PtdCho and SM Figure , which aCholesterol is an essential constituent in the membrane of the mammalian cells, therefore abnormalities affecting cholesterol homeostasis result in several pathological conditions, notably atherosclerosis, Alzheimer's and Niemann-Pick type C (NPC) diseases. The cells obtain cholesterol by taking it up from their environment, mostly in the form of low-density lipoproteins or by de novo synthesis . CholestThree organelles are involved in cholesterol trafficking Figure : (1) ER,Maintenance of the cycle between free and esterified cholesterol relies on the bidirectional transport of sterols between the ER and the PM and/or an endocytic compartment. Proper control of this transport is important for normal cell function and development, as indicated by fatal human pathologies such as NPC disease and atherosclerosis, which are characterized by an over-accumulation of free sterols within the endosomal membranes and the ER, respectively . Two indOur group has extensively examined the effects of the antitumoral drug miltefosine on intracellular cholesterol transport and metabolism and its relevance in maintaining cholesterol homeostasis. It was shown that treatment of HepG2 and Vero cells with miltefosine significantly alters cholesterol metabolism and leads to an accumulation of cholesterol in the cell . In factUptake of cholesteryl linoleate in LDL and further hydrolysis of these esters increased following exposure of HepG2 cells to miltefosine. However, cholesterol esterification from several radioactive exogenous fatty acids was markedly reduced after treatment with miltefosine, even in the presence of the cholesterol analog 25-hydroxycholesterol added to the culture medium; in addition, the reesterification rate of cholesterol from LDL decreased after treatment with the APC ,58. ThisLeishmania donovani promastigotes has also been reported [All these observations point to the fact that miltefosine in general alters cholesterol metabolism. The observed increase in cholesterol synthesis brought about by miltefosine treatment and the decrease in cholesterol esterification disturb the intracellular cholesterol/CE cycle and lead to high levels of unesterified cholesterol in HepG2 cells. An increased content of cholesterol in membranes from miltefosine-treated reported , neverthreported .It has been suggested that CE might serve as a dynamic reservoir, its synthesis being controlled by ACAT activity, which would be regulated by the supply of cholesterol in the ER . BearingIn addition to synthesizing cholesterol, mammalian cells also synthesize substantial amounts of precursor sterols. Similar to cholesterol, the precursor sterols leave the ER and rapidly reach the PM ,62 and tHydrolysis of SM in the PM by treatment of HepG2 cells with exogenously added bacterial sphingomyelinase resulted in an enhanced fluxing and esterification of PM-associated cholesterol into the ER, as previously reported in other cell lines ; howeverOur most recent observations indicate that exposure to nonlytic concentrations of other membrane-active APLs such as edelfosine, erucylphosphocholine and perifosine decrease the proliferation rate of cultured HepG2 cells. Likewise, these agents alter intracellular cholesterol transport and metabolism in a manner similar to miltefosine, that is, they impaire cholesterol trafficking from the PM to intracellular membranes and, as a result, produce a remarkable decrease in cholesterol esterification, hence leading to an enhancement of cholesterol synthesis and LDL-cholesterol uptake in the hepatoma HepG2 cell line .Cholesterogenesis is known to be transiently induced by the translocation of the transcription factor SREBP2 from the ER membrane (125-kDa precursor form) to the nucleus (70-kDa mature form) . In factCholesterol and SM are major lipid constituents of membrane raft microdomains, and the ratio cholesterol/SM is crucial to maintain the integrity of lipid rafts and thence membrane functionality. Consequently, the disturbance of this ratio could alter several signaling pathways associated to these membrane domains ,69 and bThe bulk of our data indicates that miltefosine impairs cholesterol arrival into the ER, without altering reverse cholesterol trafficking from the ER to the PM, leading to a depletion of free cholesterol in the ER and consequently a deregulation of cholesterol biosynthesis and receptor-mediated cholesterol uptake. The final result of this interference is an increased uptake, synthesis and accumulation of cholesterol within the cell. Together with the reduction in PtdCho and SM syntheses induced by miltefosine, all these effects lead to an alteration in the choline-containing phospholipid/cholesterol ratio that can disturb membrane stability and function, and thus might be expected to inhibit tumor cell growth. Therefore, the imbalance in this ratio may well be partly responsible for the induction of apoptosis and the antiproliferative activity exhibited by this APC in HepG2 cells. We have recently found that other membrane-directed APLs such as edelfosine, erucylphosphocholine and perifosine also alter intracellular cholesterol homeostasis. Cholesterogenic response induced by APLs in HepG2 cells involves an increased gene expression and higher levels of several proteins related to the pathway of biosynthesis as well as the receptor-mediated uptake of cholesterol. All these alterations may affect membrane lipid composition and their distribution in raft-nonraft domains.ACAT: acyl-CoA:cholesterol acyltransferase; APC: alkylphosphocholine; APL: alkylphospholipid; CE: cholesteryl esters; CT: cytidylyltransferase; ER: endoplasmic reticulum; HMGCR: 3-hydroxy-3-methylglutaryl-CoA reductase; LDLR: low density lipoprotein receptor; nCEH: neutral cholesteryl ester hydrolase; PM: plasma membrane; PtdCho: phosphatidylcholine; PtdEtn: phosphatidylethanolamine; PtdSer: phosphatidylserine; SM: sphingomyelin; SREBP: sterol regulatory element-binding protein; TAG: triacylglycerol.The authors declare that they have no competing interests.All authors participated in the design of these studies and carried out the different assays. JMJL drafted the manuscript. All authors read and approved the final manuscript.

Hematopoietic stem cell lineage choices are decided by genetic networks that are turned ON/OFF in a switch-like manner. However, prior to lineage commitment, genes are primed at low expression levels. Understanding the underlying molecular circuitry in terms of how it governs both a primed state and, at the other extreme, a committed state is of relevance not only to hematopoiesis but also to developmental systems in general. We develop a computational model for the hematopoietic erythroid-myeloid lineage decision, which is determined by a genetic switch involving the genes PU.1 and GATA-1. Dynamical models based upon known interactions between these master genes, such as mutual antagonism and autoregulation, fail to make the system bistable, a desired feature for robust lineage determination. We therefore suggest a new mechanism involving a cofactor that is regulated as well as recruited by one of the master genes to bind to the antagonistic partner that is necessary for bistability and hence switch-like behavior. An interesting fallout from this architecture is that suppression of the cofactor through external means can lead to a loss of cooperativity, and hence to a primed state for PU.1 and GATA-1. The PU.1–GATA-1 switch also interacts with another mutually antagonistic pair, An important question in developmental biology is how different lineage choices are regulated at the genetic level. Robust lineage decisions are implemented by genetic switches, whereby one set of master genes are ON and another set are OFF, leading to a specific expression pattern of genes for a particular lineage. We develop a computational model to illustrate these principles as applied to the hematopoietic erythroid-myeloid lineage choice, where two master regulator genes, PU.1 and GATA-1, function as a genetic switch. The model, which is based upon known interactions, suggests missing interactions between the master genes, which we hypothesize, so as to reproduce the desired dynamics. Furthermore, there exist feedback interactions between the master genes and their downstream targets. When these are included in the model, the dynamics imply that the feedback is responsible for irreversible commitment. Our results suggest the search for missing interactions between the master genes in terms of a coregulated cofactor. The second important result of the model is that reprogramming irreversible cell fate may be possible by perturbing feedback regulation between the master genes and their downstream targets. Hence, dynamical modeling provides prediction of novel mechanisms and also strategies for reprogramming the fates of cells. Stem cell fates are decided upon the basis of which genes are turned ON/OFF. However, prior to commitment, it has been observed that many genes are expressed at intermediate or basal levels for the hematopoietic stem cell system From forced expression studies in both cell lines and primary cells, it is evident that GATA-1 and PU.1 are able to specify erythroid and myeloid cell fates bridges the master regulators, through a feedforward structure The second issue is how irreversibility of the erythroid-myeloid lineage switch can be achieved through feedback from other lineage components, namely FOG-1–The system can be reprogrammed by reducing the feedback from GATA-1 downstream to FOG-1, or by the upstream activation of Identification of the X gene should be possible through loss-of-function studies of the PU.1–GATA-1 system. Combining ChIP-chip with gene expression experiments Mutual antagonism among pairs of genes has been suggested as a general mechanism for lineage commitment One issue not addressed here are the effects of noise. Stochasticity in gene expression has now been both theoretically as well as experimentally explored and been shown to be due to both intrinsic as well as extrinsic factors The network dynamics is modeled using the Shea-Ackers formalism The dynamical equations corresponding to Equation (1) are given byThe dynamical equations corresponding to Equation (3) are given byi.e. when GATA-1 itself is at a high level. Alternatively, C could also be chosen as an activator of X, which means that it is required for the expression of X, and hence also required to be present for repression of PU.1, by regulated recruitment by GATA-1.Here we have assumed that an external signal C regulates X independently of PU.1 and GATA-1, and in particular can be used to repress it. Hence when C is not present, X is fully expressed, The dynamical equations corresponding to the network in 1 and A2 respectively and the parameters values are displayed in In Equation (5), the external signals to [F] and [E] are ASimulations of the differential equations were implemented using MATLAB software (The Mathworks) and the Systems Biology Workbench (SBW/BioSPICE) tools Figure S1Effects of the gene X. The nullclines, d[P]/dt = 0 and d[G]/dt = 0, from Eqs. , with parameters in (0.03 MB EPS)Click here for additional data file.Figure S24 = 0.25). The curves exhibit irreversibility.Concentrations of GATA-1, PU.1 and X as functions of the environmental signal A, when the binding strength of the repressive heterodimer GATA-1-X is made to bind strongly to the PU.1 regulatory region (ε(0.02 MB EPS)Click here for additional data file.Figure S34 = 0.25). The bistable curves are not irreversible.Concentrations of GATA-1, PU.1 and X as functions of the environmental signal B, when the binding strength of the repressive heterodimer GATA-1–X is made to bind strongly to the PU.1 regulatory region (ε(0.03 MB EPS)Click here for additional data file.Figure S4Concentrations of GATA-1, PU.1, FOG-1 and (0.04 MB EPS)Click here for additional data file.Figure S5Concentrations of GATA-1, PU.1, FOG-1 and (0.04 MB EPS)Click here for additional data file.Figure S6Concentrations of GATA-1, PU.1, FOG-1 and (0.07 MB EPS)Click here for additional data file.Figure S7Concentrations of GATA-1, PU.1, FOG-1 and (0.06 MB EPS)Click here for additional data file.Figure S8Concentrations of GATA-1, PU.1, FOG-1 and (0.04 MB EPS)Click here for additional data file.Figure S9Concentrations of GATA-1, PU.1 as functions of the environmental signal A for the case when GATA-1 dimers associate with PU.1 to repress each other's expression, as well as auto-regulate GATA-1. For low values of A, the system is unable to be primed, and in fact as shown by the arrows, the bistable switch ultimately becomes irreversible, if GATA-1 dimers self associate even stronger.(0.03 MB EPS)Click here for additional data file.Text S1(0.07 MB PDF)Click here for additional data file.

Since the oncogenes c- myc and TGFα are frequently overexpressed in human lung bronchiolo-alveolar adenocarcinomas, these mouse lines are useful as models for human lung bronchiolo-alveolar adenocarcinomas. The average life expectancies of hemizygous and homozygous c- myc transgenics were 14.25 months and 9.2 months, respectively, suggesting that a dosage effect of c- myc caused an accelerated bronchiolo-alveolar adenocarcinoma formation. First analyses of double transgenics, hemizygous for both c- myc and IgEGF, show that these mice develop bronchiolo-alveolar adenocarcinomas at the average age of 9 months, indicating that these oncogenes cooperate during the lung cancer formation. Our results demonstrate that c- myc and EGF are directly involved and cooperate with one another during formation of bronchiolo-alveolar adenocarcinomas in the lung. © 2001 Cancer Research Campaign http://www.bjcancer.comTransgenic mouse models were established to study tumorigenesis of bronchiolo-alveolar adenocarcinomas derived from alveolar type II pneumocytes (AT-II cells). Transgenic lines expressing the murine oncogene c-

