Datasets:

hatakeyama-llm-team
/

PMC

Dataset card Viewer Files Files and versions Community

Split (3)

PMC002xxxxxx_0 · 117k rows

text stringlengths 4 518k
A twofold rotation axis passes through the water O atom. In the crystal structure, a two-dimensional network is constructed through N—H⋯O and O—H⋯N hydrogen bonds.The molecular structure of title compound, C Å b = 6.5806 (19) Å c = 6.914 (2) Å β = 105.253 (6)°V = 527.0 (3) Å3 Z = 2 Kα radiationMo −1 μ = 0.09 mmT = 296 K 0.23 × 0.17 × 0.10 mm Bruker SMART CCD area-detector diffractometerSADABS; Sheldrick, 2001T min = 0.980, T max = 0.991Absorption correction: multi-scan (2143 measured reflections910 independent reflectionsI > 2σ(I)583 reflections with R int = 0.052 R[F 2 > 2σ(F 2)] = 0.065 wR(F 2) = 0.191 S = 1.05 910 reflections74 parameters1 restraintH atoms treated by a mixture of independent and constrained refinementmax = 0.24 e Å−3 Δρmin = −0.16 e Å−3 Δρ SMART used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008PLATON (Spek, 2009PLATON.Data collection: 10.1107/S1600536809025422/at2834sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809025422/at2834Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:
Merkel cell polyomavirus (MCPyV) DNA was detected in 88% of Merkel cell carcinomas in contrast to 16% of other skin tumors. MCPyV was also found in anogenital and oral samples (31%) and eyebrow hairs (50%) of HIV-positive men and in forehead swabs (62%) of healthy controls. MCPyV thus appears to be widespread. Merkel cell polyomavirus (MCPyV) was recently discovered in Merkel cell carcinomas (MCC), rare but aggressive skin cancers (All samples (n = 355) were analyzed by hot-start single-round LT3-PCR (sPCR) and nested LT1/M1M2-PCR (nPCR) by using primers described previously (MCPyV DNA was detectable in 30/34 (88%) MCC biopsies and in 5/5 (100%) MCC metastases by nPCR, and in 68% and 80%, respectively, by sPCR. MCPyV DNA was found by nPCR only in 1/13 (7.7%) whole blood samples of MCC-patients. The patient with MCPyV-positive blood had positive sPCR/nPCR results for MCC and positive nPCR results for a second sample taken from the previous MCC site. Of 5 further non-MCC biopsy samples from MCC patients, 1 skin sample from a patient with unspecific dermatitis was positive by nPCR.2 test).MCPyV DNA was traceable only by nPCR in 10/61 (16%) biopsy samples of different non-MCC skin tumors and in 8/34 (24%) of perilesional, clinically, and histologically healthy skin samples from 56 immunocompetent patients . MCPyV D2 test). For HR-HPV, a trend for a higher detection rate in patients with CD4 counts <200/μL could be observed (without MCC) participating in an anogenital dysplasia/human papillomavirus (HPV) screening program . In analn = 120) . In 7 ceIn an immunodeficient patient with WILD syndrome of plucked eyebrow hairs of 14 HIV-MSM and by sPCR in 5/14 (36%) as well Using nested PCR, we found MCPyV DNA in 88% of in samples from persons with MCC. In 68%, viral DNA load was high enough to be detectable by sPCR. This finding is similar to detection rates reported before (54%–89%) (The MCPyV positivity of 16% in non-MCC skin tumors was significantly lower than in MCC; MCPyV DNA was only detectable by nPCR, pointing to lower viral loads than in MCC. Similar to our results, MCPyV DNA has been found in 12.5% of basal cell carcinomas and viral load was 4-log lower than in MCC (HR-alpha-HPV induces anogenital dysplasia/cancer and HIV-MSM have a strongly increased risk for developing these lesions (MCPyV DNA was detected only once in hematolymphoid tissue and never in donated blood (In normal skin, MCPyV DNA has been identified before by PCR and Southern blot in 1/6 biopsies (
P=0.01). Allowing for potential prognostic variables in a Cox regression analysis, CA IX remained a significant independent predictor of survival (P=0.035). This study showed in both univariate and multivariate analysis that survival is significantly inferior in patients with tumour expressing CA IX. Prospective studies are underway to investigate this correlation in clinical trial setting.Tumour hypoxia is a microenvironmental factor related to poor response to radiation, chemotherapy, genetic instability, selection for resistance to apoptosis, and increased risk of invasion and metastasis. Hypoxia-regulated carbonic anhydrase IX (CA IX) has been studied in various tumour sites and its expression has been correlated with the clinical outcome. The purpose of this study was to investigate the correlation of CA IX expression with outcome in patients with invasive breast cancer. We conducted a retrospective study examining the effects of carbonic anhydrase IX (CA IX) on survival in patients with breast cancer. To facilitate the screening of multiple tissue blocks from each patient, tissue microarrays were prepared containing between two and five representative samples of tumour per patient. Immunohistochemistry was used to examine expression of CA IX in patients with breast cancer. The study includes a cohort of 144 unselected patients with early invasive breast cancer who underwent surgery, and had CA IX expression and follow-up data available for analysis. At the time of analysis, there were 28 deaths and median follow-up of 48 months with 96% of patients having at least 2 years of follow-up. CA IX was negative for 107 patients (17 deaths) and positive for 37 patients (11 deaths). Kaplan–Meier survival curves show that survival was superior in the CA IX-negative group with a 2-year survival of 97% for negatives and 83% for positives (log-rank test Despite pivotal developments in endocrine therapy and chemotherapy, resistance to therapy remains a key limitation in the management of invasive breast cancer. A fundamental difficulty in the understanding, prevention, and treatment of breast cancer is clinical heterogeneity between tumours. This is commonly manifested as variable responses to specific therapeutic regimens. Numerous studies indicate that this clinical heterogeneity reflects underlying molecular heterogeneity. Tumour hypoxia is a micro-environmental factor related to poor response to radiation and chemotherapy, genetic instability, selection for resistance to apoptosis, and increased risk of invasion and metastasis sections from each case were screened by a pathologist and appropriate representative areas of tumour highlighted for sampling. Tissue cores for the construction of tissue microarrays (TMAs) were taken with a 3-mm skin punch biopsy needle from the paraffin blocks that were used for histological diagnosis. The tissue cores were inserted in the holes of the rectangular carrier made of liver tissue, punched out by a 4-mm punch biopsy needle . The carrier facilitated the smooth cutting of sections with minimal artefacts in transition from paraffin to tissue.Each carrier had a grid of 4 × 5 holes and, in addition to the breast tumour tissue samples, contained one core of normal breast tissue as a control. Four cores per sample, from multiple areas of the same tumour, were included in the TMA and embedded in different blocks at different positions on the grid for redundancy. After core insertion, tissue was re-embedded in paraffin. A small number of cores were damaged during TMA construction or subsequent methods and were labelled as noninformative. On an average, 83.4% of the cores, or 3.3 cores per specimen, were informative and were used in the analysis. and heated for 1 h at 60°C. After deparaffinising and rehydration, sections were treated in 0.3% H2O2 in water to block endogenous peroxidase activity. Antigen retrieval was performed using the ALTER technique as previously described and once by a pathologist (RG), both of whom were blinded to any other data. The whole of each section was subjectively assessed under light microscopy. For assessment of the level of CA IX expression, individual tumours were scored according to the level of staining in tumour cells. Staining of the biliary epithelial cells within surrounding liver (used to support the breast cores) served as the internal positive control (unpublished data). There was one score for the strength of staining and one score for distribution pattern within the tumour stained . Sections where intra-observer or inter-observer error occurred for either of the scores were reviewed again by a pathologist (RG) and assigned a score that dictated which of the two original scores was recorded. In the event of all three pairs of scores differing, a consensus score was agreed upon after examination by both observers (SAH and RG) at a multiheaded microscope. Tumours were categorised into five patterns of expression of CA IX: tumour negative, weak diffuse (WD), weak focal (WF), strong diffuse (SD), or strong focal (SF). Expression of CA IX, whether strong or weak and focal or diffuse was grouped as positive.χ2 and Fischer's exact tests for the categorical measures and t-tests for the numerical measures. Survival times were calculated as the date of primary tumour diagnosis to date of death, or date of censor, if alive. Survival curves were constructed using the method of Correlations between CA IX (positive or negative) and known prognostic variables of tumour size (numeric), tumour grade , axillary lymph node status (positive or negative), side of tumour (left or right), surgery type (mastectomy or WLE+ ALNC), vascular invasion (present or absent), ER status (positive or negative), DCIS grade , and the Nottingham Prognostic Index , DCIS grade (P=0.89), axillary lymph node status (P=0.38), and ER status (P=0.11), side of tumour (0.50), surgery type (P=0.13), vascular invasion (P=0.59), tumour grade (0.40), and Nottingham Prognostic Index (P=0.39).There was no evidence that CA IX expression was associated with known prognostic variables, specifically tumour size (P=0.01). In a Cox regression analysis, based on the 133 patients with complete data, even after adjusting for the NPI, CA IX remained significantly associated with survival (P=0.03). In fact, when adjusting individually for any of the prognostic variables in P=0.049) and CA IX marker status . The remaining variables of tumour size, tumour grade, nodal status, surgery type, ER status, and NPI did not reach the level of statistical significance required for inclusion in the model.At the time of analysis, 28 of the 144 patients had died . Median follow-up for the alive patients was 48 months (range 5–71 months), with 96% having at least 2 years follow-up. In a univariate analysis, the data showed some evidence for vascular invasion, ER status, Nottingham Prognostic Index (NPI), and tumour grade to be prognostic for survival, although not all at a statistically significant level, possibly owing to the relatively small size of the study . SurvivaRecent studies have demonstrated that many human tumours are hypoxic. This is likely to be due to compromised micro-circulation within a tumour. The clinical importance of tumour hypoxia is its association with a more aggressive malignant phenotype, increased risk of metastasis, and resistance to chemo- and radiotherapy . This may be due, in part, to heterogeneity in CA IX staining both within and between individual tumours, which might lead to inaccuracy in estimating the number of positive and negative tumours. Additionally, this may be related to differences in technique and interpretation in nonstandardised immunohistochemistry assays. It was interesting to note that when adjusted individually for any of the prognostic variables, vascular invasion and CA IX expression always remained significantly associated with survival and the HR from our multivariate analysis was comparable to that found by Chia Hypoxia is reported to be an adverse prognostic factor in most human tumours. This study demonstrates that 26% of breast cancers are positive for CA IX expression. This information may have prognostic value in that CA IX expression is a predictor of poorer survival independently of other recognised prognostic factors. This information may, therefore, facilitate a more refined selection of patients for adjuvant treatment. By adding to established prognostic factors, CA IX expression may contribute to the identification of patients at greater risk of relapse who should be offered adjuvant treatment while sparing those whose prognosis is already good.At the time of diagnosis for the patients in this series, Her-2 testing was not routinely performed. Thus, correlations between CA IX expression and Her-2 could not be made. Because of the prognostic importance of Her-2, this question must be addressed in future prospective studies in patients with known Her-2 status.Furthermore, as hypoxia is related to resistance to chemotherapy and radiotherapy, CA IX expression may serve as a predictive factor to guide the selection of the most appropriate adjuvant treatment modality. Moreover, as hypoxia as a cause of treatment resistance can be effectively overcome by a variety of strategies, including high-oxygen-content gas breathing, blood transfusion, haemoglobin–oxygen affinity modifiers, and nicotinamide, the incorporation of these could be further investigated in patients with breast cancer.Finally, the expression of CA IX in a number of breast tumours examined in this study, compared to the absence of CA IX in normal breast tissue, indicates that hypoxia and hypoxia-related gene expression may present a useful target for novel targeted therapies, for example drugs or gene therapy vectors that are specifically activated under hypoxic conditions. This study provides a rationale basis for the further study of these approaches in breast cancer. Randomised studies with translational end points are required to further elucidate the prognostic and predictive value of CA IX. Prospective study within the context of an adjuvant chemotherapy trial is underway to investigate and explore this correlation in clinical trial setting.
JAK2 V617F mutation in exon 14 is the most common mutation in chronic myeloproliferative neoplasms (MPNs); deletion of the entire exon 14 is rarely detected. In our previous study of >10,000 samples from patients with suspected MPNs tested for JAK2 mutations by reverse transcription-PCR (RT-PCR) with direct sequencing, complete deletion of exon 14 (Δexon14) constituted <1% of JAK2 mutations. This appears to be an alternative splicing mutation, not detectable with DNA-based testing.The JAK2 Δexon14 at low levels not routinely detectable by RT-PCR with direct sequencing. Using a sensitive RT-PCR–based fluorescent fragment analysis method to quantify JAK2 Δexon14 mRNA expression relative to wild-type, we tested 61 patients with confirmed MPNs, 183 with suspected MPNs , and 46 healthy control subjects. The Δexon14 variant was detected in 9 of the 61 (15%) confirmed MPN patients, accounting for 3.96% to 33.85% (mean = 12.04%) of total JAK2 transcript. This variant was also detected in 51 of the 183 patients with suspected MPNs (27%), including 20 of the 93 (22%) with V617F (mean [range] expression = 5.41% [2.13%–26.22%]) and 31 of the 90 (34%) without V617F (mean [range] expression = 3.88% [2.08%–12.22%]). Immunoprecipitation studies demonstrated that patients expressing Δexon14 mRNA expressed a corresponding truncated JAK2 protein. The Δexon14 variant was not detected in the 46 control subjects.We investigated the possibility that MPN patients may express the JAK2 Δexon14 splice variant, leading to a truncated JAK2 protein, is common in patients with MPNs. This alternatively spliced transcript appears to be more frequent in MPN patients without V617F mutation, in whom it might contribute to leukemogenesis. This mutation is missed if DNA rather than RNA is used for testing.These data suggest that expression of the JAK2 V617F mutation, has been reported in about 95% of PV patients, 35% to 70% of ET patients, and 50% of IMF patients JAK2 exon 12 mutations, as well as other mutations in exons 13 and 14, have been reported in rare cases of non-CML MPDs negative for V617F Myeloproliferative neoplasms (MPNs) are multipotent hematopoietic stem cell disorders characterized by uncontrolled proliferation of maturing blood cells. Chronic myeloid leukemia (CML) is the most common MPN, followed by polycythemia vera (PV), essential thrombocythemia (ET), and idiopathic myelofibrosis (IMF) JAK2 mutations is performed by analyzing the genomic DNA of the JAK2 gene. We have adapted the use of mRNA as the basis for testing for JAK2 mutations and have shown that RNA allows more sensitive detection of mutations than does DNA at early stages of disease Most testing for JAK2 mutation profiles in a series of >10,000 patient samples, we described detection of a novel deletion of JAK2 exon 14 (Δexon14) along with other JAK2 mutations in exons 12 through 15, using bi-directional mRNA sequencing technology JAK2 mutations. However, direct sequencing is not amenable to detecting deletions of entire exons, owing to difficulty in interpreting results as well as the low sensitivity of this approach. Therefore, in this study we used a sensitive RT-PCR–based assay with fluorescent fragment analysis to explore the possibility that MPN patients may commonly express this JAK2 mRNA splice variant at levels that cannot be reliably detected by sequence analysis. We further sought to determine whether patients expressing this splice variant also express a corresponding truncated JAK2 protein.In a previous report of JAK2 V617F as well as mutations in JAK2 exons 12 and 13: Group 2 comprised 90 samples that were negative for JAK2 mutations in V617 and exon 12 and 13, and group 3 comprised 93 samples from patients with JAK2 V617F. In addition, we tested 46 normal healthy control individuals.We tested peripheral blood samples from three groups of patients in addition to healthy normal control subjects. Group 1 comprised 61 consecutive randomly selected patients with confirmed non-CML MPN on the basis of clinical findings and complete peripheral blood and bone marrow analysis. The diagnosis of these patients was myelofibrosis in 27 (43%), polycythemia vera in 12 (19%), essential thrombocythemia in 6 (10%) and not-otherwise classified in 16 (27%). The other 2 patient groups were constructed from 183 residual de-identified samples from individuals with suspected non-CML MPNs initially submitted to Quest Diagnostics Nichols Institute for testing of JAK2 Δexon14 variant by RT-PCR with bidirectional sequencing. All samples were also screened for the Δexon14 transcript using a sensitive assay based on RT-PCR with fluorescent fragment analysis.Plasma was separated from peripheral blood samples and used for extraction of total RNA. The mRNA was then used for detection of the All work was performed according to a protocol approved by an Institutional Review Board (IRB) . Samples collected from group 1 and the normal control were collected with consent form.JAK2 exons 12 through 14 and part of exon 15: 5′-CTAAATGCTGTCCCCCAAAG-3′ (forward); and 5 ′-CCATGCCAACTGTTTAGCAA-3′ (reverse). The RT-PCR was performed using Superscript III one-step RT-PCR systems with Platinum Taq under the following thermocycler conditions: initial step of 94°C for 2 minutes, followed by 40 cycles of 94°C for 15 seconds, 60°C for 30 seconds, and 68°C for 1 minute, with a final extension step of 68°C for 7 minutes. The 491-bp PCR product was then purified and sequenced in both forward and reverse directions using an ABI PRISM 3730XL Genetic Analyzer . Sequencing data were base-called using sequencing analysis software and assembled and analyzed with SeqScape software (Applied Biosystems) using GenBank accession number NM 004972 as reference.Total nucleic acid was extracted from patient plasma or PB/BM cells using the NucliSens extraction kit. The primer pair was designed to encompass JAK2 exon 14, with the forward primer annealed in JAK2 exon 13 (5′-GAC TAC GGT CAA CTG CAT GAA A-3′) and the reverse primer annealed in exon 16 (5′-CCATGCCAACTG TTTAGCAA-3′). One of the two primers was FAM-labeled. The RT-PCR was performed using same buffer system (Invitrogen) and thermocycler conditions as the sequencing method. The JAK2 wild-type and Δexon 14 products were verified by determining the size of PCR products using the GeneScan 350ROX size standard (Applied Biosystems) and ABI PRISM 3730XL Genetic Analyzer. The wild-type product displays a 273-bp peak while the Δexon 14 splice variant displays a 185-bp peak . The percentage of transcript accounted for by the JAK2 Δexon 14 splice mutant is calculated using the following formula:Total nucleic acid was extracted as described above from patient plasma or cells . The primer pair was designed to encompass 5–1×106) were lysed in isotonic lysis buffer containing 1× protease inhibitor mix . Clarified lysates were subjected to immunoprecipitation using TrueBlot™ beads with an N-terminal anti-JAK2 antibody . After incubation at 4°C for 4 to 12 hours, immune complexes were washed 4 times in lysis buffer, separated by SDS/PAGE, and analyzed by immunoblotting using C-terminal JAK2 antibody or N-terminal JAK2 antibody . K562 cell line (ATCC CCL-243 Manassas VA) was used as negative control.Cells . Briefly, equal amounts of immunoprecipitation products were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and the gels were electrophoretically transferred to nitrocellulose membranes . The blots were blocked with 5% bovine serum albumin in Tris-buffered saline with 0.05% Tween-20 (TBS-Tween) for 2 hours. The membrane was incubated with primary antibody for 5 hours at 4°C, washed with TBS-Tween, and incubated with secondary antibody for 30 minutes at room temperature . After additional washing in TBS-Tween, chemiluminescent reagent was added and the image was developed on x-ray film.JAK2 RNA (not DNA) is used for direct sequencing, the Δexon 14 transcript is reliably detected if present at levels >15% to 20% of total JAK2 RNA overall, including 20 of the 93 (22%) V617-positive patients (mean [range] expression = 5.41% [2.13%–26.22%]) and 31 of the 90 (34%) V617F-negative patients , there is a tendency of finding Δexon14 in unmutated patients. None of the 46 plasma RNA samples from the normal control group showed any expression of the Δexon14 transcript. Most patients with Δexon14-positive in each group had expression levels below 15%, therefore, it is frequently missed by direct sequencing.Using the RT-PCR/fragment length analysis assay, we screened all groups of patients. Samples with Δexon 14 mutant to wild-type ratios greater than 15% by fragment analysis were tested and successfully confirmed by careful inspection of direct sequencing results. The Δexon14 was detected in 9 of the 61 confirmed MPN patients (15%) , where iJAK2 Δexon14 transcripts (P = 0.07), suggests that it may play a significant role in the pathophysiology of MPNs. Current knowledge of JAK2 functional domains and known mutations may shed light on the potential biological effects of this unique splice variant. All currently identified JAK2 mutations, including point mutations and indels in exons 12 through 15, reside in the pseudokinase domain (JH2)-coding region of JAK2 and do not affect the reading frame JAK2 Δexon14 transcripts on tumorogenesis should be performed.The fact that the JAK2 Δexon14 splice variant is a relatively common anomaly in patients with MPNs, possibly more so in those lacking the V617F mutation. Further functional analyses of the Δexon14 JAK2 protein are needed to better understand how this abnormality may contribute to the pathophysiology of disease and its potential role as a marker for diagnosis, prognosis, or prediction of response to therapy.In conclusion, the
Small noncoding RNAs (ncRNAs), including short interfering RNAs (siRNAs) and microRNAs (miRNAs), can silence genes at the transcriptional, post-transcriptional or translational level ,2.hoxd4 gene and represses its expression at the transcriptional level. Mutational analysis of the miR-10a sequence revealed that the 3' end of the miRNA sequence is the most critical element for the silencing effect. MicroRNA-10a-induced transcriptional gene inhibition requires the presence of Dicer and Argonautes 1 and 3, and it is related to promoter associated noncoding RNAs. Bisulfite sequencing analysis showed that the reduced hoxd4 expression was accompanied by de novo DNA methylation at the hoxd4 promoter. We further demonstrated that trimethylation of histone 3 lysine 27 (H3K27me3) is involved in the miR-10a-induced hoxd4 transcriptional gene silence.Here, we show that microRNA-10a (miR-10a) targets a homologous DNA region in the promoter region of the In conclusion, our results demonstrate that miR-10a can regulate human gene expression in a transcriptional manner, and indicate that endogenous small noncoding RNA-induced control of transcription may be a potential system for expressional regulation in human breast cancer cells. Large nnd plants. Althougnd plants, transcrHox genes as putative miRNA targets. It is believed that knowledge about the relationship between Hox genes and miRNAs is important for the understanding of the Hox gene regulatory mechanism in animal development as well as in tumor invasion and metastasis [hoxb4 and the hsa-miR-10b locus is similarly situated in the promoter region of hoxd4 , hepatocellular liver carcinoma cells (HepG2), cervical carcinoma cells (HeLa) and lung adenocarcinoma cells (A549) Fig. . The hoxlls Fig. . This exlls Fig. . The explls Fig. , and theebrafish and coulnes Fig. .hoxd4 gene expression, we first performed in vitro loss-of-function analyses by silencing the miRNA with antisense oligonucleotides and assessing hoxd4 gene expression. Quantitative PCR showed that unlike negative control 2'-O-methyl oligos (N.C.) or anti-miR-196a, the transfection of a modified 2'-O-methyl miR-10a antisense oligonucleotide (anti-miR-10a) resulted in a 2-fold increase in hoxd4 mRNA levels MDA-MB-231 cells and a 4-fold increase in hoxd4 mRNA levels in MCF7 cells or anti-miR-196a or the loop region and Argonaute 2 (Ago2) ,19. Also10a Fig. . SiAgo3 hoxd4 expression by de novo DNA methylation, MCF7 and MDA-MB-231 cells were treated for 5 days with 0.75 μM 5-Aza-2'-deoxycytidine (5-aza-dC), a DNA methylotransferase (DNMT) inhibitor. In MCF7 cells, the 5-aza-dC treatment clearly upregulated the expression of the p15 gene, whose promotor is normally methylated, but did neither affect the expression of the unmethylated gapdh gene nor affect the expression of miR-10a and the bisulphite sequencing PCR (BSP) detection site (Chip Box2: -330 ~ -122). Western blot analysis demonstrated the presence of H3K9me2 and H3K27me3 in the promoter region of the hoxd4 gene , we found that the extent of methylation decreased and was accompanied by upregulation hoxd4 expression in both cells types was performed with lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.Human breast cancer cell lines MCF-7, MDA-MB-231, human mammary epithelial cell line MCF10A, human cervical carcinoma cell line HeLa, human hepatocellular liver carcinoma cell line HepG2, human lung adenocarcinoma cell line A549 were obtained from the American Type Culture Collection . MCF10A cells were cultured in DMEM-F12 (Life Technologies) supplemented with 5% horse serum, 0.5 μg/ml hydrocortisone (Sigma), 10 μg/ml insulin (Sigma), 20 ng/ml epidermal growth factor (Sigma), 100 μg/ml penicillin and 100 μg/ml streptomycin. Other cells were grown in DMEM (Life Technologies) supplemented with 100 μg/ml penicillin, 100 μg/ml streptomycin and 10% heat-inactivated FBS at 37°C in a humidified atmosphere containing 5% COU6 small nuclear RNA was used as an internal control.Total RNA from cultured cells was isolated using the mirVana miRNA Isolation Kit (Ambion). Detection of the mature form of miRNAs was performed using the Hairpin-it miRNAs qPCR Quantitation Assay, according to the manufacturer's instructions (GenePharma). The Total protein (40 μg) was resolved with 10% SDS-polyacrylamide gel eletrophoresis and bands of protein transferred to a polyvinylidene difluoride (PVDF) membrane (Amersham). The membrane was blocked with 5% nonfat milk TBS buffer overnight at RT, and incubated for 2 hours with primary antibodies. β-actin was used as loading control. The antibodies used included hoxd4 (Abcam), β-actin (SantaCruz Biotechnology). The membranes then were incubated for 1 h with HRP-conjugated goat anti-mouse (Zymed Laboratories) or rabbit anti-goat (SantaCruz Biotechnology) secondary antibody. Immunocomplexes were visualized with an ECL kit (Pierce).hoxd4 promoter regions (-300 bp – 122 bp). The amplifed product was purified using a Qiagen PCR purification kit (Qiagen) and sequenced using the sense primer with an ABI automated fluorescent sequencer according to the manufacturer's instructions.Genomic DNA (1 μg) was treated with sodium bisulphate and. used to PCR-amplify the MCF7 and MDA-MB231 breast cancer cells were treated with 0.75 μM 5-aza-dC (Sigma), and collected 0, 3 and 5 days later. MCF7 and MDA-MB231 breast cancer cells that had been transfected with 100 nM small RNA duplexes were treated with 1 μM 5-aza-dC for 48 h after transfection before subjected to qPCR analysis.We extracted total RNA from the treated cells with Trizol (Invitrogen) and treated it with DNase (Qiagen). We carried out qRT-PCR analysis using QuantiTeck SYBR Green PCR kit (Qiagen). PCR primers used in this paper are listed in Table 1, Additional file in vitro transcription reaction and precipitated with digoxinum antibody. Amplified β-actin served as a loading control. Bound RNA was eluted from the beads by adding Trizol (Invitrogen) to the beads, followed by RNA extraction and RT-real time PCR as described previously.Nuclear run-on assays were performed in accordance with the Current Protocols of Molecular Biology. Digoxinum linked dUTP was added to an 6 cells for each immunoprecipitation reaction, and used rabbit antibody to H3K27me3 (Upstate 07-449) for specific immunoprecipitation of the histone residues. The precipitates were analyzed by real-time PCR with two sets of hoxd4 promoter specific primers spanning the CpG island of interest Assay Kit protocol UpState 17-295). We used 2 × 107-295. WeCells of 50% confluence in 24-well plates were transfected using Lipofectamine 2000 (Invitrogene). Firefly luciferase reporter gene constructs (200 ng) and pRL-SV40 Renilla luciferase construct were cotransfected per well. Cell extracts were prepared 48 h after transfection, and the luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega).All experiments were repeated 3 times. Data are presented as mean ± s.e.m. Student's t test (two-tailed) was used to compare two groups (P < 0.05 was considered significant). Two asterisks indicated that the p-value was less than 0.01, one asterisks indicated that the p-value was less than 0.05.YT carried out experiments, data analysis, and drafted the manuscript. BZ developed experimental methods. TW, GS, XZ, XG and HS participated in conception and design of the study. RC supervised the study, contributed to the data analysis, and reviewed the manuscript. All authors read and approved the final manuscript.Tables. Tables 1 and 2.Click here for file
Open fractures frequently result in serious complications for patients, including infections, wound healing problems, and failure of fracture healing, many of which necessitate subsequent operations. One of the most important steps in the initial management of open fractures is a thorough wound irrigation and debridement to remove any contaminants. There is, however, currently no consensus regarding the optimal approach to irrigating open fracture wounds during the initial operative procedure. The selection of both the type of irrigating fluid and the pressure of fluid delivery remain controversial. The primary objective of this study is to investigate the effects of irrigation solutions and pressure on re-operation within one year among patients with open fractures.The FLOW study is a multi-center, randomized controlled trial using a 2 × 3 factorial design. Surgeons at clinical sites in North America, Europe, Australia, and Asia will recruit 2 280 patients who will be centrally randomized into one of the 6 treatment arms . The primary outcome of the study is re-operation to promote wound or bone healing, or to treat an infection. This composite endpoint of re-operation includes a narrow spectrum of patient-important procedures: irrigation and debridement for infected wound, revision and closure for wound dehiscence, wound coverage procedures for infected or necrotic wound, bone grafts or implant exchange procedures for established nonunion in patients with postoperative fracture gaps less than 1 cm, intramedullary nail dynamizations in the operating room, and fasciotomies for compartment syndrome. Patients, outcome adjudicators, and data analysts will be blinded. We will compare rates of re-operation at 12 months across soap vs. saline, low pressure vs. high pressure, gravity flow pressure vs. high pressure, and low pressure vs. gravity flow pressure. We will measure function and quality of life with the Short Form-12 (SF-12) and the EuroQol-5 Dimensions (EQ-5D) at baseline, 2 weeks, 6 weeks, 3 months, 6 months, 9 months, and 12 months after initial surgical management, and measure patients' illness beliefs with the Somatic Pre-Occupation and Coping (SPOC) questionnaire at 1 and 6 weeks. We will also compare non-operatively managed infections, wound healing, and fracture healing problems at 12 months after initial surgery.This study represents a major international effort to identify a simple and easily applicable strategy for emergency wound management. The importance of the question and the potential to identify a low cost treatment strategy argues strongly for global participation, especially in low and middle income countries such as India and China where disability from traumatic injuries is substantial.This trial is registered at ClinicalTrials.gov (NCT00788398). Orthopaedic injuries represent 67% of injury admissions to Canadian hospitals . It is eOrthopaedic injuries are even more common internationally. Accelerated urbanization and industrialization in India and China, which represent 40% of the world's population, have resulted in an alarming increase in traumatic injuries. A vehicular accident is reported every three minutes and a death every 10 minutes on Indian roads. For every death, 3 patients survive and live with disability reported they would change their practice if a large RCT showed a clear benefit of an irrigating solution. The majority of surgeons [765 (80.6%)] believed that a particular irrigating solution would need to reduce the risk of infection compared to a standard by at least 25% to change practice. As a final confirmation of support, 612 surgeons reported they would participate in a randomized trial to resolve the controversy .We have successfully completed a pilot RCT using a factorial design to assess the feasibility of the proposed definitive FLOW trial. One hundred and eleven patients with open extremity fractures were randomized in permuted blocks using a customized web-based/telephone randomization system, to receive either soap or saline solution and either low or high pressure irrigation. Patients, outcome assessors and data analysts were blinded to treatment allocation. The primary outcomes of the pilot study were the rates of reoperation to treatment infection, non-union, and would healing problems in open fracture wounds. Our pilot study demonstrates: 1) our ability to recruit patients for the definitive trial; 2) investigators' compliance with key aspects of the protocol; 3) maintenance of data quality; 4) maintenance of high follow up rates; 5) our ability to organize trial procedures in a multinational trial; 6) The study results are consistent with a possible benefit of soap and low pressure irrigation. We have also used the pilot to develop and revise Case Report Forms (CRFs) and the Manual of Operations for Investigational Sites for the pivotal FLOW trial.The objectives of this study are to determine the effects of irrigation solutions and irrigation pressures on open fractures of extremities. The primary objective is to determine, in patients operatively treated for open fractures of the extremity, the effects of irrigation solutions and irrigation pressures on re-operations within one year after initial surgery. The secondary objective is to investigate the impact of irrigation solution , pressure , and illness beliefs on patient function and quality of life at one year. We will also compare non-operatively managed infections, wound healing, and fracture healing problems within 12 months after initial surgery.This study is a multi-center, blinded, randomized controlled trial, using a 2 × 3 factorial design. Patients are randomized to one of 6 treatment arms: 1) castile soap solution and low pressure, 2) castile soap solution and high pressure, 3) castile soap solution and gravity flow pressure, 4) saline solution and low pressure, 5) saline solution and high pressure, and 6) saline solution and gravity flow pressure (Table We will randomize patients using variable block sizes to ensure effective stratification. An automated internet-based randomization system based at the CLARITY Methods Center at McMaster University (available 24 hours/day), which we have used successfully for other multicenter trials, will ensure concealed randomization of eligible consenting patients. To ensure a prognostic balance between key factors, we will stratify patients by center and the type of Gustilo-Anderson open fracture (Types I and Type II versus Type III). We will apply permuted randomization, using block sizes of 6 or 12 at random, to allocate patients.Once patients or their proxy have provided informed consent and the operating or attending surgeon has evaluated the open fracture wound, the investigator or designated study team member will contact the automated randomization system at the Methods Center. Patients will be randomized to one of 6 treatment groups: 1) castile soap solution and low pressure, 2) castile soap solution and high pressure, 3) castile soap solution and gravity flow pressure, 4) saline solution and low pressure, 5) saline solution and high pressure, and 6) saline solution & gravity flow pressure.Patients who meet the eligibility criteria outlined below are to be included in the FLOW study. Only one fracture per patient is to be included. For patients with multiple eligible open fractures, the study fracture will be the most severe (i.e. the greatest Gustilo-Anderson Type).Eligible patients will meet all the following inclusion criteria: 1) men or women who are 18 years of age or older, 2) adequate x-ray confirmation of an open fracture, 3) open fractures (Gustilo-Anderson Types I-IIIB) (Table We will exclude patients meeting any of the following criteria: 1) open fractures with an associated vascular deficit (Gustilo-Anderson type IIIc), 2) known allergy to detergents or castile soap ingredients, 3) previous wound infection or history of osteomyelitis in the injured extremity, 4) previous fracture with retained hardware in injured extremity that will interfere with new implant fixation, 5) surgical delay to operative wound management greater than 24 hours from hospital admission, 6) use of immunosuppressive medication within 6 months, 7) immunological deficient disease conditions (e.g. HIV), 8) fracture of the hand , 9) fracture of the toes , 10) likely problems, in the judgment of the investigators, with maintaining follow-up, 11) previous randomization in this study or a competing study, 12) patient is a prisoner or is at high risk of incarceration during the follow-up period , and 13) failure to obtain informed consent.Figure We will register all patients who meet the eligibility criteria and document reasons for failure to randomize. We will document all patients screened for eligibility and record patients as: 1) eligible and included, 2) eligible and missed, and 3) excluded. The blinded Central Adjudication Committee (CAC) will adjudicate all situations where eligibility is in doubt.Patients will be randomized to have their open fracture wound irrigated with either soap or normal saline. In the operating room, surgeons will use sterile technique to inject 80 mL of the clear liquid soap with a sterile syringe into a 3L bag of normal saline. Our choice of castile soap and dosing is based upon experimental evidence, a recent clinical trial that used this formulation without adverse effects , and ourWe will standardize the minimum amount of soap or saline solution based upon the severity of open fracture wound according to the Gustilo-Anderson Classification . We based these volumes on our international survey data to reflePatients will also be randomized to have the solutions delivered to the open fracture wound by gravity flow (1-2 p.s.i.), low-pressure irrigation (5-10 p.s.i.), or high-pressure irrigation (>20 p.s.i.) with a battery operated irrigator [Stryker Surgilav or Zimmer Pulsavac Plus].Gravity flow irrigation will be standardized across participating centers as 3L bags of normal saline suspended 6-8 feet above floor level (2-5 feet above the table) using an I.V. pole. Irrigation tubing (measuring 1/4 - 3/8 inch inner diameter) will be connected to the 3L bag and secured with a stopcock (or compressive device) until ready for use. At the time of irrigation, the stopcock (or compression device) will be released and gravity flow irrigation of the open wound will occur. A large basin collecting the runoff will be suctioned by standard intraoperative suction tubing. No pressure will be applied to the bag of solution.To ensure standard low and high pressure delivery, we will require the irrigator to be one of two devices [Stryker Surgilav or Zimmer Pulsavac Plus] at all participating sites. For low pressure delivery, the high flow trauma tip of the Stryker Surgilav (at the low pressure setting) or the shower tip of the Zimmer Pulsavac Plus (at the low pressure setting) will be used to deliver a pressure of 6 p.s.i or 5.8 p.s.i, respectively. For the high pressure delivery, the multi-orifice tip of the Stryker Surgilav (at the high pressure setting) or the shower tip of the Zimmer Pulsavac Plus (at the high pressure setting) will be used to deliver a pressure of 30 p.s.i or 23 p.s.i., respectively. The irrigator tip will be held perpendicular to and 5 cm above the wound.We will standardize key aspects of peri-operative care and technical aspects of the initial irrigation and debridement procedure.Pre-operative I.V. antibiotics will be administered commencing on diagnosis. Postoperative, I.V. antibiotics will be administered for at least 24 hours post-surgery. Specific antibiotics will be used at the discretion of the attending surgeon. The recommended guidelines include: Cephalosporin (Ancef) I.V. for Grade I-II injuries, Cephalosporin (Ancef) I.V. and Aminoglycoside (Gentamycin) I.V. for Grade III injuries, and Cephalosporin (Ancef) I.V., Aminoglycoside (Gentamycin I.V) and penicillin for gross contaminated injuries. For large open wounds (Types III), temporary local antibiotic administration will be permitted (bead pouch) until definitive wound closure. All antibiotics that are prescribed for the randomized fracture are to be recorded on the CRFs.Prior to randomization, we will record whether the attending surgeon plans to use antibiotic beads or antibiotic osteobiologics and if the attending surgeon plans to use negative pressure wound therapy (wound vacs) to treat the patient's randomized open fracture wound. The FLOW randomization system will capture this information prior to the treatment allocation being provided. Since the attending surgeons will not be blinded to the treatment allocation and bias may be introduced, we strongly encourage surgeons to use antibiotic beads or antibiotic osteobiologics, and negative pressure wound therapy (wound vacs) only if they indicated this prior to randomization. We will record the actual use of antibiotic beads or antibiotic osteobiologics and negative pressure wound therapy (wound vacs) on the case report forms and we will document any discrepancies with the initial plan.Intra-operatively, surgeons will prepare and drape the injured extremity using sterile technique. Iodine-based or chlorhexidine-based initial wound scrubs will be allowed for extremity preparation. Surgeons will initially remove all gross debris, contaminants, and dead tissue . Adequacy of the debridement will be judged by colour, consistency, contractility, and bleeding of the muscle as well as complete eradication of contaminated and necrotic tissue including nonarticular devitalized bone. Delayed wound closure, split thickness skin grafting, or muscle flaps should occur by 7-14 days following the initial surgery when possible. Surgeons will repeat the irrigation and debridement procedure until the open wound is clean and soft tissues viable. Patients will receive the same irrigating pressure and solution to which they were initially randomized for all subsequent irrigations and debridements.Fracture stabilization will be at the surgeon's discretion. Surgeons should stabilize the fractures using current best practices. These include the following guidelines: 1) definitive fixation should be in place by 14 days from the initial operative wound irrigation and debridement as soft tissue allows, 2) temporizing fracture stabilization for grossly contaminated (Type II or Type III) wounds if used should be spanning external fixation outside the zone of the injury, 3) definitive fixation for shaft fractures of the lower extremity will include statically locked intramedullary nails , and 4) The primary study endpoint is re-operation within 12 months post initial surgery to treat an infection, manage a wound healing problem, or promote fracture healing. Re-operation is defined as a surgery that occurs subsequent to the initial procedure. This composite endpoint of re-operation will include a narrow spectrum of patient-important procedures: irrigation and debridement for infection, revision and closure for wound dehiscence, wound coverage procedures for infected or necrotic wounds, bone grafts or implant exchange procedures for established nonunion in patients with postoperative fracture gaps less than 1 cm, intramedullary nail dynamizations in the operating room, and fasciotomies for compartment syndrome.Infections will be classified according to the Center for Disease Control (CDC) Criteria . We willOur definition for wound healing problems will follow previously published criteria . Any re-Diagnosis of nonunion will include a failure of the fracture to progress towards healing as observed by the treating surgeon and that requires further intervention to promote healing either surgical (i.e. bone graft) or non-surgical (i.e. bone stimulator). Final consensus on nonunion will be determined by the Central Adjudication Committee.The following conditions are not considered outcome events: 1) planned secondary interventions from initial surgical procedures and 2) any re-operations to promote fracture healing in patients with post-operative fracture gaps greater than 1 cm.The secondary study endpoints include patient function and quality of life measured by the Short Form-12 (SF-12) and the EuroQol-5 Dimensions (EQ-5D), non-operatively managed infections, wound healing problems, and fracture healing problems within 12 months.The Central Adjudication Committee, blinded to treatment allocation, will adjudicate re-operations to treat infection, wound healing problems, or fracture healing problems (delayed unions and nonunions), soft tissue procedures without infection in patients who have undergone more than 3 re-operations, and non-operatively managed infections, wound healing problems, and fracture healing problems. The adjudicators may review the patient's initial hospital notes, clinic notes, and x-rays.Figure Any adverse events, re-operations, infections, wound healing problems, antibiotic use relating to the fracture, and protocol deviations will be recorded. Missed follow up or early withdrawal will also be documented.We will withdraw patients only if patients withdraw consent for participation. We will document the reasons for patient withdrawal from the trial. For those patients who withdraw from other study activities, we will seek their approval to collect clinical data from their medical and hospital charts, and/or to contact them by telephone to ask about the primary and secondary outcomes.Patients, outcome adjudicators, and data analysts will be blinded to the study treatment. The operating room team (including the surgeon and study coordinator) cannot be blinded since the equipment they use for the irrigation pressures and the solutions are readily distinguishable. We will implement several procedures to limit loss of follow up Figure . PatientTo minimize the co-interventions, we will standardize the peri-operative procedures and antibiotics use. Patients will receive the surgical management to which they are randomized for the initial irrigation and debridement and for all subsequent irrigation and debridements. To prevent any patients from receiving the wrong solution or pressure, the following three measures will be applied whenever possible: 1) FLOW posters with clear preparation guides will be posted in all emergency operating rooms, 2) soap bottles will be placed in all orthopaedic operating rooms in clearly marked boxes with instructions, and 3) surgeons who complete the subsequent irrigation and debridements will be aware of the patient's treatment allocation. The study coordinator of the clinical site will, if possible, be present during any subsequent irrigation and debridements to ensure that patients receive the treatment to which they are randomized.Our sample size is chosen to identify if there is any difference in effects of pairwise comparisons of the three irrigation pressure groups on re-operations at 12 months for the saline solution effect, based on two randomized trials ,35. GiveFor our secondary outcomes, we consider an important difference in SF-12 to correspond to a moderate effect as reported by Cohen as well The EQ-5D correlates well with the Health Utilities Index (HUI) and both have been reported to provide similar estimates of utility . DrummonAnalyses will include all patients in the groups to which they were randomized. The data analyst and investigators, while conducting the analyses, will be blind to treatment groups. We will use the log-rank test and the Kaplan-Meier survival curve to compare the main effects of irrigating solution and irrigation pressure at the margins of the 2 × 3 factorial design on time to the first re-operation after the initial surgery. We will use a two-sided alpha level of 0.05 for the comparison of irrigation solution and a two-sided alpha level of 0.0188 for pairwise comparison of irrigation solution. We will use Cox model to generate hazard ratio and its associated 95% confidence intervals for each comparison. The analyses will be stratified by center and the type of Gustilo-Anderson open fracture (Types I and II versus Type III).Adjusted analyses, employing Cox regression, will examine and control for the influence of patient and surgical factors that might be associated with the risk of re-operation, including age, degree of soft tissue injury, upper or lower extremity injury, extent of fracture gap, type of internal fixation, and severity of fracture.We will also examine the interaction of soap with pressure by including the main effects and their interaction terms in the Cox regression with the outcome variable as re-operation. This secondary analysis will have lower power and only large effects will be detectable.In addition to re-operation, we will also compare the effects of irrigation solution and pressure on the component outcomes, including non-operatively treated fracture healing complications, wound healing problems, and infection , using log-rank test and Kaplan-Meier survival curve. Adjusted analyses, using the Cox model, will be used to examine and control for the influence of patients and surgical factors.We will employ the generalized linear model for repeated-measure analysis of variance to examine the effects of time, treatment, and the interaction between the two to compare functional status and quality of life for all comparison groups. We will construct multi-variable regression models to explore the association between SPOC scores and functional outcome at 1-year, as measured by SF-12 physical component summary (PCS) and mental component summary (MCS) scores. We will also examine if SPOC scores at 1 and 6 weeks are similarly predictive.We plan to conduct two subgroup analyses, both with strong biological rationale and possible interaction effects. The first will compare hazard ratios of re-operation based upon the degree of soft tissue injury (Gustilo-Anderson Type I/II open fractures vs. Gustilo-Anderson Type IIIA/B open fractures). The second will compare hazard ratios of re-operation between fractures of the upper and lower extremity. We will test if the treatment effects differ with fracture types and extremities by putting their main effect and interaction terms in the Cox regression. For the comparison of pressure, we anticipate that the low/gravity flow will be more effective in the Type IIIA-B open fracture than in the Type I/II open fracture, and be more effective in the upper extremity than the lower extremity. For the comparison of solution, we anticipate that soap will do better in the Type IIIA-B open fracture than in the Type I/II open fracture, and better in the upper extremity than the lower extremity.We will conduct an interim analysis to monitor the treatment benefits. The interim analysis will be performed when two-thirds of the entire patient follow-up is completed (i.e. 1520 person-years). At this point, 91.7% (1886) patients will have been recruited into the trial.We use the O'Brien-Fleming Method to calculate the stopping boundary. We will maintain the overall specified type I error rate of 0.05 for the comparison of soap solution versus normal saline, and the threshold 2-sided significance level is 0.012 for the interim analysis. We will maintain the overall specified type I error of 0.0188 for each of the three pairwise comparisons of irrigation solutions, and the threshold 2-sided significance level is 0.003.The data analyst will present the results of analysis, including confidence intervals, to an independent DMC. No one other than committee members will be aware of the data on which the committee makes its decision, and no one involved in the study will be aware of the content of their deliberations.This study is to be conducted according to US and international standards of Good Clinical Practice , applicable government regulations and Institutional research policies and procedures. All patients for this study will receive a consent form describing this study and providing sufficient information for patients to make an informed decision about their participation. The consent form has been submitted with the protocol for review and approval by the Research Ethics Board (REB) or Institutional Review Board (IRB) for each clinical study site. The formal consent of a patient, using the REB or IRB-approved consent form, will be obtained before that patient undergoes any study procedure.Orthopaedic trials have been typically single-center, small studies that often lack sufficient power to reliably evaluate the important treatment effects, and suffer from methodological weakness. Previous orthopaedic trials have also tested only a single surgical intervention per study. The FLOW trial is the first study in orthopaedic traumatic surgery that uses a factorial design to address the treatment effects of two interventions in a single trial. Subsequent to our first large randomized orthopaedic trial (SPRINT) that has set a benchmark of conducting orthopaedic trials ,46, the Our trial will test whether the soap solution and lower irrigation pressure (i.e. gravity flow) reduce the risk of re-operation. These strategies are easily applicable and associated with minimal costs. Establishing their effects will have potentially important clinical and economic implications, in particular to patients in low and middle income countries such as India and China where disability from traumatic injuries is substantial.The FLOW trial has several important strengths. It will enroll 2280 open fracture patients from clinical sites in North America, Australia, Europe, and Asia - a sample size that ensures sufficient power to reliably detect small but important differences. Our trial uses the factorial design to simultaneously address effects of irrigation solutions and pressures, which improves the efficiency of the evaluation and substantially reduces the trial costs. Our trial has set stringent methodological safeguards against bias. We employ a variable block size with a centralized system to randomize patients; we will blind patients, outcomes adjudicators, and data analysts to treatment allocations; we will standardize peri-operative care and wound management strategies to reduce co-interventions; we will implement strategies to limit the patients lost to follow up; and we will adjudicate the events and address patient eligibility when in doubt through a central adjudication committee.One major limitation of FLOW is the fact that surgeons cannot be blinded to treatment allocation, leaving the assessment of outcomes and decisions to re-operate vulnerable to bias. To limit such bias, we are using an objective primary outcome and centrally adjudicating all primary outcome events by a group of orthopaedic trauma surgeons blinded to treatment allocation. The primary composite outcome of re-operation provides a patient-important estimate of effect superior to previously described measures such as radiographic fracture healing, delayed unions, and nonunions.FLOW, as for any trial evaluating two procedures requiring surgical experience, is at risk for differential expertise bias . The proThe effects of irrigation strategies on open fractures remain controversial. Prior evidence has suggested potential benefits of soap solution and lower irrigation pressures that have reduced costs. Identifying effective treatment alternatives that reduce both the risk of subsequent operation and health care costs will have an important contribution to orthopaedic practice. This trial will not only potentially change current orthopaedic practice, but also advance research methods for future orthopaedic trials.Stryker will provide the Surgilav irrigator, free of charge, to the Chinese sites. Zimmer will provide the Pulsavac irrigator, at a special price, to the sites in North America, Europe, and Australia.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2474/11/85/prepub
The 4-nitrophenyl ring is almost perpendicular to the pyran ring [dihedral angle = 89.39 (1)°]. In the crystal, molecules are connected by intermolecular C—H⋯O hydrogen bonds.In the molecular structure of the title compound, C Åb = 11.078 (2) Åc = 17.481 (4) Åβ = 119.78 (3)°V = 4063.9 (19) Å3Z = 8Kα radiationMo −1μ = 0.09 mmT = 113 K0.20 × 0.18 × 0.10 mmRigaku Saturn CCD area-detector diffractometerCrystalClear; Rigaku/MSC, 2005Tmin = 0.983, Tmax = 0.999Absorption correction: multi-scan (14653 measured reflections4007 independent reflectionsI > 2σ(I)3106 reflections with Rint = 0.044R[F2 > 2σ(F2)] = 0.055wR(F2) = 0.153S = 1.034007 reflections274 parametersH-atom parameters constrainedmax = 0.29 e Å−3Δρmin = −0.26 e Å−3ΔρCrystalClear used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536809048570/bh2257sup1.cifCrystal structure: contains datablocks I, global. DOI: 10.1107/S1600536809048570/bh2257Isup2.hklStructure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:
An important and yet rather neglected question related to bioinformatics predictions is the estimation of the amount of data that is needed to allow reliable predictions. Bioinformatics predictions are usually validated through a series of figures of merit, like for example sensitivity and precision, and little attention is paid to the fact that their performance may depend on the amount of data used to make the predictions themselves.Here I describe a tool, named Fragmented Prediction Performance Plot (FPPP), which monitors the relationship between the prediction reliability and the amount of information underling the prediction themselves. Three examples of FPPPs are presented to illustrate their principal features. In one example, the reliability becomes independent, over a certain threshold, of the amount of data used to predict protein features and the intrinsic reliability of the predictor can be estimated. In the other two cases, on the contrary, the reliability strongly depends on the amount of data used to make the predictions and, thus, the intrinsic reliability of the two predictors cannot be determined. Only in the first example it is thus possible to fully quantify the prediction performance.It is thus highly advisable to use FPPPs to determine the performance of any new bioinformatics prediction protocol, in order to fully quantify its prediction power and to allow comparisons between two or more predictors based on different types of data. Bioinformatics prediction methods rely systematically on the knowledge stored in biological databases and consequently the prediction reliability depends on the amount and quality of the available information.For example, early predictions of protein secondary structure based on amino acidic sequence were rather unreliable, since the paucity of protein three-dimensional structures that were available . Later oab absurdo, without knowledge, no predictions can be made. However, on the other hand, it is impossible to foresee that a prediction method will become infallible if an infinite number of experimental data become available. This uncertainty can also be seen from a different perspective: It is in general rather difficult to compare the reliability of two (or more) prediction methods [On the one hand it is obvious that better predictions are possible if larger amounts of experimental information are available: methods . In factIn the present paper, I describe a new procedure to estimate if the reliability of a prediction algorithm is expected to vary with the amount of experimental information that is being accumulated. In other words, this is a way to verify if the quality of the prediction results can be considered to be independent of the amount of experimental information that underlies them, provided that sufficient information is available. If this is verified, it is possible to assume that the prediction method reached its best performance and thus it is also possible to compare two (or more) prediction algorithms independently of the data that were used to develop and validate them.In a simple case in which it is necessary to predict if a protein is associated with feature A or with feature B , it is necessary to build two learning sets, one containing type A proteins and the other containing type B proteins. A query protein can then be predicted to be associated with feature A or with feature B by comparing it with the two learning sets . From anThe reliability of the predictions is usually estimated by a Jack-knife procedure, in which each member of the learning sets is used as query. It is thus eliminated from the learning sets used to delineate the prediction method and if both learning sets contain N members, such a procedure is performed 2N times and the resulting estimation of the quality of the predictions is based on 2N queries. Obviously, if N is small, one is expecting bad quality predictions. However, little attention is usually put on the eventuality that N is sufficiently large to allow to make reasonable predictions.Alternatively, several machine learning methods often adopt a partial cross-correlation validation. The learning sets are divided into n subsets, and one of them is used to compare the reality with the predictions performed by using all the others n-1 . This isTo solve such a problem, it is possible to select M elements from both learning sets, with M<<N, and to define and test the prediction method on two subsets of the learning sets, each containing M elements. The reliability R(M) can be thus estimated. Subsequently, it is possible to repeat everything by using two learning sets containing 2M elements each and record the reliability R(2M), and so on until M = N. This results into a series of reliability values R(X) that can be plotted against X. This is defined here as the Fragmented Prediction Performance Plot (FPPP) and some of its properties can be evidenced here.At low X values, when the learning sets are small, the reliability of the predictions cannot be estimated well. It may be either very small or very large but this does not provide, in general, any consistent information. By increasing X, the prediction reliability tends to converge towards a stable value. If X is large enough, the reliability should be invariant relative to a further increase of X. Such a reliability value can be considered to be the intrinsic reliability of the prediction method.However, if the number N of proteins contained in the two learning sets is not large enough, such a plateau is not observed in the Fragmented Prediction Performance Plot. In such a case, one can foresee that the reliability of the prediction method will vary if new data will be inserted into the learning sets. In other words, given that the experimental information stored in databases increases quite rapidly, the prediction method should be re-tested at a later date, when new data will become available.Interestingly, if it is possible to determine the intrinsic reliability of two prediction protocols, it is also possible to compare their performances, independently of the fact that they had been developed by using different learning sets. This is particularly interesting, since, as mentioned in the introduction, it is often rather difficult if not impossible to reconstruct data sets used by different scientists at different dates. Furthermore, the intrinsic reliability values allow one to compare the performances of methods that are based on different types of data, like for example amino acidic sequences and three-dimensional structures, where identical learning sets cannot be assembled by definition.In the following sections, three prediction methods are described, together with their Fragmented Prediction Performance Plots. They are not intended to make predictions suitable to solve real biological and biophysical problems. They are only examples, selected amongst many others, for describing some properties of the FPPPs.All the examples below share some common features. There are always two learning sets, each containing a particular type of subjects. The predictions are made by comparing the query with each of the two sets and by assigning the query to its closest group. In each case, a Jack-knife complete cross validation was performed.However, it is important to observe that the FPPPs can be used also in a general case in which there are more than two learning sets, independently of the definition of proximity between pairs of single subjects or of groups of subjects, and independently of the variables used to represent the subjects.The degree of reliability of each prediction was estimated with the confusion matrix and some of the figures of merit associated with it. First, by defining arbitrarily which of the two features is positive or negative, the following four quantities were defined: true positives (tp) = number of positive events that are correctly predicted; true negatives (tn) = number of negative event that are correctly predicted; false positives (fp) = number of negative events that are (incorrectly) predicted to be positive; and false negative (fn) = number of subjects that are predicted to be negative despite they are positive.These four elements of the confusion matrix can be used in a wide variety of ways to summarize by means of a single figure of merit the degree of reliability of a prediction. The following three figures of merits were considered here, since they are widely used.The sensitivity was defined asthe precision was defined asand the Matthews correlation coefficient was defined asSeveral other quantities can be used for estimating the prediction reliability and all of them can be used to produce Fragmented Prediction Performance Plots. The three figures of merit that are examined here are however nearly indispensable for the following reasons. First, sensitivity and precision tend to be anti-correlated and monitor different aspects of the prediction. The sensitivity indicates the fraction of positive events that are recognized by the predictor and the precision monitors how many spurious subjects are incorrectly considered to be positive. Both of them may range from 0 to +1, the latter value being associated with perfect predictions. Second, the Matthews correlation coefficient, which can vary from -1 to +1, with higher values indicating better predictions, considers both the true positives and the true negatives as successful predictions and is rather unaffected by sampling biases, which may occur when the dimensions of the learning sets are very different.A predictor of protein subcellular location was designed. Given a single protein sequence, it predicts if the protein is cytoplasmic or if it is an integral membrane protein. Each protein chain is represented by its amino acidic composition and it is thus associated with twenty variables, each of which is the percentage of observations of one of the twenty natural amino acids. The proximity between two subjects is estimated by the Euclidean distance computed over these twenty variables and the proximity between a single subject and a group of subjects is defined as the minimal value of the distances between the single subject and all the subjects belonging to the group.The amino acidic sequences of 928 human cytoplasmic protein and of 565 integral membrane proteins were downloaded from the UniProt database by usingThe values of sensitivity, precision, and of Matthews correlation coefficient were recorded at each step and are shown in Figure A predictor of quaternary status was designed. It is intended to predict, on the basis of the amino acidic sequence, if a protein chain participates in obligate hetero-oligomeric assemblies with other, different chains or if it exists as a monomeric or a homo-oligomeric protein.X = and Y = was estimated by the Tanimoto coefficient ST, defined asEach chain was represented by a vector of twenty elements, each indicating the percentage of occurrence of one of the twenty natural amino acids within the chain. The proximity between two single subjects Its values range between -0.33 and +1, if the variables are standardized withand it is a similarity measure between the two subjects that are compared. Therefore, a value equal to +1 indicates the identity between the two subjects and a value equal to -0.33 indicates the complete difference between the two subjects.The similarity between a single subject and a group of subjects was defined as the maximal value of similarity betweeh the single subject and the entries of the group. A query was considered to participate to a hetero-oligomeric assembly if its similarity to the group of hetero-oligomeric chains was higher that its similarity to the group containing non hetero-oligomeric chains.The amino acidic sequences of 1406 monomeric protein, 2985 homo-oligomeric proteins, and of 1446 hetero-oligomeric proteins were downloaded from the UniProt database. Initial predictions were performed by using two learning sets, one containing 10 hetero-oligormeric chains and the other containing 10 monomeric and 10 homo-oligomeric protein chains. Subsequently, predictions were performed by enlarging the first learning set to 20 hetero-oligomeric proteins and the other learning set to 20 monomeric and 20 homo-oligomeric proteins, and so on, until the first learning set contained 1400 hetero-oligomeric proteins and the other learning set contained 1400 monomeric and 1400 homo-oligomeric proteins.The values of sensitivity, precision, and of Matthews correlation coefficient were recorded at each step and are depicted in Figure This was a variation on the second example described above, the only difference being the definition of proximity between a single subject and a group of subjects. While in the second example the maximal similarity criterion was used, here the similarity between a query chain and a learning set was defined as the average similarity between the single subject and all the entries of the group.Like in the second example, predictions were performed by enlarging gradually the dimensions of the learning sets and the values of sensitivity, precision, and of the Matthews correlation coefficient were recorded at each step. Figure The Fragmented Prediction Performance Plots describe the variation of the prediction reliability as a function of the amount of information used to make the predictions.Figure One can observe that these values of sensitivity, precision, and of Matthew correlation coefficient are quite high. And this is not surprising, since it is obvious that soluble, cytoplasmic proteins can easily be distinguished from integral membrane proteins on the basis of their amino acidic composition. It must however be observed that the most reasonable way to further improve the quality of these predictions is not the enlargement of the learning sets. Other variables should be included into the representation of each subject, besides the percentages of the twenty amino acids, and/or other definitions of the proximity between the query and the learning sets should be used. A different algorithmic set-up might also be used.The FPPPs of the second predictor, which should discriminate protein chains that take part in permanent hetero-oligomeric supra-molecular assemblies from chains that do not, are depicted in Figure In fact, not only the values of sensitivity, precision, and of Matthews correlation coefficient are quite modest, but also they tend to decrease when the amount of information stored into the learning sets increases. It is thus reasonable to foresee that when new data will become available in the databases the prediction quality will decrease further. In this example, the intrinsic reliability of the predictions cannot be estimated.Figure Also in this case it is impossible to define the intrinsic reliability of such a predictor and it can be expected that a further enlargement of the learning sets might allow one to improve the quality of the predictions. In other words, such a prediction protocol seems to be rather promising, though the amount of information included into the data sets seems to be insufficient to fully exploit the potential of this prediction strategy.The three sets of FPPPs described above Figures , 2, 3 arIn the experience of the author of the present paper, several good predictors tend to behave like in Figure It must however be observed that the FPPP analysis is not intended to be the only tool to validate the predictors, the performances of which can be influenced by many other factors beside the amount of data that are used to design them. For example, the training sets might contain clusters that behave quite differently and these differences would not diminish even if the data used for training is increased. More in general, three different issues must be considered in order to evaluate predictive technologies: i) it is mandatory to verify if the predictions are better than random guesses; ii) data noise and heterogeneity can seriously affect the prediction quality; iii) different computational methods can behave differently on the same type of input data. On the basis of the three examples described in this paper, it is obvious to observe that the use of larger learning sets cannot per se guarantee an increase of the prediction reliability. However, it is clear that the dependence of the prediction quality on the amount of information present in the learning sets is a very important issue as well, since the final prediction reliability may depend considerably on the learning set dimension. Therefore, although the FPPP analysis, which remembers many bootstrapping procedures, is not the unique tool to validate bioinformatic predictions, it is a useful benchmark along this validation, which is absolutely necessary.All protein sequences were downloaded from the UniProt database by usingThe author declares that there are no competing interests.OC is the only author of this manuscript.
S. cerevisiae relies on pA site recognition by 3′ end processing factors. Here we demonstrate the existence of two alternative termination mechanisms that rescue polymerases failing to disengage from the template at pA sites. One of these fail-safe mechanisms is mediated by the NRD complex, similar to termination of short noncoding genes. The other termination mechanism is mediated by Rnt1 cleavage of the nascent transcript. Both fail-safe termination mechanisms trigger degradation of readthrough transcripts by the exosome. However, Rnt1-mediated termination can also enhance the usage of weak pA signals and thereby generate functional mRNA. We propose that these alternative Pol II termination pathways serve the dual function of avoiding transcription interference and promoting rapid removal of aberrant transcripts.Transcription termination of RNA polymerase II (Pol II) on protein-coding genes in S. cerevisiae transcribes genes for either polyadenylated mRNA or noncoding RNA such as small nuclear RNA (snRNA) and small nucleolar RNA (snoRNA). In both cases, Pol II termination is tightly coupled to RNA 3′ end formation, although different cis- and trans-acting elements are involved. Transcription termination of mRNA-encoding genes relies on recognition of the polyadenylation (pA) signal by cleavage/polyadenylation complexes that trigger Pol II disassembly from the template by a still-uncertain mechanism (RNA polymerase II (Pol II) in echanism . Accordiechanism .S. cerevisiae occurs by a different, specific mechanism involving the NRD complex (NRD) comprising Nrd1, Nab3, and Sen1 , this is activated and the transcript is stabilized by Pap1-mediated polyadenylation. Finally we analyze the crosstalk between pA-dependent, NRD- and Rnt1-induced termination pathways in the endogenous NPL3 locus and on reporter plasmids.We present evidence that malfunction of pA-dependent termination due to either mutations in CYC1 transcribed from the GAL1 promoter, and the endogenous PMA1 gene , possibly reflecting promoter-restricted Pol II. While the single rat1-1 mutant showed little increase in transcription beyond the poly(A) signal, the single sen1-1 mutant did show some increase over probes 4–8, indicating a defect in Pol II termination. Higher readthrough levels were detected on the double rat1-1 sen1-1 mutant . Together, these results indicate that, in the absence of functional Rat1, NRD acts to terminate readthrough transcription.We have shown that Sen1 cooperates with Rat1 to promote Pol II transcription termination on two different mRNA-coding genes, MA1 gene . To exteonstruct A. As in 1 mutant B, indica1 mutant . To testmination . TRO anaGFP gene C, simila1 sen1-1 B. The rarat1-1. Chromatin immunoprecipitation (ChIP) analysis across endogenous ADH1 in wild-type (WT) cells reveals Nrd1 signal spread across the whole gene peaking at the 5′ region and downstream of the pA signal or S5-P (3E8) CTD-specific antibodies was performed on ADH1. As shown above, shifting rat1-1 cells to nonpermissive temperature resulted in Pol II readthrough signals over probes A3 and A4 and higher levels than in the WT at A3 and A4 . Thirteen clones had 3′ ends in the first cluster region around the fifth Nrd1-binding site, while 19 were in the second cluster mainly at the first UCUU Nab3 sequence. A further five clones mapped around 70 nt downstream of the last UCUU repeat. The precise sites are indicated by arrows to evaluate their impact on termination. Mutations in the second cluster clearly reduced the number of transcripts ending in this region, as shown by a decrease in the intensity of the 670 bp PCR product to form a new plasmid, pKGGRCS . This argues against a role for Rnt1 in recruiting Sen1 to mediate termination. To establish that RCS generates an entry site for Rat1, we performed TRO analysis on a strain bearing a methionine-repressible RAT1 gene (MET1p::RAT1). This depletes Rat1 from the cell after 20 hr growth in media with methionine , presumably because nascent RNA is rapidly degraded. The upper band observed in ΔpA corresponds to a cryptic pA site previously reported for pGCYC1-512 polymerase, did not alter levels of kanMX4 mRNA (data not shown). These results show that RCS can enhance utilization of cryptic pA sites.In parallel with steady-state analysis of pGCYC1RCS, we assessed mRNA accumulation in the pKGG-based system used above for termination assays . Even thmination B, it onlA levels C and 5D.nstructs E. In conGAL10 mRNA displayed heterogeneous 3′ ends over the poly(A) signal region . However, 3 out of 16 clones analyzed were longer, indicating that a proportion of polymerases fail to terminate at the pA site. This is in agreement with recent studies showing that NPL3 pA signal is weak and Npl3 itself regulates pA site usage by competing with 3′ end cleavage and polyadenylation factors , although a small proportion still continued until GIP17 pA site with a rat1-1 allele causes a strong increase in mRNA encoding gene readthrough transcription. Significantly, these readthrough transcripts end at Nrd1- and Nab3-binding sites. Discrimination between pA- or NRD-dependent termination correlates with the phosphorylation state of Pol II CTD. Nrd1 binds preferentially to S5-P CTD, and S2-P antagonizes this interaction using genome-wide analysis has revealed that several additional genes to NPL3 generate 3′ flanking region Pol II profiles and detectible readthrough transcripts in rnt1Δ strains, indicative of Rnt1-dependent termination.g to RNA . Indeed,g to RNA . Interesg to RNA . PossiblS. cerevisiae must reflect strong evolutionary selection to maintain separate transcription units.Overall, the data presented in these studies demonstrate the existence of three different termination pathways for protein-coding genes. The dominant pA-dependent mechanism exclusively generates stable mRNA. If Pol II fails to terminate at the pA site, then NRD- or Rnt1-mediated termination may act as a fail-safe mechanism. This remarkable triplication of Pol II termination mechanisms in Strains, plasmids, and oligonucleotides used in this study are listed in Yeast strains were grown in minimal media at 25°C and transferred to 37°C 2.5 hr prior to TRO or ChIP assays. YCBA63 and DRY41-4A were grown in selective media with 2% galactose to OD 0.6 and then transferred to selective media with 2% glucose for 20 hr at 25°C and 2.5 hr at 37°C. YAEH97 was grown at 30°C to OD 0.5 in SD medium lacking methionine, then diluted to OD 0.03 and grown for 20 hr in medium supplemented with methionine (5 mM).ChIP was performed as described , with moTRO analysis and probes for pKGG, pGCYC1, and derived plasmids are as described . LocatioLM-RT-PCR was performed as described with mod3′RACE was performed with the primers listed in cRT-PCR was performed as previously described , with 5 Northern blot was performed from 8 μg of total RNA or 400 ng of mRNA isolated with Oligotex mRNA kit.qRT-PCR employed 1 μg of total RNA with oligodT and SuperScript III following the manufacture indications. Two microliters were used as template for each quantitative PCR, using primers as listed in
We describe the epidemiology of human rabies postexposure prophylaxis (PEP) in four upstate New York counties during the 1st and 2nd year of a raccoon rabies epizootic. We obtained data from records of 1,173 persons whose rabies PEP was reported to local health departments in 1993 and 1994. Mean annual PEP incidence rates were highest in rural counties, in summer, and in patients 10 to 14 and 35 to 44 years of age. PEP given after bites was primarily associated with unvaccinated dogs and cats, but most (70%) was not attributable to bites. Although pet vaccination and stray animal control, which target direct exposure, remain the cornerstones of human rabies prevention, the risk for rabies by the nonbite route should also be considered.
We perform a large-scale study of intrinsically disordered regions in proteins and protein complexes using a non-redundant set of hundreds of different protein complexes. In accordance with the conventional view that folding and binding are coupled, in many of our cases the disorder-to-order transition occurs upon complex formation and can be localized to binding interfaces. Moreover, analysis of disorder in protein complexes depicts a significant fraction of intrinsically disordered regions, with up to one third of all residues being disordered. We find that the disorder in homodimers, especially in symmetrical homodimers, is significantly higher than in heterodimers and offer an explanation for this interesting phenomenon. We argue that the mechanisms of regulation of binding specificity through disordered regions in complexes can be as common as for unbound monomeric proteins. The fascinating diversity of roles of disordered regions in various biological processes and protein oligomeric forms shown in our study may be a subject of future endeavors in this area. Traditionally, protein structure is believed to determine function. Recently, it was observed that many proteins contain regions without well-defined structure , including a large fraction of eukaryotic proteins. Intrinsic disorder has been associated with particular functions including cell regulation; signaling; and protein, DNA, and ligand binding. Many proteins are intrinsically disordered in native form and fold upon binding, following the conventional paradigm. Accordingly, disorder in a protein may facilitate binding to multiple partners. However, in some cases disorder has also been found in the bound state. To gain clearer insight into the functional importance of disorder regions in protein complexes, we perform a large-scale analysis of disorder using protein structures in complex and in unbound forms. We show that disorder in protein complexes is rather common and pinpoint changes that occur upon protein binding at interaction interfaces. By illustrating a variety of functional roles for disorder in specific proteins, we emphasize the versatility and importance of this phenomenon. Many proteins and protein regions have been shown to be intrinsically disordered under native conditions; namely, they contain no or very little well-defined structure IDPs have certain properties and functions that distinguish them from proteins with well-defined structures. 1) IDPs have no unique three-dimensional structure in an isolated state but can fold upon binding to their interaction partners Predictions of disorder in proteins take into account the characteristic features of unstructured proteins and have been shown to be rather successful, especially in the case of large regions. According to the results of CASP7 , the best prediction groups successfully identified 50–70% of the disordered residues with false positive rates from 3% to 16% As protein interactions are crucial for protein function (A database of continuous protein fragments (Molecular Recognition Features or MORFs) has been compiled from the Protein Data Bank to include short protein chains (with fewer than 70 residues) bound to larger proteins Examples of proteins with intrinsically disordered regions which exhibit coupling between folding and binding have been described in the literature previously Once CDD families are assigned, we identify all interacting chains within a PDB entry. Two chains qualify as interacting if they have at least 5 residue-residue contacts. A contact takes place between a residue from one chain and a residue from the other when the distance between any non-hydrogen atom of one residue is within 6 Å of any non-hydrogen atom of the other residue. The set of residues which make contacts between the chains form the interface. To ensure that interactions are biological and not spurious, such as from crystal packing, we remove interactions that are not confirmed with additional instances of the same family pair interacting in the same orientation, so-called Conserved Binding Modes (CBM) While analyzing disorder in dimer complexes, we also compare their disorder content with the fraction disorder of the protein in a monomeric state . MonomerWe cannot directly investigate the disorder on the interfaces in complexes as complexes are defined through residue contacts so those interface residue coordinates must be present in PDB files (see definitions of disorder below). As shown in X was averaged over all instances (structures) of family X interacting with family type Y through a specific CBM. Hereafter we refer to them as “CBM interactions” or merely “interactions”. Overall, we ended up with 588 CBM interactions (“test588”). To compare disorder content in monomeric and complex states we used the more strict definitions for both binding modes and oligomerization states (see previous section). If we use the more strict CBM definitions and restrict the monomeric states by PISA the set is reduced to 149 interactions (“test149”). Also, for each protein used in our test set we retrieve the Gene Ontology (GO) functional annotations After excluding those cases where interfaces are entirely outside of the alignment, our data set contained 4,884 dimer complexes and 418 unique monomer structures. Since multiple protein chains can be found in the same PDB entry (on average four chains per PDB entry from our test set) and these chains may belong to the same family, we performed an averaging of all observed quantities over the members of the family and conserved binding modes. Namely, as shown in Disordered regions were defined as those regions with missing coordinates in X-ray-resolved structures. This is the most direct way to observe intrinsically disordered regions although largely disordered proteins may be underrepresented in PDB because of the difficulties in their crystallization fraction disorder” as a ratio of the number of residues in disordered regions and the number of residues in the footprint or aligned regions. To see all computed values of fraction disorder consult To differentiate between ordered regions with missing PDB coordinates and true disordered regions, we annotated those regions which are both predicted to be disordered and at the same time have missing coordinates in PDB. They will be referred hereafter as “confirmed disordered regions”. To quantify the disorder content, we calculated the “Analysis of fraction disorder in different families shows that one quarter of our test complexes do not have any disorder while others can have as much as one third of their residues in the disordered state . The thrHere we describe in detail one example from the table: a complex of heat shock protein hsp31 which has chaperone activity and functions as a homodimer in solution 1PV2 Figure . The comWe performed an analysis separating all interacting pairs from our test set into homo- (535 complexes) and heterodimers (53 complexes), where both chains in a pair are classified as belonging to the same or different families respectively. Similarly, the prevalence of homodimers over heterodimers in a cell was reported previously In studying disorder in protein complexes, we can use the monomer states of the proteins as references. First we would like to check whether the disorder-to-order transition may occur upon binding; and second, to analyze if this transition happens on binding interfaces. In this section we compared fraction disorder of proteins in their monomer and complex states. By definition, binding interfaces should involve only residues with coordinates and therefore can introduce bias toward ordered regions in the complexes . Therefore, for fair comparison between monomers and complexes we subtracted the number of disordered residues in a monomer which are mapped onto interfaces in a complex from the overall number of disordered residues in a monomer.While in the previous section we focused on the disordered regions spanning the whole aligned or footprint regions, here we will focus on disorder in the interface regions. Since the interface in complexes is ordered by definition, we looked at disordered regions in monomers which are aligned to the interface region of the same protein in a complex. The monomer reference state gives us an opportunity to analyze the disorder in the regions of a monomer which form the interface upon binding. We found that the mapped (inferred) interface regions can be up to 50% disordered in a monomer and for 42% of the complexes which points to the coupling between folding and binding. It was suggested earlier that this disordered loop might prevent access to the active site for larger substrates and affect substrate specificity as larger substrates could only be accommodated in the active site by peeling away this loop from the active site cleft Several cases with significant disorder on inferred interfaces are listed in Our large-scale study of disordered regions in proteins and protein complexes underscores a fascinating diversity among the biological processes that make use of protein disorder. Analysis of GO functional annotations of complexes reveals a variety of categories where intrinsic disorder can play an important functional role, the most frequent of them being nucleic acid binding proteins, enzymes, ATP binding proteins, receptor binding proteins and other ligand binding proteins see . In addiMany complexes in our dataset have significant amounts of intrinsic disorder. The role of disordered regions in complexes has been analyzed in several previous studies on smaller test sets 2 and UmuD2′, which lack secondary structure and might lock the disordered regions in conformations that facilitate further binding of other proteins Many proteins perform their functions while interacting with each other in larger complexes. We argue that intrinsic disorder in complexes may play an important functional role in regulating the specificity of interactions between the dimer complexes and their interacting partners, in establishing the links between different residues upon allosteric regulation, and in possibly influencing the kinetics. For example, the mechanisms of regulation of binding specificity through disordered regions in complexes can be as common as for unbound proteins: controlling the exposure of the dimer interface or nearby regions for potential binding targets, or providing specific binding for substrates of certain sizes. The former mechanism has been recently investigated in the stable symmetrical homodimers, UmuDInterestingly, we find that the disorder content in homodimers, especially in symmetrical homodimers, is significantly higher than in heterodimers. Indeed, many soluble and membrane-bound proteins form homo-oligomeric complexes in a cell and oligomerization can generate new binding sites at dimer interfaces to increase specificity and diversity in the formation of complexes. Indeed, intrinsic disorder in homodimers might have more pronounced functional importance compared to the disorder in heterodimeric complexes. Symmetrical arrangements in homodimers might be crucial to keep functional disordered regions close together in space to form joint binding interfaces or to form near-interface regions to regulate the accessibility of the binding partner. Moreover, from the energetic point of view, symmetrical homodimers have an advantage over non-symmetrical arrangements Another explanation comes from thermodynamics considerations. Entropy of complexation gives an important contribution to the complex stability and drives macromolecular complexes to less symmetric states. Any rearrangement of monomers that decrease complex symmetry would therefore result in a more stable complex Click here for additional data file.Table S2Comparison of different disorder prediction methods for proteins from (0.03 MB PDF)Click here for additional data file.Dataset S1Fraction disorder for each pair of interacting chains using disorder defined as regions with missing coordinates(0.03 MB TXT)Click here for additional data file.Dataset S2Fraction disorder for each pair of interacting chains using disorder defined as the intersection of regions with missing coordinates and predicted disordered regions(0.00 MB TXT)Click here for additional data file.Dataset S3Functional annotations of complexes(0.25 MB TXT)Click here for additional data file.