Individuals are “Spotlighted” at the invitation of the Editor-in-Chief. To be considered for an invitation, please send a brief description of your research interests to.Q: What would you say is the primary focus of your research effort (how do you refer to your ‘sub-area’)?A: The primary focus of my group’s research is developing, validating, applying and automating algorithms for decision support and discovery for molecular medicine. The emphasis is on cancer; however, the methods are broad enough to be useful for a number of other diseases, as well as for general pattern recognition and discovery tasks.One set of these algorithms is designed to produce models for diagnosis, clinical outcome prediction and personalized treatment decisions. Another set is designed to select compact sets of biomarkers. Finally the last set seeks to discover structural relationships to shed light on complex molecular mechanisms of disease.Q: What do you consider to be the most significant open questions and research challenges in cancer informatics?A: There exist numerous challenges of which I mention just a few: Overfitting and other data analysis problems caused by very small samples and large dimensionalities. Developing mechanistic (causative) models and separating them from purely predictive ones. Utilizing a multiplicity of information/data types concurrently, for example mass throughput, clinical, imaging, literature, data etc. There is a need for - but lack of standards in - data analysis for mass throughput data. Biologists, physicians and informatics researchers often do not share the same language, scientific culture, and expectations. There are serious assay reproducibility issues. It is not clear how to optimally deliver the results of molecular medicine to physicians at the bedside. Regulating molecular medicine modalities for safety without impeding timely progress in the field is a big challenge. Exploring proper ways to build and maintain interdisciplinary teams and assign academic credit is another. Finally there is a myriad of thorny ethical issues surrounding the storage, protection, and retrieval of patient data.Q: What do you consider to be the most significant developments arising from research in cancer informatics?A: The emerging ability to perform early diagnosis, personalize treatments, predict clinical outcomes, and understand disease using mass-throughput information.Q: Tell us about your collaborative research. How much of your effort is typically focused on helping to provide cancer researchers with clinically significant results?A: Approximately 50% of my work is application of methods and analysis of data for cutting edge biomedical (mainly cancer) research. The rest is methods development, service, and teaching, which I hope to also benefit cancer researchers down the road.Q: Do you find balancing all of these activities challenging? How might cancer centers better meet the increasing demand for the analysis of high-dimensional data?A: It is very challenging as often methods are not well-developed and method development has to take place during the lifecycle of the specific cancer research project, subject to many practical constraints . Furthermore, when a good method is developed, in the initial phases of its lifecycle its application is often not straightforward unless the inventor is involved, which in turn precludes scaling-up of the method development efforts and dissemination of the methods rapidly.–Developing a critical mass of dedicated experts inside the institution and solid working collaborations with experts in other institutions.–Creating dedicated groups to develop, test, and automate new methods (an example methods group is the Discovery Systems Laboratory at Vanderbilt) as well as groups that apply appropriate methods and protocols for analysis in research .–Creating consulting services that will disseminate methodological knowledge and connect cancer biology researchers with methods researchers according to the project needs.–Creating and sharing robust analysis protocols and automated data analysis systems, and code libraries .There is a number of ways to meet these needs:Q: What do you consider to be the most pressing challenges or barriers to success in the field of cancer research?A: Cancer is a hugely heterogeneous class of diseases that affect cells and organisms in numerous concurrent ways both at the molecular level and at the system level. Thus developing methods to help us understand the pathophysiology of cancer is particularly challenging.Q: What do you consider to be the most significant developments or advancements arising from cancer research?A: Same as previously stated: the emerging ability to perform early diagnosis, personalize treatments, predict clinical outcomes, and understand disease using mass-throughput information.Q: When did you decide to be—or realize that you were—involved primarily in informatics as a research focus?A: In 1985 when I started intensive informatics research while in medical school, and then in 1991 when I entered a PhD program with this specific focus.Q: Do you currently conduct research on diseases other than cancer?A: My work is inherently methodological and as such applies to many diseases. For example, we have been building models with colleagues to predict lab results across the board for all Vanderbilt inpatient population. In the past I have worked on predicting mortality in pneumonia patients, graft failure in post-transplant patients, mortality in patients with syncope, to classify biomedical literature in internal medicine, etc.Q: Tell us about three or four ‘must-have’ essential informatics computing or research resources that you use on a regular basis developed by someone other than yourself or collaborators. Why are these resources so useful, and why do you consider them essential?A: Matlab, because it facilitates very rapid prototyping of code and allows one to focus on the algorithm instead of the language.The internet through which access to numerous remote sources of knowledge, tools, and colleagues is facilitated.A collection of library sources very conveniently accessed in the Eskind Biomedical Library building where Vanderbilt’s Department of Biomedical Informatics is housed.The last two resources are essential because methods work needs to be grounded very solidly on the vast literature (past and present) on computational, mathematical, statistical, and biochemical/medical/biological research and tools. The first resource is essential because it allows a quick transition from the paper/whiteboard to actual experiments and data modeling.Q: What do you think about the development of open access publishing and open access development? How has either changed your perspective on research and development practices?A: I can see both advantages and disadvantages in these paradigms relative to older and more established ones. Open access publishing gives easier and faster access to new knowledge to some members of the community. On the other hand the publishing costs may be prohibitive to some author groups . Open access development is leveraged by low-cost and for gratis coding, however for areas where technology is not mature this may lead to dangerous errors in the software for which there is no accountability. This is especially troublesome for medical and for security-sensitive applications . Time will tell whether these models are successful. Neither has affected my own work directly so far.Q: What books do you think should be required reading for researchers involved in informatics? In cancer research?A: The list is very wide, I will mention a few books that I open or cite frequently. In the field of informatics: Cormen et al’s “Introduction to algorithms”, Agresti’s “Categorical data analysis”, and Spirtes et al’s “Causation, Prediction and Search” are books that I visit and cite again and again. Mitchell’s “machine learning” gives a clear (but dated nowadays) introduction to the field, Duda et al’s “Pattern Classification” is an excellent textbook and reference, while Herbrich’s “Learning Kernel Classifiers” is probably the single most useful SVM textbook and reference in my bookshelf.With respect to the field of cancer research, please note that I am conducting methodological research and not biological so my perspective here is certainly skewed compared to the cancer biologist’s. With this caveat stated, I have found “Molecular Biology of the Cell” , Genes VII , and Liebler’s “Introduction to Proteomics” very valuable. Very readable—and brief—first introductions to cancer molecular medicine for interdisciplinary scientists are Ross’ “Introduction to Oncogenes and molecular cancer medicine” as well as Ross’ “Introduction to molecular medicine”. Redei’s “Encyclopedic Dictionary of Genetics, Genomics and Proteomics” is a worthy encyclopedic reference.Q: What books are on your current reading list?A: Many, but I am currently focusing on large parts of Tietz’s Clinical Chemistry and Molecular Diagnostics. Q: Do you teach any courses? If so which ones?A: I teach Biomedical Artificial Intelligence and Machine Learning at the graduate level as well as an advanced lab component associated with that course. I also have given directed studies in AI/Machine Learning and Information retrieval and several seminars and tutorials. I am also on the teaching faculty of the Cancer Biology and Clinical Proteomics graduate-level courses at Vanderbilt.Q: List the historical research figures that you think have most influenced how you think about research? Why are these influences significant?A: Many great scientists have influenced my reasoning and have qualities that I admire. I will mention a few. Collectively the ancient Greek scientists were amazing in their ability to exceed the standard of science at the time: for example they computed the circumference of the earth, computed distances between the earth and the sun, laid the foundations of geometry and logic etc. etc.Jumping ahead a couple of millenia, Niels Bohr was very influential to me because he did not emphasize whether the data were consistent with his biases: as long as the theory was validated experimentally, he accepted it despite it being vastly counterintuitive. Einstein despite all his brilliance was not able to leap mentally that far and insisted (wrongly) on determinism.David Hume was incredibly powerful intellectually and personality-wise in recognizing and describing the limits of both faith-based doctrines and inductive science. He practically destroyed them both from a philosophical perspective and lived to be happy regardless. Reichenbach is inspiring because he provided, in my assessment, a simple but very convincing account of why we can still pursue inductive generalization successfully despite Hume being correct.Karl Marx and Adam Smith laid out two still dominant economic frameworks and identified major principles of human economic behaviour. Aristotle and DaVinci were inspiring on account of their breadth and depth of knowledge. Chomsky is inspiring in his dual ability as linguist and contrarian political scientist with deep humanitarian concerns.Darwin’s colossal mental leap, as well as his meticulous method toward establishing evolution, are astounding. Richard Feynman was inspiring in his balance of scientific ability as well as ability to be a well-adjusted man. He also was one of the clearest thinkers ever to live: his “Lectures on physics” are the clearest science book I have come across so far. Bertrand Russell was inspiring because of his momentous achievement in the meta-theory of mathematics but also because at the same time he was committed to humanitarian values and chose to be imprisoned rather than betray them. On the side he won a Nobel prize for literature. Similarly Herb Simon won a Nobel prize in economics but did most of his work on computer science/artificial intelligence, and political science.With respect to my own research area, Gregory F. Cooper my former advisor and mentor introduced me to rigorous, principled and uncompromised research. He also taught me Bayesian networks and computational causal discovery, among other topics. Judea Perl, Peter Spirtes, Clark Glymour, Granger, and Cooper are among the major pioneers of modern computational causal discovery. These researchers have collectively shaped a very powerful paradigm for discovery using computational tools and this collective achievement will prove to be no less significant in my opinion than many of the highest achievements of science so far.Q: Could you describe for us briefly what key insights you think researchers in the area of causal discovery have provided that make modern computational causal discovery so exciting to you?A: The main insights are:–Causation is a crucial aspect of discovery and has to be addressed explicitly when thinking about research and data collection/analysis.–There is a formal framework that ties together causation and prediction.–Randomized experiments are not always feasible, ethical, efficient or even correct for discovering causality.–It is mathematically and algorithmically possible to learn causal relationships from observational data or mixtures of observational and experimental data.–It is mathematically and algorithmically possible to discover structural confounding variables)).–Although causal discovery is worst-case intractable, there exist algorithmic techniques and reasonable assumptions to make it tractable in practical settings.Q: Which research meetings do you attend on a regular basis? Please provide URL’s any other information you consider relevant.A: I almost never miss the AMIA Fall meeting (www.amia.org). Occasionally I go—or at least send papers—to AAAI , ISMB (ismb2006.cbi.cnptia.embrapa.br/), ICML (www.icml2006.org/icml2006/14770.html), KDD (www.kdd2006.com/), AI and Stats (www.gatsby.ucl.ac.uk/aistats/), FLAIRS (www.indiana.edu/~flairs06/), MEDINFO (www.medinfo2007.org/), and UAI (www.ics.uci.edu/~csp/uai2006/).Q: Please tell us about your own resource development efforts. Which of your computing resources or research papers would you like most people to know about?A: Currently, the Markov Blanket & Bayesian Network discovery algorithms such as HITON and MMHC for biomarker discovery and structural discovery. Related papers and code can be found in the DSL web site: www.dsl-lab.org. Another is the GEMS system for gene expression modelling and biomarker discovery; papers and code are available from the DSL web site. Another one is the Causal Explorer toolkit for causal discovery and biomarker discovery .Q: If you could change three things about how informatics research is conducted, used, perceived, or resourced, what would they be?A: First, Increase the realization that informatics is less about computers and more about methods. Second, rigorous training in biomedicine and computer science, math, and statistics is essential for the advancement of the field. Third, informatics is not just an enabling technology but a field that contributes important novel methods for discovery.Q: What do you think are the most significant cancer research studies in the last year that have been made possible by advances in informatics? Do you have any that specifically stick out in your mind as breakthroughs?A: It is very difficult to make a “most significant” determination for breakthrough clinical and research studies before seeing longer-term clinical impact and citation impact respectively. Moreover, in a sense, all papers were made possible by advances in informatics: regardless of study, it is safe to assume that samples were assayed by computer-controlled machinery, resulting data was analyzed with statistical and pattern recognition software, and results were indexed/stored/retrieved, and published electronically. It is also more than probable that hypotheses were shaped by consulting databases containing bibliographic, sequence, functional, evolutionary, genetic and other stored knowledge.In terms of excellent—but certainly not “most significant”—specific examples of papers using informatics for cancer research, I could mention include “Gene Expression Tests Foretell Breast Cancer's Future,” Ken Garber, Science 19 March 2004: Vol. 303. no. 5665, pp. 1754 – 1755. This report and the prior research leading to it, is an exciting example of clinical bioinformatics-enabled service that is offered to the public and that has the potential to revolutionize care for cancer patients (by predicting metastases in breast cancer patients and helping treatment decisions).As a highly-regarded example of array technology enabling discovery of new and significant biological insights about cancer I can mention Westbrook TF, Martin ES, Schlabach MR, Leng Y, Liang AC, Feng B, Zhao JJ, Roberts TM, Mandel G, Hannon GJ, Depinho RA, Chin L, Elledge SJ. “A Genetic Screen For Candidate Tumor Suppressors Identifies REST.” Cell. 2005 Jun 17;121(6):837–48.

Matrix metalloproteinases (MMPs) are proteolytic enzymes that may contribute to tissue destruction in Sjögren's syndrome (SS). Low-dose doxycycline (LDD) inhibits MMPs. We evaluated the efficacy of LDD for the subjective symptoms in primary SS patients.This was a randomized, double blind, placebo controlled cross-over study. 22 patients were randomly assigned to receive either 20 mg LDD or matching placebo twice a day for 10 weeks. The first medication period was followed by 10-week washout period, after which the patient received either LDD or placebo, depending on the first drug received, followed by the second washout period. Stimulated saliva flow rates and pH were measured before and after one and ten weeks of each medication and after washout periods. VAS scale was used to assess the effect of LDD and placebo on following six subjective symptoms: xerostomia; xerophtalmia; difficulty of swallowing; myalgia; arthralgia; and fatigue. The effect was evaluated for each medication and washout period separately.Overall, the effects of medications on subjective symptoms were minor. Wilcoxon test demonstrated increased fatigue with LDD during medication (p < 0.05). The differences may, however, reflect normal fluctuation of symptoms in SS patients.LDD may not be useful in reducing the primary SS symptoms. Sjögren syndrome (SS) is a slowly progressing autoimmune rheumatic disease with unknown etiology . It is aMatrix metalloproteinases (MMPs) constitute a family of zinc-containing endoproteinases with 23 members. The principal function of MMPs is the proteolytic degradation of connective tissue matrix proteins, and in concert they can degrade practically all extracellular matrix proteins . MMPs paThe effect of medication targeting the potential factors behind the pathogenesis of SS on subjective symptoms has recently been a focus of interest in several studies ,17, but Tetracyclines are antimicrobial agents, inhibiting also MMPs with a mechanism which is independent from their antimicrobial effect . DoxycycBased on the earlier studies a hypothesis was formed that through its MMP-inhibitory action, LDD could be effective in treatment of SS by decreasing the tissue damage and therefore also the subjective symptoms of the patients. The aim of this study was to evaluate the effectiveness of LDD on clinical symptoms of SS in a randomized, double-blinded, placebo-controlled clinical cross-over trial.Seventeen subjects out of 22 patients included at the onset of the study (77%) completed the study and provided the VAS score data after each medication and washout period. The stimulated salivary flow rates and pH were low compared to normal reference values Figure . No statIn Figure Comparison of the VAS scores between the pre-medication and seven-week medication demonstrated statistically significantly higher values for myalgia after seven weeks of both LDD and placebo Figure . CompariFor the post-experimental telephone interview, 16 patients were reached. Five patients had experienced significant alleviation of symptoms during one of the medication periods. Three patients had felt the benefits during the LDD medication and two had felt the benefits during placebo medication.In spite of tissue destructive nature of primary SS, the subjective symptoms are the most significant handicap. Therefore development of palliative treatment strategies has long been an object of interest. Local treatments, such as artificial saliva or lozenges, are insufficient and provide only temporary relief ,23. PiloThe low salivary flow rate and low saliva pH were expected, as values of this kind are normally found in SS patients with established disease. Measuring the unstimulated salivary flow rate proved impossible due to practically zero unstimulated saliva secretion in most patients. The findings indicate the severe condition of SS in the subjects involved in the study.th week of Periostat medication the finding may be a coincidence. This is supported by the post-experimental interview, which clearly indicated that there was no overall effect on subjective symptoms by LDD. On the other hand, taking into consideration the multi-dimensional subjective symptomology of SS patients, with mostly unknown pathology behind the symptoms, it is possible that MMP inhibition might in some way increase the subjective feeling of myalgia. The lack of clinically significant findings in this study may also be affected by the low numer of patients (22 patients) involved, even though all the patients in the patient records of Northern Ostrobothnia Hospital District with SS diagnosis were included into screening. Another study with larger patient population, requiring multi-center study, would be needed for the final conclusion in this matter. However, since the positive effects of LDD medication on SS subjective symptoms seem to be minor, larger-scale studies with SS patients, at least the patients with established disease as in this study, do not seem justified.Overall, the changes in the subjective symptoms within the LDD or placebo medication or washout periods were small and most likely reflect the usual fluctuation of symptoms rather than true differences caused by medication. Considering the subjective symptoms that exhibited statistically significant differences within specific medication or washout, only the increase in fatigue with LDD medication seems possibly clinically significant Figure . Muscle MMP inhibition with LDD was not effective in alleviating the subjective symptoms of primary SS patients with already established disease. The finding is concurrent with the other studies aiming at the reduction of symptoms by directing the systemic medication against potential pathogenetic factors ,17, withDetailed description of the patient inclusion and exclusion criteria has been presented previously . BrieflyThis was a randomized, double blind, placebo-controlled clinical trial, and the patients were randomized at the baseline. Randomization was performed by use of a computer-generated list, and the drug and placebo were indistinguishable in appearance, smell and taste. Neither the person in charge of clinical protocol of the study nor the patients were aware of the treatment assignments.®; further referred as LDD) or matching placebo twice a day for a period of 10 weeks were used to describe the intensity of the following symptoms: xerostomia; xerophtalmia; difficulty of swallowing; myalgia; arthralgia; and fatigue. The patients were instructed to provide a VAS rating every week at the same time of the week for each of the six symptoms, using a range from 0 for the total absence of symptom to 100 for worst imaginable symptom. After each medication and washout period the VAS score sheets were collected Figure and new Six months after the experiment the patients were contacted by telephone and asked for their subjective opinion whether the drug provided any help in general for their subjective symptoms or not Figure .SPSS for Windows Release 11.5.1 was used for the statistical analysis. Since the number of the marked scores decreased towards the end of each medication and washout period (because of apparent reduction of co-operation towards the end of each period), the statistical analysis was only extended to the 7th week of each period. Wilcoxon signed ranks test for two related variables was used to analyse the differences between the pre-medication and 7-week medication samples within both medication regimens, and between the values after 7-week LDD and 7-week placebo medications, to evaluate the possible effect of LDD on subjective symptoms. The same test was also used to examine the differences between the pre-medication levels, to exclude the effect of possible differences at the starting point of the medication regimens.LDD: Low-dose doxicycline;SS: Sjögren's Syndrome;MMP: Matrix metalloproteinases.The author(s) declare that they have no competing interests.HS was responsible for the handling of the subjects and collection of the samples, participated into data analysis and writing of the manuscript. RKN participated in the design of the study, collection of the patient material and drafting of the manuscript. MM-G participated in the handling of the collection and analysis of the samples. TV participated in the design of the study. LT participated in preliminary data analysis, performed the statistical analysis and drafting of the manuscript. TS conceived of the study, participated in its design, coordination, funding, data-analysis and drafting of the manuscript. All authors read and approved the final manuscript.

Long term time-lapse imaging reveals that individual synapses undergo significant structural remodeling not only when driven by activity, but also when network activity is absent, raising questions about how reliably individual synapses maintain connections. Synaptic plasticity is widely believed to constitute a key mechanism for modifying functional properties of neuronal networks. This belief implicitly implies, however, that synapses, when not driven to change their characteristics by physiologically relevant stimuli, will maintain these characteristics over time. How tenacious are synapses over behaviorally relevant time scales? To begin to address this question, we developed a system for continuously imaging the structural dynamics of individual synapses over many days, while recording network activity in the same preparations. We found that in spontaneously active networks, distributions of synaptic sizes were generally stable over days. Following individual synapses revealed, however, that the apparently static distributions were actually steady states of synapses exhibiting continual and extensive remodeling. In active networks, large synapses tended to grow smaller, whereas small synapses tended to grow larger, mainly during periods of particularly synchronous activity. Suppression of network activity only mildly affected the magnitude of synaptic remodeling, but dependence on synaptic size was lost, leading to the broadening of synaptic size distributions and increases in mean synaptic size. From the perspective of individual neurons, activity drove changes in the relative sizes of their excitatory inputs, but such changes continued, albeit at lower rates, even when network activity was blocked. Our findings show that activity strongly drives synaptic remodeling, but they also show that significant remodeling occurs spontaneously. Whereas such spontaneous remodeling provides an explanation for “synaptic homeostasis” like processes, it also raises significant questions concerning the reliability of individual synapses as sites for persistently modifying network function. not driven to change their properties by physiologically relevant stimuli, should preserve their individual properties over time. Otherwise, physiologically relevant modifications to network function would be gradually lost or become inseparable from stochastically occurring changes in the network. So do synapses actually preserve their properties over behaviorally relevant time scales? To begin to address this question, we examined the structural dynamics of individual postsynaptic densities for several days, while recording and manipulating network activity levels in the same networks. We found that as expected in highly active networks, individual synapses undergo continual and extensive remodeling over time scales of many hours to days. However, we also observed, that synaptic remodeling continues at very significant rates even when network activity is completely blocked. Our findings thus indicate that the capacity of synapses to preserve their specific properties might be more limited than previously thought, raising intriguing questions about the long-term reliability of individual synapses.Neurons communicate via synapses, and it is believed that activity-dependent modifications to synaptic connections—synaptic plasticity—is a fundamental mechanism for stably altering the function of neuronal networks. This belief implies that synapses, when Otherwise, physiologically relevant modifications to network function would be gradually lost due to stochastic, spurious changes or spontaneous drift. Thus, it might be expected that the capacity of synapses for directed change—synaptic plasticity—should be accompanied by a tendency to retain their characteristics at all other times, a phenomenon we will refer to here as “synaptic tenacity”.Synapses are widely believed to constitute key loci for modifying the functional properties of neuronal networks, possibly providing the basis for phenomena collectively referred to as learning and memory The advent of molecular imaging techniques and the ability to study the molecular dynamics of specific molecules are gradually leading to the realization that synapses are not static, rigid structures; rather, they are made of multimolecular protein ensembles that exhibit significant dynamics at time scales of seconds to hours. Such dynamics include the recruitment and dispersal of regulatory constituents, lateral diffusion, endocytosis and exocytosis of postsynaptic neurotransmitter receptors, cytoskeletal dynamics and spine “morphing”, loss, incorporation, and turnover of scaffold molecules, and the interchange of synaptic molecules, multimolecular complexes, and synaptic vesicles among neighboring synapses synapses appear to be quite persistent, although some degree of synapse formation and elimination is observed, depending on brain region, type of synapse, animal age, and imaging techniques In most of the aforementioned studies, synapses were visualized by means of volume-filling fluorescent dyes and identified on the basis of typical pre- and postsynaptic morphological features , whereas functionally relevant reporters, such as synaptic vesicle, postsynaptic receptor, active zone, or postsynaptic density (PSD) molecules were rarely used. Furthermore, even though manipulations aimed at altering network activity were performed in some of these studies, actual network activity was not recorded. Thus, the actual relationships between synaptic tenacity, synaptic remodeling, and network activity over these long time scales remained unknown.To evaluate the tenacity of individual synaptic structures over behaviorally relevant time scales and differentiate between activity-dependent and activity independent-synaptic remodeling, an experimental system is needed in which both structural dynamics of individual synapses and electrical activity can be monitored continuously and simultaneously at sufficiently high temporal resolutions for very long periods. At present, this is an extremely challenging requirement, in particular where in vivo studies are concerned. We therefore developed a novel system, based on networks of rat cortical neurons in primary culture, that allowed us to continuously follow and record the structural dynamics of individual PSDs over time scales of minutes to weeks while concomitantly recording (and manipulating) network activity in the same preparations. We find that the vast majority of PSDs in this preparation undergo significant, continuous remodeling over time scales of many hours and days. The direction and extent of PSD remodeling are strongly affected by network activity levels, but remodeling does not cease upon suppression or elimination of activity. Our findings, described below, thus indicate that the tenacity exhibited by individual synapses over time scales of days is rather limited and may indicate that structural properties of individual synapses experience significant drift over long durations.In order to examine the tenacity of individual synapses, a system was needed that would allow us to record the structural dynamics of individual synaptic structures while concomitantly recording network activity in the same preparations and to do so continuously for many days. The experimental system we developed for this purpose was based on primary cultures of cortical neurons obtained from neonatal rats and plated on substrate-integrated multielectrode array (MEA) dishes PSDs were visualized by expressing an EGFP-tagged variant of the PSD molecule PSD-95 (PSD-95:GFP). PSD-95 2, 95% air was streamed into the MEA dish. An ultraslow perfusion system was used to exchange the media at very low rates (two volumes per day). Images were collected automatically at 30-min intervals from four to 12 fields of view , with each site representing a portion of the dendritic arbor of a different neuron combined optical/electrophysiological recordings from these preparations, a commercial MEA headstage/amplifier was installed on a custom-built confocal laser scanning (inverted) microscope (CLSM) equipped with a robotic XYZ stage. In each experiment, the MEA dish was covered with a custom-built cap and placed in the headstage/amplifier connected to the CLSM's robotic stage. The MEA dish and oil-immersion objective were heated to 37°C, and a sterile mixture of 5% COt neuron . Seven tThe synaptic identity of PSD-95:GFP puncta was verified by labeling active presynaptic compartments in live neurons with fluorescent antibodies against the lumenal domain of the synaptic vesicle protein synaptotagmin-1 . The higMEA dishes allowed us to sample network activity from 59 locations in the network, but due to the presence of multiple neurons near each electrode, the identity of neurons from which activity was recorded remained obscure. Furthermore, due to the random nature of lentiviral infection, neurons expressing PSD-95:GFP were not necessarily located over any particular electrode. It was thus necessary to verify that the activity recorded through the electrodes faithfully represented the activity of those neurons expressing PSD-95:GFP and followed by time-lapse microscopy. To that end, we took advantage of the fact that most activity in networks of dissociated cortical neurons occurs in the form of synchronized bursts due to increased density of PSD-95:GFP puncta along existing dendritic segments, at both spine tips and shafts and 3B. n = 7) did we observe signs of damage. In fact, these experiments resulted in exciting and, to the best of our knowledge, unprecedented recordings of dendritic development and synapse formation that will be described elsewhere. These experiments, therefore, do not support the possibility that the experimental conditions used here adversely affect neuronal viability, and lead us to conclude that the synaptic remodeling described above is not secondary to pathological processes.The (post)synaptic remodeling described above resulted in dendrites assuming morphological characteristics more akin to those of dendrites in vivo. Yet we could not rule out the possibility that these morphological changes were actually reflecting pathological processes induced by the environmental conditions during experiments or damage inflicted by continuous imaging. To examine the possibility that the experimental conditions were detrimental to neuronal vitality, we used the same system to follow the development of less mature networks in which vigorous growth and synapse formation are known to occur, because here, pathological phenomena such as growth cessation, axon/dendrite retraction, and synapse elimination, are clearly recognizable. To that end, preparations were mounted on the CLSM starting from day 9–10 in vitro, maintained in the environmental conditions described above, and imaged at higher frequencies (every 10 min instead of 30) for about 1 wk. Dendritic development in these experiments appeared to proceed as expected: new branches were added, synapses were formed at high rates, and network activity levels increased 10- to 20-fold . In noneIn the aforementioned experiments, we observed significant changes in PSD-95:GFP puncta number and fluorescence intensity, which, in all likelihood, reflected changes in glutamatergic synapse number and PSD size. This remodeling occurred concomitantly with significant changes in network activity, which pointed to the possibility that the two phenomena might be causally related. It should be noted, however, that unlike network activity, that generally increased over time , the iniTo determine whether the observed changes in PSD-95:GFP puncta number and fluorescence intensity were dependent on changes in network activity, we repeated the experiments described above except that here, spontaneous network activity was blocked by adding tetrodotoxin (TTX) about an hour after the experiments were started. As shown in These experiments indicate that the initial broadening of PSD-95:GFP puncta fluorescence intensity distribution is not driven by activity. Rather, it seems to be driven by the exposure to environmental conditions during experiments. Given that ambient temperature and atmospheric conditions were identical to those in the incubators in which preparations were maintained, the most likely “culprit” is the slow perfusion. Indeed, these phenomena are not observed if perfusion is not applied (unpublished data). On the other hand, in the absence of perfusion, the long-term viability of these preparations was drastically impaired. Interestingly, media turnover rates (∼0.15%/min) were one to two orders of magnitudes lower than cerebrospinal fluid (CSF) turnover rates in the intact rat brain as previously described R2 values of these linear fits were not very high, suggesting that the direction and magnitude of PSD size change were only partially determined by their instantaneous size.To examine the dependence of changes in PSD size on initial PSD size, changes in the fluorescence of individually tracked puncta at the end of consecutive, 7-h time windows, were plotted as a function of their fluorescence at the beginning of each time window. To minimize the effects of short-term fluctuations, data were first “smoothed” with a five–time point (2-h) kernel. As shown in To further examine the dependence of the aforementioned relationship on network activity, identical experiments were performed in which spontaneous network activity was blocked abruptly by adding TTX 40 to 70 h after the experiments were started. Significant changes in puncta fluorescence over time were still observed in the presence of TTX, and such changes were observed for small and large puncta alike . StrikinA receptors in widespread clinical use. As shown in Relationships between PSD-95:GFP puncta fluorescence and subsequent changes in puncta fluorescence were also examined by manipulating network activity with diazepam, a coagonist of GABAR2 values of the linear regression fits, but also from the fact that the distribution of PSD sizes in active networks did not continue to constrict with time spontaneous network activity maintains distributions of synaptic sizes within rather constrained boundaries; (2) reductions in network activity levels result in a broadening of synaptic size distributions, increases in mean synaptic size, and reductions in synapse numbers; (3) most synapses exhibit significant changes in size over time; (4) in active networks, changes in synaptic size are partially dependent on momentary synapse size: large synapses tend to become smaller, whereas small synapses tend to become larger; and (5) when activity is blocked or significantly suppressed, synapses continue to change their sizes, but the direction and extent of these changes become independent of momentary synapse size.We hypothesized that the phenomenological relationships between network activity and synaptic remodeling described above could be explained by the following set of rules: (1) synapses continuously undergo spontaneous, activity-independent changes (drift) in their size; (2) activity acts to reduce the size of large synapses on the one hand, and increase the size of small synapses on the other; (3) new, small synapses are continually formed at a constant rate; and 4) synapses whose size is reduced beneath some threshold are eliminated.To examine whether this set of rules could, at least in principle, explain the phenomena described above and produce synaptic size distributions similar to those measured experimentally, we created a simple numerical model in which sizes and fates of individual synapses were updated over time according to these four rules was taken to represent the relative remodeling for that time point and for that particular neuron. In practice, Mt was calculated according to the following equation:n is the population of tracked PSD-95:GFP puncta, tr is its rank at time t, and 0r its rank at time t = 0. tM will approach 1.0 if the rank of each synapse at time t is furthest away from its rank at time t = 0, and will approach 0.67 if the ranks at time t bear no relationships beyond chance to the ranks at t = 0.To evaluate the impact of synaptic remodeling on the synaptic configurations of individual neurons, we defined a measure for quantifying the degree to which PSD-95:GFP puncta belonging to a given neuron changed their sizes relative to each other over time . The basic idea was to sort the synapses formed on a given neuron according to their sizes. Then, at each subsequent time point, the same synapses were sorted again according to their new sizes. The degree to which each synapse changed its rank relative to its original rank was then determined, and finally, all rank changes for all synapses were summed and normalized to give a value between 0 and 1. This measure even in the absence of activity, indicating that the structural, and by extension, the functional tenacity of synapses is somewhat limited over long time scales. Second, they suggest that activity acts to partially direct this drift, promoting the convergence of synaptic sizes on some “optimal” size distribution. Third, although our findings do support previous reports that activity blockade is associated with increased synaptic size, they do not support the notion of multiplicative scaling The experiments described here were based on several techniques: networks of dissociated cortical neurons, MEA substrates, automated multisite confocal microscopy, fusion proteins of synaptic proteins, lentiviral expression vectors, and automated image analysis. Although most of these techniques are in common use, it was their unique combination that allowed us to follow synaptic remodeling and relate it to network activity over relatively long time scales. Of particular note is the use of MEA substrates fabricated on very thin glass (ThinMEAs) that allowed the use of high numerical aperture objectives, resulting in both high-resolution images and very efficient light collection. In fact, control experiments performed in paraformaldehyde-fixed neurons revealed that photobleaching rates did not exceed 10% per day . This was undoubtedly an essential factor in our ability to image neurons at relatively high rates for such prolonged periods.Another key technique was the use of an ultraslow perfusion system. This system maintained cell viability in a remarkable fashion: unlike typical long-term experiments carried out at physiological temperatures, where some rundown is usually observed after 12–24 h, we observed no signs of rundown even after 2 wk of continuous imaging. As the perfusion medium was identical to the normal growth medium, it would seem that medium replacement was the critical factor. Furthermore, we found that slow exchange rates were imperative, as rapid medium replacement was detrimental as well. A byproduct of the slow perfusion was a gradual increase in network activity resulting in very high and complex spontaneous spiking patterns. At present, we do not know why this occurs, but this phenomenon was instrumental in exposing the effects of activity and accentuating the effects of activity suppression.A potential concern is the use of an exogenous form of PSD-95 fused to EGFP (an ∼30 kDa polypeptide). We cannot exclude the possibility that the addition of EGFP interferes, perhaps in subtle ways, with the interactions of PSD-95 with its endogenous binding partners, with implications on PSD remodeling dynamics. Furthermore, PSD-95:GFP overexpression was previously shown to affect synaptic properties and even occlude forms of activity-induced synaptic plasticity A broader concern relates to the fact that the study was performed in dissociated cell culture. Although it was this very fact that allowed us to concomitantly record synaptic remodeling and network activity as described above, we cannot ignore the possibility that the limited tenacity exhibited by synapses here is somehow related to this experimental system. We could mention the fact that many phenomena pertaining to synaptic dynamics described in cell culture were also observed in vivo , whose surface had been pretreated with Polyethylenimine (Sigma) to facilitate cell adherence. Cells were initially grown in medium containing minimal essential medium , 25 mg/l insulin (Sigma), 20 mM glucose (Sigma), 2 mM l-glutamine (Sigma), 5 µg/ml gentamycin sulfate (Sigma), and 10% NuSerum (Becton Dickinson Labware). The preparation was then transferred to a humidified tissue culture incubator and maintained at 37°C in a gas mixture of 5% CO2, 95% air. Half the volume of the culture medium was replaced three times a week with feeding medium similar to the medium described above but devoid of NuSerum, containing a lower l-glutamine concentration (0.5 mM) and 2% B-27 supplement (Invitrogen).Primary cultures of rat cortical neurons were prepared in a similar manner to that described previously for hippocampal preparations FU(PSD-95:EGFP)W was assembled from FUGW Lentiviral particles were produced using a mixture of FU(PSD-95:EGFP)W and the Lentiviral packaging vector mix of the ViraPower four-plasmid lentiviral expression system (Invitrogen). HEK293T cells were cotransfected with a mixture of FU(PSD-95:EGFP)W and the three packaging plasmids: pLP1, pLP2, and pLP\VSVG. Transfection was performed in 10-cm plates when the cells had reached 80% confluence, using 3 µg of FU(PSD-95:EGFP)W, 9 µg of the packaging mixture, and 36 µl of Lipofectamine 2000 (Invitrogen). Supernatant was collected after 48 and 72 h, filtered through 0.45-µm filters, aliquoted, and stored at −80°C. Transduction of cortical cultures was performed on day 5 in vitro by adding 5–15 µl of the filtered supernatant to each MEA dish.The thin-glass MEA dishes used here contained 59 30-µm-diameter electrodes arranged in an 8×8 array, spaced 200 µm apart. The dishes contain 59 electrodes, rather than 64, because the corner electrodes are missing, and one of the remaining leads is connected to a large substrate-embedded electrode designed for use as a reference (ground) electrode. The flat, round (30-µm diameter) electrodes are made of titanium nitride, whereas the tracks and contact pads were made of transparent indium tin oxide .Network activity was recorded through a commercial 60-channel headstage/amplifier with a gain of X1024 and frequency limits of 1–5,000 Hz. The amplified signal was multiplexed into 16 channels, amplified by a factor of 10 by a 16-channel amplifier (Alligator Technologies), and then digitized by an A/D board (Microstar Laboratories) at 12 K samples/s per channel. Data acquisition was performed using AlphaMap (Alpha-Omega). Most data were stored as threshold-crossing events with the threshold set to −30 µV. Electrophysiological data were imported to Matlab (MathWorks) and analyzed using custom-written programs.2 was continuously streamed into the dish at very low rates through a third port, with flow rates regulated by a high-precision flow meter (Gilmont Instruments). The base of the headstage/amplifier and the objective were heated to 38°C and 36°C, respectively, using resistive elements, separate temperature sensors, and controllers, resulting in temperatures of approximately 37°C in the culture medium.Scanning fluorescence and brightfield images were acquired using a custom-designed confocal laser scanning microscope based on a Zeiss Aviovert 100 using a 40× 1.3 NA Fluar objective. The system was controlled by software written by one of us (NEZ) and includes provisions for automated, multisite time-lapse microscopy EGFP was excited by using the 488-nm line of an argon laser. Fluorescence emissions were read through a 500–545-nm bandpass filter (Chroma Technology). Time-lapse recordings were usually performed by averaging six frames collected at each of seven to 26 focal planes spaced 0.8–1 µm apart. All data were collected at a resolution of 640×480 pixels, at 12 bits/pixel, with the confocal aperture fully open. To increase experimental throughput, we collected data sequentially from up to 11 predefined sites, using the CLSM robotic XYZ stage to cycle automatically through these sites at 30-min time intervals. Focal drift during the experiment was corrected automatically by using the CLSM autofocus feature Fura Red labeling of virally transduced cells was performed at the end of several long-term experiments. A total of 1 µl of Fura Red (Invitrogen) from a 2 mM stock solution in DMSO was diluted into 800 µl of culture medium drawn from the preparation dish, subsequently returning the mixture into the dish and mixing gently. After 30 min of incubation, line scan imaging through the neurons somata was performed at a rate of 54 lines/s. At the beginning of each scan cycle, a TTL signal was generated by the microscope and recorded to one of the four free channels of the electrophysiology data acquisition system for temporally aligning imaging and electrophysiological recordings performed during the same period. Fura Red was excited at 488 nm, and the emission was read through a 565-nm long-pass filter (Chroma Technology).The synaptic identity of PSD-95:GFP puncta was verified by labeling active presynaptic compartments with fluorescent antibodies against the lumenal domain of the synaptic vesicle protein synaptotagmin-1 TTX (Alomone Labs) or diazepam (Teva) were diluted in 100 µl of medium drawn from the culture dish. The mixture was subsequently returned to the dish and mixed gently. The final concentration in the dish was 1 µM (TTX) or 2.5/25 µg/ml (diazepam). The addition of TTX to the dish was also followed by the addition of TTX to the perfusion medium.Z-section stacks. For measuring distributions of puncta intensities , intensity, and most importantly, “constellations,” that is, punctum location relative to neighboring puncta within a radius of 50 pixels. The reliability of automatic tracking was reasonable, but not perfect, and therefore, all tracking was verified and, if necessary, corrected manually.All imaging data analysis was performed using custom-written software (“OpenView”) written by one of us (NEZ). For the purpose of this project, major portions of the software were rewritten to allow for automated/manual tracking of objects in 3-D time series of confocal images. Boxes of 8×8 pixels were centered on fluorescent puncta, and mean pixel intensities within these boxes were obtained from maximal intensity projections of All data were exported to Matlab and analyzed using custom-written algorithms. Images for figures were processed by linear contrast enhancement and low-pass filtering using Adobe Photoshop and prepared for presentation using Microsoft PowerPoint.t, the stepwise change in fluorescence Δf(t) was calculated as a weighted sum of a predictable, activity dependent component Δp(t)f and a random component Δr(t)f:Changes in the intensity of a given PSD-95:GFP punctum were modeled as follows: at each time point S(t) (0 to 1):The relative weights of the two components were set to depend on the normalized spike rate The predictable component was calculated as follows:c1, c2, and c3.The random component was determined by randomly choosing a step from a pool of >20,000 measured steps A dendrite of a neuron expressing PSD-95:GFP. (B) Labeling of functional synapses with Alexafluor 647–tagged antibodies against the lumenal domain of synaptotagmin-1. The antibodies were added to the MEA dish, and spontaneous activity in the network led to the labeling of functional presynaptic boutons over several hours. (C) Overlay of images in (A and B). Note the good overlap of PSD-95:GFP and synaptotagmin-1–labeled presynaptic boutons. (D) Degree of match between PSD-95:GFP puncta and synaptotagmin-1–labeled presynaptic boutons as a function of time from antibody addition. Time point of image in (B) is shown in red.(1.04 MB PDF)Click here for additional data file.Figure S22+ transients in the soma of a cell expressing PSD-95:GFP.Imaging of Ca (A) An X-t (line scan) image of Fura Red fluorescence at the cell body of a neuron expressing PSD-95:GFP. (B) Averages of fluorescence intensities in each line. Note that Ca2+ elevations reduce Fura Red fluorescence. (C) Raster plots of action potentials measured from all MEA electrodes over the same period. Each dot denotes a single action potential. (D) Total action potentials recorded from all electrodes in 1-ms bins. (E) Number of active electrodes over the same period. Note the tight time-locking between action potential bursts measured via the MEA and the calcium transients measured at the soma.(0.18 MB PDF)Click here for additional data file.Figure S3Evolution of activity recorded from individual MEA electrodes. Activity recorded from each electrode over the duration of an entire experiment . Activity is displayed as action potentials per second according to color scale at bottom.(0.04 MB PDF)Click here for additional data file.Figure S4Long-term recordings of dendritic development. (A) A dendritic segment of a cortical neuron expressing PSD-95:GFP was imaged continuously at 10-min intervals from day 10 to day 17 in vitro, . Time interval between the images shown here is 24 h. (B) Changes in PSD-95:GFP puncta numbers over time for three cells in this preparation (the cell shown in [A] is Cell 2). (C) Development of spontaneous activity in the same network. Note the concomitant increase in synaptic density and spontaneous activity levels. No obvious signs of phototoxicity or otherwise detrimental processes were observed. See also Video S1. Bar indicates 20 µm.(1.21 MB PDF)Click here for additional data file.Figure S5Comparison of fluorescence intensity distributions for all PSD-95:GFP puncta and tracked puncta. (A) Normalized distribution of fluorescence intensities of all discernable PSD-95:GFP puncta at each time point . (B) Normalized distribution of fluorescence intensities of all 281 tracked puncta in this experiment.(0.03 MB PDF)Click here for additional data file.Figure S6Synchronous activity drives the appearance of particularly large synapses. (A) Temporal correlations between burst rates and the appearance rates of bright synapses. Bright puncta were examined in a sliding time window of 5 h. A global threshold was defined (1.5 standard deviations above mean PSD-95:GFP puncta fluorescence). Puncta were counted if their brightness was at least 200 fluorescence units below the threshold at the beginning of the time window and exceeded the threshold at the end of the time window. Burst counts were smoothed with a 2-h kernel. Same experiment as that of Figure 4. (B) Eighteen bright PSD-95:GFP puncta at t = 22 h were tracked backwards in time to the beginning of the experiment. Each line denotes the fluorescence intensity of one punctum. Horizontal dashed line indicates mean+1.5 standard deviations. Same experiment shown in Figure 6. (C) Network activity levels during the same period. (D) Bursts rates for three 1-h periods in this experiment (red bars in [C]). Data were smoothed using a 60-s kernel.(0.12 MB PDF)Click here for additional data file.Figure S7Relationships between changes in fluorescence in consecutive time windows, before and after addition of TTX. Absolute changes in fluorescence (two top rows) and fractional changes (two bottom rows) in consecutive 10-h time windows straddling the moment of TTX application. Data are shown in raw form (first and third rows) and in normalized form: after correcting for the mean change of the entire population in each time window (second and fourth rows). This analysis indicates that most PSDs that had recently experienced considerable growth or shrinkage do not seem to be particularly protected from subsequent change upon complete activity blockade.(1.05 MB PDF)Click here for additional data file.Video S1A week-long time-lapse recording of a developing dendrite. Images were obtained every 10 min, seven sections per time point. Note the extraordinary developmental dynamics displayed by dendrites and axons in the field of view and the lack of any apparent signs of phototoxicity.(10.54 MB MPG)Click here for additional data file.Video S2Changes in the fluorescence of individual PSD-95:GFP puncta over time. Each circle represents one PSD-95:GFP punctum, with its momentary fluorescence depicted by its position along the y-axis. Data from two neurons, 349 synapses, and 114 30-min time steps. Data were smoothed with a six–time step kernel.(2.48 MB MPG)Click here for additional data file.Video S3Changes in the fluorescence of individual PSD-95:GFP puncta over time in the presence of TTX. Each circle represents one PSD-95:GFP punctum, with its momentary fluorescence depicted by its position along the y-axis. Data from two neurons, 281 synapses, and 110 30-min time steps. Data were smoothed with a six–time step kernel.(2.48 MB MPG)Click here for additional data file.