Gene set analysis (GSA) is a widely used strategy for gene expression data analysis based on pathway knowledge. GSA focuses on sets of related genes and has established major advantages over individual gene analyses, including greater robustness, sensitivity and biological relevance. However, previous GSA methods have limited usage as they cannot handle datasets of different sample sizes or experimental designs.To address these limitations, we present a new GSA method called Generally Applicable Gene-set Enrichment (GAGE). We successfully apply GAGE to multiple microarray datasets with different sample sizes, experimental designs and profiling techniques. GAGE shows significantly better results when compared to two other commonly used GSA methods of GSEA and PAGE. We demonstrate this improvement in the following three aspects: (1) consistency across repeated studies/experiments; (2) sensitivity and specificity; (3) biological relevance of the regulatory mechanisms inferred.GAGE reveals novel and relevant regulatory mechanisms from both published and previously unpublished microarray studies. From two published lung cancer data sets, GAGE derived a more cohesive and predictive mechanistic scheme underlying lung cancer progress and metastasis. For a previously unpublished BMP6 study, GAGE predicted novel regulatory mechanisms for BMP6 induced osteoblast differentiation, including the canonical BMP-TGF beta signaling, JAK-STAT signaling, Wnt signaling, and estrogen signaling pathways–all of which are supported by the experimental literature..GAGE is generally applicable to gene expression datasets with different sample sizes and experimental designs. GAGE consistently outperformed two most frequently used GSA methods and inferred statistically and biologically more relevant regulatory pathways. The GAGE method is implemented in R in the "gage" package, available under the GNU GPL from A central goal of biomedical research is to define mechanistic causes for cellular behavior and disease. High throughput technologies such as gene expression profiling provide a rich starting point to identify mechanistic causes, e.g. de novo network inference . IdeallyGene set analysis (GSA) is a widely used strategy for gene expression data analysis based on pathway knowledge -12. Unliet al. [et al. [There are two categories of GSA based on the statistical tests used: sample randomization and gene randomization ,15. Sampet al. and Nam All these methods established GSA as a powerful strategy for gene expression data analysis. In spite of its advantages, GSA as a whole strategy still suffers from three major limitations.First, currently available GSA methods do not handle small datasets effectively, yet most gene expression datasets fall into this category. As mentioned above, the sample randomization strategy used by methods such as GSEA is not appropriate for studies with under 8 gene chips per state, thus gene randomization remains to be the only feasible option ,15. GeneSecond, no GSA method currently available handles datasets with different sample sizes and experiment designs consistently. For datasets with few or no replicates, t-test statistics, signal to noise ratios, or their corresponding p-values are not robust estimates of differential expression for genes or simply not applicable. Therefore, fold change (log based) is frequently used as more versatile per gene statistics ,5-7,18. Third, most GSA methods only consider transcriptional regulation in one direction in a gene set. This directional bias makes sense for experimentally derived gene sets, but not for gene sets based on canonical signaling pathways, which frequently show reciprocal gene regulation in both directions upon perturbation ,20. ThusTo address these issues, we have developed a novel method called Generally Applicable Gene-set Enrichment (GAGE) Figure . GAGE apIn this work, we show that GAGE is generally applicable to datasets with different sample sizes and experimental designs. We first apply GAGE to two lung cancer datasets ,22 and oAs a test case, we applied GAGE, PAGE and GSEA to two lung cancer datasets ,22 whichWe compared the top 10 most significant gene sets inferred by the three methods Table . While oSeveral major mechanistic themes predictive of poor clinical outcomes emerged from the list of top gene sets inferred by GAGE. These themes included G-protein coupled receptors (GPCRS) associated signals upon BMP6 treatment Table . For an Using a p-value cutoff of <0.01, GAGE identified fewer gene sets than PAGE Table . GAGE idBiologically, GAGE gene sets were mechanistically more relevant for BMP6 effects compared to those sets selected by PAGE. 9 out of 10 experimental sets inferred by GAGE Table are direSignificant gene sets inferred by GAGE were consistent across replicate experiments and within the top 10 lists. The top 10 gene sets are almost the same if we used either one of the two experiments only Table . The difWe conducted simulation study to compare the performance of GAGE vs GSEA and PAGE in a more controllable setting. To minimize the potential artifact of using synthetic data, we used the type 2 diabetes dataset which has been analyzed in the first part of the Results. We chose this large clinical dataset so that all methods including the sample randomization based GSEA are applicable. Also, to make the simulation tractable for GSEA, we employed a sub-dataset with 2000 randomly sampled genes from the full set of 17000 genes. While the dataset is real microarray data, we synthesized the testing gene sets with controlled levels of differential expression . We then applied GAGE, PAGE or GSEA to score these testing gene sets, and evaluated whether the enrichment scores reasonably reflect the differential expression levels of these testing gene sets.-324. or 10-15 (n = 50) for gene sets with no up-regulation at all (β = α = 1) shows that PAGE suffers from low specificity. In other words, the extremely small p-values did not indicate high sensitivity but rather a high false positive rate for PAGE. On the other hand, GAGE and GSEA are selective and started from insignificant p-values for the negative control gene sets with β = α = 1. Compared to GSEA, GAGE gave smaller p-value for gene sets with different levels of up-regulation gene set separation, 2) two-sample t-test, and 3) one-on-one comparisons between experiment and control samples. In this section, we show the impact of each of these three strategies in representative analyses, although these strategies have been consistently effective when applied to multiple datasets covered or not covered in this paper. We compare GAGE to PAGE on these aspects if possible, or to GAGE variants which ensembles PAGE in each one of these three aspects for exact comparison. GSEA is either not or less comparable in these aspects.In contrast to PAGE and GSEA, GAGE separates canonical pathways from experimental sets and considers potential perturbations in both directions (i.e. up and down regulation simultaneously) in canonical pathways. Expression data directly showed that genes in the most relevant canonical pathways are regulated in both directions Figure . Figure Compared to the top 10 canonical pathways assuming one-way changes, the top 10 canonical pathways allowing two-way changes better described BMP induced osteoblast differentiation mechanistically , while a one-sample z-test only considers the variance for the background distribution and ignores the effect of specific target gene set distribution (Formula 2). The background variance is small and often negligible compared to the within gene set variance, hence PAGE can produce unrealistically large z-scores and small p-values , which is potentially less sensitive to the violation of normal distribution assumption and expression outliers. GAGE-r gave similar results would be orders of magnitude smaller for the one-on-one comparisons versus the group comparisons Table . The enuIn this work we have presented a new gene set analysis method GAGE that is generally applicable to gene expression datasets of all sample sizes and experimental designs and in general performs better than two most frequently used methods. We have demonstrated GAGE's performance by comparing it to GSEA and PAGE extensively in the following three aspects: (1) consistency across parallel studies or experiments; (2) sensitivity and specificity of the pathway inference; (3) biological relevance of the pathways identified.Our results show a significant impact of separating gene sets into pathway and experimentally derived gene sets as is shown in Figure GAGE made two assumptions in conducting two sample t-tests on the log based fold changes of target gene set and control sets. The first assumption is approximate normal distribution for the mean fold change of the two sets. The central limit theorem states that the distribution of an average of sampled observations is normal regardless of the nature of parent distribution when sampling size is large enough. Indeed, the mean of fold change values for gene sets with ≥ 10 genes are close to normal distribution as shown by q-q plot previously . The secThe one-on-one comparison scheme is generally applicable to datasets of all sample sizes and experiment designs. We used a meta-test to infer a global p-value for all the individual comparison p-values. The global p-values and the number of significant gene sets we derived are sensible. As in common statistical tests, these p-values tend to decrease when the sample size increases, and can become small for large datasets like the lung cancer datasets Table , hence tThere are frequently multiple significant gene sets that share multiple genes or represent the same regulatory mechanism, especially for experimental gene sets. This redundant gene sets problem has been discussed elsewhere in detail . In respK p-values is the same (with the same null hypothesis) for all gene sets despite of their different size.There is also a multiple testing issue, i.e. gene sets may become significant when the gene set number is large. Classical FDR procedures like Benjamini-Hochberg (BH) and BonfIn this work, we present a novel method GAGE for gene set analysis (GSA). GAGE is generally applicable to gene expression datasets with different sample sizes and experimental designs, hence greatly expands the applicability of GSA. In both simulation experiments and multiple microarray data analyses, GAGE consistently outperformed two most frequently used GSA methods, GSEA and PAGE in three major aspects: (1) consistency across repeated studies/experiments; (2) sensitivity and specificity; (3) biological relevance of the regulatory mechanisms inferred. GAGE reveals novel and relevant regulatory mechanisms from both published and previously unpublished microarray studies.A schematic overview of GAGE procedure is shown in Figure GAGE uses curated gene sets collecteFor an experimental set the test statistic (score) used in GAGE is the average of the per-gene test statistics–similar to the scoring scheme used by other gene set analysis methods. However, for canonical pathways GAGE uses the average of the absolute values of the per gene test statistics to account for both up- and down-regulation.To test whether a gene set is significantly correlated with a phenotype or an experiment condition, we exam the fold changes of gene expression level in the experiment condition (or phenotype) vs control condition. Correspondingly, we want to test whether the mean fold changes of a target gene set is significantly different from that of the background set (the whole gene set of the microarray). This is a prototype two-sample t-test, as shown in Formula 1, in contrast to the one-sample z-test used in PAGE shown inWhere m, s and n are the mean fold change (log ratio of expression levels), standard deviation, and number of genes in a particular gene set, and M and S are the mean fold change and standard deviation for all of the genes in the dataset. Notice that this is a two sample t-test between the interesting gene set containing n genes and a virtual random set of the same size derived from the background (comparable to the one-sample z-test control set in Formula 2). Two sample t-test would be inaccurate when the two sample sizes are not comparable . The degWith the classical two-sample t-test as the default of GAGE, we also implement a rank-based two-sample t-test as an alFor microarray studies with one-on-one paired experiment and control samples, we calculate fold changes and carried out gene set significance tests for each experiment versus control sample pair. For microarray studies with multiple unpaired experimental and control samples, GAGE has two options: 1-on-1 and 1-on-grp. In 1-on-1 we enumerate all pairs of experiment-control and do gene set significance tests. In the 1-on-grp option we take the average gene expression level for all control samples as the sole reference, compare each experimental sample against this reference and do gene set significance tests. 1-on-1 is more rigorous theoretically. Our experiment showed that 1-on-grp gives nearly identical results and is much faster when the sample size is large. We take 1-on-1 as our standard, and leave 1-on-grp as a computationally fast option (default for unpaired experiments in this paper). We also implemented the commonly used comparison between experiment group and control group as the grp-on-grp option.K independent p-values follows a Gamma distribution. Hence we can do a meta-test for all the p-values of a gene set across multiple samples (Formula 4–5).GAGE derived multiple t-statistics and p-values from Formula 1 when doing 1-on-1 or 1-on-grp comparison for datasets with replicate samples. We derive a global p-value by combining these individual p-values. Individual p-value follows a Uniform distribution under the null hypothesis of the two-sample t-test and the negative log sum of k = 1,., K experiments and l = 1,., L controls), thus we need to take the average of the p-values for all L comparisons of a experiment to different controls as the p-value for that experiment (Formula 6) and then apply Formula 5 to these K independent p-values.Note that this analysis assumes that individual p-values come from independent comparisons. However, the 1-on-1 comparisons are not all independent for unpaired studies repository (accession number GSE13604). For the use in this paper, the raw data were processed by using RMA implemented in the Bioconductor Affy package with up-While the dataset for simulations study is real microarray data, we synthesized the testing gene sets with controlled levels of differential expression (or degrees of enrichment). We ranked all genes based on average fold change between the two sample groups (i.e. type 2 diabetes samples and controls) from most up-regulated to most down-regulated. We then sampled gene sets following a series of different Beta-distributions in gene ranks. One of the two parameters, α is fixed to 1, and the other parameters β takes values from integer 1 to 10 Figure , which cWL and PJW conceived and designed the study; WL and KS designed the statistical procedure; WL conducted the research and wrote the computer program; MSF and KDH conducted the BMP6-MSC microarray experiment. WL, MSF, KS, KDH and PJW drafted the manuscript. All authors read and approved the final manuscript.Supplementary tables, figures and notes.Click here for fileFull and non-redundant lists of significant gene sets inferred by GAGE when applied to the BMP6-MSC dataset.Click here for file
We report an unusual case of corneal lamellar injury caused by long bamboo splinters.A 70-year-old Japanese man visited our hospital with a bamboo injury. Slit lamp examination revealed that a bundle of bamboo splinters had deeply penetrated the corneal stroma of the right eye from the nasal limbus. The splinters were approximately 8 mm in length, but had not perforated the anterior chamber. They were completely removed by superficial corneal incision alongside each splinter with no consequences. The eye has remained healed for 3 months postoperatively.The bamboo splinters did not perforate the anterior chamber, although they were long and hard enough to do so. This may be because the spatula-like shape and flexibility of the bamboo splinters allowed them to penetrate the lamellar layer of the corneal stroma with ease, but with no perforation of deeper tissue. Bamboo has been reported as an unusual palpebral or orbital foreign body in ophthalmological studies ,2. BamboA 70-year-old Japanese man visited our hospital in January 2007 with a foreign body lodged deeply in his ocular stroma. He had sustained this injury while felling bamboo. At the initial examination, his best-corrected visual acuity (BCVA) was 0.3 in the right eye and manifest refraction was +1.25D-0.50 × 165. Bamboo splinters, approximately 8 mm in length, had pierced the cornea from the nasal side (Figure To remove the splinters, an inclined corneal incision was created alongside each one. This incision allowed them to be removed completely and with ease, demonstrating an effective way of avoiding infection from residual splinters. The wound was sutured in place with four interrupted 10-0 nylon sutures after washing the interface. Corneal sutures were used to facilitate wound healing, and were removed completely after 1 week.The eye showed no signs of infection and little scar formation; no strong astigmatism was observed Figure . BCVA waBamboo injury is unusual, and few cases have been reported where penetration has occurred with no perforation of blood vessels in the neck or perfoIn our patient, the bamboo splinters were long and hard enough to penetrate the corneal stroma. It appears, though, that the physical properties specific to bamboo allow it to penetrate deeply, but with no perforation of the anterior chamber. We believe this phenomenon may also be partially explained by the spatula-like shape of bamboo, together with its flexibility, enabling it to break the lamellar layer of collagen fibers with ease.The foreign body was lodged deeply in his stroma from the nasal limbus. We believe that the foreign body changed direction after coming into contact with the nose.et al. noted that bamboo acts as a huge reservoir of microorganisms, with 257 fungal strains being isolated from bamboo tissues in Japan [Morakotkarn in Japan . Therefoin Japan . This neThe bamboo splinters were long and hard enough to penetrate the corneal stroma, but did not. This may be explained by the spatula-like shape and flexibility of the bamboo splinters enabling them to penetrate the lamellar phase with ease.Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.The authors declare that they have no competing interests.MK: study concept and design, patient care, drafting the manuscript, literature review, TK: editing the manuscript, CS: patient care, data collection, literature review, JS: study concept and design, revising the manuscript,All authors have read and approved the final version of the manuscript.
In pregnancy, maternal serum concentrations of calcitriol significantly rise as a result of increased renal and placental contribution in order to assure calcium supply for the developing fetus. Considering that placenta is a site for vitamin D activation, and the versatility and potency of calcitriol, it is feasible that this hormone participates in fetal/placental development and physiology. In the present work we studied calcitriol actions upon human chorionic gonadotropin (hCG) secretion and expression in cultured trophoblasts, as well as vitamin D receptor (VDR) and CYP27B1 immunolocalization in placental villi.Quantification of hCG in culture media was performed by immunoassay. Expression studies were carried out by real time PCR. Analysis of CYP27B1 and VDR localization in placental slides were performed by immunohistochemistry. Statistical significance was established by one way ANOVA using Tukey test for comparisons.Calcitriol regulated hCG in a time-dependent manner: at 6 h the secosteroid stimulated hCG, whereas longer incubations (24 h) showed opposite effects. Interestingly, calcitriol stimulatory effects on hCG were accompanied by an increase in intracellular cAMP content and were abolished by pre-incubation of the cells with a selective protein kinase A inhibitor. Immunohistochemical techniques showed differential VDR localization in the syncytiotrophoblast layer or in the vascular smooth muscle cells depending on the epitope to which the antibodies were raised . CYP27B1 was immunolocalized in the syncytiotrophoblast layer of placental villi.The presence and location of the vitamin D activating enzyme CYP27B1 as well as the specific receptor for vitamin D were shown in placental sections. The latter, together with findings demonstrating specific effects of calcitriol acting through the VDR and the cAMP/PKA signaling pathway upon hCG expression and secretion, indicate that there is a functional vitamin D endocrine system in the placenta, and recognize calcitriol as an autocrine regulator of hCG. Calcitriol, the most active vitamin D metabolite, exerts its biological effects by binding to the vitamin D receptor (VDR), which is a ligand-activated transcription factor that recognizes cognate vitamin D response elements (VDREs) in target genes, and can also elicit rapid responses mediated by membrane receptors , containing 20% heat-inactivated FBS. Incubations were performed in humidified 5% CO2-95% air at 37°C. The morphological aspects of cells were examined daily, secreted hCG was measured by immunoassay (EIA) following manufacturer instructions and results were normalized against total protein content. Protein was determined by the method of Bradford 25-hydroxyvitamin D bioconversion into [3H]1,25-dihydroxyvitamin D was significantly reduced in preeclamptic placentas [The concentration of hCG was also measured after 12, 24 and 48 h of calcitriol treatment, but the results reported in the present study were only those that differed significantly when compared with the vehicle alone. The stimulatory effects observed at 6 h were no further evident after 12 or 24 h, and when cells were incubated in the presence of calcitriol during 2 consecutive days, the effects were rather inhibitory. Inhibition was evident at the mRNA level after 24 hours treatment, preceding the observed response in hCG protein. These data are probably more likely to be reflective of the true biological situation. Indeed, our results that calcitriol inhibited hCG were in line with previous data from this and other laboratories where low serum calcitriol and high serum hCG levels were found in preeclampsia , that colacentas , may suglacentas , this melacentas , which pIn non pregnant women the physiological concentration of calcitriol fluctuates between 40–100 pM. In the present study the calcitriol doses tested were: 100 pM, 1 nM and 10 nM. The lowest concentration (100 pM) is within the physiological range of circulating calcitriol levels in mexican pregnant women (127 pM and 151 pM) as observed previously ,29. The Placenta is considered not only as a source but also as a target of calcitriol . In ordeIn summary, the present study broadens the knowledge of placental vitamin D endocrine system by demonstrating the physiological effects of calcitriol on an important biochemical placental function marker such as hCG. In addition, this is the first report to show immunoreactive VDR in different locations in human placental villi, and opens the field to address important research questions on the role of calcitriol in specific placental structures.The author(s) declare that they have no competing interests.DB carried out real time PCR's analysis, hCG quantification and participated in the design of the study and statistical analysis. EA participated in the design of the study, particularly the molecular studies, performed real time PCR analysis and helped to draft the manuscript. GH performed placenta collection, trophoblast primary cell cultures, RNA extraction and reverse transcription reactions. IM and LG were in charge of all experiments concerning cAMP, including design and analysis of the results. AH contributed in interpretation of data and was involved in drafting the manuscript. FL made substantial contribution to the design of the study, was involved in drafting the manuscript and revised it critically. AM performed the immunohistochemical studies and helped to draft the manuscript. LD conceived the study, participated in the design and coordination, structured the manuscript and actively participated in experimental procedures. All authors read and approved the final manuscript.
P = 0.02) of maternal effect. We conducted a genome-wide association analysis for height, testing both the direct effect of the focal individual's genotype and the indirect effect of the maternal genotype. Offspring height showed suggestive evidence of association with maternal genotype for two single-nucleotide polymorphisms in the trafficking protein particle complex 9 gene TRAPPC9 (NIBP), which plays a role in neuronal NF-κB signalling. This work establishes a methodological framework for identifying genetic variants that may influence the contribution of the maternal environment to offspring phenotypes.Many phenotypes may be influenced by the prenatal environment of the mother and/or maternal care, and these maternal effects may have a heritable component. We have implemented in the computer program SOLAR a variance components-based method for detecting indirect effects of maternal genotype on offspring phenotype. Of six phenotypes measured in three generations of the Framingham Heart Study, height showed the strongest evidence ( Much research has focused on the impact of measurable properties of the mother on subsequent phenotypes in their children 16 Framingham Heart Study (FHS) data release (Problem 2). All authors of this study are 'approved users' of these data per the NHLBI Data Use Certification of April 2008. Analysis of these data was approved by the Institutional Review Board of the University of Texas Health Science Center, San Antonio.Outlying phenotype measurements (more than four standard deviations from the mean) were removed from the lipid measures , 43 for triglyceride (TG)) on the assumption that these represented assay errors. The data were normal-quantile-transformed before analysis using the SOLAR "inormal" option to meet the distributional assumptions of the variance components and regression methods. The normal quantile transformation is robust to a range of departures from normality and also removed scale effects by standardizing the data. Transformations of this type are convenient for batch processing of multiple phenotypes .all SNPs for the non-genotyped implicit mothers of genotyped and phenotyped founders. These maternal genotypes entered the association analysis as properties of their offspring ; the 'virtual' mothers did not enter the analysis otherwise.Individuals with incomplete genotype data were given imputed genotype scores for the missing markers using the -- infer option in the computer program Merlin ,10 Merlii, j may be decomposed into additive genetic and environmental components in the usual way:We have implemented in SOLAR a general model for incorporating polygenic maternal effects -14. BrieI is an identity term , ϕ is a coefficient of coancestry, σz is the phenotypic covariance, and σ2e and σ2a are, respectively, environmental and additive genetic variances. The additive genetic covariance can be further decomposed to include maternal effects:where ϕ is the coancestry coefficient for i and the mother of j, and 2ϕ is the coancestry of the mothers. ρa, am is the additive genetic correlation between direct and maternal effects. Decomposition of the environmental component of Eq. 1 is modified from Eq. 14 of Bijma if i, j are siblings or half-siblings, ρmo ∈ if i, j are mother and offspring, or 0 otherwise. Our modification from Bijma [σ2mito; the mitochondrial variance component is structured by a matrix whose elements are 1 if i, j belong to the same matriline or 0 otherwise, as described by Czerwinski et al. [with om Bijma was thati et al. .Measured genotype analysis was conducted for each polymorphic SNP by including its genotype score as a covariate in the mixed model . Unlike 2, and their interactions were included as covariates in all models, and use of antihypertensive medication was a covariate for SBP and DBP. The use of an indicator variable-type covariate for medication has been questioned, especially with regard to BP [We tested our maternal random effects model on quantitative phenotypes , systolic blood pressure (SBP) and diastolic blood pressure (DBP), fasting total and HDL cholesterol and triglycerides) in individuals measured at exams when they were as similar as possible in mean age Table . Sex, agrd to BP ,18. In rrd to BP ; this diP = 0.02 at 4 degrees of freedom; 4 df is probably over-conservative [P = 0.008, 1 df), evidently capturing some of the maternal effects when these were not explicitly modeled.Table ervative ). IntereWe performed measured genotype (MG) tests of association for own genotype (OMG), maternal measured genotype (MMG), and conditional maternal measured genotype (CMMG), for 476,987 autosomal SNPs from the Affymetrix 500k panel. The saturated maternal effects model was used as the null for all analyses. No SNP gave significant evidence of own- or maternal-genotype association with height when corrected for multiple testing using a Bonferroni test . We did not attempt to account for any linkage disequilibrium among the SNPs in our sample. The SNPs with strongest evidence for OMG, MMG, and CMMG are listed in Table MPZL1 (OMIM #604376), a protein tyrosine phosphatase involved in cell proliferation and differentiation. Our next four highest 'hits' were in the mucolipin2 gene MCOLN2 on 1p22.Several recent studies have undertaken genome-wide association analysis of human height -22. ThesTRAPPC9 gene on chromosome 8 and an intergenic region on chromosome 18. The trafficking protein particle complex 9 gene TRAPPC9 (NIBP) plays a role in neuronal NF-κB signalling [Because the published genome-wide association study on height used unrelated individuals, none reported maternal effects. Interestingly, among our strongest maternal associations are repeated hits in two regions: the gnalling but has We have implemented combined random-effects, measured-genotype fixed effects approach for discovery of genetic variants contributing to the indirect effect of maternal genotype on offspring phenotype. We have identified two regions on chromosomes 2 and 8 - with suggestive association at two SNPs in each region - that may contribute to maternal effects on human height. The tools developed here should be of use for a variety of phenotypes and diseases for which an effect of maternal environment is known or suspected, including height, hypertension, birthweight, and the metabolic syndrome.BMI: Body mass index; CMMG: Conditional maternal measured genotype; DBP: Diastolic blood pressure; FHS: Framingham Heart Study; GAW16: Genetic Analysis Workshop 16; HDL: High-density lipoprotein; MG: Measured genotype; MMG: Maternal measured genotype; OMG: Own measured genotype; PG: Polygenic SBP: Systolic blood pressure; SNP: Single-nucleotide polymorphism; TG: Triglyceride.The authors declare that they have no competing interests.JB, LA, TDD, and JWK participated in the design of the study. TDD prepared the phenotype and genotype data for analysis. JWK and CPP implemented the maternal-effects analysis in SOLAR. JWK performed the analyses and drafted the manuscript.
Vitiligo, characterized by depigmented macules is a common disorder with a high psychosocial impact, particularly in darker skins. Surgical methods become important in cases where medical therapy fails to cause repigmentation or in cases of segmental vitiligo where the response to surgery is excellent. The basic principle of surgical treatment is autologous grafting of viable melanocytes from pigmented donor skin to recipient vitiliginous areas. Various grafting methods have been described including tissue grafts and cellular grafts. Stability of the disease is the most important criterion to obtain a successful outcome. Counseling of the patient regarding the outcome is vital before surgery. The technique and followup management of the tissue grafts has been described in detail in this review. Vitiligo is a common depigmenting disorder, characterized clinically by milky white macules and histologically by an absence of functional melanocytes in the affected area. It causes severe cosmetic distress, particularly in darkly pigmented skins and is also associated with a great social stigma. It has a profound psychological impact and greatly affects the quality of life. In additet al.,[in vitro cultures of melanocyte-bearing epidermis for the treatment of vitiligo. The use of epidermal suspensions obtained by trypsinization was first reported in 1992 by Gauthier and Surleve-Bazeille[et al.,[Skin grafting was first described in India in ancient Sanskrit texts around 2500 - 3000 BC as a technique for nasal reconstruction for mutilated noses. Thin split thickness skin grafts were first introduced in 1872 by Ollier in France, and later by Thiersch in Germany in 1874. Brown in England developed the electric dermatome in 1944, to harvest thin homogenous grafts. In 1947, Haxthausen transplanted thin split thickness skin grafts from normal to vitiliginous skin in three cases, to study the pathogenesis of the disease.2 Falabell-Bazeille utilizede[et al., reportedThe basic principle of surgical treatment in vitiligo is to achieve cosmetically acceptable repigmentation of the vitiliginous areas by transplantation of autologous melanocytes from the unaffected pigmented skin to the lesional skin. It cannot stop the progression of the disease, and is indicated for resistant stable vitiligo that does not show adequate response to medical therapy. Different surgical modalities are available and the choice of surgical treatment depends on the type of vitiligo, extent and site of the lesions, and the availability of equipment and expertise of the treating surgeon.et al.,[Stability of the disease process in vitiligo is the most important parameter to achieve a successful outcome in surgical treatment. Stability is defined as the absence of new lesions and absence of the spread of existing lesions for a defined period. However, there is no consensus on the period of stability, and it varies from 4 months to 2 years, according to different authors.– 15 A reet al., proposedet al.,[Njoo et al., proposedSurgery in vitiligo is indicated in patients with stable vitiligo not responding to medical treatment or causing severe psychosocial distress. It can also be performed in patients with leukoderma due to burns, piebaldism, inactive discoid lupus erythematosus, and other stable disease states causing permanent depigmentation.Vitiligo surgery is contraindicated in patients with active unstable vitiligo and in childhood vitiligo. In children, progress of the disease is difficult to predict and by and large they respond better to medical therapy as compared to adults. In addition, surgery has to be carried out under general anesthesia, which is another added risk factor in children.There are various surgical modalities to treat vitiligo, the goal being to achieve complete repigmentation; cosmetically matching the surrounding normal skin. The choice of surgical treatment depends on the extent of vitiligo, the sites involved, the availability of equipment, and the expertise of the surgeon. Various surgical methods including tissue grafts and cellular grafts are described in Mini punch grafting has been discussed in detail in a separate article.Suction blister grafting (SBG) is a technique where the pigmented epidermis is harvested from the donor site by using suction to raise a blister which is then transferred to the vitiliginous area.The differentiation and development of the epidermal cells is regulated by the dermis. In surgical techniques like split skin thickness grafting and punch grafting, where both the epidermis and dermis are grafted, the graft retains some of the characteristics of the donor site, hence, the cosmetic outcome may not be an exact match. However, in suction blister grafting, cleavage occurs between the basal cells and the basal lamina of the basement membrane zone and only the epidermal portion of the donor area is grafted. Hence, the graft generally acquires the characteristics of the recipient site, thus leading to a better color match and cosmetic outcome.The donor site can be anywhere from the flexor aspect of the arm or forearm, abdomen, or the anterolateral aspect of the thigh or leg. In a study by Laxmisha and Thappa, it was fAfter surgical cleansing, a topical local anesthetic may be applied as the procedure is painful. Some prefer injecting the area with local anesthetic with saline as it reduces blister induction time (BIT).Blisters may be raised using syringes or sucti®).Once the blisters are well formed, the roofs of the blisters are gently cut using iris scissors. Care should be taken to avoid touching the floor of the blisters as it causes pain. The roofs are inverted onto a glass slide such that the dermal side faces upwards. The graft is then cleaned and spread to its maximum size and kept moist with normal saline. The donor site is cleaned and bandaged using nonadherent dressing such as chlorhexidine gauze . There was no significant difference in repigmentation rates at different body sites.[In a meta-analysis, it was found that 87% of the patients achieved more than 75% repigmentation with SBG, which was similar to split thickness grafting (87%), but better than minigrafting (68%) and grafting of noncultured epidermal suspensions(31%). Segmentady sites.It is a safe, easy, and inexpensive method, with very good success rates. Repigmentation is faster and the color match is very good, especially over the lips, eyelids and areoIt is time consuming and the raising of blisters is painful. Larger areas require multiple sittings. Improper handling may lead to tearing of the graft or the epidermal side being grafted, causing failure of repigmentation.In this technique, thin split thickness skin grafts are harvested from the pigmented donor area and transplanted at the recipient sites as continuous sheets of tissue grafts.In the surgical treatment of vitiligo, thin split thickness grafts are used. There are three biological changes which follow skin grafting.There are two phases in this stage. In the first 72 hours of the placement of the graft adherence of the graft is due to fibrin bonding and the graft appears pink. Hence, these first 72 hours are most crucial for graft uptake and bleeding, infection, and mechanical movement due to improper immobilization of the area can lead to graft failure at this stage. Hence strict immobilization in the first three days is very essential. The second phase begins with the onset of vascular anastomosis and fibrovascular growth.In this stage there is a connection between the graft and host vessels, with the formation of new vascular channels. Insufficient vascular proliferation, development of a thick layer of fibrin or hematoma or seroma can lead to failure of graft uptake in this stage. Hence compression is useful.There is contracture of the graft when it is harvested because of the contraction of the elastin fibers. Contracture also occurs at the recipient site. These two factors lead to achromic fissures and perigraft halo. Overlapping of graft edges at the recipient site can prevent these complications.®, Toplap®) under occlusion, for at least two hours, can be used.[Though the gluteal area is a relatively difficult area to harvest, it is the most preferred site for cosmetic reasons, in case scarring occurs. However, the thigh can be used as a donor site by beginners and when larger areas of donor skin are required. The arms be used.The skin is stretched firmly at one end by an assistant with the flat of the hand or a wooden block and the other end is stretched by the operator. A thin even split thickness graft is harvested free hand using either a sterile razor blade mounted on a Kochers forceps or a blade holding instrument . Alterna® or Tegaderm 3M, St. Paul, Minn) and a pressure dressing is given. The dressing is left undisturbed for a week.The donor skin is kept in a sterile petri dish containing normal saline and the donor area is dressed with nonadherent dressing (Chlorhexidine dressing Bactigras2 laser. Kahn et al.,[2 laser and a dermabrader. The ultrapulse CO2 laser is preferred over the Er:YAG laser because it achieves better hemostasis and causes an epidermal - dermal split at a single pass.[E. coli.[The recipient area is anesthetized by using either a topical anesthetic cream applied under occlusion 2 to 3 hours before the procedure by the patient, or infiltration anesthesia using 1% lignocaine without adrenaline is administered. For larger areas, general anesthesia is usually required. Preoperative medication, diazepam, 10mg orally at night and 2 hours before the operation relieves anxiety and may be given in anxious patients. After surgical cleansing, the vitiliginous area is first marked with a surgical pen and abraded by dermabrasion with a diamond fraise attached to an electric high-speed dermabrader at 10,000 rpm till pinpoint bleeding is seen. The recipient site can also be prepared using a pulsed Erbium-YAG laser or ultrapulse COn et al., reportedgle pass. Manual dgle pass.. The adh[E. coli. In a stu[E. coli. It is beThe first dressing is preferably changed at 24 hours, to observe for any serous collection or hematoma under the graft, which can be drained. Subsequently, the dressing is changed after 1 week by which time healing is almost complete. Prophylactic oral antibiotics are given for one week to prevent postoperative infection.If there is perigraft depigmentation or achromic fissures, NB- UVB is required postoperatively for complete repigmentation.Thin split thickness skin grafting is the most successful technique among all the surgical methods, with a success rate of 78 - 91%.Hyperpigmentation is the commonest complication in dark skinned patients and takes a long time to resolve.39 PeriphThe advantages of split thickness skin grafting are that pigmentation can instantly cover larger areas over a short period of time as compared to other techniques. Difficult areas such as eyelids, inner canthus of eyes, areola, nipples, and genitals can be treated readily. Pigmentation achieved is uniform and cobblestoning that is common with punch grafting is not seen. Repigmentation of leukotrichia is also possible. In addit2 laser to prepare the recipient areas reduces blood splatter as compared to dermabrasion and are further advances in the technique.Prolonged hyperpigmentation is commonly seen, particularly on the exposed areas in dark-skinned patients. Large areas require multiple sittings due to limitation of the donor site. Surgical skill is required to take thin even grafts free-hand. However, the recent use of electric dermatomes has made it easier to harvest uniform ultrathin grafts. In addition, the use of Er:YAG or COCertain precautions and modification of techniques can optimize results at sites that are difficult to treat.While grafting the upper eyelid the thinnest graft should be selected. If the area is small, a suction blister graft is ideal. When almost the entire eyelid is involved, thin or ultrathin split thickness skin grafts give optimum results. Strict immobilization for the first 72 hours by application of cyanoacrylate adhesive and pressure bandage is essential for graft uptake.Suction blister grafts for small areas and thin split thickness grafts for larger areas, give a good cosmetic outcome on the lips Figures and 8.4The entire areola should be grafted in order to maintain a uniform color and 10.The fingers, toes, palms and soles are the most difficult areas to treat and results are not always successful. The possible explanations are absence of hair follicles and thicker epidermis, leading to inadequate dermabrasion and preparation of a good vascular bed. These sites are also more prone to friction and trauma, thus Koebnerization is common. Mini punIt is essential to rule out a history of genital herpes, before attempting surgical treatment. It can be a cause of recurrence at the treated site and failure of surgical procedure. Long-term prophylaxis with acyclovir should be given in proven and doubtful cases and the prognosis clearly explained. Suction blister grafts, thin split thickness skin grafts, mini punch grafts and noncultured melanocyte suspensions have beeThe hair should not be shaved but plucked out before grafting to delay hair regrowth and lifting up of the graft. Alternatively, a chemical depilatory may be used.Mesh grafting is a technique where the graft is expanded by making slits in it such that it appears like a mesh. The advantage of this technique is that it allows coverage of large body surface areas with a smaller graft.The donor site is cleaned and a split thickness graft of 0.0252 inch thickness is obtained either manually or by using a Padgett or Duvals dermatome. The graft is then meshed in an Ampligreffe or Discard-A-pad into anyThe dressing at the recipient site is removed after a week. Phototherapy is started immediately or after a week.The meshing of the graft allows larger areas to be covered due to graft expansion. It also allows coverage of areas with variable contours, where a sheet might not adhere well.There is risk of scarring at the donor site. If the graft is thick, then it might lead to beading at the margin. Cosmetic results are inferior as compared to other methods.Flip-top technique is a method in which the graft is placed between a flap of epidermis and dermis at the recipient site.A thin split thickness graft is harvested from either the medical aspect of the upper arm or lateral aspect of the thigh, by using a sterile blade. The grafts are kept moist in saline-soaked gauzes. The recipient site is cleaned and similarly a flap of the epidermis is raised using a sterile blade. One end of the epidermis is left in contact with the dermis and the flap is turned to expose the dermis. The graft is placed with the dermal side of the graft in contact with the dermis and the flap is put back in position to cover the graft. Cyanoacrylate glue is used to secure the graft and the flap. Both the donor and recipient areas are dressed.The dressing is removed after a week and graft uptake is checked. The patient is started on phototherapy thereafter.The flap of epidermis acts as a biological dressing. Chances of the graft falling off and secondary infection are less in this procedure. It is inexpensive, easy to perform, and a quick method.Like all dermoepidermal grafts, skill is required to harvest a thin graft or there is beading at the margins.It has been long considered that repigmentation in vitiligo occurs from the melanocytes in the hair follicle. Hence, hair transplantation in vitiligo patches has been seen to cause repigmentation. Also, tissue grafting leads to repigmentation of the skin, but very rarely of the leucotrichia. Hence, on hair-bearing areas like the eyebrows, scalp, eyelashes, transplantation of hair follicles is required.A strip of hair is removed from the occipital area of the scalp and cut into smaller pieces, each containing a single hair follicle unit. The hair is then transplanted onto the vitiligo patch. The recipient site is dressed. After a week, the dressing is removed and checked for graft uptake. The patient is started on phototherapy.It is a good technique for management of leucotrichia. There is no cobblestoning and the color match is good.It is a cumbersome procedure requiring expertise and time. Scarring occurs at the occipital area from where the graft is taken.Vitiligo, characterized by depigmented macules is a common disorder with a high psychosocial impact. Surgical treatment is indicated in resistant stable vitiligo that does not show adequate response to medical therapy. Stability of the disease process is the most important parameter to achieve a successful outcome. Conventional surgical modalities are tissue grafts such as punch grafting, suction blister grafting and split thickness skin grafts. The choice of surgical treatment depends on type of vitiligo, extent and site of lesions, availability of equipment and expertise of the treating surgeon. Split thickness skin grafting is the most successful out of all tissue grafting methods. Recent advances include autologous non-cultured epidermal cell suspensions and cultured melanocyte suspensions or sheets. Hence though surgical treatment of vitiligo is evolving over the years, the basic etiopathogenetic mechanisms need to be elucidated to achieve long term successful results.
Secondary cicatricial alopecia occurs as a result of destruction of hair follicles by scar tissue formed in the scalp and eyebrows. It is a permanent condition and regrowth of hairs in the area is not expected. The purpose of the study was to select the appropriate method for treating cicatricial alopecia. 24 patients were admitted to our hospital during the period from June 2006 to July 2007. They were suffering from acquired cicatricial alopecia affecting the scalp and the eyebrow. Their ages ranged from 6-48 years with mean age 26-25 years. They were treated surgically by total excision of the lesions with direct closure of the defect in ten cases, excision of alopecia with advancement flaps with the aid of scalp expanders in seven cases, scalp reduction through serial excision of alopecia in three cases and excision of alopecia and reconstruction of the defect by strip composite hair-bearing scalp grafts in four cases. Our results suggest there are three key factors that decide the surgical methods for treating alopecia: size, location and shape. We also discuss and evaluate the various techniques of reconstruction. Good results were obtained in 18 patients. The scalp is probably the second most visible part of the human anatomy second only to the face. Aesthetic considerations are extremely important in devising any plan for the restitution of the scalp. The eyeb2 with mean size11.35 cm2.24 patients were admitted to our hospital suffering from acquired cicatricial alopecia affecting the scalp and the eyebrow, during the period June 2006 to July 2007. Their ages ranged from 6-48 years with mean age 26.25 years. There were 14 males and 10 females and the interval from the initial injury to the time of reconstruction was between one and seven years. The lesions involved more than 30% of the scalp or the entire eyebrow length. The size of alopecia ranged from 2.5 to 25 cmThe causes of alopecia were postburn injury (15 cases), to mechanical trauma (5 cases) and pyogenic infection (4 cases).Management of patients included evaluation of their medical conditions, defect analysis and assessment of surgical options. Skin biopsy was done to confirm the scarring process.The patients were classified according to the method of covering the defect after excision of the alopecia into:-Group 1: Total excision of the lesions with direct closure of the defect (six cases) [x cases) .Group 2: Excision of alopecia and closure of the defect by rotation flap (three cases).Group 3: Excision of alopecia and closure of the defect with advancement flaps with the aid of scalp expanders (five cases) [e cases) .Group 4: Scalp reduction through serial excision of alopecia (three cases).Group 5: Excision of alopecia and reconstruction using composite hair-bearing scalp strip graf ts (seven cases) [n cases) .Technique: All operations were done under general anesthesia. After sterilization of the area with 10% povidone iodine, infiltration with a local anesthetic was done to minimize the blood loss. The lesions were totally excised as in groups 1, 2 and 5 but in group 3, insertion of expander was done in the first sitting and once the desired expansion was achieved the alopecia was excised and the raw area was covered by a flap harvested from the expanded skin in the second stage. In group 4, serial excisions from the periphery of the lesion were done. Coverage of the defect thus was achieved by either direct approximation of two edges, or advancement flap with the aid of scalp expanders, or strip composite hair-bearing scalp grafts from the lower occipital and parietal areas of the scalp or scalp reduction through serial excision depending on the size of the defect and its location.rd postoperative day.In reconstructing the eye brow defect by strip graft the hairs were oriented to grow upward and outward, as in a normal eyebrow. The skinCriteria of evaluation was surgeon's satisfaction, patient's satisfaction, and the presence or absence of complications.Patients have been followed up for six months. The morning after the surgery, dressings were removed and the surgical site was cleansed gently with saline solution. Most patients healed and shed the scabs in 7-14 days. In group 5, there was an initial false growth of hair for approximately three to four weeks, subsequently those hairs shed and there was no growth of hair up to two to three months. Thereafter the hairs reappeared and significant growth of hair was noted at six month after surgery. In group 1 widening of suture line after total excision with direct closure was noted in one case and accepted by the patient.Group1: Total excision of the lesions with direct closure of the defect (six cases). Figure and bGroup 2: Excision of alopecia and closure of the defect by rotation flap (three cases). In this group necrosis of tip of the flap occurred in one case.Group 3: Excision of alopecia and closure of the defect with advancement flaps with the aid of scalp expanders (five cases) Figure and 2b. Group 4: Scalp reduction through serial excision of alopecia (three cases).Group 5: Excision of alopecia then reconstruction of the defect by strip composite hair-bearing scalp grafts (seven cases) Figure and b. IComposite hair-bearing scalp grafting has proved to be an ingenious procedure for surgeon and patient alike because of its simplicity and versatility. Dardour Scalping flaps are used for large defects not amenable to other forms of surgical treatment. However, they are often associated with long unsightly scars, unappealing skin grafts at donor sites and decreased sensation within the flaps. The disaScalp reduction is indicated for complete or partial elimination of alopecia on the vertex of the scalp.Tissue expansion is an important tool for providing donor skin that is an optimal match in terms of skin colour, texture and hair-bearing characteristics. This is achieved by recruiting local tissue, with primary closure at the donor site and minimal morbidity. In largeet al, who observed that despite attempts to minimize complications and potential implant exposures the incidence of these complications remained high.[In our study, the complication rate for tissue expansion was 60%. This agrees with Pandya ned high.Tissue expansion too has the disadvantage of being a two-stage procedure, multiple visits to the surgeon for repeated injections into the expander, infections, risk of skin necrosis and exposure of the expander. The cost of the expander and cost of commuting to the hospital several times should also be remembered while recommending tissue expansion. In addition, expanders cause an inelastic subdermal fibrous scar.Exposure of expanders may occur early in the course of expansion through a suture line or a preexisting scar, or occur late in the course of expansion. ExposureLeonard and Small, used the largest expander that could be accommodated. However 1Implant failure is relatively uncommon in experienced hands. We have seen leakage due to a puncture in the expander dome itself. Difficulty during expansion can occur if there is a problem in locating the expander valve. Tissue expansion can produce excellent results where indicated, but should be used as an adjunct to, and not a substitute for other reconstructive procedures.There are five factors to consider when planning a tissue expansion strategy: (1) the dimensions of tissue to be replaced, (2) proper expander selection, i.e. how big or which type, (3) incision type and placement for expander insertion, (4) the number of expanders to be used, and (5) the schedule for saline injections. Careful planning is necessary to expand tissue in the required direction and dimension to obtain excellent results. On the other hand, few complications are actually encountered during the expansion process itself and there is a lower rate of associated complications following reconstruction. Exposure of the tissue expander is one typical complication encountered using this method in our series. Pressure seems to be the cause of such expander exposure. In our sNo better substitute for scalp tissue exists than scalp tissue itself. Tailoring the right procedure for the right patient is necessary for scalp coverage either with flap or skin expansion techniques.
Artemisinin combination therapy has become the standard of care for uncomplicated malaria in most of Africa. However, there is limited data on the safety and tolerability of these drugs, especially in young children and patients co-infected with HIV.A longitudinal, randomized controlled trial was conducted in a cohort of HIV-infected and uninfected children aged 4-22 months in Tororo, Uganda. Participants were randomized to treatment with artemether-lumefantrine (AL) or dihydroartemisinin-piperaquine (DP) upon diagnosis of their first episode of uncomplicated malaria and received the same regimen for all subsequent episodes. Participants were actively monitored for adverse events for 28 days and then passively for up to 63 days after treatment. This study was registered in ClinicalTrials.gov (registration # NCT00527800).A total of 122 children were randomized to AL and 124 to DP, resulting in 412 and 425 treatments, respectively. Most adverse events were rare, with only cough, diarrhoea, vomiting, and anaemia occurring in more than 1% of treatments. There were no differences in the risk of these events between treatment groups. Younger age was associated with an increased risk of diarrhoea in both the AL and DP treatment arms. Retreatment for malaria within 17-28 days was associated with an increased risk of vomiting in the DP treatment arm . There was no increase in the risk of diarrhoea or vomiting for children who were HIV-infected or on concomitant therapy with antiretrovirals or trimethoprim-sulphamethoxazole prophylaxis.Both AL and DP were safe and well tolerated for the treatment of uncomplicated malaria in young HIV-infected and uninfected children.http://clinicaltrials.gov/ct2/show/NCT00527800ClinicalTrials.gov: NCT00527800; Guidelines for the treatment of uncomplicated malaria in Africa have recently undergone a paradigm shift away from inexpensive monotherapies, such as chloroquine and sulphadoxine-pyrimethamine, to artemisinin-based combination therapies (ACT). Two of the most important artemisinin-based combinations for use in Africa are artemether-lumefantrine (AL) and dihydroartemisinin-piperaquine (DP). AL has been shown to be highly efficacious and well tolerated, and has become the most widely recommended first-line regimen in Africa ,2. DP, aThere are a number of methodological challenges in evaluating the safety of anti-malarial drugs, such as establishing causality between drugs and adverse events in the setting of malaria. The World Health Organization (WHO) has established guidelines for evaluating the efficacy of anti-malarial drugs, but no similar guidelines exist for safety monitoring -10. A laResults of a study comparing the efficacy AL and DP for the treatment of uncomplicated malaria using a longitudinal study design in a cohort of young children living in an area of very high malaria transmission intensity in Uganda were recently published . This coThis study was conducted in Tororo, a rural district in southeast Uganda, where malaria is holoendemic . ParticiDetails of the study procedures have been published previously and are summarized here . Study p®, Novartis, 20 mg artemether/120 mg lumefantrine tablets), administered as one (5-14 kg) or two (15-24 kg) tablets given twice daily for three days; DP , targeting a total dose of 6.4 and 51.2 mg/kg of dihydroartemisinin and piperaquine, respectively, given in three equally divided daily doses to the nearest 1/4 tablet.Study drugs were administered according to weight-based guidelines for fractions of tablets as follows: AL guidelines and gradOn the day that treatment was initiated (day 0), a baseline assessment was conducted, consisting of a standardized history and physical examination and haemoglobin measurement using a portable spectrophotometer . Active surveillance for adverse events following therapy consisted of assessment on days 1, 2, 3, 7, 14, 21, 28 and any other day they felt ill. Haemoglobin measurements were repeated on day 28 or earlier if severe anaemia was suspected. At each follow-up visit, adverse events were identified by evaluating for any new or worsening symptoms, physical exam findings, or haemoglobin values, as compared to the day 0 baseline assessment. Participants with abnormalities present on day 0 were not classified as experiencing an adverse event unless the symptom worsened from baseline, or resolved and then recurred. Following the initial 28-day active surveillance period, participants were asked to return to the clinic only when they desired medical attention. Passive surveillance for adverse events continued until the participant was re-treated with study drugs (at which time a new cycle of adverse event assessment began), the end of the study period (September 2008), or withdrawal from the study.Data were double entered into Microsoft Access and analysed using Stata version 10 . Data were evaluated with an intention-to-treat analysis including all episodes of uncomplicated malaria in children who were assigned treatment with study drugs through September 2008. The cumulative risks of the first occurrence of individual adverse events following the initiation of study drug therapy were estimated using the Kaplan-Meier product limit formula. Participants were censored on the day prior to repeat therapy with study drugs to remove the potential confounding effect of recurrent malaria, which can mimic adverse events . CumulatMultivariate Cox proportional hazards models were used to measure the associations between the following covariates and the risk of common adverse events after 28 days of follow-up, adjusting for repeated measures in the same patient: 1) age, 2) duration since last treatment with study drugs, and 3) combination of HIV status, concomitant TS use and ARV use. Comparisons of adverse events due to anaemia after 28 days of follow-up were modeled with a binomial distribution using generalized estimating equations, adjusting for repeated measures in the same study participant with exchangeable correlation and robust standard errors. A p-value < 0.05 was considered statistically significant.A total of 351 children were enrolled in the cohort study, of which 246 (70%) had at least one episode of uncomplicated malaria and were randomized to study drugs. A total of 122 children were randomized to AL resulting in 412 treatments and 124 children were randomized to DP resulting in 425 treatments occurred in less than 1% of study drug treatments, and 3 were frequent enough for comparative analyses. Considering 63 days of follow-up among all 837 treatments with study drugs; 415 adverse events due to cough (373 mild and 42 moderate severity), 179 adverse events due to diarrhoea , and 56 adverse events due to vomiting were reported. Any adverse event due to cough, diarrhoea, or vomiting occurred in 296 of 412 (72%) treatments with AL and 313 of 425 (74%) treatments with DP. Comparisons of the risks for the three most common adverse events between the AL and DP treatment arms after 1-3, 4-28, and 29-63 days of follow-up are presented in Table Non-treatment related risk factors for diarrhoea and vomiting over 28 days of follow-up stratified by treatment group were identified using multivariate analysis Table . Risk faAmong 837 treatments with study drugs, 107 (13%) repeat haemoglobin measurements were made on the day of recurrent malaria and 8 (1%) had missing repeat haemoglobin measurements and were not included in the analysis of adverse events due to anaemia. There was no significant difference in the risks of adverse events due to anaemia in the AL and DP treatment arms .Serious adverse events were rare. Out of 837 total treatments with study drugs, there were only 5 serious adverse events (two in the AL group and three in the DP group) and all were due to the development of severe anaemia, which was likely a consequence of malaria and not the study drugs. Of note, one patient developed severe anaemia twice following treatment with DP. This patient was removed from the study protocol because of initial concerns about a causal relationship between DP and severe anaemia. However, the patient developed a subsequent episode of malaria off-protocol that was treated with AL, and again developed severe anaemia, which resulted in his death. A blood sample taken during the anemic episode in the month prior to his death was direct Coombs test positive, indicative of immune-mediated haemolytic anaemia. Post-mortem this male child was found to be hemizygous for the G202A mutation, the predominant East African allele of glucose-6-phosphate dehydrogenase deficiency.Results from this longitudinal randomized clinical trial suggest that both AL and DP are safe for treating uncomplicated malaria in young HIV-infected and uninfected infants and children. Adverse events were uncommon and generally of mild severity, with only cough, diarrhoea, vomiting, and anaemia occurring in more than 1% of treatments with study drugs. There were no significant differences in adverse events between the two treatment arms, although recent treatment with DP was associated with an increased risk of vomiting. Concomitant use of TS and ARVs were not associated with an increased risk of common adverse events.This study contributes to a body of literature suggesting that AL and DP are both safe and well tolerated across a wide range of epidemiological settings. AL has been extensively studied in clinical trials primarily from Asia and Africa, and was added to the WHO Essential Medicines List in 2002. A review of AL safety and tolerability in 1,869 patients (33% children) from Asia reported gastro-intestinal complaints , headache, and dizziness as the most commonly reported adverse events . SeveralThis study addresses some of the limitations from previously published studies on the safety and tolerability of AL and DP. First there is limited data on the safety of these drugs in children under 12 months of age, an important population in Africa. Study participants initiated ACT therapy at four months of age and over 50% of the treatments given for uncomplicated malaria were in children younger than 12 months. Both medications were well tolerated by infants, with diarrhoea the only adverse event associated with this younger age group, independent of the treatment given. Second, most anti-malarial clinical trials are limited to single episodes of uncomplicated malaria in the same patient, which precludes the ability to analyse the effect of repeated treatments. The longitudinal design used in this study allowed for the follow-up of children for up to one year, and observe the effects of repeated treatments of ACT drugs. Repeated therapy was found to be generally safe and well tolerated with the exception of a significantly higher risk of vomiting following repeat treatment with DP within 2-4 weeks of a previous dose. Although the extended half-life of piperaquine providesThere were several limitations to this study. Firstly, although every effort was made to apply standardized definitions for adverse events, treatment assignment was not blinded and results were limited by largely subjective reports of symptoms from parents or guardians. Secondly, only haemoglobin levels were regularly measured during the period of malaria follow-up, preventing the detection other laboratory associated adverse events. Finally, this study was not powered to specifically test for hypothesis of differences in the risk of adverse events between the various subgroups. Therefore, the possibility of type II errors cannot be ruled out, especially in those subgroups with small samples sizes such as HIV-infected children taking ARVs.In summary, both AL and DP were safe and well tolerated for the treatment of uncomplicated malaria in a cohort of children uniquely characterized by their young age, repeated therapy, and the inclusion of HIV-exposed and HIV-infected patients. However, the occurrence of haemolytic anaemia leading to death in a G6PD deficient patient highlights the importance of monitoring for rare, but serious adverse events. As the use of ACT is scaled up in Africa, continued evaluation of the safety and tolerability of these drugs in diverse patient populations is essential.The authors declare that they have no competing interests.GD and EA supervised the clinical studies. SK and GD analysed the data. All authors contributed to the drafting of the manuscript.
The complex displays numerous intermolecular π–π interactions between adjacent six-membered rings, the shortest centroid–centroid distance being 3.680 (4) Å. The nearly planar [maximum deviation 0.143 (2) Å] molecules stack in columns parallel to (101) with a Pd⋯Pd distance of 4.8466 (9) Å.In the title complex, [PdBr X 2(phen)] complexes , see: Cheng et al. (19772(phen)] which is isotypic to the title complex, see: Grzesiak & Matzger (2007X 2(bipy)] , see: Maekawa et al. ] = 0.045 wR(F 2) = 0.091 S = 1.00 2933 reflections154 parametersH-atom parameters constrainedmax = 1.37 e Å−3 Δρmin = −1.54 e Å−3 Δρ SMART used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008ORTEP-3 (Farrugia, 1997PLATON (Spek, 2009SHELXL97.Data collection: 10.1107/S160053680905168X/xu2703sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S160053680905168X/xu2703Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:
A recent and provocative meta-analysis, based on few outcome events, suggested that rosiglitazone increased cardiovascular mortality and myocardial infarction. However, results of meta-analyses of trials with sparse events, often performed when examining uncommon adverse effects due to common therapies, can vary substantially depending on methodologic decisions. The objective of this study was to assess the robustness of the rosiglitazone results by using alternative reasonable methodologic approaches and by analyzing additional related outcomes.In duplicate and independently, we abstracted all myocardial and cerebrovascular ischemic events from all randomized controlled trials listed on the manufacturer's web site meeting inclusion criteria of the original meta-analysis (at least 24 weeks of rosiglitazone exposure in the intervention group and any control group without rosiglitazone). We performed meta-analyses of these data under different methodologic conditions. An unconfounded comparison that includes only trials in which medications apart from rosiglitazone are identical suggests higher risks than previously reported, making even the risk of cardiovascular death statistically significant. Alternatively, meta-analysis that includes all trials comparing a treatment arm receiving rosiglitazone to any control arm without rosiglitazone but also including trials with no events in both the rosiglitazone and control arms , shows adverse but non-statistically significant effects of rosiglitazone on myocardial infarction and cardiovascular mortality. Rosiglitazone appears to have inconsistent effects on a wider range of cardiovascular outcomes. It increases the risk of a broad range of myocardial ischemic events . However, its effect on cerebrovascular ischemic events suggests benefit, although far from statistically significant.We have shown that alternative reasonable methodological approaches to the rosiglitazone meta-analysis can yield increased or decreased risks that are either statistically significant or not significant at the p = 0.05 level for both myocardial infarction and cardiovascular death. Completion of ongoing trials may help to generate more accurate estimates of rosiglitazone's effect on cardiovascular outcomes. However, given that almost all point estimates suggest harm rather than benefit and the availability of alternative agents, the use of rosiglitazone may greatly decline prior to more definitive safety data being generated. A recent and provMeta-analysts and otheAll randomized controlled trials on the manufacturer's website meeting From each included trial, we abstracted data on the outcomes of myocardial infarction and cardiovascular death. For the outcome of myocardial ischemia, we included all the following events : myocardial infarction (154 patients), myocardial ischemia (301 patients), new angina (44 patients), angina (36 patients), aggravated angina (19 patients), unstable angina (8 patients), cardiac chest pain (1 patient), coronary artery insufficiency (2 patients), revascularization (62 patients), coronary thrombosis (6 patients), coronary artery stenosis (2 patients), coronary artery occlusion (2 patients), coronary artery disorder (15 patients), coronary artery disease (7 patients), coronary artery atherosclerosis (2 patients), coronary artery spasm (1 patient), and three vessel disease (1 patient). For the outcome of cerebrovascular event we included all the following events : stroke (64 patients), cerebrovascular accident (5 patients), cerebral infarction (1 patient), cerebral embolism (1 patient), cerebrovascular disorder (43 patients), transient ischemic attack (31 patients), cerebral ischemia (1 patient), vestibulobasilar insufficiency (1 patient), and carotid stenosis (2 patients). For both myocardial ischemia and cerebrovascular events, trials did not specify which patients had more than one event among those listed above. Therefore, if a trial reported outcome events in more than one category, in our primary analysis we assumed that the number of patients with an event was equal to the maximum number of patients in any one category. In a sensitivity analysis we used the least conservative approach and assumed that each adverse event occurred in a different patient; our results did not change.Interim data for RECORD, which was not included in the manufacturer's website , was obt]).Binary effect measure meta-analyses were carried out using standard equations and confirmed with Review Manager 4.2 where possible. Odds ratios derived using exact statistical methods were calculated with StatXact 8 and odds ratios derived using Bayesian methods were calculated with WinBUGS 1.4.1 [available at The original meta-analysis includedno statistically significant effects, with most p-values ≥ 0.10 . Simulation studies ,12 have Regardless of the specific form of odds ratio, however, this effect measure forces the exclusion of studies with zero events in both the intervention and control arms . This ocThe inclusion of such zero total event trials would move effect estimates closer to nil. In principle, including such trials is possible for any effect measure , but staall events resulting from myocardial ischemia. Doing so and using the same statistical methods also suggests increased risk as seen in our rigorous meta-analysis of long term trials with rosiglitazone, which showed that rosiglitazone is associated with increased ischemic risk with long term use in patients with type 2 diabetes as compared to alternative therapies [This report by Friedrich herapies .However, there are several challenges in measuring rare but important adverse effects in randomized trials because of incomplete reporting of outcomes and inconsistent definitions. The short term trials may be inadequately powered to detect long term adverse effects, and hence we focused on the long term trials. We used the latest version of the published data, and consistently extracted similar categories of events such as those requiring hospitalization or classified as serious adverse events, irrespective of whether adjudicated or not because different trials may have different ways of adjudication . The useThe inclusion of zero event trials as done by the authors of this article is problematic as it is unclear if no events were reported or whether events did not occur. Several of these problems can be fixed by consistent reporting of outcomes of all trials and methodological consensus on how best to conduct meta-analysis on sparse events.However the authors overemphasize the precise estimate of the RRs and the corresponding P values, which are likely to vary given the different inclusion and exclusion criteria. More important than the absolute precisions of risk, the consistency of effects across comparisons suggests a higher cardiovascular risk with rosiglitazone compared to placebo or active controls, despite the modest benefit in glycemic control seen with rosiglitazone. Finally observational studies have also proved to be useful and shown similar increased cardiovascular risk with rosiglitazone ,24." rosiglitazone be avoided in the treatment of type 2 diabetes [rd of deaths are due to cardiovascular death, should at the minimum be cardiac neutral, which is not the case with rosiglitazone which raises the risk of cardiovascular adverse effects no matter what methodology is used.Hence accurate estimates of cardiac risk on ongoing trials are unlikely to change this general scientific consensus recommendations by the American Diabetes Association that diabetes . Infact,diabetes ,27. UnfoCompeting interests: None
The Ni atom is five-coordinated in a square-pyramidal geometry, with two imine N and two phenolate O atoms of the Schiff base ligand in the square plane, and the water O atom in the axial position. In the crystal, the molecules are linked via intermolecular O—H⋯O hydrogen bonds, forming chains along the a axis.The title mononuclear nickel(II) complex, [Ni(C DOI: 10.1107/S1600536809039129/sj2661Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:
The results indicate that these compounds may have value in the therapy of human diseases where these inflammatory cytokines have a central role in pathogenesis.Synthesis of IL-1β and TNFα by human monocytesmacrophages was significantly inhibited by eleven bisbenzylisoquinolines and one half-molecule (benzylisoquinoline), with IC
To develop public health adaptation strategies and to project the impacts of climate change on human health, indicators of vulnerability and preparedness along with accurate surveillance data on climate-sensitive health outcomes are needed. We researched and developed environmental health indicators for inputs into human health vulnerability assessments for climate change and to propose public health preventative actions.We conducted a review of the scientific literature to identify outcomes and actions that were related to climate change. Data sources included governmental and nongovernmental agencies and the published literature.Sources were identified and assessed for completeness, usability, and accuracy. Priority was then given to identifying longitudinal data sets that were applicable at the state and community level.We present a list of surveillance indicators for practitioners and policy makers that include climate-sensitive health outcomes and environmental and vulnerability indicators, as well as mitigation, adaptation, and policy indicators of climate change.A review of environmental health indicators for climate change shows that data exist for many of these measures, but more evaluation of their sensitivity and usefulness is needed. Further attention is necessary to increase data quality and availability and to develop new surveillance databases, especially for climate-sensitive morbidity. The Intergovernmental Panel on Climate Change (IPCC) projected that changes in temperature, precipitation, and other weather variables due to climate change “are likely to affect the health status of millions of people, particularly those with low adaptive capacity” and statUnfortunately, because of previous substantial emissions, even the most optimistic reduction scenarios project that over the next few decades substantial increases in temperature and other weather changes will occur that will have large impacts on public health. For example, climate models predict that the world is expected to warm 0.5–1.0°C over the next several decades due to past emissions alone . Under tTo develop public health adaptation strategies, evaluate their success, and project the impacts of climate change on human health, indicators of vulnerability and preparedness, along with accurate surveillance data on climate-sensitive health outcomes, are urgently needed. These outcomes are important for assessing human health vulnerability to climate change , for devThe Council of State and Territorial Epidemiologists (CSTE), a U.S. professional association of public health epidemiologists, established the State Environmental Health Indicators Collaborative (SEHIC) in 2004. SEHIC comprises a group of state-level environmental health practitioners interested in developing environmental public health indicators for use within environmental health surveillance and practice. The SEHIC first focused on developing indicators for air quality, asthma, and drinking water. Last year, it established a workgroup on climate change. This article presents the initial findings of that workgroup.Indicators are quantitative summary measures that can be used to track changes in conditions by person, place, and time. The purpose of environmental health indicators as established by the SEHIC is to describe elements of environmental sources, hazards, exposures, health effects, and intervention and prevention activities. Indicators can be used to assess positive and negative environmental determinants of health in order to identify areas for intervention and prevention and to evaluate the outcomes of specific policies or programs aimed at improving public health. Thus, indicators serve as important communication tools for making environmental health information available to stakeholders, including environmental health practitioners, partners, policy makers, and the general public.Aedes aegypti mosquitoes, the vector for dengue fever, because human cases of this tropical disease are increasingly found in more northern latitudes in 2005, up 16% from 1990 (3) (3 concentrations are estimated to increase 5–10% in the United States between now and the 2050s (and possibly 2.5–5% by 2030) because of climate change, if anthropogenic emissions and global background concentrations are held constant , total U.S. GHGEs were 7,260 teragrams of COrom 1990 . Increas1990 (3) ; projectconstant .3 production and will increase in frequency as weather conditions favorable to heat waves increase (2) by economic sector are easily obtainable by state from the We recommend that GHGE and air mass stagnation events be tracked as indicators of air quality changes associated with climate variability. GHGEs are important indicators because they increase climate change and affect public health through direct effects such as heat waves, and through indirect effects such as increased growth of plant biomass that affects allergic airway disease. Air mass stagnation events, which increase Oincrease , are anoincrease , and alt3 levels themselves are expected to increase, it will be difficult to determine which proportion of increase of O3 is attributable to elevated warming from climate change and which is due to anthropogenic sources, such as population and industrial growth with concomitant emissions from mobile and stationary sources. Modeling is needed to determine the temporal increase in O3, after controlling for industrial and population growth and any increase in pollution controls.Although OAlong with higher temperatures, the IPCC has noted that surface specific humidity has generally increased globally after 1976 . Both hiWe recommend the following indicators to track for temperature: maximum temperature, minimum temperatures, and apparent temperature. Apparent temperature, or the use of a heat index, which combines humidity and temperature, is important in looking at mortality effects , and hum2 levels have been shown in laboratory and field studies to increase plant biomass and to raise the pollen production of ragweed . Geographic areas with high levels of O3 and pollen from ragweed could cause cumulative impacts on populations; one report estimated that as many as 131 million Americans currently live in such areas (Increasing CO ragweed . For exach areas .We recommend the following indicators: pollen loads (if available or through modeling) and the presence of ragweed. Routine data for pollen loads are collected by the National Allergy Bureau (NAB). However, the spatial coverage of the monitoring stations is sparse. To obtain more complete coverage of pollen levels for the United States, either modeling or the use of satellite imagery to generate detailed land use coverage (to project the distribution of ragweed) would be necessary. However, more complete coverage via remote sensing would not provide real-time airborne pollen data, so it would be preferable to increase the number of pollen-monitoring stations.The presence of ragweed by county is available through the U.S. Department of Agriculture (USDA) Natural Resources Conservation Service PLANTS database and the 3 concentrations , which could increase the potential for wildfires , the Palmer Drought Severity Index, and the surface water supply index (SWSI) . The NDM3/person) and water stress as indicators.To assess the impact of drought on human populations, A worldwide increase in cyanobacterial sources has been observed in both coastal and freshwaters . These hPotential indicators include shellfish poisoning and blue-green algae and red tide outbreaks. Outbreaks of shellfish poisonings and red tides in the ocean could be monitored, along with blue-green algae outbreaks in freshwater. Shellfish poisoning outbreaks in humans, however, are typically underreported and often misdiagnosed. The National Oceanic and Atmospheric Administration (NOAA) maintains a Harmful Algae Bloom Forecasting System that traThe IPCC projects with “virtual certainty” that climate change will cause more frequent, more intense, and longer heat waves. It also notes with “medium confidence” that the number of heat wave deaths will increase . All heaWe recommend indicators for mortality and morbidity from extreme heat to include excess mortality and morbidity. Mortality data at a statewide level are available from CDC’s National Center for Health Statistics (NCHS), which defines a death as heat-related when heat is the underlying or contributing cause of death. To document the full impact of a heat event on mortality, it is important to calculate the excess mortality associated with an event because some deaths would have occurred regardless of the weather conditions. Excess mortality can be calculated by comparing the number of deaths during an extreme temperature event with those during a reference period that has been matched by day of the week and other potentially confounding factors, or by using a time-series approach. For example, during the California 2006 heat wave, 655 excess all-cause deaths occurred, a statistically significant increase of 6% . During the same time period in 2007, only 140 deaths were reported on coroners’ reports .On a national scale, Medicare and Medicaid data are available to analyze the morbidity impact of heat waves on poor and elderly populations. Other vulnerable populations, such as non-Medicaid children, are not covered by these data. The Agency for Healthcare Research and Quality (AHRQ) provides access to community hospital inpatient and ER data through its Healthcare Cost and Utilization Project (HCUP). Data from some participating states are publicly available through HCUPnet, an online access point for HCUP . ThroughIn addition, it is important to track the presence and effectiveness of heat wave early warning systems, because they are critical determinants of the extent of mortality during a heat wave. Further, development of such systems and local heat response emergency plans will be critical for adaptation for chronic heat stress .Increases in heavy precipitation related to climate change and earlier regional snow melt and temperature variability raise risks of flooding and related community displacement and injuries. Strong Atlantic hurricanes are projected to increase in intensity, and strong cold weather storms are expected to become more frequent . After HWe recommend mortality from flooding and storms for indicators in this area. These data are available from the Emergency Events Database (EM-DAT) at the country level from the Centre for Research in the Epidemiology of Disasters (CRED) in Belgium . Data arAedes aegypti and the emerging vector A. albopictus.Climate change may affect the geographic range and incidence of several environmental infectious diseases, including West Nile encephalitis, Lyme disease, coccidioidomycosis , dengue fever, and human hantavirus cardiopulmonary syndrome (HCPS). Cases of dengue fever have been found at the U.S./Mexico border. The southern and southeastern United States are considered at risk for the illness because of the presence of the mosquito vector Recommended indicators include human cases of West Nile virus , Lyme disease, dengue fever, coccidioidomycosis, and HCPS. Surveillance data for human cases of environmental infectious diseases and disease vectors and reservoirs are routinely collected by state programs and reported to CDC’s ArboNET surveillance system. Several environmental infectious diseases have been cited in the literature as likely to undergo a change in the quantity of human disease cases, or in the geographic range of vectors or reservoirs as a result of climate change. Human cases of WNV have been mapped by the U.S. Geological Survey (USGS) using data submitted to the ArboNET program . HistoriIxodes scapularis and I. pacificus are limited were projected to increase 4.8 ppb, resulting in a 0.11–0.27% increase in daily total mortality.Relatively few studies have attempted to document increases in mortality and other health impacts due to climate change increases in O3 , the elderly, low-income populations, and children. Any change in their daily routine may become a stressor. Population vulnerability indicators are important for public health and emergency response officials to target susceptible communities for prevention and intervention activities.Populations that have been found to have high vulnerability to heat mortality and morbidity include the socially isolated, children, the poor, and the elderly. Other vulnerable populations affected by drought include dialysis patients, the elderly, pregnant and nursing women, infants, immunocompromised individuals , and persons with preexisting health conditions, such as hypertension and diabetes.Proposed indicators that can be used to map vulnerabilities for heat mortality and drought are available from the U.S. Census and include population distributions of elderly persons living alone, poverty status, children, infants, and individuals with disabilities.As with extreme weather events in general, populations vulnerable to the impacts of flooding include the elderly and the poor . In addiOther groups with increased vulnerability to climate change include infants, immunocompromised persons, those with chronic diseases or receiving drug treatment, and the obese . ResearcRecommended indicators include the percentage of elderly, those in poverty, infants, and the disabled living in 100- and 500-year flood zones. Paper floodplain maps have been generated by the Federal Emergency Management Agency (FEMA) for zoning and insurance purposes. FEMA is currently modernizing its mapping process, the Digital Flood Insurance Rate Maps (DFIRMs). More importantly, FEMA is updating the flood risk zones on the DFIRMs, which were found to be inadequate in projecting flood risk, such as the aftermath of Hurricane Floyd in 1999. To identify populations vulnerable to displacement from flooding, census data can be coupled with digital flood zone maps to identify the number and percentage of populations living in 100- and 500-year flood zones. These maps could be further refined to identify the percentage of elderly persons, the percentage of persons living in poverty, and those with comorbidities and other restrictions in these areas.A recent study has projected that the mean sea level along the California coast will rise from 1.0 to 1.4 m by the year 2100 under medium to medium-high emissions scenarios . CoastalThe USGS has developed an index of coastal vulnerability to future sea-level rise, which incorporates tidal range, wave height, coastal slope, shoreline erosion rates, geomorphology, and historical rates of sea-level rise . CoastalAs mentioned previously, mitigation has been the primary focus of state climate change efforts in the United States. Adaptation is just as important as mitigation to reduce short-term and longer term health risks. However, limited attention has been paid to public health adaptation to climate change until recently. Adaptation indicators are needed to measure the status of public health efforts to avoid, prepare for, and effectively respond to the risks of climate change.Data on mitigation indicators are available from federal sources. Proposed mitigation indicators are energy efficiency levels, use of renewable energies, and vehicle miles traveled. For example, the Department of Energy’s Energy Information Administration (EIA) collects information on energy consumption in U.S. households by census region and type of housing unit . The EIAData on adaptation indicators are sparse and most likely will need to be collected by public institutions or other organizations using surveys. Proposed indicators include community access to cooling centers during heat waves (and transportation to the centers); heat wave early warning systems; municipal heat island mitigation plans; surveillance systems per state that collect data on the human health effects of climate change; and a public health workforce trained in climate change research, surveillance, or adaptation. A city or region may also set up an adaptation climate change task force that includes a representative from the health sector.Heat warnings and alerts are issued by the NWS and by early warning systems in various cities. A list of heat alerts and warnings by jurisdiction is available in the NWS’s storm event database , but datFinally, data on some proposed policy indicators are available, which include the number of cities or municipalities covered by the Kyoto protocol and the number of states and local jurisdictions participating in climate change initiatives, such as climate registries or the U.S. Mayors’ Climate Protection Agreement. Data are available from the It is very likely that heat-related illnesses and deaths will increase over coming decades.3 concentrations are more likely to increase than to decrease in the United States as a result of climate change, if one assumes that precursor emissions are held constant. An increase in O3 could cause or exacerbate heart and lung diseases.A growing body of evidence indicates that OBecause it is not yet possible to project changes in future extreme climate change events, researchers cannot estimate the exact health impacts that may result from these events. However, potentially serious health consequences do exist when such events occur. Health risks associated with extreme events are likely to increase because of an increasing population and the degree to which people are physically or financially constrained or uninformed about their ability to prepare for and respond to extreme weather events.The very young and old, the poor, those with health problems and disabilities, and certain occupational groups are at greater risk.Health burdens related to climate change will vary by region.3 modeling should be done at smaller spatial scales to estimate impacts on local areas. However, finer resolution of health outcome data, such as morbidity and mortality, may involve confidentiality restrictions and may prevent data sharing unless spatial smoothing techniques are employed (In order to evaluate these impacts, we have presented a recommended list of surveillance indicators that include not only climate- sensitive health outcomes but also environmental, population vulnerability, and mitigation, adaptation, and policy indicators of climate change. Besides evaluating the health impact of climate change, developing these indicators is also vital for program evaluation, health service planning, and communication. For example, one issue that requires attention is to refine the spatial scale of the recommended indicators, which currently vary widely. In fact, some indicators cannot be used at local geographic scales. Until finer scale surveillance methods can be implemented, the modeling of the indicators should be downscaled to the local level. For example, Oemployed .Further indicator development will be hampered by sensitivity and data quality and availability issues. Sensitivity will not be uniform for all indicators. For example, although an increase in heat waves is projected, it is not a foregone conclusion that morbidity and mortality will increase to the same degree in all locations. Health impacts from heat waves would be affected by local preparedness infrastructure, personal health behaviors, acclimatization, and the built environment. Public health agencies and partner organizations can affect the likelihood of health effects from occurring by developing and promoting emergency heat warning systems, improving heat risk communication and education, and working with planners to minimize heat island effects.3 on respiratory conditions (Further evaluation, validation, and research are needed to determine the health effects of proposed indicators such as air mass stagnation events and HABs. Additional investigations are needed to determine the role of warming on plant biomass and ragweed and the implications of increased pollen, allergies, and asthma and the nditions .Data gaps are especially critical for some environmental and population vulnerability indicators. No national surveillance data set is available to analyze hyperthermia impacts on morbidity for all U.S. populations. For example, BioSense , the natNo domestic surveillance database exists for deaths and injuries for extreme weather events. The NWS, state health departments, and CDC shuld work together to form an accurate system for recording these cases on a state-by-state basis in the United States. For environmental infectious diseases, a surveillance system needs to be developed for ongoing examination of the range and distribution of Lyme disease and dengue fever vectors.For population vulnerability indicators, the greatest needs include modernizing and implementing FEMA’s project and identifying and communicating information to those at high risk of heat morbidity and mortality. The paucity of data on adaptation and policy indicators is evident, and we encourage organizations such as the Association of State, Territorial and Health Officials, CSTE, and other organizations to undertake surveys to collect this information. In addition, the NWS should work with health organizations to standardize heat alerts and warnings and benchmark them to public health outcomes. These warnings need to be coupled with public health responses.In conclusion, a review of proposed environmental health indicators for climate change in the United States shows that data exist for many environmental and health measures, but more research is needed to evaluate the sensitivity and usefulness of these measures. Further attention is necessary to increase data quality and availability and to develop new environmental monitoring and surveillance databases, especially for climate-sensitive morbidity. Maintaining the public health infrastructure by adequately funding environmental and chronic disease surveillance systems and a well-trained public health workforce are critical.
Caenorhabditis elegans dosage compensation. Taking a candidate approach, we have looked at specific histone modifications and variants on the C. elegans dosage compensated X chromosomes. Using RNAi-based assays, we show that reducing levels of the histone H2A variant, H2A.Z (HTZ-1 in C. elegans), leads to partial disruption of dosage compensation. By immunofluorescence, we have observed that HTZ-1 is under-represented on the dosage compensated X chromosomes, but not on the non-dosage compensated male X chromosome. We find that reduction of HTZ-1 levels by RNA interference (RNAi) and mutation results in only a very modest change in dosage compensation complex protein levels. However, in these animals, the X chromosome–specific localization of the complex is partially disrupted, with some nuclei displaying DCC localization beyond the X chromosome territory. We propose a model in which HTZ-1, directly or indirectly, serves to restrict the dosage compensation complex to the X chromosome by acting as or regulating the activity of an autosomal repellant.Dosage compensation ensures similar levels of X-linked gene products in males (XY or XO) and females (XX), despite their different numbers of X chromosomes. In mammals, flies, and worms, dosage compensation is mediated by a specialized machinery that localizes to one or both of the X chromosomes in one sex resulting in a change in gene expression from the affected X chromosome(s). In mammals and flies, dosage compensation is associated with specific histone posttranslational modifications and replacement with variant histones. Until now, no specific histone modifications or histone variants have been implicated in In organisms where females have two X chromosomes and males only have one, a mechanism called dosage compensation ensures that both sexes receive the same amount of information from their X chromosomes. Disruption of dosage compensation leads to lethality in the affected sex. While the precise mechanisms of dosage compensation differ between organisms, changes to the structure of the X chromosomes are involved in each case. The DNA of all chromosomes is packaged into a complex protein–DNA structure called chromatin. The most basic level of packaging involves wrapping DNA around a group of small proteins called histones. In both mammals and flies, dosage compensation is associated with specific changes to the histones on the dosage compensated X chromosome. Until now, no such change has been associated with dosage compensation in worms. Here we present evidence that the histone variant HTZ-1/H2A.Z plays a role in dosage compensation in the worm. Specifically, we suggest that HTZ-1 functions to ensure that only the X chromosomes, and not the other chromosomes, are subjected to dosage compensation. This suggests that, despite different mechanisms, one common theme of dosage compensation is a change at the level of the histones associated with the chromosomal DNA. Many species- such as humans, mice, flies, and worms- utilize a chromosome-based mechanism to establish sex. This results in a difference in sex chromosome number between the sexes that, left uncorrected, puts one sex at a great selective disadvantage. In order to combat this, these organisms employ a second mechanism to ensure that the same amount of sex chromosome-linked gene expression occurs in both sexes. This mechanism is called dosage compensation male-specific-lethal) complex that localizes to the single X chromosome in males resulting in a two-fold increase in gene expression RNA on the Xmales-absent on the first) places the H4K16ac mark on the male X and this function is essential for dosage compensation In flies and mammals, specific posttranslational histone modifications and/or replacement of core histones with variants are key features of the dosage compensated X chromosomes C. elegans, dosage compensation is achieved by the dosage compensation complex (DCC), which binds both X chromosomes in hermaphrodites to downregulate gene expression two-fold DC. SDC-2 rex (recruitment elements on the X) sites, which represent sites of DCC enrichment on the X chromosome, and spreads in cis along the lengths of both X chromosomes in the hermaphrodite C. elegans dosage compensation.In maternal effect sterility (MES) proteins mediate silencing of the germ line X chromosome and their function is required for germ line viability mes genes encode proteins that function together in a PRC2-like complex, which localizes to the germ line X-chromosome(s) and leads to enrichment of H3 lysine 27 trimethylation on the X While in somatic cells of hermaphrodites the X chromosome is subject to dosage compensation, in the postembryonic germ line of both sexes the X is subject to a distinct form of chromosome-wide regulatory process: global repression throughout meiosis in males and during early meiosis in hermaphrodites C. elegans, there are many well-documented links between different forms of chromosome-wide gene regulation and specific nucleosome characteristics. This led us to explore whether we might find a similar link between C. elegans dosage compensation and nucleosome composition. We were interested to see if any histone modifications or histone variants play a functional role in dosage compensation in worms. In this paper we report on the role of the C. elegans histone H2A.Z variant (HTZ-1).From studies of dosage compensation in other organisms and of germ line X chromosome silencing in Tetrahymena, hv1/H2A.Z associates with the transcriptionally active macronucleus C. elegans H2A.Z homolog, HTZ-1 The histone variant H2A.Z is conserved from yeast to humans and has been implicated in diverse biological processes. Interestingly, depending on its histone partner in the nucleosome core particle, H2A.Z can either stabilize or destabilize the nucleosome However, H2A.Z also localizes to regulatory regions not corresponding to promoters to exert other functions. In budding yeast, Htz1 also functions at boundary elements to protect genes from heterochromatinization by antagonizing the spread of silencing complexes On the other hand, H2A.Z also plays a role in heterochromatin formation. In this context, H2A.Z most likely partners with H3 to form stable nucleosomes C. elegans the histone variant H2A.Z/HTZ-1 functions in dosage compensation. Consistent with previous reports Here we show that in C. elegans homologs of histone variants, genes implicated in modifying chromatin via posttranslational histone modifications (such as acetylation or methylation) or chromatin remodeling http://www.wormbase.org], release WS201).To search for chromatin modifiers involved in worm dosage compensation, we utilized two RNAi-based assays in a genetic background sensitized for detecting disturbances in dosage compensation. We tested genes encoding sex-1(y263) mutant background. sex-1 functions genetically as an X signal element by repressing xol-1, the master switch regulating both sex-determination and dosage compensation sex-1 plays a role downstream of xol-1, promoting dosage compensation in hermaphrodites sex-1(y263) mutant hermaphrodites, dosage compensation is partially impaired, resulting in 15–30% embryonic lethality. In these worms, partial loss-of-function due to feeding RNAi of a gene important for dosage compensation leads to increased lethality xol-1(y9) mutation. Expression of xol-1 in males is essential to prevent dosage compensation of the single X chromosome xol-1 are male lethal due to ectopic dosage compensation, leading to abnormally low levels of X-linked gene expression. The sex-1(y263) mutation partially weakens dosage compensation, as described above. xol-1(y9) sex-1(y263) males die, but they can be rescued by feeding RNAi of dosage compensation genes him-8(e1489) allele. Mutations in him-8 cause X chromosome nondisjunction in meiosis and results in a predictable 38% of XO progeny each generation The first assay was completed in the sex-1 lethality and results in 33–60% rescue of him-8(e1489); xol-1(y9) sex-1(y263) males in these two assays htz-1 (C. elegans H2A.Z homolog) showed a similar genetic interaction. RNAi in the wild type background leads to little to no lethality, while htz-1 RNAi in the sex-1(y263) background leads to near complete embryonic lethality (him-8(e1489); xol-1(y9) sex-1(y263) background, RNAi of the histone variant htz-1 resulted in over 15% rescue (his-71 and his-72) his-24 (H1.1), hil-3 (H1.3), hil-4 (H1.4), hil-5 (H1.5), hil-6 (H1.6), and hil-7 (H1.Q)] isw-1, and the histone deacetylase let-418 are shown as examples and hermaphrodites (dosage compensation active).A previous study found that in worms HTZ-1 preferentially localizes to promoters, as in other organisms in situ hybridization (FISH) (to mark the X chromosomes in both sexes). Consistent with a previous report To analyze HTZ-1 distribution, we took advantage of a strain expressing a YFP-HTZ-1 fusion protein, or used an HTZ-1 specific antibody. The specificity of our HTZ-1 antibody is demonstrated by recognition of a protein of the predicted size on western blots and reduction of signal after HTZ-1 depletion on both western blots and by immunofluorescence (IF) . We markhtz-1 expression disrupts dosage compensation, yet the protein itself is depleted on the dosage compensated X chromosomes. Therefore, we wanted to explore how dosage compensation is affected in htz-1 depleted animals. If HTZ-1 functions in dosage compensation indirectly (by regulating expression of dosage compensation genes) we would predict to see a decrease in DCC protein levels upon HTZ-1 depletion. We analyzed worms carrying the htz-1 deletion allele tm2469 that removes 345 of 885 base pairs from htz-1 and likely represents a null allele. htz-1(tm2469) homozygous progeny of heterozygous mothers (m+z−) develop into healthy adults but are sterile, as reported tm2469 deletion appears to affect expression of not just htz-1, but the neighboring gene as well .htz-1 RNAi, we did not observe a dramatic change in DCC protein levels in HTZ-1 depleted cells, as was observed for genes involved in foregut development To investigate the possibility that HTZ-1 depletion leads to a decrease in DCC protein levels, we quantified protein levels by western blotting of HTZ-1 depleted and control animals. Although HTZ-1 levels were clearly reduced after n levels . Levels sdc-2 transcript levels are affected after HTZ-1 depletion. We analyzed sdc-2 mRNA levels in HTZ-1 depleted and control animals by reverse transcription followed by quantitative polymerase chain reaction (RT-qPCR) and observed no significant change in sdc-2 expression animals, again suggesting that HTZ-1 depletion does not lead to a significant reduction in DCC protein levels. However, the territory occupied by the DCC in these nuclei was significantly more diffuse in appearance than in wild type nuclei (rR) values and muta-1(RNAi) animals.lues see . An Rr vrR was 0.65±0.14. rR was greater than 0.5 in the vast majority of nuclei observed (88%), and only a minority of nuclei had rR values between 0.5 and 0.2 (∼12%). No correlation values of less than 0.2 were observed in these animals. Representative nuclei and corresponding rR are shown in htz-1 RNAi, the mean rR for htz-1 RNAi nuclei was 0.44±0.20, significantly lower than control (p = 5.79E-8). The majority of nuclei (58%) had DPY-27/X-paint correlation values below 0.5, and 27% of nuclei had values below the lowest value observed in the control. Representative htz-1(RNAi) nuclei and corresponding rR values are shown in htz-1 RNAi is shown in In vector control RNAi animals we observed that the DCC was highly restricted to the X chromosomes and the mean htz-1(tm2469) hermaphrodite progeny of heterozygous mothers (m+z−) (htz-1(tm2469) nuclei (59%) had values below 0.5. Additionally, 45% of nuclei observed had values below the lowest value observed in wild-type nuclei , confirming that DCC mislocalization is not tissue specific and in Hs (m+z−) . The mis(tm2469) mutant ae nuclei . We alsospecific .ssl-1 (n4077) mutant animals. ssl-1 encodes a homolog of Swr1, the catalytic subunit of Swr1-com, the complex responsible for exchanging H2A for H2A.Z ssl-1(n4077) m+z− homozygous animals have reduced HTZ-1 staining (ssl-1(n4077) hermaphrodites, 43% of nuclei observed had rR values below 0.5, similar to what we observe after htz-1 RNAi and in htz-1(tm2469) animals. Also, 33% of ssl-1 nuclei had rR values below the lowest value observed in wild type nuclei, confirming that reduced HTZ-1 disrupts the localization of DCC to the X chromosomes , are important for attracting the DCC to the X chromosome includes keeping the DCC away from autosomes. Previous studies indicated that specific DCC binding sites on the X chromosome, so-called romosome . Taken tromosome .rex sites, followed by dispersal to numerous so-called dox sites (dependent on X) or “way stations” Rex sites coincide with the highest peaks of DCC binding and are characterized by the presence and clustering of short sequence motifs called MEX motifs rex sites, or dispersal to dox sites, or both.The mechanism of how HTZ-1 restricts DCC localization is unclear. We will consider three possible models. First, HTZ-1 may serve as a direct regulator of DCC binding. Targeting of the DCC to the X chromosome is believed to be a two-step process. The complex initially binds to an estimated 200 rex sites) rex sites, but not the dispersal step to dox sites. Another way to reconcile the data in the two studies is to suggest that HTZ-1 at dox sites is modified posttranslationally (see below) in such a way that permits DCC binding. According to this model, MEX motifs attract DCC to the X chromosome, whereas HTZ-1 negatively regulates DCC recruitment to rex sites. If a MEX motif-containing sequence is not bound by HTZ-1 the DCC will be recruited. However, if a MEX motif-containing sequence is bound by HTZ-1, the DCC will be prevented from binding. From sites of entry, the DCC then may be dispersed to dox sites in a sequence and HTZ-1 independent manner. When HTZ-1 levels are reduced by RNAi or mutation, the DCC will be able to bind all MEX motif containing sites, whether they are on the autosomes or on the X chromosome. Ectopic DCC binding to autosomes will reduce the amount of DCC binding to the X chromosomes, and dosage compensation will be impaired as a result. To test this model, it will be important to observe DCC binding patterns genome-wide at high resolution upon htz-1 depletion and to determine whether ectopic DCC binding sites contain a DNA sequence motif similar to MEX motifs.It should be pointed out that this model is different from the interpretation of the HTZ-1 localization data presented in An alternative possibility is that changes in the higher order chromatin organization imposed by HTZ-1 determine whether the DCC is able to bind the chromosome. H2A.Z has been reported to alter the nucleosome surface, affect recruitment of other chromatin components, and thereby modulate higher order features of the chromatin fiber sdc-2 RNA levels when htz-1 expression is reduced. In addition, most DCC proteins are loaded into oocytes, and this maternal load of DCC proteins is sufficient for healthy development. Therefore, it is unlikely that the observed dosage compensation defects in m+z− htz-1 mutant animals are due to defects in transcription of DCC genes. However, it remains possible that HTZ-1 plays more subtle roles in regulating the exact levels and timing of expression of dosage compensation genes. Nonetheless, the difference in HTZ-1 levels in male and hermaphrodite X chromosomes , worms possess both H3 and H3.3 C. elegans. The gene encoding MES-4 was originally identified in a forward genetic screen with several other genes whose mutations led to the same mes phenotype mes-4 and mrg-1 mutants, de-silencing of X-linked genes is observed. It has been proposed that the activities of MES-4 and MRG-1 on autosomes prevent the binding of a repressor protein or complex and help limit repressor binding to the X chromosomes. The proposed mode of action of MRG-1 and MES-4 in germ line X chromosome silencing is similar to the model of HTZ-1 function in dosage compensation we have proposed.The proposed role of HTZ-1 in dosage compensation is similar to that of two proteins shown to function in germ line X-chromosome silencing in htz1Δ cells, the Sir proteins spread into these regions, leading to silencing of genes. Recent evidence has shown that loss of Htz1 leads to ectopic Sir complex localization that is not limited to immediate anti-silenced regions, but, rather, is found throughout the genome Arabidopsis, H2A.Z also plays a global antisilencing role by protecting DNA from methylation Our model describing HTZ-1 as an autosomal DCC barrier is also similar to the role of Htz1 in yeast in blocking the spread of silencing complexes into euchromatic regions adjacent to telomeres C. elegans.Htz1 functions in parallel with other nucleosomal elements to prevent heterochromatic spreading. The Set1 complex is responsible for histone H3 lysine 4 methylation (H3K4me) and also has an anti-silencing function sex-1(y263) X; TY4403 him-8(e1489) IV; xol-1(y9) sex-1(y263) X; EKM11 htz-1(tm2469) IV/nT1(qIs51) IV,V; MT12963 ssl-1(n4077)III/eT1 ; SM1353 cha-1(p1182) IV; pxEx214(HTZ-1promoter::YFP::HTZ-1 + HTZ-1promoter::CFP::LacI +pRF4)All strains used were maintained as described E. coli HT115 bacteria expressing double stranded RNA for htz-1, dpy-27, capg-1, his-71 (coding region), his-24, hil-3, hil-4, hil-5, hil-6, hil-7, isw-1 or vector (polylinker), were used for feeding RNAi using the Ahringer feeding RNAi clones let-418 and the 3′ UTR of his-71 and his-72, the regions were PCR amplified, digested with Bam HI and Bgl II (let-418) or Bgl II and Not I (his-71 and his-72), and cloned into the DT7 vector as described his-71 3′-UTRcgaagatctcgtgcataaacgttgagctg and gagcggccgccatgcacgctgttcaaaaachis-72 3′-UTRcgaagatctagctccatcaccaattctcg and gagcggccggcgtggaatatagttgctlet-418catgggatccttgccgctcctcattcaact and gtacagatctgacgatgtgcacgagagaaasex-1 strain, adult animals were allowed to lay eggs for 24 hours and the number of embryos laid was counted. The next day the number of dead embryos and larvae were counted and the percentage of embryonic lethality was calculated by dividing number of dead embryos by the total number of embryos laid. To score male rescue in him-8(e1489) IV; xol-1(y9) sex-1(y263) X, adult animals were allowed to lay eggs for 24 hours. When adult animals were removed from the RNAi plates, the number of embryos laid was counted. Three days later the number of male progeny on each plate was counted. Male viability was calculated by dividing the number of male progeny observed by the expected number of males. The him-8(e1489) mutation reproducibly results in 38% male self-progeny RNAi in N2 was initiated at the L1–L2 stage. Adults were then transferred to new RNAi plates to produce progeny for 24 hours. For IF/FISH, western, and RT-PCR analysis, RNAi progeny were processed 24 hours post-L4. To score embryonic lethality in the NKKGAPVPGKPGAPGQGPQ) and affinity purified. Polyclonal rat α-HTZ-1 was used at a dilution of 1∶500, polyclonal rabbit α-HTZ-1 at a dilution of 1∶100 for immunofluorescence. Other primary antibodies used are: polyclonal rabbit α-DPY-27 at a dilution of 1∶100 Rabbit and rat α-HTZ-1 antibodies were raised against the C-terminal 19 amino acids . Imaging was conducted as described above.FISH probe templates were generated by degenerate oligonucleotide primed PCR to amplify purified yeast artificial chromosome DNA. The labeled X-paint probe was prepared and used as described 3i Slidebook imaging software was used to measure colocalization of DPY-27 (FITC) and X-Paint (Cy3) signals on images obtained as described above. A FITC mask was set for each nucleus z-stack and the correlation between signals was calculated within this mask by the software. The FITC∶Cy3 correlation coefficient was recorded and used as an indication of colocalization between DPY-27 and X-Paint.in situ hybridization or immunofluorescence.Detergent extraction of nucleoplasmic protein from dissected nuclei was performed by dissecting animals in 1× sperm salts plus 1% Triton detergent htz-1 RNAi were calculated by dividing the normalized htz-1 RNAi level by normalized vector RNAi level.For each treatment described, 100 animals were picked into 1XM9, washed, and incubated for ten minutes at 95°C in 19 µl SDS-PAGE loading dye plus 1 µl β-mercaptoethanol. The treated samples were then loaded into either 6% acrylamide or 15% acrylamide gels (for detection of HTZ-1). SDS-PAGE was performed and protein was transferred onto nitrocellulose. The following antibodies and dilutions were used: rabbit α-HTZ-1 at 1∶500, rabbit α-DPY-27 at 1∶500, rabbit α-CAPG-1 at 1∶500 Trizol (Invitrogen) was used to extract RNA from all samples. Worms were washed from RNAi plates or normal OP50 plates 24 hours post L4, washed with M9 and stored at −80°C until extraction. For RNA extraction, samples were thawed on ice and tissue was homogenized by grinding using a microcentrifuge tube pestle. Tissue was ground in three 60-second intervals and re-frozen in liquid nitrogen between each interval. During the final 60-second interval, 250 µl of Trizol was added to the tube, and when completed, another 250 µl was added for a total volume of 500 µl Trizol and the standard protocol was used to extract RNA from the homogenized samples (Invitrogen). DNA-Free kit (Applied Biosystems) was used to digest remaining DNA contamination.Reverse transcription (RT) reactions were performed utilizing the High Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems). 1 µl of DNase-treated RNA was used in each RT reaction.htz-1, R08C7.10, and act-1 (actin) expression levels. The following primers were used with a 60°C annealing temperature:PCR was used to observe relative levels of act-1: gctatgttccagccatccttc and aagagcggtgatttccttctghtz-1: tggctggaggaaaaggaaag and aacgatggatgtgtgggatggtagaccaaaccagccagca and agcgccttgacgatactttttR08C7.10: Real-time PCR analysis was conducted as described act-1: same as abovehtz-1: gcgctgccatcctcgaat and gggctcccttcttgttcatcsdc-2: ggaaacaagaccgacaggaa and gatgcaatagtacacgccaaatchtz-1 and sdc-1 expression levels were calculated using the Pfaffl method Relative Figure S1htz-1 RNAi treated hermaphrodites. The HTZ-1 signal is greatly reduced after htz-1 RNAi. (B) α-HTZ-1 Western blot. α-HTZ-1 recognizes a band of the expected size (∼15 kDa) in both embryonic extract and adult protein samples. The α-HTZ-1 signal is reduced in htz-1 RNAi treated animals as compared to vector treated animals.α-HTZ-1 antibody is specific. (A) HTZ-1 (red), DPY-27 (green), and DAPI staining of adult intestinal nuclei in vector and (7.19 MB TIF)Click here for additional data file.Figure S2Transgenic YFP-HTZ-1 is also under-represented on the dosage compensated X chromosomes. Embryos after the onset of dosage compensation were stained with α-GFP antibodies to observe YFP-HTZ-1 localization (red), α-DPY-27 to mark the X chromosome (green) and DAPI . Arrows in the top panels indicate enlarged nucleus shown below. YFP-HTZ-1 levels are reduced in the territory of the dosage compensated X chromosomes.(7.78 MB TIF)Click here for additional data file.Figure S3htz-1 and R08C7.10 expression. (A) Reverse-transcription polymerase chain reaction (RT-PCR) analysis of expression of htz-1, R08C7.10 and actin (control) in wild type (+/+), heterozygous (htz-1(tm2469)/nT1), or homozygous (htz-1(tm2469)) animals. Expression of both htz-1 and R08C7.10 is affected in homozygous animals. Contaminating amplification product from residual DNA in the RNA sample is indicated by a star. (B) Schematic showing relative positions of htz-1 and R08C7.10 on chromosome IV . The tm2469 deletion removes most of the coding region of htz-1. In addition, it likely the affects the promoter or other cis control elements of the R08C7.10, a gene located only 522 base pairs away from the deletion.tm2469 deletion affects (5.72 MB TIF)Click here for additional data file.Figure S4htz-1-depleted embryos also show compromised DCC localization. Vector and htz-1 RNAi embryos were stained with α-Phospho-H3 Ser10 (red) (to mark mitotic nuclei) and α-DPY-27 (green). After htz-1 RNAi, 16% of embryos with Phospho-H3 Ser10 staining (>50 cell stage) had diffuse nuclear DPY-27 localization (n = 372), as opposed to 2% in vector embryos (n = 314).(2.89 MB TIF)Click here for additional data file.Table S1RNAi of the following genes did not result in significant (>10%) male rescue.(0.12 MB DOC)Click here for additional data file.