Introduction. Papillary thyroid carcinoma (PTC) is the most common malignancy of the thyroid. An accurate cytological diagnosis is based on distinctive cytological features in combination with immunocytochemistry. Methods. A number of 83 fine needle aspirations, positive for papillary thyroid cancer , were studied using Thin Layer Cytology. A panel of the immunomarkers Cytokeratin-19, Galectin-3, HBME1, CD-44, CD-56, and E-Cadherin was performed. Results. Positive expression of CK-19 was observed in 77 cases (92.7%), of Galectin-3 in 74 cases (89.1%), of HBME1 in 65 (78.3%), and of CD-44 in 72 cases (86.7%). Loss of expression of CD-56 was observed in 80 cases (96.4%) and of E-cadherin in 78 (93.9%). Conclusions. Our data suggest that Thin Layer Cytology increases the diagnostic accuracy in papillary carcinoma and seems to be a promising technique for further investigation of thyroid lesions permitting the possibility to use archive material. Positive immunoexpression of CK-19, Galectin-3, HBME-1, and CD-44 improves the diagnostic accuracy of papillary thyroid cancer. Furthermore, loss of E-cadherin and of CD-56 expression is a feature of malignancy. Papillary thyroid carcinoma (PTC) is the most common malignancy of the thyroid gland, and fine needle aspiration cytology (FNAC) is the only preoperative diagnostic method used in its detection. The cytological diagnosis of PTC is considered particularly reliable and allows for a definitive diagnosis and treatment planning at the time of FNA , 2 as itcip1, p27kip1, and p16ink4a [Although FNAC is widely accepted as the primary diagnostic procedure for thyroid nodules , few repp16ink4a .The purpose of our study was the evaluation of immunochemistry in combination with cytomorphology in the diagnosis of papillary cancer in FNA smears using liquid-based cytology.Cytopathological files of primary papillary thyroid cancer as well as metastatic ones were reviewed from our cases during the last five years. A total number of 83 FNA cases were included; 44 were from thyroid nodules and 39 from cervical lymph nodes. In addition, 30 benign cases that belonged mainly in thyroid adenomatous nodules were used as control. The majority of the cases concerned ultrasound-guided aspirations of thyroid nodules or lymph nodes performed in collaboration with an experienced endocrinologist and cytopathologist on site. All malignant cases and controls were histologically confirmed. The cytological material was prepared using, mainly, liquid-based cytology. The conventional method was used in 13 cases. Immediately after the aspiration, one or two conventional smears were prepared, and the remaining sample was rinsed immediately in a Preservcyt . A thin evenly dispersed monolayer of cells was dispersed from the filter onto the slide in a cycle of 20 mm in diameter. ThinPrep slides were prepared in the laboratory using the TP2000 instrument, and both conventional and ThinPrep slides were stained with a modified Papanicolaou method. Immunocytochemistry was performed only in slides prepared by thin layer method. All samples were stained in an automated immunostainer and the related Ventana reagents were used, using standard manufacturer's instructions. Our panel included Cytokeratin 19 , Galectin-3 , HBME-1 , CD 44 , CD-56 , and E-cadherin . 2O2H for 4 minutes to quench the endogenous peroxidase activity. We used the primary antibodies diluted in an appropriate dilution with Ventana antibody diluent in a Venatana user fillable dispenser. A standard avidin-biotin method was applied. The primary antibody was bound by a biotin-conjugated mouse secretory antibody formulation and next an avidin enzyme conjugate bound to the biotin present on the secondary antibody followed. The primary antibody-secondary antibody-avidin enzyme complex was then visualized utilizing a precipitating enzyme product. The staining intensity was assessed in a semiquantitative way, independently by two experienced cytopathologists. A scale from negative (0) to weak (1), moderate (2), and strong (3) was applied to each slide while the pattern of stain was classified as membranous or cytoplasmic, diffuse or nuclear. A positive stain was defined by the presence of either a moderate (2) or a strong stain (3) in at least 10% of tumor cells, and the percentage of the remaining positive cells, was evaluated.According to manufacturer's suggestions, the samples were immersed in a citrate buffer solution and heated for 20 minutes at 350 W. The slides were rinsed in tap water for 5 minutes, and then they were incubated with 3% t-test was used for the evaluation of differences in the expression between each immunomarker in cancer material and controls, respectively. Calculations were carried out using SPSS version 14.0. Results were considered statistically significant when P-value was less than .05.A standard independent-samples Our cases included 44 FNAs of thyroid nodules, diagnosed as papillary thyroid cancers, and 39 FNAs from cervical lymph nodes with metastases from papillary thyroid cancer too . CK-19 wA week positive stain to CD-56 was observed in 3 (3.6%) cases, while 80 (96.4%) cases showed loss of expression. E-cadherin was positive in 5 out of 83 (6%) cases, and 78 (93.97%) cases showed loss of expression. All controls retained their normal expression in the above two immunomarkers .The immunoexpression of all markers was similar in both thyroid and lymph node FNAs. The microscopic evaluation of each immunomarker expression is summarized in Tables It is well known that FNA is usually the first choice for the preoperative diagnostic evaluation of thyroid nodules in everyday clinical practice , 2. A prIn this study, we found that CK-19, Galectin-3, CD-44, and HBME1 were highly expressed in papillary carcinomas, a finding that is in agreement with other data reported in the literature , 16–19. It is reported that CK-19, a cytoskeletal protein, is significantly increased in papillary thyroid carcinoma and is helpful in distinguishing papillary thyroid cancer from benign or other malignant thyroid carcinomas . A stronCD-56, a neural cell adhesion molecule, is present in follicular epithelial cells of normal thyroid. The expression of CD-56 protein was found to be strong within all nonmalignant thyroid cells, but not in cases of PTCs . 94% of Cytologic material used by the conventional method is in most cases unavailable for additional investigation either due to the inadequacy of cellularity or the presence of excess blood mucus or inflammation. This gap is filled by liquid-based cytology and thin layer techniques which may be effective innovations . The quaOur results suggest the following. (1) A precise diagnosis of PTC in fine needle aspiration material is practicable and credible with the use of contemporary liquid cytology techniques and immunocytochemistry, which is the key for a correct and accurate diagnosis. (2) Positive immunoexpression of CK-19, Galectin-3, CD-44, and HBME1 contributes the most in PTCs diagnosis, and these antibodies can be considered as first-line immunomarkers. Although HBME1 is not necessarily a marker of papillary differentiation, it serves as an indicator of thyroid papillary malignancy especially in combination with the above markers. (3) CD-56 can assist in decision making about the benign or malignant nature of the aspirated material. Loss of expression seems to agree with the presence of papillary thyroid cancer. (4) Loss of the expression of E-cadherin seems to serve as a good indicative marker of malignancy. (5) Thin layer cytology is a promising technique for the investigation of thyroid lesions and increasing the diagnostic accuracy in papillary carcinoma. (6) There is a clear need for the development of additional molecular markers in order to improve the diagnostic capabilities and thereby advance the clinical management in patients with borderline FNA results.

A wide range of research areas in molecular biology and medical biochemistry require a reliable enzyme classification system, e.g., drug design, metabolic network reconstruction and system biology. When research scientists in the above mentioned areas wish to unambiguously refer to an enzyme and its function, the EC number introduced by the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (IUBMB) is used. However, each and every one of these applications is critically dependent upon the consistency and reliability of the underlying data for success. We have developed tools for the validation of the EC number classification scheme. In this paper, we present validated data of 3788 enzymatic reactions including 229 sub-subclasses of the EC classification system. Over 80% agreement was found between our assignment and the EC classification. For 61 reactions we found that their assignment was inconsistent with the rules of the nomenclature committee; they have to be transferred to other sub-subclasses. We demonstrate that our validation results can be used to initiate corrections and improvements to the EC number classification scheme. The fundamental understanding of metabolism in organisms which can only be achieved by integrated studies on their biology using a systems biology approach will aid in the design of future metabolic engineering strategies. Metabolic network reconstruction provides insight into the molecular mechanisms of a particular organism. An annotated genome containing the specific metabolic genes found in a particular organism can be used to reconstruct its metabolic network. The correlation between the genome and metabolism is made by searching gene databases or by searching protein databases with a known EC number in order to find the associated gene. The success of the search process is critically dependent upon the consistency and reliability of the underlying data. Therefore we have developed tools which can be used to identify wrong or inconsistent classification of enzymes and help to remove them from the relevant search databases. With the several thousand proteins found in each organism a highly developed hierarchical and consistent classification scheme is absolutely essential for a comparison of metabolic capacities of the organisms. Unfortunately such a system exists only for the enzymes and not for the other protein classes but for the enzymes the classification scheme allows an immediate access or the enzyme functional properties including catalysed reaction, substrate specificity, etc. In this respect a quick comparative assessment of enzymatic pathways between organisms is possible even when the enzymes in the different organisms have totally different sequences as long as they belong to the same EC-class. A well reconstructed metabolic network provides a unified platform to integrate all the biological and medical information on genes, enzymes, metabolites, drugs and drug targets for a system level study of the relationship between metabolism and disease. Therefore an accurate representation of biochemical and metabolic networks by mathematical models is one of the major goals of integrative systems biology. Metabolic networks have been constructed for a number of genomes The objective of the study was the automatic assignment of reactions to the EC number classification system. The approach is designed to adapt the EC number classification system as closely as possible. Therefore in most cases the results corresponds to the given sub-subclass by the IUBMB, but it some cases it differs from the established classification. We decided to subdivide the results into nine different subsets.As shown in + or NADP+ as acceptor’, but it can also be assigned the sub-subclass 1.2.1 which covers enzymes ‘Acting on the aldehyde or oxo-group of donors, with NAD+ or NADP+ as acceptor’.A reaction catalysed by pyridoxal 4-dehydrogenase represents an example of subset 3 . This en+ or NADP+ as acceptor which corresponds to sub-subclass 1.3.1 as it is defined by the NC-IUBMB. The transfer of the EC Number of 1.1.1.158 into sub-subclass 1.3.1 issued on our initiative is already accepted by the IUBMB. The other 60 errors have also been reported to the IUBMB and are currently under examination.Subset 4 contains enzymes where the assignment is definitely inconsistent assigned with the NC-IUBMB rules . For exaCholine oxidase (EC 1.1.3.17) an example of subset 5 of our results is a bifunctional enzyme which catalyses two different kinds of reactions. The overall reaction shown is The subset 6 involves all enzymes catalysing reactions which are identified as unclear assignement. The reaction shown in An example for subset 7 is shown in Subset 8 is composed of enzymes which could not be clearly assigned to any defined sub-subclass. For example the trimethylamine dehydrogenase is assigned to sub-subclass 1.5.8 which contains enzymes ‘Acting on the CH-NH group of donors,with a flavin as acceptor’, but as shown in In subset 9 we have summarized enzymes where the assignment to a subclass is not unequivocally determined by the chemical reaction given. The reaction ATP + H2O = ADP + phosphate as shown in Our approach has been used for the classification of 3788 enzymatic reactions including 229 sub-subclasses of the EC classification system. We demonstrated that enzyme-catalysed reactions can be classified efficiently and reliably by our approach. Furthermore, reactions can be assigned even if full characteristics of enzymes are not known. Moreover we have shown that this method can be used to identify wrong or inconsistent classification of enzymes and help to remove them.With one of the authors being the present chairman of the NC-IUBMB it is planned to use this and related tools to identify and remove errors and inconsistencies in the current EC-system and to optimise the system in a transparent and stable way. We plan to develop a tool that assign EC sub-subclasses to new reactions, access to which will be provided to the scientific community in the Internet’.We used 3,788 different enzyme-catalysed reactions from an in-house-developed Database named BiReDa . The database held exclusively error-free MDL/MOL files as well as stoichiometrically and stereochemically correct reaction data from the BRENDA Database The key idea of this approach is to reproduce the classification system given by the IUBMB as closely as possible and not to create new classification rules. The underlying procedure is divided into two steps:The chemical similarity calculationIn order to identify the corresponding partners within a biochemical reaction every atom of each compound is coded as follows:sCCCOOOHNNNSSSPPPRRRAsAsAsMMMXXXcwhere ‘s’ is the symbol of the corresponding element of the given atom and each other letter represents the symbols of the connected atoms except for a few exceptions: ‘R’ stands for any rest, ‘M’ represents any metal ion, ‘X’ is any halogen and ‘c’ is the charge of the considered atom. In most cases there are three entries for each symbol: e.g. ‘CCC’, the first position represents the number of carbon atoms connected via a single bond, the second the number of atoms connected via a double bond and the third the number of atoms connected via a triple bond with the given atom. In the case of ‘H’ only one placeholder is needed because hydrogen forms only single bonds. A few examples of complete atom coding operators are shown in In addition to the atoms which are affected in the enzyme-catalyzed reactions, the bonds cleaved have to be identified. This in particular is necessary for the lyases which catalyzes the breakage of a carbon-oxygen, carbon-carbon or carbon-nitrogen bond in non-oxidative manner .Therefore each bond is coded as follows:For the scoring scheme describing the similarity between each substrate and product molecule the Tanimoto Coefficient was used ‘a’ is the sum of the number of atom-types and bond-types which have the same frequency of occurrence in both the given substrate and the given product.‘b’ is the number of atom-types and bond-types which have a higher frequency of occurrence in the given substrate than in the corresponding product molecule.‘c’ is the number of atom-types and bond-types which have a lower frequency of occurrence in the given substrate than in the corresponding product molecule.‘T’ is the Tanimoto coefficient which lies between 0 for unequal and 1 for identical molecules.As a result we obtain a list of substrate/product pairs sorted according to their similarity.The characterization of the individual reactionAt the beginning compounds of known substrate/product pairs see , which aIn this step the atom coding operators generated during chemical similarity calculation (Step 1) are used to identify the important molecular functional groups responsible for the characteristics of each biochemical reaction.As an example a carboxilic acid is shown in 2+ and Fe3+ the charge of the iron atom has to be taken into account too is shown in on steps . As a reon steps , countedon steps and elemon steps and finaon steps . The aboTable S1Wrong assigned EC Numbers and new suggested Sub-Sub-Classes. Contains enzymes which were definitely wrong assigned by the NC-IUBMB.(0.02 MB DOC)Click here for additional data file.

Older people are among the segments of the population for which the digital divide is most persistent and are considered to be at risk of losing out on the potential benefits that the information society can provide to their quality of life. Little attention has been paid, however, to relationships between Internet use and actual indicators of health among older people. The aim of this study was to examine the association between Internet use and self-rated health among older people and determine whether this association holds independently of socioeconomic position. Data were from a survey about the digital divide and quality of life among older people in Spain that was conducted in 2008. The final sample consisted of 709 individuals and was representative of the Spanish adult population in terms of Internet use and sex across two age groups (55-64 and 65-74 years). Multivariate logistic regression analyses were performed to assess the relationship between Internet use and self-rated health.P = .002), suggesting that Internet users have better self-rated health than nonusers. This effect remained significant when other sociodemographic variables were entered into the equation . However, the significant relationship between Internet use and self-rated health disappeared once social class was considered . Results initially showed a significant relationship between Internet use and poor self-rated health (Model 1, OR = 0.32, 95% CI 0.16-0.67, This study suggests that the use of the Internet is not a significant determinant of health among older people once the socioeconomic position of individuals is taken into account. Older people are among the segments of the population with lower levels of Internet use—levels that decline sharply with advancing age -4. For eThe exclusion of older people from the information society is an issue of growing concern. For instance, the European Commission is developing a highly proactive agenda to break the barriers that prevent the older generation from fully embracing the information society and to promote the digital inclusion of older people ,7. BehinThe available research on the digital divide and health issues has focused mainly on access to health-related information -15. ReseClearly, more research is needed to explore the relationship between the digital divide and actual indicators of health among older people. The research question we posit is, therefore, whether the digital divide can be considered as a significant determinant of health among older people.The digital divide has often been defined as the split between the “haves” and “have-nots” (or between users and nonusers of new media) -27. ThisTo our knowledge, this is the first study examining relationships between Internet use and self-rated health among older people using representative samples of Internet users and nonusers from the general population. In this paper we will examine whether Internet use among older people is associated with self-rated health and whether this association holds beyond the socioeconomic position of individuals , a major social determinant of health -37. It hTo disentangle these relationships, we analyzed the association between Internet use and self-rated health, comparing users and nonusers of the Internet between 55 and 74 years of age, taking into account the socioeconomic position of individuals as well as other potential sociodemographic correlates of health: sex, age, marital status, and area of residence.We used data from a survey about the digital divide and quality of life among older people in Spain conducted in 2008. In Spain, the National Statistics Institute has calculated that, in 2008, there were 1,226,000 Internet users between 55 and 64 years and that this number decreases sharply to 302,000 users between 65 and 74 years . In percInternet users were sampled from an online research panel of more than 50,000 Spanish Internet users. The recruitment of panel members is based on sociodemographic variables as well as Internet behavior, leading to a high rate of representation of the population of Spanish Internet users. This panel is maintained only for research purposes, with constant recruitment of new members. To exert a tight control of potential sampling bias, eligible participants were selected and invited to participate in the study (targeted advertising), applying quotas of sex, age, size of locality, and education level to match official data . A link The final sample consisted of 709 Spanish individuals between 55 and 74 years and was finally balanced to represent the Spanish population 55-74 years in terms of Internet use and sex across two age groups (55-64 and 65-74 years). Sampling error was ± 3.7% for a 95% confidence interval.Subjects were asked to rate their health in general on a 5-point scale, ranging from “very good” to “very bad.” We used the categories that fell below “good” health as an indicator for self-rated poor health. This single-item measure of self-rated health is an extensively used measure of health with strong relations with outcomes such as mortality, morbidity, and physical and mental health status across groups with different sociodemographic characteristics, and it has been considered as a valid measure of health -48.Internet use refers to Internet user status rather than the type of Internet use . We assigned the status of “user” to those participants who had been connected at least once in the last 3 months. All the remaining participants were considered nonusers. Sex was coded as 1 = male, 2 = female. Age was coded into two groups: 1 = 55-64 years, 2 = 65-74 years. Marital status was coded as 1 = never married, 2 = married/living with partner, 3 = separated/divorced, 4 = widowed. Area of residence was coded as 1 = a country village or farm in the countryside, 2 = a town or small city, and 3 = a big city or the suburbs or outskirts of a big city. These last two were treated as categorical variables in the analyses.To measure the socioeconomic position of participants, we used an indicator of social class that derives from the cross-classification of occupation and educational attainment of the head of family (main income earner). This cross-classification is a standard for media studies in Spain and provides five different social classes by combining head of family education level and occupation (or last occupation) . Given tFor the analysis of the data, we used multivariate binomial logistic regression to estimate the odds ratios of being in the self-rated poor health category. We estimated four regression equations (models) in a nested fashion. The first equation (Model 1) tested whether there was any association between Internet use and health. Model 2 adds sociodemographic covariates to equation 1. In Model 3, we included area of residence. Finally, in Model 4, we included social class as a covariate to estimate the effect of Internet use on health, controlling for socioeconomic effects. Odds ratios, 95% confidence intervals, deviation statistics, and chi-square values were calculated for each model. Results for Model 1 show that Internet users have statistically significant lower odds of being in the poor health category as compared to nonusers. This result remained for Model 2 and Model 3 as well, indicating that the effect of Internet use on health was still present after taking into account sex, age, marital status (Model 2), and area of residence (Model 3). In the specific case of marital status, we further checked if the small size of the “never married” category was affecting the results. Results remained the same whether we collapsed marital status into married vs other, or any other combination.P = .23).The inclusion of social class as a continuous covariate in Model 4, however, removed the statistical significance of the influence of Internet use on health that was observed in previous models , after adjusting for all other covariates of the study.The only remaining significant covariate in Model 4 other than socioeconomic position was sex, indicating that women have 1.90 greater odds of being in the poor health category than men , suggesting that Internet users have better self-rated health than nonusers. This effect remained when other sociodemographic variables were entered into the equation (Models 2 and 3). However, the significant relationship between Internet use and self-rated health disappeared once social class was considered (Model 4). Overall, these results suggest that there is no evidence supporting the idea that use of the Internet has a significant relationship with health for the older population once the socioeconomic position of individuals is taken into account.The analysis of Internet users aged 55-74 years in relation to health issues is a strength of the study. Traditionally, little attention has been paid to Internet users in this age group. For instance, in Spain, little is known about this segment of the population beyond the fact that they constitute a rather small group. It has been suggested that access to and participation in the information society among older people will promote positive outcomes in health and well-being ,6-9. FroThe study has several limitations. First, we examined self-rated health and did not include specific measures of mental health. Future research would benefit from including specific measures of physical and mental health. Second, recent research has shown how self-rated health responses, our outcome variable, might be biased in certain sociodemographic groups. For instance, Delpierre et al have shoIn conclusion, results from this paper suggest that beyond the social divide, the digital divide does not add another source of health inequalities for older people. Older people are among the groups most excluded from the information society. Reducing the digital divide among older people has become a target for many policy initiatives since it is believed that the information society will provide benefits for the well-being of older people ,10. Howe