Cycles involving covalent modification of proteins are key components of the intracellular signaling machinery. Each cycle is comprised of two interconvertable forms of a particular protein. A classic signaling pathway is structured by a chain or cascade of basic cycle units in such a way that the activated protein in one cycle promotes the activation of the next protein in the chain, and so on. Starting from a mechanistic kinetic description and using a careful perturbation analysis, we have derived, to our knowledge for the first time, a consistent approximation of the chain with one variable per cycle. The model we derive is distinct from the one that has been in use in the literature for several years, which is a phenomenological extension of the Goldbeter-Koshland biochemical switch. Even though much has been done regarding the mathematical modeling of these systems, our contribution fills a gap between existing models and, in doing so, we have unveiled critical new properties of this type of signaling cascades. A key feature of our new model is that a negative feedback emerges naturally, exerted between each cycle and its predecessor. Due to this negative feedback, the system displays damped temporal oscillations under constant stimulation and, most important, propagates perturbations both forwards and backwards. This last attribute challenges the widespread notion of unidirectionality in signaling cascades. Concrete examples of applications to MAPK cascades are discussed. All these properties are shared by the complete mechanistic description and our simplified model, but not by previously derived phenomenological models of signaling cascades. Cellular signaling is carried out by a complex network of interactions. A structure that is found commonly in signaling pathways is a sequence of on-off cycles between two states of the same protein, referred to as a cascade. By analyzing and reducing the basic kinetic equations of this system, we have constructed a new mathematical model of an intracellular signaling cascade. It is widely accepted that information travels both outside-in and inside-out in signaling pathways. Conversely, cascades, even while being main components of those pathways, have been so far understood as structures where signal transmission occurs in a manner analogous to a domino effect: the information flows in only one direction. Adding explicit connections linking a particular level with an upstream location has been the way bidirectional propagation has been explained so far. In other words, up to now, unidirectional cascades would allow bidirectional propagation only when embedded in more complicated circuits. The proposed model shows that a cascade can naturally exhibit bidirectional propagation without invoking extra re-wiring. This result inspires novel interpretations of experimental data; since signaling pathways are usually reconstructed from such data, this outcome could have far-reaching implications in the understanding of cell signaling. Covalent modification cycles are one of the major intracellular signaling mechanisms, both in prokaryotic and eukaryotic organisms Examples of covalent modification are methylation-demethylation, activation-inactivation of GTP-binding proteins and, probably the most studied process, phosphorylation-dephosphorylation (PD) The advantages of these cascades in signal transduction are multiple and the conservation of their basic structure throughout evolution, suggests their usefulness. A reaction cascade may amplify a weak signal, it may accelerate the speed of signaling, can steepen the profile of a graded input as it is propagated, filter out noise in signal reception, introduce time delay, and allow alternative entry points for differential regulation Intracellular signaling through cascades of biochemical reactions has been the subject of a great number of studies cascade, which is widely involved in eukaryotic signal transduction GK-like model. The GK-like model has been used by several authors to describe the dynamics of signal transduction linear rates model.The focus of our study is to refine the mathematical modeling of cascades of covalent modification cycles, such us the one depicted in mechanistic model. For the purposes of this paper, we will consider that the mechanistic model represents a complete description of the system under study .The concept of a “cascade” in the study of transduction pathways is appealing because of its modular structure. What is especially appealing is the possibility of defining the cascade state by only one variable per module. As mentioned above, since the building blocks of the GK-like model are the well-studied GK cycles, they involve only one equation per cycle. A different approach however, is to deal with the dynamics of the cascade of reduced mechanistic description, the phenomenological GK-like model is not recovered. At first sight, our new approximation differs slightly from the previously derived description for signaling cascades. However, it involves qualitatively different dynamics from the GK-like model, yet it is in very good agreement with the complete mechanistic description when the approximation conditions are fulfilled.In this article, starting from the mechanistic description of a cascade composed of an arbitrary number of cycles, we derive a consistent approximation under which the cascade is described with one variable per cycle. It turns out that in this derivation, referred to as a The main difference between our simplified mechanistic description and the phenomenological one is the appearance of an intrinsic feedback from each unit to the preceding one, caused by the fact that in each cycle there is sequestration of part of the activated protein of the previous step. The new description of the cascade predicts the existence of damped oscillations along the chain, a phenomenon that cannot be observed using the previous phenomenological description. Interestingly, a corollary of our model is that if a particular unit in the middle of the chain receives an input–a common event, given the high degree of crosstalk between signaling pathways–then our reduced mechanistic description predicts that this perturbation is able to travel both forwards and backwards. This “bicistronic” propagation, which may be critical for effective eukaryotic signaling, is not possible within the GK-like description either. Our model provides a suitable framework for future experiments that investigate crosstalk and bicistronic propagation of signals.iY and iY* represent two interconvertible forms of one protein, such as the dephosphorylated and the phosphorylated forms of a kinase; the activated form iY* acts as a catalyst for the next reaction. The cycle between iY and iY* constitutes the basic module of a signaling pathway, which comprises n such elements. In this cascade, the deactivation occurs by means of a phosphatase denoted by iE′.We consider a cascade of biochemical cycles, as illustrated on iTY is considered to be constant in time and the variables [iY] and [iY] (the square brackets denote concentration) are then linked by a conservation law. Consequently, only one of the forms, iY or iY, will be treated as an independent variable. The first module is activated by an external input signal, that could be, for example, a growth factor or a hormone level. The level of the last protein nY* can be thought of as the “output” of the system.Since processes involved in the control of production of new proteins proceed at a much slower timescale than processes that chemically modify existing proteins, the total quantity thi protein can be described by the following reactions:iC and iC′ are intermediate enzyme-substrate complexes. Here the conservation law for the protein indexed by i is iTY = [iY]+[iY]+[iC]+[iC′ ]+[iC+1]. Notice that it comprises the complex concentration [iC+1] formed at the step i+1, since iY activates the (i+1)th cycle. There is also a conservation equation for the reverse enzyme (phosphatase) which can be written as iT = E′[iE′]+[iC′]. The five variables associated with the module i, [iY], [iY], [iC], [iC′ ], [iE′], are related by two conservation laws, leaving in principle three state variables per cycle. In this setting, the kinetic equations of the cascade can be written using the law of mass action , and this could be the optimal choice for comparing experimental data with numerical simulations of the model. This option was taken, for example, in the context of the MAPK cascade On the other hand, more complicated models, although in principle more realistic, are also less amenable to developing insights into the transduction pathways. It is appealing then, to find out under which set of hypotheses can the mechanistic model be approximated by a simpler one, for example a model with a single variable per cycle. Arriving to such reduced description is the main contribution of the present paper. Before providing that description, we briefly review some approaches followed in the literature to study signaling cascades by means of only one equation per cycle K = (k+d)/(aY and K′ = (k′+d′)/(T).a′Y The phenomenological extension of this description for a cascade like the one in The linear rates model does not account for the fact that the transformations from iK and iK′ are much larger than 1, the system in Equation 4 can be approximated by the simpler model of Equation 2 introduced before.We will refer to this generalization of the model of Goldbeter and Koshland as the GK-like model. Let us note that in the case where the coefficients K′s are small the cycle behaves like a switch where the steady state for y passes abruptly from its lowest to the highest value as a function of the ratio V/V′.Equation 3 was first derived by Goldbeter and Koshland, to study the so-called property of zero-order ultrasensitivity. This means that when the iY for the protein iY+1 is high, but its catalytic activity is rather slow, then iY will remain “sequestered” in the complex iC+1, causing a decrease in available free iY. This phenomenon has been called “sequestration” and it was shown that it can strongly reduce the ultrasensitivity of the chain. If sequestration is important, then the dynamics predicted by the model of Equation 4 is quite different from the one shown by the mechanistic model. Similar arguments are discussed in other work The cascade extensions of the Goldbeter-Koshland model have been extensively used in several important articles iY and the next substrate iY+1 in the cascade. Dissociation of this heterodimer is supposed to be induced by the (doubly) phosphorylated protein in cycle i+1, entailing a “relief-from-inhibition” positive feedback. In our study however, we point out for the first time a sequestration-based feedback that has been so far overlooked: it exists in the basic model for the MAPK cascade, without invoking any additional mechanism.The importance of sequestration-based feedback in signaling cascades is thoroughly analyzed in the recent work by Legewie et al iε and iη are ratios of total amounts of proteins. iε is the ratio of total phosphatase over total targeted protein. iη is defined as the total targeted protein in one cycle over the corresponding amount in the next cycle in the cascade, or, equivalently, the ratio of total kinase over total targeted protein. The parameter iµ is the ratio of the kinetic rates of product formation in both the activation and the inactivation reactions (see reactions in Equation 1).In i = yi+cix+1, which is the natural slow variable describing the total kinase i available at a given time for the phosphorylation in cycle i+1. This reduction is only valid if the total phosphatase in the cycle is much lower than the total targeted protein, i.e., in the limit i«ε1. The other parameters must satisfy i ηi∼εiµ. The dynamics of xi is described by the differential equation:yi has to be extracted:x0 = S is the normalized input signal and ny+1 = 0. In Equation 6, iV = (i µi ηik′)/(ε k′) and i = V′(i k′iε) /(ε k′), where ε k′ is a typical number representing the set of i k′iε , e.g. the arithmetical or the geometrical average over this set. In the conservation equation (Equation 7), the notation O(iε) is just a reminder that this equation is written in the lowest order in iε, as is also the case for the differential equation for ix. In iε. Although this extension does not alter the new properties discussed below, its numerical integration is easy and it increases the accuracy of the approximation.Using a standard singular perturbation analysis, we have found that the state of each biochemical cycle can be described by a single variable defined as iy+1, in contrast to the GK-like model. This function has the appearance of an effective Michaelis-Menten coefficient eff,i = K′iK′ (1+iy+1i/K+1), which is a typical way to indicate competitive inhibition in enzyme kinetics eff,i = K′(1+i/Kiy). In our study, however, the competition is induced by the next substrate iy+1, and this precisely describes a negative feedback from cycle i+1 on cycle i: the higher the level of i+x1, the smaller iy+1 and, therefore, the larger the value of the negative term in Equation 6. This modified denominator reflects the influence of the downstream step on the state variables of one given cycle. It is not a detail of the formalism. It has consequences upon the dynamics and on the properties of the signaling pathway, as it will be demonstrated in the following sections. Moreover, we will see that, since our system arises from a controlled approximation of the mechanistic model, the dynamics of both models can be made comparable.The reduced system given by Equations 6–7 seems to be, in principle, equivalent to the GK-like model given by Equation 4. However, two main features make it significantly different. First, in our novel system, termed the reduced mechanistic model, the conservation equation depends on the variable of the previous cycle. Second and more interesting, the denominator of the negative term in Equation 6 is now a function of the next variable i∼εi«η1, one retrieves the simple conservation law xi+yi≈1. However, we note that even in that limit and due to eff,iK′, our resulting system is not equivalent to the GK-like model. Notice that i∼εi«η1 is the closest we can be to the hypothesis behind the GK-like model, where it is considered that the concentration of the targeted protein is in large excess over those of the converting enzymes. In our description, the converting enzymes for unit i are iTE′ (phosphatase) and i−YT1, (kinase). Taking the limit i«η1 together with the fact that the targeted protein of each cycle is the activating protein of the next one, results in increasing protein concentrations as the cascade proceeds. Even though this is not the usual condition in signaling cascades, examples could arise where this limit is suitable. As a possible relevant example, the concentrations reported for the MAPK cascade go from nM in the first unit to µM in the second and third ones In the limit i∼εi«η1, our perturbation scheme encompasses situations where the total protein does not necessarily increase along the cascade. We then allow i∼η1, for all or for some index i, as long as i ηi∼εi,µ which results in the limit i∼εi«µ1. Since µi = i/k′ik, this limit requires that the phosphatase of that cycle be much more active that the corresponding kinase. In this limit however, the conservation law remains as expressed in Equation 7 and no further simplification can be made. As a result, in this limiting case, the first term in Equation 6 depends on the variable describing the previous step in a different (and more complicated) way compared to Equation 4.In addition to the limit µ1∼ε1 and η1∼1 for the first cycle, µ2∼1 and 2∼ε2η for the second cycle, etc. Or even i∼εi½µ and i∼εi½η for all or for some index i.Finally, we notice that our description enables a reduction of the cascade equations with mixed hypothesis concerning the enzymatic reactions. For example, we could have ix variable, can be identified as a negative feedback. In the current study we analyze mostly static properties of these more complicated equations and compare them to those of Equations 6–7, while a more exhaustive characterization will be presented in a future article.In n = 3) and long chains , respectively. In all the figures we plot iy, the level of active protein, obtained from ix in Equations 6–7 (see ix and iy). In this section, each parameter in the reduced mechanistic model is considered to be homogeneous throughout the chain, i.e., the parameters do not depend on the index i characterizing the position of a particular unit in the chain.In this section we report on dynamic and static properties of the new chain equations (Equations 6–7), when studied by numerical simulations, and compare them to those of previous cascade models. We will consider both short for every i.The homogeneity assumption implies that y1, is plotted. For each choice of η = ε (or µ = ε), the output of the novel reduced mechanistic model is displayed in dashed lines and the predictions of the mechanistic model are depicted in filled lines. The differences between the two descriptions become more noticeable as ε increases, as expected. Measuring those differences with the L1-norm, meaning that we compare the curves by computing the difference in the areas under these curves, we find that the reduced model deviates from the complete one less than 0.5%, 4.7%, and 10.6%, for ε of 0.01, 0.1 and 0.5, respectively, in In ε = 0.1, η = µ = 0.5; 2) ε = 0.1, η = 0.5, and µ = 1; and 3) ε = 0.1, η = 1, and µ = 0.5 (notice that ηµ∼2.5 ε for 1) and ηµ∼5 ε for both 2) and 3)). The respective errors are 4.3%, 3.5%, and 5% (data not shown). The errors in the prediction of the steady states are lower than 0.0001% in all the mentioned cases, indicating the high accuracy of the reduced mechanistic model to study static features of the cascade. This property is due to the conservation equation, Equation 7, taking into account the first correction in iε n εi see .i.e. Equations 2 and 4. Our simplified new description reveals this attribute of the complete (mechanistic) model, that has remained (to our knowledge) hidden until now.Interestingly, the temporal evolution of activated protein depicted in S parameter) and therefore we cannot obtain sustained oscillations in this chain. A more detailed mathematical study of the spectrum of stability of the chain is beyond the scope of this paper and will be the object of future work. Damped oscillations are not possible without a negative feedback between the cycles The existence of damped oscillations has been corroborated by a numerical study of stability of the steady state of Equation 6, which is a stable focus. The spectrum of the Jacobian matrix of this system computed at steady-state indeed possesses several eigenvalues with nonzero imaginary parts. The real parts however, are always negative where y4 begins to rise at a later time, but reaches a higher asymptotic value than y1. To study this phenomenon further, in n = 10, versus the unit index, for the cases A1, A3, B1 and B3. The positional organization throughout the chain is what we have called “pathway”. Thus, in this sense, B3 illustrates “pathway oscillations” that are being amplified along the cascade. The other three examples, when examined in detail, exhibit similar behavior but with less prominent amplification. Notice that for this particular figure we have plotted the variable ix to better explain the origin of the pathway oscillations in terms of Equations 6–7. The variable iy was included only for the case B3 (dashed-dotted line without symbols). A comprehensive explanation of this phenomenon is included in Another interesting and surprising feature revealed by our new model is that, even though the parameters are homogeneous through the chain, the steady states of variables i.e., a cascade in which every unit has achieved steady-state. We then perturb a single variable ix, as indicated in 3 and B3 respectively, illustrate cases where the propagation occurs mainly forward or mainly backward. However, propagation in both directions simultaneously is also possible. We observe that K/K′ has a value of 10 for B and 2 for A.Let us consider a chain that is in equilibrium, S . 1 from We now study the time-independent features of our model (Equations 6–7), and compare them with those of the system described by Equation 4 for the same set of parameters. The stimulus-response curve is defined, as customary, by the steady-state values of the variables as a function of the input stimulus iy display sigmoidal responses. The low level of activation for units 1 and 2 is due to the fact that the proteins are indeed partially sequestered in the enzyme-substrate complexes. However, y3, having no possible sequestration, achieves then a much higher steady state than the other units, and this steady-state is comparable to the one predicted by the GK-like model. In contrast, the predictions of the GK-like model for units 1 and 2 diverge significantly from those of our new model (data not shown). y3* in the GK-like model responds in a steep manner due to the characteristic ultrasensitivity of this model. The same variable computed with our equations responds in a less steep way, this disparity could be interpreted, as suggested in the work of Blüthgen et. al. In In this section we apply the reduced mechanistic model to a well-known signaling pathway, the mitogen-activated protein kinase (MAPK) one It is well know that the MAPK cascade consists of three levels, the second and the third ones involving a double-phosphorylation mechanism. In this section we consider both the MAPK cascade and a simpler case, a 3-unit chain where each unit is a 2-state cycle.ν, K, and K″ and take the values of 1, 0.25, and 0.25, respectively.Starting with the published set of parameters . ET1, related to the parameter S we have used as input in the previous section, was varied over a wide range. The outcomes were obtained by both the complete mechanistic and the reduced mechanistic models and the results are indistinguishable for the scales of the figure . For completeness, we are also including the corresponding outcomes obtained by the GK-like model (dotted lines).In Hn . As explained in the section dealing with stimulus-response curves, these differences could be due to the fact that both the mechanistic and the reduced mechanistic descriptions take into account “sequestration” in the enzymatic reactions In order to compare the steepness in the responses, we have computed the apparent Hill coefficient nH for eachiε . These results strongly indicate the robustness of the new equations regarding the “ultrasensitivity” characteristics of the cascade.We have mentioned that the good agreement between the mechanistic and reduced mechanistic descriptions regarding the prediction of steady states is due to the conservation law, Equation 7, taking into account the first correction in εi see . If thatIn E′T3, the total amount of phosphatase for the last unit in the cascade (corresponding to MAPK in B). E′T3 was varied over its suggested range of variation y3 (red filled line), as expected. Interestingly, our new reduced model (Equations 6–7), as well as the complete mechanistic description, predict that this perturbation on the third level of the chain is propagated backwards: the variation in y2* is actually a decrease due to a higher sequestration of free y2* by the next step in the chain caused, in turn, by the increased demand of y3. This result is exhibited by both cascades in In E′T3 over a wide range to observe this property, rather it is clearly seen by changing it only by a factor 5 around its suggested concentration (0.12 µM), where a 20% variation in y2* is observed, a value that is high enough to be detected experimentally (meaning that it is most likely not contained within the error of the experiment). Due to the parameters characterizing this particular pathway, the effect is not propagated to y1* (black filled line), but this fact does not have to be generalized ∂x ˙i/∂xi+1 indicates that the (i+1)th level of the cascade exerts a negative effect in what concerns variable ix. This effect is intrinsic, as opposed to “explicit” negative feedback which is sometimes considered in models of signaling pathways As a matter of fact, the negative sign of the Jacobian element r is obtained. An element ijr in this matrix describes how the state of the variable associated with module j directly influences the state of the variable associated with module i. More precisely, a response coefficient ijr lower/greater than 1 means that a relative change in module j is attenuated/amplified in module i by a factor ijr . A zero response coefficient indicates no direct effect between the involved modules, whereas a negative response coefficient means inhibition. In this way, the matrix r provides an interaction map to characterize the type and strength of the interactions between the modules in a cellular regulatory network.As a result of applying MRA, a matrix of local response coefficients ix is denoted by the function if, it easily can be shown that:ijr corresponds to a scaled version of the Jacobian matrix i/∂xj∂f . Moreover, it was proven that the local response matrix r can be obtained from another matrix named global response matrix, Rp, that has the advantage of being accessible experimentally i, j) of this matrix can be obtained by perturbing a parameter jp affecting only module j and computing the relative changes induced on the steady state of ix, namely (Δi/xi)/xΔj.p For more details about the broad scope of the method, we refer the reader to the cited reference and references therein.Indeed, if the rate of change of variable ix. r. This matrix was obtained both by direct computation of the scaled Jacobian matrix (Equation 8) and by simulating experimental perturbations to the cascade, then computing the global response matrix, Rp, and finally obtaining r, as described previously Using notations and concepts from the literature r is tridiagonal, meaning that the first level in the cascade does not directly influence the third one (r31 = 0), and viceversa (r13 = 0). Coefficients r21 and r32 are positive, representing the positive effect of each level in the cascade to the subsequent one. Interestingly, r12 and r23 are both negative, indicating an inhibitory effect from unit (i+1) to unit i. The resulting connections between the units in the cascade are summarized in the scheme in The structure of matrix r21, r32, r12, and r23 versus the parameter ET1. r31 and r13 are zero (data not shown), r21 and r32 are positive, and r12 and r23 are negative, throughout the range where ET1 was varied. Depending on the value of ET1, each of the nonzero ijr could be less or greater than 1 and the relative strength of the backward and forward couplings for a given pair of modules, e.g. \|r12/r21\|, could exhibit large variations. Similar curves have been reported in the literature for signaling cascades r12 and r23, which have always been considered to be zero in previous papers.To understand these results in more depth, we have studied how the coefficients in the matrix in Studies like the one in ix (matrix r(ix) in iy (matrix r(iy) in iy, the matrix r(iy) can be calculated using the “experimental”' method described in the literature r12 and r23 are now positive (as are r21 and r32), r31 is zero, and r13 is negative, indicating an inhibitory coupling from variable y3* to variable y1. The matrix r(iy) is consistent with the results in y2* goes in the same direction as the one in y3* .Interestingly, the interaction map characterizing the connectivities between variables r21 and r32 coefficients . The interpretation of non zero r31 and r13 was proposed in terms of the usual “explicit” positive or negative feedbacks which are sometimes considered in models of signaling pathways r12 and r23 coefficients was, at least regarding r23 and based on experimental evidence, that not only is y2* able to phosphorylate y3, but y3can phosphorylate y2 as well r12, r13, r23) can be accounted for, at least partly, by the natural “implicit” feedback which can exist in a signaling cascade. A quantitative correlation between these recent experimental results and our predictions is not possible at this time. In the published experiments, the MAPK cascade is not isolated but embedded in the complex cellular machinery; therefore, the measured connectivities could involve proteins external to the cascade itself and it would be premature to establish the connection with our simplified model. Nevertheless, the work in Experimental data concerning the application of MRA to the MAPK cascade are now available in the literature The main contribution of this work is to propose a new one-variable per cycle model for signaling cascades of covalent modification cycles, consistent with a mechanistic complete description. Our model reveals new and biologically relevant properties of such cascades. These properties are characterized completely for the case of single-phosphorylated cascades. Furthermore, single and doubly-phosphorylated cases are compared regarding their stimulus-response curves, while a more exhaustive characterization of the scheme involving double phosphorylation will be presented in a future article.The scheme in Our initial motivation for developing a new one-variable description of signaling cascades, was the following observation. The main assumption underlying the GK description of a single cycle is that the concentration of the target protein is in large excess compared to those of the converting enzymes. Holding the same assumption over a cascade of units would mean that the target proteins are in higher and higher concentration as the cascade progresses, since they act as the transforming enzyme for the following cycle. To our knowledge, this important issue has not been remarked upon in the literature, except for a brief comment in the work of Millat et. al. , page 11In order to get more insight into this point, we have sought special limiting cases for which the mechanistic and the GK-like model are in good agreement. However, it turns out that the dynamics of the signaling cascade described by the mechanistic and the GK-like models cannot be compared consistently. The fundamental reason for this mismatch is that a careful perturbation analysis applied to the mechanistic model provides a different set of equations.iY is not directly the kinase of the next reaction. Instead, we studied the case where iY* activates that kinase. This scheme was suggested by the work of Goldbeter We note that in search for an adequate set of hypothesis leading from the mechanistic equations to the model given by Equations 4, we have studied an alternative scheme in which the modified protein thi cycle plus the amount of this protein which is captured by the next inter-converting cycle. The idea of working with a mixed variable ix can be further generalized by considering the “total” variable corresponding to the total amount of activated enzyme found not only as free molecules or bound to the next substrate, but also complexed with the reverse enzyme iE′. In fact, this choice is the key ingredient of the method called the “total” quasi-steady state approximation (tQSSA) which has been proved to be a simple but most efficient extension of the standard QSSA Our mathematical method relies on the standard quasi-steady state assumption (QSSA), which can be applied under well defined conditions to elicit a clear separation between the slow and fast dynamics of the mechanistic model. Under this standard QSSA framework, our analysis shows that a good slow variable for which evolution equations can be written is the sum of the free activated enzyme which is available in the Even in the less extended QSSA framework, the conditions under which the model is valid are made clear. Under such conditions, our new model is indeed in perfect agreement with the complete mechanistic model . Those ci«ε1 and i ηi∼εiµ. The study of the performance of the new approximation . Moreover, we have observed that the steady state predictions of the reduced model are highly accurate. Therefore the properties of signaling cascades we are unveiling thanks to the new reduced model, are not restricted by a tight relationship between concentrations and reaction rates hard to achieve in in vivo or in vitro conditions.It was stated that the reduced mechanistic model is valid whenever these two conditions are satisfied: All the novel properties of a signaling cascade reported in this paper are linked, as previously mentioned, to the negative feedback from each unit to the previous one. This backward negative feedback can produce damped temporal oscillations in the chain, or it can create amplified “pathway” oscillations in the steady states of the cascade. Interestingly, it can also transduce a signal both forward and backwards. Given the multi-branched complex nature of many signal transduction pathways, this finding could have wide implications and can help focus further experimental investigation.It has recently been reported that the 3-level MAPK cascade has autonomous oscillations without any kind of added explicit feedback The stimulus-response curves of the new model were also investigated . They haTo further characterize the new model within realistic conditions, we have studied it subject to different sets of published parameters corresponding to a well-known signaling pathway, such as the MAPK one . We haveFinally, we have applied a modular response analysis to determine the network architecture of the cascade described by the new model equations . This weIn summary, our findings do not at all weaken the importance of previous models like the GK-like models and those with linear rates. To the contrary, the results of our model provide a different approach to deal with a simple one-variable per cycle model to describe signaling cascades. We hope that our contribution will help in the understanding of existing models for signaling cascades, will improve the description of available data, and will inspire both theoretical and experimental investigation.All the ODEs were integrated in MATLAB 7 . The stimulus-response curves were obtained using MATCONT, a MATLAB package for numerical bifurcation analysis of ODEs. The symbolic calculations were done using the Symbolic Math Toolbox in MATLAB.Text S1Perturbation analysis of the mechanistic model.(0.06 MB PDF)Click here for additional data file.Text S2Available models for signaling cascades using one variable per unit.(0.06 MB PDF)Click here for additional data file.Text S3Cascades involving double phosphorylation.(0.23 MB PDF)Click here for additional data file.Text S4ix and i*.yComparison variables (0.49 MB PDF)Click here for additional data file.Text S5About the amplified “pathway” oscillations.(0.05 MB PDF)Click here for additional data file.Text S6More on “reverse” stimulus-response curves.(0.53 MB PDF)Click here for additional data file.Text S7A variation of the model with an intermediate step in the kinase activation.(0.21 MB PDF)Click here for additional data file.
Infectious diseases continue to be a major cause of death in the human population, with tuberculosis and malaria affecting 500 million people and causing 1–2 million deaths annually The new sequencing technologies enable small academic research groups to create huge genome datasets at low cost. As a result, scientists with expertise in other fields of research, such as clinical microbiology and ecology, are just beginning to face the challenge of handling, comparing, and extracting useful information from millions of sequences. Here, we discuss the limitations of publicly available resources in the field of genomics of emerging bacterial pathogens, emphasizing areas where increased efforts in computational biology are urgently needed.A natural ecosystem of a bacterial population that incidentally infects humans provides a high-risk microenvironment for the establishment of this pathogen in the human population . ComparaMycobacterium, which contains several severe human pathogens, including the agents of tuberculosis (M. tuberculosis) and leprosy (M. leprae) and also the recently emerged M. ulcerans. M. ulcerans causes severe skin lesions; this disease, known as Buruli ulcer, is becoming a serious public health problem in West and Central Africa as well as in other parts of the tropics.The movement of a bacterial species from abundant animal hosts such as rodents, which are a major reservoir of infectious disease agents, to the relatively small human population is typically associated with decreased genome size and loss/alteration of the mobile gene pool M. ulcerans appears to have switched from a generalist to a specialist lifestyle: starting with a progenitor very similar to the aquatic M. marinum. While M. marinum has been found both free-living and as an intracellular pathogen of fish and other species, M. ulcerans is thought to have a restricted host range and to be transmitted by insects (M. marinum). This gene loss is thought to have been crucial for the organism to evade the human immune system, by limiting the number of antigens on the bacterial surface Like many other recently emerged human pathogens insects . The hosM. ulcerans. This plasmid consists mainly of three unusually large and internally repeated genes , and thus illustrates the concept of long and repeated virulence genes in single-copy genes, but performs very poorly in repeated and highly divergent regions of the genome. Genes involved in infection processes, with their complex repeat structures, high duplication frequency, and rapid evolution, are thus often left unresolved.The perhaps most imminent need is not for improved assembly algorithms but for better ways to integrate data from diverse sources, including shotgun sequencing, paired-end sequencing, PCR experiments, fosmid and BAC clone sequencing, physical mapping, and restriction fragment data. A program integrating these different data should not only accurately assemble as much of the genome as possible, but also assist the researcher in designing additional experiments to resolve the remaining regions. Given the rapidly increasing number of incomplete genome sequences available, it would also be valuable with a quality-scoring standard that not only provides quality scores at individual sites under the assumption that the assembly is correct, but also reflects the uncertainty of the actual assembly over specific regions.While assembly software development is struggling to keep up, the sequencing revolution shows no signs of slowing down. Perhaps the most important new development is real-time single molecule detection platforms with ultra-long sequencing reads Annotation is the process of assigning meaningful information, such as the location or function of genes, to raw sequence data. Reliable and consistent annotations are thus fundamental for analysis and interpretation of genome data. Since annotation of new genomes is usually based on homology searches , errors and inconsistencies tend to propagate. One way to reduce error propagation is to functionally annotate a set of reference genomes based on experimentally determined information. Annotation of new genomes could then start with searches in this database, which would allow high-quality annotation of all well-conserved genes. The Gene Ontology's Reference Genome Project Functional annotation of pathogen genomes is particularly important, because genes involved in host-interaction processes are among the most difficult to annotate. One problem is that different research groups often have studied homologous genes in various species, and given them different names that are not always logical or reflective of similarities in sequence and function. A manually curated database of protein families involved in host interactions that incorporates currently used gene names, sequence motifs, gene functions, and experimental results would substantially improve the situation. Much improved guidelines for how to annotate genes in large families with different combinations of sequence motifs would also be valuable.Rickettsia prowazekii and its closest relatives Comparative studies of very closely related genomes can help to distinguish functional genes from spurious ORFs (open reading frames) and pseudogenes, and thereby improve gene prediction. To this end, a tool to visualize all the fine details in comparisons of multiple closely related genomes is crucial. Such a tool was developed recently for genomes with a conserved order of genes, and it has been applied to analyze sequence deterioration in the typhus pathogen Classification of infectious disease agents is typically based on multilocus sequence-typing (MLST) systems, by which new bacterial isolates are analyzed by sequencing five to seven predefined core genes Understanding the evolutionary dynamics of host-interaction genes in terms of both mechanisms and selective forces is also important in order to design drugs that will be effective in the long term. What good would be the development of a new antibiotic or vaccine if the intended target protein evolves beyond recognition before the drug reaches the market? One solution to this problem is to characterize the selective pressures on candidate vaccine targets, and then exclude genes or parts of genes based on their evolutionary dynamics The next challenge is to place the genomic data within its ecological context, which has led to a new research field called molecular ecosystems biology To be able to integrate and evaluate these data, new software is needed. Imagine a program that can read sequence data from hundreds of bacterial isolates, infer the underlying population structure, and combine it with gene expression data, ecological factors, and clinical data such as the number of disease cases reported in various geographic areas. It should be possible to visualize global patterns in the data, such as abundance of particular strains and sequence variants and migration of infected hosts and vectors over geographic areas and seasons. Changes in taxonomic profiles, virulence genes, and metabolic pathways should be visualized in real time. This program could also be linked to a Web site where researchers can post daily updates of clinical cases, spread of virulence genes, appearance of new strains and new mutations, migration patterns, and news about genome and functional data. This site would be useful for estimating the risk for new epidemics to emerge in the human population.http://www.genomesonline.org). Several multinational projects on the human microbiome have been launched, which, together with studies of 16S rRNA amplicons, have provided new insights into the human intestinal Analyzing the behavior of complete pathogen ecosystems is an immediate priority. Random shotgun sequencing projects of bacterial DNA from diverse environments count in the hundreds, and the amount of metagenomic sequence data already exceeds the available genomic sequences in public databases The massive amount of data created by microbial community sequencing poses new challenges and will require extensive bioinformatics development The priority goals for the next decade within the area of emerging infectious diseases should be the study of complete pathogen ecosystems and the dissection of host–pathogen interaction communication pathways directly in the natural environment. To achieve these goals, investments in user-friendly software and improved visualization tools, along with excellent expertise in computational biology, will be of utmost importance. Unfortunately, too few undergraduate students in clinical microbiology and microbial ecology are trained in computational skills, and national governments and universities need to take action to address this deficiency to meet the demands of the near future. Often neglected by public and private funding is the monumental need for stable and standardized infrastructure at all levels, from the individual research group to the intergovernmental organization. Only with proper investments in everything from hardware and personnel for data handling, to the development of sensible and standardized file formats, can we ensure that the current developments can be fully exploited to more efficiently battle emerging infectious diseases.http://www.wikipedia.org), demonstrates the power of user-contributed initiatives.Currently, the slow transition from a scientific in-house program to the distribution of a stable and efficient software package is a major bottleneck in scientific knowledge sharing, preventing efficient progress in all areas of computational biology. Efforts to design, share, and improve software must receive increased funding, practical support, and, not the least, scientific impact. Since microorganisms do not follow national borders, such initiatives are probably best started from intergovernmental organizations with close links to national centers with established communication networks to distribute know-how and advances further within the country, and vice versa, to facilitate the spread of new concepts and software to all members of the organization. Eventually, many of these initiatives may become community-driven. The example of Wikipedia, with more than 10 million entries written since the launch in 2001 and a current growth rate of thousands of articles daily (
Pesticides are of concern in Bolivia because of increasing use. Frequent intoxications have been demonstrated due to use of very toxic pesticides, insufficient control of distribution and sale and little knowledge among farmers of protective measures and hygienic procedures.Questionnaires were applied and blood tests taken from 81 volunteers from La Paz County, of whom 48 were pesticide exposed farmers and 33 non-exposed controls. Sixty males and 21 females participated with a mean age of 37.3 years (range 17–76). Data of exposure and possible genetic damage were collected and evaluated by well known statistical methods, controlling for relevant confounders. To measure genetic damage chromosomal aberrations and the comet assay analysis were performed.Pesticide exposed farmers had a higher degree of genetic damage compared to the control group. The number of chromosomal aberrations increased with the intensity of pesticide exposure. Females had a lower number of chromosomal aberrations than males, and people living at altitudes above 2500 metres seemed to exhibit more DNA damage measured by the comet assay.Bolivian farmers showed signs of genotoxic damage, probably related to exposure to pesticides. Due to the potentially negative long term health effects of genetic damage on reproduction and the development of cancer, preventive measures are recommended. Effective control with imports and sales, banning of the most toxic pesticides, education and information are possible measures, which could help preventing the negative effects of pesticides on human health and the environment. During the last decades the use of pesticides has increased steadily in developing countries in an effort to increase food production and control vector-borne diseases. Unfortunately this has resulted in some negative side effects on human health and the environment. Many people are potentially at risk of becoming intoxicated when using pesticides in agriculture, in health vector programmes, and at home. Moreover people trying to commit suicide and consumers eating pesticide contaminated foods are at risk, due to the easy accessibility of pesticides and the high levels of pesticide residues found in e.g. vegetables on the market .The pesticides used are among the most toxic ones and there is often insufficient control with imports and sales. The farmers who use pesticides have only little or no access to information about proper use or the precautions needed when handling pesticides. Therefore, they often do not use even the simplest hygienic and protective measures .The most obvious health problem is the large number of acute and often fatal intoxications seen. Chronic health problems such as respiratory diseases, dermatitis, and neurological disorders are also reported . Increaswww.plagbol.org.bo).In this study the possible genotoxic effects of pesticides among exposed small-scale farmers are evaluated as part of the PLAGBOL project whose primary goal is the prevention of negative health effects of pesticides by intervention directed mainly towards farmers and health personnel in Bolivia . Each culture was incubated at 37 °C for 72 hours. Metaphases were obtained by adding 0.25 ml colchicine 0,001% to the cultures 2 hours before harvesting. The lymphocyte cells were collected by centrifugation at 800 rpm and suspended in a preheated hypotonic solution of 0,075 M KCl for 15 min at 37° and fixed 3 times in acetic acid: methanol . Cells were suspended in 0.3 to 0.5 ml of fixative solution and dropped onto the slides; the slides were stained with 2% Giemsa solution for 5 min. in Sorensen buffer pH 6.8 and air dried. The slides were analyzed at 1000x magnification using a light microscope, and 100 meta-phase cells were screened per individual. Cells with 46 chromosomes were scored for chromosome and chromatide gaps and breaks.Venous blood samples were collected using heparinized vacutainer tubes. The samples were coded and transported on ice to the laboratory and processed on the same day. Three slides were prepared per subject. The slides were precoated with 1.5% normal melting point agars (40–42 °C) and allowed to gel at 4 °C for 10 min. An aliquot of 20 μl of whole blood was then added to 0.7% of 110 μl of low melting point agars (37 °C) and allowed to solidify at 4 °C for 10 min, with the cover slips in place. To lyse cellular and nuclear membranes of the embedded cells and to permit DNA unfolding in alkaline conditions, the cover was removed and the slides were immersed in ice-cold freshly prepared lyses solution for 1 h at 4 °C. The slides were then placed in alkaline buffer for 20 min to allow unwinding of the DNA. Electrophoresis was conducted for 20 min at 25 V (0.66 V/cm) adjusted to 300 mA by raising or lowering the buffer level in the tank. Slides were then drained, placed on a tray and washed slowly with three changes of neutralizing buffer for 5 min each. DNA was precipitated and slides were dehydrated in absolute ethanol for 10 min and left to dry at room temperature. The whole procedure was carried out in dimmed light to minimize artifact DNA damage. Slides were stained with ethidium bromide (20 ug/ml).http://free.of.pl/c/casp/). From the parameters delivered by the CASP comet assay analysis, we present the area of the comet tail, % of DNA in the comet tail, length of the comet tail, and comet tail moment (% of DNA in the tail × length of the tail), all measures of DNA migration from the cell indicating DNA-damage.The lymphocytes were examined with a fluorescent microscope using an automated system with a camera connected to a computer using the CASP package for analysis were used to include confounding factors. For the chromosome aberrations a Poisson distribution was chosen, while the different variables of the Comet assay were logarithmically transformed. The exposed group of farmers was divided into three categories, those having sprayed two or more times during the previous month, those having sprayed once and those not having sprayed within the last month. Smoking habits, sex, age (≤35 and >35) and altitude of living above sea level (high >2500 m or low <2500 m) were tested for correlation with exposure. Only altitude and sex were correlated with the exposure status and therefore included in the final statistical models. All analyses were made on the STATA software package version 8 .The participants were informed about the health dangers a blood test might pose and signed an informed consent before they were included in the study. The study is in compliance with the Helsinki Declaration and was approved by the Medical Ethical Committee in Bolivia.The total number of chromosome aberrations was 8.38 ± 9.67 among exposed farmers and 2.53 ± 4.79 among controls (p < 0.001). The average number of chromosome and chromatide breaks and gaps seen in different exposure groups and in groups with different living altitude is shown in The mean level of DNA damage in lymphocytes compared among different exposure groups and in groups with different living altitude is shown in Correlations between the variables in the comet assay and those of the chromosome aberrations subtypes were low with coefficiences R around 0.20.This study shows that pesticide exposed farmers, when compared to non-exposed controls, have a higher degree of genetic damage in their peripheral lymphocytes.A dose response correlation with the number of recent application and chromosome aberrations is in accordance with an acute effect of pesticide application, and this is also seen in studies from both developing and industrialized countries. The percentage of total chromosomal aberrations of 8% among exposed farmers found in this study is comparable to other studies with findings of chromosomal aberrations between <1% to >20% among exposed groups .Likewise the comet assay shows more DNA damage in the lymphocytes of farmers spraying pesticides than in the control group, which is also seen in other studies . This daBoth pesticide exposed farmers and controls living at high altitudes show significantly more DNA-damage than those living at lower altitude. This finding could be due to higher exposure to UV-radiation at the altitude or more hours in the sunlight, a finding that might parallel an earlier finding were latitude seemed to be correlated to the degree of DNA damage .We did not find any relation with age or smoking habits, while sex was found to influence the number of chromosomal aberrations. Such varying results are also shown in other studies (Bolognesi 2006; A study found a positive correlation between the length of pesticide exposure and DNA damage, and one showed a decrease in the comet tail length after 8 months of non-exposure in the same group of workers, as an indication of the role of pesticides in producing DNA damage . LebaillIn Bolivia the subsistence farmers are exposed to pesticides most of the year because the climate allows several harvests per year. They use very toxic pesticides and have little knowledge about safe use, and that is probably one of the reasons why personal protective equipment is only used to a limited extent, a situation seen in several developing countries . Other eA study from Denmark was not able to show any differences in chromosomal aberrations between pesticide applicators and controls, but showed that the genotoxic effects were linked to re-entry when workers handled newly sprayed crops . This wawww.iarc.fr, The cytogenetic alterations found among the farmers might mean that they have a higher risk of getting cancer , and varTo prevent genetic damage in humans a better education of farmers and technicians, banning of the most toxic pesticides and promotion of ecological methods are possible options to improve the current serious situation in most developing countries . To eval
Candida parapsilosis is known to show limited genetic variability, despite different karyotypes and phenotypes have been described. To further investigate this aspect, a collection of 62 sensu strictu C. parapsilosis independent isolates from 4 geographic regions and different body sites were analysed for their genetic and phenotypic traits. Amplification fragment length polymorphism (AFLP) analysis was used to confirm species identification and to evaluate intraspecific genetic variability. Phenotypic characterisation included clinically relevant traits, such as drug susceptibility, in vitro biofilm formation and aspartyl protease secretion.C. parapsilosis isolates from different geographic origins varied in the number of biofilm producers, with a higher prevalence of producers isolated in Hungary and Argentina. The frequency of secreted proteinase producers also varied in isolates obtained from different areas, with a higher number of proteinase producers found in Italy and New Zealand. Interestingly, biofilm production and proteinase secretion were negatively correlated. This finding could be explained by assuming that proteinase activity plays a role in detachment and release from a mature biofilm, via degradation of C. parapsilosis adhesins and/or extracellular matrix components, as observed for other microorganisms.AFLP genotyping showed little variation among isolates, when the presence/absence of bands was considered. However, when AFLP profiles were compared by relative intensity for each fragment, a significant level of variation and geographical clustering was observed. All isolates were found to be susceptible to commonly used antifungals, although a reduced susceptibility to echinocandins was observed in all isolates. C. parapsilosis isolates is in agreement with the limited sequence variability described for this species. However, when band intensity was included in the analysis, geographical clustering was observed. Expression of virulence factors varied among strains isolated from different geographical regions, with biofilm and proteinase producers more frequently isolated from Hungary and Italy, respectively.The low number of polymorphic AFLP bands (18 out of 80) obtained for Candida parapsilosis is by far the most studied and characterised. It represents about 90% of the infection attributed to C. parapsilosis sensu lato [C. orthopsilosis and C. metapsilosis), as also shown by the high incidence of C. parapsilosis systemic infection worldwide, assessed as the second most common candidemia in many countries [C. parapsilosis is an opportunistic pathogen that colonises human skin and can spread nosocomially through hand carriage [C. parapsilosis to produce biofilm in the presence of plastic surfaces such as catheters or other prosthetic materials [Of the species belonging to the "psilosis" group, nsu lato and it sountries -6. C. pacarriage ,8. It hacarriage . This caaterials -12.C. parapsilosis isolates, which has been interpreted as a predominant clonal mode of reproduction [C. metapsilosis and C. orthopsilosis species, in which recombination has been shown to occur by AFLP analysis [C. parapsilosis, such as the ability to produce biofilm or hydrolytic enzymes [An increasing number of studies points towards a reduced genetic variability among oduction ,13-15. Tanalysis ,17. On t enzymes ,18.C. parapsilosis isolates obtained from different patients was made from a wide collection of "psilosis" isolates on the basis of different geographical and anatomical origins, in order to evaluate if these factors may have an impact on genetic variability.In this study, a selection of 62 C. parapsilosis and C. metapsilosis [unpublished data, [AFLP was applied to our entire "psilosis" collection (n = 650), as this method has been shown to reproducibly and unequivocally identify Candida species ,17,19. TIn parallel, phenotypic properties such as biofilm formation and proteinase secretion were analysed. Since the "psilosis" species have been recently associated with a lower susceptibility to the echinocandin class of antifungals ,21, drugCandida parapsilosis collection included 62 individual isolates obtained from different body sites and geographical regions . C. parapsilosis ATCC 22019 was included in the study as reference strain. All isolates were maintained on Sabouraud agar for the duration of the study.The ns Table . The majns Table . HungariGenomic DNA was extracted from yeast samples grown in Sabouraud broth, (Liofilchem) as previously described . DNA quaC. parapsilosis isolates. AFLP was performed on 50 ng of genomic DNA as previously described [AFLP analysis was used to confirm species identification and to evaluate the genetic relatedness of escribed . The resescribed . Pre-selescribed . AFLP prescribed . Only baAB) was calculated, ranging between 0 (complete non-identity) and 1.0 (identity). The SAB between the patterns for every pair of isolates A and B was computed by the formula SAB = 2E/(2E+a+b), where E is the number of bands shared by both isolates A and B, a is the number of unique bands in the pattern for isolate A absent in the pattern for isolate B, and b is the number of unique bands for isolate B not present in isolate A.Dendrograms were built by the TL120 software using the unweighted-pair group method using arithmetic means (UPGMA). For each pair of isolates, a similarity index . This distance matrix was imported into the Treefit program and usedC. parapsilosis clinical isolates was evaluated as previously described [Biofilm production by escribed ,17. One escribed .C. parapsilosis isolates were analyzed for secreted proteolytic activity on solid medium containing bovine serum albumin (BSA) as the sole nitrogen source. The inducing medium containing 1.17% yeast carbon base (Difco); 0.01% yeast extract ; 0.2% BSA (pH 5.0) was sterilised by filtration and added to a solution of autoclaved (2%) agar. The number of blastoconidia was microscopically determined and yeast suspensions were adjusted to 106cells/ml. Ten μl of each yeast suspension was inoculated in duplicate onto BSA agar plates and incubated at 30°C for 7 days. Proteolysis was determined by amido black staining of the BSA present in the medium as described by Ruchel and colleagues [Yeasts were pre-grown in YEPD liquid medium . lleagues . Protein® was used to evaluate C. parapsilosis susceptibility to amphotericin B, fluconazole, posaconazole, itraconazole, voriconazole, 5-flucytosine and the echinocandins as previously described [The colorimetric broth micro dilution method SensititreYeastOneescribed . AccordiC. parapsilosis reference strain ATCC 22019 was used as control.Antifungal susceptibility interpretation criteria were according to the Clinical Laboratory Standards Institute (CLSI) M27-A3 and M27-S3 documents ,27. BrieP value < 0.05 was considered statistically significant.Statistical analysis was performed using Instat software . One-way ANOVA followed by Post-hoc test (Bonferroni) was used to evaluate the level of statistical significance of clustering. The association between biofilm and proteinase production was determined by Pearson's correlation coefficient (r). Differences between proteinase/biofilm producers versus non producers were examined using Fisher's exact test. A C. parapsilosis isolates. AFLP profiles obtained for C. parapsilosis consisted of 80 fragments ranging from 100 to 700 bases. Fragments larger than 700 bases were used as a control of DNA integrity. The number of monomorphic fragments was 62, which were common to all C. parapsilosis isolates. Therefore, these fragments were considered species specific and used for identification. Indeed, as shown in Figure C. metapsilosis and C. tropicalis , which were excluded from this study. Identification of C. tropicalis and C. metapsilosis was performed by comparing AFLP profiles with those of 16 different fungal reference species [[AFLP was used to confirm correct species identification and to evaluate genetic variability within the selected 62 C. parapsilosis isolates including those selected for the study and isolated from Argentina, Hungary higher than 0.96 . Reproducibility of the AFLP analysis was 97%, estimated by the average correlation among duplicated samples of reference C. parapsilosis strain (data not shown).With this type of analysis, significant geographic clustering of the isolates was observed Figure . One-wayC. parapsilosis isolates were found to be susceptible to the antifungals included in the SensititreYeastOne® Y09 panel, with the exception of CP558 that displayed a dose-dependant susceptibility to fluconazole (MIC = 16 μg/ml). MIC values (μg/ml) were as follows: 5-flucytosine 0.06 ≤ MIC ≤ 0.25 (mean 0.127 ± 0.084 SD); posaconazole 0.008 ≤ MIC ≤ 0.5 (mean 0.069 ± 0.07 SD); voriconazole 0.008 ≤ MIC ≤ 0.5 (mean 0.037 ± 0.064 SD); itraconazole, 0.003 ≤ MIC ≤ 0.25 (mean 0.07 ± 0.036 SD); fluconazole, 0.125 ≤ MIC ≤ 16 (mean 1.8 ± 1.7 SD); amphotericin B, 0.125≤MIC≤ 1 (mean 0.44 ± 0.18 SD).All C. parapsilosis isolates exhibited a reduced susceptibility to the echinocandin class, with the following MICs: anidulafungin, 0.5 ≤ MIC ≤ 2 (mean 1.32 ± 0.54 SD); micafungin, 0.5 ≤ MIC ≤ 2 (mean 1.17 ± 0.52 SD); caspofungin, 0.25 ≤ MIC ≤ 1 (mean 0.5 ± 0.22 SD).All All MIC values for echinocandin were ≤ 2 μg/ml . However, caspofungin was the most active, with 85.5% of isolates showing MIC values ≤ 0.5 μg/ml.C. parapsilosis reference strain ATCC 22019 failed to produce biofilm at both temperatures tested. Statistically significant differences in the distribution of biofilm producers vs non producers were observed in strains isolated from different geographic regions. As shown in Figure P = 0.001) and Argentina (P = 0.011), compared with Italian strains, where a higher prevalence of non producers was found. The majority of isolates from New Zealand were biofilm producers. A similar trend was observed at 37°C (data not shown). When biofilm production was correlated with the anatomical origin of the samples, regardless of the geographical location, statistically significant differences in producers vs non producers could be observed between nail and blood isolates, with the latter encompassing a majority of biofilm producer strains, or between nail and cerebrospinal fluid samples unable to hydrolyse BSA Table . When thC. parapsilosis isolates was observed .Univariate regression was applied to determine whether an association existed between the expression of the two virulence factors studied. As shown in Figure Candida parapsilosis [To date, no significant sequence variation has been described for psilosis . TherefoC. parapsilosis isolates were selected to be representative of different geographical regions and of different anatomical sites . The EcoRI/HindIII enzyme combination used in the AFLP protocol was expected to produce a higher number of polymorphic bands since in C. metapsilosis band homoplasy was reduced with this combination and the average fragment length was larger than the one obtained with EcoRI/MseI [C. parapsilosis and led to the identification of 20.7% of polymorphic fragments versus only 5% observed with EcoRI/MseI (data not shown). However, when genotype analysis was performed on the presence/absence of a band, the AFLP profiles obtained clearly indicated very high similarity, with all isolates grouped within a similarity index of 0.97.To evaluate the effect of different environments upon genetic variability oRI/MseI . Indeed C. metapsilosis and C. orthopsilosis, for which we observed a greater number of polymorphic bands [C. parapsilosis is 30 to 70 fold lower than in other Candida species [C. orthopsilosis and C. metapsilosis [C. parapsilosis, with 192 different genotypes found among 233 isolates, based on 4 hyper variable loci. This is remarkable, considering that the majority of the literature points towards limited genetic variability in this species. The hypervariability found can provide an excellent tool to discriminate between isolates in outbreak investigations. However, it does not seem to be useful for genetic relatedness studies on larger time scale or on population structure [This genetic variability is much lower than what we have observed for the species ic bands ,17. Our species . It is n species , since tpsilosis ,17. Intepsilosis reports P < 0.001). This coefficient has been used as an index of genetic distance and has been previously reported in AFLP analysis of bacteria [When the genetic distance between each isolate pair was calculated using the Pearson's coefficient, which takes into account both the presence/absence of bands and their relative "intensity", significant geographic clustering of the isolates was obtained . Variable DNA methylation of restriction sites might be responsible for different AFLP profiles, including the observed differences in relative intensities of AFLP bands found in this study with the enzymes HindIII and EcoRI.Using AFLP with the enzyme combinations EcoRI, HpaII, and MspI, we have noted that in Candida species [For what concerns phenotypic traits, drug susceptibility tests showed that all isolates were susceptible to the antifungals tested, with the exception of one fluconazole dose-dependant susceptible isolate. Regardless of the geographical or anatomical origin, a reduced susceptibility to echinocandins was observed for all isolates, confirming what has already been described for this species . It has species ,27.Since this fungal pathogen is able to colonise body sites with different core temperatures, we examined whether biofilm formation was influenced by incubation at 30 or 37°C. The results obtained indicated that this parameter does not significantly alter the ability to produce biofilm in vitro, with minor differences in the quantity of the extracellular matrix produced at different temperatures. Interestingly, biofilm production was linked to both geographical and anatomical origin of isolates; indeed, Argentinian or Hungarian isolates produced significantly more biofilm than Italian strains. To date we do not have an explanation to justify the higher biofilm production that was observed in Hungarian isolates. The majority of these high biofilm producers came from surgery or intensive care units, where catheter related infections with biofilm producer isolates are more commonly found. Of note, even though the analysis was performed on a limited number of isolates, blood and cerebrospinal fluid isolates were found to be more frequently biofilm producers than strains isolated from nails. These findings need to be confirmed by comparing a wider set of isolates for each anatomical site of origin.C. parapsilosis isolates (66.1%) produced proteinase in vitro. In contrast to what was observed for biofilm production, proteinase producers were mostly detected in Italy and New Zealand. Interestingly, a statistically significant inverse correlation was found between proteolytic activity and the ability to form biofilm, independent of the geographical/anatomical origin of isolates. Indeed, this finding has also been described for Staphylococcus aureus [S. aureus mutant, as shown by the addition of proteinase inhibitors to biofilm formation assay [S. aureus double mutant in a metalloprotease and serine protease, displaying minimal extracellular protease activity, was improved in biofilm formation, and had a strongly attenuated detachment phenotype. These findings demonstrate that the S. aureus dispersal mechanism from consolidated biofilm requires extracellular protease activity. Recently, the existence of a new pathway has been demonstrated, controlling protein-mediated biofilm formation in which different global regulators modulate biofilm formation by controlling the expression of S. aureus extracellular proteases [S. aureus, we hypothesise that the negative impact of extracellular proteases on biofilm formation is multifactorial, potentially promoting detachment and release from a mature biofilm, via degradation of C. parapsilosis adhesins and/or extracellular matrix components.The majority of s aureus , where eon assay . In addion assay demonstrroteases . TherefoCandida parapsilosis is characterised by a limited DNA sequence variability, even when considering isolates collected from distant geographical regions. The fact that phenotypic properties were found to significantly differ in strains isolated from various geographical regions suggests that other mechanisms such as epigenetic modifications may be used by this yeast to adapt to environmental changes.Overall, these results confirm previous evidence that AT designed the study with LAMH, performed phenotypical analysis and drafted the manuscript; LAMH conceived the study with AT, performed AFLP analysis and wrote the manuscript; SM participated in the drug susceptibility assays; LM has made substantial contribution to acquisition of data and critically revised the manuscript. SS participated in the study coordination and has made substantive contribution to data analysis; MC participated in the study design and has given the final approval to the version to be published.All authors have read and approved the final version of the manuscript.
The effects of flavone acetic acid (FAA) on the coagulation properties of plasma from tumour-bearing and non-tumour-bearing mice have been investigated. The study was carried out primarily on CBA mice and the CaNT tumour, although substantiating data are included for two other tumours grown in the WH strain. FAA was injected at a range of single doses up to a maximum of 300 mg kg-1, and clotting properties of the plasma were measured in vitro at various times after FAA administration. Platelet numbers and the concentration of fibrin degradation products (FDP) in the plasma were also determined. Following a dose of 300 mg kg-1, the clotting times were significantly reduced at 15-30 min in both tumour-bearing and non-tumour-bearing mice of both strains. Detailed studies on coagulation in the CBA strain (+/- CaNT tumour) indicate that in tumour-bearing animals the initial decrease in clotting time is followed 4-6 h later by an increase in clotting time, thrombin time and FDP levels. Platelet counts of tumour-bearing mice also decreased significantly over this period. Similar experiments in non-tumour-bearing mice did not show these late effects. All the data from the coagulation tests on mice with CaNT tumours are consistent with the hypothesis that intravascular coagulation occurs following treatment with FAA, and that vascular occlusion in tumours, as a results of FAA-induced coagulopathy, may contribute to tumour regression.
There is an error in the first affiliation. It should appear:Institute for Human Evolution and the Bernard Price Institute for Palaeontology, School of GeoSciences, University of the Witwatersrand, Johannesburg, South Africa.
In this systematic review we evaluated the evidence on the association between dioxin exposure and cardiovascular disease (CVD) mortality in humans.We conducted a PubMed search in December 2007 and considered all English-language epidemiologic studies and their citations regarding dioxin exposure and CVD mortality. To focus on dioxins, we excluded cohorts that were either primarily exposed to polychlorinated biphenyls or from the leather and perfume industries, which include other cardiotoxic coexposures.We included results from 12 cohorts in the review. Ten cohorts were occupationally exposed. We divided analyses according to two well-recognized criteria of epidemiologic study quality: the accuracy of the exposure assessment, and whether the exposed population was compared with an internal or an external reference group. Analyses using internal comparisons with accurate exposure assessments are the highest quality because they minimize both exposure misclassification and confounding due to workers being healthier than the general population . The studies in the highest-quality group found consistent and significant dose-related increases in ischemic heart disease (IHD) mortality and more modest associations with all-CVD mortality. Their primary limitation was a lack of adjustment for potential confounding by the major risk factors for CVD.The results of this systematic review suggest that dioxin exposure is associated with mortality from both IHD and all CVD, although more strongly with the former. However, it is not possible to determine the potential bias, if any, from confounding by other risk factors for CVD. Dioxins, a class of environmental pollutants resulting from the production and combustion of chlorinated compounds, have been shown to cause cardiovascular toxicity in animals . Althougp-dioxins (PCDDs), including 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), the most potent member of this class of chemicals. Although “dioxin” is also sometimes used to refer to TCDD alone, in this review we use the broader definition.The term “dioxin” refers to a diverse group of structurally related, environmentally persistent chemicals that exert toxic effects through a common pathway mediated by the aryl hydrocarbon receptor , 2006. DApoE−/− mice exposed to subchronic doses of TCDD also developed earlier and more severe atherosclerotic lesions . We also excluded studies whose primary exposure was to PCBs. Only 12 of 209 PCBs have dioxin-like activity, so exposure to non–dioxin-like PCBs would complicate the interpretation of any association of total PCBs with CVD.Although dioxin exposure may occur during leather tanning and processing and in fIf several follow-up studies had been published for a cohort, we included only the most recent results. By necessity, we made an exception when applying this rule to the IARC multicenter cohort, which updated and pooled the results of 36 individual cohorts . We did Eleven cohorts remainedAlthough quantitative dioxin exposure profiles for each cohort were not available because limited biological measurements were performed, broad exposure categorizations are possible. The workers in the 10 occupational cohorts were primarily exposed to PCDDs through the production and/or application of phenoxy acid herbicides and chlorophenols , with soWe grouped study results according to two well-recognized criteria of study design quality. The first criterion was whether mortality among the exposed participants was compared with an internal or an external reference group. External comparisons used standardized mortality ratios (SMRs) to compare the number of deaths observed in the exposed group with the number of deaths expected in the general population, standardized for age and sex. The primary limitation of external comparisons is that whenever the exposed group is an employed population, associations between exposure and CVD mortality will be biased downward because workers are healthier on average than the general population , to septiles of cumulative exposure [National Institute for Occupational Safety and Health (NIOSH)]. Additional details on these studies’ personal exposure assessments can be found in the original articles .p = 0.07), whereas the Army Chemical Corps study . In the BASF study (The IHD SMRs (95% CIs) for the IARC and NIOSH studies from lowest to highest exposure using the same categories as shown in SF study , the IHDp-Values for trend were calculated in the NIOSH . The BASF study found no elevated adjusted RRs for all CVD. Neither study examined IHD, and neither study presented crude RRs, which otherwise could have been compared with the adjusted RRs to assess the strength of confounding.A major concern in all the reviewed studies was potential confounding by the major risk factors for CVD . If these risk factors were strongly associated with dioxin exposure, they could confound the association between dioxins and CVD, biasing it either upward or downward. Of the studies in The Hamburg study reportedThe present review synthesizes the epidemiologic studies of dioxin and CVD mortality and advances our understanding by considering in detail the studies according to their quality. Studies using external comparisons and crude exposure estimates found no association between dioxin exposure and increased risk of IHD or all-CVD mortality, but this may be due to healthy worker effect bias and nondThe Seveso study was the The major limitation of these epidemiologic studies is the lack of adjustment for other major risk factors for CVD . Only age was consistently adjusted for. The Ranch Hand and BASFp for trend = 0.07) after adjustment for age, race, BMI, smoking, alcohol consumption, exercise, cholesterol, hypertension, and C-reactive protein. No crude ORs were shown. Some recent cross-sectional studies of dioxin exposure and CVD morbidity have found associations that persisted after more thorough adjustment for confounding . Ha et aThe associations between dioxin exposure and increased risk of cardiovascular mortality were in study populations with dioxin levels substantially higher than U.S. general population levels . HoweverThe RRs from internal comparisons across the various studies are similar, even though the mean exposure levels differ. However, in each case the highest exposed category consisted of individuals with estimated exposures of comparable magnitude . TherefoAnother weakness of the reviewed mortality studies is the difficulty of accurately retrospectively assessing personal exposure. However, this exposure misclassification is likely to be nondifferential with respect to CVD mortality, which would tend to decrease the observed associations in the highest exposure category .Most studies reported results only for TCDD, and not total TEQ, which is considered more biologically relevant. In addition, dioxin exposure was usually accompanied by coexposure to other contaminants, whose precise composition varied within occupational settings, and between occupational and environmental settings. It is a limitation of epidemiologic studies that separating out the effect of any one specific contaminant is difficult, especially given the possibility of synergism or antagonism. The primary occupational coexposure was to chlorophenols and their derivatives, but the available toxicologic studies of chlorophenols do not suggest that they have toxic effects on the cardiovascular system .Our findings do not directly address the risks of dioxin exposure for females because none of the internal comparison studies included substantial numbers of women. In a general population morbidity study, The downward bias of the SMRs of occupational studies due to the healthy worker effect complicates their interpretation. This bias is illustrated by the substantially stronger associations found using internal comparisons than using SMRs in the IARC and NIOSa priori focus of these studies was cancer mortality.Although information on the mortality status of the participants was available at the time of the retrospective exposure assessment, this was unlikely to influence the estimation process in a way that might induce a relationship between the estimated dioxin exposure and CVD mortality because the International Classification of Diseases, Ninth Revision (These studies were also limited by their reliance on mortality and death certificate diagnoses. However, CVD mortality is likely to be diagnosed relatively accurately, and any errors would affect the precision but not the validity of the results. Virtually identical Revision codes weThe IARC internal comparison results at least partially include the results from three of the other internal comparison studies and 3. TThe results of this systematic review suggest that dioxin exposure is associated with increased risk of mortality from both IHD and all CVD, although more strongly with the former. Although biological plausibility is provided by animal studies, uncontrolled confounding by other risk factors for CVD cannot be ruled out as a contributor to the association.We hope our results will stimulate further evaluation of CVD incidence and mortality in dioxin-exposed cohorts, especially using internal comparisons with detailed exposure assessments, and careful control for confounding. Future studies in both animals and humans should assess whether cardiovascular effects are present at environmentally relevant doses. Of additional interest would be analysis of whether the association between dioxin exposure and all CVD persists when IHD cases are excluded, as well as a pooled or meta-analysis of the internal comparison results in order to obtain a dose–response curve for dioxin and CVD.
Saccharomyces cerevisiae during biomass-directed processes. It results from elevated sugar consumption rates that cause a high substrate conversion to ethanol and other bi-products, severely affecting cell physiology, bioprocess performance, and biomass yields. Fed-batch culture, where sucrose consumption rates are controlled by the external addition of sugar aiming at its low concentrations in the fermentor, is the classical bioprocessing alternative to prevent sugar fermentation by yeasts. However, fed-batch fermentations present drawbacks that could be overcome by simpler batch cultures at relatively high (e.g. 20 g/L) initial sugar concentrations. In this study, a S. cerevisiae strain lacking invertase activity was engineered to transport sucrose into the cells through a low-affinity and low-capacity sucrose-H+ symport activity, and the growth kinetics and biomass yields on sucrose analyzed using simple batch cultures.Overflow metabolism is an undesirable characteristic of aerobic cultures of S. cerevisiae strain lacking invertase the high-affinity sucrose-H+ symporter encoded by the AGT1 gene. This strain could still grow efficiently on sucrose due to a low-affinity and low-capacity sucrose-H+ symport activity mediated by the MALx1 maltose permeases, and its further intracellular hydrolysis by cytoplasmic maltases. Although sucrose consumption by this engineered yeast strain was slower than with the parental yeast strain, the cells grew efficiently on sucrose due to an increased respiration of the carbon source. Consequently, this engineered yeast strain produced less ethanol and 1.5 to 2 times more biomass when cultivated in simple batch mode using 20 g/L sucrose as the carbon source.We have deleted from the genome of a S. cerevisiae strain engineered in the sucrose uptake system. Such result was accomplished by effectively reducing sucrose uptake by the yeast cells, avoiding overflow metabolism, with the concomitant reduction in ethanol production. The use of this modified yeast strain in simpler batch culture mode can be a viable option to more complicated traditional sucrose-limited fed-batch cultures for biomass-directed processes of S. cerevisiae.Higher cell densities during batch cultures on 20 g/L sucrose were achieved by using a Saccharomyces cerevisiae has been known to humans for thousands of years and it is routinely used in many traditional biotechnological processes, including bread making and production of several alcoholic beverages. Consequently, it has been extensively studied and thus is considered a model system for the metabolic, molecular and genetic analysis of eukaryotic organisms. Due to its GRAS status, S. cerevisiae yeasts are also applied on a huge scale in biomass-directed processes, such as the production of baker's yeast, yeast extract and other food additives [The yeast agents) , as well agents) -5. The c agents) ,7.S. cerevisiae rely in its ability to efficiently ferment sugars, even under fully aerobic conditions [S. cerevisiae cultures occurs when the carbon flux through glycolysis exceeds the capacity of the tricarboxylic acids cycle to completely oxidize the pyruvate produced. Thus, fully respiratory metabolism only takes place during the utilization of low sugar concentrations and slow rates of sugar consumption and growth, and plenitude of oxygen. Indeed, this yeast has developed several sensing and signaling mechanisms in order to not only ensure efficient sugar uptake from the medium, but to also repress alternative carbon source utilization and respiration, thus favoring the production of ethanol [However, it should be stressed out that most of the industrial applications of nditions . Since lnditions . Aerobic ethanol -14. AccoS. cerevisiae yeast cell are cultivated in a fed-batch manner, in which a sugar-concentrated solution is fed into the bioreactor under a variety of control strategies. Usually, after a batch phase, an exponential feeding profile is applied to ensure optimal production and growth conditions, followed by a decline phase at the end of cultivation. To ensure optimal oxidative growth several approaches have been developed to control the feed rate at a level below the critical value, beyond which ethanol is produced and therefore the biomass yield decreases. Nevertheless, supplementary equipment, complex control systems and kinetic models are usually required to monitor on-line the fermentation process in order to provide small sugar concentrations to the yeast cells, avoiding ethanol production [Consequently, in order to maximize biomass yield oduction -17. Otheoduction ,19. ManyS. cerevisiae. More than half of the world's ethanol production relies on the efficient fermentation of sucrose-rich broths such as sugarcane juice and molasses, and these raw materials are also used for the production of baker's yeast, and for production of several distilled alcoholic beverages [S. cerevisiae cells harbor an extracellular invertase (β-D-fructosidase), that hydrolyzes sucrose into glucose and fructose, which are transported into the cell by hexose transporters and metabolized through glycolysis. This enzyme has been a paradigm for the study of protein synthesis and regulation of gene expression. Invertase is encoded by one or several SUC genes (SUC1 to SUC5 and SUC7), SUC2 being the most common loci found in almost all S. cerevisiae strains, including in other closely related yeast species [Sucrose is by far the most abundant, cheap and important sugar in the industrial utilization of the yeast everages ,21. It i species ,23.SUC genes generate two different mRNAs: a larger transcript encoding an invertase with a signal sequence required for its secretion from the cell, and a shorter transcript lacking this signal sequence and thus coding for an intracellular form of the enzyme [SUC expression, the transcriptional activator of this gene is still unknown [S. cerevisiae cells [These e enzyme . While te enzyme -27. Desp unknown ,29. A fu unknown -32. Extr unknown . Extraceae cells , which mS. cerevisiae was engineered in order to improve biomass-directed applications of this microorganism. Several reports have shown that the kinetics of cell growth on sucrose by this yeast can only fit a model in which its utilization is composed of the contributions from both the direct uptake of sucrose, and the uptake of its hydrolysis products into the cell [S. cerevisiae cells revealed the presence of an active sucrose-H+ symport [Km~7 mM) uptake mediated by the the AGT1 permease, while the MALx1 maltose transporters allow the active uptake of sucrose with low (Km > 100 mM) affinity [S. cerevisiae represents an interesting alternative to classical bioprocessing approaches.In this study, a poorly characterized pathway for sucrose utilization in the cell -37. The symport ,39 whichaffinity ,41. The affinity . Indeed,affinity ,44. In tMAL constitutive strain that lacks invertase activity, but it still grows and ferments efficiently sucrose due to its active transport into the cell, and intracellular hydrolysis by a cytoplasmic α-glucosidase [+ symport [Km~7 mM) and low-affinity (Km~120 mM) transport activities, as has already been described for other wild-type yeast strains [AGT1 permease is responsible for the high-affinity component, while the low-affinity transport activity is mediated by any of the MALx1 maltose permeases. Indeed, this strain contains in its genome , MAL31 (chromosome II), and MAL41 (chromosome XI), while the AGT1 gene is located in chromosome VII. It should be stressed out that both genetic and molecular studies [MAL31, MAL41 and AGT1 permeases are functional, and we do not know if the MAL21 gene encodes for a functional permease. Our PFGE and blotting analysis also showed the presence of a unique SUC gene in the genome of strain 1403-7A, probably a mutant suc2 allele of the gene since this strain lacks invertase activity [Strain 1403-7A is a cosidase ,44,45. Snity Km~10 mM tran studies ,47 have activity ,44,45.+ symporter encoded by the AGT1 gene maltose transporter [MALx1 maltose transport activities (data not shown).In order to develop a new yeast strain that would take up sucrose from the medium by just the low-affinity transport activity, we deleted from strain's 1403-7A genome the high-affinity sucrose-Hnsporter , in straagt1Δ strain LCM001 had a significant slower capacity to consume sucrose from the medium (at a concentration of 20 g/L), producing less ethanol than the parental wild-type strain 1403-7A. This phenotype was more pronounced when fermentations were performed in synthetic medium, compared with rich YP medium -1 h-1 in synthetic and rich medium, respectively. The beneficial effect of complex nitrogen sources (peptides or amino acids) compared with ammonium sulfate present in the synthetic medium has been described previously [agt1Δ strains were 0.99 and 0.78 g sucrose (g cell dry weight)-1 h-1, respectively, which is in accordance with the kinetics of active sucrose transport presented by each strain as strain 1403-7A (μ = 0.24 ± 0.01 h-1) or other SUC+ strains [-1 h-1 for strains LCM001 and 1403-7A, respectively). These LCM001 yeast cells did not enter into the diauxic shift -1 when ammonium sulfate or peptone were used as nitrogen source, respectively, the agt1Δ strain LCM001 produced only 10 to 40% of the ethanol produced by the wild-type strain 1403-7A when sucrose was used as carbon source. In order to confirm that this increase in biomass production by the LCM001 strain is due to respiration of the sugar, we added amtimycin A to the medium. Under this condition (respiration blocked), the biomass yield on sucrose of strain LCM001 was exactly the same as for the parental strain 1403-7A .We thus analyzed the biomass yield of these two strains during growth using three different carbon sources and different amounts of nitrogen sources Figure . It is eS. cerevisiae, several approaches have been developed to engineer the metabolism of this microorganism towards a more aerobic or respiratory utilization of sugars. In one approach where the targets are key regulatory proteins, either overexpression of the transcriptional factor HAP4 (activating respiratory genes), or deletion of GCR1 and GCR2 (activators of glycolytic genes), HXK2 or REG1 (relieving glucose repression), results in yeast strains showing increased biomass production during glucose fermentation [S. cerevisiae was a huge challenge as it was required not only to delete the hole set of hexose transporters found in this yeast , but also required the expression of a mutant chimera between the low-affinity (HXT1) and high-affinity (HXT7) glucose transporters as the unique sugar permease at the plasma membrane [GAL2 deletion). Indeed, the modification of the glucose uptake system in E. coli [Due to the increased interest in biomass-based industrial applications of entation -56. Howeentation -61. Anotmembrane -64. Alth E. coli ,66 also S. cerevisiae, allowing the direct uptake of the sugar by low-affinity and low-capacity transport systems, followed by its intracellular hydrolysis mediated by a maltase (α-glucosidase), the yeast cells grow efficiently on sucrose but produce significantly less ethanol since the cells are diverting more of this carbon source towards biomass production. Thus, higher biomass production can be attained with simple batch cultures in 20 g/L sucrose, avoiding some drawbacks of fed-batch cultures due to easier operational procedures, reduced equipment and process time needed for each production lot. Indeed, the more respiratory phenotype of strain LCM001 was clearly demonstrated by the occurrence of only one growth phase during batch cultivation with sucrose as the carbon and energy source, and the corresponding decrease in the biomass yield when the respiratory inhibitor antimycin A was used.Our results show that when we engineer the mode of sucrose utilization by the yeast S. cerevisiae has a strong tendency towards alcoholic fermentation of sugars, several reports have shown that in the case of some α-glucosides , or even by using the classical fed-batch mode of yeast cultivation. It remains to be seen whether combination of such approaches can further improve the biomass yield of S. cerevisiae at higher sucrose concentrations.Although totriose ,68 and ttotriose -72) whictotriose . It is al growth ,12. It wS. cerevisiae strain engineered in the sucrose transport system. Deletion of the high-affinity sucrose transport system mediated by the AGT1 permease produced a yeast strain where sucrose was transported by low-affinity and low-capacity permeases. While up to 1.5 to 2-times more biomass, when compared with the parental strain, were obtained by the engineered yeast strain in simple batch cultivations using 20 g/L sucrose, the ability of the strains to efficiently ferment very-high sucrose concentrations (> 200 g/L) was unaffected. The yeast growth rate on rich medium containing 20 g/L sucrose was also unaffected, and thus the higher biomass yields were accomplished by preventing overflow metabolism and increasing respiration by the engineered strain, with the concomitant reduction in ethanol production. The simpler batch cultivation mode can be a viable option to more complicated traditional sucrose-limited fed-batch cultures. A thorough analysis of the physiological and transcriptional response of the engineered S. cerevisiae strain to very-high sucrose concentrations will help to better understand the regulatory mechanisms involved in sugar fermentation by yeasts, and could serve as a basis for engineering metabolic pathways to improve process performance of S. cerevisiae for biomass directed approaches using highly concentrated culture media.Higher cell densities during batch cultures on sucrose were achieved by using a g, 1 min), and their supernatants used for the determination of sugars and ethanol. For batch fermentations yeasts were pregrown on YP-20 g/L sucrose until the exponential phase (~1 g of dry yeast/L), centrifuged and washed twice with cold water, and inoculated at a high cell density (10 g of dry yeast/L) into synthetic medium (4 g/L yeast nitrogen base without aminoacids and 10 g/L ammonium sulfate) or rich YP medium containing the indicated amounts of sucrose. Batch fermentations were incubated as described above for growth assays, and samples were collected regularly, centrifuged, and their supernatants analyzed as described below.Cells were routinely grown on rich YP medium (10 g/L yeast extract and 20 g/L peptone), or synthetic medium (2 g/L yeast nitrogen base without aminoacids containing 75 mg/L L-tryptophane and 150 mg/L uracil) supplemented with different quantities of ammonium sulfate or peptone as nitrogen source, and 20 g/L glucose, sucrose or maltose as carbon source. The pH of each medium was adjusted to pH 5.0 with HCl, and media was either sterilized by filtration (synthetic medium), or autoclaved at 120°C for 20 min (rich YP medium). When required, 20 g/L agar, 3 mg/L antimycin A, or 200 mg/L geneticin (G-418) sulfate were added to the medium. Cells were grown aerobically at 28°C with shaking (160 rpm) in cotton plugged Erlenmeyer flasks filled to 1/5 of the volume with medium. The inoculum for growth assays was prepared by transferring aseptically a single colony from a plate into 5–10 mL of the selected medium containing 20 g/L glucose, and allowed to growth into stationary phase for 2 to 3 days before they were used to inoculate (by a 100 × dilution) new media containing the indicated carbon sources. Culture samples were harvested regularly, centrifuged -based gene replacement procedure as described previously [AGT1 locus by Southern analysis (see below) and analytical colony PCR using 3 primers was performed at 10°C using a Gene Navigator pulsed-field system (Pharmacia Biotech) for a total of 27 hours at 200 V. The pulse time was stepped from 70 seconds after 15 hours to 120 seconds for 12 hours. Following electrophoresis, the gel was stained with ethidium bromide and photographed. The chromosomes separated by PFGE were transferred to a nylon filter by capillary blotting [AGT1 ORF, -73 through +1845 of the MAL31 gene, or +77 through + 1333 of the SUC2 locus were generated by PCR using primers AGT1-F and AGT1-R, MAL31-F and MAL31-R, and SUC2-F and SUC2-R was determined as slope of a straight line between ln OD570 nm and time (h) during the initial (~12 h) exponential phase of growth. Biomass and ethanol yield coefficients were obtained at the end of cell growth or ethanol production, taking into account the amount of sugar utilized. The kinetics of active H+-sucrose or H+-maltose symport were determined as previously described [Sucrose was quantified using 50 U/mL of yeast β-D-fructosidase (Sigma) in 50 mM citrate-phosphate buffer, pH 4.5, followed by glucose determination. Glucose was measured by the glucose oxidase and peroxidase method using a commercial kit (BioDiagnostica-Laborclin). Maltose was determined spectrophotometrically at 540 nm with methylamine in 0.25 M NaOH as described previously ,50. Cellescribed using a The author(s) declare that they have no competing interests.FB, MGD, SLA-J, MLAC, LCM and BUS conceived, designed and performed the experiments. PSDA and BUS contributed with reagents and materials, analyzed the data, and wrote the paper. All authors read and approved the final version of the manuscript.