This study was designed to evaluate the hypothesis that the prevalence of autism spectrum disorder (ASD) among children in the United States is positively associated with socioeconomic status (SES).A cross-sectional study was implemented with data from the Autism and Developmental Disabilities Monitoring Network, a multiple source surveillance system that incorporates data from educational and health care sources to determine the number of 8-year-old children with ASD among defined populations. For the years 2002 and 2004, there were 3,680 children with ASD among a population of 557 689 8-year-old children. Area-level census SES indicators were used to compute ASD prevalence by SES tertiles of the population.P<0.001). Significant SES gradients were observed for children with and without a pre-existing ASD diagnosis, and in analyses stratified by gender, race/ethnicity, and surveillance data source. The SES gradient was significantly stronger in children with a pre-existing diagnosis than in those meeting criteria for ASD but with no previous record of an ASD diagnosis (p<0.001), and was not present in children with co-occurring ASD and intellectual disability.Prevalence increased with increasing SES in a dose-response manner, with prevalence ratios relative to medium SES of 0.70 for low SES, and of 1.25 for high SES, (The stronger SES gradient in ASD prevalence in children with versus without a pre-existing ASD diagnosis points to potential ascertainment or diagnostic bias and to the possibility of SES disparity in access to services for children with autism. Further research is needed to confirm and understand the sources of this disparity so that policy implications can be drawn. Consideration should also be given to the possibility that there may be causal mechanisms or confounding factors associated with both high SES and vulnerability to ASD. Population indicators of socioeconomic status (SES), such as household wealth or income and parental education and occupation, are strongly correlated with the health and development of children In the case of autism and autism spectrum disorder (ASD), evidence for an association with SES has been mixed and more often in the opposite direction of that for other childhood disorders. In the earliest clinical descriptions of children with autism, Kanner noted a preponderance of “highly intelligent parents” A compelling argument has been made that the positive associations between SES and ASD prevalence that have been observed likely are due either in part or entirely to ascertainment bias In a previous analysis We designed the present study to examine—among a large, diverse, population-based sample of 8-year-old children in the United States in which ASD case status was determined regardless of whether a child had a pre-existing ASD diagnosis—whether the prevalence of ASD is associated with SES and, if so, whether the association is consistent across subgroups defined by race/ethnicity, gender, phenotypic characteristics, diagnosis, and data sources.We implemented a population-based cross-sectional design in which data from 12 participating ADDM Network sites were analyzed Using the ADDM Network methodology, the network counted a total of 3680 8-year-old children as having an ASD in 2002 and 2004 in all study sites with available case and SES information, which were those located in Alabama, Arkansas, Arizona, Colorado, Georgia, Maryland, Missouri, North Carolina, New Jersey, Pennsylvania, South Carolina, and Wisconsin. ADDM Network data from the states of Utah and West Virginia were excluded because they did not include sufficient geographic indicators to allow SES classification.The population denominator comprised 557 689 8-year-old boys and girls residing in the respective study areas in the two study years according to the 2000 U.S. Census Autism spectrum disorder (ASD) refers to a group of neurodevelopmental disorders involving impairments in social interaction and communication, as well as the presence of repetitive or stereotyped behaviors. Specific disorders encompassed by ASD for which diagnostic criteria are provided by the Diagnostic and Statistical Manual Version IV-TR are autistic disorder, Asperger's disorder, and pervasive developmental disorder not otherwise specified Of the 3680 children with ASD, 2436 (66.2%) had a pre-existing ASD diagnosis. Of those with a pre-existing diagnosis, 1411 (58%) had a pre-existing diagnosis of autistic disorder, while information on the remaining 42% was insufficient to determine whether Diagnostic and Statistical Manual Version IV-TR criteria were met for autistic disorder versus pervasive developmental disorder not otherwise specified. Information from standardized intelligence tests was available for 75% of the children with ASD. Based on this information, children with an ASD were classified as having intellectual disability (IQ<70) versus normal range intelligence. Developmental regression was noted if the onset of ASD was characterized by loss of previously acquired skills in communication, social interaction or behavior. Further details regarding the ADDM Network methodology can be found in previous publications To evaluate the association between SES and ASD, we implemented the following procedure to compute the prevalence of ASD in “Low SES,” “Medium SES,” and “High SES” tertiles of the population. We used three different approaches, each based on a different census indicator at the block group level, to identify population SES tertiles based on: (1) the percentage of families with children that had incomes above the federal poverty level (abbreviated here as “% above poverty”); (2) the percentage of adults 25 years of age or older who had a bachelor's degree (abbreviated here as “% bachelors”); and (3) median household income (“MHI”). The purpose of creating three sets of SES tertiles was to allow evaluation of consistency of the findings across different indicators.To create the population SES tertiles, we: (1) weighted each census block group in the study areas by its number of 8-year-old residents; (2) ranked the census block groups by their values on the three census indicators and computed percentiles for each indicator; and (3) classified the block groups and thus the denominator of 8-year-olds into SES tertiles based on their percentiles. The result was three sets of population SES tertiles, one based on each indicator.In the absence of current individual-level measures of SES in the ADDM Network surveillance database, we attached area-based SES measures to each child with ASD, using the approach described by Krieger and colleagues 2 tests and 95% confidence intervals based on a Poisson distribution and log-link function To allow formal testing of a dose-response relationship between SES and ASD risk, we computed prevalence ratios with medium SES serving as the reference category, and Cochran-Armitage trend tests. We used SAS version 9.1 for all statistical analyses. We computed χ2 tests both of the SES gradient within strata and of the difference in the SES distribution of cases across strata, using the % above poverty indicator for SES. We chose this indicator for the stratified analyses after determining that the results were similar for all three SES indicators, and because the % above poverty block group indicator has been shown in previous studies to be correlated with a range of other measures of SES among the general population To evaluate whether the associations between SES and ASD varied by race/ethnicity, gender, phenotypic characteristics, pre-existing diagnosis of an ASD, and ascertainment sources of information, we performed stratified analyses and χ% above poverty’ in analyses presented in percentage of the population residing in poverty areas,’ where poverty areas are defined by the U.S. Census to include census block groups in which more than 20% of families with children have incomes below the poverty level In addition to use of the indicator ‘Compared to all 8-year-old children in the study areas, those with ASD were less likely to reside in census block groups classified as poverty areas, and more likely to be male and live in block groups with higher adult educational achievement and a higher MHI and 2. IThe prevalence of ASD increased in a dose-response manner with increasing SES, a pattern seen for all three SES indicators used to define SES categories . When th2 test comparing the SES distribution of cases with and without a pre-existing diagnosis). In addition, when the children with ASD were stratified by the presence or absence of co-occurring cognitive impairment, there was no evidence of an SES gradient in the prevalence of ASD with co-occurring cognitive impairment and a relatively strong gradient in the prevalence of ASD without cognitive impairment and 2.7 months earlier than those of low SES (p<0.0272). This modest difference in age at identification may indicate that diagnostic bias contributes to the SES gradient in ASD prevalence in some studies, though not necessarily in the present study which relied on surveillance at the age of eight years and included cases with and without a pre-existing ASD diagnosis.Another limitation of this study was the reliance on area-level measures of SES that might not have served as accurate proxies for the SES of individuals or specific families or households. Though perhaps not ideal, these measures have been shown to be reasonable proxies for individual-level SES and have the advantage of serving as indicators of the social and economic contexts in which children live but without introducing ecological fallacy If the SES gradient found in this study is due only to ascertainment bias, this would imply that there are significant SES disparities in access to diagnostic and other services for children with autism in communities across the United States. It also would imply that the current estimate of ASD prevalence might be substantially undercounted, with children of low and medium SES being under-identified and underserved relative to those with high SES.The presence of an attenuated but still statistically significant SES gradient when the analysis was restricted to children with no pre-existing ASD diagnosis suggests the overall SES gradient may not be entirely due to ascertainment bias and points to the possibility that factors associated with socioeconomic advantage might be causally associated with the risk for developing autism. The types of exposures that might merit consideration in future research could include a wide range of factors, from physical or social environmental factors to which children living in more advantaged environments might have higher exposures, to immunological factors (such as that suggested by the “hygiene hypothesis”

Clonal expansion of B lymphocytes coupled with somatic mutation and antigen selection allow the mammalian humoral immune system to generate highly specific immunoglobulins (IG) or antibodies against invading bacteria, viruses and toxins. The availability of high-throughput DNA sequencing methods is providing new avenues for studying this clonal expansion and identifying the factors guiding the generation of antibodies. The identification of groups of rearranged immunoglobulin gene sequences descended from the same rearrangement in very large sets of sequences is facilitated by the availability of immunoglobulin gene sequence alignment and partitioning software that can accurately predict component germline gene, but has required painstaking visual inspection and analysis of sequences. http://www.cse.unsw.edu.au/~ihmmune/ClonalRelate/ClonalRelate.zip.We have developed and implemented an algorithm for identifying sets of clonally-related sequences in large human immunoglobulin heavy chain gene variable region sequence sets. The program processes sequences that have been partitioned using iHMMune-align, and uses pairwise comparisons of CDR3 sequences and similarity in IGHV and IGHJ germline gene assignments to construct a distance matrix. Agglomerative hierarchical clustering is then used to identify likely groups of clonally-related sequences. The program is available for download from The method was evaluated on several benchmark datasets and provided a more accurate and considerably faster identification of clonally-related immunoglobulin gene sequences than visual inspection by domain experts. The human immune system has the ability to produce millions of different types of antibodies in the defence against bacteria, virus and toxins. Immunoglobulin heavy and light chain gene rearrangement happens during the early differentiation of the B cell precursors. The rearranged immunoglobulin heavy (IGH) chain is formed by recombination of genes selected from three sets of germline genes: variable , diversity (IGHD) and joining (IGHJ) . AdditioThe development of ultra-deep DNA sequencing technologies is opening a powerful new avenue of investigation into the B cell-mediated immune response, by enabling the characterisation of antibody diversity in individuals .The idenPrevious studies have demonstrated the importance and potential of accurate alignment and analysis for studying the immune response, using software such as IMGT/V-QUEST , SoDA , iHMMuneThe third complementarity determining region (CDR3) is a highly variable region in V domain. This region encodes a protein loop that lies at the centre of the antigen binding site ,11, and Here we demonstrate a new method for identifying clonally related sequences in large sets of rearranged IGH sequences, based on analysis of the highly variable CDR3 region of the VH domain. Sequences are partitioned using iHMMune-align then cluhttp://www.cse.unsw.edu.au/~ihmmune/ClonalRelate/ClonalRelate.zip. It accepts as input a set of sequences partitioned by iHMMune-align (as a semi-colon separated text file) and outputs a comma-separated text file listing the sequences and their clonal set assignment, together with dendrograms showing the structure of the clonal sets, in XML format. Several methods were tested for calculating a pairwise distance reflecting clonal relationships that was suitable for clustering. The resulting algorithms were evaluated using a benchmark sequence set containing known clonally-related sequence sets. The best performing version of the algorithm provided a more accurate identification of clonal sets than review by a domain expert. A hierarchical agglomerative clustering method was implemented to group IG gene sequences on the basis of CDR3 sequence similarity and IGHV and IGHJ usage, with clusters below an empirically selected threshold classified as clonally related. The resulting software program can be downloaded from In order to evaluate the suitability of clustering for identifying clonally-related sequence sets in large sets of IG genes, a human IGH sequence dataset known to contain multiple clonally-related sets obtained by Sanger sequencing was selected as a benchmark set to evaluate methods for clonally-related set identification. The dataset was scrutinised by a domain expert and sequences recognised as containing sequencing errors were removed. The resulting benchmark dataset contained 1116 human IGH sequences. Sequences were partitioned using the hidden Markov model based immunoglobulin gene sequence partitioning tool, iHMMune-align. Partitioning results were then examined, and clonally related sequence sets were identified by an iterative process of visual inspection by domain experts and automated clustering using the methods developed in this study. The final benchmark data set contained 182 sequences grouped into 66 clusters of clonally related sequences and the best results were obtained in all cases with a fixed gap penalty of 3 per gap (independent of gap length). This value was subsequently adopted for all other tests. Table The CDR3 is the most variable region of the immunoglobulin V domain, and was therefore selected as the main criterion for clonal relatedness. However clonally related sequences share the same component germline genes and therefore including this information into the comparison should improve its accuracy. IGHD germline gene identity was not used as a criterion as this gene is difficult to identify accurately and it iAn agglomerative hierarchical clustering algorithm was used to group sequences on the basis of their pairwise distance and to construct a dendrogram. An average linkage scheme was implIn order to estimate the threshold distance below which a cluster corresponds to a clonally related sequence set, an evaluation graph showing the cumulative merging of sequences into clusters as the threshold distance between leaves is increased was plotted. This graph was constructed for the PNG, PW99 and PW57 datasets, using NED_VJ as similarity measure. Figure The performance of the algorithm can be evaluated by evaluating the performance of the edit distance calculation algorithm and that of the agglomerative hierarchical clustering algorithm.m and n, and n ≤ m. Let LD be the Levenshtein Distance between X and Y, and NED be the normalized edit distance between X and Y. Using dynamic programming, the computation of LD can be finished in O(mn) time and memory space The actual space requirements can be reduced to O(n) in implementation [2)O(m·n time and an array of (m+1) ·(n+1) ·(m+n) memory locations. Given two gene sequences X and Y of lengths entation . Howeveentation NED requS. Time and space complexity will increase by S2. The time and space complexities of calculating a distance matrix within a gene sequence dataset greatly depends on the size of the dataset 2)O and isotype class switching within the germinal centres of the lymph nodes . UnderstWe designed a tool for identifying clonally related sets as a component in a pipeline for processing high-throughput rearranged immunoglobulin gene sequence data. This tool requires as input a set of sequences partitioned into their likely component germline gene using iHMMune-align, and labels these sequences with information about their likely clonally-related sequence cluster membership. iHMMune-align is used to obtain the identity of the IGHV and IGHJ genes and was selected as it is a component of our analysis pipeline and the only currently available utility suitable for scriptable high-throughput analysis. However there is no reason why the clustering program cannot be modified to make use of other partitioning programs such as IMGT/V-QUEST or SoDA if these are available in high-throughput versions.Standard phylogeny inference methods are not suitable for exploring clonal relationships within an immunoglobulin gene sequence dataset as antibodies diversify through processes that differ substantially from those of long time scale evolutionary events. However, string comparison methods that are widely used in sequence analysis are still applicable: sequence insertions, deletions and substitutions can be thought of as editing operations that transform one string into another. Pairwise distances between sequences can be calculated from string edit distances. Clonally related sequences are similar in length and have many common mutations, and this is reflected in their pairwise edit distances. A dendrogram representing the hierarchical structure of the relationship between sequences can then be constructed. The major differences between different hierarchical clustering algorithms are the measure of similarity between each pair of clusters and the underlying modelling of the clusters. Distance measures which can accurately represent relationships between sequences result in improved accuracy in the identification of clonally related sets. The Levenshtein distance is the most commonly used metric for measuring the dissimilarity between strings. However, it is not very suitable for strings of different lengths since it lacks normalization for appropriately weighting edit operations relative to the length of the strings being compared. It should be clear that one difference between two short strings is more critical than one difference between two longer strings.There are two well-known approaches for normalizing the Levenshtein distance: one based on the editing path lengths , and the other on the string lengths . Post normalized edit distance (PNED) normalizes the editing transformation by the length of one of the strings, while NED normalizes the editing transformation by the alignment path length. Marzal and Vidal demonstrThe clustering accuracy was further improved by incorporating information about common usage of V and J genes between sequences, in addition to the CDR3 similarity. However CDR3 similarity remains the main criterion, as it is less sensitive to potential errors in germline gene identification. The resulting NED_VJ distance produced a clustering of clonally-related sequences in the benchmark set that, when examined by domain experts, was found to improve on their initial classification by visual inspection of the iHMMune-align outputs. This demonstrates the value of our approach not only in automating the painstaking task of identifying clonally-related sequence sets by visual inspection but also in improving the accuracy of that identification.Various combinations of values for the gap, V mismatch and J mismatch penalty parameters were tested using the PNG dataset in order to select the best performing values. The PNG dataset covers a wide range of germline gene usage and mutation level and is very likely to be representative of most heavy chain gene sets. The resulting values are therefore likely to be suitable for all immunoglobulin heavy chain gene sets. However the user has the option of modifying these values if deemed necessary.One issue with clonally-related sequence identification is the presence of sets of sequences which appear clonally-related but are only similar as a result of chance matching. This is particularly an issue with sequences containing very short IGHD genes where CDR3 similarity can more readily occur by chance and is less likely to reflect a common clonal origin. This issue was addressed by selecting a conservative distance threshold below which a cluster is considered to be a clonally-related sequence set, although this may decrease the sensitivity of our method. Some improvements may be obtained by taking into account IGHD gene identity and number of shared mutations, when these can be determined with confidence .Another source of error in the classification of the benchmark dataset was the presence of chimeric sequences in the dataset. These chimeric sequences are formed from recombination of two sequences and may have identical CDR3 sequences, but different V genes. Our method relies primarily on CDR3 differences for identifying clonally related sets, and therefore cannot avoid erroneous clustering of chimeric sequences. This problem was minimised by inclusion of IGHV identity in distance calculations.The identification of clonally related immunoglobulin gene sequences is usually performed by visual inspection of N1, IGHD and N2 regions from sequences previously identified as having the same IGHV and IGHJ regions, This visual inspection method is unsuitable for analysing high throughput sequencing data obtained using newly developed DNA sequencing technologies. To our knowledge, the hierarchical clustering based method presented here is the first automated method for clonally related immunoglobulin heavy chain gene identification. It identified clonally-related sequences with more accuracy than visual inspection alone, and successfully identified the known PW57 and PW99 clonally related sets when they were mixed into a much larger set of immunoglobulin gene sequences.Our current method uses the most highly variable region in immunoglobulin gene, CDR3, as a key indicator of clonal relatedness and supplements it with information about shared V and J gene usage. Best results in terms of both speed and accuracy were obtained when pre-inspecting the input datasets to filter out sequencing errors and especially chimeric sequences. However, in the absence of an automated method for detecting such error sequences, our method can still be applied to unfiltered data sets as visual detection of chimeric sequences is easier on a dataset that has been processed to identify clonally-related sequences. In such a dataset, chimeric sequences typically show a pattern of IGHV mutations that differ significantly from the other sequences in their cluster and therefore stand out in the results. Clustering-based identification of clonal relatedness in immunoglobulin heavy chain genes improves our ability to study the clonal expansion in B cells, and provides a new tool for understanding the immune response in a large number of clinically important conditions including autoimmune diseases, infectious diseases and cancerThe PNG immunoglobulin sequence set was sampled from blood from a cohort of Papua New Guinea individuals. Sequences were visually inspected to filter out sequencing errors before running the test. The two other benchmark sets of clonally related sequences, PW99 and PW57, were derived from tonsillar IgD class-switched B cells , and conThe human germline IGHV and IGHJ repertoires were the same repertoires used by the current version of iHMMune-align. They include sequences obtained from IMGT ,23,25 mond-CYS 104and the IGHJ region J-TRP 118. The CDR3 was defined as per the IMGT unique numbering , from poThe IGHV germline repertoire was processed through IMGT/V-QUEST to calcuThe CDR3 ending length library storing the distances between the start of each IGHJ germline gene and the end of CDR3 (defined as the first TGG (Trp) codon) was constructed in the same way. Rearranged V-D-J sequences were aligned to the reported germline repertoire using the iHMMune-align program, an alignment tool based on a hidden Markov model of the rearranged variable domain . SequencFor each iHMMune-align-partitioned sequence, the CDR3 was extracted by concatenating the end of the IGHV region (as defined by the CDR3 starting length library), the N1, IGHD, N2 regions and the beginning of the IGHJ region (as defined by the CDR3 ending length library). Levenshtein distance (LD), post-normalized edit distance (PNED) and normalized edit distance (NED) were calculated from pairs of CDR3 sequences using the described algorithms -18, implg. for IGHV1-2*01, subgroup is IGHV1, gene is IGHV1-2 and allele is IGHV1-2*01). IGHJ germline genes are not classified into families and are therefore labelled only with gene and allele numbers. In the iHMMune-align results, V regions are identified by subgroup, gene and allele , JS is the mismatch penalty for IGHJ gene . L is the CDR3 alignment length (edit path length).Where LD is the un-normalised Levenshtein distance, Agglomerative hierarchical clustering was performed using the mean distance between elements of each cluster (average linkage) to build a dendrogram for the sequence set. The algorithm was implemented in Java. The resulting dendrogram was stored as an XML tree file.The distance threshold defining a clonally-related sequence cluster was determined by analysis of the overall agglomerative clustering pattern in the PNG dataset and using two sets of sequences known to be clonally-related (PW57 and PW99). Sub-clusters below this threshold were extracted and stored into XML sub-tree files. Clonally-related sequence sets were also output as a comma-delimited text file for import into a spreadsheet for further analysis.The authors declare no competing interests.ZC developed, implemented and tested the algorithm under the supervision of BG. YW and AC provided the benchmark datasets and expert evaluation of the method as well as feedback on its performance. All authors reviewed and agree with the final version of the manuscript.

The following funding information was omitted. RTM's research was supported in part by a breast cancer grant from the US Department of Defense, grant number W81XWH-07-1-0367.

Intra­molecular O—H⋯O hydrogen bonding is observed between the carbonyl and two hydroxyl groups. The mol­ecules are linked into a ribbon-like structure along the [100] direction by O—H⋯N and C—H⋯O hydrogen bonds. The crystal used was twinned via a 180° rotation about [100]. The ratio of the two twin components is 0.947 (1):0.053 (1).In the title compound, C Å b = 29.7496 (17) Å c = 14.2201 (8) Å β = 90.530 (4)°V = 2143.4 (2) Å3 Z = 4 Kα radiationMo −1 μ = 0.10 mmT = 295 (2) K 0.32 × 0.14 × 0.04 mm Bruker APEXII CCD area-detector diffractometerSADABS; Bruker,2005T min = 0.969, T max = 0.996Absorption correction: multi-scan (17905 measured reflections4939 independent reflectionsI > 2σ(I)2028 reflections with R int = 0.072 R[F 2 > 2σ(F 2)] = 0.072 wR(F 2) = 0.232 S = 0.99 4939 reflections305 parameters1 restraintH-atom parameters constrainedmax = 0.65 e Å−3 Δρmin = −0.28 e Å−3 Δρ APEX2 used to solve structure: SIR97 (Altomare et al., 1999SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008WinGX (Farrugia, 1999Data collection: 10.1107/S1600536809002347/ci2754sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536809002347/ci2754Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

In recent years, it has become apparent that smoking has a negative impact on renal function, being one of the most important remediable renal risk factors. It has been clearly shown that the risk for high-normal urinary albumin excretion and microalbuminuria is increased in smoking compared to non-smoking subjects of the general population. Data from the Multiple Risk Factor Intervention Trial (MRFIT) indicate that at least in males, smoking increases the risk to reach end-stage renal failure. Smoking is particularly "nephrotoxic" in older subjects, subjects with essential hypertension and patients with preexisting renal disease. Of interest, the magnitude of the adverse renal effect of smoking seems to be independent of the underlying renal disease. Death-censored renal graft survival is decreased in smokers, indicating that smoking also damages the renal transplant. Cessation of smoking has been show to reduce the rate of progression of renal failure both in patients with renal disease or a renal transplant. The mechanisms of smoking-induced renal damage are only partly understood and comprise acute hemodynamic and chronic effects . Renal failure per se leads to an increased cardiovascular risk. The latter is further aggravated by smoking. Particularly survival of smokers with diabetes mellitus on hemodialysis is abysmal. In the present review article the current state of knowledge about the renal risks of smoking is reviewed. It is the aim of the article to point out that smoking not only increases the risk of renal cell carcinoma or uroepithelial cell carcinoma, but also the risk of a faster decline of renal function. The latter is a relatively new negative aspect which has not been widely recognized. The fact that smoking is a risk factor for renal and uroepithelial cell carcinoma is well known. In the following, I shall review the current knowledge about the less well known adverse renal effects of smoking, which are of particular importance not only for nephrologists but physicians in general. Furthermore, I shall discuss the cardiovacular complications conferred by smoking in the renal patient.Although earlier reports had indiSeveral potential mechanisms of smoking-induced renal damage have been discussed , e.g. inOnce in end-stage renal failure (ESRF), the failure to discontinue smoking adversely affects the prognosis of patients on renal replacement therapy and patients with a kidney transplant, mainly by increasing the risk of cardiovascular complications. Discontinuation of smoking has been shown to be the single most effective measure to prolong life . This isThe nephrotoxic effect of smoking in the general population is documented by a cross-sectional study in 7,476 non-diabetic subjects in Groningen, The Netherlands . The stuThe question arises whether the increase in albuminuria/proteinuria attributable to smoking is paralleled by an increased risk for renal functional deterioration.This important issue was addressed in the study of Halimi et al. . SmokersIt can be concluded that (i) smoking increases the risk of albuminuria/proteinuria in the general population and (ii) that there is some evidence indicating that smoking increases the risk of renal functional impairment in the general population, particularly in men and in the elderly. The definition of renal functional deterioration in the studies available is, however, not beyond any doubt and large prospective studies investigating hard end-points, e.g. time to doubling of serum-creatinine, are clearly indicated.It is noteworthy that the negative impact of smoking on renal function contributes to the increased cardiovascular risk conferred by smoking. An increase in urinary albumin concentrations far below the microalbuminuric range is associated with increased prevalence of established cardiovaskular risk factors and cardiovascular morbidity in the general population . This isProteinuria is found in 4–18% and albuminuria in 10–25% of patients with primary hypertension ,21. AlbuSmoking emerged as an independent predictor of (micro)albuminuria in several studies which examined otherwise healthy hypertensive subjects. Mimran et al. studied Important new information has become available concerning the negative impact of smoking on renal functional deterioration in hypertensive patients. Regalado et al. performeThus, the issue whether or not smoking increases the rate of progression in patients with primary hypertension remains controversial. Considering the proven effects of smoking on albuminuria/proteinuria it is, however, cautious to conclude that smoking has to be considered as a renal risk factor in hypertensive patients.The effect of smoking in patients with renal disease is of major interest, because it can be anticipated that this population is particularly susceptible to smoking-induced renal damage.The first well documented reports about an increased renal risk in smokers were mostly retrospective studies in patients with type 1 diabetes. It was noted that smokers have a higher risk to develop diabetic nephropathy than non-smokers ,33.In the study of Telmer et al. 668 patiSince then, several studies confirmed an increased renal risk in patients with both type 1 and type 2 diabetes who smoke.Smoking (i) increases the risk to develop microalbuminuria ,35-45, , a prospective study with an observation time of 4 years including 794 patients with type 2 diabetes reported a 2- to 2.5-fold higher relative risk in heavy smokers than in never-smokers .The acceleration of the rate of progression of renal failure induced by smoking is dramatic. Sawicki et al. calculatIn vitro data suggest that this effect is partly mediated by scavenging free radicals and by attenuation of the cigarette-induced suppression of nitric oxide production [A recent prospective study with a mean follow-up time of 5.3 years including 33 patients with type 2 diabetes and manifest nephropathy investigated the impact of smoking on progression of renal failure . The inioduction . Due to oduction , the abooduction .If the data of the well performed but small study by Chuahiran et al. can be confirmed, it can be expected that smoking also counteracts the nephroprotective effect of blood pressure lowering including an ACE-inhibitor in patients with type 1 diabetes. This assumption is based on the fact that the course of diabetic nephropathy is identical in type 1 and type 2 diabetes and thatIt is of major clinical importance that smokers are at greater risk to develop type 2 diabetes -68. In aAn interesting issue is the effect of smoking on the risk to develop proliferative retinopathy. Based on a priori considerations, one would expect that the risk is increased in smokers, since damage to the microvascular bed of the kidney, i.e. diabetic nephropathy, is often associated with damage to the microvascular bed of the eye, i.e. proliferative diabetic retinopathy -72. In mIn summary, there is clear evidence that smoking has adverse effects on the onset and evolution of diabetic nephropathy in type 1 and type 2 diabetes mellitus. Furthermore, the number of cigarettes smoked per day and the number of pack-years of exposure seem to be associated with development of impaired fasting glucose and type 2 diabetes.There is no evidence in the literature that smoking induces any type of glomerulonephritis or any systemic disease involving the kidney to begin with -84. SoliIn patients with autosomal dominant polycystic kidney disease (ADPKD) Chapman et al. had founSince the design of these studies was retrospective, a prospective study would be desirable. A post-hoc analysis of a prospective study, which had originally been performed to evaluate the role of dyslipidemia on the progression of renal failure in 73 patients with primary renal disease found that smoking status at entry was related to the decline in glomerular filtration rate after 3.2 years of follow-up . In patiThe fact that we and StenOnly a few data are available concerning the effect of smoking on renal function in systemic diseases involving the kidney, namely lupus nephritis. A retrospective cohort study of 160 patients with a median follow-up of 6.4 years documented that smoking at the time of onset of lupus nephritis was an independent risk factor for more rapid progression to ESRF . Life-taThe hypothesis that heavy smoking might be a risk factor for the development and/or progression of pauci-immune ANCA-positive extracapillary glomerulonephritis has been forwarded , but solAs far as systemic diseases are concerned, cigarette smoking appears to be a risk factor for pulmonary complications in two clinical situations, which are of importance for the nephrologist. First, smoking increases the risk for fatal lung disease in hypocomplementemic urticarial vasculitis syndrome (HUVS) , a rare The prevalence of atherosclerotic renal artery stenosis is increasing in the ageing population and ischemic nephropathy is a significant cause of ESRF in patients over 65 years of age .The incidence of renal vascular stenosis increases as the extent of peripheral vascular disease increases . Since tHadj-Abdelkader et al. examinedAlthough no reports are available about the rate of progression of renal failure in smokers versus non-smokers with renal artery stenosis/ischemic nephropathy, it is likely that smoking accelerates the course of renal failure. This assumption is based on the consideration that besides progressive narrowing of the renal artery, a combination of hypertensive and atheroembolic damage , is likely to contribute to progressive loss of renal function in patients with so-called ischemic nephropathy. Actually, smoking is a risk factor for cholesterol embolism -108.In a group of 89 normotensive, non-diabetic elderly subjects with different degrees of peripheral atherosclerosis and no clinical signs of ischemic nephropathy, renovascular hypertension or other nephropathies, evaluation of renal function and plasma flow revealed that despite normal values for glomerular filtration rate, renal plasma flow declined progressively in parallel with the severity of peripheral atherosclerosis . StepwisLower serum albumin concentrations predict increased mortality in hemodialysis patients. According to Wave-1 of the United States Renal Data System Dialysis Morbidity and Mortality special study, baseline serum albumin is significantly lower in active smokers as compared to non-smokers on hemodialysis . It is oThe analysis of 936 hemodialysis patients enrolled in the baseline phase of the Hemodialysis Study sponsored by the US National Institutes of Health revealed that diabetes and smoking are strongly associated with cardiovascular disease . In a naSmoking further adds to the increased mortality in patients with diabetes mellitus on hemodialysis, being an independent risk factor contributing particularly to cardiovascular death ,116,117.In dialysed patients with type 1 diabetes smoking has been shown to confer a relative risk for lethal myocardial infarction of 2.6 . In a grSmoking also confers a higher risk for atherosclerotic lesions outside the heart. In a study including 89 patients on hemodialysis and 30 on chronic ambulatory peritoneal dialysis, smoking correlated with the mean internal diameter of carotid arteries, the degree of carotid stenosis and the number of plaques in the carotid arteries . An analThe risk of atrial fibrillation, a frequent arrythmia in hemodialysis patients, appears to be associated to coronary heart disease and may contribute to cardiovascular morbidity and mortality in ESRF . SmokingAccording to a study from the U.S.A., which investigated a cohort of 1,572 patients (mean age 57.4 ± 15.0 years) who started hemodialysis in 1989, smoking is amongst the strongest predictors of the number of hospital days per year . The majConcerning patients on continuous peritoneal dialysis, only a few scattered informations about the adverse effects of smoking are available. Of importance, smoking increases the risk of permanent change to hemodialysis due to complications . For nonIn the context of management of the patient on renal replacement therapy, it is of importance that smoking is associated with incompliance in hemodialysis and peritoneal dialysis patients .Contraintuitively, it has been documented that smoking does not appear to increase the risk of microalbuminuria in patients with a renal transplant . Most stA recent cohort study of 645 adult renal allograft recipients performed from 1985 to 1995 evaluated the relationship between smoking and graft outcome . Twenty-In an ongoing prospective study using the large Collaborative Transplant Study database, the issue is currently adressed by G Opelz . A preliminary retrospective analysis of Opelz suggests that smoking by itself adversely affects late graft function, even if corrections are made for cardiovascular death with a functioning graft . A similar analysis was performed by the group of LC Paul and yielded the same results . It is lThe effect of smoking on renal allograft function may depend on the renal disease that has led to ESRF. In patients who had reached ESRF as a result of lupus nephritis, the risk of renal transplant loss was substantially increased in smokers . In thisIt is of note that an investigation of kidney donor lifestyle factors, including smoking, drinking, drug use, and sexual history, found no significant negative impact on renal allograft survival .The evidence that the risk of death with a functioning graft is increased in patients with a history of cigarette smoking is beyond any doubt. The magnitude of the negative impact of smoking in renal transplant recipients is quantitatively similar to that of diabetes mellitus . A retroThe increase in cardiovascular death is due to the well known atherogenic effects of smoking ,147. SmoDiabetic transplant recipients are at a high risk for foot pathology leading to amputation. Smoking has a profoundly negative effect on the amputation rate as has an amputation prior to transplantation .Another clinically relevant aspect is the higher incidence of cancer in smokers. In one study, cigarette smoking was associated with an increased risk for cancer, with each 10 pack-years smoked at transplant increasing the risk by 1.12 . It has Finally, smoking increases the risk for osteoporosis in corticosteroid-treated transplant patients (and patients with chronic glomerulonephritis) and favoSeveral potential mechanisms of smoking-induced renal damage have been discussed in detail elsewhere and are Some pathomechanisms of smoking-induced renal damage, which seem of particular importance, are briefly discussed in the following.Since the first decade of the 20th century it has been known that smoking induces a transient increase of BP and heart rate . The incGrassi et al. demonstrIn view of the importance of blood pressure on the evolution of renal disease, the effects of smoking on blood pressure are of considerable interest. Ambulatory BP measurements documented that smoking in parallel with the stimulation of the sympathetic system causes a significant, but transient increase (lasting ~30 minutes) of blood pressure in healthy and hypeSmoking also seems to alter the diurnal rhythm of blood pressure. Hansen et al. reportedRitz et al. performeRitz et al. also comTaken together these findings are consistent with the hypothesis that in patients with glomerular disease, in whom the preglomerular vasculature is presumably vasodilated, smoking-induced vasoconstriction is unable to overcome vasodilation. As a result one would expect that the increase in systemic pressure is transmitted partially to the glomerular microcirculation, causing acute glomerular hypertension. As reported by Benck et al. pretreatOxidative stress is probably another major player in the genesis of smoking-induced vascular renal injury. Extrusion of glutathione from endothelial cells and activation of the hexose monophosphate shunt, which is necessary to maintain glutathione in the reduced state, point to the presence of oxidative stress, which may be imposed by the free radicals that are present in tobacco smoke . The conThe inhibitory effect of smoking on nitric oxide generation may play a critical role in increasing renal vasculature tone. In addition, intrarenal arterial dilation in response to nitroglycerine is significantly impaired in type 2 diabetic patients who smoke . Nitric An increase in thickness of walls of arterioles of organs not in direct contact with cigarette smoke, mainly due to fibroelastic intimal proliferation and hyaline thickening in the intima, has been observed in various organs of individuals without renal disease ,181, incIn a renal biopsy study, the histological findings of 107 patients (aged 48 ± 12 years) with chronic renal failure were assessed by investigating the effect of smoking on glomerulosclerosis and vascular damage . Most ofThe above study is important, because it documents that ever-smoking increases myointimal hyperplasia in elderly male patients with renal disease. Since hypertension per se seems not to be related to myointimal hyperplasia of intrarenal arterioles , the effThe above observation in patients with idiopathic nodular glomerulosclerosis or a renal transplant indicate that cessation of smoking may substantially reduce the rate of progression of renal failure. The question arises whether this is also true in patients with common renal diseases.One study in patients with type 1 diabetes and nephropathy provided convincing evidence in this respect : in patiIt is plausible to assume that this may also be true in non-diabetic renal disease. Pinto-Sietsma et al. found thThe present data do not allow to draw a definite conclusion about the magnitude of the renal benefit derived from smoking cessation. There is, however, good evidence indicating that smoking cessation is one of the single most effective measures to retard progression of renal failure.Smoking is one of the most important remediable renal risk factors. It has a negative impact on renal function even in subjects without apparent renal disease, but the adverse renal effects of smoking are particularly eminent in patients with a diseased kidney. Importantly, the increase in the rate of progression of renal failure attributable to smoking seems to be independent of the underlying renal disease.Nephrologists have to be aware of two major growing medical problems. First, the increase in the number of patients requiring renal replacement therapy, which is partly due to cigarette smoking. Second, the dramatic increase of deaths related to cigarette smoking. The World Health Organization estimated that world-wide tobacco abuse accounted for 3 million deaths in 1996 and even 10 million deaths are expected for the year 2020 .Besides improvement of renal prognosis, cessation of smoking undoubtedly improves cardiovascular prognosis in the renal patient . Thus, ETobacco control programs with the ultimate goal to reduce tobacco use by young individuals are effective . BesidesManagement of the renal patient requires information about (i) the magnitude of the renal and cardiovascular risk related to smoking including the benefits from smoking cessation and (ii) application of the above modern therapeutic modalities to increase the success rate in patients willing to stop smoking. To the best of my knowledge, there is no information about the exact pharmacokinetics of sustained-release bupropion in patients with impaired renal function. Apparently, bupropion does not accumulate in renal failure. In contrast, nicotine accumulates in renal failure , a fact As discussed on page 142, males may be more susceptible to smoking-induced renal damage than females. Recent data strengthen this hypothesis : A populThe authors declare that they have no competing interests.