As HIV treatment is scaled-up in resource-poor settings, the timely identification of persons with HIV infection remains an important challenge. Most people with HIV are unaware of their status, and those who are often present late in the course of their illness. Free-standing voluntary counseling and testing sites often have poor uptake of testing. We aimed to evaluate a 'provider-initiated' HIV testing strategy in a primary care clinic in rural resource-poor Haiti by reviewing the number of visits made to clinic before an HIV test was performed in those who were ultimately found to have HIV infection. In collaboration with the Haitian Ministry of Health, a non-governmental organization scaled up HIV care in central Haiti by reinforcing primary care clinics, instituting provider-initiated HIV testing and by providing HIV treatment in the context of primary medical care, free of charge to patients. Among a cohort of people with HIV infection, we assessed retrospectively for delays in or 'missed opportunities' for diagnosis of HIV by the providers in one clinic. Of the first 117 patients diagnosed with HIV in one clinic, 100 (85%) were diagnosed at the first medical encounter. Median delay in diagnosis for the remaining 17 was only 62 days . There was no statistical difference in CD4 cell count between those with and without a delay. 3787 HIV tests were performed in the period reviewed. Provider-initiated testing was associated with high volume uptake of HIV testing and minimal delay between first medical encounter and diagnosis of HIV infection. In scale up of HIV care, provider-initiated HIV testing at primary care clinics can be a successful strategy to identify patients with HIV infection. Only 5–8% of individuals with Human Immunodeficiency Virus (HIV) infection globally are aware of their diagnosis . In the Much of the HIV testing in the developing world is done through maternity clinics offering antiretroviral drugs for the prevention of maternal to child transmission of HIV or specialty voluntary counseling and testing (VCT) clinics to which people come desiring knowledge of their status. Studies from such settings in South Africa and Côte d'Ivoire have identified factors including 'fear of a positive HIV test', low levels of education and poor housing as associated with low uptake rates ,4. US anIn Haiti neither primary health care nor HIV VCT is widely available and the estimated HIV prevalence is estimated between 2.2 and 3.8% ,12. In tWe performed a retrospective chart review of 117 patients who were ultimately diagnosed with HIV infection attending a public general medical clinic revitalized with monies from the GFATM in Boucan Carré, Haiti, between March 1, 2003 and December 31, 2003. Medical records were reviewed for each HIV-infected patient and the following data were abstracted: age, sex, date of HIV diagnosis, date of first visit to the clinic, number of encounters at the clinic prior to HIV diagnosis, number of days between first visit and diagnosis, and CD4 cell count at time of diagnosis. Any visit to the clinic before the diagnosis of HIV was made (dating back to March 2003) was considered to be a 'missed opportunity' for that patient. Prior to March 2003 the medical clinic was only minimally functional and records were inconsistently kept, HIV testing and treatment and most primary healthcare services were not available (see discussion for further details). 'Delay' was defined as the number of days between the date of the first visit to the clinic and the date that the diagnosis of HIV was ultimately made. HIV testing was performed on plasma specimens using a standardized algorithm of two rapid tests with discordant results settled by Western Blot. Statistical analysis was performed using SAS 9.1™software. We used the Wilcoxon Rank Sum Test to assess differences in CD4 cell count at the time of diagnosis between those with and without a delay in diagnosis, and chi-square analysis for comparison of proportions. This study was approved by Brigham and Women's Hospital Institutional Review Board in USA, and by the Zanmi Lasante Ethics Committee in Haiti.3 . Seven patients had CD4 cell counts <100 cells/mm3 at diagnosis and twenty-one patients had CD4 cell counts <200 cells/mm3at diagnosis. CD4 cell count data were missing for twelve patients.During the review period, 3787 HIV tests were performed and 117 patients were newly diagnosed with HIV infection and included in this study . Fifty-five percent of adult visits (N = 6859) resulted in an HIV test being completed. Of 117 patients diagnosed with HIV, data on prior clinical encounters were available for 112. Medical record review suggested that none of the individuals had previously had an HIV test. Seventy percent were female. Median first CD4 cell count was 351 cells/mmNinety-five of the 112 patients had their HIV diagnosis made at the time of their first clinic visit. Of the 17 patients not diagnosed on the first visit, 14 were tested and diagnosed on the second visit, two on the third visit and one ) on the fifth visit to the clinic.3) and those without a delay . No CD4 cell count data were missing in the group with a delay in diagnosis. There was no significant difference in median age, proportion of females or proportion of patients with CD4 cell count <200 cells/mm3 between the two groups, although power to detect differences between these groups was low. Table Of the 17 who were not diagnosed on the first visit, 14 were female (82%); three were male (18%). The median delay in diagnosis (i.e. the number of days between first clinic visit and HIV diagnosis) was 62 days . No patient's diagnosis was delayed as a result of refusing an HIV test. There was no significant difference in median CD4 cell count between those patients who had any delay in diagnosis , but to evaluate if there were missed opportunities in the context of a minimal package of services during HIV scale up.During the time period of review, there were no fixed, specific criteria in place for when to offer HIV testing, however, providers were encouraged to widely offer HIV testing and were trained to identify clinical signs or symptoms of HIV-related disease and opportunistic infections but not to limit testing to only those with suspicion of immunosuppression. None of the patient charts of those who were HIV-infected specifically suggested that the patient had requested the HIV test (as opposed to being initiated by the provider), but it may not be unusual for clients who are interested in HIV testing to present to primary care clinic and to initially ask to be evaluated for minor complaints. Our staff is also trained to identify this possibility and, as mentioned above, to remain open to offering HIV testing broadly.The results of our study demonstrate that it is possible to have a very low rate of missed opportunities for HIV testing in a high-volume, rural, resource-poor clinic when HIV counseling and testing is integrated into general medical care. This very low rate of missed opportunities occurs, we believe, as a result of a high level of staff awareness and education regarding the importance of considering a diagnosis of HIV infection, and because the same clinician who sees the patient for medical care provides the counseling for HIV testing. This means that HIV voluntary counseling and testing is incorporated into medical care, with no separate wait or visit required by the patient. HIV test results are available within 15 minutes. Comprehensive HIV treatment is available at the clinic.This study has a number of limitations. It is a retrospective, observational study of patients known to have HIV infection and it does not provide information regarding the HIV status of patients who were not offered testing by the staff. Since the exact number of missed diagnoses of HIV is not known, it is possible that a number of those not tested actually did have HIV. However 55% of patient visits resulted in an HIV test and it is likely that in fact more than 55% of patients were tested, since repeat patient visits often occur in the outpatient department but repeat HIV testing within a period of 9 months is rare. Over a 3-year period, 15,000 HIV tests have been performed at the Boucan Carré health center and the HIV prevalence among those tested of 3% has remained consistent with the prevalence reported in this study – almost double the reported local prevalence. This suggests that only a very small proportion of the untested patients could be infected. Furthermore, those found to have HIV in the clinic had higher CD4 counts at diagnosis than those of individuals diagnosed with HIV in the US or Africa ,20. EvenFinally, the power to detect clinically meaningful differences between the two groups was low and the lack of differences in Table In summary, in contrast to similar studies in US and Africa, we found a very low rate of missed opportunities for HIV testing in a rural, resource-limited clinic setting in Haiti after staff was trained and primary care services were reinforced. This demonstrates the success of a rural HIV testing program that is integrated into primary medical care and initiated by providers. HIV prevention and treatment programs will not achieve success without addressing the urgent need for individuals to be aware of their HIV status in a timely manner and provider-initiated testing can be a successful strategy to address this concern.The authors wish to thank Partners In Health/Zanmi Lasante staff and patients. This work was supported in part by the National Institute of Allergy and Infectious Disease and through Partners In Health, the Global Fund to Fight AIDS, Tuberculosis, and Malaria, the Haitian Ministry of Health and numerous private donors. Thanks to Martin Hirsch, MD and Garrett Fitzmaurice, PhD for helpful comments on the manuscript.The author(s) declare that they have no competing interests.LCI designed the study, collected the data and drafted the manuscript. JSM and KAF contributed to the design of the study and helped to draft the manuscript. All authors read and approve the final manuscript.
Pancreatic cancer is the fourth most common cause of cancer related death in Western countries. Advantages in surgical techniques, radiation and chemotherapy had almost no impact on the long term survival of affected patients. Therefore, the need for better treatment strategies is urgent. HER2, a receptor tyrosine kinase of the EGFR family, involved in signal transduction pathways leading to cell growth and differentiation is overexpressed in a number of cancers, including breast and pancreatic cancer. While in breast cancer HER2 has already been successfully used as a treatment target, there are only limited data evaluating the effects of inhibiting HER2 tyrosine kinases in patients with pancreatic cancer.®) and the monoclonal anti-HER2 antibody Trastuzumab (Herceptin®) in patients with non-resectable, HER2 overexpressing pancreatic cancer. Patients eligible for the study will receive Trastuzumab infusions on day 1, 8 and 15 concomitant to the oral intake of Capecitabine from day 1 to day 14 of each three week cylce. Cycles will be repeated until tumor progression. A total of 37 patients will be enrolled with an interim analysis after 23 patients.Here we report the design of a prospective, non-randomized multi-centered Phase II clinical study evaluating the effects of the Fluoropyrimidine-carbamate Capecitabine (Xeloda Primary end point of the study is to determine the progression free survival after 12 weeks of bimodal treatment with the chemotherapeutic agent Capecitabine and the anti-HER2 antibody Trastuzumab. Secondary end points include patient's survival, toxicity analysis, quality of life, the correlation of HER2 overexpression and clinical response to Trastuzumab treatment and, finally, the correlation of CA19-9 plasma levels and progression free intervals. Pancreatic cancer it is the fourth most common cause of cancer related death in Western countries . A recenCapecitabine is an orally applied fluoropyrimidine, which is converted into active 5-FU. Within this enzymatic cascade thymidinephosphorylase finally catalyzes the generation of active 5-Fluoruracil (5-FU). Thymidinephosphorylase is almost exclusively present in tumor cells, the activation of capecitabine to 5-FU is restricted to malignant cells. When applied twice daily capecitabine shows similar pharmacokinetics as a continuous 5-FU infusion ,7. CommoTrastuzumab is a neutralizing humanized antibody directed against the extracellular domain of the HER2 tyrosine receptor kinase. Expression of the HER2neu oncogen is analyzed by immunohistochemistry (IHC) and fluorescent in-situ hybridization (FISH) in routine pathological specimen assessment. The antineoplastic effect of Trastuzumab is well documented in breast cancer and has been ascribed to cell cycle arrest and incuction of apoptosis as well as induction of antibody-dependent cellular cytotoxicity (ADCC) against HER2 – overexpressing tumor cells . A numbeTaken together, the need for novel therapeutic strategies such as target therapy in pancreatic cancer patients is obvious. One approach involves targeting the HER2/neu receptor in combination with cytotoxic agents. Based on the poor outcome of current therapies, we evaluate the activity and tolerability of the combination therapy of trastuzumab plus oral capcitabine in patients with proven HER2 overexpressing advanced pancreatic cancer.This multicentric, multiinstitutional trial has been designed by the Centre of Clinical Trials, University Medical Center Freiburg and by LabConsult GmbH Freiburg. The trial medication (trastuzumab and capecitabine) is supplied by the Roche AG, Basel, Switzerland. Participating study centers are as follows:• Department of General Surgery, University of Heidelberg, Im Neuenheimer Feld 110, 69120 Heidelberg, Germany• Department of Gastroenterology and Hepatology, Freiburg University Hospital, Hugstetterstr. 55, 79106 Freiburg, Germany• Department of Internal Medicine I, University Clinic Tubingen, Ottfried-Müller-Str. 10, 72076 Tübingen, Germany.• Department of Internal Medicine I, Johannes Gutenberg University, Langenbeckstr. 1, 55101 Mainz, Germany• III. Medical Clinic, University Hospital Mannheim, University of Heidelberg, Wiesbadener Strasse 7–11, 68167 Mannheim, Germany• Department of Medicine, Ruhr University Bochum (Knappschaftskrankenhaus), In der Schornau 23–25, 44892 Bochum, Germany• University of Munich, Medical Department III, Klinikum Muenchen-Grosshadern, Marchioninistrasse 15, 81377 Munich, Germany• Department of Internal Medicine I, University of Regensburg, Franz-Josef-Strauß-Allee, 93042 Regensburg, Germany• Department of Pathology, University of Kiel, Michaelisstr.11, 24105 Kiel, Germany.• Department of Medicine, Gastroenterology and Oncology, Municipal Hospital Esslingen, GermanyThe trial is co-ordinated by the Centre of Clinical Trials, University Medical Center Freiburg and by LabConsult GmbH Freiburg. This institution is responsible for overall trial management, trial registration, database management, quality assurance including monitoring, reporting and for the scientific program of all trial related meetings.Patients will be recruited by all participating institutions. All investigators are experienced oncologists from the fields of medical oncology and general surgery at co-operating institutes.For all severe serious adverse events the documentation and relevant patient data are verified by the co-ordinating personnel before submitting the data to the Center for Clinical Trials, Freiburg as well as to Roche with 24 h. The German authorities will be informed by Roche in the case of causal relationship. Severe adverse events are events that cause:• death of study subject• life threatening illness• hospitalization or• extend of hospitalization• permanent or significant discomfort/disabilitiesPatient toxicities will be assessed using the NCI Common Toxicity Criteria (CTC) 3.0 (June 2003). Toxicity will be evaluated before treatment, and prior to each course of trastuzumab and capecitabine and at follow-up. Unacceptable toxicity is defined as unpredictable, or irreversible Grade 4 toxicity.All chemotherapeutic agents are provided by the Roche upon request. Each request comprises 2 cycles (6 weeks).Quality control is achieved by monitoring, auditing and data verification according to the good clinical practice guidelines (GCP). To ensure correct documentation a specially trained independent trial monitor will perform regular visits in the study centers as well as checks on the individual principal investigators. Source data verification is done by the monitor to ensure that all data present in the case report form corresponds to data in the original documents present in the patient folder. Finally audits will be held either by the sponsor or responsible authorities.The final protocol was approved by the ethics committee of the University of Freiburg and by the local ethic committees of participating institutions. This study complies with the Helsinki Declaration in its recent German version, the Medical Association's professional code of conduct, the principles of Good Clinical Practice (GCP) guidelines and the Federal Data Protection Act. The trial will also be carried out in keeping with local legal and regulatory requirements. The medical secrecy and the Federal Data Protection Act will be followed. Written informed consent is obtained from each patient in oral and written form before inclusion and after nature, scope, and possible consequences of the trial have been explained by a physician. The investigator will not undertake any measures specifically required only for the clinical trial until valid consent has been obtained.Patients over 18 years of age with advanced pancreatic cancer (Stage IVb) without the chance of surgical tumor removal are potential candidates for the study and will be screened for inclusion. Recruitment started during the first trimester of 2004 and is expected to be completed within a 36 months period. Table The study is designed as a prospective, open, one-armed multicentric Phase-II trial evaluating the efficacy of trastuzumab in combination with capecitabine compared to capecitabine alone in patients with advanced pancreatic cancer. Efficacy is evaluated by the primary study objective which is progression free survival after 12 weeks. Secondary study objectives are to assess efficacy by evaluating: a) progression free survival time; b) overall survival; c) time till remission ; d) duration of remission; e) rate of "clinical benefit response" after 12 weeks; f) quality of life before treatment and after two 2 cycles of chemotherapy. Additional secondary trial endpoints include toxicity analysis, the rate of adverse events and the relationship between progression free survival and CA19-9 plasma levels. Finally, the relation between HER2/neu overexpression and progression free survival will be evaluated.2 on day 1–14 followed by a break of 7 days. The three weeks cycles will be repeated till tumor progression or till a grade 3–4 toxicity occurs. A detailed overview over the treatment protocol is outlined in Table The trastuzumab loading dose of 4 mg/kg body weight will be given on day 1 over 90 min. For maintenance therapy a weekly dose of 2 mg/kg body weight over 30 min will be infused until tumor progression takes place. Patients will be monitored closely for 6 hours during the first dose of trastuzumab and for 2 hours after the following trastuzumab infusions to rule out adverse reactions. Capecitabine will be applied orally twice daily at a dose of 1250 mg/mAll patients with histologically proven pancreatic cancer undergo appropriate diagnostic studies. The radiological studies induced a chest X-ray, contrast enhanced computed tomography (CT) or magnetic resonance imaging (MRI). Laboratory tests included complete blood count, electrolytes, blood urea nitrogen, creatinine, liver function tests, bilirubin, transaminases, alkaline phosphatase, γGT, total serum protein, albumine and CA 19-9. Furthermore, to meet the inclusion criteria an electrocardiogram and a transesophageal echocardiogram is conducted by cardiologists. HER2/neu overexpression and standardized grading will be performed for each patient. Only in the case of a grade 2 overexpression additional FISH analysis will be done to assess a possible gene amplification. Patients in whom the HER2 immunohistochemistry of the tumor tissue was graded as grade 3 HER2/neu overexpression were included in the study, without performing additional FISH analysis. Also patients with the grade 2 and proven HER2 gene amplification by FISH analysis will be included in the study. To ensure a high quality of histological analysis all samples were analyzed by a highly specialized expert in pancreatic pathology . Furthermore, a thorough physical exam and measurement of vital signs will be performed prior to the start of the study as well as on day 1, 8 and 15 of each cycle. Similarly, blood tests will be performed every week and blood chemistry (including CA19-9 levels) on the beginning of each new cycle prior to the start of the study as well as at the beginning of each new cycle. Quality of life will be assessed using the EORTC QLQ-C30 questionnaire (v 3.0) prior to the start of the study and at the beginning of the third cycle. The assessment will then be repeated every other cycle. EORTC QLQ-C30 serves as a general measure of quality of life in cancer patients. It incorporates nine multi-item scales: five functional scales ; three symptom scales ; and a global health and quality-of-life scale . SpecifiIn addition, analgesic consumption and assessment of pain will be documented at the beginning of each week using a visual analogue scale (VAS) for pain ranging from 1 to 10 with 10 as the highest pain score. Staging of the tumor via chest X-ray, contrast enhanced computed tomography or a magnetresonance imaging will be performed on day 43, followed by restaging every other cycle.Patients who are no longer treated with the study medications due to tumor progression or toxicity will be followed for at least 12 months (max. 4 years).Primary endpoint of this study is progression free survival after 12 weeks. Secondary endpoints are listed in the section "study design and objectives". The sample size calculation is based on the two-step minimax design by Simon . Trials According to the "intention-to-treat" principle all patients fulfilling the inclusion- and exclusion criteria and who have started chemotherapy are included in the evaluation, i.e. even patients who show a fast tumor progression, who die before tumor progression can be evaluated or who die due to treatment related toxicities are included. In addition, "per protocol" analysis of the primary end point will be performed. For this purpose only patients who have received at least 2 cycles of the combination therapy are included. Furthermore, all patients who have received at least one cycle of the combination therapy are evaluated for toxicities and side-effects.If less than 13 of the 23 patients during the interim analysis show progression-free survival the combination therapy might be considered ineffective and the study could be stopped. The degree of HER2 expression of the included patients will be taken into account before the trial is stopped. If, on the other hand, 13 or more of the 23 patients during interim analysis exhibit progression-free survival the recruitment will be extended to 37 patients.The progression free survival after 3 months will be calculated with a confidence interval of 95%. Progression free survival and overall survival will be summarized by Kaplan and Meier estimate. The probability of remission over time will be calculated using cumulative incidence rates. The duration of remission will be summarized by Kaplan and Meier estimates. The clinical benefit response (CBR) probability 12 weeks after initiation of therapy will be estimated by the number of patients that exhibit a CBR within 12 weeks. The correlation between the CA19-9 and HER2 levels with progression free survival time will be analyzed using Cox's regression model. The rate of adverse events or severe adverse events will be given using a 95% confidence interval.Most patients with pancreatic cancer will have to be treated by chemotherapy. So far only limited success has been achieved with this kind of treatment. Addition of multimodal therapies, including radiation and chemotherapy regimes has had only minimal effect on the prognosis of these patients ,23. Up tThe anti-HER2 antibody trastuzumab is a promising new candidate in the treatment of advanced pancreatic adenocarcinoma, because HER2 is overexpressed in a subset of ductal adenocarcinoms of the pancreas . FurtherThis study is a prospective, non-randomized multi-centered Phase II clinical trial evaluating the clinical effects of Capecitabine in combination with the monoclonal anti-HER2 antibody Trastuzumab in patients with non-resectable, HER2 overexpressing pancreatic cancer. Apart from the oncological efficacy of this treatment combination, its toxicity as well as the quality of life of this therapeutic regimen will be assessed. Furthermore, the trial should provide evidence for the relationship between progression free survival and CA19-9 plasma levels as a predictive therapeutic factor. The results of this study will definitely contribute to our current clinical and scientific knowledge on the treatment of locally advanced pancreatic adenocarcinoma.Roche Pharma AG, Grenzach, Germany has supplied the study medication and has paid for registration of this trial at the International Standard Randomized Controlled Trial Number Register (ISRCTN).All authors substantially contributed to the current manuscript as listed below:AM drafted the manuscript. PB revised the manuscript, JH, RH, MG, SK, WS, VH, EE and TS were involved in the conception and acquisition of data of this study. GK performed the pathological analysis of specimens. MG is the principal investigator of the study and designed this clinical trial.The pre-publication history for this paper can be accessed here:
The focus of this study was to test a novel tool for the analysis of motor coordination with an altered visual input. The altered visual input was created using special glasses that presented the view as recorded by a video camera placed at various positions around the subject. The camera was positioned at a frontal (F), lateral (L), or top (T) position with respect to the subject. We studied the differences between the arm-end (wrist) trajectories while grasping an object between altered vision and normal vision (N) in ten subjects. The outcome measures from the analysis were the trajectory errors, the movement parameters, and the time of execution. We found substantial trajectory errors and an increased execution time at the baseline of the study. We also found that trajectory errors decreased in all conditions after three days of practice with the altered vision in the F condition only for 20 minutes per day, suggesting that recalibration of the visual systems occurred relatively quickly. These results indicate that this recalibration occurs via movement training in an altered condition. The results also suggest that recalibration is more difficult to achieve for altered vision in the F and L conditions compared to the T condition. This study has direct implications on the design of new rehabilitation systems. When planning the eannerod . During eannerod . The perThe role of vision during reaching to grasp was studied in detail by either preventing the subject from viewing either only the hand or both the object and the hand during movement . The The brain can adapt to a variety of distortions of visual feedback when reaching for targets, including rotations and lateral shifts, by adjusting hand movements , 17. ThiCerebrovascular accident often results with paralysis (decreased or complete loss of abilities to manipulate the grasp), but also leading to modified association of proprioceptive and visual information coming to the brain and preventing the brain from sending necessary command signals to the periphery , 21. Thehttp://www.myvu.com/) developed for the iPod. The goggles integrate two miniature video monitors into the left and right eye covers. We connected the goggles to the video output of a high-resolution digital camera. Thus, the visual input to the subjects was the image seen by the digital camera. This paper presents the analysis of how one learns to make hand movements in a new visuoperceptual association generated by a simple tool for altering visual input. The alteration of visual input was achieved with commercially available computer goggles and nonsuccessful (object missed). We analyzed the performance on the day one and on day five allowing subjects to practice for three consecutive days with the goggles. This research follows studies related to the so-called perceptual recalibration that takes place when the subject is exposed to altered visual input. It was suggested that when a discrepancy was introduced between the “seen” and “felt” location of an object [We analyzed the learning outcome when vision was altered by presenting the scene recorded by the camera placed at three locations around the working space. The analysis of movement errors relates only to the n object , performn object . One of n object because n object .Ten healthy volunteers with no history of neuromuscular or visual disorders participated in the experiment. All subjects signed the informed consent prior to the experimental sessions. The investigation complied with the declaration of Helsinki and was approved by the Local Ethics Committee.The subjects sat comfortably in a chair in front of a standard large desk covered with a black cloth . The truThe subjects' altered vision was created by positioning the camera in front (F) of the subject, providing a mirror-like view, lateral (L) view from the right side, and top (T) view where the camera was recording from the position above the table. The camera projected the image from these viewpoints to the goggles , insert.The analysis followed the protocol depicted in The recordings on Day 1 were used as the baseline assessment. The session comprised three 30-second trials under all conditions with the altered vision and normal vision. In each trial the subject was asked to repeat the task as many times as he could. In most cases the subject accomplished the task three times. This provided in average nine data sets for each condition.Days 2, 3, and 4 were allThe final evaluation was on Day 5 with the same protocol as the one described for Day 1.The kinematics of arm-end point during reach and grasp activities were recorded in the Human Performance Lab at the Center for Sensory-Motor Interaction, Aalborg University, using a motion capture system with six cameras mounted on the tripods and positioned around the workspace. Two markers were placed on the lateral and medial aspects of the wrist. The marker positions were acquired at 50 Hz using Qualisys Track Manager and then exported to Matlab. The 3D trajectory of the wrist joint was calculated as the mean of the two recorded marker trajectories and was then projected onto the plane coincident with the surface of the table to obtain the resulting 2D trajectory of the movement. The calculated signal was filtered using a second-order dual-pass Butterworth filter at a cutoff frequency of 10 Hz based on previously published literature , 26.We distinguished between performed and unsuccessful tasks when the subject failed to grasp the object. This unsuccessful case was termed “no pick-up” error, and the measure was the number of “no pick-up” errors. The evaluation of the successful trials comprised analysis of the following: (1) End-point Error—EE, (2) sequence parameters, and (3) time of execution. End-Point-Errors (EEs). An end-point error (EE) was defined as the distance between the reference point (the center of the circle in the workspace) and the actual end point of the trajectory for sequences 1, 2, and 3. We distinguished between the contralateral 1 EE (end of sequence 1), ipsilateral EE (end of sequence 2), and contralateral 2 EE (end of sequence 3).Sequence Parameters. Peak velocity (PV), acceleration phase duration (AD), and deceleration phase duration (DD) were computed for each of the four sequences. PV was defined as the highest point on the velocity profile. AD was defined as the time from the onset of sequence movement to the time of peak velocity. DD was defined as the time from the peak velocity to the end of the sequence movement. Sequence movement onset and the end of the sequence movement were defined as times when the velocity was higher or lower than 5% of the peak velocity, respectively.Time of Execution (TE). TE was defined as the total duration of the complex four-sequence movement.P < .05.A one-way repeated-measures analysis of variance (ANOVA) was used to assess differences in errors between the first and fifth day. Significant differences were determined by the Student-Newman, Keuls test for multiple comparisons. The outcomes were declared significant at Note that on Day 1, the trajectories were scattered within the workspace, especially for conditions F and L. Furthermore, the end points of the individual sequences often ended up outside of the reference circles. On Day 5, the trajectories were more consistent, and the end points accumulated within or in close proximity to the reference circles. The latter is also demonstrated in P < .05). The contralateral 1 EE was higher before the training sessions than after, and this difference was statistically significant for the F = 7.83, P < .03), L = 6.73, P < .02), and T = 4.09, P < .04) conditions. In addition, contralateral 1 EE was greater for the F, L, and T conditions on Day 1 than the EE for the N condition, and this difference was statistically significant for the F, L, and T conditions = 7.28, P < .03); = 5.43, P < .01); = 3.64, P < .05). On Day 5, the errors for the F, L, and T conditions became comparable with those for the N condition.We show one result for the N-condition because there was no difference in the recordings between Days 1 and 5. There was no Negative Aftereffect . P < .03) and L = 6.23, P < .05) conditions. In addition, contralateral 2 EE for the F, L, and T conditions was greater on Day 1 than the EE for the N condition, and this difference was statistically significant for the F and T conditions = 8.12, P < .02; = 7.46, P < .05). On Day 5, the errors for the F, L, and T conditions became comparable with those for the N condition.The contralateral 2 EE was higher before the training sessions than after, and this difference was statistically significant for the F = 8.24, P < .03) and L = 8.78, P < .05) conditions. In addition, the ipsilateral EE for the F, L, and T conditions was greater on Day 1 compared with the EE for the N condition, and this difference was statistically significant for the F and L conditions = 7.68, P < .03; = 8.26, P < .04). On Day 5, the errors for the F, L, and T conditions became similar to those for the N condition.The ipsilateral EE was also higher before the training sessions than after, and this difference was statistically significant for the F = 7.12, For all conditions with altered vision, there was an obvious decrease in AD and DD on Day 5 compared with Day 1 . On Day These observations are consistent with the scattered end points shown in The high trajectory errors and end-point variability on Day 1 were accompanied by an increase in AD, DD, and TE and a decrease in PV for the F, L, and T conditions, as presented in Movement time tends to increase when visual feedback is reduced , mostlyThe presented data further extend the findings of Van Opstal and Van Gisbergen ; Sivak aSubjects' performance even increased across trials on Day 1 as shown in On Day 5, EE and no pick-up number decreased for all altered vision conditions as presented in Note that on Day 5 the variability of the trajectory end points decreased (full circles on A similar pattern (decrease in the trajectory errors and increase in peak velocity from Day 1 to Day 5) was obtained in the F and L conditions in contrast to the T condition. This result suggests that although a general learning occurred, it was not at the same level for all views.Video-controlled reaching tasks represent a complex and original visuomotor situation because there is a discrepancy between the working and visual spaces, implying more elaborate processing of spatial information . We analyzed subjects' performance on the first and the fifth days of goggle use to assess their ability to learn reaching and grasping with an altered visual input. We tested how the CNS deals with imposed artificial visual feedback compared with normal visually guided reaching. On Day 1, the altered vision resulted in worse performance than normal vision. However, by Day 5, the sensory systems had adapted to the discrepancy, returning perception and performance to near normal. One of the suggestions of these results is that this adaptation consists of “recalibrating” the transformation between the visual and proprioceptive perception of spatial location . PerceptWe do not assume that perceptual recalibration and visual-motor skill acquisition (a task-dependent adjustment of the motor response to compensate for a manipulation of the working environment) are mutually exclusive –34. On tWhen visuomotor discrepancies occur, feedback that is perceived to be coincident with the limb is registered as an internal error, leading to the induction of a perceptual recalibration. Feedback that is not perceived to be physically coincident with the limb is registered as an external error, leading to the reduction of error during exposure . It is aOur results suggest that the difference between altered vision tasks and normal visually guided reaching leads to an adaptation in the form of perceptual recalibration, where proprioception is calibrated in terms of the visual system. If the adaptation is expected to take the guise of a more cognitive, problem-solving process, we can refer to this as the visual-motor skill acquisition. Future studies are warranted to further explore this issue. The ability to predict with some confidence which of these two types of adaptation a peripheral manipulation would allow for a prediction of whether significant improvement is likely to occur on training, how persistent the adaptation will be, and whether it will result in Aftereffects .One of the envisioned applications of the results of this study is for rehabilitation of stroke patients. In stroke patients, a dissociation of proprioception and vision is caused due to the impaired sensory-motor systems. The accepted approach for effective therapy suggests intensive repetitive exercise, being possibly augmented with assistive systems such as functional electrical stimulation or assisThe other application that is envisioned relates to the inclusion of cognitive vision in the control loop for transradial prosthesis , 42. In In this paper, we presented an effective, yet simple new tool for altering visual input when studying motor coordination of reaching during the reach to grasp task. The results show that this alteration of visual input can be graded and, hence, allow for the study of different concepts of learning of the movement. This study partly confirms the negative aftereffect acting after perceptual recalibration due to altered visual input. Namely, the results confirm that the learning of a new skill and perceptual recalibration acted with different proportion during the adaptation period. However, we need to restate that the learning of a new task has not disrupted the previous skills ; therefore, suggesting no negative aftereffect.
Adolescence is a transitional stage from childhood to adulthood that is characterized by physical, physiological, psychosocial and behavioral changes that are influenced to a large extent by the age, culture and socialization of the individual. To explore what adolescent mothers perceive as their struggles during the period of transition from childhood to parenthood (through motherhood) and to describe strategies employed in coping with stress of pregnancy, motherhood and parenthood.Longitudinal qualitative study involving twenty two in-depth interviews and six focus group discussions among pregnant adolescents who were followed from pregnant to delivery, from January 2004 to August 2005. Participant were selected by theoretical sampling and data was analyzed using grounded theory.Overall, young adolescents reported more anxiety, loss of self esteem (when they conceived), difficulty in accessing financial, moral and material support from parents or partners and stigmatization by health workers when they sought care from health facilities. Three strategies by which adolescent mothers cope with parenting and pregnancy stress that were described as utilizing opportunities (thriving), accommodating the challenges (bargaining and surviving), or failure (despairing), and varied in the extent to which they enabled adolescents to cope with the stress.Adolescents on the transition to motherhood have variable needs and aspirations and utilize different strategies to cope with the stress of pregnancy and parenthood. Adolescence is a transitional stage from childhood to adulthood that is characterized by physical, physiological, psychosocial and behavioral changes that are influenced to a large extent by the age, culture and socialization of the individual. Programmes for adolescents often fail to recognize the heterogeneity and widely differing needs of the group ,2, whichResearch employing qualitative methods (to explore coping with pregnancy and motherhood) may provide the necessary information for informing policy and practice for care of adolescents. Firstly, it provides information on experiences, significance, consequences and implications of adolescent behavior from the perspective of the adolescents themselves ,2. SeconThis study was carried out in Mulago hospital, the national referral hospital in Kampala, Uganda from January 2004 to August 2005, in a cohort of pregnant women recruited from the antenatal clinic and followed up to delivery and postnatal clinic. Of the women who attend the hospital's antenatal clinic, about 40% are adolescents, several of whom already have children. The data is derived from twenty two in-depth interviews and six focus group discussions (involving 52 adolescent women). The participants were interviewed during pregnancy and within the first six weeks after delivery. The focus groups were conducted after delivery, and were arranged according to two age groups: those aged 16 years and less and those more than 16 years. Theoretical sampling was used for participant selection: after each interview, data was evaluated to decide next interviewee or which issues to explore further in the focus groups, until data saturation. Interviews carried out in English or Luganda lasted 45 to 60 minutes and were tape recorded. Ethical clearance to carry out the study, including permission to conduct research on adolescents who are minors, was obtained from Makerere University Higher Degrees Committee, Karolinska Institutet Ethics Committee, Mulago Hospital and Uganda National Council of Science and Technology. Participants gave written informed consent before participation in the study, and were offered psychological counseling for domestic violence and given health education on how to improve personal safety. Those who needed further counseling were referred to professional counselors.The study employed the stress and coping model to exploGrounded theory was employed for data analysis. Using Easy Text software for data retrieval, analysis involved an inductive process of developing codes (open coding) according to key concepts from transcripts and (field) notes. Related emerging codes were identified by selective coding and grouped into categories by constant text comparison. Some codes were descriptive of the coping strategy employed, others were interpretive (the desired consequence of the strategy) or explanatory (reason why the chosen strategy was employed and perception of whether it was successful).The participants' age ranged from 14 to 19 years. Only three of those interviewed were in formal employment. Twenty three participants had no formal education, and only five had gone up to secondary level of education. All reported that the relationships that led eventually to the conception were consensual. Only four were in marital relationships which had been formalized or legally recognized, though another six reported that they were cohabiting (living with their partners/boyfriends with the knowledge of their parents or other close relatives). They reported anxiety, loss of self esteem (when they conceived), difficulty in accessing financial, moral and material support from parents or partners and stigmatization by health workers when they sought care from health facilities. There was no major distinction in coping mechanisms according to age group of the adolescents. Analysis of the data revealed three major themes: Utilizing opportunities for change (thriving), accommodating the challenges while tolerating the abandonment of support (bargaining and surviving), or failure to handle the stress in their lives to such an extent that they were overwhelmed by the struggle(despairing).Overall, motherhood was a positive experience for the younger and older adolescents, and was looked upon with pride and joy for most adolescents interviewed and those in the focus group discussions. To many adolescents, it was apparent that they had partly achieved what was their heart's desire. This is exemplified by one 18-year-old participant who was having her second pregnancy:"I was (at the beginning) dismissed from school. My brother (with whom I was staying with) sent me away when I became pregnant, saying that this will embarrass his family as he was a preacher... It is important that you get your children when you are young and strong.... I (later) stayed with my grandmother in the village. Life (then) was not easy. (When) I moved in with my boyfriend, he put me in his shop (where I worked) until I delivered (the first child). (Later) we got married, .... and he gave me money to enroll for a computer course and secretarial work at Y.W.C.A. I (now) have a good job stay with my young sister. He (my husband) pays my school fees."Whereas some adolescents were eager to settle down into parenting and childrearing roles, some adolescent mothers had high hopes of returning to school once they have given birth. Some had no immediate plans to settle down in marriage, and were ready to go back to school as long as there was someone ready to look after their child, especially if it was their parents or one of the relatives. With such optimism, they were willing to nurse their children and cope with the stress of pregnancy, childbirth and parenthood. This optimism is exemplified by one 16-year old mother:"It (getting pregnant) was a mistake... I do not plan to marry. I (think) I will go back to school... I will have to change to a new school. I don't think they will accept me back (in my former school). I even got some notes (from some friends) and will go for coaching (if this is necessary). ...(Probed on who will look after the child): My mother is ready to take care of my child. My father will get for me fees. I (promised them) will not be involved in this (relationship) again. In fact they have already secured me a place in a day school, .... and I don't care whether he gets someone else."The findings demonstrate that the optimistic coping style (emotion-focused) was frequently used as an effective coping style for the stress of pregnancy and motherhood in these women. From the focus group discussions, such optimistic approaches suggested lack of understanding of the challenges that pregnancy, childbirth and motherhood will place upon them. Participants acknowledged that some adolescents settle down to serious studies after pregnancy, arguing that they have "learnt their lessons", "have no need to adventure", "are more mature and understanding of the world". Such successful participants can be described as thriving despite the adolescent pregnancy and parenthood. The acknowledgement/acceptance of the adolescent pregnancy, moral support to the adolescent mother and material/financial support to look after the child, were important factors that minimized the adolescents' stress and enabled them to cope adequately with pregnancy and subsequent motherhood.For some adolescents, it was apparent that the pregnancy was planned, and even where it was unplanned, financial, relationship and security were assured, guaranteed or expected. Such adolescents described their relationships as "stable" or "strong", and expressed positive attributes of an adolescent pregnancy and motherhood, as exemplified by one 19-year-old participant from one focus group who was not staying with the partner:I am happy where I am. I do not regret getting pregnant. Actually he (the man) advised on family planning but I refused (for no particular reasons). I am now in a stable relationship (though he has another family). I am happy with my two children even though most of the time he(the child's father)is not around. But (he is a soldier) so I understand his situation even when he does not send support. ...I wouldn't advise anyone to get children when they are too old, and I don't regret.""Traditional views of adolescent mothers perpetuate negative stereotypes and fail to acknowledge many who seem to cope adequately and provide care for their children despite the challenges. The acknowledgement/acceptance of the adolescent pregnancy, moral support to the adolescent mother and material/financial support to look after the child were perceived to be dependent on paternal recognition. As long as the fathers of the children acknowledged and accepted the paternity, the parents/relatives were willing to look after the children of adolescent mothers so that they could go back to school.Paternity acceptance was also a preliquisite for the adolescent mothers to move into a more permanent relationship with the father of the child. Unfortunately, some boyfriends/partners were reportedly unwilling to admit paternity (for three of the babies of adolescent mothers interviewed). From focus groups, participants acknowledged that this problem was common and pervasive. Some of the reasons why it was common were that it (admitting paternity) jeopardizes boys' educational and employment opportunities. Other participants thought it was because partners (and their parents) were irresponsible. This was a major source of stress to the adolescent mother, as described by a 17-year-old mother, who reported rejection of the pregnancy and the baby by her boyfriend's family:"It is hard to accept (that the father has denied responsibility) because they (his or my parents) can't look after you and the child when pregnant. (Probed on why this is so) Sometimes they are forced to deny (responsibility) by circumstances. (They)...fear arrest and imprisonment and may be discontinued (from school) so that (both) your education may end. But yours has also ended and you have no support so what are you expected to do? Sometimes you have nothing. Even the breast milk may not be adequate and you don't have what to feed the baby."From the interviews and focus group discussions, many teenage mothers reported renewed vigor, strength and hope in with the birth of the children, despite despair during pregnancy. Motherhood and parenting roles were described as "satisfying" and "fulfilling", as it gave adolescents new identity and status. In others, the adolescents satisfaction was reduced by coexisting burdens such as waking up to nurse the baby, having no assistance with looking after the baby, or rebuke by health workers, relatives and even strangers who disapproved of adolescent pregnancy in particular or adolescent sexual relationships in general. Some felt that most people they interacted with considered them unsuitable to be parents by virtue of their age, and experienced. stigmatization. In focus groups discussions, adolescents felt they got inadequate social, moral, material and financial support from their relatives or their partners, and health workers were singled out as a group that has negative attitudes to pregnant adolescents and mothers. To such mothers, adolescent pregnancy and motherhood was big but bearable burden, and were willing to make sacrifices to succeed in their new roles.Some adolescents described stories of unhappiness in adolescence which extended through pregnancy into motherhood, disrupted lives, turmoil during adolescence and a need to find love and connection in their lives (which they had partly achieved from the adolescent relationships and subsequent pregnancy and motherhood). Unfortunately for some, this happiness was short-lived, as described by a 16 year old mother:"At the beginning I did not care about what people said, though I was worried about my safety and that of my baby. My boyfriend was not working, so (though) we had little (but) we shared (what we had). But when (my boyfriend) changed, this affected me as we could no longer understand each other. ...we were always quarreling and fighting. I (at times) regretted my (stubborn) behavior (of getting involved in groups and getting boyfriends) which had landed me in this (trouble). I did not know that he could change because he showed me a lot of love and things were alright (at the beginning) before they (misunderstandings) started. Now (though) I don't have any where to go we will survive."Such adolescents indicated a surprising level of maturity and commitment to pregnancy, motherhood and adolescent parenthood. Expectedly, these mothers described motherhood and parenthood as a positive force that helped change their lives to a more productive and hopeful future, despite their stress and struggles. To some adolescents, conception and motherhood provided acceptance and recognition by the partners' family, which improved their self worth and esteem. This is exemplified by an 18-year-old mother who was interviewed during pregnancy and six weeks after delivery:"It is hard to leave because you can not stay alone and look after yourself when pregnant. ....My parents and relatives rejected me and they (his people) don't like me. I don't think they like me. I don't think they will change....Sometimes you are forced to go back (to the boyfriend to ask for help) by circumstances, but would not if you could survive on your own."Interview before delivery: Such has not happened since delivery..... My concern now is to settle down with him and his family. They (he and his family) have been giving me "support", which was not the case (before becoming pregnant or delivery). I think they like (me and) the baby and we will look after the baby (together with them)."Interview after delivery: While most adolescents seemed to cope with the stress of the transition from adolescence to parenthood, some seemed unable to cope. Some participants felt nearly overwhelmed by the heavy burden of stigma due to the adolescent pregnancy and were just struggling to survive. Such adolescents expressed regrets that pregnancy reduced their opportunities in life, and regretted the decision to get into relationships, conceive or go into motherhood at an early age. Three participants strongly regretted having kept the pregnancy in the initial interview during pregnancy , which cast doubt about the future safety of the newborns. They further reported difficulties in breastfeeding and bonding with the children and their babies were apparently underweight or malnourished. To such women, the transition from adolescence to motherhood was a bumpy road with few episodes of happiness or satisfaction, to an extent that they appeared desperate, overwhelmed by the stress of pregnancy and subsequent motherhood. This is exemplified by one of them, a mother of three, who despite moving into a marital home with the father of her child at 15 years, found married life, parenthood and child rearing difficult and on many occasions 'unbearable":"It is hard to survive because you can't look after yourself and the baby. (I) can't even get a job as you are not educated. You have nobody to help you and nowhere to turn. ... could survive on odd jobs but what you get is not enough. I have nowhere to leave the child and feeding it is a problem. (I understand why) sometimes some women abandon their babies, (as you are) forced to by circumstances."For some adolescents in the focus groups, their view of motherhood and childrearing were negative and to some extent could be described as "hostile". Hostile childrearing attitudes contributed to increased stress in the adolescent mothers. From discussion on what could be responsible for such negative perceptions and what were likely consequences of such behavior, a pattern emerged, suggesting that those with more hostile attitudes engaged in behavior that contributed directly to making their lives more stressful. Such behavior also made it difficult for them obtaining the moral and financial support they needed, subsequently making it difficult for them to look after their children successfully. Some of the behaviors described included having multiple sex partners, alcohol abuse and drug abuse (often starting before they conceived or extending into the postpartum period).Risk-taking was also influenced by or associated with lack of security and safety in daily lives, emotion-focused coping and peer pressure. Such a combative coping style (problem-focused) was also used and found to be effective by some adolescents, as exemplified by one participant, a 17-year-old single mother, who seemed overwhelmed by the stress of adolescence, pregnancy, motherhood and parenthood:"I think it was wrong to marry (at an early age) and I am now regretting. I only stayed (with him) because I am not sure what to do or where to go. I (now) have someone else who is the not father of the child (pregnancy) though he is not aware. Some (of my friends) have advised me to leave (him). (The most important thing is that) it is my child I cannot leave my child to suffer."In many developing countries especially in sub-Saharan Africa, adolescent pregnancy is readily identified as one of the pressing social and reproductive health issues. However, this perception is rarely translated into programmes that effectively reach adolescents' needs. This may be due to lack of awareness of their specific needs. This study that explored experiences and coping strategies of adolescents on the transition from adolescence to parenthood indicates that many adolescents take on adult roles and responsibilities when they are ill-prepared. This affects adolescents to different extents. The study shows that teenage pregnancy and parenthood may be socially accepted as a source of identity and status and may be prestigious to some adolescents. While they may be undesirable and strongly resented but tolerated in some adolescents, they may markedly reduce the quality of life of those affected in others.The findings are in agreement with other studies on adolescents in both developed -13 and dThe findings are in agreement with Varga (2003) that gender roles are important contextual determinants of the decision-making process for adolescents. Secondly, psychological factors may influence risk taking behaviour in young adults, a finding that has been observed even in developed country contexts such as Australia and Sweden -13. TheyThe implication study's findings is that healthcare providers need to recognize that pregnant adolescents and adolescent mothers have varying needs. They should carefully assess each individual's strengths, weaknesses, hopes, and goals prior to developing a plan of care. They also need to design relevant and appropriate strategies to reduce adolescents' stress or offer relevant health education to enable them cope with stress of pregnancy and motherhood. Secondly, adolescent programs need to be flexible in order to be responsive to the changing needs of the adolescents as they negotiate the transition from adolescence to motherhood and parenthood.Adolescents on the transition to motherhood have variable needs and aspirations, and therefore use different strategies to cope with the stress of pregnancy and parenthood. The stress and coping model can be used to explain and interpret the behavior exhibited by adolescents as they negotiate this transitional period.The author(s) declare that they have no competing interests.DKK was involved in the conceptualization and design of the study, design of the interview instruments, data collection, data analysis, manuscript writing and revision of the manuscript at all its stages.The pre-publication history for this paper can be accessed here:
Out of 41 patients, 38 received at least one cycle of therapy. There were no differences in activity or tolerability between the two docetaxel doses. G3/4 toxicities were neutropenia (49%), diarrhoea (10%), acne-like rash (5%), and anaemia (2%). Complete plus partial responses (CR+PR) were observed in 22 out of 41 patients with a 54% response rate 45–75%). The 22 patients that achieved a response following six cycles of docetaxel plus gefitinib continued gefitinib monotherapy . Two patients with PR following combination therapy achieved a CR during gefitinib monotherapy. Complete plus partial responses correlated with oestrogen receptor (ER) status, since they occurred in 19 out of 27 (70%) patients with ER-positive tumours as compared to three out of 14 (21%) patients with ER-negative tumours (P=0.01).We have evaluated the activity and safety of gefitinib, a small-molecule epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor, in combination with docetaxel as first-line treatment of women with metastatic breast cancer (MBC). In total, 41 patients with MBC were enrolled in a first-line combination therapy study with oral gefitinib (250 mg day Breast cancer is the most common malignancy among women and is the second leading cause of death for cancer in the Western countries after lung cancer. Although only a minority of patients is initially diagnosed with metastatic breast cancer (MBC), approximately 30–40% of all patients with early breast cancer, which are treated with curative intent will ultimately develop metastatic disease. Survival rates for MBC patients have been improved in recent years. However, despite advances in therapy, MBC largely remains an incurable disease and after documentation of metastasis the median survival time is approximately 2 years . Docetaxα (TGFα), in the mammary epithelium results in mammary hyperplasias and carcinomas after a prolonged latency pathway contributes to a number of processes involved in cancer cell proliferation, survival and invasion rendering it an attractive target for anticancer therapy . StudiesThere are several agents in clinical development that target the EGFR, and two of the most effective pharmacologic approaches currently under clinical investigation are small-molecule EGFR tyrosine kinase inhibitors and EGFR-blocking monoclonal antibodies . Gefitin−2 and 100 mg m−2).Based on these preclinical data, we have performed a phase II study of the combination of gefitinib and docetaxel as first-line treatment in patient with MBC. We have evaluated the safety, the tolerability profile and the clinical activity of gefitinib, 250 mg daily, in combination with docetaxel on a 3 weeks schedule at two different doses greater than 1.5 × 109 l−1 (L) and platelets greater than 100 × 109 l−1; ALT or AST⩽1.5 times the upper limit of normal range (ULRR) and alkaline phosphatase of ⩽2.5 times the ULRR; bilirurbin within normal limits and creatinine of ⩽1.5 times the ULRR. Women of childbearing potential should have had a negative pregnancy test before enrollment and were advised to practice appropriate contraception while on study. Patients were excluded from treatment with phenytoin, carbamazepine, barbiturates or rifampicin while on protocol. Concomitant bisphosphonates were allowed for patients with bone metastasis. This study was conducted in accordance with the Declaration of Helsinki and the study protocol was reviewed and approved by the local Research Ethics Committees . Before study entry, each patient signed a written informed consent. Patients were enrolled between August 2002 and May 2004. Data analysis has been performed 12 months after the last patient had been enrolled (31 May 2005). The median follow-up was 23 months .Female patients aged 18 years or older with histologically confirmed MBC who had not previously received chemotherapy, hormonal therapy, immunotherapy or treatment with monoclonal antibodies for metastatic disease were eligible for this study. Patients were required to have measurable disease as defined in the Response Evaluation Criteria in Solid Tumours (RECIST) criteria and adequate general health status . Patients who had received prior radiotherapy within the 2 weeks before entry into the trial were ineligible. Any patient with a history of a second malignancy within 5 years, with the exception of curatively treated basal cell carcinoma of the skin or cervical cancer −2 as intravenous (i.v.) administration for 60 min, every 3 weeks. Docetaxel dose was escalated to 100 mg m−2 i.v. administration for 60 min, every 3 weeks, after the first 14 patients completed the planned treatment without the occurrence of any unacceptable toxicity as defined by an event that required dosage reduction or interruption in more than three patients. Patients received three doses of prophylactic dexamethasone, 8 mg i.m., every 12 h starting the 24 h before docetaxel infusion. Toxicities were graded according to the National Cancer Institute Common Toxicity Criteria (NCI-CTC), Version 2.0. Dose interruption was planned for NCI-CTC grade 3 and 4 toxicity related to gefitinib. Once the toxicity decreased in severity to grade 1, the patient may have continued on the assigned dose. Repeated dose interruptions were allowed as required, for a maximum of 14 days on each occasion. No dose reduction was allowed. If toxicity recurred after drug rechallenge, and further interruptions were considered insufficient to manage the toxicity, gefitinib discontinuation was required and patients were withdrawn from the trial. To manage docetaxel-related toxicity, treatment with docetaxel was delayed by no more than 2 weeks. If treatment was delayed for either haematologic or nonhaematologic toxicity for more than 2 weeks, the patients were withdrawn from the trial. In case of grade 2 neutropenia and of grade 3 thrombocytopenia, treatment with docetaxel was delayed until toxicity was resolved to grade 1 or less. In case of repeated delays due to grade 2 neutropenia, the dose of docetaxel could be reduced to 75 mg m−2 or to 50 mg m−2, for all the subsequent infusions in patients who received, respectively, the initial docetaxel dose of 100 mg m−2 or of 75 mg m−2. If further delays were required the patients would have been withdrawn from the trial. The treatment with docetaxel was planned to be discontinued with patients taken off study in case of grade 4 neutropenia for 7 days or more and/or grade 3–4 neutropenia with axilar fever ⩾38°C or documented infection.Docetaxel and gefitinib combined treatment was planned for initial three cycles. Patients who had a clinical response (i.e. patients with complete response (CR), partial response (PR), or stable disease (SD)) after the first three clycles received additional three cycles of combination therapy. Gefitinib was continued as monotherapy only for patients who had CR or PR after the end of six cycle of combination therapy and this treatment was given until disease progression, unacceptable toxicity or withdrawal of consent. Patients received gefitinib, 250 mg, orally, once daily, continuously, in the morning at approximately the same time each day. The initial docetaxel dose was 75 mg mBefore study entry, a complete medical history, physical examination including performance status, height, weight and vital signs, electrocardiogram, urine analysis, pregnancy test if indicated, and radiographic tumour assessment within 21 days before start treatment were performed. Patients were evaluated at the start of each cycle during the combination treatment with physical examination, laboratory tests while adverse reactions were documented every week, whereas radiographic tumour assessment was repeated at the end of cycles 3 and 6. During gefitinib monotherapy, physical examination, haematology, biochemistry, evaluation of adverse events and radiographic tumour assessment were performed every 6 weeks until patient progression or trial closure.The primary objective of this trial was to evaluate the activity of oral gefitinib administration in combination with docetaxel as first-line treatment in patients with MBC by estimating the objective tumour response rates (CR and PR) according to the RECIST criteria and gefitinib. Since no major toxicity occurred, as per protocol planning, the following 27 patients enrolled in this study were treated with combination of docetaxel (100 mg m−2 dose) and gefitinib. There were no differences in grade and profile of toxicity between the two docetaxel doses. Therefore, toxicity data are presented on the whole 41 patient population. Thirty eight patients received at least one cycle of combination therapy with docetaxel and gefitinib. In general, treatment was well tolerated. The worst grades of treatment-related toxicity for the 41 patients are listed in A total of 216 cycles of docetaxel infusions were administrated. None of the patients had docetaxel dose delay and no woman developed toxicity requiring dose adjustment of docetaxel. The first 14 patients were treated for up to six cycles with the combination of docetaxel . Five CRTo our knowledge this is the first report on docetaxel and gefitinib combination as first-line treatment of patients with MBC. The results of this study suggest that treatment with docetaxel and gefitinib is an active and generally well-tolerated regimen in women with MBC who have not been previously treated for metastatic disease. Most of the toxicities observed were consistent with those expected when using docetaxel as single agent (reviewed in The RR reported in this trial are in a range which is comparable to those obtained when docetaxel is combined with antracyclines (reviewed in A potentially interesting observation which emerges from our study is that a statistically significant association has been found between clinical response to gefitinib plus docetaxel treatment and ER status . In factIn summary, the results of this study suggest that treatment with gefitinib in combination with docetaxel is a potentially active and well-tolerated regimen in untreated patient with MBC. A clinically relevant issue is the identification of potential predictive factors, which could help to select breast cancer patients who could respond to anti-EGFR targeted therapies. The results of this study suggest that women with ER-positive tumours have a higher RR and are most likely the patients that could benefit from the docetaxel plus gefitinib combination. However, further clinical translational research studies are necessary to define the role of gefitinib alone and/or in combination with docetaxel in the management of this subset of MBC patients.
Whether or not a document is about a particular topic is computed from term frequencies, modeled as Poisson distributions. Unlike previous probabilistic retrieval models, we do not attempt to estimate relevance–but rather our focus is "relatedness", the probability that a user would want to examine a particular document given known interest in another. We also describe a novel technique for estimating parameters that does not require human relevance judgments; instead, the process is based on the existence of MeSH ® in MEDLINE ®.We present a probabilistic topic-based model for content similarity called pmra retrieval model was compared against bm25, a competitive probabilistic model that shares theoretical similarities. Experiments using the test collection from the TREC 2005 genomics track shows a small but statistically significant improvement of pmra over bm25 in terms of precision.The pmra model provides an effective ranking algorithm for related article search.Our experiments suggest that the WheneveThere is evidence to suggest that related article search is a useful feature. Based on PubMed query logs gathered during a one-week period in June 2007, we observed approximately 35 million page views across 8 million browser sessions. Of those sessions, 63% consisted of a single page view–representing bots and direct access into MEDLINE . Of all sessions in our data set, approximately 2 million include at least one PubMed search query and at least one view of an abstract–this figure roughly quantifies actual searches. About 19% of these involve at least one click on a related article. In other words, roughly a fifth of all non-trivial user sessions contain at least one invocation of related article search. In terms of overall frequency, approximately five percent of all page views in these non-trivial sessions were generated from clicks on related article links. More details can be found in were assigned to a citation, than the term "headache" must be elite in that abstract. We can record the frequency of the term and estimate λ from such observations. Similarly, we can treat as the non-elite case terms in a document that do not appear in any MeSH descriptors, and from this we can derive μ. There is, however, one additional consideration: from what set of citations should these parameters be estimated? A few possibilities include: the entire corpus, a random sample, or a biased sample . In this work, we experiment with variants of the third approach.Nevertheless, we must still determine the parameters η based on MeSH descriptors using a similar procedure, this assumes that the coverage of MeSH terms is complete, i.e., that they completely enumerate all topics present in the abstract. Since the assignment of MeSH is performed by humans, we suspect that recall is less than perfect–therefore, we do not explore this idea further.As a final note, while it is theoretically possible to estimate the parameter pmra retrieval model against bm25–a comparison that is appropriate given their shared theoretical ancestry (see Section 3.2). Despite the popularity and performance of language modeling techniques for information retrieval . Precision, a standard metric for quantifying retrieval performance, is defined as:More specifically, we measured precision at a cutoff of five retrieved documents, commonly written as P5 for short. Since our test collection contains a list of relevant PMIDs for each information need , this computation was straightforward.We performed two types of experiments:• a number of runs that exhaustively explored the parameter space to determine optimal values, andpmra using parameters that were estimated in different ways.• additional runs of pmra experiments used the ranking algorithm described in the previous section. For bm25, we used the complete text of the abstract verbatim as the "query" and treated the resulting output as the ranked list of related documents. Finally, as a computational expedient, we ran retrieval experiments as a reranking task using the top 100 documents retrieved by bm25 with default parameter settings , as implemented in the open source Lemur Toolkit for language modeling and information retrieval [The etrieval . Due to bm25, we tried all possible parameter combinations, with k1 ranging from 0.5 to 3.0 in 0.1 increments and b from 0.6 to 1.0 in 0.05 increments. This range was selected based on the default settings of k1 = 1.2, b = 0.75 widely reported in the literature. Our exploration of the pmra parameter space started with arbitrary values of λ and μ. Assuming that the performance surface was convex and smooth, we tried different values until its shape became apparent. This was accomplished by first fixing a λ value and varying μ values in increments of 0.001; this process was repeated for different λ values in 0.001 increments.The following procedures were adopted for our exhaustive runs: For λ and μ for pmra were estimated using the procedure described in Section 1.2, on different sets of citations. We also performed cross-validation as necessary to further verify our experimental results.In the second set of experiments, bm25 are shown in Figure k1 and b, P5 performance is relatively insensitive to parameter settings (more on this below). Results for the pmra parameter tuning experiments are shown in Figure λ and μ (more on this in Section 3.3).The results of our exhaustive parameter tuning experiments for bm25 is achieved with k1 = 1.9 and b = 1.0; by the same metric, the optimal setting for pmra is λ = 0.022 and μ = 0.013. Table bm25 and optimal pmra, which we refer to as bm25* and pmra* for convenience. For comparison, the performance of bm25 with default parameter values k1 = 1.2, b = 0.75 (denoted as bm25b) is also shown. We applied the Wilcoxon signed-rank test to determine if the differences in the evaluation metrics are statistically significant. Throughout this paper, significance at the 1% level is indicated by *; significance at the 5% level is indicated by . Differences that are not statistically significant are marked with the symbol °. Results show a small, but statistically significant improvement of pmra over bm25 (both default and optimized), but no significant difference between optimized and default bm25. Due to the large number of test abstracts, we are able to discriminate small differences in performance between the models .The highest P5 performance for bm25 are not statistically significant, except for template #3. Optimized pmra outperforms optimized bm25 on four out of five templates, three of which are statistically significant.Information needs from the TREC 2005 genomics track were grouped into five templates, each with ten different instantiations; see Section 5.1 for more details. Precision at five values broken down by template are shown in Table pmra model using the method described in Section 1.2. However, that method is underspecified with respect to the set of MEDLINE citations over which it is applied. We experimented with the following possibilities:We also attempted to automatically estimate parameters for the • The complete set of documents examined by human assessors in the TREC 2005 genomics track is 4.7%. In terms of the PubMed interface, for each abstract, one would expect 2.0 vs. 1.9 interesting articles in the related links display. We argue that although small, this is nevertheless a meaningful improvement.Although we measured statistically significant differences in P5 between per interaction, since a list of related articles is retrieved for every citation that the user examines. In the course of a search session, a user may examine many citations, especially when conducting in-depth research on a particular subject. Thus, the effects of small performance improvements accumulate.PubMed is one of the Internet's most-visited gateways to MEDLINE–small differences, multiplied by thousands of users and many more interactions add up to substantial quantities. In addition, our metrics are measuring performance differences 13 vs. 2.013) would result in potential access to twice as many interesting articles.One might also argue that this accumulation of benefits is not linear. Consider the case of repeatedly browsing related articles–the user views a citation, examines related articles, selects an interesting one, and repeats . In bm25. Indeed, bm25 was chosen as a baseline not only for its performance, but also because it shares certain theoretical similarities with our model. Along with related work dating back several decades [A suitable point of comparison for this work is the Binary Independent Retrieval (BIR) model for probabilistic IR ,6, which decades ,9, thesepmra model was designed for a fundamentally different task–related document search, not ad hoc retrieval. In the latter, the system's task is to return a ranked list of documents that is relevant to a user's query (what most people think of as "search"). One substantial difference is query length–in ad hoc retrieval, user queries are typically very short (a few words at the most). As a result, query-length normalization is not a critical problem, and hence has not received much attention. In contrast, since the "query" in related document search is a complete document, more care is required to account for document length differences.The pmra and bm25 is that there is no notion of relevance in the pmra model, only that of relatedness, mediated via topic similarity. Note, however, that the concept of relevance is still implicitly present in the task definition–in that the examination of documents may take place in the context of broader information-seeking behaviors. In contrast, the starting point of BIR is a log-odds, i.e., P(R\|D)/P(D), which explicitly attempts to estimate the relevance (R) and non-relevance (D). Relevance is then modeled in terms of eliteness (see below). The starting point of our task definition leads to a different derivation.Another important difference between bm25 and pmra attempt to capture term dependencies in terms of Poisson distributions, they do so in different ways. BIR employs a more complex representation, where term frequencies are modeled as mixtures of two different Poisson distributions (elite and non-elite). In total, the complete model has four parameters–the two Poisson parameters, P(E\|R), and P, we plot the optimal value of μ. Superimposed on this graph is a linear regression line, which achieves an R2 value of 0.976, a very good fit. This finding suggests that the relationship between λ and μ is perhaps even more important than their absolute values, since good performance is attainable with a wide range of parameter settings (as long as the relationship between λ and μ is maintained).We see from Figure x-axis we plot values of λ ; the y-axis shows P5 values for two conditions–optimal μ (for that λ), shown as squares, and interpolated μ based on the regression line in Figure λ = 0.022, μ = 0.013, which yields P5 = 0.399) is shown as the dotted line. We see that across a wide range of parameter settings, P5 performance remains close to the global optimum. The Wilcoxon signed-rank test was applied to compare the performance at each setting with the globally-optimal setting: differences that are statistically significant (p < 0.05) are shown as solid diamonds and squares. Only at both ends of the wide λ range do differences become significant.How good is related document search performance along this ridge? The answer is found in Figure pmra model is relatively insensitive to parameter settings, so long as a particular relationship is maintained between λ and μ. Thus, it would be reasonable to apply our model to texts for which controlled-vocabulary resources do not exist.This finding suggests that the bm25, a competitive probabilistic retrieval model. Evidence suggests that the pmra model is able to effectively retrieve related articles, and that its integration into PubMed enriches the user experience.In most search applications, system input is comprised of a short query, which is a textual representation of the user's information need. In contrast, this work focuses on related document search, where given a document, the goal is to find other documents that may be of interest to the user–in our case, the specific task is to retrieve related MEDLINE abstracts. We present a novel probabilistic topic-based content similarity algorithm for accomplishing this, deployed in the PubMed search engine. Experiments on the TREC 2005 genomics track test collection show a small but statistically significant improvement over The test collection used in our experiments was developed from the TREC 2005 genomics track . The TexThe live MEDLINE database as deployed in PubMed is constantly evolving as new articles are added, making it unsuitable for controlled, reproducible experiments. Therefore, the TREC 2005 genomics track evaluation employed a ten-year subset of MEDLINE (1994–2003), which totals 4.6 million citations (approximately a third of the size of the entire database at the time it was collected in 2004). Each record is identified by a unique PMID and includes bibliographic information and abstract text (if available).ad hoc retrieval tasks, e.g., [One salient feature of the evaluation is its use of generic topic templates (GTTs) to capture users' information needs, instead of the typical free-text title, description, and narrative combinations used in other s, e.g., . The GTTIn total, 32 groups submitted 59 runs to the TREC 2005 genomics track, consisting of both automatic runs and those with human intervention. Relevance judgments were provided by an undergraduate student and a Ph.D. researcher in biology. We adapted the judgments for our task by treating each relevant document as a test abstract–citations relevant to the same information need were said to be related to each other. In other words, we assume that if a user were examining a MEDLINE citation to address a particular information need, other relevant citations would also be of interest.bm25 with default paramters. We describe an experiment that examined the potential impact of this setup.Recall from Section 2.1 that for computational expediency, our experiments were performed as reranking runs over results retrieved by bm25 and pmra establish an ordering over all documents in a corpus with respect to a query. Reranking in the limit yields exactly the same results; thus, the substantive question is whether reranking the top hundred hits would yield the same results as searching over the entire corpus. We can examine this issue by tallying the original rank positions of the top five results after reranking–that is, if reranking promotes hits that are highly ranked in the original list to begin with, then we can conclude that hits in the lower ranked positions of the original list matter little. On the other hand, if the reranking brings up hits that are very far down in the original ranked list, it might cause us to wonder what other documents from lower-ranked positions are missed.In theory, both pmra run . For each test abstract, we tallied the original ranks of the top five results, e.g., hit 1 of pmra was promoted from hit 9 of the original ranked list, etc. We divided the original rank positions into ten bins of equal size and plotted a histogram of the bin frequencies. The results are shown by the bar graph in Figure pmra results came from the top ten results in the original ranked list. That is, 80% of the time the pmra algorithm was merely reshuffing the top ten bm25 results–this is not unexpected, since bm25 already performs well and there's not much to be done in terms of improving the results in many cases. The cumulative distribution tops 95% at rank 31 and 99% at rank 67–which means that pmra is promoting hits below these ranks to the top five positions only five and one percent of the time, respectively. Thus, it is unlikely that our reranking setup resulted in different conclusions than if the retrieval had been performed on the entire corpus. This experiment supports the validity of our experimental design.We performed exactly this experiment with the optimal pmra model. JL worked on subsequent refinements, including the parameter estimation method. JL ran the experiments. Both authors read and approved the final manuscript.WJW developed the original
Capacity-building programs are vital for healthcare workforce development in low- and middle-income countries. In addition to increasing human capital, participation in such programs may lead to new professional networks and access to social capital. Although network development and social capital generation were not explicit program goals, we took advantage of a natural experiment and studied the social networks that developed in the first year of an executive-education Master of Hospital and Healthcare Administration (MHA) program in Jimma, Ethiopia.We conducted a sociometric network analysis, which included all program participants and supporters . We studied two networks: the Trainee Network and the Trainee-Supporter Network (25 trainees and 38 supporters). The independent variable of interest was out-degree, the number of program-related connections reported by each respondent. We assessed social capital exchange in terms of resource exchange, both informational and functional. Contingency table analysis for relational data was used to evaluate the relationship between out-degree and informational and functional exchange.2 = 123.61, p < 0.01. We did not find a statistically significant relationship between out-degree and functional exchange in this network, χ2 = 26.11, p > 0.05. In the Trainee-Supporter Network, trainees with the highest level of out-degree had the highest reports of informational exchange, χ2 = 74.93, p < 0.05. The same pattern held for functional exchange, χ2 = 81.31, p < 0.01.Both networks demonstrated growth and inclusion of most or all network members. In the Trainee Network, those with the highest level of out-degree had the highest reports of informational exchange, χWe found substantial and productive development of social networks in the first year of a healthcare management capacity-building program. Environmental constraints, such as limited access to information and communication technologies, or challenges with transportation and logistics, may limit the ability of some participants to engage in the networks fully. This work suggests that intentional social network development may be an important opportunity for capacity-building programs as healthcare systems improve their ability to manage resources and tackle emerging problems. The global health agenda is increasingly focused on strengthening health systems to improve population-level health outcomes in low- and middle-income countries . One comSuccessful management and leadership training programs have improved process-related outcomes in a range of countries, including The Gambia, Ethiopia, and Nicaragua -9. Such Taking a broad view of potential benefits is consistent with current perspectives on capacity-building, which focus on processes that assist individuals, organizations, and societies in efforts to manage, develop, and utilize the resources at their disposal to solve problems ,11, hereAlthough there are a wide range of conceptualizations of social capital , we takeSocial network analysis provides the necessary tools for our analysis as the methodology allows for the assessment of structures in social relationships, as well as the resources exchanged through those relationships . AdditioDespite the number of programs focused on building healthcare worker capacity ,7-9 and The capacity-building program under study was a two-year executive-education Master of Hospital and Healthcare Administration (MHA) program in Ethiopia developed by the Federal Ministry of Health (FMOH), the Clinton HIV/AIDS Initiative (CHAI), Jimma University, and the Yale School of Public Health ,31. The Executives of public hospitals were eligible to apply. The course focused on improving trainees' skills in a range of management-related areas, such as human resources, hospital operations, financial management, strategic planning, and leadership. Trainees also had the opportunity to develop professional connections with each other as well as with leaders and mentors in Ethiopia and the United States.We conducted a cross-sectional study at the end of the first year of the MHA program to describe the social networks that developed during the year. Data were collected with a self-administered survey of two groups of respondents: trainees and supporters. Trainees were the first Chief Executive Officers (CEOs) of public hospitals in Ethiopia. Supporters comprised educators and mentors formally linked with the MHA program through either Yale or Jimma University or through CHAI. We contacted all 25 trainees enrolled in the MHA program and 38 supporters affiliated with the program to complete the survey. All research procedures were approved by the Human Investigation Committee at the Yale School of Public Health and the Institutional Review Board at Jimma University.The self-administered survey was distributed in December 2008 and January 2009 and required approximately 20 minutes to complete. Paper copies of the survey were distributed to all trainees in residence during the December course session and electronic copies were distributed to all other respondents. Surveys were administered in English, which was the language of instruction and a requirement for participants in the MHA program.For this study, we focused on two networks: 1) the Trainee Network, which was comprised solely of trainees, and 2) the Trainee-Supporter Network, which included trainees and supporters (educators and mentors). Respondents were presented with a roster that listed all trainees and supporters. The survey asked all respondents to identify trainees and supporters with whom they interacted for professional purposes. Respondents also noted whether or not they were acquainted with each network member before the MHA program started. From these responses, we derived our measures of interest for each network.We measured a series of network characteristics which have been shown in other settings to promote exchange of information and flow through networks . These mTo describe the network as a whole, the first measure of interest was network density, or the proportion of possible relationships between members that were realized, which described the extent to which network members are connected, regardless of the direction of connections . A more Shifting our focus to individual network members, we calculated degree, the number of connections between a given network member and all other network members, regardless of the direction of ties . The bulth percentile for each network, resulting in categories of 'low exchange' and 'high exchange' for each network. Based on the distribution of data, 'low exchange represents zero reported informational exchange in the Trainee Network.To assess potential by-products of social network development, we measured informational and functional exchanges, which are complementary manifestations of social capital that can help trainees achieve work-related goals ,24. Infoth percentile for each network, resulting in categories of 'low exchange' and 'high exchange' for each network.Functional exchange described the provision of tangible support from one network member to another . Such exWe conducted a sociometric network analysis for both the 25-member trainee network and for the larger 63-member trainee-supporter network, which included educators and mentors (n = 38) in addition to trainees (n = 25). Sociometric analyses assess the connections between all members of each network of interest, supporting evaluation of network growth and resource exchange ,37. ThusNetwork analysis requires dedicated software to assess relational data, and we used UCINET-6 . As netwAmong trainees, 23 of 25 individuals completed the survey (92% response rate). Table The network graphs comparing connections before the program started at year 1 Figure demonstrAt year 1, trainees in the lowest out-degree tertile averaged 0.5 outgoing connections compared with an average of 2.0 outgoing connections for the middle tertile, and 6.1 outgoing connections for the highest tertile. Individuals with the highest level of connections were more likely to be working in the capital city of Addis Ababa compared with other regions . We found a significant (p < 0.001) association between regional homophily and connections reported at year 1. Of potential connections among individuals from the same region, 45% (45 of 100) were reported compared with 6% (30 of 500) of potential connections among individuals from different regions.2 = 123.61, p < 0.01. Those with the highest tertile of trainee out-degree had the highest reports of informational exchange. We did not find a statistically significant relationship between trainee out-degree and functional exchange, χ2 = 26.11, p > 0.05.As presented in Table For the larger network, 41 of 63 individuals completed the survey (65% response rate), with a 47% response rate among supporters. Network-level growth was assessed using a pair of network graphs Figure and a seWhen we narrowed our focus to relationships between trainees and supporters, we found that at year 1, 94% of trainees reported informational exchange with supporters and 55% reported functional exchange with supporters. The average trainee-supporter out-degree at year 1 was 8.1 connections. In this network, the average number of outgoing connections with supporters was 2.3 for the lowest trainee-supporter out-degree tertile, 5.3 for the middle tertile, and 14.9 for the highest tertile. Trainee-supporter out-degree did not vary significantly between regions.2 = 74.93, p < 0.05. Those in the highest tertile of trainee-supporter out-degree also had the highest reports of informational exchange. We found a similar pattern for trainee-supporter out-degree and functional exchange, χ2 = 81.31, p < 0.01.As seen in Table We found substantial development of social networks within the context of a capacity-building program in healthcare management. Through involvement with the MHA program, participants developed professional connections with each other and with supporters, including faculty in Ethiopia and hospital executives in the United States of America. These connections supported valuable exchanges including information relating to hospital management and resources such as hands-on assistance.The networks that developed through the first year of this program demonstrated several characteristics that have been shown to support resource exchange such as sufficient network density and connections between all or almost all members ,32. We fAlthough the network growth and resource exchange are promising, limited resources for communication may have inhibited network development of some network members. We found that the network of program participants centered on a subset of individuals from the capitol city of Addis Ababa. The centralization of the network is important because the literature suggests that central members of a network have higher potential to access and utilize resources than their colleagues ,42. The We also saw evidence of the benefits of diverse connections for program participants and found that program participants were able to gain different categories of resources from different types of network members. This is likely a function of differential access to resources by individuals in different organizations and levels of power . In a loExperience with the MHA program suggests that programs to build human resource capacity in low-income countries can also increase network-based resources. However, given the common challenges of geography and limited communication technologies in such settings, social network development and resource exchange will likely be more effective if they are integrated as explicit goals of training programs to develop human resources for health. For instance, curricula can be developed to facilitate opportunities for developing new contacts. The focus on development of relationships should extend both to fellow trainees as well as supporters of the trainees, given the breadth of resources that can be accessed through diverse contacts. Another important lesson from the MHA experience is the importance of an enabling environment. This program was developed at the request of the Ethiopian government and was part of a broader effort to reform the healthcare system, such as adopting new hospital standards. This climate of organizational and system change was supportive of changing approaches to hospital management, and thus presented an environment in which social capital exchange was warranted and could have impact. Network development and social capital exchange may be particularly critical in low-resource settings as such networks can foster information and function exchanges in inexpensive ways.There are several limitations that help place the results in context. First, although we had a high response rate, some trainees and supporters did not complete the survey potentially influencing our findings. However, we used out-degree as our independent variable, which is robust to missing data . Second,Developing human resources for health is an international priority in global health , and ourThis analysis suggests that network-based social capital may be a useful addition to the goals and evaluation of capacity-building programs. As discussed by Hawe and colleagues , social The authors declare that they have no competing interests.All authors were involved in study and survey instrument design. SR conducted the data analysis and drafted the manuscript. EHB, SK, and JM provided intellectual content and manuscript revisions. All authors read and approved the final manuscript.
Armigeres subalbatus, mounts a distinctively robust innate immune response when infected with the nematode Brugia malayi, a causative agent of lymphatic filariasis. In order to mine the transcriptome for new insight into the cascade of events that takes place in response to infection in this mosquito, 6 cDNA libraries were generated from tissues of adult female mosquitoes subjected to immune-response activation treatments that lead to well-characterized responses, and from aging, naïve mosquitoes. Expressed sequence tags (ESTs) from each library were produced, annotated, and subjected to comparative analyses.The mosquito, Anopheles gambiae and Drosophila melanogaster genome projects.Six libraries were constructed and used to generate 44,940 expressed sequence tags, of which 38,079 passed quality filters to be included in the annotation project and subsequent analyses. All of these sequences were collapsed into clusters resulting in 8,020 unique sequence clusters or singletons. EST clusters were annotated and curated manually within ASAP web portal according to BLAST results from comparisons to Genbank, and the The resulting dataset is the first of its kind for this mosquito vector and provides a basis for future studies of mosquito vectors regarding the cascade of events that occurs in response to infection, and thereby providing insight into vector competence and innate immunity. The perpetuation of mosquito-borne diseases is dependent on the compatibility of the pathogen with its invertebrate and vertebrate hosts, as dictated by each respective genome. The failure of traditional mosquito-borne disease control efforts to reduce the burden of these diseases on public health has created an incentive to develop a more comprehensive understanding of molecular interactions between host and pathogen, in order to develop novel means to control disease transmission. Innate immune responsiveness in the mosquito host is of particular interest in such explorations because extensive research efforts have shown that vector mosquito species produce robust humoral and cellular immune responses against invading pathogens -4.Armigeres subalbatus, a natural vector of the nematode parasites that cause lymphatic filariasis. This debilitating disease affects 120 million people annually, one third of who suffer gross pathology (CDC 2006). Ar. subalbatus is ideally suited for laboratory studies of immune responsiveness because it is a natural vector of the filarial worm, Brugia pahangi, but it exhibits a refractory state to the microfilariae of Brugia malayi by virtue of a strong melanotic encapsulation response; therefore, it is the ideal organism for studying molecular mechanisms of the anti-filarial worm response as a function of the broader innate immune capacity of the mosquito. In fact, Ar. subalbatus is one of the few species of mosquito to effectively use melanotic encapsulation as a natural defense mechanism against metazoan pathogens ), Serpin 27A (D. melanogaster [FBgn0028990]), and Aslectin (AY426975) – a ficolin-like pattern recognition molecule [B. malayi infection is a protein-tyrosine kinase, involved in the JAK-STAT cascade, which is represented by 107 ESTs.An analysis of EST clusters from the complete project was done by combining annotations and cluster composition (in terms of source libraries) to provide insight into the molecular effort put forth by the mosquito in the face of different types of immunological challenge. Within Microsoft Access, a table was built that contains EST clusters according to ASAP ID number, contig number (created during assembly in Seqman), project (cDNA library) from which ESTs were contributed, and the number of ESTs contributed per project. Queries were built to extract the number of EST clusters unique to a particular library , or shared between projects (e.g. bacteria-inoculated whole body and hemocyte libraries) Figure . Shared molecule . Unique et al.[B. malayi infected females EST clusters. From the perspective of the entire dataset, 851 (11%) clusters have annotations but lack a GO annotation. Data from GO analyses are presented graphically, according to second tier categories within the top-level categories of Biological Process, Cellular Compartment, and Molecular Function. Of particular interest for this dataset are those clusters related to innate immunity, so a more in-depth (4th and 6th tier) view is presented classifications were migrated from Flybase annotations to homologous Ar. subalbatus, EST clusters were interrogated beyond the GO analysis for clusters encoding immunity-related proteins. Those clusters encoding proteins that have a documented role in Ar. subalbatus immunity were sorted according to representation in different libraries , and Aedes and Culex species are critically important in the transmission of arthropod-borne viruses as well as filarial worms.Among the Diptera, there is an evolutionary divergence of approximately 250 million years separating mosquitoes from on years . An. gamtructure -32, and Ar. subalbatus is a competent vector of viruses and parasites, and is more closely related to Ae. aegypti than to An gambiae; Ae. aegypti and Ar. subalbatus are phylogenetically linked at the level of tribe (Culicini). Therefore, comparisons between these two species of mosquito may provide unique insights into vector competence and innate immunity.Based on the evolutionary distance, vector status, and vector competence of the fly species for which we have genome data, we asked: of the 8,020 EST clusters or singletons, how many have homologs in the available databases for 4 fly genomes/transcriptomes? The output from blastx analysis of predicted peptide sequences was filtered to search for homologous sequences using an e-value cutoff of 1e-20, a percent match of 40% , and a minimum match length of 30 for the high-scoring segment pair. A large number of clusters ) did not have a homolog in any database as defined by this screen.Ae. aegypti, (Ae Vectorbase AaegL1.1), An. gambiae (Anoph Vectorbase AgamP3), and C.p. quinquefasciatus (Cpip Vectorbase CpipJ1.0_5), and the fruit fly, D. melanogaster. The mosquito with the largest number of gene products that are uniquely homologous to Ar. subalbatus is Ae. aegypti, as would be predicted by the degree of relatedness of these two mosquitoes. In comparing Ar. subalbatus to all available mosquito and Drosophila homologous predicted peptides, 2908 sequences are represented in all fly species. A significant number of clusters from Ar. subalbatus qualify as homologs to genes in other mosquito species, but have no homolog in the fruit fly , cellular (e.g. phagocytosis) and cell-mediated events (e.g. melanotic encapsulation). Because immunity-related genes function in concert to clear a pathogen ,34, it ia et al. ), and thAr. subalbatus, because of the material used to construct the libraries from which ESTs were produced. The rapidly expanding bank of large EST datasets and whole genome sequences for mosquitoes [Ar. subalbatus EST dataset has been designed for this purpose, and was screened with material from immune-response activated mosquitoes .For comparative purposes at the species level, this large dataset provides an important addition to the available sequence databases. Dipterans exhibit extraordinary variation in morphology, behaviour and physiology, so these ESTs add to the ongoing and increasingly powerful comparisons of fly species ,40-42. BAr. subalbatus was obtained from the University of Notre Dame in 1986. Larvae were hatched in distilled water and fed a ground slurry of Tetramin® fish food. Pupae were separated by sex, and females transferred in lots of 80 to cartons. Adult females were fed on 0.3 M sucrose-soaked cotton balls. All mosquitoes were maintained at 26.5° ± 1°C, 75% ± 10% relative humidity with a 16 hr/8 hr light/dark cycle beginning and ending with a 90 min crepuscular period [Ar. subalbatus either were inoculated or infected with the pathogen or parasite known to elicit the response of interest.To construct libraries from immune response activated mosquitoes, 2–3 day old adult female Bacteria inoculation. A mixture of E. coli K12 and M. luteus was used as an inoculum as previously described [escribed . Cold-imDirofilaria immitis inoculation. Cold-immobilized mosquitoes were secured in a vacuum saddle as previously described [D. immitis microfilarae (mf) in physiologic saline [escribed and injec saline , and retBrugia malayi infection. Sucrose was removed from the cartons 14–16 h prior to presenting mosquitoes to gerbils infected with B. malayi (microfilaraemia of approximately 44 mf/20 ml) for a blood meal. Gerbils were anesthetized with a ketamine/xylazine mixture. Microfilaremia was measured using 20 ul of blood collected by retro-orbital bleeding; formalin was added to lyse red blood cells and microfilariae were counted using phase microscopy as done previously [eviously . RepleteNaïve blood fed mosquitoes: Sucrose was removed from the cartons 14–16 h prior to presenting mosquitoes to uninfected gerbils for a blood meal. Gerbils were anesthetized as described previously. Replete females were returned to the insectary for 24, 48, or 72 hours prior to harvesting. The library developed from this source did not produce quality sequences, so sequence data are unavailable.Naïve mosquitoes. Females were randomly collected by aspiration from cartons of undisturbed, non-infected naïve adult females at 5–7 and 14–21 days post-eclosion.E. coli and M. luteus inoculated, D. immitis inoculated, B. malayi infected, naïve 7-day, naïve 14-day, and naïve bloodfed. For whole body collection, infected or inoculated female mosquitoes were collected at the aforementioned time points, frozen on dry ice, and stored at -80°C until ready for extraction. Frozen bodies were homogenized in a 1.5 ml tube using a Kontes® tissue grinder in the presence of guanidinium thiocyanate-phenol-chloroform solution [RNA was isolated from 5–10 whole bodies for the following libraries: solution . For hemRNA was extracted from mosquito whole bodies or hemocytes by single-step guanidinium thiocyanate-phenol-chloroform extraction . RNA wasFor all libraries, sequence data were collected as previously described . Brieflyphred version 0.020425.c [seqclean [E. coli or any of the pathogens used for stimulus were removed, and finally, all traces with less than 51 bases of quality sequence were discarded, resulting in 38,079 traces proceeding into the assembler.A total of 44,940 trace files from both the UW and Yang-Ming collections were base-called and vector-trimmed using 020425.c ,50. A "tseqclean , traces Quality trace data were clustered using LaserGene Seqman, Genome Edition on a WinD. melanogaster (Flybase version 5.1), An. gambiae (ENSEMBL genebuild 41), and Ae. aeygpti (Vectorbase version L1.1). A FASTA-formatted file was collected from the assembly software, and subjected to BLASTX searches using the aforementioned databases. An E-value cut-off of 10-3 was used to reduce non-informative hits, and filtering was not used. Search results were uploaded to A Systematic Annotation Package for Community Analysis of Genomes (ASAP) annotation workbench for manual annotation [To predict gene products and assign gene ontology classifications, EST clusters were compared to sequences from the GenPept database (Genbank version 156) and gene products from the whole genome annotations of notation .An. gambiae (Ensembl) and Ae. aeygpti (Vectorbase), with links provided to those databases. Special attention was paid to Gene Ontology descriptors on the matches to D. melanogaster in Flybase. Where an annotation to Flybase was of "putative" or better, Gene Ontology information was transferred onto the cluster annotation.The annotations of EST clusters in ASAP were conducted in a similar fashion as outlined previously , excludiEU204979 – EU212998.All data for this project are publicly accessible in ASAP via the web as annotated collapsed EST clusters . IndividGFM and LCB annotated sequences, analyzed data and prepared the text and figures. HYK analyzed sequence data. TAR constructed libraries and annotated sequence data. LCB and JFF prepared materials for library construction and annotated sequence data. GFM developed sequencing techniques and supervised sequencing efforts at UW-Madison. MTA contributed to manuscript preparation. IYT and CYH excised libraries for plasmid sequencing. TTL, KJH, SFT, and UCY conceived of and optimized parameters for plasmid sequencing. NTP facilitated the use of ASAP to annotate sequence data. WLC, BMC, and CCC conceived these studies and supervised all aspects of data collection and analysis.Dirofilaria immitis injected), imacbac (bacteria-inoculated whole body), brumal , n7 and n14 . Columns with (norm) in the header are the number of ESTs in that library normalized by the number of ESTs total in that library and the number of ESTs total. The "bluer" the shading, the more "up" the relative abundance of ESTs are compared the the rest of the libraries in that row. "AC" columns are Audic and Claverie 2 × 2 comparisons [Brugia malayi blood-fed females in Aliota, et. al. [Cluster analysis using six different statistical methods to determine differential copy numbers of ESTs broken down by library. Clusters and their constituent ESTs were analysed using IDEG6 to find parisons ; "Fisherparisons . The R vparisons , and the et. al. Click here for file
The median age was 56 years, the median follow-up time 56 months. A wide range (0.01–144.79 pg μg−1 DNA) of VEGF content was found (median 1.92). Significant associations were found between VEGF and oestrogen receptor (ER) content, progesterone receptor (PR) and tumour size (P = 0.005). Univariate analysis displayed significant reduced RFS and OS for patients with higher VEGF content (P = 0.0113 and P = 0.0075 respectively). A total of 43 recurrences have been found . There was no significant correlation between the localization of the relapse and the VEGF content. Multivariate analysis suggested VEGF as the only predictor of OS (relative risk (RR) = 3.6, 95% confidence interval (CI) = 0.97–13.37), and in patients with T1 tumours (n = 236) the multivariate analysis clearly displayed VEGF as the only independent predictor of both RFS and OS . In the sub-group with ER-positive tumours (n = 229), multivariate analysis showed VEGF as the only significant predictor of RFS and OS . The results suggest VEGF165 as a predictor of RFS and OS in NNBC patients treated with locoregional radiotherapy, comprising especially patients with favourable prognosis of T1 tumours, or ER-positive tumours. The high VEGF expression might define a radioresistant phenotype, or indicate an early distant spread which might require adjuvant systemic treatment. © 1999 Cancer Research CampaignThe aim of this study was to determine the association of vascular endothelial growth factor (VEGF) content in 302 consecutive node-negative breast cancer (NNBC) patients treated with only locoregional radiotherapy to relapse free- (RFS) and overall survival (OS). VEGF content in tumour cytosols was measured by an enzymatic immunoassay for the major isoform VEGF
Loss of c-IAP2 ubiquitin ligase activity, which occurs in the lymphoma-causing c-IAP2/MALT1 fusion protein, activates non-canonical NF-κB signaling and results in B cell abnormalities characteristic of MALT lymphoma. Chromosomal translocations between loci encoding MALT1 and c-IAP2 are common in MALT lymphomas. The resulting fusion proteins lack the c-IAP2 RING domain, the region responsible for its ubiquitin protein ligase (E3) activity. Ectopic expression of the fusion protein activates the canonical NF-κB signaling cascade, but how it does so is controversial and how it promotes MALT lymphoma is unknown. Considering recent reports implicating c-IAP1 and c-IAP2 E3 activity in repression of non-canonical NF-κB signaling, we asked if the c-IAP2/MALT fusion protein can initiate non-canonical NF-κB activation. Here we show that in addition to canonical activation, the fusion protein stabilizes NIK and activates non-canonical NF-κB. Canonical but not non-canonical activation depended on MALT1 paracaspase activity, and expression of E3-inactive c-IAP2 activated non-canonical NF-κB. Mice in which endogenous c-IAP2 was replaced with an E3-inactive mutant accumulated abnormal B cells with elevated non-canonical NF-κB and had increased numbers of B cells with a marginal zone phenotype, gut-associated lymphoid hyperplasia, and other features of MALT lymphoma. Thus, the c-IAP2/MALT1 fusion protein activates NF-κB by two distinct mechanisms, and loss of c-IAP2 E3 activity in vivo is sufficient to induce abnormalities common to MALT lymphoma. MALT lymphomas commonly express a mutant protein that contains a portion of the ubiquitin protein ligase cellular Inhibitor of Apoptosis 2 (c-IAP2) and a portion of the paracaspase MALT1. Expression of this fusion protein activates the anti-apoptotic transcription factor NF-κB, but how it does so and whether or not this activity contributes to lymphomagenesis is not known. Here we identify the mechanisms by which the fusion protein activates NF-κB and show that absence of c-IAP2 ubiquitin protein ligase activity in mice, as is the case in patients that express the fusion protein, results in spontaneous activation of NF-κB and many of the phenotypic cellular features of MALT lymphoma. Our findings demonstrate that c-IAP2 ubiquitin protein ligase activity dampens constitutive NF-κB activity and maintains B cell homeostasis, and provide genetic evidence that the loss of this enzymatic activity in the fusion protein has a major contributing role in MALT lymphomagenesis. The defining characteristic of the IAP (Inhibitor of Apoptosis) gene family is the presence of one or more baculovirus IAP repeats (BIRs) evidence for c-IAP regulation of NF-κB, primary cells from c-IAP1 and c-IAP2 knockout mice showed no obvious abnormalities in NF-κB activation 2-terminal (BIR-containing) fragment of c-IAP2 and the COOH-terminal portion of MALT1, a paracaspase involved in antigen receptor signaling MALT lymphomas are indolent neoplasms that have cytological features and bear cell surface markers of marginal zone B cells, and typically invade epithelial organs such as the gut and lung Here we investigate the mechanism by which the c-IAP2/MALT1 fusion protein contributes to the development of MALT lymphoma. Ectopic expression of the fusion protein in cell lines activated both the canonical and non-canonical NF-κB signaling pathways, the former but not the latter being dependent on the MALT1 paracaspase activity. Expression of a mutant c-IAP2 that, like the c-IAP2 portion of the fusion protein, lacks E3 activity activated non-canonical but not canonical NF-κB. Knockin mice expressing this same c-IAP2 mutant in lieu of the wild type gene accumulated abnormal B-cells that had elevated non-canonical but not canonical NF-κB signaling, a cell-autonomous survival advantage in vivo, and other features of MALT lymphomas. The many points of similarity between mice expressing a c-IAP2 E3-inactive mutant and patients expressing a c-IAP2 E3-inactive MALT1 fusion protein suggests that the loss of this activity activates non-canonical NF-κB and predisposes to malignancy.Ectopic expression of the c-IAP2/MALT1 fusion protein causes p65 to translocate to the nucleus, evidence of canonical NF-κB activation C464A) c-IAP2/MALT1 cDNA (H574A), but the protein was otherwise intact under the control of the native regulatory regions as well as mesenteric lymph nodes were markedly increased (+) cells . c-IAP2H570A/H570A lymphocytes had an unactivated phenotype, with normal levels of B7.1 and I-Ab (B cells) and CD25 and CD69 (T cells) (unpublished data). Two- to three-month-old c-IAP2H570A/H570A mice also had increases in lymph node B cells, although to a lesser extent than older animals (hiCD23−), with a compensatory decrease in the percentage of follicular (CD21intCD23hi) and immature (CD21−CD23−) B cells cells . The res+) cells . The CD4 animals . Analysi B cells . Althoug as well . No statH570A/H570A mice had enlarged GALT and mesenteric lymph nodes, which was confirmed by histological evaluation and lung is a feature of MALT lymphomas aluation . There waluation , with nohenotype , organizhenotype , and no + and TCRβ+ cells by measuring 7-AAD incorporation (2 or lipopolysaccharide (LPS) and measuring 3H-thymidine incorporation . To determine if these in vitro observations correspond to B cell behavior in vivo, experiments were performed in which a mixture of wild type and c-IAP2 knockin splenic B cells was adoptively transferred into RAG2-deficient mice or NIK, both of which lead to non-canonical NF-κB activation, results in B cell hyperplasia with increased numbers of CD23It is widely believed that the c-IAP2/MALT1 protein is pathogenic because it activates the canonical NF-κB signaling pathway H574A and pRK5-Flag-tagged human c-IAP2/MALT1C464A were generated by site directed mutagenesis using the primers 5′-GTCCATAGTGTTTATTCCTTGTGGTCATCTAGTAGTATGCAAAGATTGTGC-3′, 5′-GCACAATCTTTGCATACTACTAGATGACCACAAGGAATAAACACTATGGAC-3′, 5′-GACTTAATGTGTTCTTATTGGATATGGCTAGGAAAAGAAATGACTACGATGATAC-3′, 5′-GTATCATCGTAGTCATTTCTTTTCCTAGCCATATCCAATAAGAACACATTAAGTC-3′, respectively, and the QuickChange mutagenesis system from Stratagene. pRK5-Flag-tagged human c-IAP2ΔCARD-RING was generated by cloning a PCR product amplified from human c-IAP2 cDNA into pRK5 that already contained cDNA encoding the Flag-tag using the primers 5′-GCTCGTGAATGCGGGATCCTCTAGAAACATAGTAGAAAACAGC-3′ and 5-GCTGCAACGTAAGCTTTCATTCATTTGATTCTTTTTCCTCAGTTGC-3′, BamH1 and HindIII. Presence of the mutations was confirmed by direct sequencing. pCMV-Tag2 murine c-IAP2 has been described H570A was generated by site directed mutagenesis using primers that have been described 5′-CTGCCTCCTGGTCACGAA-3′), GADD45β 3′ (5′-TTGCCTCTGCTCTCTTCACA-3′), IκB 5′ (5′-TCACGGAGGACGGAGACTCG-3′), IκB 3′ (TGGAGATGCTGGGGTGTGC), ferritin heavy chain 5′ (5′-GGAGTTGTATGCCTCCTACGTCT-3′), ferritin heavy chain 3′ (5′-TGGAGAAAGTATTTGGCAAAGTT-3′), c-IAP2 5′ (5′-TATTTGTGCAACAGGACATTAGGAGT-3′), c-IAP2 3′ (TCTTTCCTCCTGGAGTTTCCG), Bcl-2 5′ (5′-GTACCTGAACCGGCATCTG-3′), and Bcl-2 3′ (5′-GGGGCCATATAGTTCCACAA-3′). The HPRT primers have been described 5′-AAGUGGUAGGGACUUGUGCUCAAAG-3′ and 5′-CUUUGAGCACAAGUCCCUACCACUU-3′.RAG2-deficient and CD45.1 congenic mice were obtained from the Jackson Laboratory. All restriction endonucleases were obtained from New England Biolabs. pCMV9 containing carboxy-terminal myc-tagged human NIK cDNA was obtained from Nobuhiko Kayagaki and Vishva Dixit (Genentech) and pRK5 containing Flag-tagged human c-IAP2 and c-IAP2/MALT1 was obtained from Xiaolu Yang (University of Pennsylvania). pRK5-Flag-tagged human c-IAP2H570A targeting construct were obtained from BAC-DNA using the respective endonucleases and subcloned into shuttle vectors. To insert the silent mutation in the neighboring leucine codon introducing a novel Spe1 restriction endonuclease site and then replace the histidine codon with an alanine codon, the BamH1-Ecor1 arm was sequentially mutagenized using mutagenic primers 5′-CATCGTGTTCATTCCCTGTGGCGCACTAGTCGTGTGCAAAGACTGCG-3′ and 5′-CGCAGTCTTTGCACACGACTAGTGCGCCACAGGGAATGAACACGATG-3′, and then 5′-CATTCCCTGTGGCCATCTAGTCGTGTGCAAAGACTGC-3′ and 5′-GCAGTCTTTGCACACGACTAGATGGCCACAGGGAATG-3′ using the QuickChange mutagenesis system from Stratagene. The presence of H570A in exon 9 and absence of other spontaneous mutations in the other exons were confirmed by direct sequencing. After subcloning both recombination arms into a vector containing a neomycin cassette flanked by two loxP recombination sites, the resultant targeting vector was linearized with Not1 and transfected into ES cells. Stable transfectants were screened by southern blotting and long-range polymerase chain reaction (LR-PCR) coupled with Spe1 restriction endonuclease digestion. The primers used to screen the c-IAP2H570A/H570A mice were obtained from Invitrogen and their sequence was 5′ CGAAAAAGATGCCCATCTACTCAG-3′ and 5′-TATCCCTAAAATGTCATCCAATAAATAACAG-3′. The clone that had correctly integrated the targeting construct at the c-IAP2 locus was injected into blastocytes to generate chimeric mice. F1 offspring of the chimeric mice were backcrossed 6 additional times to the C57BL/6 (B6) background and then c-IAP2+/H570A were interbred to obtain c-IAP2H570A/H570A mice. B6 mice bred in the CRC Vivarium (NIH) were used as controls for all experiments.The BamH1-EcoR1 and EcoR1-EcoR1 recombination arms used to generate the c-IAP2All animal experimental procedures were approved by the Animal Care and Use Committee of the National Cancer Institute.H570A was amplified from tail DNA using buffer 3 from the Expand Long Template PCR System (Roche) and the c-IAP2 locus 5′ and c-IAP2 locus 3′ primers, digested with Spe1, and resolved by agarose gel electrophoresis. Total RNA was isolated from purified B cells using the Utraspec RNA isolation reagent (Biotecx laboratory) and reverse transcribed using Superscript II Reverse Transcriptase kit (Invitrogen) following the manufacturers' protocol. The amount of ferritin heavy chain, IκB, c-IAP2, GADD45β, Bcl-2, and hypoxanthine phosphoribosyltransferase (HPRT) mRNA was quantified using the respective primers, SYBR Green PCR Master Mix (Applied Biosystems), and the 7500 Real Time PCR System (Applied Biosystems). The values were normalized to HPRT and the percent increase relative to wild type was calculated by dividing the c-IAP2 knockin values by the wild type values.The fragment spanning the recombination arm containing c-IAP2H570A/H570A mice, disrupted by teasing, and total cell suspensions made by gently mashing the debris through 40 µM nylon mesh (BD Biosciences). The cells were counted and the distribution of lymphoid populations in each organ was determined by cell surface staining and flow cytometry. B and T cells were purified from spleen and lymph nodes from wild type and c-IAP2H570A/H570A mice using B and T cell enrichment kits following the manufacturer's protocol. The purity was determined by cell surface staining and flow cytometry, and for all experiments, greater than 90%. In some experiments B cells and splenocytes were cultured in RPMI supplemented with 10% fetal calf serum, 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mM L-glutamine, and 50 µM-β-mercaptoethanol. MEFs were prepared from day 13.5 embryos as described Bone marrow, thymus, spleen, lymph nodes and GALT were harvested from wild type and c-IAP25 cells/ml) were incubated in vitro, stained with fluorescently labeled anti-B220/CD45R and anti-TCRβ, and incubated with 7-amino-actinomycin D . Uptake of 7AAD by dying B (B220+) and T (TCRβ+) cells was quantified by flow cytometry. The percentage of viable cells was calculated by dividing B220+7AAD− or TCRβ+7AAD− by the total B220+ or TCRβ+ cells at each time point. For BAFF- and anti-CD40-induced survival, purified B cells were incubated at (7.5×105 cells/ml) with the indicated concentrations of BAFF or agonistic anti-CD40 (100 ng/ml) for 66 h, stained with fluorescently labeled anti-B220 and 7AAD, and analyzed by flow cytometry. To assess proliferation, purified B cells (2.5×105 cells/ml) were stimulated with anti-μ F(ab′)2 or LPS (Sigma), and during the final 18 h of the 66 h period, DNA synthesis was measured by adding 1 µCi 3H-thymidine to the culture. The cells were then harvested and lysed, and the DNA was transferred to a filtermat. The amount of incorporated 3H-thymidine was quantified using a scintillation counter.For quantifying cell death, splenocytes following the manufacturer's protocol. After 24 h the cells were washed twice with phosphate-buffered saline (PBS) and lysed. For ectopic expression studies, 293T cells were transfected with the indicated plasmids using Lipofectamine 2000 (Invitrogen) following the manufacturer's protocol. Twenty-four hours later the cells were harvested, washed with PBS, counted, and lysed in sample buffer.B cells, T cells, and MEFs were lysed in a buffer containing 20 mM Tris pH 7.5, 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 30 mM NaF, 2 mM sodium pyrophosphate supplemented with Complete (Roche) protease inhibitor cocktail, and the detergent-soluble lysate was collected after centrifugation. Lysates were normalized to protein concentration, denatured in sample buffer , resolved by SDS-PAGE, and immunoblotted with the appropriate antibodies. For knockdown studies, 3.0×102, 1% Triton X-100. The recombinant proteins were purified from clarified lysates using glutathione Sepharose 4B beads (Amersham Biosciences). The beads were washed extensively and incubated with 35S-labeled TRAF2 that had been translated in vitro using the TNT Quick Coupled Transcription/Translation System (Promega) for 3 h at 4°C in binding buffer containing 120 mM NaCl, 10% glycerol, 1% Triton X-100, and 50 mM Tris pH 7.5. The bead-bound complexes were washed with the binding buffer, eluted with sample buffer, and resolved by SDS-PAGE.Glutathione S-transferase (GST)-tagged proteins were expressed in DH5α cells with 0.05 mM isopropyl-β-thiogalactopyranoside at 16°C for 20 h and lysed in 20 mM HEPES pH 7.5, 100 mM NaCl, 1.5 mM MgCl+) and c-IAP2H570A/H570A (CD45.2+) knockin mice were mixed and 107 cells were injected into the tail veins of RAG2-deficient (CD45.2+) mice. Forty-five days later the percentage of wild type and c-IAP2H570A/H570A B cells in the spleens and lymph nodes was determined by staining cell suspensions with B220, CD45.1, and CD45.2 and analyzed by flow cytometry. The ratio was generated by dividing the percentage of c-IAP2H570A/H570A B cells by the percentage of wild type B cells.Equal number of splenic B cells purified from wild type or citrate buffer (CD3). Detection of B220 was performed using the avidin-biotinylated enzyme complex (Vector Laboratories) with 3,3′-diaminobenzidine (Sigma) as chromagen. Detection of CD3 was accomplished using the Rabbit Elite kit (Vector Laboratories) using 3,3′-diaminobenzidine as chromagen. Slides were counterstained with hematoxylin. Stained sections were evaluated by a boarded veterinary pathologist. Serum immunoglobulin isotypes were quantified by ELISA following the manufacturer's protocol. p values were calculated using GraphPad Prism and a two-tailed t test.Mice were euthanized using COFigure S1Absence of c-IAP2 E3-activity activates the non-canonical NF-κB signaling pathway.(0.27 MB TIF)Click here for additional data file.Figure S2H570A/H570A mice.Targeting strategy for generating the c-IAP2(0.19 MB TIF)Click here for additional data file.Figure S3c-IAP2/MALT1 fusion protein lacks E3 activity.(0.16 MB TIF)Click here for additional data file.Figure S4H570A/H570A mice.Lymphoid development and homeostasis in 7–12-wk-old c-IAP2(0.60 MB TIF)Click here for additional data file.Figure S5H570A/H570A mice.T cell hyperplasia in GALT of wild type and c-IAP2(4.39 MB TIF)Click here for additional data file.Figure S6H570A.Binding of in vitro translated and metabolically labeled TRAF2 to glutathione beads bound to recombinant GST-tagged murine c-IAP2 and c-IAP2(0.10 MB TIF)Click here for additional data file.
Drosophila melanogaster is often necessary for studies of behaviour, nutrition and drug administration. There is no reliable and agreed method for measuring food intake of flies in undisturbed, steady state, and normal culture conditions. We report such a method, based on measurement of feeding frequency by proboscis-extension, validated by short-term measurements of food dye intake. We used the method to demonstrate that (a) female flies feed more frequently than males, (b) flies feed more often when housed in larger groups and (c) fly feeding varies at different times of the day. We also show that alterations in food intake are not induced by dietary restriction or by a null mutation of the fly insulin receptor substrate chico. In contrast, mutation of takeout increases food intake by increasing feeding frequency while mutation of Dovo increases food intake by increasing the volume of food consumed per proboscis-extension. This approach provides a practical and reliable method for quantification of food intake in Drosophila under normal, undisturbed culture conditions.Measurement of food intake in the fruit fly Drosophila melanogaster is a key model organism for discovery of evolutionarily conserved biological mechanisms, which include the control of nutrient sensing Drosophila are therefore often needed. However, quantification of food consumption in the fly poses challenges. In mammals, food ingestion can be directly quantified by weighing the food before and after feeding has taken place. However, flies consume volumes of food that are too low to weigh accurately, and feed by extension of their proboscis into the food medium, prohibiting direct observation of the volume of food ingested. One method has overcome this problem by measuring the food consumed in liquid form in a capillary feeder (CAFE) Drosophila feed on microorganisms, particularly yeast, on the surface of fruit The fruit fly Drosophila, which increases the capacity of the crop Drosophila, a time period during which disturbance of the flies affects their feeding behaviour. There is thus a requirement for a method of measuring feeding in undisturbed conditions.To overcome the problems of measuring food intake when flies feed on gelled media, several studies have made indirect measures of food uptake after marking the food, either with a visible dye Previously, we have reported that direct observations of fly proboscis-extension onto the food surface chico1takeout1ovoD1In this study we tested the accuracy of the method, by measuring the volume of food ingested using a dye food label in parallel with observing the number of proboscis-extensions. We compared flies that had either known or suspected differences in food intake, such as males versus females, flies subjected to dietary restriction Drosophila is often achieved by dilution of the food medium, and complete records of food intake are needed to determine if flies compensate for the reduced nutritional content of food by increasing the total amount of food they consume. Measurement of food intake is also needed to determine if other interventions, such as sensory perception of food chico, which extends the lifespan of DrosophilaDietary restriction (DR) in In nature and in the laboratory, fruit flies feed on the food surface, by extending their proboscis into contact with the food and drawing it in. The amount of proboscis-extension onto the food surface was measured by making periodic observations of groups of flies. The number of observations of proboscis-extension was then expressed as a proportion of the total number of observations Volume of blue food found in the fly and the proportion of feeding events Observed (V/O) . The gradient of this relationship represents the ingestion ratio of the flies, as it describes the volume of blue accumulated per proboscis-extension. To test for non-linearity , we added a quadratic term to the statistical model. The quadratic term was not significant (P = 0.62), indicating the V/O relationship is indeed linear over the timespan we measured . The gradients of these relationships were not found to be significantly different (P = 0.9871), indicating that the ingestion ratio did not differ between the sexes. However, the intercept of the male relationship was significantly lower than that for females (P<0.001) and suggested males across all observations contained a lowered basal level of blue dye content than in females (P = 0.54), indicating that a linear V/O relationship exists. In spite of the sexes sharing the same ingestion ratio, females were found to have fed more than males over the 30-minute period because they spent a greater proportion of time with the proboscis extended (2.8-fold more on average) than males . This suggested it is possible for flies to increase their food intake by feeding at a greater frequency rather than by consuming in greater volume, and it is possible to detect such differences in food intake.Next, we tested whether the sexes differed in ingestion ratio (gradient of the V/O relationship) by repeating the combined assay with 7-day-old mated males and females , with no significant differences in the gradient and intercept of this relationship between the two different diet regimes .We then extended the use of this method to examine the effect of other factors that could determine the physiology and behaviour of feeding flies. The nutritional environment may be such a factor, and is particularly important in the context of DR experiments where dietary dilution is employed to restrict access to nutrients. We therefore performed the combined assay with 7-day-old mated females that were fed either DR or full fed control diet 1chico, is a null mutation in the single fly insulin receptor substrate in the insulin/insulin-like growth factor-1 signalling (IIS) pathway, a pathway suggested to affect foraging and feeding in larvae 1chico and their genetic control (Dahomey) , with no significant differences in the gradient or intercept between 1chico heterozygotes and control flies .Finally, we also tested whether the ingestion ratio or feeding frequency were altered by genetic mutations known or suspected to affect feeding. The first mutation, 1takeout, is in a gene reported to regulate the circadian rhythm and to increase food intake prior to starvation in Drosophila1takeout flies and their genetic control (Canton-S) with gradient and intercept not significantly different between the two genotypes . The flies thus elevated their nutrient-intake by feeding at a greater frequency, rather than by increasing the volume of intake per proboscis-extension.The second mutation, ovoD1, causes female sterility and has been reported to induce a reduced feeding frequency whiteDahomey) ; however, the gradient and the intercept for the relationship differed between the two genotypes . The V/O gradient for ovoD1 was steeper (205.52 versus 14.46 in whiteDahomey) and the intercept greater (56.40 versus 28.65 in whiteDahomey) than for whiteDahomey controls , as well as a greater basal level of blue dye. However, no significant difference in the proportion of time spent feeding between ovoD1 females and whiteDahomey controls was recorded . This indicated that D1ovo flies elevated their received nutrition by increasing the volume of intake per proboscis-extension rather than by feeding at a greater frequency.The final mutant studied, P<0.0001, linear regression model), but neither the gradient (P = 0.0961) nor the intercept (P = 0.649) changed with age. The volume of intake per proboscis-extension was thus unaffected by the age of the flies.We also analysed the effect of age upon the ingestion ratio. Dahomey females were subjected to the combined blue dye and proboscis-extension assay at 4 different ages . The food intake of the flies thus varied widely. Despite the variation in the overall amount of feeding, there was no significant variation in the ingestion ratios except in one genotype, DrosophilaWe investigated other variables that could affect food intake during undisturbed conditions. The circadian rhythm is reported to alter feeding in P<0.001 for both group size and time of day, GLM), while the interaction between these two was not significant (P = 0.88). The lowest feeding proportion was observed in the morning for flies housed singly (0.15 of the time spent feeding), and this increased to approximately 0.50 in the afternoon and evening for flies feeding in groups of 5 or more. Both the afternoon and evening feeding proportions were significantly higher than those in the morning . There was no significant difference in feeding proportions between flies during the afternoon and evening . The lowest proportion of feeding was observed for flies housed singly 0.15–0.22 (depending on time of day), and this significantly increased to 0.18–0.31 (depending on time of day) when flies were housed in pairs . The proportion of flies feeding was found to nearly double when the number of flies was increased to 5 per vial , and did not increase further when flies were housed at 10 per vial , in the afternoon (4 hours after lights-on), and in the evening (8 hours after lights-on) using 4 different group sizes . As previously reported, flies exhibited significantly lower feeding frequency when the concentration of yeast extract was increased in the CSYExtract diet . In contrast, the feeding frequency of flies was unaffected when altering the yeast concentration of the SYBrewer's diet .Finally, we tested the response of 7-day old female flies to two different yeast-based diets, one made with water-soluble yeast extract (CSYExtract) The proboscis-extension method allows repeated feeding assays to be performed with the same cohort of flies, an advantage over methods that sacrifice flies during measurements. As far as we are aware, no publication to date has studied either the feeding frequency of a cohort of flies throughout their lifespan or measured how much food flies consume throughout their lives. This is especially important when monitoring the effects of dietary restriction on lifespan, as the short-term probability of death as revealed by mortality analysis is rapidly affected by changes in nutritional conditions P<0.001, GLM). No overall difference was found in average feeding frequency (0.17 in both cohorts) for the course of the lifespan. However, flies on a DR diet fed in a greater proportion of observations than full fed flies early in life, while this reversed later in life when full fed flies fed more than DR flies (between day 31 and day 50), after which the feeding became similar on the two diets. Preliminary studies showed that the feeding frequency of flies on both diets were low at the beginning of the proboscis-extension assay but gradually increased to a steady state over 30 minutes . Overall observed feeding proportions also did not differ significantly from wild type controls .We also compared the feeding frequency of wild type and long-lived Drosophila (measuring proboscis-extensions) by combining it with a direct method (measuring food intake with a food dye). Despite considerable variation in feeding between replicate groups of flies and between experiments performed on different days, the volume of food ingested per proboscis-extension (ingestion ratio) did not significantly differ between females and males, flies of different ages, flies subjected to DR and flies with mutations in chico or takeout. Only ovoD1 females ingested more dye per proboscis-extension.In this study, we validated an indirect method of measuring food intake in The observation data revealed that males feed less than females. The higher food intake of female flies is presumably related to their high nutrient-usage in egg-production ovoD1 females exhibited a greater ingestion ratio than any of the other genotypes tested. This finding is surprising, because egg development is arrested in D1ovo flies before the major nutrient investment occurs ovoD1 flies, it could be that they expend more energy through a higher level of activity than fertile flies. This could partially explain why we found a higher ingestion ratio in these mutant flies. ovoD1 has been reported as feeding less frequently during long-term undisturbed conditions et al. (2008), because our data were obtained from the first 30 minutes after transferring to blue-labelled food, and we found no differences with feeding frequency, only with ingestion ratio.Sterile The combined assay is not suitable for long-term, undisturbed feeding experiments because the assay requires that flies are transferred to dyed food, which disturbs fly feeding behaviour. Frequencies of proboscis-extension were observed to be lower than in steady-state conditions, and only reached a constant level by the end of the 30-minute observation period. However, the indirect method alone is accurate for measuring fly feeding during long-term, undisturbed, experimental conditions once assessed by the combined assay for any differences in the ingestion ratio.Data from the undisturbed steady-state studies suggested that flies exhibit marked diurnal differences in feeding behavior when feeding in groups and earlier in life. The effect of fly group size may reflect the role of aggregation pheromones, which act as communication signals between flies on breeding substrates, with feeding and oviposition rates increasing with the level of aggregation pheromone Caenorhabditis elegans, as well as Drosophila and the mouse Drosophilachico in Drosophila both extends lifespan hico-heterozygotes using the proboscis-extension assay and found total food intake was not reduced in the mutants. The increased survival of 1chico mutant flies compared to controls can therefore not be explained by a reduction in food intake 1chico mutants Mutations in the IIS pathway have been shown to extend the healthy lifespan of the nematode worm et al. (2005), we saw feeding frequency decrease as the concentration of CSYExtract in the medium was increased. In contrast, but consistent with previous reports DR in flies can be imposed by dilution of their food source, which is available in excess. Flies could therefore adjust their feeding frequency to compensate for the reduction in nutritional value, thus reducing or eliminating the effect of food dilution on nutrient-intake. The literature on this topic is conflicting, with some reports that flies can partially compensate for the food dilution An important element of studies into ageing is the longitudinal effects of lifespan-altering interventions. Previously, we have reported that flies subjected to DR do not alter their feeding frequency on day 7 of adult life DrosophilaDrosophila to be measured during conditions that reflect either the experimental set-up they are normally housed in or their feeding frequency in undisturbed conditions. We established that the proboscis-extension method fulfils these criteria.In recent years, various methods have been proposed to measure food intake in et al. (2007) 1chico allele is maintained as a balanced stock that has been backcrossed to the Dahomey outbred laboratory population as described in Clancy et al. (2001) wsn, 506ry, 1to (takeout) flies were a gift from Brigitte Dauwalder. All flies were maintained at 25°C, 65% humidity, on a 12h∶ 12h light∶ dark cycle. Unless stated otherwise, all assays used mated females at day 7 after eclosion. Day 7 was chosen because the flies are still young, but several early adult developmental processes have been completed 2 anaesthesia, into 30 mL glass vials containing 7 mL food.Wild type Dahomey flies were housed and maintained as described in Bass The DR food medium contained 100 g autolysed Brewer's yeast powder , 50 g sugar, 15 g agar, 30 ml nipagin (100 g/L), and 3 mL propionic acid made up to 1 litre of distilled water. The full fed food contained 200 g autolysed yeast powder, 50 g sugar, 15 g agar, 30 ml nipagin (100 g/L), and 3 ml propionic acid made up to 1 litre of distilled water For DR lifespan experiments, flies were maintained 5 per vial at 25°C, 65% humidity, on a 12h∶ 12h light∶ dark cycle. Proboscis-extension assays were performed for 60 minutes at 5-minute intervals, 4 hours after lights-on at 21 separate days across the lifespan experiment.For undisturbed observations of feeding, 7-day-old mated flies of the same sex, were transferred to new food at a density of 5 per vial on the evening before the assay. Flies were maintained in a pooled population, 100 flies per bottle, and a subset was collected and returned before and after the assay. Different measurements on different days were therefore considered to be independent of each other. Vials were coded and placed in a randomised order in rows on viewing racks at 25°C overnight. The assay occurred with minimal noise and physical disturbance to the flies. To avoid recording disturbed fly feeding behaviour, 30 minutes was allowed between the arrival of the observer and commencement of the assay. Observations were performed “blind” the next day for 90 minutes, commencing one hour after lights-on. In turn, each vial was observed for approximately 3 seconds during which the number of flies feeding was noted. A feeding event was scored when a fly had its proboscis extended and touching the food surface while performing a bobbing motion. Once all vials in the experiment had been scored in this way, successive rounds of observations were carried out in the same way for the whole 90 minutes of the assay, which, depending on the size of the experiment meant that each vial was observed once every 2 to 5 minutes. At the end of the assay, the vial labels were decoded and the feeding data expressed as a proportion by experimental group . For statistical analyses, comparisons between experimental groups were made on the totals of feeding events by all flies within a vial, to avoid pseudoreplication.Groups of five 7-day-old mated flies were transferred onto fresh food medium as indicated containing 2.5% (w/v) blue food dye (F D & C Blue Dye no. 1). Vials were scored approximately every 2 minutes for proboscis-extension and after a total of 30 minutes were transferred to eppendorf tubes and snap frozen in liquid nitrogen.Flies were homogenised in 200 µL of distilled water. A further 800 µL of distilled water was added and the suspension passed through a 0.22 µm Millex filter to remove debris and lipids. The absorbance of the liquid sample was then measured at 629 nm [Hitachi U-2001 Spectrophotometer ]. Age-matched flies exposed to non-dyed food were used as the baseline during spectrophotometry. The amount of labelled food in the fly was calculated from a standard curve made by serial dilution in water of a sample of blue food.Statistical analyses were performed using R, v2.2.1 F-tests for analysing significance). The generalised linear models incorporate information on the sample sizes and use weighted regression analyses. Significance among factor levels (e.g. among the 4 different group sizes) was determined by model simplification, where we evaluated whether combining >1 factor level into a single level led to a significant increase in deviance of the model, using F-tests To compare the effect of time of day, group size and dietary composition on feeding frequency, we used generalised linear models (with binomial error structure and logit link function, the deviances were scaled to correct for over-dispersion, and using
Speaker detection is an important component of many human-computer interaction applications, like for example, multimedia indexing, or ambient intelligent systems. This work addresses the problem of detecting the current speaker in audio-visual sequences. The detector performs with few and simple material since a single camera and microphone meets the needs.A multimodal pattern recognition framework is proposed, with solutions provided for each step of the process, namely, the feature generation and extraction steps, the classification, and the evaluation of the system performance. The decision is based on the estimation of the synchrony between the audio and the video signals. Prior to the classification, an information theoretic framework is applied to extract optimized audio features using video information. The classification step is then defined through a hypothesis testing framework in order to get confidence levels associated to the classifier outputs, allowing thereby an evaluation of the performance of the whole multimodal pattern recognition system.Through the hypothesis testing approach, the classifier performance can be given as a ratio of detection to false-alarm probabilities. Above all, the hypothesis tests give means for measuring the whole pattern recognition process effciency. In particular, the gain offered by the proposed feature extraction step can be evaluated. As a result, it is shown that introducing such a feature extraction step increases the ability of the classifier to produce good relative instance scores, and therefore, the performance of the pattern recognition process.The powerful capacities of hypothesis tests as an evaluation tool are exploited to assess the performance of a multimodal pattern recognition process. In particular, the advantage of performing or not a feature extraction step prior to the classification is evaluated. Although the proposed framework is used here for detecting the speaker in audiovisual sequences, it could be applied to any other classification task involving two spatio-temporal co-occurring signals. Speaker detection is an important component of many human-computer interaction applications, like for example, multimedia indexing, or ambient intelligent systems (through the use of speech-based user-interfaces). Recent and reliable speech recognition methods rely indeed on both acoustic and visual cues to perform . They reThe work presented in this paper addresses the problem of detecting the current speaker among two candidates in an audio-video sequence using simple material, namely, a single camera and microphone. A mono audio signal contains no spatial information about the source location, nor does the video signal alone permits to discriminate between a speaker and a person moving his lips – if chewing a gum for example. Therefore, the detection process has to consider both the audio and video cues as well as their inter-relationship to come up with a decision. In particular, previous works in the domain have shown that the evaluation of the synchrony between the two modalities, interpreted as the degree of mutual information between the signals, allowed to recover the common source of the two signals, that is, the speaker ,4. OtherAs stated previously, the classifier decision should rely on an evaluation of the synchrony between pairs of audio and video features. In , the autIn the present work, the classification task is cast in a hypothesis testing framework as well. However, the objective – thus, the novelty – is to define not only a classifier, but the means for evaluating the multimodal classification chain – or pattern recognition process – performance. To this end, the hypothesis tests are defined using the Neyman-Pearson frequentist approach and one As a result, a complete multimodal pattern recognition process is proposed in this work, with solutions given for each step of the process, namely, the feature generation and extraction steps, the classification, and finally, the evaluation of the system performance.Given different mouth regions extracted from an audio-video sequence and corresponding to different potential speakers, the problem is to assign the current speech audio signal to the mouth region which effectively did produce it. This is therefore a decision, or classification, task.S emitting jointly an audio and a video signal, A and V. The source S itself is not directly accessible but through these measurements. The classification process has therefore to evaluate whether two audio and video measurements are issued from a common estimated source C defined over the set ΩC, can be either "speaker" or "non-speaker". Obviously, the overall goal of the classification process is to minimize the classification error probability PE = P (C), where the wrong class is assigned to the audio-visual feature pair. In the present case, a good estimation of the class Pe = P (S) of committing an error during the estimation. The source estimate is inferred from the audio and video measurements by evaluating their shared quantity of information. However, these measurements are generally corrupted by noise due to independent interfering sources so that the source estimate and thus the classifier performance might be poor.Let the speaker be modelled as a bimodal source S while discarding the noise coming from the interfering sources. Obviously, this objective can only be reached by considering the two modalities together. Now, given that such features FA and FV . Thus, an estimate FV, respectively, FA, can be inferred from FA, respectively, FV . This allows to define the transition probabilities for FA → FV → p(FA) = p(FA)/p(FA), and p(FV) = p(FV)/p(FV)). Two estimation error probabilities and their associated lower bounds can be defined for these Markov chains, using Fano's inequality and the data processing inequality [Preliminarily to the classification, a feature extraction step should be performed in order to possibly retrieve the information present in each modality that originates from the common source equality ,8:S\| is the cardinality of S, I the mutual information, and H the entropy. Since the probability densities of FA, respectively FV, are both estimated from the same data sequence A, respectively V, it is possible to introduce the following approximations:where \|ΩI ≈ I. Moreover, the symmetry property of mutual information allows to define a joint lower bound on the classification error Pe:Pe should include the minimization of its associated lower bound. This is done by minimizing the right-hand term of inequality (3), that is, by introducing a constraint on the feature extraction step since it requires to maximize the mutual information between the extracted features FA and FV . In order to both decreases the lower bound on Pe and try to get as close as possible to this bound, a mutual information based estimator denoted effciency coeffcient [To be effcient, the minimization of effcient ,8, is fie still minimizes the lower bound on the error probability defined in Eq. (3) while constraining inter-feature independence. In other words, the extracted features FA and FV will tend to capture specifically the information related to the common origin of A and V, discarding the unrelated interference information. The interested reader is referred to [Maximizing erred to for morePE of classification error, the last step leading from Applying this framework to extract features, we expect to minimize the probability of estimation error. However, to minimize the probability Before applying the optimization framework previously described to the problem at hand, both audio and video signals have to be represented in a suitable way. Notice that the representation chosen here does not need to be the most optimal since an automatic feature optimization step follows.N × M pixels, including the lips and the chin), signed as the vertical velocity component. The mouth regions are roughly extracted using the face detector depicted in [fv, n}n = 1, ... N × M × (T-1) observations of the video feature forms the sample of the 1D random variable FV .Physiological evidence points out the motion in the mouth region as a visual clue for speech. It is estimated using the Horn and Schunck gradient-based optical flow . This meicted in . The setT - 1 vectors P MFCCs:Mel-frequency cepstrum coeffcients (MFCCs), widely used in the speech processing community, have been chosen for the audio representation. They describe the salient aspects of the speech signal, while being robust to variations in speaker or acquisition conditions . The melCt(i)}i = 1,...,P with t = 1, ..., T - 1 (the first coeffcient has been discarded as it pertains to the energy).{fa,t P-dimensional observations is reduced to (T - 1) 1D values fa,t(M1 and M2). This way, the discrepancy between the marginal densities of the video features in each region are taken into account. Moreover, only one optimization is performed for two mouths resulting in a single set of optimized audio features. It implies however that the potential number of speakers is limited to two in the test audio-video sequences. If M1 and M2 respectively, then the optimization problem becomes:Thus, the set of originate from a common bimodal source S – the speaker – or from two independent sources – speech and video noise. As previously stated, the problem of deciding between two mouth regions which one is responsible for the simultaneously recorded speech audio signal can be solved by evaluating the synchrony, or dependence relationship, that exists between this audio signal and each of the two video signals.Hypothesis tests are used in detection problems in order to take the most appropriate decision given an observation x of a random variable From a statistical point of view, the dependence between the audio and the video features corresponding to a given mouth region can be expressed through a hypothesis framework, as follows:H0 postulates the data fa and fv to be governed by a probability density function stating the independence of the video and audio sources. The mouth region should therefore be labeled as "non-speaker". Hypothesis H1 states the dependence between the two modalities: the mouth region is then associated to the measured speech signal and classified as "speaker". The two hypothesis are obviously mutually exclusive. In the Neyman-Pearson approach [PFA, or size α of the test, is defined as:approach certain PD, or power β of the test, is given by:while the detection probability α: the decision rule should be constructed so that the probability of detection is maximal while the probability of false-alarm do not exceed a given value α. Using the log-likelihood ratio, the Neyman-Pearson test can be expressed as follows:The Neyman-Pearson criterion selects the most powerful test of size fa and fv, by finding the threshold η that will give the best test of size α.The test function must then decide which of the hypothesis is the most likely to describe the probability density functions of the observations The mutual information is a metric evaluating the distance between a joint distribution stating the dependence of the variables and a joint distribution stating the independence between those same variables:fa and fv grows large, the normalized log-likelihood ratio approaches its expected value and becomes equal to the mutual information between the random variables FA and FV [η. This result differs from the approach of Fisher et al. in [α-β trade-off is known. Considering that two mouth regions could potentially be associated to the current audio signal and defining one hypothesis test (with associated thresholds η1 and η2) for each of these regions, four different cases can occur:The link with the hypothesis test of Eq. (7) seems straightforward. Indeed, as the number of observations A and FV . The test al. in , where tI1 graphs allow to visualize and select classifiers based on their performance . They peFirstly, the ability of hypothesis testing to act as a classifier is discussed. The evaluation of the possible gain offered by using optimized audio features with respect to simpler ones is addressed next.g11 to g22 taken from the CUAVE database [g18 has been discarded as it exhibits strong noise due to the compression). These sequences are shot in the NTSC standard . For the purpose of the experiments, the problem has been restricted to the case where one of the speaker and only one of them is speaking in any case. Therefore, the last seconds of the video clips where the two speakers are speaking all together, as well as the silent frames – labelled as in [The sequence test set is composed of the eleven two-speaker sequences database , where eed as in – have bN × M mouth regions are extracted, using the face detector given in [N and M varying between 30 and 60 pixels, depending on speakers' characteristics and acquisition conditions). A frame example taken from the CUAVE database is shown in Fig. For all the sequences, the given in (N and MN × M × (T - 1) values of the optical flow norm at each pixel location . From the audio signal, 12 mel-cepstrum coeffcients are computed using 30 ms Hamming windows.The video feature set is composed of the The optimization is done over a 2 second temporal window, shifted by one second steps over the whole sequence to take decisions every seconds. The output of the classifier for each window is compared to the corresponding ground truth label, defined as in . The tesα and receives the optimized audio features at input.The classifier is defined as the test function giving the best test of size i.e, "speaker1" for test1 (defined between the random variables FA and FV1), and "speaker2" for test2. Table α.For binary tests, a positive and a negative class have to be defined. We assume the positive class to be the class "speaker" for each test. More precisely, since the experimental conditions implies that there is always one speaker speaking, the positive class is the label of the mouth region where the test is performed: η1 = 0.18 and η2 = 0.19.Let us introduce now the accuracy of a test as the sum of the true positive and true negative rates divided by the total number of positive and negative instances . Table 2α-β trade-off (thus greater adaptability to changes of the target condition or the classification requirement). The classifier produces better relative instance scores for test1. However, the thresholds giving the best accuracy values are about the same for the two tests. This tends to indicate that this threshold is not speaker dependent. Further tests on larger test sets would be necessary however for a more precise analysis of the classifier capacity.These results indicate hypothesis test as a good method for assigning a speaker class to mouth regions, with a given The advantage of using optimized audio features against simple ones at the input of the classifier is now discussed. As in the previous paragraph, two tests are considered, with the positive classes being respectively the "speaker 1" and the "speaker 2". The ROC graphs corresponding to each test are plotted on Figs. Table This work addresses the problem of labeling mouth regions extracted from audio-visual sequences with a given speaker class label. The system uses a simple material, namely a single microphone and camera. The detector must then analyze jointly the audio and video information to come to a decision. The problem is cast in a hypothesis testing framework, linked to information theory. The resulting classifier is based on the evaluation of the mutual information between the audio signal and the mouths' video features with respect to a threshold, issued from the Neyman-Pearson lemma. A confidence level can then be assigned to the classifier outputs. This allows firstly to adapt the classifier to changes of the target condition or of the classification requirement. Secondly, this approach results in the definition of an evaluation framework. The latter is not only used to determine the performance of the classifier itself, but considers rather rating the whole pattern recognition process effciency.In particular, it is used to check whether a feature extraction step performed prior to the classification can increase the accuracy of the detection process. Optimized audio features obtained through an information theoretic feature extraction framework feed the classifier, in turn with non-optimized audio features. Analysis tools derived from hypothesis testing, such as ROC graphs, establish eventually the performance gain offered by introducing the feature extraction step in the process.As far as the classifier itself is concerned, more intensive tests should be performed in order to draw robust conclusions. However, preliminary remarks tend to indicate that a hypothesis-based model can be used with advantage for multimodal speaker detection. It would also be interesting to consider in future works the cases of simultaneous silent or speaking states (cases 3 and 4 defined previously).As a final remark, let us stress that the multimodal pattern recognition framework we propose does not apply exclusively to speaker detection. It can be used with advantage for other applications, provided bimodal signals co-occurring in space and time are involved. One might think for example to medical applications where several synchronized biological signals exist and are to be processed to come to a diagnostic.The author(s) declare that they have no competing interests.A complete multimodal pattern recognition approach has been proposed. It is applied here for detecting the speaker in audio-video sequences but could be applied to other pattern recognition tasks involving bimodal signals co-occurring in space and time. An information theoretic feature extraction is performed prior to the classification. The definition of the classification step through a hypothesis testing framework is the main contribution of this work. It completes the pattern recognition process as it gives means for evaluating the performance of the classifier as well as of the whole pattern recognition process.
Consistently swelling proportion of the frail elderly within a modern society challenges the overstrained public health sector to provide both adequate medical care and comprehensive assistance in their multiple functional deficits of daily living. Easy-to-apply and task-specific ways of addressing this issue are being sought out, with a view to proposing systemic solutions for nationwide application.The present randomised, double-blind, placebo-controlled, 7-week clinical trial aimed to determine whether specifically structured, intensive exercise regimens, combined with nutritional supplementation, might improve and help sustain individual muscle strength and mobility, and possibly enhance individual functional capabilities in an on-going quest for active prevention of care-dependency. Ninety-one frail elderly were recruited from both nursing home residents and community dwellers and randomly split into four groups: Group I – progressive resistance exercises (PRE) + functionally-oriented exercises (FOE) + nutritional supplementation (NS), Group II – PRE + FOE + placebo, Group III – standard exercises (SE) + FOE + NS, Group IV – SE + FOE + placebo. Each group pursued a 45 min. exercise session 5 times weekly. The subjects' strength with regard to four muscle groups, i.e. hip and knee extensors and flexons, was assessed at 80% (1 RM) weekly, whereas their balance and mobility at baseline and at the end of the study.The study was completed by 80 subjects. Despite its relatively short duration significant differences in muscle strength were noted both in Group I and Group II , although this did not translate directly into perceptible improvement in individual mobility. Notable improvements in individual mobility were reported in Group III and Group IV (p = 0.002), although without positive impact on individual muscle strength.Comprehensively structured, high-intensity regimen made up of diverse exercise types, i.e. functionally-oriented, progressive resistance and standard ones, preferably if combined with nutritional supplementation in adequate volume, demonstrates clear potential for appreciably improving overall functional status in the frail elderly in terms of individual walking capacity and muscle strength.Central Register of Clinical Trials, Poland – CEBK180/2000. Human life expectancy has steadily been increasing over the past several decades, much aided by momentous advances in medical science. Modern society is nowadays invariably faced with the daunting challenge of having to care for its consistently swelling proportion of the frail elderly. Their individual expectations in overall quality of life by no means diminish with advancing age, usually remaining at odds with their much impaired functional capabilities and therefore causing much grief and frustration to themselves and their carers alike -5.A vast majority of the elderly are widely acknowledged to experience significant decline in their overall functional capacity, primarily originating from advancing age, concomitant chronic illnesses and frequently inadequate nutritional intake. This consequently makes them heavily dependent on others for their daily functional routine, especially with regard to mobility, let alone running a relatively high risk of sustaining accidental falls, serious fractures, recurrent hospitalisations and ultimately an admission into a nursing facility -9. Such Functional deficiency experienced by the elderly, as routinely encountered by physicians, is in fact expected to take up a significant proportion of their medical practice. Whereas modern science and technology should definitely seek out innovative and more effective ways of facilitating adequate medical treatment to the seniors, it should also focus on finding effective ways of combating their growing dependency on outside assistance through introducing feasible and easy-to-apply measures. Those should primarily be designed to interact effectively with their predominantly sedentary lifestyles, also with a view to persuading them that even a little effort on their part, especially when structured as a specifically targeted intervention and regularly pursued, may in fact make a tremendous and lasting difference to overall quality of their lives -13.Since an overwhelming body of evidence suggests that a loss of muscle strength and function observed with advancing age is reversible even in the frail elderly, it might reasonably be assumed that such a reversal might well be facilitated by a comprehensively structured solution involving task-specific exercise interventions, possibly combined with adequate nutritional supplementation ,3,14. PrThese key considerations prompted the authors to focus primarily on the applied aspect of the study, seeking out to design a feasible intervention routine, ostensibly with a view to having it subsequently utilised as a core part of a nationwide public health project aimed at helping the frail elderly cope effectively with the activities of daily living. The need for such a comprehensive, nationwide project to be put in place is already paramount, its urgency underpinned by the fact that the generation of baby-boomers is now approaching a critical milestone – their retirement age.The present study aimed therefore to verify the working hypothesis that a comprehensive, functionally-oriented exercise regimen, when pursued in conjunction with adequate nutritional supplementation, might appreciably improve individual activity level and significantly enhance individual functional capacity in the frail elderly.It was designed as a randomised, double-blind, placebo-controlled, 7-week clinical trial in which the subjects, randomly split into four intervention groups, were assigned to participate in two discrete types of functionally-oriented exercise (FOE) regimens incorporating elements of balance and multi-sensory training: either in the structured standard exercises (SE) or the structured progressive resistance exercises (PRE), both regimens pursued in conjunction with either multi-nutrient or placebo supplementation.Double-blinding with regard to nutritional supplementation was assured as neither the study subjects, nor indeed the nursing staff had any prior knowledge of the actual composition of the identically packaged drink. With respect to the exercise regimen, each set of exercises was supervised by a separate group of outsourced, free-lance physiotherapists who had no knowledge of the actual nature of the complementary set of exercises, nor did they come into personal contact with each other in any of the settings, so no inferences could possibly have been made by them as to the true purpose of the two combined regimens.Throughout the course of the study all pertinent data were collected either by the nursing staff, or the physiotherapists, who all had successfully completed the Good Clinical Practice training scheme, and then duly collated by the Project Leader.The present study protocol was duly endorsed by an Independent Ethics Committee as fully compliant with the 1964 Helsinki Declaration, as well as a written informed consent was secured from each study participant.Volunteers were recruited from a nursing home facility (42), as well as from the former patients of the University Clinic Geriatric Ward (49), subsequently becoming the free-living study subjects (i.e. community dwellers).Out of 301 original volunteers 91 subjects (mean age 79 ± 7.6) were ultimately enrolled into the study 3. Body Mass Index (BMI) > 194. Individual balance, as evidenced by > 21 score on the Berg Balance Scale (BBS)5. Score of > 20 on the Mini Mental State Examination (MMSE)6. Lack of any counter-indications on medical grounds The following exclusion criteria were also stringently applied:1. Cancerous disease in the stage of advancement rendering a subject's participation in the trial non-feasible2. Prior surgical treatment of the abdominal area within three months prior to the commencement of the study3. Acute gastric tract disorders4. Acute pancreatitis or diabetes5. Any recently sustained fractures (i.e. within the year immediately preceding the commencement of the study)6. Any past cerebral incidents whose lasting functional after-effects would make the pursuit of exercise regimens non-feasible (e.g. hemiplegia accounting for a stiff knee joint)Out of 91 subjects ultimately enrolled into the study, 11 dropped out within the first fortnight , thus reducing down to 80 the overall number of participants who successfully completed the study (i.e. 38 nursing home residents and 42 community-dwellers).Medical, functional and overall mental/cognitive status of the study subjects was assessed and documented using the following standard evaluative procedures: select blood tests, ECG, lung X-ray, the Katz Index Activities of Daily Living (ADL) , the LawFollowing the completion of the recruitment stage the participants were randomly assigned (through computer-assisted randomisation) to either the control, or intervention group after the baseline testing. Allocation of study subjects into the respective groups envisaged equal distribution of both the nursing home residents and former geriatric ward patients. The assessors were duly blinded to the group allocations in respect of all outcome measures.In order to be admitted into the testing procedure all potential participants were required to pass successfully the Berg Balance Scale test, i.e. the required score > 21 points ,21, whicThe entire study population was then assessed in terms of individual functional performance capabilities using two standard test procedures: Six-Minute Walk test (6 MW) ,23 and T®), in full consideration of their individual physical capacity, therefore ensuring truly progressive character of the training regimen.The measurements were taken with the aid of HOGGAN MicroFET2 dynamometer -28, usinEach subject was allowed two or three practice trials to familiarize himself with the actual procedure. Three formal measurements of a subject's muscle strength were then taken in four different lower limb positions and duly recorded , whereas the best trial was ultimately accepted as the final result.The measurements consequently allowed to determine 80% of the muscle strength within each specific muscle group (i.e. hip and knee extensors and flexons), selected in view of their significant impact upon general functional activities. This value was then verified by one repetition maximum (1-RM), i.e. the maximal stretch of a rubber resistance band at one time only, as per interim (weekly) measurements in order to adjust the individualized training load accordingly.The subjects' muscle strength was assessed twice, i.e. prior to the commencement of the PRE regimen and after its conclusion. All measurements were carried out by the same physiotherapist to ensure that there were no idiosyncratic differences in the actual application of the procedure. Full compliance with the GCP Guidelines was assured throughout.This assessment procedure was applied prior to the actual commencement of the study protocol, aiming to provide the attending physician with the structured information in the following categories: standard anthropometric measurements, inclusive of BMI , global evaluation and dietetic assessment, expressed by a maximum score of 30 points.Initially, the habitual nutritional intake of every study subject was assessed by a full-time clinical dietician who charted the caloric value of an entire daily food intake of each patient for 7 days prior to the commencement of the study. The subjects were instructed by the dietician to complete an estimated record of all foods consumed during each day (including weekend) in as much detail as possible. The information supplied voluntarily by the subjects, as well as pertinent dietary data collected by the dietician off the actual nursing home menu cards, was then meticulously recorded in the standardised Case Report Forms (CRFs).The same procedure was then extended over the entire length of the study, so as to facilitate strict monitoring of overall energy intake in full consideration of the nutritional supplementation. All records were duly coded and subsequently analysed for nutrient composition by the same person, using the MS EXCEL-based computer application, specifically designed for the purpose by the resident IT engineers.All exercise interventions were comprehensively structured by the authors, primarily with the aim of restoring the already impaired functional capabilities in the frail elderly through helping them build up overall fitness, with particular emphasis on individual balance, mobility and muscle strength.Since all exercises are actually designed with a view to making active use of simple and easy to obtain props, i.e. pedal exercisers, ball cushions, standardised elastic resistance bands, household furniture, they are easily adaptable to different environments, as well as seem to hold much more appeal to the subjects than the highly sophisticated training equipment, frequently known to cause apprehension or even high anxiety ,30.The principal idea consisted in selecting such props that could easily be applied in the way effectively interacting with the subjects' predominantly sedentary lifestyle. For instance, the subjects were found to be quite at ease when balancing on a ball cushion on top of the chair seat, or pedalling away at the exerciser, whilst watching their favourite TV shows. This way the subjects did not have to divert much from their daily routines, merely having them slightly modified to accommodate actual application of the props. The obvious functional advantage of establishing such an easy-going exercise routine consisted in the fact that it effectively aided activation of cardiovascular function, stimulation of walking capacity and overall enhancement of individual balance. Finally, these exercises may be individually pursued without any supervision, once the actual routine has been established by a licensed physiotherapist.Each exercise training session was designed to last 45 minutes and the regimen was to be pursued for 5 days a week (i.e. weekends were exercise-free for administrative reasons), which in the view of the present authors might reasonably be construed as a high-intensity activity. Each 45 min. session was further broken down into the following components: 5 min. general warm-up exercises of the upper and lower limbs and the trunk , to be followed by ca. 20 min. of functionally-oriented exercises (FOE), to be then followed by ca. 20 min. long standard exercises (SE), or progressive resistance exercises (PRE), depending on a specific group allocation. Every session was then rounded off with a series of simple breathing and relaxation exercises. All exercise interventions were pursued at the subjects' actual place of residence and individually supervised by a physiotherapist to ensure full (100%) compliance with the study regimen were allocated to all study groups specifically with a view to generally enhancing their respective functional capabilities prior to the actual commencement of the other two exercise regimens (SE and PRE) designed as the ultimate differentiation factor. As opposed to a diversity of other types of exercises generally recommended to the frail elderly by physiotherapists, the functionally-oriented ones are commonly acknowledged to be universally well tolerated, versatile and offer a multitude of tangibly beneficial effects, e.g. stimulate individual balance , promote safe postural shifts and enhance individual walking capabilities. Such a complex "warm-up" routine was also meant to have the subjects better prepared to face up to the much more challenging "power" exercises, as well as was expected to put all participants on the same functional platform, as it were, so that subsequent results could consequently lend themselves to more objective assessment in terms of their actual statistical relevance.These exercises consisted of a series of 3 exercises designed to stabilise the subject's balance when rising from a standardised chair to a fully upright position. This was then followed by a series of multi-sensory exercises with the aid of a ball cushion, so as to give the subject an impression of an uneven, as well as an unstable surface on which he is then required to perform. All exercises were carried out in both sitting and fully upright position .Standard exercises (SE) consisted of a series of 10 simple exercises (implemented in an upright sitting position on a standardised chair), followed by another series pursued on a pedal exerciser, designed to activate the lower limbs .Progressive resistance exercises (PRE), meant to be pursued after prior completion of the warm-up set, were developed as the four series of proper resistance exercises pursued with the aid of a standardised elastic resistive exercise band ,33. Each® colour-coding system) to suit his own muscle strength. In the present study only two Thera-Band® colour codes were utilised: yellow and red . The attending physiotherapist would then instruct the subject by exactly how much the double folded elastic band was to be stretched out in order to achieve the required 80% of 1-RM. The subjects' delivery was also strictly monitored throughout to minimize the risk for muscle injury.Following the initial individual assessment of 1-RM, each subject was allocated the elastic resistive exercise band specifically calibrated was provided to the study subjects once daily, each time shortly before the commencement of their routine exercise regimen, throughout the period of 7 weeks, five times a week, with a view to establishing the impact of supplementary nutrition intake on patients undergoing specific physiotherapy programme. The nutritional supplement – a 200 ml liquid supplying 300 kcal in the form of carbohydrate (49%), lipids (35%) and protein (16%) mixture was designed to augment individual caloric intake by ca. 20%, as well as top up their recommended daily allowances of vitamins and minerals (by ca. 25%). Full (100%) compliance was assured by the trained nursing stuff .Nutritional supplement (NUTRIDRINK® manufactured by Habiron). Both the supplement and placebo were administered in unmarked containers by the nursing staff, who had no prior knowledge of their contents, nor indeed were in any way privy to the actual nature of their assignment.All subjects not receiving a nutritional supplement were given an equal volume of a substantially less nutritive , artificially sweetened, strawberry-flavoured liquid containing 97.5% of carbohydrates, 1% lipids and 1.5% proteins of the study subjects their daily nutritional supplement should range from 1 – 3 servings of NUTRIDRINKP <0.05. With a view to determining the statistical significance of any differences between the first and the second assessment of the study subjects, t-Student test was applied, as well as the Paired-Sample-Comparison, with the aim of establishing the actual effectiveness of the pursued regimens.The statistical analysis made use of the following trait characteristics: arithmetic mean, standard deviation, standard skewness and standard kurtosis. A sample size of 22 – 23 participants per group was estimated to provide over 90% power at a significance level of ® software package.In order to compare the results yielded by the respective study groups, one-way analysis of variance (ANOVA I) and multiple range tests (i.e. the Bonferroni method) were applied. Statistical significance was established as p < 0.05. Since individual balance and gait scores were assessed with the aid of the 0 – 2 scale (as per the modified Tinetti POMA test), a non-parametric Wilcoxon test was used for comparing the paired variables. All data were subsequently processed by STATGRAPHICS Plus v. 5.0. for WindowsSignificant differences in muscle strength were noted both in favour of Group I and Group II (PRE + placebo), as compared to Group III and Group IV (SE + placebo). It might therefore be reasonably inferred, despite a relatively short duration of the study, that progressive resistance exercise (PRE) regimen is clearly instrumental in appreciably improving individual muscle strength, irrespective of nutritional supplementation, at least in the volume actually offered to the present study subjects Table and 4.With regard to individual mobility notable improvements were reported in Group III which pursued the regimen combining SE with nutritional supplementation, although, admittedly, appreciable gains in individual muscle strength (Group I) clearly did not appear to translate directly into perceptible improvement in individual mobility Table and 6.In the groups assigned standard exercise (SE) regimen statistically significant improvement was noted with regard to the distance covered by over 35 metres on completion of a 7-week study Table .p = 0.01), whereas no such gains were observed in the group pursuing the progressive resistance exercise (PRE) regimen (Group I); the difference possibly attributable to the perceptibly less strenuous character of the former regimen.The study subjects who followed standard exercise (SE) regimen (Group III), as well as received nutritional supplement were found to have appreciably gained in body weight by ca. 1.72 kg on average over 7 weeks as a significant marker of individual functional capability, opting for the assessment of the gait speed instead, which in turn seems to undermine to certain extent overall consistency of his approach, especially in view of so much praise having been lavished on the High Intensity Functional Exercise (HIFE) Programme applied throughout his study.Considering, however, that our own exercise regimen provided for 45 min. uniform exercise sessions 5 times a week, pursued for 7 weeks , we would be somewhat wary of accepting Rosendahl's term HIFE Programme, especially in view that each of his study subjects had his exercises individually tailored by the physiotherapist to suit his individual functional deficits. Arguably, this particular approach seems to make the actual quantification of exercise effectiveness a rather daunting task.Besides, despite offering rather comprehensive baseline characteristics, Rosendahl neglected to offer, however, any information on whether the application of HIFE Programme actually yielded any quantifiable improvements in terms of downgrading the type of walking aids used by his subjects, which might otherwise be of some value for designing more effectively targeted exercise regimens; this particular type of study generally expected to be intrinsically focused on practical application of its findings.The results yielded by our own study clearly support the conclusion that only standard exercises in combination with the functionally targeted ones may prove effectively instrumental in appreciably enhancing individual walking capabilities, as assessed by the 6 MW test, despite notably failing to improve overall muscle strength in the knee flexors and extensors. Admittedly, overall muscle strength in the lower limbs is just one of several key factors essentially contributing to the effective performance of independent activities, although its true significance should by no means be underestimated.Although Bunout et al. reportedIt might perhaps also be worth mentioning at this juncture that in ca. 20% of the study subjects who had been allocated progressive resistance exercise regimen a perceptible trend toward diminished reliance on assistive devices was observed , although a study embracing a much longer time span would obviously be required to determine its true, long-term statistical significance. Similar observations were also made by Fiatarone et al. and SullThe presently applied resistance exercise regimen was deliberately focused on leg extension, as both the knee and hip extensors are the muscle groups widely acknowledged to be of critical importance in executing such basic postural shifts as sit-to-stand (and vice versa) and walking, with a long-term aim of appreciably enhancing individual functional performance ,43.Fiatarone et al. , who conBonnefoy et al. , whose rThe study pursued by Bunout et al. , embraci®), overall effectiveness of the applied supplementation regimen should be assessed in terms of the respective compliance rates. The fact that Bunout had his nutritional supplement diluted in a soup or porridge seems to have significantly contributed to a relatively low compliance rate.Since the composition of the nutritional supplement used by Bunout was on a par with the one offered to our own study subjects should always be pursued in combination, it is actually the FOE type that can safely be recommended to a much more diversified population of frail elderly , irrespective of their specific social setting, as they have positive impact over a significantly larger number of bodily systems and functions.In seeking to design optimum exercise interventions programme de Vreede advocated that specifically targeted, functional-task exercises be primarily considered in view of their substantial potential for long-term effectiveness. The authors fully support this view in so far as more in-depth research is still required in order to determine beyond reasonable doubt which specific exercise interventions of the FOE type hold by far the greatest potential to yield the most promising, long-term results and should therefore primarily be considered as the core element of any viable physical rehabilitation programme under development; overall validity and persuasive character of de Vreede's findings notwithstanding .Admittedly, overall complexity of the issue addressed by the present study clearly merits pursuit of further studies of a closely similar, multi-factorial intervention design, though preferably conducted over much longer time span, as well as best targeting the over 60s as the population standing by far the best chance of a successful outcome, in order to verify whether the present findings, clearly encouraging as they appear, might actually have sufficient potential to develop into a trend of indisputable clinical significance, especially in terms of possible application in a comprehensively designed, nationwide programme specifically aimed at addressing the problem of a steadily growing proportion of the frail seniors dependent for their activities of daily living.Comprehensively structured, high-intensity regimen made up of diverse exercise types, i.e. functionally-oriented, progressive resistance and standard ones, preferably if combined with nutritional supplementation offered in adequate volume, is believed to demonstrate clear potential for appreciably improving overall functional status in the frail elderly, especially in terms of individual walking capacity and muscle strength, as well as for possible downgrading of any currently used assistive devices. It would also appear that consistent application of functionally-oriented exercise regimens making active use of simple, easy-to-use props may significantly enhance individual balance.PRE: Progressive resistance exercises; FOE: Functionally-oriented exercises; SE: Standard exercises; 6 MW: Six-Minute Walk test; Tinetti's POMA test: Tinetti's Performance Oriented Mobility Assessment test; BMI: Body Mass Index; BBS: Berg Balance Scale test; MMSE: Mini-Mental State Examination; ADL: Activities of Daily Living; IADL: Instrumental Activities of Daily Living; MNA: Mini Nutritional Assessment; CRF: Case Report Form(s); GCP: Good Clinical Practice guidelines; SD: standard deviation; LDL: Low-density lipoprotein cholesterol; HDL: High-density lipoprotein cholesterol; 1 RM: One repetition maximum; HIFE: High Intensity Functional Exercise.The authors declare that they have no competing interests.MZ contributed to overall design of the study, inclusive of the intervention set-up, contributed to analyses and interpretation of results and drafted the manuscript. CHS made key contribution to the actual conception and overall design of the study, supervised all its aspects throughout and critically revised the final draft of the manuscript. TG facilitated the actual implementation of the study regimens, generally managed the project and contributed to the preparation of the manuscript in terms of overall analytical consistency.All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:
We attempt to ascertain if the 3 linked single nucleotide polymorphisms (SNPs) of the Progesterone Receptor (PR) gene and the PROGINS insertion in the intron G, between exons 7 and 8, are associated with Recurrent Spontaneous Abortion (RSA) in the Indian population.A total of 143 women with RSA and 150 controls were sequenced for all the 8 exons looking for the above 3 linked SNPs of the PR gene earlier implicated in the RSA, as well as for any new SNPs that may be possibly found in the Indian population. PROGINS insertion was screened by electrophoresis. We did not find any new mutations, not observed earlier, in our population. Further, we did not find significant role of the 2 allele or the T2 allele (PROGINS insertion) in the manifestation of RSA. We also did not find an LD pattern between each of the 3 SNPs and the PROGINS insertion.The results suggest that the PR gene mutations may not play any exclusive role in the manifestation of RSA, and instead, given significantly higher frequency of the 2 allele among the normal women, we surmise if it does not really confer a protective role among the Indian populations, albeit further studies are required in the heterogeneous populations of this region before making any conclusive statement. It is mainly involved in the female menstrual cycle, pregnancy and embryogenesis in most mammalian species. It stimulates and regulates various functions - i) helps in preparing the body for conception and pregnancy Progesterone receptor (PR) mediates the physiologic effects of progesterone. The PR gene uses separate promoters and translational start sites to produce 2 isoforms, PRA and PRB, the only difference between the two being an additional 165 amino acids present in the N terminus of PRB. The human progesterone receptor (hPR) gene was localized to 11q22–q23 Alu subfamily in intron G, between exons 7 and 8 in the codifying region of the hormone binding domain Three linked single nucleotide polymorphisms (SNPs) in the PR gene were found to be associated with RSA Given that most studies hitherto undertaken were on the Caucasian populations, it is not known if ethnicity has any role in the observed pattern of association of PR polymorphisms with adverse pregnancy outcomes. There were no studies on the role of these polymorphisms vis-à-vis RSA in the Asian populations, especially from India, which is known for its unique population structure characterized by strictly endogamous castes and tribes. In view of this, we attempt to ascertain if the 3 linked SNPs of the hPR gene and the PROGINS insertion are associated with RSA in the relatively homogenous Indian sample. We also attempt to explore if we can find any novel SNPs in hPR gene that can be implicated in RSA.2 = 3.44, df = 2, p = 0.18).We did not find any new SNPs in hPR gene, other than the 3 found earlier. The three SNPs found in the PR gene – exon 1: G 1031 C, S344T; exon 4: G 1978 T, L660V; exon 5: C 2310 T, H770H – co-inherit. The genotype frequencies of the homozygotes for wild type allele (1), heterozygotes (1/2) and homozygotes for the rarer mutant allele (2) in the RSA women were observed to be 127 (88.8%), 15 (10.5%) and 1(0.7%), respectively, as compared to 122 (81.3%), 25 (16.7%), and 3(2%) in controls . The gen2 = 3.75, df = 1, p = 0.05) as well as between the RSA women with ≤3 abortions and controls . However, this significance is due to an increased frequency of the 2 allele among the controls, not among the RSA women. Similar trend was seen when allele frequencies were calculated for the patients from LFC and FMH and for primary and secondary aborters separately. Although significant χ2 values were observed to suggest association in the LFC data , as well as for the primary aborters the perceived risk allele (2), contrary to the expectation, is observed in higher frequency among the controls, suggesting probably a protective role of this allele. Further analysis was carried out to check, if this trend can be statistically validated. Logistic regression was performed considering a possible protective role for the 2 allele. Although the odds ratio (OR) for the pooled RSA sample and the controls was only marginally significant (p = 0.056), OR for the RSA women with 2–3 abortions and the controls was significant (p = 0.03), suggesting a protective role for the allele of these results was computed using GPower 3.1. Given the large sample (2N), the power obtained was significant at 80% for pooled RSA women (286) and controls (300) and 87% for RSA women with 2–3 abortions (250) and controls (300), conferring fair degree of reliability to the findings of this study.Alu insertion revealed genotypic frequencies of 133 (97.1%) homozygous wild type (T1/T1), 3 (2.2%) heterozygous (T1/T2) and 1 (0.7%) homozygous PROGINS insertion (T2/T2) among the RSA women as compared to the frequencies of 143 (95.3%), 6 (4%) and 1 (0.7%) among the controls . Allele frequencies for the T1 and T2 alleles were observed to be 0.982 and 0.018 and 0.973 and 0.027, respectively for the RSA and control women. The difference in the allele frequencies between RSA and control women was not significant in either the pooled sample or when RSA women with different number of abortions are separately considered.The analyses of PROGINS controls . The genThe mutant alleles considered together at the three SNP sites and the PROGINS insertion are reported to be in LD Progesterone receptor mediated effects play a critical role in female reproduction We did not find any significant increase in the frequency of either the 2 allele or the T2 allele among RSA women in our study of the Indian population and contrary to the expectations, we find a higher frequency of the 2 allele in the controls. Therefore, our results based on a relatively larger and more homogeneous Indian sample suggest that PR gene mutations may not play a significant role in the manifestation of RSA and, instead, prompt one to surmise if the 2 allele does not really confer a protective role among the Indian populations. Our results are not in agreement with previous reports of associations between progesterone receptor mutations and adverse reproductive outcomes including unexplained infertility To the best of our knowledge, ours is by far the largest sample as far as the studies of PR mutations in RSA are concerned. For example, the studies concerning unexplained infertility Despite the crucial role that progesterone plays in the maintenance of the pregnancy the genetic analysis of PR gene did not provide formidable evidence towards its association with RSA, either in the western or Indian populations so as to attach any prognostic value for RSA. However, since progesterone is essential for the development of a receptive endometrium, it is necessary to also consider: progesterone levels in the suburban Nellore town and Fernandez Maternity Hospital (FMH) in metropolitan Hyderabad. These two hospitals not only represent two different socio economic strata of the patients, but are also separated geographically by about 500kms. Control samples were collected from Hyderabad, Nellore and nearby villages so that they broadly represent matched ethnic and socio-economic backgrounds with that of the cases. This framework facilitates to test if the results are consistent between the socioeconomically contrasting but genetically somewhat homogenous samples; screening a number of autosomal STR markers from 27 Telugu populations (castes and tribes) from different socioeconomic strata, Reddy et al Peripheral blood samples (3–5 ml) were collected in EDTA coated vacutainers from 143 women with RSA of unknown etiology. Of these 83 were from LFC while remaining 60 were from FMH. All RSA women, with the mean age of 26 yrs (range 18–37 years of age) and with number of miscarriages ranging from 2 to 9, had regular menstrual cycles and were healthy. Karyotypes were normal. The women underwent careful clinical examinations, as well as analysis of tissue antibodies and auto-antibodies as prescribed by their doctors. Women normal for the above tests as well as for the blood glucose and thyroid stimulating hormone concentrations were enrolled for the study. A possible infectious etiology was also ruled out by assessing the reports of the microbiological cultures of the samples obtained from the cervix and uterine cavity. A total of 130 women had no previous children (primary aborters) while 13 had one or two children before the consecutive miscarriages (secondary aborters). Our control group consisted of 150 healthy women with no history of abortions and at least one live born child. Women in the control group were aged between 18–45 years. Blood samples from the cases as well as the controls were collected with written informed consent and we had obtained approval for this study from the Indian Statistical Institute Review Committee for Protection of Research Risks to Humans.Alu insertion analysis was carried as per Gomes et al., DNA was isolated from the above samples following Sambrook et al., 2 analysis and logistic regression were carried out using SPSS. GPower was employed to detect the power of the study. Linkage disequilibrium estimates, for the three SNP loci and the PROGINS insertion, were calculated using Haploview 4.1 software.Allele frequencies were calculated by gene counting method for the case and control samples, women with ≤3 and ≥4 abortions, RSA women from LFC and FMH and primary and secondary aborters separately. χ
The intestine is a complex structure that is involved not only in absorption of nutrients, but also acts as a barrier between the individual and the outside world. As such, the intestine plays a pivotal role in immunosurveillance and protection from enteric pathogens. Investigating intestinal physiology and immunology commonly employs 'intestinal loops' as an experimental model. The majority of these loop models are non-recovery surgical procedures that study short-term (<24 hr) changes in the intestine (1-3). We previously created a recovery intestinal loop model to specifically measure long-term (<6 mo) immunological changes in the intestine of sheep following exposure to vaccines, adjuvants, and viruses (4). This procedure localized treatments to a specific 'loop', allowing us to sample this area of the intestine. A significant drawback of this method is the single window of opportunity to administer treatments (i.e. at the time of surgery). Furthermore, samples of both the intestinal mucosa and luminal contents can only be taken at the termination of the project. Other salient limitations of the above model are that the surgical manipulation and requisite post-operative measures can directly affect the treatment itself and/or alter immune function, thereby confounding results. Therefore, we modified our intestinal loop model by inserting long-term catheters into the loops. Sheep recover fully from the procedure, and are unaffected by the exteriorized catheters. Notably, the establishment of catheters in loops allows us to introduce multiple treatments over an extended interval, following recovery from surgery and clearance of drugs administered during surgery and the post-operative period. All instruments are autoclaved; non-autoclaveable materials are sterilized in Germex cold sterilization solution for a minimum of 10 min.Sheep are pre-medicated with acepromazine (0.05 mg/kg), glycopyrrolate (0.005 mg/kg), and butorphanol tartrate (0.2 mg/kg) IM, and left for 15-20 min.The neck is shaved and the skin surgically scrubbed. Once the jugular vein is visualized, 0.1 ml of lidocaine is injected SC over the vein, the catheter is introduced into the vein and secured to the skin using livestock identification tag cement and 2" hospital tape. During surgery, the animals are given 10 ml/kg/hr of Plasmalyte 148 (by gravity flow). 2 at a rate of 4 L/min) for the duration of the surgery.Diazepam (0.2 mg/kg) is administered IV, and anesthesia is induced with thiopental sodium (10 mg/kg). Lidocaine endotracheal spray is applied to the vocal folds, the sheep is intubated, and maintained on isoflurane is maintained. A 15-20 cm midline incision is made using an electroscapel, caudally from the umbilicus, and the ileocecal fold is located in the right lower quadrant of the abdomen. The caudal ileum and cecum are then exteriorized. Throughout the procedure, handling of the intestine is minimized and care is taken to ensure the exteriorized intestine is kept moist with warm (37-39°C) sterile phosphate buffered saline . An 85 cm segment of ileum is measured and then clamped with Doyen forceps and large Kelly forceps at each end of the segment. Within the intestinal segment, 'loops' and 'interspaces' between the loops will be established. Doyen forceps are placed on the side of the ileum to be joined (anastomosis), and the Kelly forceps are placed on the intestinal segment side of the ileum.The ileum is cut between each Doyen and Kelly forcep and the intestinal segment designated for loops is gently flushed twice with 60 ml of warm PBS to remove ingesta. A cocktail of broad-spectrum antibiotics is distributed throughout the intestinal segment and left for 30 min. The proximal and distal cut ends of the ileum are joined to form a continuous and functional intestinal tract. First, the ileum is aligned by two stay sutures, placed at the mesenteric and antimesenteric borders of the intestine, respectively. Then, a simple continuous suture pattern (2-0 Vicryl) is completed on both sides of the intestine to join the intestine together. Warm PBS (3-5 ml) is injected at the anastomosis site to check for leakage and suture failure. Then, the tip of Kelly forcep is pressed against the serosal surface of the intestine, close to the site of the anastomosis site, and advanced inwards at the anastomosis site to ensure the intestinal lumen is large and patent.The antibiotic cocktail is removed from the intestinal segment. Each end of the segment is closed with a simple continuous suture pattern followed by an inverting suture pattern using 2-0 Vicryl.The 85 cm-long intestinal segment is partitioned into three 15 cm 'loops', two 15 cm-long 'interspaces' between the loops, and two 5 cm-long blunt-end compartments at the termini of the intestinal segment . The loops are created by placing a ligature around the intestine using 2-0 silk. It is noteworthy that major mesenteric vessels are not ligated during this procedure, as these are needed to supply the intestine with blood, maintaining intestinal viability. Also, the ligatures are left long, as they will be used to secure the catheters.Catheters (i.e. silastic tubing) are individually identified using a permanent marker. A silicon ball (5 mm-diameter) encircling the catheter, is placed 4-5 cm from the catheter end to help prevent the catheter from sliding out of the intestine . After sterilization by autoclaving, a non-antibiotic ointment is aseptically inserted into the catheter end (3-5 mm); this ensures that the catheter remains patent (i.e. it does not become plugged by sloughed mucosa within the loop). A small incision is placed at the cranial aspect of each of the three loops. Each hole is enlarged with a catheter introducer (i.e. 'vessel dilator'), and a 6-8 cm segment of catheter is inserted caudally into the loop, until the silcone ball passes into the lumen .The intestinal wall is secured around the catheter with a purse string suture (2-0 Vicryl). The catheter is further secured to the intestine by tying the catheter with the ligature silk that delineated the cranial end of the loop.Ampicillin is injected into each loop and interspace, and the intestine is placed back in the abdominal cavity. Cefazolin is injected into the peritoneal cavity through the abdominal incision. A single small stab incision is made through the abdominal wall adjacent to the midline incision, and the catheters are exteriorized through this site.The position and tension of the catheters is adjusted within the peritoneal cavity. Abdominal muscles are closed with a simple interrupted suture pattern , and skin is closed with an interrupted horizontal mattress pattern .A curved hollow stainless steel tube is inserted under the skin near the abdominal incision, tunneled under the skin to an exit site just caudal to the neck and between the shoulders. The catheters are inserted into the tube and pushed forward for at least 50% of the tube length. The tube with the catheters is then pulled from the skin at the exit site, exposing the catheters.The tension of the catheters is adjusted at the stab incision site, and the skin is closed with Supramid #1.Individual catheters are identified and placed within a bandage "pouch" which is sutured to the skin with Supramid #1. The pouch protects the catheters from subsequent damage.ad libitum, but feed is restricted until normal rumen and bowel functions are restored. Food intake, water consumption, body temperature, passage of feces and urine, gut noises, abdominal discomfort, demeanor, and blood glucose concentrations are closely monitored (b.i.d.); when necessary, glucose concentrations in the intravenous fluids are adjusted to maintain blood glucose concentrations within the normal range. Blood chemistry and hematology are monitored before and immediately after surgery, and every other day thereafter. Once normal bowel function commences, intravenous fluid therapy is terminated and animals are transferred to paddocks (i.e. 5-7 days post-surgery). Animals are maintained in individual pens , thereby reducing stress and the chance of sustaining damage to their catheter pouches (e.g. chewing by a penmate).Post-operatively, sheep are injected IM with flunixin (s.i.d.) at an initial dose 2.2 mg/kg, followed by a maintenance dose of 1.1 mg/kg s.i.d. for 3 days. Sheep also are injected IM with Hemostam (3 ml) and enrofloxacin (2.5 mg/kg) s.i.d. for 3 and 5 days, respectively. Animals are maintained on intravenous Plasmalyte 148 with 5% dextrose solution, administered continuously with a peristaltic pump to ensure that flow (145 ml/hr) continues regardless of body position. They are allowed to drink To inject treatments into individual loops, 5 ml of the treatment is injected into the catheter using a sterile syringe fitted with an 18 gauge, blunt-ended needle. To ensure the deposition of all of the treatment into the loop, the catheter is then injected with 3 ml of PBS.Figure 1. A schematic representation of catheterized ileal loops. Note the three 15 cm-long catheterized 'loops', the two 15 cm-long non-catheterized 'interspaces' established between the loops, and the two 5 cm-long terminal segments, all established within an 85 cm-long 'intestinal segment' of a sheep ileum.Procedures of crucial importance to the success of this surgical procedure include: (1) verifying that the intestine is not twisted on itself before establishing the anastomosis; (2) ensuring the integrity and patency of the anastomosis; (3) adequately securing the catheter to the loop wall with the ligature delineating the cranial end of the loop, but ensuring that the attachment does not affect the patency of the catheter; (4) minimizing intestinal handling and ensuring that exteriorized intestine is kept moist; (5) ensuring the appropriate catheter tension; (6) ensuring that the integrity of the catheter is not affected during muscle and skin suturing; (7) preventing gorging by sheep post-surgery (i.e. during the period of post-operative ileus) which can cause ruminal impaction and impairment of rumen function; and (8) ensuring that animals receive sufficient intravenous fluid therapy for the first 3-5 days post-surgery, that blood glucose concentrations are carefully monitored, and glucose concentrations in the intravenous fluids are adjusted if necessary to prevent hypoglycemia.<p>All procedures on experimental animals were approved by the Institutional Animal Care Committee and followed the guidelines set by the Canadian Council of Animal Care.</p> <p>We have nothing to disclose.</p>In this procedure, we were able to successfully establish catheters in intestinal loops established within the ileum of sheep. By adhering to stringent post-operative care, animals rapidly recovered from the procedure and resumed normal activity 5-7 days after surgery. We determined that the establishment of catheters within loops does not affect intestinal mucosal or immune function (data not shown) and animals can live for at least 8 wk after surgery. This procedure allows us to introduce multiple treatments into distinct immunological compartments over an extended interval, once animals have recovered from surgery, and to empirically measure the physiological and immunological effects of these treatments.An important consideration for future experiments is the location of the intestinal segment within the small intestine. In this procedure we surgically created the intestinal segment within the ‘immunologically functional ileum’ as often defined by ileal (continuous) Peyer’s patches . This area can extend cranially up to 2 m beyond ileocecal fold. Although this region is considered anatomically as the jejunum, in the context of immunological function, it is ileum, highlighting the importance of considering function when describing intestinal regions.
Twenty patients were enrolled . Surgical procedures included: no surgery: five, open biopsy: three, stereotactic biopsy: six, partial resection: three, and sub-total resection: three. Histological diagnoses included pilocytic astrocytoma: one, astrocytoma with no other specification: three, anaplastic astrocytoma: three, glioblastoma multiforme: eight, no histology: five. The most frequent side effects were haematologic and gastrointestinal. There was no toxic death. The response to combined treatment in 12 evaluable patients was: complete response: 0, partial response: three, stable disease: four, and progressive disease: five. All tumours progressed locally and all patients died. The overall median survival was 8 months. The overall survival rates at 1 and 4 years were: 0.4 and 0.05 respectively. This was not different from a control group of patients documented in the same population. Oral trophosphamide in combination with etoposide did not improve survival of pontine glioma patients. The treatment was well tolerated and should be evaluated for more chemoresponsive paediatric malignancies.To evaluate the overall survival of paediatric patients with pontine gliomas treated with oral trophosphamide and etoposide. Patients between 3 and 17 years of age with either typical diffuse pontine glioma on MRI or histologically proven anaplastic astrocytoma/glioblastoma multiforme located in the pons, were eligible. Treatment consisted of oral trophosphamide 100 mg mBritish Journal of Cancer (2002) 87, 945–949. doi:10.1038/sj.bjc.6600552www.bjcancer.comCancer Research UK© 2002 The term ‘brain stem glioma’ had originally developed as a clinical diagnosis without histological confirmation because the morbidity for surgical intervention within the pons was high and the relevance of histological diagnoses was low. By now, MRI morphology differentiates at least three groups of tumours to be treated in very different ways . (ii) InOn histology, brain stem gliomas are predominately astrocytic tumours. In other locations and age groups, tumour gradings such as the WHO classification, have proven to be of high prognostic value. This even includes adult patients with brain stem glioma started to document (HIT-DOC) paediatric brain tumour patients who are not enrolled in other clinical studies. For patients with diffuse pontine glioma and glioblastoma multiforme, a series of phase I/II treatment trials was activated in 1995 and glioblastoma multiforme were enrolled. The histology had to be confirmed by the Neuropathology Reference Center. The study enrolled patients mainly between July 1995 and April 1997, by which time it was substituted by the following protocol (‘HIT-GBM-B’). However, two patients were enrolled after the planned study closure and were not excluded from this analysis.Twenty patients with pontine tumours were enrolled in the treatment study HIT-GBM-A. The male : female ratio was 9 : 11, the median age was 6 years double-documentation on the treatment cohort, and (ii) patients enrolled in one of the later treatment protocols . This left 26 patients eligible for the control group. As expected, the year of diagnosis was much more widespread, ranging from 1983 to 1998 . The ageThe study protocol included up front standard fractionated radiotherapy to the tumour region plus 2 cm margins in 30 fractions of 1.8 Gy resulting in a total dose of 54 Gy, given over a period of 6 weeks with one radiation on 5 of 7 days per week. This was completed in 18 of the 20 patients. A 5-year-old girl received only 50 Gy after a partial resection of a glioblastoma multiforme, an 8-year-old boy with stereotactically biopsied pilocytic astrocytoma received 56 Gy.−2 day−1 per os, and etoposide 25 mg m−2 day−1 per os daily for 21 days followed by a week of rest, after which the next cycle started. Chemotherapy was started simultaneously with radiation as soon as the diagnosis was confirmed and was planned for a period of 1 year or 13 cycles. All patients of the treatment group started this protocol. It was discontinued when the tumours progressed, and it was extended after completing the 13 cycles in a few patients by parents'/physicians' choice. This resulted in a mean number of cycles of 7.2 .The chemotherapy included trophosphamide 100 mg mThe control group's adjuvant treatment was rather inhomogeneous, as it was not a treatment protocol but a documentation study, summarising, what was done by different institutions. By definition, all patients had radiotherapy. Five patients had stereotactic seed implantations, while three of them had additional external radiotherapy. The external radiotherapy doses varied between 15 and 64.8 Gy . In addition to the radiation, chemotherapy was given in 16 patients. Three patients received carboplatinum/vincristine, one patient was treated according to the CCNU/vincristine/cisplatinum chemotherapy protocol , four paOral chemotherapy with trophosphamide/VP16 was well tolerated. There were no treatment-related deaths. Less severe side effects were not the primary objective of this study, and the documentation was insufficient in four patients. Of the remaining 16 patients, one had no side effects. Nausea was reported in eight patients, and vomiting in five of those. Haematological side effects were reported in 13 patients . Of those, one patient developed fever and neutropenia and required admission for antibiotic treatment. Rare side effects included increase of liver enzymes (NIH grade III), abdominal pain, dysuria (NIH grade II), and haematuria (NIH grade I) in one patient each. Response to treatment could be evaluated in 12 patients. The response rates were: complete response: 0, partial response: three, stable disease: four, progressive disease: five. All patients eventually died from local tumour progression. Time to progression was defined as time interval between diagnosis and either tumour growth seen in neuroimaging (>25% product of two perpendicular diameters) or death of disease, whatever came first. Using this definition, the median time to progression was 5.9 months : 2.6–9.1), the mean time to progression was 9.6 months . The median overall survival time was 8 months , the mean overall survival time was 13.8 months . The overall survival rates (and standard errors) at 1, 2, 3, 4, and 5 years were: 0.4 (±.11), 0.15 (±.08), 0.05 (±.05), 0.05 (±.05), and 0 (±0), . Multivariate analyses done with the Cox regression model, with both overall and progression free survival as endpoints, confirmed the lack of a significant difference between the two groups.The control group from the documentation study (HIT-DOC) had comparable survival rates with a median event free survival time of 7 months . The median overall survival time of the control group was 11 months . The 1 and 2 year overall survival rates were 0.40 (±0.11 standard error), and 0 (±0). The survival curves of the tTrophosphamide is an oxazaphosphorine, which is more lipid soluble as compared to cyclophosphamide and iphosphamide. This results in better intestinal reabsorption and allows oral treatment. Hepatic activation produces 4-hydroxy metabolites, including 4-hydroxy-iphosphamid , trophosEtoposide (VP16) is a topoisomerase II inhibitor from the group of epipodophyllotoxins. It is widely used in paediatric brain tumour treatment and given in many different schedules. Oral continuous chemotherapy has recently shown activity in glioma (Treatment intensification has increased cure rates in a number of paediatric malignancies. In phase II studies, normally one dose level below the maximal tolerated dose is used. In view of the short remaining lifetime of patients with pontine glioma, the trophosphamide/VP16 treatment intensity was picked differently (Diffuse and malignant pontine glioma in childhood remains a challenge of paediatric cancer care. Our treatment did not change this, as it was largely without effect on this tumour . The surResponse to chemotherapy is a difficult endpoint for a chemotherapy study with paediatric pontine glioma. Up to now, no chemotherapeutic protocol has matched the results of radiation. Delaying radiation in order to collect clean data for response to chemotherapy, had been controversially discussed and would have reduced the number of participating centres. The concept might be more suitable for a disease, which does not progress as fast as pontine glioma. Starting chemotherapy simultaneously with radiation will give response rates to the combined treatment. These data are of limited value unless they are compared to response rates of radiation only. In this cohort, the response of 12 patients was: 0/3/4/5 for complete response/partial response/stable disease/progressive disease. When comparing this to literature data from other populations, there does not appear to be an improvement , these dThe experience of this study with pontine glioma patients is negative with respect to antitumour effects. This does not preclude antitumour effectiveness in other malignancies, since all chemotherapeutic protocols tested in pontine gliomas up to now have failed, even when they are effective in more chemoresponsive tumours. This combination can safely be given to paediatric patients as palliative chemotherapy in other settings, since it was easy to monitor, side effects were mild, and since the treatment intensity can easily be adjusted on an individual basis.
Giardia duodenalis is prevalent in tropical settings where diverse opportunities exist for transmission between people and animals. We conducted a cross-sectional study of G. duodenalis in people, livestock, and wild primates near Kibale National Park, Uganda, where human-livestock-wildlife interaction is high due to habitat disturbance. Our goal was to infer the cross-species transmission potential of G. duodenalis using molecular methods and to investigate clinical consequences of infection.G. duodenalis in people from three villages of 44/108 (40.7%), with prevalence reaching 67.5% in one village. Prevalence rates in livestock and primates were 12.4% and 11.1%, respectively. Age was associated with G. duodenalis infection in people and livestock , but other potential risk factors in people were not. G. duodenalis infection was not associated with gastrointestinal symptoms in people, nor was clinical disease noted in livestock or primates. Sequence analysis of four G. duodenalis genes identified assemblage AII in humans, assemblage BIV in humans and endangered red colobus monkeys, and assemblage E in livestock and red colobus, representing the first documentation of assemblage E in a non-human primate. In addition, genetic relationships within the BIV assemblage revealed sub-clades of identical G. duodenalis sequences from humans and red colobus.Real-time PCR on DNA extracted from fecal samples revealed a combined prevalence of G. duodenalis in people and primates (assemblage BIV) and livestock and primates (assemblage E) underscores that cross-species transmission of multiple G. duodenalis assemblages may occur in locations such as western Uganda where people, livestock, and primates overlap in their use of habitat. Our data also demonstrate a high but locally variable prevalence of G. duodenalis in people from western Uganda, but little evidence of associated clinical disease. Reverse zoonotic G. duodenalis transmission may be particularly frequent in tropical settings where anthropogenic habitat disturbance forces people and livestock to interact at high rates with wildlife, and this could have negative consequences for wildlife conservation.Our finding of Giardia duodenalis is a common protozoan parasite that infects multiple mammalian species, including humans. We analyzed G. duodenalis from people, livestock, and wild non-human primates in forest fragments near Kibale National Park, western Uganda, where habitat disturbance and human-animal interaction are high. Molecular analyses indicated that endangered red colobus monkeys were infected with G. duodenalis assemblages BIV and E, which characteristically infect humans and livestock, respectively. G. duodenalis infected people at rates of up to 67.5% in one village, and people age 15 years or younger were especially likely to be infected. G. duodenalis infection in people was not associated with other factors related to behavior and hygiene, and infected people were no more likely to have reported gastrointestinal symptoms than were uninfected people. These results demonstrate that G. duodenalis transmission from humans and domestic animals to wildlife may occur with ease in locations such as western Uganda, where habitat disturbance causes ecological overlap among people, livestock, and primates. This conclusion has conservation implications for wildlife such as red colobus, which are already endangered by habitat loss. Giardia is a genus of parasitic protozoan that infects the small and large intestines of a broad range of vertebrate hosts G. duodenalis ranges in clinical severity from asymptomatic to highly pathogenic G. duodenalis is also notable for cross-species transmission, including zoonotic transmission G. duodenalis ecology Canis familiaris), and cattle (Bos taurus) in Italy Gorilla beringei beringei) in Uganda G. duodenalis “assemblages” (A–G) are recognized, infecting a range of mammalian hosts and likely representing as many distinct species G. duodenalis in wild mammals have found that samples fall into assemblages A or B, which characteristically infect people, concluding that the animal hosts involved may represent reservoirs of infection for humans , and in surrounding forest fragments. This habitat consists primarily of moist semi-deciduous and evergreen forest, between approximately 1,100 and 1,600 m in elevation 2 and contain small populations of monkeys . Our previous investigations have shown that rates of human-primate-livestock bacterial transmission are elevated in these locations due to anthropogenic habitat disturbance related to timber harvesting, agriculture, and the collection of forest products (e.g. firewood) G. duodenalisFor the present study, we focused on three such forest fragments, Bugembe, Kiko 1, and Rurama, and the villages surrounding them. These sites, which are described in detail elsewhere Procolobus badius tephrosceles; n = 30) and the black-and-white colobus , and one omnivorous monkey species, the red-tailed guenon , from undisturbed areas within Kibale National Park, as well as from the highly disturbed Bugembe, Kiko 1, and Rurama forest fragments. We collected single fecal samples non-invasively from individual animals on 13 days, at the same time that we collected demographic information and behavioral observations, as previously described In May and June, 2007 (dry season), we collected fecal samples from two folivorous monkey species, the red colobus (n = 108) and their livestock in villages surrounding each forest fragment. People and livestock in these villages use forest fragments intensively for such purposes as firewood collection and grazing, respectively, thus increasing ecological overlap with primates We sampled local human volunteers . 1 ml of fecal material from each sample was homogenized with an equal volume of RNA-later nucleic acid stabilizing buffer (Ambion) and stored at −20°C in the field prior to transport to the United States.Concurrent with human fecal sample collection, a survey was administered to each participant. The survey focused on demography, gastrointestinal symptoms, patterns of land use, and interactions with animals during the four-week period prior to sample collection. The survey was administered in Rutooro by trained field assistants who were also members of the local communities; response biases caused by the presence of foreigners were thereby avoided.G. duodenalis DNA using a real-time PCR targeting the small subunit RNA gene on an ABI Prism® 7000 Sequence Detection System , with primers, probe, and cycling conditions following published methods DNA was extracted from 500 µl of fecal+RNA-later suspension using the FastDNA Spin Kit for Soil , followed by an additional wash and ethanol precipitation in the presence of CTAB in order to remove potential PCR inhibitors G. duodenalis from samples that tested positive by real-time PCR, we conducted conventional PCR amplification and direct sequencing of four G. duodenalis genes. Conditions were optimized for each locus separately using the Failsafe PCR System according to the manufacturer's recommendations and based on published primers and protocols for each gene: ef1-αgdhtpiTo infer genetic relationships among PCR products were electrophoresed on 2.0% agarose gels containing 0.5µg/ml ethidium bromide in 1× Tris-acetate-EDTA buffer at 100 volts for 30–45 minutes at room temperature . Each well contained 25 µl of PCR product and 4µl 6× loading dye or 6 µl of 0.5 mg/ml GeneRuler 100-bp DNA ladder . Amplicons were visualized under UV light, and bands of the predicted sizes were excised for DNA extraction using the Zymoclean Gel DNA Recovery Kit , according to the manufacturer's protocol.Following extraction, amplicons were sequenced in both directions on ABI 3730XL capillary sequencers located in the Roy J. Carver Biotechnology Center at the University of Illinois at Urbana-Champaign. Sequences were edited using the computer program Sequencher, Version 4.2 and were queried against known sequences using BLAST G. duodenalis in 64 (23%) of 278 total fecal samples or livestock . No similar differences were observed in the prevalence of G. duodenalis in livestock among these locations, however than in individuals between 16 and 75 years , and this difference was statistically significant . Subadult livestock (n = 24) harbored G. duodenalis at a higher rate (25.0%) than did adult livestock , and this difference was also statistically significant , mirroring the trend in humans. We were unable to examine age as a risk factor for G. duodenalis infection in primates, due to the difficulty of determining the ages of individual wild primates.The prevalence of G. duodenalis infection related to land use, demography, and behavior were used to identify risk factors for human behavior . No factbehavior . ResidenG. duodenalis and the reporting of gastrointestinal symptoms or the taking of medicines (P = 0.001). The lack of an association between infection status and the reporting of gastrointestinal symptoms held true even when individuals ≤15 years (n = 48) were analyzed separately .We found no association between infection with edicines . This waP = 0.002) and residence in Rurama . Residence in a household with another positive person or residence in a household with a positive animal, which were significant in our univariate analysis, fell out of the model as non-significant when all predictors were considered together.To account for potential confounding effects, we used multiple logistic regression with various strategies of model selection . Regardless of the method used, the same two variables were retained in the final model in all cases: age of ≤15 years . Our success in generating SSU-rDNA . Genetice lowest . Geneticour loci .G. duodenalis nucleotide sequences yielded trees that were topologically similar across loci, but that differed in their phylogenetic resolution or the reporting of gastrointestinal symptoms . We were, however, limited by a small sample size of infected children ≤5 years of age for whom both clinical data and G. duodenalis assemblage were available (n = 6); this precluded meaningful analysis of an association between assemblage and clinical disease in this age category, which might have been expected based on published results Using our phylogenetic results, we were able to classify 36 human G. duodenalis transmission cycles in western Uganda. Our sequence analysis was able to resolve four G. duodenalis clades: one involving assemblage BIV in humans and primates, one involving assemblage E in livestock and primates, and two involving assemblages AII and BIII in humans. Our phylogeny based on gdh was additionally able to resolve sub-clades of G. duodenalis within assemblages, including from humans and red colobus within assemblage BIV and from livestock and red colobus within assemblage E. Although our small sample sizes precluded formal cladistic analyses of the directionality of cross-species transmission G. duodenalis in humans was higher than in either primates or livestock , who inferred assemblage E G. duodenalis in another primate - humans - in Egypt from tpi gene sequences, implying a possible cattle-human transmission link G. duodenalis in people, cattle, and mountain gorillas in Bwindi Impenetrable National Park, Uganda (approximately 200 km from our study site), where ecological overlap between species is also high, and inferred infection with assemblage A in all three species G. duodenalis in species other than humans may reflect real differences between sites; however, we also note that SSU-rDNA had the lowest phylogenetic resolution of any gene in our study . This observation again suggests that PCR-based methods are more sensitive than microscopy.Our results also demonstrate that the prevalence of ons e.g. . Our preG. duodenalis prevalence among human communities. People from Rurama community were infected with G. duodenalis at a rate approximately three times that of people in Bugembe or Kiko 1 communities, despite the roughly similar demographic composition of these communities and their close proximity to each other found G. duodenalis at 28.1% prevalence in diarrheic Peruvian children as well as in 19.5% of nondiarrheic children, emphasizing the importance of asymptomatic patients in G. duodenalis transmission where hygiene and sanitation are poor G. duodenalis infection status and gastrointestinal symptoms.The lack of any measurable association between infection of people with G. duodenalis on human health, we cannot exclude the possibility that the parasite may be impacting the health of livestock or that of wild primates. Such effects could, in turn, have consequences for conservation. The Ugandan red colobus monkey, for example, is endangered and may be declining due to a combination of nutritional stress and parasitism Although we found little evidence for an effect of i.e. multilocus sequence tying), which might have improved phylogenetic resolution. Findings such as our discovery of assemblage E G. duodenalis in red colobus monkeys, which would be the first report of this assemblage in a non-human primate, should ideally be confirmed with additional sampling and sequencing. Also, we were unable to examine the relationship between infection status and Giardia-specific treatment in people, which could have altered prevalence and the clinical manifestations of infection. We therefore view the results of this study as indicating a strong need for future research into the epidemiology, cross-species transmission ecology, and clinical consequences of G. duodenalis infection in both humans and wildlife, especially where these species interact in anthropogenically disturbed habitats in the tropics.We emphasize that our results are based small sample sizes and short nucleic acid sequences. Moreover, variable amplification success among loci and samples precluded phylogenetic analysis of concatenated sequences (
We present a case of adult hepatoblastoma. This young female presented with severe acutecholangitis. Preoperative diagnosis was common bile duct (CBD) obstruction with portal veinthrombosis. On exploration she had a tumor mass in the CBD. The unusual features of this caseare discussed in this report.
Neutrophils have been shown to play a role in host defence against highly virulent and mouse-adapted strains of influenza virus, however it is not clear if an effective neutrophil response is an important factor moderating disease severity during infection with other virus strains. In this study, we have examined the role of neutrophils during infection of mice with influenza virus strain HKx31, a virus strain of the H3N2 subtype and of moderate virulence for mice, to determine the role of neutrophils in the early phase of infection and in clearance of influenza virus from the respiratory tract during the later phase of infection.The anti-Gr-1 monoclonal antibody (mAb) RB6-8C5 was used to (i) identify neutrophils in the upper and lower (lung) respiratory tract of uninfected and influenza virus-infected mice, and (ii) deplete neutrophils prior to and during influenza virus infection of mice.+ T cells. Thus, we investigated the role of neutrophils in both the early and later phases of infection using CD8+ T cell-deficient B6.TAP-/- mice. Infection of B6.TAP-/- mice with a low dose of influenza virus did not induce clinical disease in control animals, however RB6-8C5 treatment led to profound weight loss, severe clinical disease and enhanced virus replication throughout the respiratory tract.Neutrophils were rapidly recruited to the upper and lower airways following influenza virus infection. We demonstrated that use of mAb RB6-8C5 to deplete C57BL/6 (B6) mice of neutrophils is complicated by the ability of this mAb to bind directly to virus-specific CD8Neutrophils play a critical role in limiting influenza virus replication during the early and later phases of infection. Furthermore, a virus strain of moderate virulence can induce severe clinical disease in the absence of an effective neutrophil response. Host defence against influenza virus infection depends on a complex interplay of innate (non-specific) and adaptive (specific) components. The development of specific immunity (antibodies and cell-mediated immunity) following infection is of undoubted importance in recovery from infection and resistance to re-infection. Also crucial, however, are pre-existing and rapidly induced innate defence mechanisms which play a critical role in the initial phase of a primary infection, providing a barrier to establishment of a virus and limiting its spread in host tissues in the days before a specific immune response develops. Following inhalation, influenza virus infection is limited to epithelial cells lining the bronchotracheal system, alveolar epithelial cells and airway macrophages . Intranain vivo using virus strain A/PR/8/34. More recently, studies have used anti-granulocyte receptor 1 (Gr-1) mAb RB6-8C5 to examine the contribution of neutrophils to (i) protection in the early phase and (ii) recovery in the late phase following primary infection of mice with highly pathogenic or mouse-adapted strains of influenza A virus [+ T cells [Although neutrophils have long been considered primary effector cells against bacterial and fungal infections they are also prominent components of inflammatory responses induced by viral infections. Neutrophil infiltration is considered to be a characteristic feature in the early phase of influenza infection in humans, ferrets and mice . Studies A virus . Caution T cells .in vivo. In initial studies, mAb RB6-8C5 was found to bind to CD8+ T cells and, in particular, to virus-specific CD8+ T cells which could be isolated from the airways at high numbers after day 5 post-infection. Consequently, to investigate the role of neutrophils during the latter stages of infection, CD8+ T cell-deficient B6.TAP-/- mice were treated with RB6-8C5 during infection with a low dose of H3N2 subtype virus. This treatment profoundly enhanced disease and mortality, confirming a critical role for neutrophils in limiting influenza virus replication during the early and later phases of infection.Previous studies have focussed on the role of neutrophils during infection with a virulent recombinant H1N1 virus with genes from the 1918 influenza A virus or with -/-) mice on a B6 background [C57BL/6 (B6) mice and TAP-knockout [To deplete neutrophils RB6-8C5) ,17 was a+ cells, mice received a single i.p. injection of 1 mg/ml purified mAb YTS169.4 [To deplete CD8YTS169.4 to lyse erythrocytes and washed in RPMI 1640 medium supplemented with 10% FCS (RF10). Cell viability was assessed via trypan blue exclusion and cell numbers were determined by counting in a hemocytometer.BAL, blood, lung and nasal tissue cells were obtained from uninfected and virus-infected mice. Heparinized blood was obtained by cardiac puncture using a 29-guage needle. For collection of BAL cells, mice were euthanized and the lungs flushed three times with 1 ml of PBS through a blunted 23-guage needle inserted into the trachea. Cells from the nasal tissues were obtained by cutting down the vertical plane of the skull and scraping out the tissues and small bones from both sides of the nasal passages. Single cell suspensions of lung and nasal tissues were prepared by incubating samples with 2 mg/mL Collagenase A in serum-free RMPI 1640 medium at 37°C for 30 minutes. Each sample was passed through a wire mesh to obtain a single cell suspension. Blood, BAL, lung and nasal tissue samples were treated with Tris-NH4 cells were cytocentrifuged onto glass microscope slides, dried and stained with Diff Quick . Slides were examined using a light microscope and a minimum of 100 cells in 4–8 random fields was counted (×1000 magnification). Macrophages, lymphocytes and neutrophils were identified by their distinct nuclear morphologies.Leukocytes present in blood, BAL, lung and nasal tissue samples were analyzed by differential leukocyte counts or by flow cytometry. For differential counts, aliquots of approximately 5 × 10bPA224 (SSLENFRAYV)-specific tetramers for 60 minutes at room temperature prior to staining with anti-CD8. Propidium iodide was added to each sample and cells were analysed on a FACS Calibur flow cytometer collecting data from at least 50,000 living (PI-) cells. Leukocyte populations were sorted using a MoFlo cell sorter .For flow cytometry analysis, single cell suspensions of blood, BAL and nasal tissue cells were incubated on ice for 20 minutes with supernatants from hybridoma 2.4G2 to block Fc receptors and then stained with appropriate combinations of fluorescein isothiocyanate (FITC), phycoerythrin (PE), allophycocyanin (APC) or biotinylated monoclonal antibodies to Gr-1 (RB6-8C5), CD45.2 (104), CD8a (53-6.7), CD4 (GK1.5), B220 (RA3-6B2), NK1.1 (PK136), CD3e (145-2C11), CD11a (M17/4), CD11b (M1/70), CD18 (C71/16), CD49d (MFR4.B), CD62L (MEL-14), CD69 (H1.2F3), CD11c , F4/80 or CD107a/LAMP-1 . In some experiments, cells were stained with PE or APC-labelled D2O2) using an established protocol [2DCF; Molecular Probes, USA) is taken up by cells and in the presence of H2O2 is oxidized to the green florescent product 2'7'-dichlorofluorescein (DCF) which is trapped within the cell and detectable by flow cytometry (FL-1 channel). H2DCF (50 μM) was added to cells and incubated for 1 hour at either 4°C or 37°C and DCF levels were determined in Gr-1high cells by flow cytometry.Blood and BAL cells were assessed for intracellular hydrogen peroxide was used. A p value of ≤ 0.05 was considered statistically significant.When comparing two sets of values to each other, Student's high inflammatory cells recruited to sites of infection [+/Gr-1high cells, a phenotype consistent with that of neutrophils. To confirm the identity of this population, inflammatory cells were recovered from BAL or nasal tissues of virus-infected mice, stained with fluorescent labelled mAbs and the Gr-1high population purified by FACS. Microscopic analysis demonstrated that the Gr-1high population comprised > 90% cells exhibiting a cellular morphology characteristic of neutrophils (data not shown). Gr-1 expression was restricted to inflammatory cells as only cells expressing the common leukocyte antigen CD45 co-stained for Gr-1.A number of studies have identified neutrophils by flow cytometry as Gr-1nfection ,20. Flow+/Gr-1high) were detected at low numbers in the airspaces of uninfected mice where they comprised < 2% of CD45+ BAL cells. Following infection, neutrophil numbers in the BAL increased rapidly, peaking 3–5 days p.i. and declining thereafter we found CD69 to be the only other marker suitable to discriminate between airway neutrophils from uninfected and virus-infected mice. As seen in Fig. 2DCF which, in the presence of H2O2, is oxidized to the green fluorescent product DCF [Neutrophils contain antimicrobial products stored in intracellular granules that may be released during infection. Airway neutrophils from infected and uninfected mice were more granular than those recovered from the blood Fig. , suggestduct DCF . Blood nTo confirm a role for neutrophils in host defence during influenza virus infection we compared survival and virus titres in influenza virus-infected neutropenic (RB6-8C5-treated) and control (PBS- or IgG-treated) mice. We found that a combination of systemic and local treatments was necessary to obtain optimal neutrophil depletion using mAb RB6-8C5 as while systemic depletion alone was sufficient to reduce numbers of blood neutrophils to < 5%, in the absence of an intranasal administration of RB6-8C5, significant numbers of neutrophils accumulated in the airspaces of the lung (data not shown). As seen in Fig. We next compared virus titres in the upper and lower respiratory tract of infected neutropenic and control mice following infection with HKx31. Virus titres were significantly higher throughout the respiratory tract of RB6-8C5-treated mice at days 1, 3 and 5 when compared to either control group Fig. . These d+ cells a number of approaches were taken. First, flow cytometry studies confirmed that Gr-1high cells from the lungs of HKx31-infected mice at day 3 post-infection did not express markers characteristic of B cells (B220+), T cells (CD3ε+) or NK cells (NK1.1+) (data not shown), although intermediate levels of Gr-1 expression were observed on CD8+ T cells and, to a lesser extent, on NK cells and B cells recovered from the lungs of virus-infected mice , and (ii) numbers of NK cells were significantly reduced in 2 experiments but not in 3 others . The variable effects of RB6-8C5 treatment on NK cells may relate to the intermediate levels of expression observed in this cell population, as seen in Fig The RB6-8C5 hybridoma was originally described as secreting an antibody specific for granulocyte receptor 1 (Gr-1) ,25. Subsice Fig. . Second,ice Fig. . Of inte5 PFU of HKx31. Whilst a number of studies have reported Gr-1 expression on monocytes and macrophages [5 ± 4.61 × 104 and 8.04 × 105 ± 7.7 × 104 for IgG-treated and RB6-treated mice, respectively).We have found F4/80 to be a useful marker for identification of resident airway macrophages, however we find this marker to be down-regulated on airway macrophages during influenza infection (data not shown). Therefore, we used cytospin analysis to identify and enumerate monocyte/macrophage populations recovered in the BAL of IgG-treated and RB6-treated mice 5 days after infection with 10rophages -31, we f+ T cells play a critical role in recovery from influenza infection and in resistance to re-infection [+ T cells in vivo following treatment with RB6-8C5 has been reported previously [+ T cells are unknown. It was therefore of interest to determine the timing of CD8+ T cell recruitment to the airways and the effects of RB6-8C5-treatment on this cell population. First, we determined the kinetics of total total CD8+ T cell numbers by > 90% in spleen and BAL, and (ii) DbPA224 epitope-specific CD8+ T cells by > 95% in BAL at day 5 post-infection but did not reduce neutrophil numbers at either site (data not shown). Moreover, no differences in viral titres were recorded in lung and nasal tissue homogenates of CD8-depleted versus control mice (PBS- or IgG-treated) at days 3 and 5 after infection with HKx31 (data not shown), indicating that the absence of CD8+ cells, including CD8+ T cells, does not have a major impact on early viral replication.The effects of RB6-8C5 treatment on CD8ion Fig. . To conf+ T cells. Therefore, we treated B6.TAP-/- mice, which have defective CD8+ T cell-mediated immunity [-/- mice at days 3 and 7 post-infection (data not shown).We have confirmed a protective role for neutrophils in the early response to influenza virus infection ,7, howevimmunity , with RB-/- mice were more sensitive to HKx31 infection than immunocompetent B6 animals. Following infection with 104 PFU of HKx31, survival . Of interest B6.TAP-/- mice did recover from influenza infection, albeit with delayed kinetics, suggesting that other components of adaptive immunity can mediate viral clearance in the absence of effective CTL responses.Initial studies demonstrated that B6.TAPval Fig. and weigval Fig. was simiion Fig. . In cont-/- mice using HKx31 at an infectious dose of either 104 or 102 PFU. Following infection with 104 PFU of HKx31, both B6 and B6.TAP-/- mice treated with RB6-8C5 lost weight rapidly compared to their respective IgG-treated controls, with all mice euthanized by day 7 post-infection while IgG-treated controls showed no visible signs of infection .The effects of RB6-8C5 treatment on the course of influenza virus infection were compared in B6 and B6.TAPion Fig. . Inoculaion Fig. . Neutrop-/- mice 7 days after infection with 102 PFU of HKx31. Consistent with the profound impairment of antiviral CD8+ T cell responses observed in B6.TAP-/- mice (see above), virus titres recovered from the lungs and nasal tissues of IgG-treated B6.TAP-/- mice were markedly higher compared to IgG-treated B6 mice CD8+ T cell numbers in the airways were particularly low up to day 5 post-infection, (ii) depletion of CD8+ T cells with anti-CD8 mAb YTS169.4 had no effect on viral titres up to and including day 5 post-infection. Furthermore, neutrophil depletion of B6.TAP-/- mice, which have impaired CD8+ T cell immunity, was accompanied by severe disease and enhanced virus replication throughout the airways demonstrating a critical role for neutrophils in mediating viral clearance in this model.The results of this study confirm a protective role for neutrophils during influenza infection and establish their critical role in mediating clearance of influenza virus from the respiratory tract of mice infected with a strain of moderate virulence. Treatment with mAb RB6-8C5 was found to induce profound depletion of neutrophils in the blood and throughout the respiratory tract, accompanied by enhanced virus titres and exacerbated morbidity and mortality compared to control mice. A number of observations indicate that our findings are attributable to neutrophil depletion. First, neutrophils were recruited to the airways as early as 8 hrs post-infection (data not shown) and their presence correlated with suppressed virus replication in the airways early after infection. Second, while we could detect direct binding of mAb RB6-8C5 to virus-specific CD8We have demonstrated that neutrophils accumulate in both the upper and lower airways following infection with influenza virus strain HKx31. Initial studies aimed to address the activation status of neutrophils in the airways. Adhesion molecules such as CD11a, CD11b, CD18, CD31, CD38 and CD49d play an important role in neutrophil transmigration and modu+ T cells and these cells may also be depleted as a result of RB6-8C5 treatment. A number of factors may contribute to the protective role of neutrophils in the early phase of infection although exact mechanisms underlying their protective effects are yet to be determined. Neutrophils are non-permissive to influenza virus infection [Early studies using gamma-irradiated and carrageenan-treated mice suggested a protective role for neutrophils in the early phase of influenza infection and subsnfection , adhere nfection and medinfection . In addinfection , innate nfection ,36 and pnfection ,38 supernfection . In the + T cells play an important role in containment and clearance of influenza virus from infected tissue [+ T cell numbers may contribute to the severe weight loss and disease observed in the late phase of influenza infection in neutropenic mice. In some studies, mAb RB6-8C5 has been reported not to bind CD8+ T cells from naïve animals [+ memory-type CD8+ T cells [+ T cells from mice infected with a neurotropic strain of mouse hepatitis virus [+ T cells isolated from the site of influenza virus infection arguing that other aspects of adaptive immunity such as CD4+ T cells and/or antibody responses play a critical role in control and clearance of virus from B6.TAP-/- mice. Treatment of influenza virus-infected B6.RAG-/- mice with mAb RB6-8C5 accelerated weight loss and clinical disease such that all mice were euthanized by day 3 post-infection (data not shown) demonstrating that in the absence of adaptive immunity neutrophils play a critical role in restricting early virus replication. The effects of neutrophil depletion could not be studied in later phases of infection due to the exquisite sensitivity of B6.RAG-/- mice to influenza infection.Despite being somewhat more sensitive to influenza virus, B6.TAP+ T cell-deficient B6.TAP-/- mice with mAb RB6-8C5 induced profound weight loss and clinical disease following infection with 104 or 102 PFU of HKx31. It is interesting to note that following infection with a low dose (102 PFU) of HKx31, weight loss profiles were remarkably similar for RB6-8C5 treated B6 and B6.TAP-/- mice; in either case, virus-infected animals treated with IgG showed no significant weight loss whilst RB6-8C5 treated mice lost weight rapidly and were euthanized by day 7 post-infection. The mechanisms underlying the profound disease phenotype observed in the neutrophil-depleted mice are yet to be fully elucidated. Virus titres recovered from the airways of RB6-8C5-treated mice were 10–100 fold higher than those from control animals at day 7 post-infection , arguing that unwanted depletion of additional leukocyte populations was not a major factor contributing to severe clinical disease. In addition, these data also confirm that the morbidity and mortality associated with RB6-8C5 treatment of mice is not due to an overwhelming accumulation of leukocyte populations in the airways.Treatment of B6 mice or CD8ion Fig. and thisonocytes -31, we u5 PFU) or low (102 PFU) dose of HKx31 resulted in distinct kinetics of viral replication and this in turn is likely to impact on disease pathogenesis. After inoculation with 105 PFU of HKx31, virus titres were high early after inoculation and then declined over the course of infection and lower (lung) airways following infection of mice with influenza virus strain HKx31. As mAb RB6-8C5 binds directly to virus-specific CD8The authors declare that they have no competing interests.MT carried out the majority of experiments described in the study, analyzed and interpreted data and participated in the writing of the manuscript. AB contributed to the design of the project, interpretation of data and the writing of the manuscript. PR contributed to all aspects of project design, performed some of the experiments in conjunction with MT and wrote the manuscript. All authors read and approved the final manuscript.
Ambystoma mexicanum) to an emerging viral pathogen, Ambystoma tigrinum virus (ATV).Very little is known about the immunological responses of amphibians to pathogens that are causing global population declines. We used a custom microarray gene chip to characterize gene expression responses of axolotls (A. mexicanum as early as 24 hours after ATV infection. At 24 hours, we observed transcript abundance changes for genes that are associated with phagocytosis and cytokine signaling, complement, and other general immune and defense responses. By 144 hours, we observed gene expression changes indicating host-mediated cell death, inflammation, and cytotoxicity.At 0, 24, 72, and 144 hours post-infection, spleen and lung samples were removed for estimation of host mRNA abundance and viral load. A total of 158 up-regulated and 105 down-regulated genes were identified across all time points using statistical and fold level criteria. The presumptive functions of these genes suggest a robust innate immune and antiviral gene expression response is initiated by A. mexicanum appears to mount a robust innate immune response, we did not observe gene expression changes indicative of lymphocyte proliferation in the spleen, which is associated with clearance of Frog 3 iridovirus in adult Xenopus. We speculate that ATV may be especially lethal to A. mexicanum and related tiger salamanders because they lack proliferative lymphocyte responses that are needed to clear highly virulent iridoviruses. Genes identified from this study provide important new resources to investigate ATV disease pathology and host-pathogen dynamics in natural populations.Although Emerging infectious diseases (EIDs) pose a serious threat to the health, stability, and persistence of human and wildlife populations -4. GenetBatrachochytrium dendrobatidis and Ranaviruses have been implicated in worldwide epizootics. Although studies are beginning to investigate possible mechanisms of resistance to these pathogens 32]). The. We used the Bioconductor package "affy" to perform several quality control analyses at the individual probe level [r from replicate GeneChips > 0.980) on the summarized probe-set level data. The strong correlations observed between replicate GeneChips suggests that we were able to obtain a high degree of repeatability within treatments.All quality control and processing analyses were done in R . We usedbe level ,35. Thesbe level . Followith percentiles) across all GeneChips . Upon imposing this filtering criterion, 3619 probe-sets were available for significance testing.Microarrays may not accurately quantify the abundance of lowly expressed genes . Calculat-statistics for all six of the possible pair-wise contrasts of the four sampling times investigated in our study. LIMMA employs an empirical Bayes methodology that effectively shrinks the sample variances towards a pooled estimate. This approach reduces the likelihood of obtaining large test statistics due to underestimation of the sample variances. The moderated t-statistics generated by LIMMA test the null hypothesis that the difference between the two groups being compared is zero . LIMMA also generates moderated F-statistics that test the null hypothesis that none of the contrasts within a family of contrasts are statistically significant. We corrected for multiple testing by applying the step-up algorithm [P-values of the moderated F-statistics associated with our six contrasts. Upon correcting for multiple testing, we identified 2322 genes (probe-sets) that were statistically significant. To prioritize amongst differentially expressed genes, we focused on probe-sets that exhibited two-fold or greater changes at any time-point relative to controls. Any gene that was non-significantly down-regulated but significantly up-regulated at one or more time points was considered up-regulated, and vice versa for classification of up- versus down-regulation. We also required that these probe sets have moderated F-statistics greater than or equal to the 50th percentile of the 2322 F-statistics from the statistically significant probe-sets (F ≥ 12.68). We further limited our analysis to only those probe sets that exhibited significant sequence identity with a human reference sequence. We note that 263 probe-sets with no functional annotation were statistically significant, differentially expressed by ≥ two-fold, and had F-values ≥ 12.68.We used the Bioconductor package LIMMA ,39 to gelgorithm to the P2 ratios were calculated for each non-zero sampling time relative to 0 hours post-infection. Genesis v. 1.6.0 [2 ratio data and to generate heat maps. Clustering was conducted using a Self Organizing Map (SOM) algorithm. Default conditions were used with the exception that the SOM was allowed to run for 263,000 iterations. The dimensions of the final SOM are 2x *1y. These dimensions were determined by comparing output from several different combinations.Hybridization intensities were averaged within treatment groups and logv. 1.6.0 ,42 was uFunctional annotation of genes by gene ontology was performed using the Database for Annotation, Visualization and Integrated Discovery . FunctiWe used quantitative real-time PCR (qPCR) to confirm the results of the microarrays. We estimated a fold change for 24 and 72 hr time points using the ΔΔct method of relative quantification , utiliziTo verify that exposed animals were infected and to quantify viral load and replication over time, we performed qPCR on lung tissue with TaqMan chemistry following the protocol detailed in . ANOVA w3,44 = 242.56; p ≤ 0.01).Viral load for each animal was estimated using qPCR and then averaged for each time point Fig . The sigNo animals displayed any gross symptoms of ATV infection in terms of hemorrhaging, lesions or edema, either externally or on any internal organs upon euthanasia and subsequent surgery. Similarly, there were no notable changes in behavior observed during the period of infection. This is likely due to the relatively short infection period utilized in this experiment. As noted in the introduction, infected animals often take 8–10 days, or more, to become symptomatic upon infection.We identified 263 probe sets with statistically significant differences in mRNA abundances between Day 0 and any other subsequent time point Tables , 2. We ainterferon-induced protein with tetracopeptide repeats 5 (IFIT5).Across all time points, the majority of up-regulated genes were related to immune response or other related functions, such as inflammation and apoptosis. Other up-regulated genes pertained to gene functions such as ion binding and transport, membrane related functions, and protein binding and modification. Twenty-three genes (represented by 26 probe sets) demonstrated 2-fold or greater changes at 24 hours post-infection, all of which were up-regulated. Ten of these 23 have functions pertaining to immune response. Of the remaining highly expressed genes, one was associated with inflammation, two to regulation of apoptosis, three to ion binding, three to protein binding and modification, one to transport, one to the extracellular constituent, and one to membrane and glycolipids. Many of these genes showed increasing transcript abundances over time. At 72 hours post infection, 43 genes had a greater than 5-fold change, and 40 genes had a greater than 5-fold change at 144 hours. The highest expression level, 91-fold increase at 144 hours, was observed for chondroitin sulfate proteoglycan (NCAN). Five down-regulated genes each code for regulation of transcription and translation. An additional 15 down-regulated genes correspond to 20 probe sets that have functions associated with cell division and mitosis, which was not observed in the up-regulated genes. Other notable down-regulated gene ontologies include one gene corresponding to pinocytosis and endocytosis, and one gene related to natural killer cell mediated cytotoxicity.In contrast to the very high fold changes observed among up-regulated genes, the largest fold change observed among down-regulated genes was approximately 4.9-fold, in Myxovirus resistance 1, Macrophage receptor with collagenous structure, Complement component 3, Cyclin dependant kinase inhibitor 1B, Vaccinia related kinase 1) there is good agreement between the microarray and qPCR data. In genes where the microarray estimates of fold change were modest there is poorer agreement between fold change estimates from these two technologies. However, for this latter group of genes with modest fold change values, the microarray and qPCR data were always within four fold of each other. These results demonstrate that we were able to verify robust differences that were suggested by the microarray data.We used qPCR to estimate fold changes for nine genes to verify our microarray data Table . For fivheat shock 70 kDa protein 5 were similarly regulated. None of the cell cycle genes that are significantly up-regulated during tail regeneration were identified in this study. Thus, there was no evidence of cell proliferation by spleen cells after ATV infection.Comparison of gene expression after ATV and tail amputation identified 25 genes that are significantly up-regulated in both experimental frameworks receptor 4), phagocytosis and destruction of phagocytised particles , complement , and inflammation . Up-regulation of complement components that are known to function in the removal of viral particles, and up-regulation of the stress-associated transcription factor jun-b, clearly shows that ATV induced a humoral gene expression response in the axolotl. Further support for this idea was obtained by comparing ATV-induced gene expression changes to changes identified from a previous microarray experiment using A. mexicanum and the same microarray platform. Twenty-five genes that were up-regulated in response to ATV infection were also identified as significantly up-regulated during regeneration [We detected significant gene expression changes 24 hours post infection. Many of these gene expression changes likely reflect transcription within lymphocytes, as they are the predominant cell type in the spleen of juvenile and adult axolotls . Indeed,neration . In boththe gene expression patterns that we observed suggest that the Mexican axolotl manifests an antiviral transcriptional response that is not unlike that observed in other vertebrates. For example, ATV infection clearly induces an interferon-mediated, antiviral response. Although probe sets for interferon genes are not represented on the GeneChip, we estimate based upon literature surveys that at least 20% of the significant genes that we identified are known in other systems (in vitro and in vivo) to be involved in interferon-mediated transcription [interferon regulatory factor 1, up-regulated) and repress transcription of interferon-alpha and beta (Type 1 interferon), and inferon-inducible genes that recognize and degrade intra-cellular viral nucleic acid (interferon induced with helicase C domain 1). Considering further that four of the most highly enriched functional groups also contained genes relating to the immune response and pathogen response, the results show that axolotls mount a robust anti-viral response from 24–144 hours post-infection.In addition to this general humoral response, cription -55. ThesRanavirus frog virus 3 (FV3), larval Xenopus laevis succomb to FV3 but adults effectively clear virons and develop lasting resistance to future infection [X. laevis is correlated with a significant proliferation of cytotoxic CD8+ T cells in the spleen upon infection (within 6 days), as well as increased mortality upon CD8+ T cell depletion [A. mexicanum than FV3 is to the Xenopus immune response. Phylogenetic analyses indicate ATV is more closely related to iridoviruses found in fish than to FV3, which suggests a relatively recent host switch occurring with the introduction of sportfish to areas of the southwestern United States [Given the robust immunological transcription response that we observed, it is curious why ATV is so virulent to tiger salamanders. In the closely related nfection . Adult repletion ,57. Mortepletion . It is wepletion -29,52. Wd States . Iridovid States . Furthernd generation microarray that is currently under development. Genomic and bioinformatics tools make Ambystoma a powerful system for wildlife disease research. In particular, molecular information can be quickly cross-referenced from a genetically homogeneous strain that is available for laboratory studies (Mexican axolotl), to other closely related tiger salamander species in North America [Our study has identified hundreds of new candidate genes for laboratory and field studies of stress and disease in tiger salamanders. Significantly more gene candidates will undoubtedly be discovered using a higher content, 2 America . Such poThe authors declare that they have no competing interests.JDC performed infections and surgeries and drafted the manuscript. RBP performed microarray statistical and bioinformatic analyses. AS, CKB, and SRV contributed to experimental design and manuscript editing.Appendix A. Primer sequences used for qPCR verification of microarray data.Click here for file
Glioblastoma multiforme (GBM) is an umbrella designation that includes a heterogeneous group of primary brain tumors. Several classification strategies of GBM have been reported, some by clinical course and others by resemblance to cell types either in the adult or during development. From a practical and therapeutic standpoint, classifying GBMs by signal transduction pathway activation and by mutation in pathway member genes may be particularly valuable for the development of targeted therapies.We performed targeted proteomic analysis of 27 surgical glioma samples to identify patterns of coordinate activation among glioma-relevant signal transduction pathways, then compared these results with integrated analysis of genomic and expression data of 243 GBM samples from The Cancer Genome Atlas (TCGA). In the pattern of signaling, three subclasses of GBM emerge which appear to be associated with predominance of EGFR activation, PDGFR activation, or loss of the RAS regulator NF1. The EGFR signaling class has prominent Notch pathway activation measured by elevated expression of Notch ligands, cleaved Notch receptor, and downstream target Hes1. The PDGF class showed high levels of PDGFB ligand and phosphorylation of PDGFRβ and NFKB. NF1-loss was associated with lower overall MAPK and PI3K activation and relative overexpression of the mesenchymal marker YKL40. These three signaling classes appear to correspond with distinct transcriptomal subclasses of primary GBM samples from TCGA for which copy number aberration and mutation of EGFR, PDGFRA, and NF1 are signature events.Proteomic analysis of GBM samples revealed three patterns of expression and activation of proteins in glioma-relevant signaling pathways. These three classes are comprised of roughly equal numbers showing either EGFR activation associated with amplification and mutation of the receptor, PDGF-pathway activation that is primarily ligand-driven, or loss of NF1 expression. The associated signaling activities correlating with these sentinel alterations provide insight into glioma biology and therapeutic strategies. Glioblastoma (GBM) is the most common malignant brain tumor and is characterized by intratumoral heterogeneity, invasive growth pattern and poor response to treatment.ERBB2 and IDH1 mutation in primary and secondary GBM respectively, and a significant incidence of mutation and genomic loss of NF1.Historically, two subtypes of GBM were distinguished based on histologic grade at clinical presentation. Primary GBMs present initially as grade 4 tumors while secondary GBMs present as lower grade gliomas and progress to GBMs over time.The importance of signal transduction activity downstream of tyrosine kinase receptors in glioma biology is emphasized by the fact that these pathways are abnormally active in these tumors and causal in their formation in mice.In this study, we have measured the relative protein levels of signaling molecules within pathways thought to be crucial to glioma biology among a panel of gliomas. This represents a more extensive proteomic analysis of signaling pathway members than has previously been done, and reveals three patterns of signaling pathway activation. Distinct patterns were each associated with EGFR and PDGF pathway activity while a third was associated with low levels of NF1 protein. We present an analysis of genomic features among tumors in each group, and show how these proteomically-defined subclasses of GBM compare with genomic subclasses arising from integrated analysis of primary GBM in data from The Cancer Genome Atlas.27 glioma surgical samples were identified from a database of patients operated on at MSKCC and consented to the IRB-approved protocol. Clinical and pathologic characteristics are summarized in Protein extracts from these tumors were analyzed by western blot for the activity of various signaling pathways related to glioma formation or stem cell character, totaling 55 antibodies for proteins in total and active forms . AntibodAs expected, overall activation of signal transduction pathways differed markedly between the glioma samples and the normal brain reference. While some pathways such as PI3K and MAPK were active nearly uniformly among gliomas, we sought to investigate whether relative differences might distinguish subclasses among the samples with GBM pathology. The overall pattern of protein expression and activation was first assessed by Principal Component Analysis (PCA). Quantified western data for 57 protein forms were standardized across the set of GBM samples for analysis (n = 20). We excluded p53 from analysis because common inactivating mutations can be associated with increased or decreased protein levels. For clarity in the figure, NF1 was represented as “NF1 loss” (zero minus standardized expression), reflecting the role of NF1 as an inhibitor of RAS signaling. The first two PCA components together accounted for the majority of variation in protein levels . A cloudIn order to evaluate the significance of this three-way classification, we performed unsupervised k-means analysis on the same standardized data from the 20 GBM samples and evaluated the fit and stability over a range of cluster sizes. K-means for cluster sizes from 2–8 was run for 10,000 iterations, leaving out 15% of the data with each iteration (i.e. three randomly chosen samples left out). Consensus matrices were evaluated for cluster assignment stability both visually and by cophenetic correlation see . As predThis cluster of 15 proteins features high levels of total and phospho-EGFR. Prominent Notch activity is represented in this group by high levels of the active cleaved form of Notch 1 (Notch 1 ICD) as well as of ligands Jagged (JAG1) and Delta-like 1 (DLL1) and of the downstream Notch transcriptional target HES1. Wnt signaling is suggested by increased (stabilized) B-catenin levels. Other proteins relatively increased in this core group are EIF4EBP1, EIF4E, RHEB, phospho-BAD, INI1, La/SSB, FGF2, and phospho-Rb1. There was a trend for higher phospho-Akt levels, though this did not reach significance (p = 0.08).This cluster is comprised of 17 proteins including PDGFB, phospho-PDGFRβ and phospho-NFKB1. PTEN levels are higher in this group and relatively increased Ras activity is evidenced by elevated total and phosphorylated MEK and ERK. Levels of MTOR and downstream targets S6K and p-S6K were better-correlated with the PDGF core than the EGFR core, though levels were high in tumors of both classes. Other PDGF-associated proteins were SHH, HEB 1/2 , BRAF, p-FOXO1 and TSC1.This group is defined by higher levels of 5 proteins: IRS1, IGFBP5, YKL40 and VEGF. As suggested by PCA analysis, the group is also strongly associated with low levels of NF1 . Sporadic elevation of MYC, NMYC, and KRAS-GTP was also seen in this group. Compared to the other classes, GBM samples showing NF1-core expression pattern showed relatively suppressed levels of total- and phospho-proteins in the PI3K and MAPK pathways. These differences were relative, however, and evaluation of the Western bands shows that high levels of phosphorylation were common in nearly all tumors see .The 44 core proteins identified in the previous analysis were then used to cluster the larger set of 27 glioma samples. K-means clustering of samples was performed as before, leaving out 15% of proteins (7 out of 44) with each of 10,000 iterations. As expected in this supervised approach, three-way clustering was the best fit and all but three glioma samples showed stable clustering into signaling classes associated with EGFR, PDGF and NF1-loss . Figure Tumors with GBM histopathology were evenly distributed among the three core groups, six in each group. The only known secondary GBM clustered with the NF1-loss group. Two anaplastic astrocytomas (AA23 and AA.26) were found to cluster disparately with the PDGF and NF1 groups, respectively. Two of the four oligodendrogliomas clustered with the PDGF group: one low-grade (ODG.25) and one anaplastic (AO.24). Interestingly, one of the two low-grade oligodendrogliomas clustered with the EGFR group (ODG.22) and did in fact harbor high-level EGFR amplification. One anaplastic oligodendroglioma (AO.21) showed no distinct proteomic pattern and remained unclassified. There was a trend for untreated tumors in the EGFR tumor group (6 untreated vs. 1 treated) and for treated tumors in the PDGF group but this was neither significant for GBM (p = 0.11) nor for all tumors (p = 0.09). Testing protein levels individually between treated and untreated GBM, PDGFB was the most significantly different and was higher in treated GBM (p = 0.009) and in treated tumors overall (p = 0.028) although neither was significant after correction for multiple testing.EGFR, MET and PDGFRA; gain of chr7 without focal amplification; loss of chr10 or 10q23 region spanning PTEN; loss and/or homozygous deletion of 9p21 including Ink4a/ARF.MET and EGFR, gain of chromosome 7, homozygous deletion spanning the Ink4a/ARF locus, and loss at PTEN locus. Complete ACGH profiles are depicted in 24 of the 27 tumors for which sufficient tissue was available were analyzed by array-CGH (Agilent Whole Genome 244K) and resequencing of EGFR, PTEN and TP53. Array-CGH profiles were analyzed for copy number aberrations commonly described in GBM: focal amplification of EGFR-region amplification and four showed point mutations in the extracellular domain (ECD) previously described in GBM as activating mutations: A289V (GBM.10 and GBM.6), T263P (GBM.8), G598V (GBM.1) and R108K (GBM.6).EGFR amplification was found to harbor amplification of a narrow region including MET. Neither overexpression nor significant phosphorylation of EGFR protein was seen in this case. All tumors in the EGFR proteomic tumor class had deletion of the Ink4a/ARF locus compared with only 3/17 (18%) in the other groups. All had loss of ch10 and mutation of PTEN in the remaining allele was observed in one case.Six of the seven tumors in this class showed Ink4a/ARF region deletion and EGFR amplification, however total and phosphorylated EGFR levels in this tumor were low and PDGFB was present. Of note, a second tumor with focal MET amplification, GBM.18, was classified here and showed extremely high levels of PDGFB and associated signaling.Although this group of tumors is defined by evidence of PDGF signaling at the protein level, none of the 9 tumors in this class showed gene amplification of either PDGF receptors or ligands. One tumor had both EGFR or the MET receptor which is significantly more frequent in this class compared to the others .Tumors in this class included six GBM, one of which was a secondary GBM, one anaplastic astrocytoma, and one tumor with histopathologic features of GBM and synaptophysin positivity . The NF1-associated class is distinguished by chr7 gain without focal amplification of either EGFR, PDGFRA and NF1 and the possible association of mutations in these genes with transcriptomally-defined subclasses. Of 278 tumors for which chromosomal copy number and/or mutation data were available, amplification and/or somatic non-synonymous mutation of EGFR was found in 40% (n = 111) and of PDGFRA in 7% (n = 19), while chromosomal loss and/or mutation of NF1 was found in 16% (n = 45). As shown in Glioblastoma datasets from The Cancer Genome Atlas were analyzed for alterations in EGFR, PDGFRA and NF1 revealed that three of the transcriptomal classes were enriched for alterations in each gene, respectively, although the segregation was imperfect. We named these three subclasses “EGFR cocluster”, “PDGFRA cocluster” and “NF1 cocluster” based on the predominant signal transduction pathway member enriched for mutation in each group. A fourth transcriptomal class had neither significant enrichment for mutations in either of EGFR, PDGFRA or NF1, nor enrichment for mutations in any other sequenced gene in the TCGA dataset. As shown in PDGFRA amplification was only present in the minority of PDGFRA-cocluster tumors and this transcriptomal class included a subset of tumors with EGFR or Met amplifications. The PDGFRA-cocluster showed high expression of GRIA2, OLIG2, and NCAM1/2 as well as other genes which are signatures of the “Proneural” transcriptomal class of GBM previously described.YKL40/CHI3L1, IGFBP2 and VEGFA were most highly expressed in the NF1-cocluster transcriptomal group significantly more than in the other two classes . This subset of samples also harbored frequent homozygous deletion of 9p21 spanning the Ink4a/ARF locus . These findings were concordant with genomic profiling of tumors the EGFR signaling class. Conversely, chr7 gain without focal amplification of either EGFR or MET was most common in the NF1 transcriptomal cocluster , and this was concordant with aCGH profiling of tumors in the NF1 signaling class.We investigated possible correspondence between the proteomic EGFR, PDGF and NF1 classes and the transcriptomal EGFR-, PDGFRA-, and NF1-coclusters derived from TCGA data by comparing signature genomic aberrations. As shown in PDGFRA were more commonly seen in the PDGFRA transcriptomal cocluster as were PDGFRA mutations . However 4 out of 5 MET-amplified tumors were in this class and 7 tumors showed focal amplification of EGFR. Therefore there was no single copy number aberration distinguishing this class. There were no cases of PDGFRA amplification among the 24 tumors in our study for which aCGH was performed. Among the 9 tumors in our PDGF signaling class, one had MET amplification and one had EGFR amplification. Despite the absence of PDGFRA-amplified cases in our sample set, the overall distribution of EGFR, PDGFRA and MET amplifications was found to be within the normal sampling error if one derives expectation frequencies from the TCGA data.Among TCGA samples, amplifications of EGFR, JAG1, and HES1 compared to the other subclasses (p<1e−5 for each gene). However other EGFR core proteins and Notch pathway members showed no elevation of mRNA expression in the corresponding transcriptomal class and therefore direct correlation could not be established.Comparison of genomic aberrations suggested a correspondence between proteomic classes of EGFR, NF1 and PDGF and the corresponding TCGA transcriptomal classes, therefore expression levels for genes encoding the core proteins were next assessed in each of the four transcriptomal clusters. Among genes encoding EGFR-core proteins, the corresponding EGFR transcriptomal cocluster subclass showed significant overexpression of IRS1 and YKL40/CHI3L1. As seen in NF1 mRNA underexpression among the strongest signatures of the transcriptomal class.Within the transcriptomal NF1-cocluster, the only overexpressed genes encoding NF1 core proteins were TSC2 and HEB/TCF12 were the only genes among the PDGF core protein group significantly overexpressed (p<1e−4). The PDGFRB gene was significantly underexpressed in this group, concordant with our observation that total protein levels were higher in the EGFR class even while the phosphorylated receptor was correlated with the PDGF class. Overexpression of PDGFRA was a prominent feature of the PDGFRA-cocluster tumors (p<1e−12), nearly always associated with gene amplification. Messenger RNA levels of genes encoding PDGF ligands were not elevated in the PDGFRA cocluster even among the subset of tumors showing PDGFRA amplification. We further investigated the relationship of PDGFB mRNA and protein levels in a validation set of 40 gliomas and found no correlation between mRNA expression and levels of protein even though the latter were highly variable , concordant with recent observations of mTOR activation in reactive astrocytes under experimental conditions of injury.The histology of the TCGA samples was uniformly GBM, but this is a histologically heterogeneous tumor type. A priori, it is possible that the transcriptomal classes identified in this analysis could be related to tumor sampling or microenvironment. However, this does not appear to be the case since well-defined genetic lesions are enriched in specific tumor classes and there is no evidence for regional localization of mutations in glioma as a general phenomenon. Although clinical and pathologic data are limited and a more detailed review of this information is underway, there appeared little clinical or histological differences between the three groups identified in this analysis. PDGFRA-cocluster tumors in TCGA occurred in younger patients, and there were small but significant differences in the amount of associated necrosis and inflammatory cells (data not shown).It remains to be established whether ligand-driven PDGF signaling is common among tumors in the transcriptomal PDGFRA-cocluster and whether this is functionally important. We have shown that PDGFB ligand levels are highly variable in GBM, are associated with receptor activation, and are not correlated with mRNA expression. The PDGFRA-cocluster transcriptomal class shares features with the Proneural group of gliomas identified by Phillips et al using transcription analysis, and is characterized by genes expressed during normal cortical oligodendrocyte development such as olig2, Sox2 and doublecortin and signaling pathways involved in that process as well, such as PDGF and SHH. While the PDGFRA-cocluster group is enriched for Proneural signature genes, it is important to note that the original signature was derived from a dataset of mixed histologies and the analysis designed specifically to resolve a prognostic signature. Therefore the exact relationship between our PDGF proteomic class, the PDGFRA co-cluster, and gliomas harboring Proneural signature is unclear and will need to be further investigated.PDGFRA amplification predominated in the PDGFRA-cocluster transcriptomal group, a full 15% showed amplified EGFR and another 15% showed amplified MET. From the prevalence of PDGF signaling we found at the protein level one might hypothesize the existence of concurrent PDGF signaling in EGFR- and MET- amplified tumors in this class. In fact, we found two such tumors in our proteomic analysis: one EGFR- and one MET-amplified, both with high levels of PDGFB, phosphorylation of PDGFRβ and an overall signaling pattern matching the PDGF proteomic class. It is unclear in these cases whether the level of PDGF pathway activation is functionally important, perhaps in a subpopulation of cells. It is notable that 6 tumors in TCGA show focal amplification of both PDGFRA and another RTK: four cases sharing focal co-amplification of EGFR, and two cases sharing focal co-amplifications of PDGFRA and MET.Although In conclusion, our findings support a division of GBMs into three classes according to patterns of signal transduction pathway activation. These patterns reflect, in part, mutually exclusive signaling involving EGFR, PDGF RTK activation or NF1 silencing. Both the transcriptomal and proteomic classes were imperfectly related to genotype, suggesting that molecular assays used in patient stratification and clinical trial analysis should include measures of PDGF ligand and receptor phosphorylation as well as NF1 expression. Notch signaling was prominently associated with the EGFR class at the protein level, an observation which was not predicted by mRNA expression levels of Notch pathway members in EGFR-altered tumors from TCGA. Whether one or more non-EGF/PDGF RTKs are contributing to NF1 tumors is uncertain, but the finding that NF1-silenced tumors show elevated MET, HGF and IRS1 at the transcriptomal level and validation of IRS1 at the protein level suggest IGF and or MET signaling may be contributory. Further refinement of GBM subclasses will likely come from direct investigations of these and other signaling proteins, as well as investigation of newly described recurrent mutations in GBM such as ERBB2 and IDH1. The current study provides an initial architecture for such subclasses and suggests the potential for class-directed therapies.The collection and use of the human tissues in this study were performed after obtaining written consent from all participants, in accordance with a study protocol approved by the Institutional Review Board of Memorial Sloan-Kettering Cancer Center. Data from The Cancer Genome Atlas public portal were obtained under an approved Data Access Request.Tumors were snap-frozen in the operating room, and stored at −80°C. Samples in liquid nitrogen were ground to powder and protein was extracted through lysis with T-per tissue extract solution (Pierce) supplemented with 30 mM sodium fluoride, 1 mM sodium vanadate, and protease inhibitor cocktail tablets (Roche). Protein concentrations were determined by bicinchoninic acid assay (BCA) method (Bio-Rad).Samples (100 µg) were separated by 6, 8, 10, or 12% SDS-PAGE gel, and transferred onto polyvinylidene difluoride membrane (Millipore). For qualitative comparison, analysis included normal brain cortex lysate as previously described .Activated K-ras (K-ras-GTP) was tested by using 500 µg samples for activated Ras pull-down with 10 µg of glutathione-conjugated Raf-1 GST-RBD beads (Upstate Biotechnology) as previously described.www.cran.org). Principal component analysis was performed on standardized data. K-means clustering of quantified protein levels for 20 GBM samples was performed in R, and stability of cluster assignment assessed over 10,000 iterations leaving out 15% of tumors with each iteration . Consensus matrices were generated for each k-clustering over all iterations and assessed visually as well as by cophenetic correlation. Core correlated protein clusters are defined for 3-way clustering as >95% consensus. Proteins in these core clusters were selected for k-means analysis of 27 gliomas using, as before, an 85% resampling of proteins and consensus matrix analysis over 10,000 iterations.Quantified western data were standardized for each protein by mean and standard deviation across the sample cohorts. Standardization was done first on the glioblastoma samples (n = 20) for unsupervised clustering analysis of protein level, then again separately on the whole sample set (n = 27) for cluster analysis of samples. For the purpose of display, NF1 is represented as “NF1-loss”, or zero minus standardized NF1 quantity on western. All statistical analyses and plotting were done in R .Genomic DNA was extracted from primary tumors using standard techniques. DNA was then digested and labeled and hybridized to 244K CGH arrays according to manufacturer guidelines . This array consists of >238,000 coding and non-coding sequences allotted to assembly map positions . Normal male genomic DNA was used as a reference. After washing, the slides were scanned with an Agilent scanner and images quantified using Feature Extraction 9.5.3.1 (Agilent). Fluorescence ratios of the scanned images were calculated and the raw aCGH profiles were processed to identify statistically significant transitions in copy number using the Circular Binary Segmentation algorithm.http://cancergenome.nih.gov/dataportal/) as available on May, 2009. Specific data sources were as follows: For mRNA expression, “Level 3” normalized gene expression derived from the Cancer Genome Characterization Center (CGCC) at the Broad Institute, MIT (Affymetrix Human Genome HTS U133A 2.0). For chromosomal copy number, “Level 3” normalized and segmented copy number data from the CGCC at Memorial Sloan-Kettering Cancer Center (Agilent 244K CGH Array). From this array-CGH dataset one unique profile was selected for each tumor based on the highest signal-to-noise estimate. For sequencing data, we combined all available sequencing data summaries in “multiple alignment format” (MAF) files as of May 2009: broad.mit.edu GBM.ABI.1, genome.wustl.edu GBM.ABI.53, hgsc.bcm.edu GBM.ABI.1.maf and GBM.ABI.2. Mutations were further filtered by excluding events which were classified as “somatic,” “synonymous” or “silent,” or “unvalidated,”A description of TCGA data types, platforms and analyses are as previously described.A list of the sample IDs and the summary of genomic data are given in Unsupervised clustering of TCGA Level 3 expression data was performed on 1,807 genes representing the top 15%ile of variance . Supervised cluster analysis was performed as follows: 147 samples were identified harboring only one of either EGFR mutation/amplification (n = 103), PDGFRA mutation/amplification (n = 14) or NF1 mutation/loss (n = 30). Kruskal-Wallis test was used to identify genes which discriminate between EGFR-, PDGFRA- and NF1-altered samples. Because only 14 samples in TCGA set harbor solitary PDGFRA alteration, the numbers of profiles in each class are balanced by sampling 14 of the 103 EGFR-altered and 14 of the 30 NF1-altered samples and the KW test is run iteratively 1000 times with resampling. 1,953 genes were found to show KW p-values <0.05 in >95% of iterations and these were used to perform supervised hierarchical clustering. Calculation of significance for differences between cluster was by Fisher's Exact Test (R package:stats) using cluster assignments for PDGFRA, NF1 and EGFR-coclusters derived from unsupervised clustering, and excluding samples belonging to the “Indeterminate Genotype” cluster.Figure S1Selected bands from western blots which were quantified in this study. Signaling class assignments are shown for those samples with stable clustering: “P” = PDGF class, “N” = NF1 class, and “E” = EGFR class.(6.30 MB TIF)Click here for additional data file.Figure S2Principal Componenet Analysis of Quantified Protein Levels: Fractional variance for principal components from the analysis of quantified protein levels in 20 GBM samples. The first two components together account for 51% of total variance and are plotted in (0.34 MB TIF)Click here for additional data file.Figure S3Analysis of stable cluster assignment by k-means for varying cluster count: K-means clustering of quantified and standardized protein levels in GBM; classification of gliomas by core protein expression patterns. For each analysis, K-means was run for 10,000 iterations leaving out 15% of data with each iteration. Shown are consensus matrices for division into 2–4 clusters, and cophenetic correlations for division into 2–8 clusters. (A) Clustering of 55 proteins in 20 GBM samples shows stable two-way and three-way clustering with peak cophenetic correlations ∼0.98. Details for 3-way clustering are shown in (1.04 MB TIF)Click here for additional data file.Figure S4Genomic profiling of gliomas clustered by signaling class: Array-CGH shows high concordance between EGFR signaling class and amplification of EGFR locus and deletion of the Ink4a/ARF locus. Tumors in the NF1 class show frequent gain of chr7 without focal amplification of either EGFR or MET. Of the two tumors which do have focal MET amplification, one clusters with EGFR-class and the other with PDGF-class. No amplification of PDGFRA was found in any of the samples.(0.96 MB TIF)Click here for additional data file.Figure S5Expression of Proneural and Mesenchymal signature genes in transcriptomal subclasses: Expression analysis of Proneural and Mesenchymal signature genes across transcriptomal subclasses derived from The Cancer Genome Atlas. Unsupervised clustering of TCGA samples and subclass assignments are as shown in (0.35 MB TIF)Click here for additional data file.Figure S6Supervised transcriptomal clustering of GBM tumors in The Cancer Genome Atlas: Clustering of 243 GBM samples form TCGA using ∼1,900 genes selected for their ability to discriminate three genotypes: EGFR mutation/amplification, PDGFRA mutation/amplification or NF1 mutation/deletion see . Sample (0.91 MB TIF)Click here for additional data file.Figure S7PDGFB protein levels are not correlated with mRNA expression: PDGFB protein levels were assessed in a validation panel of 40 gliomas by western blot and compared with mRNA expression levels. Although the ligand is expressed at highly variable amounts there is no correlation with mRNA, concordant with post-transcriptional regulation of PDGF.(0.77 MB TIF)Click here for additional data file.Table S1Antibodies and conditions used for western blot panel. Antibody sources and conditions as shown. *Hes1 antibody kindly provided by Dr. Tetsuo Sudo .(0.03 MB XLS)Click here for additional data file.Table S2Quantified western results. Western bands quantified by densitometry and normalized to actin see . Images (0.05 MB XLS)Click here for additional data file.Table S3Summary of integrated analysis of genomic data from 278 samples in The Cancer Genome Atlas. In this table, mutations are denoted in blue and designated “validated” and “unvalidated” according to whether TCGA reports that the mutation was verified by second sequencing method or whether such verification is pending. Focal amplifications in red and single-copy loss or homozygous deletion are inferred from array-CGH log2 ratios see . Cluster(0.08 MB XLS)Click here for additional data file.
Unlike other malignancies, there is no literature supporting the accuracy of medical claims data for identifying surgical treatments among patients with kidney cancer. We sought to validate externally a previously published Medicare-claims-based algorithm for classifying surgical treatments among patients with early-stage kidney cancer. To achieve this aim, we compared procedure assignments based on Medicare claims with the type of surgery specified in SEER registry data and clinical operative reports.Using linked SEER-Medicare data, we calculated the agreement between Medicare claims and SEER data for identification of cancer-directed surgery among 6,515 patients diagnosed with early-stage kidney cancer. Next, for a subset of 120 cases, we determined the agreement between the claims algorithm and the medical record. Finally, using the medical record as the reference-standard, we calculated the sensitivity, specificity, and positive and negative predictive values of the claims algorithm.Among 6,515 cases, Medicare claims and SEER data identified 5,483 (84.1%) and 5,774 (88.6%) patients, respectively, who underwent cancer-directed surgery . The two data sources demonstrated 97% agreement for classification of partial versus radical nephrectomy . We observed 97% agreement between the claims algorithm and clinical operative reports; the positive predictive value of the claims algorithm exceeded 90% for identification of both partial nephrectomy and laparoscopic surgery.Medicare claims represent an accurate data source for ascertainment of population-based patterns of surgical care among patients with early-stage kidney cancer. The introduction of partial nephrectomy and laparoscopy changed the paradigm for surgical management of patients with early-stage kidney cancer in two important ways. First, pDespite their potential benefits to patients, surgeon adoption of partial nephrectomy and laparoscopy has been gradual and assymetric, -7 suggesUnlike prostate, lung, and breast cancer, ,9howeverWe sought to validate a Medicare-claims-based algorithm for surgical procedure assignment employed in a previously-published study (referred to as the parent study) that used linked SEER-Medicare data to study the utilization of partial nephrectomy and laparoscopic radical nephrectomy among Medicare beneficiaries diagnosed with kidney cancer from 1997 through 2003.The MedicFrom the SEER data included with linked SEER-Medicare files, we identified 6,515 eligible subjects with a new diagnosis of localized/regional, non-urothelial kidney cancer to classify the specific type of surgical therapy received by each patient among 6,515 patients in the preliminary cohort from our parent study ; CSP staff then sampled 5 cases from 2000–2003 for every 1 case from 1997–1999. CSP staff requested information for 141 cases before successfully retrieving records for the 120 cases comprising our final validation sample . Detailed patient characteristics for each of the previously described cohorts and sub-cohorts are presented in Additional File For the second step, we collaborated with the SEER registry for Los Angeles County, the Cancer Surveillance Program (CSP) at the University of Southern California, to carry out a medical-records-based validation of our claims algorithm. In order to retrieve medical records, we provided the CSP with a de-identified list of patient codes for Los Angeles cases included in the analytic cohort for the parent study n = 549). These 549 cases from the parent study matched with 605 records in the CSP . After the initial match – and before sampling cases – CSP staff excluded 14 LA County residents who were diagnosed and/or treated in facilities outside of LA County, 15 cases from facilities that are now closed, and 8 cases whose CSP records did not include a code for kidney cancer surgery. Anticipating that future studies in this area will employ currently-available procedure codes, we decided 9. These Upon receipt of records from treating facilities, CSP chart abstractors identified and photocopied the kidney cancer surgery operative report . Next, they removed all patient and/or provider-level identifiers, replaced these with the corresponding unique identifiers from the parent study, and sent the de-identified, photocopied medical records back to UCLA for review and data abstraction. One study author (DCM) reviewed the medical records to determine the surgical procedure received by each patient .In analyses for the subset of cases with medical records data, we considered the procedure specified in the operative note to be the reference-standard. We first calculated the overall concordance or observed agreement rate between the claims algorithm and the medical record . We performed separate calculations for overall procedure assignments , partial versus radical nephrectomy, and open versus laparoscopic surgical approach. Finally, we calculated the sensitivity, specificity, PPV and NPV of the claims algorithm for identification of open surgery versus laparoscopy, and partial versus radical nephrectomy.Among 6,515 Medicare beneficiaries with a new diagnosis of localized/regional, non-urothelial kidney cancer, Medicare claims and SEER data identified 5,483 (84.1%) and 5,774 (88.6%) patients, respectively, who underwent cancer-directed surgery. For cases with both hospital and physician claims specifying the occurrence of cancer-directed surgery, we observed 98% agreement for classification of partial versus radical nephrectomy, and 94% agreement for classification of laparoscopic versus open surgery.As presented in Table Among the 120 subjects whose medical records were reviewed, 100 83%) and 20 (17%) underwent surgery in 2000–2003 and 1997–1999, respectively. The claims-based algorithm correctly classified the specific surgical procedure for 116 of 120 cases (observed agreement = 96.7%) are now used more frequently as alternatives to partial nephrectomy. Because we anticipated (and observed) very small numbers of these cases in the parent study, we included ablative therapies with the partial nephrectomies. In the future, updated claims algorithms may be needed to separately identify patients treated with ablative therapies. Finally, the generalizability of our results may be limited by a sample that includes only patients ≥ 66 years of age at the time of diagnosis. We do not believe, however, that patterns of treatment are systematically different for 65-year-olds versus older Medicare beneficiaries ages 66 and older.Despite these limitations, this study confirms a high level of agreement between Medicare claims and clinical operative reports for the identification of specific kidney cancer surgeries. Claims data, therefore, may be considered a valid substrate for studying patterns of surgical care among patients with kidney cancer.ORN: Open Radical Nephrectomy; OPN: Open Partial Nephrectomy; LRN: Laparoscopic Radical Nephrectomy; LPN: Laparoscopic Partial Nephrectomy; CSP: Cancer Surveillance Program (Los Angeles); SEER: Surveillance, Epidemiology, and End Results; PPV: Positive Predictive Value; NPV: Negative Predictive Value; LA: Los Angeles.The authors declare that they have no competing interests.DM conceived of the study, participated in its design, coordination, execution and analyses, and drafted the manuscript. CS conceived of the study, participated in its design, coordination and analyses, and helped to draft the manuscript. JW participated in the study design and analyses, and helped to draft the manuscript. ML participated in the study design and coordinated ascertainment of cases from the LA Tumor Registry. DD participated in the study design and coordination, supervised ascertainment of cases from the LA Tumor Registry, and helped to draft the manuscript. MB participated in the study design and statistical analyses and helped to draft the manuscript. JL and JH performed statistical analyses for the study. ML conceived of the study, participated in its design, coordination and analyses, and drafted the manuscript. All authors read and approved the final manuscript. The pre-publication history for this paper can be accessed here:Cohort Selection. Flow diagram describing selection of cohort for parent study.Click here for fileIdentification of cases treated surgically for kidney cancer. This file contains additional details regarding our method for identifying Medicare beneficiaries who underwent surgical treatment for early-stage kidney cancer.Click here for fileDescription of algorithms for surgical procedure assignment. The series of tables in Additional File Click here for fileDistribution of patient characteristics. The series of tables in Additional File Click here for file
Serotonin genes have been hypothesized to play a role in the etiology of attention-deficit hyperactivity disorder (ADHD); prior work suggests that serotonin may interact with psychosocial stressors in ADHD, perhaps via mechanisms involved in emotional dysregulation. Because the development of behavioral and emotional regulation depends heavily both on the child's experience within the family context and the child's construals of that experience, children's appraisals of inter-parental conflict are a compelling candidate potentiator of the effects of variation within the serotonin transporter gene promoter polymorphism (5HTTLPR) on liability for ADHD.304 youth from the local community underwent a multi-informant diagnostic assessment procedure to identify ADHD cases and non-ADHD controls. Youth also completed the Children's Perception of Inter-Parental Conflict (CPIC) scale to assess appraisals of self-blame in relation to their parents' marital disputes. The trialleic configuration of 5HTTLPR (long/short polymorphism with A> G substitution) was genotyped and participants were assigned as having high (La/La N = 78), intermediate , or low serotonin transporter activity genotypes. Teacher reported behavior problems were examined as the target outcome to avoid informant overlap for moderator and outcome measures.Hierarchical linear regression analyses indicated significant 5HTTLPR × self-blame interactions for ADHD symptoms. Examination of the interactions indicated positive relations between reports of self-blame and ADHD symptoms for those with the high and low serotonin activity genotypes. There was no relation between self-blame and ADHD for those with intermediate activity 5HTTLPR genotypes.Both high and low serotonergic activity may exert risk for ADHD when coupled with psychosocial distress such as children's self-blame in relation to inter-parental conflict. Results are discussed in relation to the role of serotonin in the etiology of the ADHD and related externalizing behaviors. Children living with a step-parent did not report significantly higher levels of conflict properties or self-blame than did children living with two biological parents (ps > .33). Despite this, as a precaution we covaried family composition in the main G × E analyses (with no effect on the results).Children in the ADHD group were less likely to be living with both biological parents than non-ADHD children. This latter difference in regard to family constellation may potentially influence reports of self-blame, as children experiencing parental separation and/or divorce may be more likely to observe frequent and intense marital conflict and therefore, may have higher levels of self-blame. Whereas children who had experienced parental separation and/or divorce reported higher scores on conflict properties . There were also no significant main effects of 5HTTLPR genotype when dimensional measures of ADHD were examined. As seen in Table Table There were no significant differences in reports of self-blame across the three genotype groups (p = .22), suggesting an absence of gene-environment correlation between 5HTTLPR genotype and children's report of self-blame. Lack of correlation between this genetic marker and this environmental measure signals that this particular rGE effect is unlikely to emerge as spurious interaction findings in the present analyses .2 = .11], indicating an increase in total ADHD symptoms with higher reports of self-blame. The linear (low activity as risk) and non-linear (low and high activity as risk) main effects of 5HTTLPR genotype were nonsignificant as was the linear × self-blame interaction However, the non-linear × self-blame interaction was significant . Examination of the simple slopes revealed that there was no relationship between ADHD symptoms and self-blame for those with the intermediate activity genotypes . In contrast, a significant and positive relationship between self-blame and ADHD emerged for those with the high and low activity genotypes . All modeling results reported herein include these covariates. Results revealed a significant main effect of self-blame for the total ADHD Index raw score . There was no main effect of 5HTTLPR genotype group using either the linear (p = .29) or non-linear (p = .54) coding schemes. The linear × self-blame interaction was nonsignificant (p = .54). The non-linear × self-blame interaction showed a trend, but was also not significant . For Cognitive Problems, there was a significant main effect of self-blame . The linear and non-linear main effects of 5HTTLPR genotype were again nonsignificant as was the linear 5HTTLPR × self-blame interaction . In contrast, the non-linear 5HTTLPR × self-blame interaction was significant . Examination of the simple slopes revealed a similar pattern of results. For youth with the low and high activity serotonin genotypes, there was a significant and positive relationship between self-blame and Hyperactivity . Yet, there was no relationship between self-blame and ADHD for those with the intermediate serotonin activity genotypes . Further, non-linear 5HTTLPR × self-blame interactions remained significant after adjusting for a number of covariates, including gender, age, ethnicity, family composition, and overall level of conflict frequency/intensity .2 = .08]. The main effect of 5HTTLPR genotype as well as the linear 5HTTLPR × self-blame interactions were again nonsignificant (ps > .63). The non-linear 5HTTLPR genotype × self-blame showed a trend in the expected direction, but did not reach significance .To evaluate degree of internal replication of results, G × E regression models were repeated with parent report on the Conners' Rating Scale ADHD index and the two symptom dimension scales with uncorrected p values. For the ADHD index, results again indicated a significant main effect of self-blame and Hyperactivity . Similar to results with teacher report, all main effects of 5HTTLPR genotype (linear and non-linear coding schemes) as well as the linear 5HTTLPR genotype × self-blame interactions were not significant for both Cognitive Problems and hyperactivity . The non-linear 5HTTLPR genotype × self-blame interaction was not significant for Cognitive Problems . It also feel shy of significance for hyperactivity . In sum, non-linear G × E interactions were significant in predicting teacher report of ADHD symptoms , but were shy of significance when parent report was used as the dependent measure.The significant main effect of self-blame was again observed in predicting parent report for both Cognitive Problems . Both the linear and non-linear 5HTTLPR × self-blame interactions were non-significant, although there was a trend toward significance for the linear 5HTTLPR × self-blame interaction (p = .10). Results for parent report of Oppositionality were similar. A main effect of self-blame emerged , whereas all G × E interactions involving self-blame and 5HTTLPR showed no hint of an effect (ps > .41).As secondary analyses, we examined the G × E interaction on the Conners' Oppositionality scale. G × E models predicting teacher report of Oppositionality yielded a main effect of self-blame , however all other main effects and all G × E interactions were nonsignificant (ps > .24). Overall, these results indicate that while the non-linear 5HTTLPR × self-blame interaction did not generalize to other disruptive behaviors, self-blame itself may have exert some main effects for ADHD as well as other disruptive behaviors.2 = .03, total R2 = .13] as well as for hyperactive symptoms . The non-linear 5HTTLP × self-blame interaction predicting teacher inattentive symptoms was marginally significant, in the expected direction . Again, relationships between self-blame and ADHD symptoms were only positive and significant for those with the low and high 5HTTLPR activity genotypes.To enable comparisons with future studies that may rely on ADHD symptom scores, we here report G × E interactions using the lower powered tests with the DSM-IV ADHD Rating Scale. As with the Conners, the non-linear 5HTTLPR × self-blame interaction was significant in predicting teacher report of total ADHD symptoms but not for parent report of inattention were included as a covariate, the non-linear interaction terms remained significant in predicting teacher report on the Conners' ADHD Index [b = .19, 95% confidence interval .08-.31, p = .002, ΔRAs a contrast test, we examined appraisals of conflict properties as a moderator in the G × E analyses. While conflict properties exerted a main effect on both parent and teacher reports of ADHD symptoms (p < .01), the linear and non-linear 5HTTLPR × conflict properties interactions were not significant using either parent or teacher report (ps > .69). This suggested that results for self-blame could not be attributed to measurement artifact.The sample consisted of children and adolescents covering a wide age range (6-18 years). Serotonin systems have been suggested to function differently in pre and post-pubertal children . While w2 = .02, total R2 = .14) but only showed a trend toward significance in pre to-mid pubertal children . While these data are preliminary, they may reflect potential differences in serotonin functioning with age and development. The influence of development on the functioning of the serotonin system, including any potential role for G × E interactions for ADHD involving serotonin system genes, remain critical questions to address in future studies.These exploratory results revealed that the non-linear 5HTTLPR × self-blame interactions predicting teacher report on the Conners' ADHD Index remained significant for post and late-pubertal youth , along with a particularly salient marker of environmental risk .both high and low serotonergic activity genotypes exert risk and that these risk mechanisms are modulated by salient psychosocial stressors.The current study provides evidence of G × E effects for ADHD involving 5HTTLPR and youth appraisals of self-blame. Our analytic methods allowed us to examine a hypothesis previously untested at the genetic level - namely that both high and low serotonergic activity genotypes exert risk for ADHD symptoms. Findings from both the functional serotonin literature as well as from molecular genetic association studies have yielded seemingly conflicting findings about whether increased or reduced serotonergic activity is related to ADHD. The present results suggest that at the genetic level, The results were generally consistent across informant, although results for parent ratings were shy of the significance levels seen with teacher ratings. For teacher report, the pattern of results indicated significant non-linear 5HTTLPR × self-blame interactions for hyperactivity/impulsivity but not inattention or cognitive problems. The interactions revealed that youth appraisals of self-blame were significantly related to ADHD symptoms for children with the low activity and high activity (La/La) 5HTTLPR genotypes. Those with the intermediate activity genotypes , on the other hand, appeared to be immune to whatever effects self blame was having on hyperactivity/impulsivity. The interaction was not accounted for by age, gender, or ethnicity, by family composition, by overall levels of conflict frequency/intensity, or by main effects of 5HTTLPR genotype or youth reports of self-blame. It was also not likely to be due to measurement artifact, because another scale (conflict properties) showed no hint of interaction.Analysis of the symptom dimensions appeared to indicate some preliminary evidence for specificity of effects. The non-linear 5HTTLPR × self-blame interactions were non-significant or marginally significant for teacher and parent report of cognitive problems. In contrast, non-linear interactions were significant for teacher report and marginally significant for parent report of hyperactivity. The interaction again revealed that for youth with the high and low serotonin activity genotypes, the relationship between self-blame and hyperactivity was positive and significant. When examined again via the ADHD Rating Scale, a similar pattern emerged, however, the effect appeared attenuated for both parent and teacher report using DSM-IV symptom counts, perhaps due to the loss of power using the less well-distributed scores on that scale. Some potential specificity in terms of G × E effects for the ADHD symptom dimensions may make sense, as hyperactivity-impulsivity and inattention have been described as being partially separable at the genetic, neural, and temperament levels ,73,74 asThe effects appeared to be somewhat specific for ADHD, as the non-linear 5HTTLPR × self-blame interactions showed no hint of an effect for oppositional defiant disorder symptoms (by teacher report) or conduct problems (by parent report). In contrast, the linear 5HTTLPR × self-blame interaction showed marginal significance for oppositional defiant disorder symptoms. If that result were to prove stronger in future work, it could indicate that only individuals with the low activity 5HTTLPR genotypes are vulnerable to development of oppositional and conduct problems .Post-hoc data checks indicated that results were not generalizable to any appraisals of inter-parental conflict, as conflict properties failed to show significant moderation in the G × E analyses. Thus, there appears to be something about self-blame that is important for ADHD specifically. This is line with current work from our own laboratory (which included a portion of this sample) that indicates that among the CPIC scales, self-blame is a significant and unique predictor of ADHD symptomatology .In addition, while serotonin functioning and serotonin genes have also shown association with a number of conditions, including mood disorders, the current findings were not explainable by a history of comorbid depression symptoms. Furthermore, while effects were stronger in late and post-pubertal youth, non-linear 5HTTLPR × self-blame interactions continued to show marginal significance in younger children . Thus, while developmental timing and its relationship with serotonergic functioning may be accounting for some of the effects - and will be an interesting avenue for future study - the non-linear 5HTTLPR × self-blame interactions observed here could not be fully explained developmentally.With regard to the genetic literature for ADHD, our results failed to replicate a main effect of 5HTTLPR genotype with ADHD symptoms that has been previously reported -78. UnliThe overall results are also suggestive of a potential heterozygote advantage, which has been suggested as a potential explanation for some diseases, including mental disorders . HoweverCertain limitations are important to note. First, we did not have parent DNA available for the majority of our sample, thus the use of family-based analyses was not possible. While unlikely, we cannot rule out population stratification effects. Second, because our sample is cross-sectional, we could not examine the longitudinal relationships between appraisals of self-blame and ADHD symptoms. It may be the case that more frequent inter-parental conflict is the result of having a child with more severe ADHD symptoms and that over time, children view themselves (perhaps correctly) as being responsible for their parents' marital problems. As is always the case with single studies of genetic or environmental effects, our findings may be false-positives. Thus, replication of these results in other samples is necessary.The influence of development on the functioning of the serotonin system, including any potential role for G × E interactions for ADHD involving serotonin system genes, remains in need of further investigation in more costly studies, which may be justified by results such as the current one. In addition, the influence of age regarding comprehension of the 48-item CPIC remains in need of further exploration. While we took several steps to assure correct comprehension and completion of the CPIC in younger children, future work extending on these results may be well-served by considering the CPIC-Y designed for younger children .Overall, our study is among the first to examine relationships between 5HTTLPR and ADHD as well as interaction effects using the triallelic genotype configuration. Results suggest that both the low- and high-activity 5HTTLPR genotypes increase risk for ADHD symptoms within the context of higher levels of youth self-blame in relation to their parents' marital conflict.The authors declare that they have no competing interests.MN formulated study hypothesis, participated in data collection, carried out the analyses, and wrote the manuscript draft. KF oversaw genotyping procedures, obtained funding, aided in hypothesis generation, and provided manuscript revision. IW provided statistical consultation, formulated data analytic plan, and provided manuscript revision. KJ completed genotyping assays on the sample. JTN advised on hypothesis formulation, obtained funding, assisted with data analysis and manuscript revision. All authors read and approved the final manuscript.
Å b = 4.5190 (5) Å c = 19.3874 (18) Å β = 90.218 (7)°V = 1285.4 (2) Å3 Z = 4 Kα radiationMo −1 μ = 0.10 mmT = 293 K 0.22 × 0.15 × 0.12 mm Bruker SMART CCD area-detector diffractometerSADABS; Sheldrick, 2004T min = 0.981, T max = 0.987Absorption correction: ψ scan (13075 measured reflections2276 independent reflectionsI > 2σ(I)997 reflections with R int = 0.088 R[F 2 > 2σ(F 2)] = 0.075 wR(F 2) = 0.208 S = 1.04 2276 reflections182 parametersH-atom parameters constrainedmax = 0.17 e Å−3 Δρmin = −0.16 e Å−3 Δρ SMART used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008ORTEP-3 (Farrugia, 1999SHELXL97.Data collection: 10.1107/S1600536810037840/wn2410sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536810037840/wn2410Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:
Mycobacterium tuberculosis (MTB) isolates (n=692) from Mpumalanga province was assessed. In total, 692 (64%) MTB strains from cases with pulmonary TB were tested for susceptibility against rifampicin, isoniazid, ethambutol, and streptomycin using the MGIT 960 instrument. Two hundred and nine (30.2%) strains were resistant to one or more drugs. Resistance to one drug ranged from 1.4% for ethambutol to 17.7% for rifampicin. The prevalence of MDR-TB ranged from 6.7% for three drugs to 34% for four drugs, with significant predictors being patients’ age-groups of 25–54 years (p=0.0012) and >55 years (p=0.007). The result showed a high level (58.4%) of MDR-TB from cases in Mpumalanga province. To achieve a higher cure rate in this province, drug-susceptibility tests must be done for every case.Multidrug-resistant tuberculosis (MDR-TB) has been a cause of concern in both developed and developing countries. The prevalence of drug resistance in Mycobacterium tuberculosis (MTB). In 2005, 8.9 million new cases of TB were recorded, and 1.8 million deaths were attributed to the disease (Tuberculosis (TB) remains a deadly infectious disease, affecting millions of people worldwide. Although it is a global epidemic, TB predominantly affects populations in resource-poor countries, where 98% of all deaths due to TB occur . Worldwi disease . Accordi disease . It is e disease , 7. The disease .The WHO recommends standardized TB treatment regimens based on short-course chemotherapy. The anti-TB drug regimen recommended for the treatment of new cases consists of two months of INH, RIF, pyrazinamide (PZA), and ethambutol (EMB) administration, followed by four months of INH and RIF . This trContinuous surveillance of primary (infection with a drug-resistant strain) and secondary drug resistance (selection and growth of resistant population) patterns of MTB is important in assessing the efficacy of chemotherapy regimens used in the past years and in detecting the problems in past treatments . AttentiThere is a paucity of information in primary drug resistance among MTB strains circulating in Mpumalanga province, South Africa. The present study was, therefore, undertaken to measure the prevalence of DR-TB, including MDR-TB, in Mpumalanga province. These results will contribute to guiding the design of retreatment regimen for DR-TB and MDR-TB in the province.One thousand and eighty-four sputum samples were collected from 18 districts in Mpumalanga province, South Africa. The inclusion criteria for collecting sputum specimens from patients were according to the Department of Health guidelines, which include clinically-suspected TB, treatment failure, and retreatment among patients. Patients, aged 15–71, years presenting to different clinics and hospitals and outpatient facilities in Mpumalanga during January 2004–December 2006 were eligible for the study. Informed consent was obtained from all patients before enrollment. The Research and Ethics Committee of the University of Venda and the Department of Health and Welfare, Mpumalanga province, approved the study.Clinical, demographic, and epidemiologic data were collected by interviewing patients. Demographic data included age of patient, gender, region of residence, and history of treatment. The study focused primarily on patients who had positive cultures for TB. Multidrug resistance (MDR) was defined as resistance to at least both INH and RIF , 18 withThree sputum samples for acid-fast bacillus (AFB) smear microscopy and culture were obtained from each patient enrolled in the study. Specimens were obtained at each district and then transported to TB Laboratory of Dr George Mukhari Hospital in Pretoria where AFB cultures were performed in the BacT/Alert 3D system . Dr George Mukhari Hospital is a 1,200-bed tertiary teaching and referral hospital attached to the Medunsa Campus of the University of Limpopo. Sputum specimens are routinely sent to Microbiology Laboratory of Dr George Mukhari Hospital for analysis of TB. Positive cultures were stained by the Ziehl-Neelsen technique. If more than one culture-positive specimen per patient were processed, only one positive result was registered for the patient; similarly, if several negative cultures per patient were encountered, without a positive finding, only one negative result was recorded. Confirmation of MTB was done using the AccuProbe DNA hybridization assay (GenProbe) following the instructions of the manufacturer. All positive cultures were advanced for susceptibility testing.Susceptibility to all culture-positive MTB strains was done for the first-line anti-TB drugs, including INH, RMP, and EMB and one second-line drug SM using the MGIT 960 instrument . The conA standard questionnaire and the register were used for determining the history of previous anti-TB drug therapy, and the patients were categorized as having either initial or secondary resistance, according to the standard definitions . ResistaAll statistical analyses were performed using the SPSS software (version 16.0) and the Epi Info software (version 3.4.1). Risk factors for having non-multidrug resistance and multidrug resistance among culture-confirmed TB cases were assessed. Univariate analysis was performed to determine unadjusted association of TB drug resistance with demographic characteristics of patients. The prevalence ratios (PRs) with 95% confidence interval (CI) were calculated using StatCalc on Epi Info. A p value of ≤0.05 was considered statistically significant.M. tuberculosis was associated with male gender were positive for MTB culture. Drug-susceptibility test and demographic data of the 692 strains were analyzed . The rese gender .The prevalence of different patterns of resistance is shown in There was no significant difference between the MDR-TB cases and the non-MDR-TB cases (49%) (p=0.6) in male and female cases respectively . A slighSouth Africa is one of the 22 high-burden countries that contribute approximately 80% of the total global burden of all TB cases . The couM. tuberculosis is essentially similar to the treatment of other new patients. Standardized treatment regimen (STR) in South Africa is given to all patients in a population based on the history of drug used in the country and a representative drug-susceptibility testing.The main focus in the twentieth century was to cure TB and minimize its transmission to other persons . The WHOvis-a-vis the use of WHO category II (CAT II) regimen for retreatment cases in Mpumalanga. About 28.2% and 13.4% of the strains were resistant to mono-drug and poly-drugs (non-MDR) respectively. Thus, approximately 41.6% of the patients in this study needed to have their treatment changed, as the use of standard therapy in mono-DR-TB and poly-DR-TB has a high risk of failure and can lead to the development of MDR-TB in these patients and RIF (6.1%) was more prevalent than in other agents. The high resistance of MTB to INH and RIF—the two main drugs in TB treatment—is an alarming sign. In other studies, SM and INH have been reported as more common compared to the other first-line drugs , 22. Othpatients .More than half (58.4%) of our study patients were infected with MDR strains. This is different from what was obtained in Cuba during 1999–2000 where 0.5% of MDR-TB was obtained . The relKnowledge-base for future intervention can be provided by identifying risk factors for infection, disease, and MDR-TB , 30. In In our study, TB, including MDR-TB, was more common among males than among females. Other researchers also observed this trend. In a systematic review, MDR-TB cases were more likely to be associated with males in Western Europe while, in Eastern Europe, the male gender was not associated with MDR-TB , 33. It The spread of DR-TB in Mpumalanga could seriously hamper efforts to control TB. Limited resources and laboratory capacity are a few limitations in the proper control of TB. Increasing the laboratory capacity to deal with DR-TB as recommended by the Global Plan to Stop TB and better referral of specimens from patients living in remote areas to regional or national reference laboratories should be encouraged to ensure success of the TB-control programme and control transmission of DR strains.The study encountered some limitations. One of these was the potential misclassification of new and retreatment cases; some cases registered as new may actually have had treatment for TB in the past. Classification was based on the patient's history of prior treatment for TB and review of medical records . Due to this reason, categorizing the cases as new or retreatment was omitted. Our study, carried out at selected sites in Mpumalanga, was not population-based, which can introduce bias. The high rate of missing data (demographic profile) among patients with a negative AFB culture was because the study focused primarily on patients with a positive culture. However, our study provides important continual data on drug resistance in Mpumalanga.Although the sample size is small, the results suggest that multidrug resistance is likely to pose a significant threat to health and impede the success of TB management in Mpumalanga, if adequate control measures are not implemented. Monitoring the trend of resistance should remain a priority.The study was supported by the National Research Foundation, South Africa. The authors are thankful to the laboratory management for allowing them to work in their departmental laboratory at the University of Limpopo, Medunsa Campus. They thank the staff of the TB section, Microbiological Pathology Laboratory, NHLS, Dr George Mukhari Tertiary Laboratory Complex, Pretoria, for technical assistance. The authors dedicate this work to their colleague Dr. P.P. Sein who passed away recently.
With the conditional approach, SNPs that reach Bonferroni-adjusted significance at the first stage are tested in pairwise combinations with all SNPs in the data set. We compared the performance of those strategies by using Replicate 1 of the simulated data set of the Genetic Analysis Workshop 15 Problem 3. Most interactions detected resulted from SNP pairs within 1000 kb of each other. The remaining were false positives involving SNPs with excessively strong marginal signals. Our results highlight the need to account for locus proximity in the evaluation of interaction effects and emphasize the importance of marginal signal strength in logistic regression-based interaction modeling. We found that modeling additive genetic effects alone was sufficient to capture underlying dominance interaction effects in the data.Large genetic association studies based on hundreds of thousands of single-nucleotide polymorphisms (SNPs) are a popular option for the study of complex diseases. The evaluation of gene × gene interactions in such studies is a sensible method of capturing important genetic effects. The number of tests required to consider all pairs of SNPs, however, can lead to a computational burden, and efficient strategies to reduce the number of tests performed are desirable. In this study, we compare two-stage strategies for pairwise SNP interactions testing. Those approaches rely on the selection of SNPs based on the single-locus test results obtained at the first stage. In the Genetic association is an increasingly popular method to identify genetic determinants of common diseases. Traditional single-locus association tests evaluate the marginal effects of each marker. It is to be expected, however, that the genetic susceptibility of complex traits would result from the interplay of several factors, including gene × gene interactions. As such, analytical approaches that consider single-nucleotide polymorphism (SNP) interaction effects have the potential to provide more power, especially when susceptibility genes have small or undetectable marginal effects.n) of SNPs in a study, following n(n - 1)/2, and testing for the entire probability space for SNP × SNP interaction can become computationally unfeasible or cumbersome. Some promising two-stage approaches have been proposed , and the p-value of the interaction coefficient iaa was used in the additive-only model [Eq. (4)]. Bonferroni correction was used by considering the total number of valid interaction term tests. Valid interaction tests refer to those for which the problem of quasi-separation does not occur when using the logistic regression model. We also used an interaction model in which the additive effects are considered without covariates (results not shown), in this case, the p-values of the one interaction term (iaa) was used.SNPs were selected in the first stage for marginal significance levels up to 0.1 and 0.05 for the simultaneous design and up to the Bonferroni adjusted threshold for the conditional method. In the second stage, the p = 0.1, and 930 SNPs below the threshold of p = 0.05. The tests for all possible pairwise combinations involved (1361 × 1360)/2 = 925,480 interaction tests for the threshold of 0.1 and (930 × 929)/2 = 431,985 tests for the 0.05 threshold. For the conditional design, Bonferroni correction left 443 significant SNPs: 428 of which are located on chromosome 11, 14 SNPs on chromosome 6, and 1 SNP on chromosome 18. These results correspond to the detectable marginal SNP effects simulated in the data set ], we obtained 1361 SNPs that fell below the threshold of ], we obtp = 0.1, and 894 SNPs below the threshold of p = 0.05. Using the global Bonferroni correction, 398 SNPs were found significant, of which, 395 were on chromosome 11 and 3 SNPs were on chromosome 6.For the logistic model with adjustment for sex, smoking, and DR alleles [Eq. (2)], we considered only the additive effects. 1319 SNPs fell below the threshold of idd) (Table iaa). The same model detected 57 interactions with the iaa term, and the logistic model for additive effects-only (not shown) detected 7 more interactions, due to the reduction in the multiple testing correction. Based on this result, we proceeded to conduct the analysis with adjustment for covariates by using only the additive interaction model [Eq. (4)]. The use of either thresholds at p = 0.05 or p = 0.1 for the simultaneous design provided exactly the same interaction results for the full model without covariates [Eq. (3)], but a few more were found with the additive model with covariates [Eq. (4)] when using the threshold of p = 0.1.When using the full model with dominance and additive genetic terms [Eq. (3)] with the simultaneous design, five significant interactions were found by the dominance interaction term (d) Table , but allp-values < 10-200), which we believe to be responsible for generating false-positive interaction signals ] reveals that 129 different SNP × SNP interactions were found with either the conditional or simultaneous design. After eliminating the 52 interaction results between SNP < 1000 kb, 77 interactions remained, 75 of which include a chromosome 11 SNP around Locus F, 6 of those are proximity interactions on chromosome 11, and 69 are false positive between chromosome 11 and 1. This chromosome 11 region had excessively high marginal signals . According to the simulation schema of Problem 3, a simulated genetic interaction effect between Locus A on chromosome 16 and Locus C on chromosome 6 was modulated by the DR alleles. In Stage 1, we were able to detect the simulated Loci C on chromosome 6, D on chromosome 6, and E on chromosome 18, which passed Bonferroni correction in both logistic regression models with adjustment for covariates and without adjustment for covariates ] and a p-value of 0.0001 with the additive model without adjusting for covariates, which was insufficient to be detected after multiple testing adjustment. We mention here that we used only the first replicate of GAW15 Problem 3 simulated data due to computational constraints, but the analysis of more replicates may have provided different results.The simultaneous method optimizes the search for interaction effects between SNPs that provide some indication of marginal associations. This situation is most appropriate for disease models with additive polygenic effects. The advantage of the conditional design, on the other hand, is that it can capture interactions with loci that have no marginal effects, and as such is expected to be valid over a wider range of disease models. With our data, neither approach was able to capture the real underlying interaction between Loci A and C. Posterior testing for interaction between these loci revealed a An important advantage of the conditional design in a real data set, is that Step 1 should provide only a small number of globally significant SNPs , which are then tested in pairwise combination with the full complement of SNPs in the study. As such, the conditional design should generate fewer interaction tests than the simultaneous design. In the GAW15 simulated data set, however, over 400 SNPs remained significant after adjustment for multiple testing in Stage 1 and caused a special situation in which the conditional design exploded into many interaction tests and lead to the physical proximity interaction effects that we detected with both approaches. It is not clear why there were so many significant results on chromosome 11 and it would be interesting to validate those results by testing the other replicates. The use of logistic regression for the detection of interactions has the disadvantage of performing poorly with high dimensionality, which can lead to false positives and decreased power. In the present study for instance, the conditional approach with additive and dominance effects required the estimation of 16,279,364 parameters from 32,154,500 observations. Another potential problem with logistic regression is the phenomenon of the separation or quasi-separation of data. This occurs in the fitting process of the logistic model when the likelihood converges while at least one parameter estimate diverges to infinity. Quasi-complete separation of data, however, was only observed in 0.3% of the tests that we performed with the additive model with covariates in this study. High correlations between predictors, referred to as multicollinearity, may also decrease the power of the logistic regression. This may occur with SNPs that are in high LD. Multicollinearity due to linkage disequilibrium could, however, be addressed statistically by combining SNPs that are in high LD into haplotypes.iaa). We conclude from our results that using a model with only the additive genetic effects of two SNPs should capture most of the underlying interactions and will reduce the multiple testing otherwise imposed by the four interaction terms. A large portion of the interactions that we detected resulted from SNP pairs that were within 1000 kb of each other. Our results clearly highlight the need to include an additional step or procedure to account for locus proximity in the evaluation of interaction effects. All remaining interactions without exception were false positives that included a SNP with exceptionally high marginal signals from chromosome 11 or chromosome 6 are likely to be responsible for the false-positive signals. This finding draws attention to the importance of directing further work toward the evaluation of the impact of strong marginal SNPs in interaction modeling.The significant interactions found by the full logistic regression model with both dominance and additive effects [Eq. (3)] were all captured by the additive effect coefficient (The author(s) declare that they have no competing interests.
DT-diaphorase, a homodimeric flavoenzyme, can provide for a defence mechanism against carcinogenesis mediated by dietary or environmental quinones as well as bioactivate quinone-containing chemotherapeutic drugs. Human cell lines and strains have been identified with very low or undetectable enzymatic activity and a C to T transition at nucleotide 609 of the DT-diaphorase cDNA. This single base change is predicted to result in a proline to serine change in amino acid 187. Human cells homozygous for this base transition fail to exhibit Western blot reactivity for DT-diaphorase, suggesting that this substitution results in protein instability. To directly test whether this base change affects DT-diaphorase enzymatic activity and/or protein stability in vivo, mammalian expression vectors containing DT-diaphorase cDNA with or without the nucleotide 609 base transition were transiently transfected in COS-1 cells. Co-transfection with a human growth hormone expression vector allowed normalization for transfection efficiency. COS-1 transfectants expressing the C to T base change displayed at least a tenfold reduction in DT-diaphorase activity (P < 0.001) and a two- to threefold reduction in protein levels compared with wild-type transfectants. These results are the first to detect the presence of DT-diaphorase protein coded for by the 609 base transition in mammalian cells and confirm its predicted reduced enzymatic activity.
Idiopathic CD4+ lymphocytopenia, described in 1992 by the Centers for Disease Control, is characterized by persistent CD4+ lymphocytopenia (less than 300 cells per micro-liter) in nonimmunosuppressed, HIV negative individuals, who present with atypical infections. This rare though likely undiagnosed entity is associated with chronic disseminated forms of either fungal or bacterial infections in otherwise healthy adults. We report a case of a 59-year-old male with ring-enhancing brain lesions, bilateral adrenal masses, lung and vocal cord nodules, where the diagnosis of exclusion was metastatic malignancy. Fine needle aspiration (FNA) of the adrenal mass and a subsequent vocal cord biopsy confirmed chronic widely disseminated blastomycosis. Flow cytometric evaluation of peripheral blood documented persistent selective CD4+ lymphocytopenia with T8 (suppressor) T-Lymphocyte count within normal range. We believe that idiopathic CD4+ lymphocytopenia is an important etiologic factor to be considered for patients who present with mass lesions and are diagnosed by FNA with atypical fungal infections. We relate the diagnostic criteria for idiopathic CD4+ lymphocytopenia and the importance of providing on-site triage for FNA samples for fungal studies and correlation for flow cytometry. In 1992, the CDC identified a group of patients who were human immunodeficiency virus (HIV) negative and nonimmunosuppressed, however, presented with selective and sustained CD4+ lymphocytopenia and atypical fungal or bacterial infections. They defined the process as Idiopathic CD4+ Lymphocytopenia (ICL) and set specific criteria for diagnosis. The diagnosis rested upon identifying atypical infections, in otherwise healthy individuals, who had persistent CD4+ lymphocytopenia (less than 300 cells per micro-liter) and were non-immunosuppressed and were HIV negative. This entity has remained relatively rare although most likely underdiagnosed.We report a case of a 59 -year-old caucasian male with no significant past medical history who presented to the emergency department with a six-week history of weakness, loss of appetite and “hoarseness” of voice. His employment history showed that he worked in air conditioning repair and was often in basements and attics. Laboratory values upon admission were noncontributory with white blood cell counts and hemoglobin level, in normal ranges. Chest X-ray in the emergency department showed an early nonspecific nodular-interstitial infiltrate. Computerized tomography (CT) obtained upon admission revealed a left adrenal mass and multiple ring enhancing lesions in brain. Based on these findings the differential diagnostic impression was that of metastatic carcinoma. An adrenal gland FNA was performed. On-site evaluation of modified Wright-Giemsa stained smears for specimen adequacy revealed necrotic granular material with a speckled vacuolar appearance suggestive of fungal yeast. Several passes were obtained, however, it was not possible to confirm malignancy [Figure 1The cell block preparation from the FNA procedure revealed rare broad based budding yeast Figure and b. Bdermatitidis. The final diagnosis was that of Idiopathic CD4+ Lymphocytopenia with disseminated Blastomycosis involving adrenal gland, vocal cord and probable lung and brain, in an HIV negative non-immunosuppressed patient.The possibility of ICL was entertained and Flow cytometry of peripheral blood, performed at our request, documented selective CD4+ Lymphocytopenia (155 cell/microliter) with T8 (suppressor) population in normal range. This supported the diagnosis of ICL with associated atypical fungal infection. Fungal culture confirmed Blastomyces Parenthetically, the T4 lymphocytopenia has remained decreased (<300) for more than two years. Treatment included Intravenous amphotericin B followed by Amphoteracin-B Lipid complex. Patient was placed on oral itraconazole, 200 mg per day for 18 months as per IDSA guidelines for disseminated blastomycosis, with monitoring for blood levels once per month. An additional lesion had been identified in the right hip with FNA documented Blastomycosis. The lung, brain and vocal cord lesions have remained essentially unchanged.Mycobacterium avium-intracellulare, cryptococcal meningitis.[Idiopathic CD4+ Lymphocytopenia is considered rare and is rarely considered within the differential diagnosis for Fine Needle Aspirations of otherwise healthy individuals with atypical fungal infections who present with mass lesions. The CDC has defined this entity as sustained CD4+ Lymphocytopenia (less than 300 CD4+ lymphocytes per micro liter) with persistent T4 lymphocytopenia following treatment (or resolution of infection) without immunosuppression in HIV negative individuals. ICL is now considered to an underdiagnosed etiology for atypical fungal infections. It is moThe patient described in this paper presented with mass lesions diagnosed as a chronic disseminated form of Blastomycosis having involved adrenal, brain, vocal cord, lung and bone. Incidentally, pulmonary infection in patients with suppressed or low T4 counts can result in adult respiratory distress syndrome, septic shock and death with a mortality rate (in immunocompromised patients) greater than 30%.6It is important to consider, in passing, that atypical fungal infections in patients with ICL may show misleading information such as: 1) malignancy as the diagnosis of exclusion atypical fungal infections presenting with multi organ “mass” lesions; 2) 80% cross reactivity with both Histoplasma and Cryptococcus antigens in screening tests; and 3) up to 60% false negative serology in patients with local atypical fungal infection .Other organs commonly involved by blastomycosis include the skin and bone, urinary tract.–12 Invol1315Blastomyces dermititidis.[Blastomyces dermititidis. However, in the absence of CD4 lymphocytes, memory CD8 lymphocytes via the Class- 1 major histocompatiblity complex can recognize the B. dermititidis antigen and thereby initiate may immune response. This suggests that B. dermititidis vaccines may in fact be beneficial to susceptible patients whom lack CD4 T lymphocytes.[In the immunocompromised or immunosuppressed patient, fungal infections can be severe and prompt diagnosis with appropriate treatment is essential. The treaititidis. It has bphocytes.Nevertheless, prophylaxis remains the cornerstone of care for patients diagnosed with ICL. New appr21In summary, this paper highlights the importance of considering ICL as a diagnostic entity and the role for on-site specimen adequacy evaluation allowing timely triage of samples for special studies .No competing interest to declare by any of the authors.http://www.icmje.org/#author. Each author has participated sufficiently in the work and take public responsibility for appropriate portions of the content of this article.Each author acknowledges that this final version was read and approved. All authors of this article declare that we qualify for authorship as defined by ICMJE As this is case report without identifiers, our institution does not require approval from Institutional Review Board (IRB) To ensure integrity and highest quality of CytoJournal publications, the review process of this manuscript was conducted under a double blind model(authors are blinded for reviewers and reviewers are blinded for authors)through automatic online system.
Although bilingualism is prevalent throughout the world, little is known about the extent to which it influences children's conversational understanding. Our investigation involved children aged 3–6 years exposed to one or more of four major languages: English, German, Italian, and Japanese. In two experiments, we examined the children's ability to identify responses to questions as violations of conversational maxims .In Experiment 1, with increasing age, children showed greater sensitivity to maxim violations. Children in Italy who were bilingual in German and Italian (with German as the dominant language L1) significantly outperformed Italian monolinguals. In Experiment 2, children in England who were bilingual in English and Japanese (with English as L1) significantly outperformed Japanese monolinguals in Japan with vocabulary age partialled out.As the monolingual and bilingual groups had a similar family SES background (Experiment 1) and similar family cultural identity (Experiment 2), these results point to a specific role for early bilingualism in accentuating children's developing ability to appreciate effective communicative responses. Bilingualism is present to some extent in every society and at least half of the world's population uses more than one language in everyday life. From this perspective, it is monolingualism rather than bilingualism that is uncommon Bilingualism has been found to have a positive effect on children's ability to judge grammar and to substitute symbols Quantity), “tell the truth and avoid statements for which there is insufficient evidence ”, “be relevant (Maxim of Relation)”, and “avoid ambiguity, confusion and obscurity (Maxims of Manner).” To characterize the nature of effective communication more fully, Grice also discussed the need to invoke other maxims such as “be polite” (Maxim of Politeness) that have traditionally been recognized as key to conversational processes In his widely influential analysis, the philosopher Paul Grice Even in the earliest years, children demonstrate sensitivity to conversational maxims Contrary to the view that an early bilingual advantage is based on parental interpersonal sensitivity rather than enhanced access to language, it has long been observed that parents' motivation in sending their children to second language schools is to secure better employment and social conditions for their children rather than by a perceived need to engage in dialogues with speakers of another language To examine these issues, the present research involved children aged 3 to 6 years exposed to one or more of four major languages: English, German, Italian, and Japanese. All children participated with informed parental consent. In Experiment 1, we compared performance on an Italian version of the CVT by children bilingual in German and Italian with Italian monolingual children. In Experiment 2, we sought to compare performance on the CVT in two other language groups: children bilingual in English and Japanese (with English as L1 and Japanese as L2) with Japanese monolingual children. The bilingual group received the CVT in both English and Japanese permitting a cross-language comparison. In our comparison of these two groups, children received a measure of verbal mental age. We also sought to provide innovative evidence on possible cultural differences between the language groups by questioning mothers on their Japanese identity. Moreover, as food and eating contribute importantly to communicative expectations and socialization practices For both experiments, we predicted that, with increasing age, children would significantly improve in the ability to detect maxim violations and that bilingual children would outperform their monolingual counterparts.This research was approved by the ethical review board of the EU Sixth Framework and the relevant ethical review committees of the University of Trieste, the University of Trento, and Kyoto University. All children participated with written informed parental consent.2≤0.029.These were 36 German-Italian bilingual children and 41 Italian monolingual children attending Italian preschools in Bolzano in the Trentino-Alto Adige region of Italy near the Austrian border where standard German is spoken, albeit with a distinctive regional accent. As in previous research N = 77). Small changes were made in the content of the CVT items to reflect cultural familiarity. For example, in one of the items on Quantity in the Italian version, the puppet response “milk with biscuits” was substituted for “cornflakes and then a boiled egg and toast” in the English version.The children in the two groups were given the CVT in Italian by a native Italian speaker. Alpha reliability was .64 and 67 months (SD = 8.6) respectively and were comparable in age to the older group of children tested in Experiment 1 who demonstrated significant bilingualism effects on the CVT. The bilingual children were from Derby, Leeds, Manchester, and Sheffield in England. At least one of their parents was Japanese and a mixture of English and Japanese was used in their home language environment. Although some children had a predominantly Japanese home language environment, all children were exposed to both languages from birth or before the age of 2 years. The children attended English language schools and also a Saturday school and playgroups where Japanese was used and where they were tested in a quiet room. The monolingual children were from Kyoto, Japan, and attended Japanese language schools. Some of the children were tested in a quiet room in their school; others were tested in a university child development laboratory. Both parents of the monolinguals used Japanese at home.A bilingual experimenter tested the bilingual children in two sessions separated by a 1–2 week interval. Half the children received testing in English first, including the CVT in English, and in Japanese second, including the CVT in Japanese. The order was reversed for the other children. A Japanese native speaker tested the monolingual children in Japanese. Small changes were made in the content of the CVT items for the two versions to reflect cultural familiarity. For example, in one of the items on Relation in the Japanese version given to the monolinguals, the puppet response “I know how to play baseball” was substituted for “I know how to play football” in the English version. Alpha reliability was 0.54 for the English CVT (N = 33) and 0.75 for the Japanese CVT (N = 92)2 = .214, with 28 of the 33 children having a higher English than Japanese VMA. In addition, in keeping with the bilingual children are often delayed in their vocabulary comprehension in individual languages though not necessarily in overall vocabulary size 2 = .299. Moreover, their English VMA scores also tended to be lower than the VMA scores of the monolinguals in Japanese, F = 3.07, p<0.09, η2 = .033. There were no significant order effects on the bilinguals' VMA scores in either language.Both the bilingual and monolingual children were given the Day-Night task in Japanese. As a measure of vocabulary mental age (VMA), both groups were also given the Japanese Picture Vocabulary Test As a means toward determining whether the children in both countries could be considered to be similar in family cultural identity and food preferences, a brief questionnaire was administered in Japanese to a sub-sample of mothers: 17 mothers of the monolinguals in Japan and 19 mothers of the bilinguals in England Following a procedure carried out previously with a sample of Australian adults 2 = 0.361, and for language group, F = 50.85, p<0.0001, η2 = 0.411. As predicted, the bilingual children outperformed their monolingual counterparts with a mean score of 17.58 (SD = 1.83) out of 20 compared to 14.68 (SD = 2.36) for the monolinguals. The maxim main effect was also significant, F = 44.75, p<0.0001, η2 = 0.380. In addition, there was a significant age group X language group X maxim interaction effect, F = 10.49, p<0.0001, η2 = 0.126 (see A 2 (age groups) X 2 (language groups) X 4 (maxims) analysis of variance on CVT scores showed significant main effects for age group, F = 41.29, p<0.0001, η.126 see The youn2 = 0.350, and a main effect for language group that fell short of significance, F = 3.41, p<0.069, η2 = 0.045. The mean score of the bilinguals out of 16 was 14.03 (SD = 1.25) compared to 14.46 (SD = 1.55) for the monolinguals. The age group X language group interaction was nonsignificant, F<1.As found previously Years of parental education, seen to be an optimal measure of SES in Italy As predicted, in children's developing sensitivity to violations of conversational maxims, bilinguals generally outperformed monolingual children. In both the younger and older age groups, the bilingual advantage was significant on three out of the four maxim components. In the younger children, there was no significant bilingual difference only on Quantity and, in the older children, only on Politeness. In the former case, the younger children's scores on Quantity, whether monolingual or bilingual, lagged significantly behind those on the other three maxims while, in the latter case, the older bilinguals and monolinguals performed equally well on Politeness.2 = .051. Despite their lower VMA scores, the CVT performance of the children bilingual in English and Japanese with English as L1 was significantly higher than those of the Japanese monolinguals The maxims main effect was also significant, F = 14.15, p<0.0001, η2 = 0.136) Children scored significantly higher on the Relation Maxim than on Quantity and Politeness, t's (91)≥2.70, p's <.008, and significantly higher on Quantity and Politeness than on Quality, t's (91)≥3.75, p's <.0001. There were no significant interaction effects. A 2 (language groups) X 4 (maxims) analysis of variance on the Japanese CVT version yielded no significant main or interaction effects.Preliminary analyses indicated no significant order of presentation effects on the bilinguals' CVT scores in either English or Japanese. As in Experiment 1, a 2 (language group) X 4 (maxims) analysis of variance on CVT scores in English for the bilingual group and Japanese for the monolingual group yielded a significant main effect for language group, F = 4.80, p<0.032, ηadj = 16.82, SD = 2.14) outperformed monolinguals , F = 9.15, p = 0.003, η2 = 0.093. Similarly, a 2 (language groups) X 4 (maxims) analysis of covariance using Japanese VMA as a covariate for both groups also revealed only a significant language group main effect, with bilinguals outperforming monolinguals , F = 9.15, p = 0.003, η2 = 0.093. F = 6.87, p<0.01; η2 = 0.072.Further analyses were carried out to compare CVT performance in the language groups with VMA covaried. The pattern of performance on each maxim is shown in The correlation between responses on the English and Japanese CVT versions for the bilingual children was 0.59, p<.001. There were no significant differences between the bilinguals' scores on the Japanese and English versions of the CVT and no significant order of presentation effects. Correlations between VMA and CVT scores in English for the bilingual children and in Japanese for the bilingual and monolingual children were 0.41, 0.51, and 0.37 respectively . The extent to which children displayed “balanced” or “imbalanced” bilingualism as shown by their VMA in English and Japanese was not associated with their CVT performance. Differences between the bilingual children's scores on the two VMA measures were not significantly correlated with CVT scores in either English or in Japanese .As in Experiment 1, there were no significant differences between the language groups in children's responses on the Day-Night measure, F<1. The mean score of the bilinguals out of 16 was 13.67 (SD = 4.04) compared to 13.15 (SD = 3.90) for the monolinguals.In their questionnaire responses, mothers in both groups overwhelmingly provided responses indicative of a strong Japanese cultural identity. Of the 19 mothers of bilinguals, 14 agreed with the statement, “I think that being Japanese is one of the most important things about me” with 5 disagreeing; 15 mothers agreed with the statement “I definitely want to have Japan as my permanent main home” with 3 unsure and only 2 disagreeing. Of the 17 mothers of monolinguals, 11 agreed with the statement, “I think that being Japanese is one of the most important things about me” with 2 disagreeing and 4 unsure; 13 mothers agreed with the statement “I definitely want to have Japan as my permanent main home” again with 4 unsure. The mothers' ratings for the 14 foods on the questionnaire are shown in 2 = 0.017.To examine whether the CVT scores of the children whose mothers responded on the questionnaire differed from those who did not respond, 2 (respondent status) X 2 (language group) X 4 (maxims) ANOVAs were performed on the Japanese CVT scores for both the bilingual and monolingual groups and for the English scores in the bilingual group and the Japanese scores in the monolingual group. In either case, there were no significant main or simple interaction effects differences involving respondent status, F's<1. Similar results emerged from 2 (respondent status) X 2 (language groups) ANOVAs carried out on the Japanese PPVT scores for both the bilingual and monolingual groups and for the English scores in the bilingual group and the Japanese scores in the monolingual group and, F's = 1.524, p's>0.20, η2 = 0.119. However, as we did not have equivalent VMA scores for the two bilingual and two monolingual groups, differences in performance could be attributed to verbal ability. To address this issue systematically, we compared the older 20 Slovenian-Italian bilinguals and 21 Italian monolingual children who were comparable in age with those of the 33 bilingual English-Japanese and 59 monolingual Japanese children in Experiment 2 of the present investigation. The CVT scores of the four groups were analyzed in a 2 X 2 X 4 (maxims) ANCOVA with VMA scores in the testing language as a covariate. There was a significant language group main effect, F = 33.48, p<.0001, η2 = 0.209, indicating that the bilingual children outperformed the monolinguals. Although the cultural group main effect was not significant, F <1, there was also a significant language group X cultural group interaction effect, F = 6.68, p = .011, η2 = 0.050. The Slovenian-Italian bilingual children outperformed their English-Japanese counterparts , F = 7.94, p = .007, η2 = .135. By contrast, the CVT scores of the monolingual Italians and Japanese did not differ significantly, F = 0.043, p = 0.836, η2 = 0.001. In addition, the cultural group X maxim interaction effect was significant, F = 13.36, p<.0001, η2 = 0.095. The Japanese-speaking children in Japan and England scored significantly higher on Quantity, Relation, and Politeness than Quality, t's (91)≥22.69, p's <.0001, and significantly higher on Relation than either Quantity or Politeness, t's (91)≥16.15, p<.0001. By contrast, as in Experiment 1, Italian-speaking children in Italy and Slovenia scored significantly higher on Quality, Relation, and Politeness than Quantity, t's (39)≥24.45, p's<.0001, and they also scored significantly higher on Relation than on Quality, t (39) = 5.83, p<.0001. The three-way interaction effect was not significant, F = 1.273, p>0.28, η2 = 0.010.An issue that arises from our results is whether the bilinguals' superiority on the CVT is similar across language groups. Overall, the CVT scores of the older group of children in Experiment 1 were significantly higher than those of similar-aged children in Experiment 2 , F = 17.08, p<.0001, ηThe results of our investigation provide support for the position, consistent with evidence that exposure to more than one language facilitates children's metalinguistic awareness, that bilingualism confers an advantage on children's conversational understanding through accentuating their ability to appreciate effective communicative responses. Whether bilingual in German and Italian or English and Japanese, the bilingual advantage in recognizing maxim violations was similar to that reported previously in Slovenian-Italian bilinguals.obento lunches for their children that is important to Japanese socialization practices. Therefore the pattern of a strong Japanese cultural affinity shown by both groups of mothers would appear to rule out family cultural background as an explanation for the CVT advantage shown by the English-Japanese bilinguals in Experiment 2.In the light of the recent debate on the role of non-linguistic influences in comparisons of monolingual and bilingual children's cognitive task performance Still another possibility is that the bilingual children are exposed to more parental talk about maxims whereas monolingual children learn about maxims from other children. Indeed, bilingual children have been observed to switch languages specifically to gain attention and information from their mothers The practice gained by bilingual children at rapidly processing maxim violations and extracting meaning from conversation may free up resources that enable them to close the frequent gap with monolinguals in vocabulary knowledge in individual languages. This process is liable to involve enhanced attention and executive control. Our present investigation was limited in using only one measure of attention and executive control on which no significant differences were found between monolingual and bilingual children. Results in this area have been inconsistent Whatever the effects of executive control, the pattern of bilingual advantage in children's conversational understanding is consistent with the position that exposure to more than one language can facilitate performance on key measures of cognitive development such as in the expression of “theory of mind” reasoning in recognizing how holding a false belief can lead to searching for an object in an incorrect location Despite the overall pattern of a bilingual advantage, we do not wish to discount cultural variations in the interpretation of specific maxim violations. For example, in our research, children with a Japanese cultural background showed less sensitivity to violations of the Maxim of Quality compared to violations of other maxims. Their responses on Quality are consistent with those of Japanese children on theory of mind false belief tasks. In an extensive study carried out by Naito and Kayama As Kinzler, Dupoux, and Spelke
While retroperitoneal abscess is a known complication, hepatic portal venous gas and rectal perforation have not been reported as a concomitant sequelae of acute appendicitis. Here we report a case of a patient with a perforated appendicitis that was associated with these triad of complications.In addition to report our case, we carefully reviewed the literature in order to detect similar cases and the causes of such rare conditions.Only 26 cases (including our patient) of acute appendicitis complicated by retroperitoneal abscesses have been published in the English literature between 1955 and 2008. There was one case having hepatic portal venous gas, and one further case with a rectal perforation associated with acute appendicitis. All patients with retroperitoneal abscess presented with non specific clinic symptoms that not revealed any suspicion for such a complicated disease. Hence, delayed diagnosis and treatment are not uncommon.So far, no patient has been described with such a triad of rare complications related to acute appendicitis. We want to emphasize the insidious onset of retroperitoneal abscess formation, and the need of prompt recognition and adequate treatment to avoid deleterious outcome. Acute appendicitis is a very common disease with low morbidity and mortality rates in most countries. While uncomplicated appendicitis can easily be treated, complicated appendicitis with perforation and abscess formation remains a challenging treatment. In particular, large abscess and advanced peritonitis often require repeated surgical interventions combined with percutaneous drainage performed by interventional radiology, as well as intensive care and antibiotic treatment. Such treatment is associated with markedly increased complications, e.g. sepsis, prolonged ileus, and adhesion formation . The devA 43-year old man was admitted to the Emergency Department with progressive abdominal pain, nausea, reduction in defecatory frequency and change in stool appearance as hard separate lumps that started almost three weeks before, and in addition, new onset of anal bleeding. There were no preexisting co-morbidities. The patient had tachycardia (up to 140 bpm), arterial hypertension (170/70 mmHg) and fever (38°C). Clinical examination revealed an abdominal distension with a palpable mass in the lower abdomen, as well as signs of peritoneal irritation. The rectal examination was very painful, and an ulcerative lesion was perceived on the anterior rectal wall. Anal bleeding could be confirmed.The laboratory findings revealed increased C-reactive protein (CRP) levels up to 100 mg/l, leucocytes 8.8 G/l, and serum lactate levels of 4.5 mmol/l.The abdominal CT scan with only IV contrast showed a perforation of the anterior rectal wall, 10 cm proximally from the anorectal border with multiple, partially confluent large abscesses located extra- and retroperitoneally Figure . FinallyThe patient underwent emergency laparotomy. Intraoperatively, a necrotizing appendicitis was found with multiple abscess formation in the retroperitoneal space. The abscess extended from the perirectal area in the pelvis up to the left kidney. The sigmoid colon, the upper and mid rectum were surrounded by the abscess. Perforation of the anterior rectal could be confirmed. Sigmoid and the upper two third of the rectum were resected, and a Hartmann's situation created. The appendix was excised and all abscess were drained by widely opening the retroperitoneal space.Due to the severe sepsis, the patient stayed for three days in the ICU, and another 18 days on the normal ward. Initial blood cultures were positive to Bacterioides fragilis and turned sterile after a week. Cultures of the abscesses were positive to Bacterioides fragilis, Escherichia coli and Streptococcus anginosus. IV antibiotic treatment (Piperacillin-Tazobactam 4.5 g three times per day) was performed for 15 days and a further per os antibiotic treatment (Levofloxacin 500 mg twice per day) was introduced for 7 days. The patient fully recovered, and was finally discharged after 21 days. Restoration of the bowel continuity was performed after 3 months. During follow-up of one year, the long-term course was uneventful.Histopathology showed a perforated appendicitis with severe peritonitis, as well as large necrosis formation of sigmoid mesenteric adipose tissue and a necrotic ulcer measuring 1 cm square on the anterior wall of the rectum. Since no diverticular disease could be detected, it was strongly assumed that necrotizing appendicitis being the trigger of this massive inflammatory process that also facilitated rectal wall necrosis and stercoral perforation, respectively.Large retroperitoneal abscess represents a potentially life-threatening complication of hollow viscus organ perforation, e.g. appendicitis ,5, diverHsieh et al. recently reported two cases and summarized the literature, whereby they found only additional 22 cases . The maiThe presence of air bubbles in the extrahepatic and/or intrahepatic portal venous system is primarily a radiological finding that is detected by performing an abdominal CT scan for various reasons. Despite portal venous gas is generally a late feature of advanced intestinal necrosis with an increased mortality, there are various other clinical conditions that may also cause portal venous gas formation, i.e. inflammatory bowel disease, biliary tract infections, cardiac and liver transplantation, acute pancreatitis, and blunt abdominal trauma . It is aPortal venous gas formation due to perforated appendicitis has been previously reported in two cases ,12. In oRectal perforation and necrosis represents an extremely rare event after retroperitoneal abscess formation. So far, only one case of rectal necrosis and simultaneous pelvic abscess as a consequence of perforated appendicitis was published in 1968 by Gostev . In our In conclusion, this patient presented with three very rare complications of acute appendicitis that all occurred at the same time. Despite the delayed diagnosis, the final outcome was good due to the rapid surgical intervention that aimed to control all infectious areas in order to assure patient's survival.The authors declare that they have no competing interests.MD and AP drafted the manuscript, ND et MS critically revised the manuscript. All authors read and approved the final manuscript.
The growth of new synapses shapes the initial formation and subsequent rearrangement of neural circuitry. Genetic studies have demonstrated that the ubiquitin ligase Highwire restrains synaptic terminal growth by down-regulating the MAP kinase kinase kinase Wallenda/dual leucine zipper kinase (DLK). To investigate the mechanism of Highwire action, we have identified DFsn as a binding partner of Highwire and characterized the roles of DFsn in synapse development, synaptic transmission, and the regulation of Wallenda/DLK kinase abundance.Drosophila neuromuscular junction. Loss-of-function mutants for DFsn have a phenotype that is very similar to highwire mutants – there is a dramatic overgrowth of synaptic termini, with a large increase in the number of synaptic boutons and branches. In addition, synaptic transmission is impaired in DFsn mutants. Genetic interactions between DFsn and highwire mutants indicate that DFsn and Highwire collaborate to restrain synaptic terminal growth. Finally, DFsn regulates the levels of the Wallenda/DLK kinase, and wallenda is necessary for DFsn-dependent synaptic terminal overgrowth.We identified DFsn as an F-box protein that binds to the RING-domain ubiquitin ligase Highwire and that can localize to the The F-box protein DFsn binds the ubiquitin ligase Highwire and is required to down-regulate the levels of the Wallenda/DLK kinase and restrain synaptic terminal growth. We propose that DFsn and Highwire participate in an evolutionarily conserved ubiquitin ligase complex whose substrates regulate the structure and function of synapses. The connectivity and functionality of a neural circuit depends on the structure of its constituent neurons' presynaptic fields. Different neurons make very different synaptic trees – a serotonergic neuron will synapse with thousands of neurons throughout the brain, while climbing fibers from the medulla may synapse with only a single Purkinje cell in the cerebellum. Individual neurons with the same identity can also have different sized synaptic arbors and this has functional consequences: during synaptic competition at the vertebrate neuromuscular junction (NMJ), motoneurons with larger arbors are at a disadvantage when competing against those with smaller arbors . MoleculDrosophila, genetic studies have identified a number of signaling pathways that regulate the morphology of the presynaptic arbor made by motoneurons onto muscles . One subranches . This fuve zones ,5, mutatjections , while mrphology .C. elegans and zebrafish, the isolated RING domain can promote ubiquitination in vitro . To assess rescue, we again quantified bouton number, synaptic branching, and synaptic span at the MN4-Ib NMJ onto muscle 4. All of these aspects of synaptic terminal overgrowth are rescued by the presynaptic expression of DFsn . Furthermore, synaptic terminal overgrowth of the DFsn mutant is also fully rescued when GFP-DFsn is expressed selectively in motoneurons mutant, which we have renamed DFsnf06595. These data demonstrate that DFsn is required in the presynaptic motoneuron to restrain synaptic terminal growth at the Drosophila NMJ.Highwire regulates synaptic terminal growth presynaptically. If DFsn functions with Highwire to restrain this growth, then it should also be required in the presynaptic motoneuron. We generated transgenic flies capable of expressing n Figure . The preDFsn is also required to regulate synaptic release. We analyzed synaptic transmission in DFsn mutants by performing intracellular recordings from muscle 6 (segments A3 and A4) of third instar larvae and measured both spontaneous and evoked neurotransmitter release in the excitatory junctional potential (EJP) compared with wild type in quantal content, the number of vesicles released by a nerve following an action potential, in the mutant alleles of DFsn should enhance the phenotype of a hypomorphic highwire mutant. We generated double mutants between the hypomorphic DFsnf06595 mutant and the weak highwire allele hiwND51, which carries an amino acid change at residue 2054 (G2054R) and DFsn motoneuron rescue (DFsn-MN Res) third instar larvae. (b) Quantification of bouton number of muscle 4 synapses in WT, DFsn and DFsn motoneuron rescue (DFsn-MN Res) third instar larvae . The morphological defects in the DFsn mutant are rescued by the expression of GFP-DFsn in motoneurons .Expression of a Click here for file
In this era of complete genomes, our knowledge of neuroanatomical circuitry remains surprisingly sparse. Such knowledge is critical, however, for both basic and clinical research into brain function. Here we advocate for a concerted effort to fill this gap, through systematic, experimental mapping of neural circuits at a mesoscopic scale of resolution suitable for comprehensive, brainwide coverage, using injections of tracers or viral vectors. We detail the scientific and medical rationale and briefly review existing knowledge and experimental techniques. We define a set of desiderata, including brainwide coverage; validated and extensible experimental techniques suitable for standardization and automation; centralized, open-access data repository; compatibility with existing resources; and tractability with current informatics technology. We discuss a hypothetical but tractable plan for mouse, additional efforts for the macaque, and technique development for human. We estimate that the mouse connectivity project could be completed within five years with a comparatively modest budget. The defining architectural feature of the nervous system is that it forms a circuit. Unlike other tissues or organs, it is the patterns of axonal connections between neurons that determine the functioning of the brain. Nevertheless, more than a decade after Francis Crick and Ted Jones bemoaned the “Backwardness of Human Neuroanatomy Here we argue the case for a coordinated effort across the neuroscience community to comprehensively determine neuroanatomical connectivity at a brainwide level in model organisms including the mouse, macaque, and eventually human. We discuss the important issues of resolution and rationale and survey the state of current knowledge and available techniques, then offer a basic outline for an experimental program and associated informatics requirements. The Allen Brain Atlas (ABA) for gene expression in the mouse Macroscopic brain organization, at the level of entire structural–functional systems and major fiber bundles, is somewhat understood but provides an insufficient description of the overall architecture. However, for complex vertebrate brains it is not currently technologically feasible to determine brainwide connectivity at the level of individual synapses. Further, while a statistical description is possible at this microscopic resolution, correspondence cannot be expected between individual brains described at the level of all synapses of all neurons. Significantly more invariance can be expected at a mesoscopic level where co-localized groups of neurons, perhaps of the same type or sharing common organizational features, are considered together as a unit, and projection patterns from these neuronal groups are studied over macroscopic distances. This level of connectivity is well-suited to aid our understanding of specific mental functions. A comprehensive mesoscopic wiring diagram, if available, would supply a meaningful skeleton that can be further augmented by the statistical characterization of microcircuitry at a finer scale .It is clear that there exists some degree of nonrandom organization of the interconnections in the nervous system at multiple scales, including individual neurons, groups of neurons, architectonic regions and subcortical nuclei, and functional systems. The existence and nature of invariant connectivity patterns across individual brains is itself a topic of research that can be addressed within a large-scale connectivity project. There is adequate evidence for mesoscopic architectural invariance in the form of cyto-, chemo-, and myelo-architectonically defined brain regions and from spatial gene expression patterns to proceed. In addition, however, a brainwide project executed with calculated redundancy will make it possible to empirically define the extent of such invariance. Further, if input and output connections are methodically determined along an appropriate anatomical grid, it should be possible to delineate the mesoscopic projection patterns in brain space without imposing a system of discrete anatomical parcels defined a priori.connectivity phenotype—is a critical missing link between genotype and behavioral phenotype; the simultaneous availability of comprehensive genomic and neuroanatomical information will greatly narrow this gap. The scientific rationale can be further sharpened by examining the role of circuitry in experimental and theoretical approaches to the nervous system.The availability of mesoscopic circuit diagrams for model nervous systems would impact neuroscience research at nearly all levels. Because connectivity underlies nervous system function, any lack of such knowledge impedes the achievement of comprehensive understanding, even if complete information was present about cytoarchitecture, neuronal cell types, gene expression profiles, or other structural considerations. Furthermore, the connectional architecture of the nervous system—the Experimental design in electrophysiological studies can be improved by explicit consideration of connectivity. For example, without any reference to underlying connectivity it is difficult to interpret measured physiological activity or the effects of microstimulation. Studies that consider the internal dynamics of the brain, including studies of selective attention, often make arguments about top-down or bottom-up processes, which are ultimately contingent on neuroanatomical information that is frequently deficient. Likewise, the lack of empirical constraints on neural network models remains an Achilles heel of that subject area, and such theoretical research would benefit greatly from added knowledge of connectional brain architecture.comparative and evolutionary studies have also suffered from a phrenological emphasis on changes in morphological characteristics and relative sizes of parts of the nervous system, with less consideration of connectivity. Knowledge of the mesoscopic circuit diagrams for multiple model organisms will greatly advance comparative and evolutionary neuroanatomy, as has been the case for comparative and evolutionary genomics. This is highlighted by recent advances in understanding the relation between avian and mammalian brains. Purely structural considerations, such as the presence of a layered cortex in mammals, had led to incorrect homological identification of avian telencephalic structures with mammalian basal ganglia. Connectivity considerations have led to a profound revision of this view, leading to a new nomenclature for avian brain compartments Many http://www.who.int/healthinfo/global_burden_disease/en/index.html). The dominant paradigms for understanding such disorders have involved focal lesions, widespread neurodegeneration, vascular compromise, and neurotransmitter dysregulation, with circuit considerations playing a comparatively minor role. It has long been known, however, that disruptions in neural connectivity can underlie human brain disease Neurological and neuropsychiatric disorders are responsible for approximately 30% of the total burden of illness in the United States, according to the World Health Organization's estimated Disability Adjusted Life Years (DALYs) for 2002 addiction is beginning to be recognized. These illnesses are considered disorders of the affective circuitry underlying emotion and motivated behaviors, which spans the brainstem, hypothalamus, frontal and cingulate cortices, and basal cortical nuclei We propose a concerted experimental effort to comprehensively determine brainwide mesoscale neuronal connectivity in model organisms. Our proposal is to employ existing neuroanatomical methods, including tracer injections and viral gene transfer, which have been sufficiently well-established and are appropriately scalable for deployment at this level. The first and primary objective is to apply these methods in a standardized, high-throughput experimental program to fully map the mesoscale wiring diagram for the mouse brain and, following the model of successful genome projects, to rapidly make the results and digitized primary data publicly accessible. The second objective is to collate and, where possible, digitize existing experimental data from the macaque, and to pursue targeted experiments using standardized protocols to plug key gaps in our knowledge of primate brain connectivity. Additionally, we argue for similar efforts in other model organisms and for the pursuit of experimental methods that can be used in postmortem human brain tissue.The projects may be carried out in a distributed manner by coordinating efforts at multiple experimental laboratories making use of uniform experimental protocols, or in a more centralized way by creating one or a few dedicated sites. Here we outline the properties of a large-scale connectivity mapping project that are seen as essential, and some that are desirable but not required. The required attributes are as follows.Brainwide coverage at a mesoscopic resolution. The experimental technique must be applicable in all brain systems, cortical and subcortical. It should not be applicable only to specific cell types; if the technique is used to target specific cells, it must be capable of targeting any cell group.Validated and extensible experimental techniques. The experimental methods must be well-characterized and, to the extent possible, validated. The false positive rate should be especially low. The techniques must be amenable to high-throughput application; the individual steps for sample preparation, injection, histology, detection, and data analysis should be stereotyped and of limited complexity.Centralized, open-access data repository. The data collected from such an effort must be made freely available to all researchers from a centralized data repository. This includes raw image data, processed summary data, and metadata.Compatibility with existing neuroanatomical resources. The results of this project must be interpretable with respect to existing datasets. For example, creating ties to the ABA Tractability with current informatics technology. The data collected and maintained in the repository must be suitable to be analyzed and stored using existing informatics techniques and available technology, allowing for predictable growth in both methods and hardware.Additional characteristics that would enhance the project's impact include the following.Availability of detailed anatomical information. The ability to characterize various additional properties of the observed projection patterns would be beneficial. This might include classification of the neuronal cell types and neurotransmitters involved, laminar origins and terminations of projections in stratified structures, receptor information, cell density estimates in the origin and termination areas, morphological properties of the axons and/or dendritic arbors, and statistical characterization of topography and convergence or divergence patterns of projections.Reconstruction of projection trajectories. In addition to the origins and terminations of projections, it would be valuable to determine their spatial trajectories. Such data would be particularly useful, for example, in understanding the impact of white matter lesions.Compatibility with high-resolution methods for targeted investigations. While the primary imaging data should be obtained with light microscopy, electron microscopy or other high-resolution imaging methods could enable more detailed study of particular systems, provided the experimental protocols remain compatible with such techniques.Characterization of intersubject variability. As discussed above, quantifying the variability of observed connectivity patterns would be valuable. This would require additional informatics methods and a substantially larger number of experiments than needed for estimating a single “map.”Assessing the extent of current connectivity knowledge in various species is difficult because virtually all aspects of previous reports, including the specifics of animals used, experimental methodology, anatomical nomenclature, and presentation of results have varied across studies and laboratories. Furthermore, published data often include only processed results in the form of prose, tables, and schematic illustrations, while primary materials including original tissue sections sit on laboratory shelves.data into a common spatial framework, but is currently limited in scope to the rat cerebrocerebellar system. Our understanding of the overall architecture of model nervous systems is currently limited to very simple organisms such as the nematode Caenorhabditis elegansA small number of public repositories for connectivity information are available see , includihuman brain connectivity comes from either very old sources human nervous system will require additional technological development, we are well-positioned to push forward with a systematic high-throughput experimental program for model organisms using mostly existing methods.Much of our theoretical knowledge of Reviews of the history Neuronal tracers allow injected molecules to be distributed within intact living neurons through active intra-axonal transport mechanisms. Tracer substances is used to label the cells projecting to a particular target region, while anterograde transport allows for labeling the projection terminal regions of a cell or group of cells.phaseolus vulgaris–leucoagglutinin (PHA-L) Modern “conventional” tracers yield strong, high-resolution labeling of fine processes, and can often be used in combination with one another, with histochemical techniques, genetic markers, light or electron microscopy, and a variety of delivery mechanisms. While there are many tracers that may prove suitable in a large-scale connectivity mapping project, neurotropic viruses such as rabies virus Some tracer substances, and in particular viral vectors engineered from adeno-associated virus (AAV), lentivirus, herpesvirus, and others can be used to drive high expression of fluorescent proteins as anterograde and retrograde tracers. These methods can have higher sensitivity than conventional tracer methods Replication-incompetent The first and primary phase of our proposal is to systematically map mesoscale connectivity in the mouse brain using standardized methods to label neuronal projections in combination with optical microscopy. The mouse, as opposed to rat, is the preferred rodent model due to its increasing use in neuroscience The proposed protocol calls for systematic injections of conventional tracers and/or viral vectors in the young adult mouse, age-matched and weight-matched to an existing stereotaxic brain atlas. The ABA has established a standard by using male, 56-day-old C57BL/6J mice The project will necessitate further development of algorithms to reliably extract wiring information from digitized images, and to bring data from different sections and animals into register with one another. Photomicrographs from an individual animal must be registered in 3D while accounting for tissue distortions, a process that can be improved by acquiring low-resolution reference block face images prior to cutting each section A high-throughput investigation in primates, on the scale proposed for mouse, is not feasible. Primate experiments are tremendously more costly, and the monkey brain is considerably larger, more complex, and more variable than mouse. It is therefore of critical importance that: 1) results from previous connectivity studies in primates are carefully curated from the existing literature, leveraging ongoing efforts such as CoCoMac The success of the proposed efforts will hinge on the ability to coordinate activities across laboratories while maintaining quality control, to automate the analysis of acquired data, to store both raw and processed data, and to make the integrated results reliably available to different user groups through intuitive interfaces. Management of the large-scale dataset will require significant computational equipment and informatics expertise, some of which is likely to be distributed across multiple sites. The scope of the proposed project demands a customized laboratory information management system (LIMS) to organize and track tasks and materials within and across sites. Much can be learned from the informatics procedures carried out at the Allen Institute for Brain Science http://sumsdb.wustl.edu/sums), for example, includes a surface-based macaque atlas containing many anatomical partitioning schemes registered to a common spatial framework, along with maps of neuronal connectivity from retrograde tracer injections registered from individual subjects to the atlas solves for the partitioning of brain space that best follows the connectivity patterns observed in the data.A major challenge is to develop an appropriate structured database to store the results of injection experiments, digitized legacy data, and associated metadata. In the CoCoMac and BAMS databases, the underlying data model of anatomy is discrete; that is, each “connection” is associated with a pair of discrete brain sites. Through systematic injections, and by preserving and storing primary image data, it is possible for the underlying data to be represented in analog form. Spatial databases human brain. A much-improved partial understanding can be obtained from the proposed efforts in mouse and macaque, and a proposal has been made for a human connectivity project that would rely primarily on neuroimaging techniques The ultimate goal of our proposal to experimentally map brainwide connectivity patterns is to arrive at a comprehensive understanding of the architecture of the brainwide at the tractable yet representative mesoscopic scale, first in the mouse and followed by additional efforts for the macaque and eventually humans. The mouse proposal is based on existing methods, scaled up, and standardized for high-throughput experimentation. This effort would be complementary to, and would provide “scaffolding” for, additional anatomical projects using different emerging technologies, and can be integrated with existing resources such as the ABA to probe various levels of structural and functional organization. Examination of a potential project plan demonstrates that such an effort would be relatively inexpensive in terms of both money and time Click here for additional data file.Text S2Example workflow, informatics requirements, timeline, and cost estimates for mouse connectivity project. Here we describe in greater detail a possible experimental pipeline and data analysis workflow for a systematic study of mesoscale mouse brain connectivity using neuroanatomical tracers.(1.43 MB PDF)Click here for additional data file.Text S3Brief proposal for primate connectivity project. We describe an approach to better understand connectivity in the macaque brain that includes collating and digitizing existing materials as well as implementing specifically targeted experiments with standard protocols.(0.15 MB PDF)Click here for additional data file.
In vertebrate hosts, malaria parasites produce specialized male and female sexual stages (gametocytes). Soon after being taken up by a mosquito, gametocytes rapidly produce gametes and, once mated, they infect their vector and can be transmitted to new hosts. Despite being the parasite stages that were first identified (over a century ago), gametocytes have remained elusive, and basic questions remain concerning their biology. However, the postgenomic era has substantiated information on the specialized molecular machinery of gametocytogenesis and expedited the development of molecular tools to detect and quantify gametocytes. The application of such highly sensitive and specific tools has opened up novel approaches and provided new insights into gametocyte biology. Here, we review the discoveries made during the past decade, highlight unanswered questions and suggest new directions. Plasmodium parasites, replicate asexually in the blood of their vertebrate hosts, and a proportion of these asexually produced parasites differentiate into male and female sexual stages (gametocytes). Whereas the asexual stage in the life cycle of the parasite is responsible for clinical disease, gametocytes are responsible for transmission from host to vector. When taken up in the bloodmeal of a vector, male and female gametocytes immediately leave their red blood cells and produce gametes, which then mate and differentiate into stages that are infective to mosquitoes. Parasites then progress through several developmental stages in their vector, culminating in sporozoite stages that move to the salivary glands, ready to be transmitted to new hosts. Although sexual reproduction in Plasmodium parasites was discovered over a century ago, key questions about gametocyte biology remain. For example, the investment in gametocytes and their sex ratio both vary extensively across and within parasite species, populations and individual infections. Progress is being made in uncovering the genes and proximate mechanisms responsible Malaria is a debilitating disease that is responsible for between one and three million deaths annually, across tropical and subtropical climatic zones. The causative agents, P. falciparum in 1999 Plasmodium gametocyte and transmission biology gained using molecular tools over the past decade genotypes have a competitive advantage and tend to suppress the growth of less-virulent (minority) competitors P. chabaudi, experiments indicate that genotypes do not conditionally alter conversion when in a single- or a double-genotype infection Laboratory studies using Most laboratory-based studies have focused on gametocyte dynamics during the acute phase of infections, but the transmission advantage of virulent (majority) genotypes might not extend into the chronic phase because the development of anaemia and the immune response could alter the balance between asexual replication and gametocyte density. Quantifying genotype-specific investment into gametocytes during chronic infections in which co-infecting genotypes vary in competitive ability would be useful. Assays designed specifically to detect the gametocytes of minority genotypes will avoid the problem of over-amplifying majority genotypes and, thus, missing the minority ones of interest Successful transmission to vectors is related not only to the density of infectious gametocytes but also to their sex ratio. Sex ratios in malaria parasites are generally female-biased P. chabaudi genotypes can evaluate their inbreeding rate and adjust their sex ratio as predicted P. chabaudi parasites can discriminate genetically identical clone-mates from con-specific genotypes in their infections. Whether they are able to ‘discriminate kin’ directly or indirectly is yet to be investigated.The application of this theory to malaria parasites has been rather controversial P. chabaudi has also revealed that patterns of sex allocation during infections correlate with factors such as gametocyte density and host anaemia P. chabaudi, so developing assays to test these hypotheses more generally is required. Molecular assays to discriminate different genotypes in natural infections of the lizard malaria, Plasmodium mexicanum, have already been developed, and field experiments with this system are possible The use of sex-specific assays to track sex ratios throughout single-genotype infections of Over the past decade, molecular methods have superseded traditional microscopy because they have enabled, for the first time, gametocytes at low densities to be readily quantified and gametocytes produced by parasites of different genotypes in multi-genotype infections to be distinguished. Molecular methods have also facilitated the reliable and rapid detection and quantification of gametocytes at different developmental stages and sexes. Some long-standing questions have been answered and new lines of research have developed.Plasmodium parasites into methods to analyse gametocytes in different stages of development, maturity and sexes. Testing when, why and how gametocyte conversion is shaped by environmental factors and by competition in multi-genotype infections is also necessary. This requires differentiating gametocytes produced by different genotypes, which is a considerable challenge in natural infections. However, a combination of several gametocyte-specific quantification assays based on unlinked single-copy polymorphic genes will reduce the probability of underestimating the number of gametocyte-producing genotypes in natural infections. By continuing to develop and refine molecular methods, we expect that the next decade will reveal a deeper understanding of gametocyte biology and of the mating biology of gametes.Gametocytes might no longer be elusive, but many mysteries and challenges remain. For example, despite recent advances in mapping genes that are involved in gametocytogenesis Plasmodium. For example, asymptomatic infectious individuals are of major importance from a public health perspective. The identification of ‘gametocyte carriers’ and factors that can lead to increased transmission has been considered very important for determining the sources of infection in a community. With many asymptomatic carriers contributing to transmission, the feasibility and public health impact of gametocyte-targeted control, such as intermittent preventive treatment and mass treatment R0; the number of future cases derived from one infective case at the present time) to a controllable level. However, a limitation to this approach in the short term is the presence of drug-resistant parasites that can overcome the effect of drugs used and escalate in frequency in the face of drug pressure A better understanding of factors that influence gametocyte investment and transmission is essential to the development and evaluation of clinical interventions that disrupt sexual reproduction in
Flow cytometry based suspended microarray assays are susceptible to many sources of variance; multi-well replication and inter-instrument reproducibility is uncertain.m of microparticle set classifications assaying for the same analyte, with each of the m classifier sets having different sensitivity to analyte, and n classifier sets replicating each of the m levels of sensitivity, where m > 1 .An "intraplex" method was developed in order to minimize differences in sample readings between instruments. A full intraplex assay consists of a set ® users may want to consider the evidence that shows that despite calibration to the same standard, two instruments may not give similar results for all concentrations of analytes.The intraplex method can compensate adequately for the sources of variance that have been identified in suspended microarray assays. It requires no changes to current equipment in use, and is a superior method of constructing precision assays. Additionally, Luminex A suspended microarray assay system uses small particles, such as microspheres or microrods that contain some method for identifying a set of particles composing one assay. An chemical compound used to bind to a biological target molecule is bound to the surface of a set of identical particles, which are generally in the size range of 3–15 microns. Differently labeled particles have different target molecules that they assay for. These particles are added to a liquid (such as serum or cell lysate) containing the potential analytes. The final step in the assay activates a reporter fluorophore that provides a signal. The particles are run through a flow cytometer, which may be optimized for the specific assay system. For each particle in the mixture, the cytometer identifies the classifier for the set the particle belongs to together with the fluorescence reading of the reporter fluorophore. Because the particle classifiers are designed to be unique for each analyte, it is possible to multiplex the assays together in a test tube in order to test for multiple analytes in one sample. Multi-well assay plates can be used to test many samples, and such assays then become a high throughput system.n levels of brightness that can be differentiated, and the two are proportionally varied to separate them into n2 different microsphere populations for identification (currently n2 = 100 for two fluorophores.) This study used classical sandwich assays to attach reporter molecules of streptavidin-linked phycoeryrthrin to the microspheres. Luminex also provides assays which utilize nucleotide hybridizations to attach reporter fluorophores, and other assays are possible. The reporter fluorophore intensity is then measured in a specialized flow cytometer together with the microsphere classifiers; the reporter fluorescence measurement is collected separately for each microsphere population in the mixture. For each microsphere classifier population a sample of microspheres is collected, and one or more of the following are then used as the reported value: median, mean, trimmed mean, or peak. Median is the most commonly used value. The system is usually deployed with one well containing the same analyte fluid, sometimes two, however, some laboratories use three replicate wells as a standard, and throw out outlier values when they occur.The Luminex Corporation is one vendor of specialized flow cytometry equipment, which they also license to BioRad . The Luminex assay examined in this study utilizes microspheres on the order of 5.6 microns in diameter, upon which antigens or antibodies have been covalently bonded (xMap™ assays). The Luminex xMap™ assay microspheres used in this study contain two classifier fluorophores. Each fluorophore has n sets of microspheres flows up through a probe, which has a tip with 5 fine holes leading to a single channel at the top. The fluid travels through a system of tubing and valves into the flow cell, where (in the current equipment) two lasers are present. One laser stimulates the two marker fluorophores, and the other stimulates the reporter fluorophore. A system of avalanche photodiodes and a photomultiplier tube captures the fluorescence from marker and reporter emissions.The experimental sample fluid with Users of the Luminex instrument with xMap™ microsphere arrays have had mixed success in correlating the results of the assays with ELISA assays and generating reproducible results for a given assay -7. A solintraplex method was developed. This method compensates for various sources of variance that occur under typical real world laboratory conditions. Potential sources of variance that can be compensated for in whole or in part include: variation in size of microspheres affecting brightness [In response to the above, and a set of concerns from prior experimental work, the ightness ; carryovightness ; stochasintraplex assay method was developed. Due to significant opportunities for confusion in this discussion, three terms are introduced for clarity: Suspended Microarray Particle (SMP), Suspended Microarray Particle Classifier Set (SMPCS) and Suspended Microarray Particle Classifier Set – IDentical Group (SMPCS-IDG). An SMP corresponds to a single microsphere, and an SMPCS corresponds to a set of microspheres that share a classifier. An SMPCS corresponds to what Luminex commonly calls "a microbead region", a "microbead set" or more colloquially, "a microbead" or simply "beads" and is usually interchangeable with bead number, since Luminex identifies their microbeads to users by numbers from 001 to 100 in the older systems in use.In order to try to minimize inter-instrument and inter-well variances, the n SMPCS's that assay for the same analyte with the same level of sensitivity. This is explained in more detail below.What is new to intraplexing is the SMPCS-IDG, a superset of SMPCS's composing an identically responsive group. An SMPCS-IDG is a set of simple intraplex shown in Figure m SMPCS's, all of which assay for the same analyte, but at differing levels of sensitivity. Having differing sensitivity to analyte results in different levels of signal from the reporter for each SMPCS. Figure m reporter readings to produce the mean of m. The mean of m is used as the denominator for each of the m readings. The end result is m internal self-mean ratios of the fluorescent readings of m to the mean of m. These ratios have been shown to be stable between instruments and between wells, even when absolute readings differ from each other by ratios as large as 30:1. It should be emphasized, however, that intraplexing cannot compensate for errors generated on the bench or in sample handling.The full intraplex conceptualized in Figure m × n matrix in which each of m different SMPCS-IDG's has n SMPCS's designed to be identical. This allows three levels of processing to be conducted on the readings. For example, analyzing the concentration of a single analyte, an m = 5 × n = 5 matrix could be developed. It would contain 5 SMPCS-IDG's, each containing 5 SMPCS's. Production of each of the 5 SMPCS-IDG's would usually be done together in a single batch, guaranteeing that all microspheres in each set should have the same average signal response level.The 5 × 5 intraplex, the first step of processing removes outlier values from each of the 5 SMPCSs making up each SMPCS-IDG if outliers exist. Step two averages the remaining n readings for each of the 5 sets, to obtain 5 averages, or "means of n." Then these means of n are themselves averaged to produce a single mean of m. The third step uses the mean of m as the denominator for each of the 5 means of n. Like the simple intraplex, the end result is 5 ratios, called internal self-mean ratios. This complete technique should give a high level of precision where precision is needed.When processing this Microsphere preparation was done according to standard Luminex xMap™ microsphere coating protocols. The assays used had already been tested against rhesus serum samples and levels of signal were recorded. This signal level was accepted as sufficient indication that they were representative of a real world assay.The virus antigens used in these experiments were:CMV- Cytomegalovirus,SFV- Simian Foamy Virus,SRV- Simian Type D Retrovirus,SIV- Simian Immunodeficiency Virus.The Luminex microsphere classifiers used for the four antigens are listed in Table MultiScreen HTS, BV 96 well filter plates were utilized for all assays. Preliminary studies of pipetting error indicated that volumes above 5 μl would have minimal error. All assays were conducted such that no fluid volume below 5 μl would be pipetted, and pipetting was done using a multi-channel pipetter. On the basis of preliminary evaporation studies, a total volume of at least 90 μl per well was used during incubations to minimize evaporation as a source of variance. In addition, all wells were filled within 2 minutes or less after each washing so that any difference between well concentrations due to evaporation was further minimized.Using a setting to collect a minimum of 100 microspheres per sample, 3, 4, and 5 microsphere set intraplexes were used to assay for the same analyte. Serum titrations of 1:50, 1:100 and 1:200 were used with 32 replicate wells per titration. The aim was to find a method for improving the accuracy of xMap™ assays through better intra-well controls. In total, 25 SMPCS's (i.e. xMap™ microsphere regions) were multiplexed, including all elements of the intraplexes. One SMPCS was coated with BSA as a control to measure nonspecific binding. An additional set of 6 uncoated SMPCS's were used as an alternate experimental intraplex control.The assays used in this study were developed previously for a simian virus detection project. They were manufactured using carboxylate xMap™ microspheres from Luminex conjugated to multiple viral antigens; the viral antigens used were 4 microsphere sets for CMV, 5 sets for SFV, 5 for SRV and 3 for SIV. Table These asThree controls were used: uncoated microspheres, the SIV microsphere assays, and a BSA standard control for background. Serum from a single Rhesus macaque with known positive and negative characteristics for the assays used was the sole experimental sample (and thus a type of control). Samples were incubated for two hours on a shaker table, washed with PBS-Tween, then incubated for 40 minutes with R-Phycoerythrin-conjugated Affinipure F(ab) Fragment Goat anti-Human IgG Fcγ , which was used as a conjugate reporter to detect the Rhesus macaque antigen specific IgG antibodies bound to antigen on microspheres. The plate contents were then washed with PBS-Tween, shaken to suspend the microspheres, washed again, resuspended, then read on a Luminex instrument. Plates were stored overnight at 4°C in a refrigerator and read on a Bioplex instrument the following morning.Two instruments were used for these experiments: a Luminex Model 100 that is approximately 5 years old, and a Biorad Bioplex instrument installed in late December 2005 and commissioned for use in January 2006. Both instruments were under standard service contract. Prior to commencing the study, both instruments had been serviced by field technicians within the previous 2 months. Also prior to commencing the study, the Luminex instrument was upgraded to the latest software and firmware levels.Each plate was run on both machines, first on the Luminex, and second on the Biorad Bioplex. Seven different statistics available from Luminex and Bioplex instrument software were examined for each instrument: mean, standard deviation, trimmed mean, median, trimmed standard deviation, peak and trimmed peak.The mean is the simple arithmetic average of all fluorescent intensities for the microsphere set that pass gating criteria. The standard deviation is the standard deviation of the simple mean calculation. The trimmed mean is an average of the fluorescent intensities collected in a sample, using an algorithm that appears to remove data points on both sides of the median. The trimmed standard deviation is the standard deviation of the data points used in calculating the trimmed mean. The median is the most commonly used value for most instrument users.Peak and trimmed peak values were not used because the Bioplex XML file does not present the "peak" values that are present in the Luminex CSV file. The peak value should correspond to a mode. Examination of distributions of individual microsphere events was done using data from the Bioplex XML file. However, these showed enough complexity, and since the precise algorithm used by the Luminex was unknown, attempting to calculate a facsimile peak value from Bioplex XML data was abandoned. Thus, it was not possible to include these data as a further test of normality of distribution for both datasets.Distributions were examined for normality, focusing on what is usually available to users of the instrument. A simple preliminary test for normality of the distribution is to divide the mean by the median and the peak (mode) for the datasets. If the sample distribution is normal then these values are equal and the ratio is 1:1. If it is skewed, then the mean will be some multiple of the median if the skew is toward the high end, or some fraction of the median if the skew is towards the low end. While this test would not be correct under all conditions in the absence of the peak values, visual examination of some histograms of microsphere distributions taken from the Bioplex shows that it appears adequate for this instrument.The fluorescent intensity histogram can be examined for each microsphere set, and the skew and normality could be determined directly. However, this information is only available from the Bio-Rad instrument in the XML export file. This study generated histograms for a significant number of wells, examined them, and determined that they approximated normal distributions, as exampled in Figure Generally speaking, untrimmed mean data for a microsphere set can be skewed Figure . It was This examination showed that trimmed mean and trimmed standard deviation was the optimum data source for the instrument for this study, since analysis used standard deviations of individual readings (not shown), although the median is more commonly used by biologists employing this instrument.intraplex assays where m = 4 and m = 5 are presented. Several ratios were studied.Results from microsphere For the first ratio, the mean of a set of 6 uncoated microspheres was used as denominator. This mean value was then used to determine a ratio with all the other SMPCS's in each intraplex assay. This is termed an 'external ratio' because it was external to the intraplex set for a single assay.mean of the SFV SMPCS's fluorescent reporter intensities, and vice versa.The second type of ratio was as follows. Since several different intraplex assays were used together (i.e. a multiplexed intraplex), the mean of a different intraplex assay could be explored as a ratio denominator: for example, the ratio of each SRV SMPCS's fluorescent reporter intensity against the The third ratio is the mean of all values for each intraplex set to their own mean as denominator. Each SMPCS's reading is used as the numerator over the mean of all the values in that set. The ratio of all SMPCS reporters in the intraplex was taken against that mean. This is termed an internal ratio against the self mean.Figure The amount of analysis that could be presented here is considerable. These figures and tables show the essence of what is important for understanding the improvement derived from this new assay technique. The primary work compared results for assay plates with 32 replicate wells where each plate was read on two different instruments.The graphs of Figure 1. For each well, a ratio between the fluorescent intensity (FI) and several denominators was taken. The denominators were: mean of uncoated control microsphere FI; FI mean of external real assays; FI self mean of the intraplex set; and FI of one arbitrarily selected SMPCS from the intraplex.2. For each SMPCS, the mean, median, maximum, minimum, and standard deviation were calculated for each 32-well replicate serum titration.3. Between instruments, the ratios of the mean, median, maximum, minimum and standard deviations were calculated for each serum titration. This was done for each permutation of denominators taken in step 1.z score was calculated for each method and is presented in the next subsection to show that the correlation is valid.The ratio of means is used for expediency due to the quantity of data in this study. A potentially valid criticism is that this procedure might remove a wide distribution from the system. For this reason, the bar chart of Figure The last step of this analysis was to examine the z scores for the intraplex assays with using a difference of means test.n1 and n2 is the number of readings, s1 and s2 are the standard deviations of the samples. For these tests the same set of 32 replicated sample wells was read, once on instrument A followed by repeating the same plate on instrument B, the anticipated results are identical.Above, The results of this analysis are summarized in Table This study indicates that intraplex methodology provides significant benefits to suspended microarray assay precision, and that for an intraplex analysis the ratio to the internal self-mean would be optimal to use, although a developer may choose an external method for some circumstance, or use both internal and external methods together as cross validations. An intraplex should produce reliable results regardless of which specific instrument (appropriate for the assay manufacturer) is used. Intraplex ratios compensated for known assay error modes.n ratios moving closer together, with a high or low outlier in most instances, since signal response levels will usually vary semi-logarithmically as the analyte concentration is lowered, frequently causing mean of m to have an apparent outlier. This clustering provides a measure correlated to concentration of analyte.A graph of the internal self-mean clustering will show To achieve intra-plate standard concentration determination independence, intraplex assays can be run by an assay developer at differing levels of known analyte. Ratios for each analyte assay can then be generated for each intraplex assay batch. These ratios can then be used to provide an independent intra-assay correlation with analyte concentration. To make the assay even more precise, intraplex assays could be used together with the current system of creating a standard curve for each assay plate. Combining such results will allow diagnosis of problems with standard solutions, and provide potentially greater precision.Intraplexing assays are useful for several purposes. Intraplexing should provide a means of making the serious issue of unpredictable large carryover events visible n ≥ 5 for the remainder of an m × n intraplex after culling possible outliers provides useful statistical significance, although some may accept lower values of n and some may require higher. The processed data from an individual well, using intraplexing, can have a validity that is currently unavailable, thus avoiding requirements for sample replication in many uses. Validity will be generally based on t tests, but with a reasonable confidence. This can allow software vendors to make better judgments for users regarding the statistical significance of a result.Having a value of Users of suspended microarray assay systems should take note of this method and apply its results as appropriate to their systems. Much of these results apply to "smart dust", smart microspheres, bar coded microspheres, microrods and others. To confer optimum precision for research, clinical use and other applications on this sector of assay technology, the matters raised here also should be considered for these alternative assay methods. Additionally, users may want to take note of the potential for significant differences between instruments when instruments are calibrated to the same standard.The author(s) declare that they have no competing interests.
The longitudinal epidemiology of major depressive episodes (MDE) is poorly characterized in most countries. Some potentially relevant data sources may be underutilized because they are not conducive to estimating the most salient epidemiologic parameters. An available data source in Canada provides estimates that are potentially valuable, but that are difficult to apply in clinical or public health practice. For example, weeks depressed in the past year is assessed in this data source whereas episode duration would be of more interest. The goal of this project was to derive, using simulation, more readily interpretable parameter values from the available data.The data source was a Canadian longitudinal study called the National Population Health Survey (NPHS). A simulation model representing the course of depressive episodes was used to reshape estimates deriving from binary and ordinal logistic models (fit to the NPHS data) into equations more capable of informing clinical and public health decisions. Discrete event simulation was used for this purpose. Whereas the intention was to clarify a complex epidemiology, the models themselves needed to become excessively complex in order to provide an accurate description of the data.Simulation methods are useful in circumstances where a representation of a real-world system has practical value. In this particular scenario, the usefulness of simulation was limited both by problems with the data source and by inherent complexity of the underlying epidemiology. Clinical practice guidelines for MDD have historically regarded the diagnosis as a eed (e.g.). Howeveeed that can potentially assist with these objectives. This study has followed a representative cohort of community (household) residents since 1994. However, direct estimates made from the NPHS do not always align well with the research needs identified above because of limitations and qualifications of the data. For example, the NPHS measures past-year MDE during interviews conducted two years apart, an approach that does not precisely align with the concept of risk. In addition, the NPHS measures weeks depressed during the preceding year, which is not the same as episode duration - the latter being a more salient parameter for practice. These problems are not unique to Canada. Many longitudinal studies employ depression measures that share analogous limitations. Some longitudinal studies, for example, obtain symptom ratings using scales that cover past week symptoms, but these ratings are spaced apart more widely .In the current project, a simulation model was developed in order to represent relevant probabilities in ways that align more closely with clinical needs than would direct estimates from a flawed epidemiologic data source such as the NPHS. The simulation model provided a representation of the epidemiology over a four year period. Inputs to the model were parameters representing easily interpretable epidemiologic estimates and the model was programmed to produce outputs representing the various flawed estimates that can be directly estimated from the NPHS data. Simulations using various values for the input parameters were then used to identify values that would be expected to reproduce the less interpretable ones that can be directly estimated. In other words, estimates from the NPHS were used to calibrate the simulation model and the simulation model was taken as a representation of the underlying epidemiology. The objective was to produce a set of easily interpretable estimates of conventional parameters such as odds ratios and hazard ratios from the less conventional and less easily interpretable estimates that can be directly estimated from the NPHS.The NPHS is a longitudinal study of a nationally representative community sample assembled by Statistics Canada in 1994/1995. NPHS respondents are interviewed every two years, with data currently being available up to 2006. Detailed information about NPHS methodology is available on the Statistics Canada Web page . Most . This brThe NPHS interview also measures a set of variables that may be useful in predicting the course of depression. The association of a set of variables (listed below) with aspects of MDD prognosis was evaluated, but only variables found to be significantly associated with outcome (see below) were included in the simulation models. In the NPHS, standard items are used to assess age, sex, marital status, income adequacy , employment status, the presence of one or more chronic medical conditions, a history of several childhood stressors , pain AreFor those respondents identified as having a depressive episode according to the CIDI-SFMD an additional item determined the number of weeks in the preceding year that they were depressed. In analysis, responses from all of the seven available NPHS cycles were combined into a single data file in order to derive more precise estimates of the proportions reporting various numbers of weeks depressed. In order to ensure independence of the observations, only a single episode from each respondent (the first episode) was included in situations where multiple episodes occurred during follow-up. Also, only apparently new episodes were included (those without a positive CIDI-SFMD rating in the preceding cycle) in order to minimize the possibility that a long episode from a previous cycle might resolve during the follow-up interval and be misconstrued as a brief episode. The combination of data for weeks depressed in past year from various cycles into a single data file resulted in estimates of weeks depressed in past year for a total of n = 1477 episodes in the same number of NPHS respondents.The weeks depressed in past year variable is not the only prognostic information available in the NPHS. As the NPHS follows a cohort prospectively, it was also possible to identify the proportion of respondents with a new episode at any cycle who were again positive on the CIDI-SFMD at the subsequent cycle 2 years later. All respondents with new onset (prior cycle was CIDI-SFMD negative) episodes were identified and the proportion of these that were associated with another positive CIDI-SFMD result 2 years later was estimated. Again, to ensure independence of observations, only one episode for an individual respondent was included in this data file. The data file contained n = 1857 respondents.After preliminary tabular and stratified analyses, several statistical approaches were used to model the relationship of potential determinants to the longitudinal course of the depressive episodes. Associations between weeks depressed in past year categories and various potential determinants were modelled using ordinal logistic regression. Brant's test was used to assess the proportional odds assumption in the ordinal logistic analysis . Binary The analysis was conducted at the Prairie Regional Research Data Centre on the University of Calgary campus, using STATA . The stuThe goal of simulation in this study was to realign the NPHS data into a format that would more directly relate to clinical and public health practice, see Table The simulation model was developed using discrete event simulation in the software Arena . The modThe simulation model is depicted graphically in Figure In Equation 1 the 'X' variables are dummy variables representing the age-grouping attributes assigned to each entity. While depressed, each entity completed a loop in the discrete event simulation modelling path and with each completion of this loop a counter variable representing weeks depressed was programmed to increase by one week. This allowed the probability of recovery in a subsequent week to be adjusted with each passing week's increase in episode duration. Consistent with the wording of the NPHS item, this counter did not distinguish between weeks depressed and consecutive weeks depressed in a single episode. Entities could recover from MDE and have a recurrence during the simulation. In each case there weeks depressed were counted by the model. The linear predictor was transformed into a probability of recovery by the equation :Upon recovery, an entity was subject to a weekly risk of recurrence that depended on its attribute status. In the simulation, the weekly probability of recurrence was also calculated based on the entity's attributes using an approach akin to logistic regression. A linear equation was programmed into the model to calculate a value for each attribute found to be associated with MDE recurrence:The other variables listed in the Methods section were not found to be significantly associated with consecutive episodes in the NPHS analysis. The value returned by this equation was conceptualized as a weekly log odds of recurrence and this was converted into a probability by taking the inverse log and converting the resulting odds to a probability by dividing it by 1 + the odds. In this way, the model calculated a weekly recurrence risk for each recovered entity, depending on that entity's various attribute values. During calibration of the model it was found that this equation was inadequate as a representation of the recurrence rate. This resulted from the effect of age, but not other variables, on weeks depressed in the past year according the ordinal logistic analysis, see above. Since episodes in older age groups were longer than those in younger age groups, a greater proportion of consecutive MD across cycles was attributable to persistence as opposed to recurrence in the older age categories. An expanded version of this equation was therefore devised that included cross-product terms so that the effect of predictive variables on recurrence could vary across age groups. As there was no clear way to determine the minimum necessary set of such cross-product terms, a comprehensive set of such terms was added to the Equation during model calibration.In order to select appropriate parameters for the α and β coefficients in the equations above, the ordinal and binary logistic models presented in Table As noted, in the ordinal logistic regression analysis, a significant association between age group and reported weeks depressed in the past year was observed. This model is presented in Table In the logistic regression analysis, age 26 to 45 years was also found to be associated with the probability of having past year MDE two years after an initial MDE, see Table The optimized values for the alpha and beta coefficients listed in Equations 1 and 3 are presented in Table Predictions from the model for weeks depressed in past year across the three age groups are depicted in Figure Figure The objective of this study was to increase the utility of longitudinal major depression data collected in a national general health survey. As with some other sources of longitudinal data on depression, the NPHS supports direct estimation of parameters that are, unfortunately, not easily interpretable. The goal was to make use of a representation (in the form of a simulation model) of the underlying epidemiology in order to derive more straightforward estimates from these flawed ones, accounting for the design features of the data source. However, the complexity of the underlying epidemiology combined with aforementioned limitations of the data source precluded full achievement of this objective. One of the accessible proportions in this dataset was the proportion of those depressed at one time interval who were also depressed at a subsequent interval. This proportion represents some mixture of persistent and recurrent cases and a partitioning of these possibilities was one goal of the simulation model, the model also being informed by the observed pattern of recovery. The available information about episode duration (weeks depressed in the past year) indicated that age was an important determinant of this variable whereas a logistic regression model estimating the frequency of positive status on two consecutive cycles was only influenced by age in one age group. If this is true, the effect of age on recurrence must differ depending on exposure to various predictive variables, resulting in the need for very complex equations in the simulation model in order for it to accurately reflect the epidemiology. The equation for recurrence needed to include multiple cross-product terms, see Table This study has examined a particular approach to simulation, but other strategies may ultimately prove to be more effective at increasing the interpretability of estimates made from incomplete data sources. On the other hand, the results highlight some inherent limitations that are likely to apply to various secondary data sources. For example, the weeks depressed in past year variable may be inaccurate because of faulty recall. As a result, the lack of statistical significance of some potential predictors of this outcome may be partially due to a dilution of their effects through non-differential misclassification bias. A bias of this sort may have contributed to the need for an extremely complex equation (see Table The analysis highlights an important aspect of the longitudinal epidemiology of MD: the declining recovery rate as a function of time. According to DSM-IV TR an untreIf the NPHS had fully recorded the duration of episodes, it would have been possible to model the pattern of recovery using conventional methods. Also, if the NPHS had directly measured the probability of recurrence among those respondents recovering between cycles, conventional approaches could have been used to model recurrence probabilities without the need for simulation. Such detailed longitudinal data are not available in most countries whereas less complete data often are available. As the epidemiology of MDE is further clarified, simulation may offer opportunities to improve the interpretability of readily available but methodologically limited data sources. However, an effective approach for accomplishing this goal has yet to be identified.CIDI-SFMD: Composite International Diagnostic Interview Short Form for Major Depression; MDE: Major Depressive Episode; NPHS: National Population Health Survey.SP has received speaking fees from Lundbeck and consulting fees from Servier Canada. SP has also received consulting fees and has served on a Data Safety Monitoring Board for Cipher Pharmaceuticals, and has received a research grant from Servier Canada.SP is the sole author of the paper and was responsible for all aspect of the design and conduct of the study.Predicted episode durations.Click here for file
Cardiovascular disease (CVD) remains a major cause of premature death in patients with chronic kidney disease (CKD), including renal transplant recipients. Both interplay of traditional cardiovascular and renal specific risk factors have been shown to be associated with an increased risk of cardiovascular death in patients with CKD. Recently, there has been great interest in the role of novel biomarkers, in particular adiponectin and leptin, and its association with CVD in the CKD population. Adiponectin is a multifunctional adipocyte-derived protein with anti-inflammatory, antiatherogenic and insulin sensitizing activity. Recent observational studies have shown adiponectin to be a novel risk marker of CVD in patients with stages 1 to 5 CKD. Leptin is an adipocyte-derived hormone that promotes weight loss by decreasing food intake. Similarly, there are observational studies to support an association between leptin and CVD, including patients with CKD. In the CKD population, leptin may be associated with uremic cachexia and subsequent increased mortality. This review aims to summarize the pathophysiological and potential clinical roles of these cardiovascular biomarkers in patients with CKD. Cardiovascular disease (CVD) remains the major cause of premature death in patients with chronic kidney disease (CKD). CKD increases the risk of cardiac death 10-20 fold compared to the non-CKD population despite stratification for age, sex, race and diabetes . FurtherIn recent years, there has been a greater appreciation of adipose tissue as an active metabolic organ beyond a storage depot for triglycerides, including the secretion of various adipokines, such as adiponectin and leptin. Human adiponectin is a multifunctional adipocyte-derived protein with anti-inflammatory, anti-atherogenic and insulin sensitizing activity . It is tet al. showed that in their cohort of 227 hemodialysis patients who were followed for a mean of 31±13 months that each 1 µg/mL increase in adiponectin concentration was associated with a 3% risk reduction in new cardiovascular events . At a me2 months . Adiponeet al., in their analysis of 820 patients with a GFR range of between 13 and 55 mls/min from the MDRD database revealed a direct correlation between adiponectin and the relative risk of cardiovascular mortality [et al., highlighting the strong association between adiponectin and GFR [In contrast to the above findings, Menon ortality . In mult and GFR . In thisWhile the above observational studies have linked adiponectin to improved cardiovascular outcomes in patients with CKD, it remains unclear as to how adiponectin confers vascular protective benefits. However, there is now evolving evidence of its mechanistic actions that may account for its cardioprotective benefits.via translocation of the insulin responsive glucose transporter (GLUT4) to the cell surface in skeletal muscle cells [Adiponectin is an abundant protein hormone, comprising nearly 0.01% of all plasma proteins . Exclusile cells . Hypoadile cells -31. Adiple cells .Furthermore, adiponectin is inversely related to various inflammatory markers such as tumour necrosis factor-α (TNF-α), C-reactive protein (CRP) and interleukin-6 (IL-6) in normal subjects and patients with type 2 diabetes and CVD -35. In aWhile most studies to date point to a consistent link between lower adiponectin levels and CVD in patients with CKD, there are no interventional studies to demonstrate any benefit in increasing adiponectin levels on cardiovascular outcome in this group. Several studies in non-CKD patients have demonstrated increased adiponectin levels with weight loss, physical exercise and the use of pharmacological agents, including angiotensin converting enzyme inhibitors, angiotensin 2 receptor blockers, statins and thiazolidinediones -42. Simiob) gene, which is secreted by white adipose tissue and primarily bound to protein in lean adults [via a combination of glomerular filtration and subsequent tubular degradation [via the hypothalamus. Leptin binds to the b isoform of the obesity receptor (Ob-Rb) and increases the synthesis of proopiomelanocortin via the Janus-activated kinase (JAK) and signal transducers and activators of transcriptions (STAT) pathway. Proopiomelanocortin is subsequently converted to α-melanocyte-stimulating hormone, which in turn activates melanocortin-3 and -4 receptors to decrease appetite [via saturable transport pathways across the blood brain barrier to the arcuate nucleus, and possibly protein tyrosine phosphatase 1B inhibition of JAK phosphorylation [In contrast to studies which have consistently found a strong inverse association between adiponectin and CVD, an association between leptin and CVD has been less clearly demonstrated. Leptin, a 16kDA protein is a product of the obesity and possibly peripheral mechanisms. Elevated leptin levels, either in transgenic mice with hyperleptinemia or by prolonged exogenous administration of leptin, resulted in elevated mean arterial pressure by 10-20mmHg. Administration of α-blockers abolished leptin-induced hypertension, supporting a role for the SNS in the development of hypertension [Experimental studies suggest a role for leptin as a causative or contributing factor in the pathogenesis of atherosclerosis. Leptin’s proatherogenic effects include the development of hypertension, oxidative stress, endothelial dysfunction, inflammation, platelet aggregation, migration, proliferation and hypertrophy of VSMC. There has been particular interest in the role of leptin in obesity related hypertension. While obesity is associated with central hypothalamic resistance, this phenomenon appears to be selective primarily to its anorectic effect. Chronic hyperleptinemia has been shown to be associated with activation of the sympathetic nervous system (SNS) rtension , 55. Thertension . Furtherrtension . Leptin rtension . Additiortension , 59. Of rtension . Clinicartension . In addirtension . HoweverObservational data support an association between leptin and CVD. Elevated leptin levels have been shown to be associated with early markers of CVD, including increased carotid intima media thickness (IMT) and decreased arterial distensibility , 63. Howvia up regulation of nitric oxide production, resulted in the generation of reactive oxygenation species (ROS). Various studies have shown that leptin-treated mice have elevated levels of various markers of oxidative stress, including malonyldialdehdye, peroxides, isoprostanes and oxidized lipoproteins, a hallmark feature of atherosclerosis, as well as reduction in anti-oxidant molecules, such as glutathione [Experimental studies have provided an insight into the potential mechanistic basis for leptin’s proatherogenic effects. Hyperleptinemia, tathione -76. Lepttathione , 78. Simtathione , 79. Leptathione -83.et al. showed that metabolic acidosis reduced the release of leptin from adipose tissue [There are sparse and conflicting data on leptin in CKD, particularly its association with CVD and mortality. In general, leptin levels are significantly higher in patients on dialysis, particularly those on peritoneal dialysis, compared to the non-dialysis population -86. Thise tissue . In addie tissue . In conte tissue . While se tissue . Higher e tissue . Leptin e tissue . To datee tissue . During e tissue , 95, 96.e tissue . In addiPatients with CKD remain at high risk of premature cardiovascular death. Interventional studies addressing traditional cardiovascular risk factors in this group of patients have failed to yield significant benefits. As such, there has been great interest in alternative cardiovascular risk factors including adipokines. While there has been a preponderance of observational and experimental data linking adipokines to CVD in the CKD and non-CKD population, their exact role remains to be verified. The interplay of other variables associated with uremia further adds to the complexity in determining whether adipokines have significant pro atherogenic properties in CKD. Adipokines like leptin and adiponectin may serve as biomarkers of CVD in CKD. To date, there have been no interventional studies with either adiponectin or leptin on cardiovascular outcomes in the humans, including those with CKD. In conclusion, further studies are necessary to clarify and determine the role of adipokines in CVD in CKD, either as a biomarker or potential therapeutic tool in addressing the cardiovascular burden in CKD.
The importance of the applications of lanthanides, as an excellent diagnosticand prognostic probe in clinical diagnostics, and an anticancer material, is remarkably increasing. Lanthanidecomplexes based X-ray contrast imaging and lanthanide chelates based contrast enhancing agents formagnetic resonance imaging (MRI) are being excessively used in radiological analysis in our body systems.The most important property of the chelating agents, in lanthanide chelate complex, is its ability to alter thebehaviour of lanthanide ion with which it binds in biological systems, and the chelation markedly modifiesthe biodistribution and excretion profile of the lanthanide ions. The chelating agents, especially aminopolycarboxylic acids, being hydrophilic, increase the proportion of their complex excreted from complexedlanthanide ion form biological systems. Lanthanide polyamino carboxylate-chelate complexes are used ascontrast enhancing agents for Magnetic Resonance Imaging. Conjugation of antibodies and other tissuespecific molecules to lanthanide chelates has led to a new type of specific MRI contrast agents and theirconjugated MRI contrast agents with improved relaxivity, functioning in the body similar to drugs. Manyspecific features of contrast agent assisted MRI make it particularly effective for musculoskeletal andcerebrospinal imaging. Lanthanide-chelate contrast agents are effectively used in clinical diagnosticinvestigations involving cerebrospinal diseases and in evaluation of central nervous system. Chelatedlanthanide complexes shift reagent aided
Ixodes scapularis is the primary vector of the Lyme disease agent in the eastern and central U.S. RNAi is a mechanism by which gene-specific double-stranded RNA (dsRNA) triggers degradation of homologous mRNA transcripts. Here, we describe an optimized protocol for effectively suppressing gene expression in the egg and nymphal stages of I. scapularis by electroporation.Ticks are blood-sucking arthropods responsible for transmitting a wide variety of disease-causing agents, and constitute important public health threats globally. 2 (PLA2), cytoplasmic Cystatin, Syntaxin-5, β-Actin and Calreticulin were targeted by delivering the dsRNA encoding the specific gene coding regions in the unfed nymphs. Silencing was measured using real time qRT-PCR. Electroporation as a mode of dsRNA delivery appears to be substantially efficient and less traumatic to the tick than dsRNA microinjection in the unfed nymphs. Using Cy3-labeled dsRNA to monitor the movement, electroporated dsRNA entered the nymphs and spread to salivary glands and other tissues. The significant disruption of β-actin and cytoplasmic Cystatin transcripts in tick eggs demonstrate the applicability of this technique. The PLA2, cytoplasmic Cystatin, Syntaxin-5, β-Actin and Calreticulin genes were also significantly silenced, suggesting that this method has the potential to introduce dsRNA in eggs and unfed nymphs.The genes encoding the putative Phospholipase AOur study demonstrates that electroporation can be used as a simple dsRNA delivery tool in assessing the functional role of tick genes in the vector-host interactions. This technique represents a novel approach for specific gene suppression in immature stages of ticks. RNA interference (RNAi) is emerging as a highly effective tool for specific gene disruption. RNAi is an evolutionarily conserved phenomenon of post-transcriptional gene silencing, which is triggered by the presence of 21-23 nucleotides, double stranded (ds) RNA molecules called short interfering RNAs (siRNAs). In cytoplasm, siRNAs from endogenous or exogenous origins interact with a nuclease-containing multiprotein complex called RISC (RNA-induced silencing complex). The siRNAs bind to RISC and unwind, pair with their complementary target mRNA, and allow the RISC complex to cleave the mRNA strand within the target site. This initial cleavage results in rapid degradation of the mRNA molecule, which prevents its translation into protein siRNA (5 μg) were labeled separately by adding Cy3 labeling reagent and incubating for 1 hr at 37°C. GAPDH siRNA was provided in the Ambion Kit. Un-reacted labeling reagent was removed by adding an ethanol precipitation step to the protocol. Briefly, labeled dsRNA/siRNA was precipitated with 0.1 volume of NaCl and 2.5 volumes of 100% ethanol followed by incubation at -20°C for 1 hr. Precipitated, labeled dsRNA was recovered by centrifugation and the pellet was further washed with 70% ethanol. The recovered pellet was dried for 10 minutes at room temperature and re-suspended in nuclease-free water. The concentration of labeled dsRNA and siRNA was determined using a Nanodrop-100 as recommended by the manufacturer.To test the delivery of fluorescein-labeled dsRNA, 25 unfed nymphs were immersed in 50 μL of water containing 200 ng Cy3 labeled tick β-actin dsRNA or GAPDH siRNA and were either electroporated [BTX Electro Square Porator ECM 830 ] or simply held for 5 min cytoplasmic cystatin, d) Syntaxin-5, e) Calreticulin dsRNA, and f) irrelevant lacZ dsRNA in each group. After electroporation, ticks were held overnight at 37°C under high humidity to observe survival. Surviving nymphs were infested on 8 naïve mice and given the opportunity to blood feed till drop off. Partially (72 hrs) fed nymphs were used to extract total RNA for endogenous gene expression. Dropped off engorged nymphs were weighed individually and kept under lab conditions to molt into male or female adults.To test the degree of gene suppression in nymphs, 300 unfed nymphs were divided into five groups of 50 each, and were electroporated with 1 μg of a) β-actin-dsRNA, b) putative PLAlacZ dsRNA, c) β-Actin dsRNA and d) cytoplasmic cystatin. Eggs were held at 32°C and >95% relative humidity for 1 week before processing for total RNA extraction. Total RNA was extracted from eggs using illustra RNAspin Mini RNA isolation kit to test expression levels of β-Actin and cytoplasmic cystatin genes in all groups.Freshly laid tick eggs (~200 in each group) were divided into four groups and electroporated with a) water, b) 500 ng of irrelevant 7 copies per reaction) was generated using each candidate gene PCR product as the template. The primer sequences used in all qRT-PCR reactions are listed in Table Real-time quantitative RT-PCR (RT-qPCR) was performed using the Mx3005P Multiplex Quantitative PCR System and the Brilliant SYBR Green Single-Step QRT-PCR Master Mix Kit according to the manufacturer's instructions. A standard curve (10° to 10RNAi: RNA interference; dsRNA: double stranded RNA; TBD: tick borne diseases; PCR: polymerase Chain Reaction; Na K ATPase: Sodium Potassium ATPase; siRNA: small interfering RNA; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; PLA2: Phospholipase A2; RISC: RNA induced silencing complex.SK conceived molecular design, organized funding, drafted the manuscript and coordinated the study. ET performed experiments. TNM organized funding, participated in the design and helped to draft the manuscript. All authors read and approved the final manuscript.
All but one of the angles at the P atom show slight distortions from an ideal tetrahedral geometry.In the title molecule, C H-benzotriazol-2H-yl)phenol (BTP-H) derivatives, see: Li et al. Å b = 9.4064 (5) Å c = 18.6362 (10) Å V = 2238.4 (2) Å3 Z = 4 Kα radiationMo −1 μ = 0.15 mmT = 296 K 0.30 × 0.20 × 0.15 mm Bruker SMART-1000 CCD diffractometerSADABS; Sheldrick, 1996T min = 0.963, T max = 0.974Absorption correction: multi-scan (11920 measured reflections3684 independent reflectionsI > 2σ(I)3343 reflections with R int = 0.034 R[F 2 > 2σ(F 2)] = 0.032 wR(F 2) = 0.086 S = 1.05 3684 reflections280 parameters1 restraintH-atom parameters constrainedmax = 0.14 e Å−3 Δρmin = −0.20 e Å−3 ΔρAbsolute structure: Flack 1983, 1412 FrFlack parameter: 0.01 (7) SMART used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536809029870/lh2871sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536809029870/lh2871Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:
Burkholderia cepacia. The organism was eventually identified by molecular methods as B. pseudomallei.After returning from Thailand, a 35-year-old man from Switzerland was hospitalized with an abscess of the head. Material cultured from the abscess and adjacent bone grew a gram-negative rod, which was misidentified by an automated microbiology system as Burkholderia pseudomallei, the etiologic agent of melioidosis, can cause pyogenic or granulomatous lesions and is endemic to tropic regions, mainly in Southeast Asia and northern Australia. This organism is a potential category B bioterrorism agent , then to southwestern and northern (Chiang Mai) Thailand where he went trekking and river rafting.The patient did not remember receiving a head injury during his trip. Seventeen days after returning to Switzerland, he had a swelling in the right parietal area of the head. The parietal bulge increased, but puncture by his general practitioner showed no aspirate. During the next 7 weeks, the bulge became painful and secretion of pus was noted at the time of admission.At admission, his general condition was good and he had no signs of systemic inflammation. He did not have any neurologic deficits or other abnormal findings. Test results for complete blood cell count, C-reactive protein and creatinine levels, and liver functions were normal. Computed tomography and magnetic resonance imaging of the head showed the abscess and a small defect of bone . The absB. cepacia (99% confidence). When a species is identified with >90% confidence, the Phoenix System gives an identification result as a measure of likelihood that the identification is the only correct one.Culture material from the abscess and biopsy specimens of the abscess capsule and the cranial bone grew gram-negative, oxidase-positive rods, and smooth creamy colonies on sheep blood agar after incubation for 48 hours at 35°C. For identification, a suspension of the isolate was prepared and tested in a UNMIC/ID-62 panel of the BD Phoenix Automated Microbiology System per the manufacturer’s instructions. This system identified the isolate as B. cepacia infection of soft tissue . He was treated with oral cotrimoxazole (160/800 mg 2× a day) for 16 days. The isolate was sensitive to cotrimoxazole (MIC = 1 mg/L for trimethoprim and 19 mg/L for sulfamethoxazole) by the Phoenix System for B. cepacia (Becton Dickinson). The isolate was sensitive to imipenem, ceftazidime, doxycycline, cotrimoxazole, and tetracycline by Etest .The patient was discharged from hospital after 5 days with a preliminary diagnosis of B. cepacia by common automated identification instruments such as the Phoenix System or VITEK 2 requires confirmatory identification by molecular tests with a 446-bp consensus length and 1 mismatch with B. mallei . These results suggested that our isolate was B. pseudomallei.To verify identification of the isolate, a 500-bp fragment of the 16S rRNA gene was amplified and sequenced by using the Fast MicroSeq 500 16S rDNA Bacterial Identification Kit and a PRISM 310 Genetic Analyzer according to the manufacturer’s instructions. Sequence analysis was performed by using MicroSeq ID Microbial Identification Software (Applied Biosystems). The MicroSeq ID 2.0 500-bp library identified B. pseudomallei or B. mallei. Multilocus sequence typing , cotrimoxazole (400 mg trimethoprim/day), and leucovorine for 2 weeks and later with cotrimoxazole (320 mg trimethoprim/day) and leucovorine for 6 months. The patient recovered after 6 months; he had a small indentation without signs of inflammation at the site of the abscess.Forty-four days after surgery, new biopsy specimens of soft tissue below the parietal scar and a sample of galea aponeurotica were cultured for B. pseudomallei .For comparison with the Phoenix System, we retrospectively analyzed the isolate by using the API 20NE biochemical test panel V7.0 (bioMérieux). This panel identified the isolate as B. pseudomallei was not in the database of this system, which led to misidentification of our isolate as B. cepacia. Failure to correctly identify B. pseudomallei has also been reported with another widely used automated system, the Vitek2 system .Automated methods for identification of bacterial isolates and testing of antimicrobial drug susceptibility, such as the Phoenix System, have become standard in most clinical laboratories because they are easy to use and turnaround time is rapid. The Phoenix System uses fluorogenic and chromogenic substrates for its identification algorithms, a broth-based antimicrobial drug–susceptibility testing method, and a data-processing application . Unfortunately, B. pseudomallei infection. Skin and soft tissue infections may occur after minor wounds or from hematogenous spread are recognized for B. pseudomallei for identification and drug resistance testing and smelled culture plates without knowing the isolate’s identity, none became ill or showed signs of melioidosis. According to expert consensus (Although laboratory personnel handled cultures of B. pseudomallei is not endemic should be aware of misdiagnosis of isolates by automated methods for bacterial identification and antimicrobial drug susceptibility testing. Identification of Burkholderia spp. by the Phoenix EpiCenter should be confirmed by molecular methods and by the API 20NE system in suspected cases of B. pseudomallei infection. Because of its high rate of accuracy and ease of use, the API 20NE system should be used first for any suspected colony when automated systems do not contain the adequate profile (Laboratories in regions where
Human data linking inflammation with long-term particulate matter (PM) exposure are still lacking. Emerging evidence suggests that people with metabolic syndrome (MS) may be a more susceptible population.Our goal was to examine potential inflammatory responses associated with long-term PM exposure and MS-dependent susceptibility.10 (PM with aerodynamic diameter < 10 μm) data from the U.S. Environmental Protection Agency Aerometric Information Retrieval System. Estimated 1-year PM10 exposures were aggregated at the centroid of each residential census-block group, using distance-weighted averages from all monitors in the residing and adjoining counties. We restricted our analyses to adults (20–89 years of age) with normal WBC , no existing cardiovascular disease, complete PM10 and MS data, and living in current residences > 1 year . Mixed-effects models were constructed to account for autocorrelation and potential confounders.We conducted secondary analyses of white blood cell (WBC) count and MS data from The Third National Health and Nutrition Examination Survey and PM10 levels (p = 0.035). Participants from the least polluted areas (1-year PM10 < 1st quartile cutoff: 27.8 μg/m3) had lower WBC counts than the others . We also noted a graded association between PM10 and WBC across subpopulations with increasing MS components, with 91 × 106/L difference in WBC for those with no MS versus 214, 338, and 461 × 106/L for those with 3, 4, and 5 metabolic abnormalities (trend-test p = 0.15).After adjustment for demographics, socioeconomic factors, lifestyles, residential characteristics, and MS, we observed a statistically significant association between WBC count and estimated local PMOur study revealed a positive association between long-term PM exposure and hematological markers of inflammation and supported the hypothesized MS-dependent susceptibility. Yearly average of PM10 (aerodynamic diameter < 10 μm) was also associated with increased risks for hospitalization for congestive heart failure or recurrent heart attack among patients with previous myocardial infarction , has increasingly been recognized as a threat to cardiovascular health . As notefarction .More recently, environmental health scientists have begun to elucidate the pathophysiologic mechanisms underlying the observed adverse short-term and long-term cardiac effects of ambient air pollution, and several interrelated mechanistic pathways have been proposed. Because of the pivotal role of vascular inflammation in pathogenesis and progression of atherosclerosis and coronary heart diseases, systemic inflammatory response to inhaled ambient particles has emerged as an important mediator of PM-associated acute cardiac effects . AlthougThe increasing prevalence and large number of U.S. adults with metabolic syndrome (MS) has imposed a major public health concern and presented a great challenge to health care . A knownThe following secondary data analyses were carried out to address these significant data gaps. We hypothesized that long-term PM exposure is associated with increased systemic inflammation, and that people with MS have a higher degree of inflammatory responses to PM.The extant health data came from the Third National Health and Nutrition Examination Survey (NHANES III) conducted by the National Center for Health Statistics of the Centers for Disease Control and Prevention between 1988 and 1994. Details about this survey and related methods have been published . In briea) no existing or prior histories of heart attack or stroke as told by physicians; b) living in current residence > 1 year; c) WBC count between 4,000 and 11,000 cells × 106; and d) having complete laboratory and physical data to define the presence or absence of MS. We excluded all subjects with WBC > 11,000 or < 4,000 cells × 106/L because they likely reflected either acute pathologic processes or underlying diseases.To parallel previous analyses on MS in U.S. adults , our stuFor the current analysis, we used the between-individual difference in WBC count as a marker of systemic inflammation. WBC count was included as part of the complete blood count performed using the Coulter Counter Model S-PLUS JR automated hematology analyzer . WBC count is an inflammatory marker and is considered a potentially useful predictor of prevalent or incident CVD, according to the joint scientific statement by the Centers for Disease Control and Prevention and the American Heart Association . Althoug10. We obtained the PM10 data from the U.S. Environmental Protection Agency (EPA) Aerometric Information Retrieval System (AIRS), which has evolved into the current U.S. EPA Air Quality System and contains information on all routine air pollution monitoring has been published elsewhere for Detection, Evaluation, and Treatment of High Blood Cholesterol in Adult Treatment Panel III , with siWe measured fasting plasma glucose using a modified hexokinase enzymatic method . The interassay coefficient of variation was < 4% during the entire 6 years of survey. We evaluated history of diabetes based on a positive response to either of the questions “Are you now taking insulin?” or “Are you now taking diabetes pills to lower your blood sugar? These are sometimes called oral agents or oral hypoglycemic agents.” Blood pressure was measured by a board-eligible physician. Treatment for hypertension was identified by positive responses to all three of the following questions: “Have you ever been told by a doctor or other health professional that you had hypertension, also called high blood pressure?”; “Because of your high blood pressure/hypertension, have you ever been told by a doctor or other health professional to take prescribed medicine?”; and “Are you now taking prescribed medicine?” Triglycerides and HDL-C were measured using a Hitachi 704 Analyzer . Waist circumference was measured, by a trained examiner, at the midpoint between the bottom of the rib cage and above the top of the iliac crest from participants at minimal respiration to the nearest 0.1 cm.Information on relevant covariates was collected through a structured interview. We determined the following covariates as important confounders: age, sex, race/ethnicity , socioeconomic status , family size, poverty–income ratio (in quartiles), and degree of urbanization of the residential neighborhoods. We used these latter two variables to measure some contextual characteristics other than the ambient air pollution exposure within the residential environment. The poverty–income ratio, as derived by comparing the self-reported family income to the U.S. Census–based poverty threshold value for each calendar year adjusted for inflation and the age of the family reference person, was a relative poverty index with its values < 1.00, indicating that the family is considered poor relative to the official poverty threshold .10 exposure level), and they are also known to predict CVD. Smoking status and frequency of alcohol consumption were considered potential confounders. We also extracted the following data to be included in the sensitivity analyses: potential sources of indoor air pollutants and exercise activities . Substantial exposure to airborne particles from indoor sources may correlate with outdoor PM exposure, thus raising the concern of confounding. Physical activities may determine the level of exposure to ambient air pollutants, and the frequency of engaging in jogging/running and aerobic exercise was associated with inflammatory markers in NHANES III participants . All theicipants .10. The constructed mixed-effects models allow for regression analyses with a covariance structure assuming a common correlation within these sampling units and a random-effects term for each community, providing proper standard error estimates for the regression parameters under these circumstances. We compared the average WBC count across communities defined by the quartile distribution of PM10 1 year before the examination. The potential modification of PM effect by the presence of MS was examined by comparing the spatial difference in WBC count, as putatively related to 1-year PM10 levels, across subgroups defined by the number of MS component abnormalities. The final mixed-effects models included the number of MS component abnormalities and also adjusted for age, sex, race, socioeconomic factors , smoking status, alcohol consumption, and urban–rural difference. All these analyses were restricted to NHANES III phase 1 participants who had available geocoded information with estimable PM10 data and fulfilled the afore-mentioned eligibility criteria. As a result, we noted that none of the assigned sampling weights in the publicly accessible data files are appropriate to conduct weighted regression analyses. We also carried out additional analyses to examine the possible confounding by concurrent exposure to indoor air pollutants or by exercise activities and to evaluate whether our findings on effect modification by MS were sensitive to the exclusion of subjects with known hypertension and diabetes mellitus before the MEC examination. All mixed-effects models were constructed using STATA 8.1 software with the xtreg command.Because NHANES participants were sampled from communities, WBC counts of individuals from the same cluster were expected to correlate with each other, likely because of geographic difference in population composition, nutritional status, and characteristics of residential neighborhoods . To account for this spatial autocorrelation, we used mixed-effects models to estimate the association between WBC count and estimated community-level exposure to PM10 monitoring stations operating within the residing counties or adjoining counties in 1988–1991. 10 , subjects with missing exposure data were slightly older (p = 0.09), more likely to be minorities (p < 0.0001), and had higher MS prevalence (p = 0.002) and WBC count (p < 0.0001). These comparisons denoted that the missing data structure of PM10 exposure levels was dependent on demographic and geographic differences, making extant NHANES III sampling weights not applicable to our analyses. There were 2,978 adults (48.5 ± 17.8 years of age) who had estimable 1-year PM10 and met the eligibility criteria . As a result of these restrictions, there were more Hispanics but fewer non-Hispanic blacks (p < 0.0001) in our study, and they had lower WBC counts than those excluded subjects with estimable PM10, although age, sex distribution, and MS prevalence were comparable. Our study population had fewer active smokers (p = 0.004), and they were more likely to be of high socioeconomic status (p < 0.0001 for comparison of family income and poverty–income ratio) and live in urban areas (p = 0.008). However, there was no difference (p = 0.47) in the exposure distribution between our study population (1-year average PM10 ± SD: 36.8 ± 13.0 μg/m3) and those excluded from the analyses (37.5 ± 13.1 μg/m3). We also noted that 94% of the observed variability in 1-year average PM10 could be attributable to between-community difference.Among those 44 communities selected in phase 1 of NHANES III, 33 had PM10 are presented in p < 0.0001) and those with higher socioeconomic positions (p < 0.0001 for both education and income comparisons) were more likely to reside in the clean air communities, and only 53% of such communities were located in urban areas . In the most polluted communities, there were more minority populations , and the majority (78%) were located in urban areas. Interestingly, the most polluted communities also had the highest MS prevalence compared with the others The population correlates across communities defined by the quartile distribution of 1-year PM10 1 year before the examination (p = 0.01). Subjects from the clean air communities (in the 1st quartile of 1-year PM10) had the lowest WBC count , whereas the highest average WBC counts were found in the most polluted communities (in the 4th quartile of 1-year PM10). We present in 10 exposure on WBC count, by comparing subjects from the clean air communities with all others residing in more polluted areas. In the crude analysis, this spatial difference in average WBC count associated with PM10 exposure was 239 × 106/L . This effect estimate was diminished to 145 × 106/L but remained statistically significant (p = 0.035) after adjustment for age, sex, race, socioeconomic factors , smoking status, alcohol consumption, urban–rural difference, and the number of MS component abnormalities (model 1 of p < 0.0001), with WBC count increased by 204 × 106/L for each MS component abnormality.In 10 exposure. Among those without MS, there was no appreciable spatial difference in average WBC count comparing subjects from the clean air communities with others residing in more polluted areas. The corresponding mixed-effects model revealed a graded association between PM10 and WBC count as the number of MS components increased, with 91 × 106/L difference in WBC estimated for those with no MS versus 214, 338, and 461 × 106/L for those with three, four, and five metabolic abnormalities, respectively (trend-test p = 0.15).6/L, p = 0.041 and 138 × 106/L, p = 0.046, respectively). Results of our sensitivity analysis also support the finding on MS-dependent spatial difference in average WBC count associated with PM10 exposure. After excluding those subjects (n = 700) with existing physician-diagnosed hypertension or diabetic mellitus and updating the corresponding mixed-effects model, we still observed a graded association between PM10 and WBC count, showing an even greater difference in WBC count as the number of MS abnormalities increased , and the test of effect modification by MS status became statistically significant (trend-test p = 0.044).Results of our sensitivity analyses PMrt Study and the rt Study , reportert Study . Short-tBC count . Taken t2.5 exposures among postmenopausal women with increasing level of obesity for 4 weeks was found to accelerate the progression of coronary atherosclerosis. PM10-instillation also increased plaque cell turnover and extracellular lipid pools in both coronary and aortic atherosclerotic lesions. In one study of concentrated air particles , researchers found that transverse sections of abdominal aorta increased 1.58-fold in percentage plaque area among mice maintained on high-fat, but not regular, chow. Further morphometric and immunohistochemical analyses indicated that vascular inflammation was elevated in atherosclerotic plaques of PM-exposed mice.The positive association we found between long-term PM exposure with increased inflammatory responses as well as the empirical evidence on the enhanced susceptibility among subjects with MS is also consistent with a small number of toxicologic studies that just began to elucidate the mechanisms of chronic PM effects on CVD, using chronic exposures in animals with underlying metabolic abnormalities. In a susceptible animal model of Watanabe heritable hyperlipidemic rabbits , instillarticles , after e10 after excluding those who had physician-diagnosed hypertension or diabetes mellitus, two clinical conditions with presumably high degrees of systemic inflammation. Interestingly, recent analyses of the Women’s Health Initiative Observational Study cohort data showed that women with prior hypertension or diabetes did not have heightened risks for CVD-associated long-term PM2.5 exposure when compared with women with no hypertension or diabetes , althougdiabetes . These d10 exposure before the laboratory examination cannot be interpreted as definitely causal without any caution. Although we could not provide any good reasons why individuals with preexisting normal but relatively low WBC counts might have preferred or chosen to live in clear air communities, it is statistically arguable that residents from clean air communities might happen to have WBC counts lower than others at baseline. Second, although we have adjusted for a large set of individual-level confounders and some other residential characteristics, we could not rule out the possibility of unmeasured confounding. Because WBC count is a sensitive hematologic marker for various physical and psychosocial stressors, future studies may need to consider other contextual features of the residential environment that are associated with CVD risks and may also covary with ambient air pollution levels. Third, using historical environmental monitoring data as the only information source for an individual-level exposure assignment, we were unable to relate the spatial difference in WBC count to other related features of ambient PM exposure beyond the varying PM10 levels across the communities. For instance, we did not know whether there were similar associations with long-term exposure to ambient PM of different size characterization . Although the effects of other copollutants were not the focus of the present study, we did conduct some additional analyses and did not find associations between WBC count and estimated levels of other ambient air pollutants, including O3, NO2, and SO2 (data not shown). Fourth, because no nationwide PM speciation data were available for 1988–1991, we failed to identify specific constituents or investigate any important PM10 sources responsible for the putative long-term inflammatory responses to ambient air particles. Given that so much of the observed exposure variability (94%) is dominated by PM10 gradients across communities, our study findings may imply some inflammatory responses induced by exposure to long-term PM of regional sources. Although earlier cohort analyses on cardiopulmonary mortality spoke to the importance of regional-scale PM sources, more recent studies were able to show the effect on CVD across PM gradients within cities for whom both daily and 1-year PM10 data were available concurrently with the WBC measurement, making it impractical to jointly model the presumably independent effects of daily and annual average PM10 exposures. Nonetheless, we noted in our restricted sample that the correlation coefficient between daily and 1-year PM10 estimates was 0.09. This empirically modest correlation suggests that short-term PM exposure contributes only a small portion, if any, of the overall inflammatory response to long-term repeated PM exposure. Finally, increased WBC count is a nonspecific hematologic marker of inflammation. Future epidemiologic data on more specific molecular markers are needed to confirm previous animal and in vitro studies.We recognize that our secondary data analysis has the following limitations that call for future studies to fully address them: First, because of its cross-sectional design, the observed association between increased WBC count and estimated 1-year PMn cities , suggest10-related spatial difference in WBC count in our study denotes the presence of inflammatory responses involved in either the development or progression of CVD associated with long-term PM exposure. The observed increasing inflammatory response across subpopulations with more MS component abnormalities supports the concept of MS-dependent susceptibility to PM-associated long-term cardiovascular effects.The consistent PM
While this can be tested empirically, results will not be available for years. Here we use a mathematical model to predict results with different graduation strategies in three African countries.Repeated mass azithromycin distributions are effective in controlling the ocular strains of chlamydia that cause trachoma. However, it is unclear when treatments can be discontinued. Investigators have proposed A stochastic model of trachoma transmission was constructed, using the parameters with the maximum likelihood of obtaining results observed from studies in Tanzania (with 16% infection in children pre-treatment), The Gambia (9%), and Ethiopia (64%). The expected prevalence of infection at 3 years was obtained, given different thresholds for graduation and varying the characteristics of the diagnostic test.graduate when the prevalence of infection falls below 5%, then the mean prevalence at 3 years with the new strategy would be 0.3%, 3.9%, and 14.4%, respectively. Graduations reduced antibiotic usage by 63% in Tanzania, 56% in The Gambia, and 11% in Ethiopia.The model projects that three annual treatments at 80% coverage would reduce the mean prevalence of infection to 0.03% in Tanzanian, 2.4% in Gambian, and 12.9% in the Ethiopian communities. If communities Models suggest that graduating communities from a program when the infection is reduced to 5% is a reasonable strategy and could reduce the amount of antibiotic distributed in some areas by more than 2-fold. Chlamydia trachomatis lead to a cascade of conjunctival scarring, in-turned eyelids and eyelashes, and eventually blindness due to corneal opacity. To reduce the prevalence of infection, the World Health Organization (WHO) advocates at least three annual community-wide distributions of oral antibiotics in affected areas. This approach has proven effective, but there is room to explore other treatment strategies which reduce the use of antibiotics. Here, we used mathematical models and data from three trachoma-endemic countries to analyze different treatment strategies. In the simulations, we show that a graduation strategy can reduce antibiotic distributions more than 2-fold in moderately affected areas. Both treatment strategies provide favorable results in reducing the prevalence of ocular chlamydia, but high costs and the potential for resistance are important issues to consider when administering mass doses of antibiotics.Trachoma, the major cause of infectious blindness in the world, occurs when repeated infections of the ocular strains of Estimates of the prevalence of infection using PCR-based tests can be made more cost-effective by sampling individuals within communities and by pooling several samples into one test Data were collected in three countries at baseline, and 2 and 6 months after treatment as previously described Susceptible, Infected, Susceptible) of ocular chlamydial infection in a core group of children i infected individuals in the population at time t (where i varies from 0 to N). At scheduled treatments, we assumed that each infected individual had an 80% chance of being treated (the WHO-recommended coverage rate), and if treated would revert to being susceptible. Between periodic mass treatments, the model is a standard continuous time Markov process. We assumed equilibrium at baseline, that infected individuals recover naturally at rate γ, that uninfected individuals become infected at rate β I/N from sources within the community (with β = 0R·γ), and at a rate of ν from outside the community (with ν decreasing to zero once wide-spread programs have begun), leading to the following set of N+1 Kolmogorov-forward equations:Previously, we constructed a simple stochastic SIS model . Note that R0 is defined as the mean number of secondary infectious cases caused by a single infectious case in an otherwise completely susceptible community c of being treated (the effective coverage), with the number of infections post treatment being drawn from the corresponding binomial distribution.For clarity, we expressed 0R, standard deviation of 0R (thus treating 0R as a random effect), γ, and ν that maximized the probability of obtaining the observed baseline and 6-month data for that country (i.e. the likelihood) were determined using an iterative, hill-climbing algorithm. Numerical optimizations were repeated a minimum of 4 times from random starting points ; each iteration converged to the same value. Furthermore, a grid search did not reveal any greater maxima.Parameters for this stochastic model were fitted to baseline and 6-month data for each country using maximum likelihood estimation. We initiated simulations at the average prevalence for that region, and simulated the Kolmogorov-forward equations for 40 years to allow the distribution of prevalence to approximate the pre-treatment distribution at time point zero. We also initiated the model at the observed 2-month prevalence and simulated the equations for 4 months to estimate the expected distribution of prevalence at 6-months. The total log-likelihood was the sum of the baseline and the 6 month log-likelihoods for each of the communities in the area. Note that any event that occurred between baseline and 2-months would not bias these results ν = 0, because in each country, a community went from 0 infections at 2 months to >0 infections at 6 months). Coverage was assumed to be 80%, and the average population size was set at the mean of empirical results from the surveyed communities in that region , the recovery rate, γ, and the exogenous infection rate, ν, are displayed for the data sets from each country, along with the 95% confidence intervals for these parameter estimates. The Ethiopian data resulted in the highest estimated mean 0R, while the largest coefficient of variation for 0R was found in The Gambia, consistent with the observed heterogeneity between villages found there. The exogenous infection rate is dependent not only on the overall prevalence of infection in an area, but the proximity of the defined communities in each country.Characteristics of the observed data from the three countries are shown in The WHO-recommended strategy of three annual mass treatments resulted in an estimated mean prevalence of 0.0% in Tanzanian, 2.4% in Gambian, and 12.9% in Ethiopian communities at three years . In addi0R, recovery rate, and the exogenous rate . The results confirm that there is likely some variability between neighboring communities even beyond that which would be expected by chance. Incorporating further mixing structure, for example preferential mixing within a household, might create more variance between simulated communities, reducing the need to introduce a random effect at the community-level as we have done here. The graduation strategy appears to be effective over a wide range of parameter choices in the Tanzanian and the Gambian communities studied here. More endemic areas such as those found in Ethiopia, appear more sensitive to parameter choices, and are far more vulnerable to reinfection.Mathematical models of trachoma control can be useful in determining optimal distribution strategies, and predicting what is expected from specific programs. Stochastic models have an advantage over deterministic models in this setting, because they include the effect of chance seen with the low levels of infection in communities near elimination. Models must also include variation between regions, since strategies that have proven effective in hypo-endemic areas may not translate to hyper-endemic areas. Models should also include variation between communities in the same region. To incorporate this community variation into a realistic model, we included a community-level random effect in transmission —other assumptions such as density dependent transmission are also possible. Finally, we have assumed that treatment of children on a given visit is independent of past treatment history. Were treatments to miss the same 20% of children each time, then infection might linger longer in this subgroup.There is a long history of the use of mathematical models of the transmission of infectious diseases. These are often used to make theoretical points, which do not require precise parameter estimates. Even when parameters are fitted to data, they are rarely fitted to data from more than one community. Community trials in trachoma control have provided longitudinal prevalence data in 14–16 communities in each of three sub-Saharan African countries. There are still many limitations of this simple model which can be explored in the future. We have included only transmission in children, the age group known to harbor most of the infection, but adults could be included with available data. We have assumed that individuals do not gain or lose immunity over the 3 year program, and that there is no antibiotic resistance; the importance of these factors has been debated Repeated mass oral azithromycin distribution will be effective in reducing the prevalence of ocular chlamydia. But distribution costs are high, and side effects and the potential for resistance are important issues. Graduating communities when diagnostic testing reveals a prevalence of ocular chlamydia of 5% or less appears to be an appropriate strategy in most areas. More frequent treatment and different stopping rules may be required for more hyper-endemic areas similar to the region of Ethiopia studied here.
Surface lightness perception is affected by scene interpretation. There is some experimental evidence that perceived lightness under bi-ocular viewing conditions is different from perceived lightness in actual scenes but there are also reports that viewing conditions have little or no effect on perceived color. We investigated how mixes of depth cues affect perception of lightness in three-dimensional rendered scenes containing strong gradients of illumination in depth.Observers viewed a virtual room (4 m width×5 m height×17.5 m depth) with checkerboard walls and floor. In four conditions, the room was presented with or without binocular disparity (BD) depth cues and with or without motion parallax (MP) depth cues. In all conditions, observers were asked to adjust the luminance of a comparison surface to match the lightness of test surfaces placed at seven different depths (8.5–17.5 m) in the scene. We estimated lightness versus depth profiles in all four depth cue conditions. Even when observers had only pictorial depth cues , they partially but significantly discounted the illumination gradient in judging lightness. Adding either MP or BD led to significantly greater discounting and both cues together produced the greatest discounting. The effects of MP and BD were approximately additive. BD had greater influence at near distances than far.These results suggest the surface lightness perception is modulated by three-dimensional perception/interpretation using pictorial, binocular-disparity, and motion-parallax cues additively. We propose a two-stage (2D and 3D) processing model for lightness perception. Much previous research concerning lightness perception makes use of stimuli that are effectively pictures of scenes, but viewed with both eyes. With scenes viewed “bi-ocularly” in this way, there is potential conflict between pictorial cues to depth and depth cues such as binocular disparity and motion parallax that are consistent with the flat surface of the picture viewed of a three-dimensional scene with both eyes In this paper we first describe why the depth interpretation of a scene should affect surface lightness perception when the flow of light in the scene is not uniform. Next we review the literature concerning lightness perception in three-dimensional scenes and examine what role specific depth cues play in experimental design. We then report an experiment contrasting bi-ocular perception of three-dimensional scenes with viewing of identical scenes with binocular disparity and/or motion parallax cues to depth also available. The scenes all had strong gradients of illumination in depth. To anticipate our conclusion, we find that added depth cues markedly alter lightness perception and lead to an increased degree of lightness constancy.light fieldIf we could insert a neutral matte surface patch at different locations in the scene pictured in In this article we are concerned only with neutral lights and achromatic surfaces and, consequently, we can characterize a matte surface patch by its albedo and the light field as the intensity of light arriving at each point in the scene from every possible direction. In Stable estimation of surface albedo (lightness) in complex, three-dimensional scenes requires that the visual system effectively discount this spatially-varying light field. Errors in judging either the spatial layout of the scene or the light field can potentially lead to failures in lightness constancy. We should note that we do not use the term “discounting of the illumination” to imply that observers have completely discounted the effect of variation in illumination or achieved perfect lightness constancy. We use it in a graded sense where we expect that the visual system attenuates but does not completely eliminate differences in illumination. Though we do not employ them here, this sense of the term is consistent with use of the Brunswick ratio or Thouless ratio as a graded measure of the visual system's success in discounting the illumination Based on earlier work The interpretation of a scene is typically the result of combining multiple cues to depth and shape Many of the articles cited compare monocular and binocular viewing of stimuli In contrast, other studies altered real or rendered scenes without changing the available mix of depth cues Viewed in detail then, the experiments summarized above vary any of three different factors across conditions (1) the mix of depth cues used, (2) whether the cues are in conflict or not, and (3) actual changes in location and orientation within real or rendered scenes.The results just reviewed demonstrate that, in many scenes, perceived depth affects perceived lightness. In this article we go beyond this result to examine whether different mixes of depth cues affect lightness. We presented observers with the same simulated scenes rendered by computer graphics methods but alter the mix and consistency of available depth cues. Pictorial cues were always present, and we systematically added or removed binocular disparity (BD) and motion parallax depth cues (MP).One evident possibility is that the mix of depth cues present in a scene cues play little or no role. This is the hypothesis we test. This hypothesis is effectively assumed by several of the studies above which compare across conditions with different mixes of depth cues.Seven undergraduate and graduate students participated in the experiment. All observers gave informed consent in writing. None of them were aware of the purpose of the experiment and all had normal eye acuity and normal stereo vision.Visual stimuli were generated and controlled by a computer with the Open GL 1.0 graphics library. Stimuli were presented on a 21 inch CRT display . We corrected the display for nonlinear gun responses using a standard gamma correction procedure.Participants observed the display at 40 cm viewing distance with a chin-rest. Field-sequential shutter goggles were used for binocular stereo viewing. The visual image for left or right eye was presented alternatively at 100 Hz (50 Hz for each-eye image).We created a virtual room (4 m width×5 m height×17.5 m depth) with checkerboard walls and floor , 4. In t2 independent of position. Observers reported no difficulty in making lightness matches. The comparison surface did not appear self-luminous to the experimenters at any distance in any of the conditions in the experiment. The luminance of white checkers around the center of the back wall was more than 50 cd/m2. The actual luminance profile of a white surface is shown in A test surface (0.5×0.5 m square patch) was put on a vertical pole (0.2 m diameter×1.0 m height) at 7 different positions in depth . Its retinal size was dependent on the distance from the observer . The pole supporting the test surface was rendered separately from the rest of the scene so as to avoid a possible local contrast cue where the pole joined the test surface. As a consequence, the shading on the pole is a pictorial cue that did not vary across depths and conditions and was not consistent with the lighting of the remainder of the scene. However, the resulting cue conflict should not affect comparisons across conditions in any important way because all conditions included the same pictorial cues. The test surface was independently illuminated at 4, 8, or 16 cd/mThe scene was presented with or without binocular disparity (BD) cues to depth and with or without motion parallax (MP) cues to depth. Thus, there were 4 depth cue conditions, in total: Pictorial cues (PC) alone, PC+MP, PC+BD and PC+MP+BD. Binocular disparity was calculated by assuming that the observer's between-eye distance was 6 cm, and presented with a field-sequential shutter goggle. The participant observed all trials through the shutter goggle even when BD was not present. In the PC condition and the PC+MP conditions, the observer viewed the scene with both eyes but with binocular disparity depth cues set to zero disparity (bi-ocular viewing).Motion parallax was simulated by moving the virtual viewpoint back and forth horizontally (1.0 m distance at 0.4 Hz). Thus, actually the room rotated on the display. We did not employ the head-yoked method The test surface was centered on a line perpendicular to the screen from the midpoint between the observer's eyes. The test surface always had zero disparity and remained almost stationary on the display even with motion parallax.Observers were asked to adjust the luminance of a comparison surface so that the comparison surface matched the test surface in lightness. The test surface was placed at any of seven different depths in the scene. The comparison surface (1.91 deg×1.91 deg) was presented in the same location outside of the room scene and surrounded by a black background . Its lumThe duration of a trial was not limited and the participant observed the stimulus till he/she made a judgment. After the judgment, the next trial followed. Each participant performed 10 repetitions of combinations of 4 depth cue conditions, 3 levels of the test surface luminance, and 7 different depths in a random order . The stimulus array is shown in This research was approved by the Committee for Human-Subject Studies of the Toyohashi University of Technology.We plotted the logarithm to base 10 of luminance setting of the test surface against the distance between the surface and the observer , 7. We rCL when it is set to match a test surface of constant luminance, TL. We assume that (1) the comparison patch is perceived as a surface of adjustable albedo αˆC under a constant but unknown illumination ÊC and (2) the test patch is perceived as a surface of albedo αˆT under an illumination ÊT that varies with depth. The luminance settings then correspond to LˆT = ÊTαˆT and LˆC = ÊCαˆC and (3) if observers do follow instruction and set αˆC = αˆT (surface lightness match), We haveLˆT is held constant by the experimenter and ÊC is assumed to be constant,a is a constant anda′ is a constant. Moreover, sinceLˆT is constant, we havea″ is a constant. If the observer is following instructions then the profiles in We next show that we can interpret the profiles are the relative perceived albedo of the test surface in logarithmic units as a function of depth. The values plotted on the vertical axis in Consequently, with the assumptions just stated, we can interpret the profiles in F = 43.063, p<.0001). That is, the test surface is perceived as lighter when it is near the observer. The largest difference induced by changes in the mix of depth cues occurs when the test patch is nearest to the observer (8.5 m). The increase in perceived lightness in going from pictorial cues alone to pictorial cues+MP+BD is about a 38% change in perceived lightness, with a surface perceived as albedo 0.5 at 16.0 m with only pictorial cues equivalent to surface of almost 0.7 with pictorial cues+MP+BD at 8.5 m. Since the scene had a strong gradient of illumination (darker in near depth to brighter in far), the result indicates observers partially discounted the illumination gradient in judging lightness, but much less than would be consistent with the actual luminance profile = 5.791, p<.001; Interaction of motion parallax and distance = 13.13, p<.0001). Thus, both depth cues enhanced discounting of three-dimensional illumination.For all conditions, the perceived lightness decreased as the distance of the surface away from the observer increased = 5.207, p<.0001). This might be because the brightest surface was perceived as self-luminous, independent of the room illumination. However, as noted above, none of the surfaces appeared self-luminous to the experimenters.Illumination discounting was better with 4 and 8 cd/mEven when observers had only pictorial depth cues and viewed the scene bi-ocularly , they partially but significantly discounted the illumination gradient in judging lightness. Adding either MP or BD led to greater discounting and both cues together significantly greater discounting. The effects of MP and BD were approximately additive across depths.In p<.05).To quantify the discounting of illumination, we applied regression analysis to obtain the slope of perceived log lightness against depth. We plotted the value of slopes for each depth-cue condition against test-patch luminance . If this2 luminance surfaces than 16 cd/m2 surface = 10.96, p<.01; post-hoc analysis Fisher's PLSD p<.05). This outcome is consistent with the previous analysis: discounting was weakened with the brightest test surface. The slope was steeper with BD or MP = 18.15, p<.01, main effect of MP F = 29.34, p<.01). This confirmed that binocular disparity and motion parallax led to increased discounting of the illumination gradient.A three-way repeated-measures ANOVA for the slopes was conducted. The slope was steeper with 4 and 8 cd/mTo test the significance of the differences between depth cue conditions, we conducted paired t-tests for each pair of slopes and report the results in In three-dimensional scenes composed of neutral light sources and achromatic surfaces, the luminance of a matte surface depends on both its surface albedo and its location and orientation with respect to the light field across the scene. Stable estimation of albedo presupposes that the visual system takes into account the location and orientation of surfaces in such scenes. There is considerable experimental evidence that it does so However, much research in lightness concerns pictorial scenes viewed bi-ocularly. The pictorial cues in the scene may signal variations in depth but binocular disparity cues signal, correctly, that the observer is looking at the flat surface of a picture. Logvinenko and colleagues In the study reported here all cues were consistent with each another and with a single scene. Observers viewed a virtual room (4 m wide×5 m high×17.5 m deep). The walls and floors were covered with a checkerboard texture providing pictorial depth cues including linear perspective and texture gradient In all conditions, observers were asked to adjust the luminance of a comparison surface to match the lightness of test surfaces placed at seven different depths (8.5–17.5 m) in the scene. We estimated lightness versus depth profiles in all four depth cue conditions. Even when observers had only pictorial depth cues, they partially but significantly discounted the illumination gradient in judging lightness. Adding either of the MP or BD cues led to significantly greater discounting and discounting was greatest with all cues combined.A first implication of these results concerns experimental method. The perception of perceived surface albedo (lightness) with monocular viewing of scenes defined by pictorial cues alone is different from that in scenes with a richer mix of available depth cues that better approximate everyday viewing conditions. Observers showed a greater degree of discounting in binocularly viewed scenes with pictorial cues supplemented by motion parallax and binocular disparity. This outcome suggests that experiments that use only pictorial cues may lead to underestimates of the human ability to discount illumination in three-dimensional scenes.Second, the differences in the perceived albedo (lightness) of constant-luminance stimuli increased markedly with distance from the observer. The largest difference was a 38% increase in perceived albedo and differences are both highly significant and patterned. Note, however, we tested surfaces that varied in depth from 8.5 m to 17.5 m. Had we confined attention to a narrower range we would have reported a smaller effect. However, this result suggests that experiments concerning lightness and color perception in three-dimensional scenes should include stimuli at a wide range of depths.Last, we address the key issue raised by our results. Why should adding consistent depth cues to the mix of cues available in a scene alter perception of surface lightness and the inferred illumination gradient?Could the effect we find be simply due to changes in perceived depth induced by changes in the mix of depth cues? If, for example, simultaneous contrast diminished with increasing separation between test and background, then changes in perceived depth due to changes in depth cue mix could lead to changes in perceived lightness. Snyder, Doerschner & Maloney steeper if plotted versus foreshortened perceived depth with pictorial cues only.When consistent cues are added to the mix of depth cues a scene, the resulting estimates of spatial organization are affected in two ways. The first is an increase in perceived depth in scenes viewed with addition of MP, BD or MP+BD that was evident to all observers. With pictorial cues alone, observers perceive a narrower range of depth as well as a shallower inferred illumination gradient. This effect is consistent with other reports of reduced lightness constancy with pictorial scenes The second way in which addition of consistent cues to the mix of depth cues in a scene could affect perceived spatial organization is best framed in terms of models statistical cue combination Models of perception based on Bayesian decision theory Bayesian decision theory provides a particular method for combining sensory information (“cues”) represented by a likelihood function with a prior probability distribution to arrive at estimates of parameters that describe the scene viewed. The prior on light fields represents information on the likely light fields that might be present in a scene. Mamassian & Landy s. Of course the visual system must simultaneously estimate other parameters describing the light field including parameters that characterize absolute light intensity and parameters that control segmentation of the scene into regions differing in illumination. Moreover, two or more parameters may be needed to characterize the gradient in depth. For illustrative purposes, we focus on the estimation of the gradient of light intensity with the assumption that a single parameter s is sufficient.The relevant component of the prior in the context of the current article is the probability of different gradients of illumination in depth. Some examples of possible gradients are shown in The observed effect of adding depth cues is consistent with the claim that added depth cues lead to a more reliable (lower variance) estimate of the light field and that cues to the light field available in the scene are combined with a prior distribution on the light field that favors uniform illumination in depth s = 0, . Similars = 0 corresponds to the uniform (flat) gradient shown in red and that the prior distribution on s is Gaussian with mean 0 and variance s = 0 but with decreasing biases as the number of depth cues increases, the observed pattern.If the model we are proposing is correct, then the curves in Consequently we make the following conjectures that can be tested experimentally. (1) Changing the reliability of a single depth cue (without adding or subtracting depth cues) should also alter perceived lightness in scenes with strong gradients of illumination in depth and (2) in scenes where the actual gradient of illumination decreases with distance from the viewer, there should be a similar ‘flattening’ of the inferred gradient of illumination as depth cues are removed.Bayesian approaches to perception are based on the assumption that the visual system makes use of prior probability distributions of possible scenes that could be innate or based on the statistics of past visual experience There is now more than sufficient evidence to show that the visual system uses cues to three-dimensional spatial organization in estimating surface color and lightness and that studies restricted to flat, pictorial stimuli (‘the Mondrian singularity’ discussed by Our results suggest that there is a profound interaction between cues to location (including depth) and orientation on the one hand and perceived lightness on the other. This interaction raises the possibility that traditional accounts of lightness perception in pictorial stimuli will not readily generalize to three-dimensional scenes, a point made recently in a different context by Logvinenko, Petrini & Maloney Our results have implications for estimation of surface properties other than lightness. Recently, Motoyoshi and colleagues reported that image histogram moments account for the perception of lightness and glossiness of surfaces in nearly-flat scenes viewed binocularly The differences in outcome in these two experiments (and many others) suggest a two stage model of processing of lightness and depth information .We refer to the first stage as “2D processing”, where contrast/assimilation and image statistics control surface lightness and the scene is treated as effectively a flat image. In 2D processing, information such as IHM are available and can be used in estimating lightness and surface properties; 2D processing does not make use of the 3D interpretation of the scene and can also be described as “image-based” or “pictorial.” 2D processing is followed by a second stage (“3D processing”) wherein the 3D interpretation of the scene and the light field are both used to correct lightness perception for variations in the light field with changes in surface location and orientation in the scene. In scenes that are nearly-flat and uniformly illuminated, it is plausible that 2D processing based on IHM or other simple image statistics could account for observed variation in lightness perception . In 3D scenes with non-uniform light fields, however, we would expect that IHM statistics alone would not adequately account for perceived lightness and material properties. The results presented here and in other studies discussed above demonstrate that IMH statistics alone cannot account for lightness perception. Similarly, Ho and colleagues find that perception of surface roughness also depends on surface depth and orientation and the light field We conjecture that, in scenes with considerable variation in depth and surface orientation, subjects' estimates of surface gloss will vary in ways that cannot be readily explained in terms of IHM statistics as proposed by Motoyoshi et al. Second, to the extent that image moments are available earlier than a full scene interpretation in visual processing, we might expect that perception of surface lightness and other material properties will be less influenced by binocular disparity and motion parallax cues in 3D scenes that are briefly presented and masked.One last point: we have presented the model above as if 2D processing preceded 3D processing, an assumption we consider plausible but by no means established. It may be that at least part of 2D processing associated with picture interpretation could occur late in visual processing. If so, one could as plausibly argue that an overall appearance is first determined by 3D scene interpretation and then modulated by 2D material cues such as IHM. An investigation of the time course of color and material perception could aid in better understanding how visual information about depth, orientation and light is combined in estimating lightness and other material properties.
Cannabinoids, the active components of marijuana, stimulate appetite, and cannabinoid receptor-1 (CB1-R) antagonists suppress appetite and promote weight loss. Little is known about how CB1-R antagonists affect the central neurocircuitry, specifically the melanocortin system that regulates energy balance.y , which lack a functional melanocortin system, and wildtype mice, demonstrating that cannabinoid effects on feeding do not require melanocortin circuitry. CB1-R antagonist or agonist administered into the ventral tegmental area (VTA) equally suppressed or stimulated feeding respectively, in both genotypes. In addition, peripheral and central cannabinoid administration similarly induced c-Fos activation in brain sites suggesting mediation via motivational dopaminergic circuitry. Amperometry-detected increases in evoked dopamine (DA) release by the CB1-R antagonist in nucleus accumbens slices indicates that AM251 modulates DA release from VTA terminals.Here, we show that peripherally administered CB1-R antagonist (AM251) or agonist equally suppressed or stimulated feeding respectively in AOur results demonstrate that the effects of cannabinoids on energy balance are independent of hypothalamic melanocortin circuitry and is primarily driven by the reward system. Obesity is a major health epidemic in developed nations. Obesity has been implicated in the etiologies of both type 2 diabetes and cardiovascular disease Central melanocortin pathways play a pivotal role in regulating appetite and energy balance. Proopiomelanocortin (POMC) neurons in the arcuate nucleus of the hypothalamus (ARH) produce the peptide α-MSH which binds to and activates melanocortin-4 receptors (MC4-R) in vitroRecent work has demonstrated that the CB1-R antagonist AM251-an analogue of Rimonabant-increases GABAergic inhibition onto POMC neurons Cannabinoids clearly exert effects on reward and motivation. The nucleus accumbens (NAc), a region involved in reward, is an important mediator of appetite y) mice. Ay mice over-express Agouti protein, an endogenous inverse agonist of MC3 and MC4 receptors, offering a convenient model of melanocortin antagonism. This study reports that feeding behavior mediated by the cannabinoid system is independent of the melanocortin system and that dopaminergic reward pathways likely play a fundamental role in cannabinoid-induced feeding.To investigate whether the melanocortin system is involved in central cannabinoid effects on appetite, we studied the effects of a CB1-R antagonist AM251 and a non-selective agonist WIN 55,212-2 on feeding behavior in agouti yellow were individually housed under a 12 h light/dark cycle and constant temperature (23°C). Standard chow and water were available ad libitum except where noted.All animal procedures were approved by the Oregon National Primate Research Center Institutional Animal Care and Use Committee. Adult male C57BL/6J mice (WT) and Agouti B6.Cg-AAll drugs were freshly prepared on day of use. AM251 (Tocris) and WIN 55,212-2 (Tocris) were dissolved in 10% dimethyl sulfoxide (DMSO) and sterile nonpyrogenic 0.9% NaCl. Drugs were administered intraperitoneally (IP) in a volume of 0.1±0.02 mL (according to body weight) for feeding tests. Control mice received vehicle in a corresponding volume containing 10% DMSO and sterile saline.2/6H2O, 2.4 CaCl2/2H2O, 1.2 NaH2PO4/H2O, 21.4 NaHCO3 and 11.1 glucose (saturated with 95% O2/5% CO2). A block of hypothalamic tissue containing the ARH was dissected and coronal slices (185 µm) were cut with a vibrating slicer (Leica VT1000S). Slices were stored for at least 1 h in a holding chamber with ACSF at room temperature and continuously bubbled with 95% O2/5% CO2. Individual slices were submerged in a recording chamber and superfused continuously with carbogenated ACSF at 35°C (3–5 mL/min). To record IPSCs, excitatory currents were blocked with TTX , D-AP5 and CNQX . To record EPSCs, inhibitory currents were blocked with TTX and picrotoxin .Coronal hypothalamic slices containing the arcuate nucleus (ARH) were prepared from 8 week-old male POMC-EGFP mice as described previously 2, 2 (Mg)ATP, 0.5 (Na)GTP; EPSCs: 132 K-gluconate, 4 NaCl, 0.5 CaCl2,. 10 HEPES, 5 EGTA-free, 4 (Mg)ATP, 0.5 (Na)GTP. Whole cell voltage clamp configuration was used. Data were filtered at 2 kHz and then sampled at 50–100 kHz by pClamp 8.2 software (Axon Instruments). Data were analyzed using Minianalysis .Recordings were made from arcuate POMC neurons, identified by bright green fluorescence Twenty four C57BL/6J ∼6 wk-old mice were used. α-MSH release assays was performed as previously described α-MSH radioimmunoreactivity (RIA) was measured as previously described y (n = 14) and WT (n = 14) C57BL/6J mice were age- and weight-matched and randomly assigned to treatment groups. To study the effects of WIN 55,212-2, mice were not fasted prior to IP injection in the morning. To determine the effects of AM251, mice were fasted overnight prior to treatment and given ad libitum access to a predetermined amount of food immediately after IP injection with AM251 (5 mg/kg) or saline vehicle. Food intake was recorded at 1, 2, 4, 8, and 24 hour intervals and normalized to wild-type saline control.Individually housed mice were habituated