Thalassiosira pseudonana the Psb28 protein is encoded in the plastid genome while a second version is nuclear-encoded and possesses a bipartite N-terminal presequence necessary to target the protein into the diatom complex plastid. Thus it can represent a gene captured during endosymbiotic gene transfer.The endosymbiotic birth of organelles is accompanied by massive transfer of endosymbiont genes to the eukaryotic host nucleus. In the centric diatom T. pseudonana we have performed extensive phylogenetic analyses of both mentioned genes. We have also experimentally tested the intracellular location of the nuclear-encoded Psb28 protein (nuPsb28) through transformation of the diatom Phaeodactylum tricornutum with the gene in question fused to EYFP.To specify the origin of nuclear- and plastid-encoded Psb28 in psb28 gene in T. pseudonana are transcribed. We also provide experimental evidence for successful targeting of the nuPsb28 fused with EYFP to the diatom complex plastid. Extensive phylogenetic analyses demonstrate that nucleotide composition of the analyzed genes deeply influences the tree topology and that appropriate methods designed to deal with a compositional bias of the sequences and the long branch attraction artefact (LBA) need to be used to overcome this obstacle. We propose that nuclear psb28 in T. pseudonana is a duplicate of a plastid localized version, and that it has been transferred from its endosymbiont.We show here that both versions of the Endosymbiotic events that have led to the evolution of plastids have been accompanied by fundamental genetic processes. Massive transfer of endosymbiont (plastid) genes to the host nucleus represents the most remarkable phenomenon Thalassiosira pseudonana was found to be encoded in both the nuclear and plastid genomes. Conversely, the nuclear-encoded version is putatively targeted, according to computer predictions, to the diatom complex plastid the protein is targeted to the organelle bounded by two membranes thanks to the N-terminal chloroplast transit peptide (cTP) Before diatom genomes were sequenced, no convincing evidence for direct transfer of genes from secondary plastid to the secondary host nucleus was available. When the first centric diatom genome was annotated, promising candidate genes for having been transferred directly from the plastid to the secondary host nucleus were identified Arabidopsis thaliana nuclear genome as a PsbW-like protein. However, both proteins differ in their molecular weight and polarity of amino acids in their sequence. The 6.1 kDa PsbW protein consists of hydrophobic amino acids that form an α-helix structure. By contrast, Psb28 (13 kDa) is a water soluble protein which is directly assembled into dimeric PSII supercomplexes. Consequently, the PsbW-like protein was later renamed Psb28 The multiprotein membrane complex of photosystem II (PSII) contains a large number of low molecular weight proteins (Psb). Most of them are located within the cyanobacterial or plastid thylakoid membrane. The Psb28 protein is a part of this multiprotein complex. However, the identification and annotation of Psb28 has often been quite confusing. Initially, the mature 6.1 kDa PsbW protein was found in plants and chlorophytes Emiliania huxleyi, Aureococcus anophagefferens, Thalassiosira pseudonana and Fragilariopsis cylindrus. As already mentioned, Psb28 was shown to be both nuclear and plastid encoded in the centric diatom T. pseudonana and pennate F. cylindrus. Surprisingly, psb28 has not been identified in the nucleus of the pennate diatom Phaeodactylum tricornutum, where the gene in question is found only in the plastid genome. Such discrepancy between two relatively closely related species has been explained by their surprisingly high divergence psb28 genes are transcribed in T. pseudonana and that the nuclear-encoded protein is targeted to the diatom complex plastid. The extensive phylogenetic analysis demonstrates the crucial impact of nucleotide and amino acid composition of the analyzed sequences on tree topology.PsbW is encoded only in the nucleus of plants and green algae, although Psb28 is also found in cyanobacteria. Indeed, the gene encoding Psb28 has been found in the plastid (or cyanelle) genomes of glaucophytes T. pseudonanaP. tricornutumF. cylindrus for psb28 homologues. In agreement with previous results psb28 gene in the plastid genome of the pennate diatom P. tricornutum and two versions of the gene in T. pseudonana and F. cylindrus, one in the nucleus, while the second is located within the plastid genome. We decided to experimentally confirm localization of the nuclear-encoded putatively plastid targeted Psb28 protein from T. pseudonana and to perform extensive phylogenetic analysis to specify the origin and location of the Psb28 protein in diatoms. Although a transformation system for T. pseudonana has been recently developed P. tricornutum because transfection is more routine We have performed an extensive search within the genomes of T. pseudonana are quite divergent. The nuclear version contains many non-synonymous mutations and both nucleotide and amino acid sequences show surprisingly high mutual divergence. Within the nucleotide sequence, of 445 nucleotides in the plastid localized gene, 120 were substituted in the nuclear gene, which constitutes a change in 27% of the nucleotides. The nuPsb28 is 149 amino acids long and contains targeting presequences at the N-terminus necessary for targeting the protein into the complex plastid. The plastid encoded homologue of the protein consists of 114 amino acid residues. Both proteins share only 63% amino acid identity; whereas 85% can be aligned with a residue with similar biochemical properties and nuclear-localized genes (47.8% A+T) , the nucleotide bias may influence the final topology significantly if nucleotides were used to infer trees (trees not shown).When we investigated the nucleotide composition of psb28 gene among all studied groups , with the lowest AT content on one side and the plastid localized AT-rich genes on the other. This suggests that the diatom nuclear psb28 has been transferred to the nucleus more recently when compared to the plant, green algae and the two genes from other chromalveolates. We have not detected significant amino acid bias among particular groups, because of high variability within the investigated groups. However, there can be LBA artefact due to high diversity of analyzed sequences . All the psb28 gene sequences that branch on the root of the nuclear clade in ML and MP analyses (When the T. pseudonana EST database (www.biologie.ens.fr/diatomics/EST4/index.php) revealed the occurrence of transcripts of both nuclear and plastid psb28 versions. Surprisingly, when the plastid localized version of the psb28 gene was searched in the non-redundant Tp EST database using BLAST P. tricotnutum the plastid psb28 is not part of a fused transcript, and the S4 gene is not in the same region of the plastid genome. Thus the presence of psb28 in the plastid genome of T. pseudonana could be the result of its fusion to the S4 ribosomal protein. In addition, we found a single EST sequence FC537861-2 corresponding to the nuclear psb28 in T. pseudonana, but which differs from the genome sequence in Thaps v3.0 at its 3′- termini. For this reason, we amplified full-length cDNA of nuPsb28 with the primer complement to adaptor on polyT primer. Genomic, EST and cDNA sequences were compared to find the probable mistake of sequence in EST library. To be sure that both versions of psb28 are transcribed, we also amplified the plastid transcript from the cDNA (data not shown).Similarity searches within the P. tricornutumThe nuclear-encoded Psb28 contains an extra 35 amino acids at its N-terminus, which clearly displays characteristics of bipartite targeting sequences to import proteins into diatom plastids. Diatom targeting sequences consist of a hydrophobic signal peptide domain (SP), followed by a transit peptide domain (TP). According to the SignalP 3.0 program in silico predictions at its C terminus showed that the protein is located inside the diatom complex plastid, in agreement with the dictions . AlthougT. pseudonana two psb28 genes were found, one in the plastid genome, while the second appears to be localized in the nucleus and encodes a protein that is targeted to the diatom plastid psb28 is relatively GC rich while its homologue from the plastid genome is rich in ATs, resulting in a difference of 20% between these two genes. We speculate that these sequential changes have occurred thanks to different locations of the genes (plastid versus nucleus) or to make the protein targetable to the secondary diatom plastid. However, the recently documented presence of many genes derived from green algae in Chromalveolates open doors to alternative explanations psb28 gene could eventually originate from this green fraction. If this is the case, both versions of psb28 would have coexisted in one cell for around 1 billion years, because such a green psb28 would have to be present in a diatom genome already before the red endosymbiosis. We therefore suggest an origin of diatom nuclear psb28 from ancient green endosymbiosis unlikely. The last but not least possibility is that nuclear psb28 in diatoms originate via non-endosymbiotic horizontal gene transfer. Although such way of the gene acquisition can never be ruled out, there are several aspects of the psb28-based phylogenetic analyses suggesting low probablity of this event. First of all, there is only one robust placement of the diatom nuclear psb28 sequences in our analyses: when the dataset was processed by Bayesian analysis using advanced models CAT and CATBP, all the diatom nuclear and plastid psb28 sequences form short branches and cluster together, with posterior probabilities ranging from 0.77 and 0.98 for CAT and CATBP respectively (psb28 in our trees. The same but unsupported position (bootstrap 44%) was obtained by AsaturA program designed to deal with amino-acid saturation can be concurrently lost from the plastid genomes with consequent multiple independent transfers to the host nucleus psb28 to the diatom nucleus in various lineages.Both versions of the psb28 gene into the nucleus might be one of the more distinct examples. It has occurred once in the green lineage of Archaeplastida, after the glaucophytes and rhodophytes diverged. In contrast, rhodophytes retained psb28 in their plastid genome at the time of the secondary endosymbiotic event. However, the transfer of psb28 from the plastid to the nuclear genome has already happened in two heterokonts: the haptophyte E. huxleyi and the pelagophyte A. anophageferrens. When compared to the diatom plastid genomes, E. huxleyi contains fewer genes in the plastid. Seemingly therefore, the process of endosymbiotic gene transfer is more advanced here Comparison of diatom plastid genomes with other heterokont lineages has led to the detection of many gene losses and rearrangements T. pseudonana create flagellated microgametes resembling sperm as well as larger egg-like macrogametes, whereas pennate diatoms form non-flagellated morphologically identical gametes known as isogametes The mechanism of transfer of a plastid gene into the nucleus has been already described in tobacco psb28 from T. pseudonana is a gene in the process of endosymbiotic gene transfer. This gene is present in both nuclear and plastid genomes of T. pseudonana and both are transcribed, with the nuclear-encoded protein being targeted to the complex plastid. We can speculate that it is the fusion of Psb28 with the ribosomal protein S4 that prevents the elimination of psb28 from the plastid genome. Phylogenetic analyses show that nuclear psb28 is a duplicate of the plastid homologue, although this relationship only became apparent when appropriate methods were used. The reason lies in the compositional bias of the analyzed sequences, which causes LBA and substantially affects the topology of the tree.We conclude that 4+I model) Nucleotide sequences coding for Psb28 from various photoautotrophs including cyanobacteria, glaucophytes, plants, chlorophytes, rhodophytes, cryptophytes, haptophytes, and stramenopiles, were downloaded from GenBank™ and other sources see . The nucThalassiosira pseudonana Hasle et Heimdal CCMP1335 and Phaeodactylum tricornutum Bohlin CCMP632 were provided by Provasoli-Guillard National center for Culture of Marine Phytoplankton . Both axenic cultures were grown in plastic 150 ml flasks filled with artificial sea water medium, made by dissolving “Tropic marine” salt at 35 units of practical salinity. Additionally, medium was enriched by Guillard's (F/2) Marine Water Enrichment Solution (Sigma-Aldrich). Cultures were grown under standard conditions at 18°C with cool white fluorescent light (120 µmol m−2 s−1), and a 12 h light/12 h dark photoperiod.T. pseudonana was isolated by Tri Reagent (Molecular Research Center Inc.) according to the manufacturer's instructions. A total of 107 cells was used as starting material for 1 ml of Tri Reagent. The final concentration of RNA was measured by spectrophotometry. The polyT primer with adaptor, nucleotides, total RNA and reverse transcriptase Superscript II (Invitrogen) were used for cDNA synthesis. After cDNA synthesis the product was treated with RNase H for 10 min at 37°C.For RNA isolation cells were harvested by centrifugation at room temperature for 10 min at 5,000 rpm. Total RNA from psb28 gene was amplified from the T. pseudonana cDNA using primers PSB1 CACCATGAGATCAATCTTCGTCCTCG and PSB2 AGCCTTGGTGAACCCAAGTCCATT. To clone the PCR product into pENTR vector (Invitrogen), primers were designed according to the manufacturer's instructions, and in order from the first nucleotide of the start codon to the triplet of the last codon. The presence and orientation of the nuclear psb28 gene in the pENTR vector was confirmned by sequencing (data not shown). Thereafter pENTR with nuclear psb28 was recombined with Destination vector pDEST- CEYFP E. coli strain TOP10. In addition, we used the PSB1 and primer 5′- GCGAGCACAGAATTAATACGACT-3′, which is complementary to the adaptor sequence to amplify the expressed product of nuclear psb28. The PCR product was cloned into pGem-Easy vector (Promega) and thereafter sequenced.The nuclear P. tricornutum was performed with expression vector nuPsb28-C-EYFP and resistance vector pFCPFp-Sh ble, as previously described Nuclear co-transformation of Cellular localization of nuPsb28-C- EYFP fusion proteins were analyzed with a confocal system FluoView™ FV1000 configured with an inverted mobile IX81 microscope (Olympus). A scanning laser with wavelength 515 nm was used for excitation of chlorophyll and EYFP. The emitted fluorescence was detected using a bandwidth setting of 525–571 nm for EYFP, and 620–710 nm for chlorophyll autofluorescence. Images were generated by the Olympus FV10-ASW Version 01.07.01.00 software and subsequently processed. The final picture arrangement was made using Adobe Photoshop CS2.Table S1Sequences used for phylogenetic analysis of Psb28.(0.06 MB DOC)Click here for additional data file.Table S2Sequences used for phylogenetic analysis of cyanobacterial Psb28 proteins.(0.05 MB DOC)Click here for additional data file.

It crystallizes with two almost identical mol­ecules in the asymmetric unit. The penta­fluoro­benzene ring is essentially coplanar with the quinoline ring, forming dihedral angles of 2.49 (17) and 8.72 (16)° in the two mol­ecules.The title compound, C Å b = 8.6730 (9) Å c = 15.0491 (16) Å β = 93.786 (2)°V = 1603.8 (3) Å3 Z = 4 Kα radiationMo −1 μ = 0.14 mmT = 293 K 0.40 × 0.37 × 0.23 mm Bruker SMART CCD area-detector diffractometerSADABS; Bruker, 2001T min = 0.946, T max = 0.968Absorption correction: multi-scan (9498 measured reflections3695 independent reflectionsI > 2σ(I)2952 reflections with R int = 0.041 R[F 2 > 2σ(F 2)] = 0.043 wR(F 2) = 0.108 S = 0.98 3695 reflections490 parameters1 restraintH-atom parameters constrainedmax = 0.21 e Å−3 Δρmin = −0.19 e Å−3 Δρ SMART used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536809043888/bt5079sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536809043888/bt5079Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials: interactive version of Fig. 2 Enhanced figure: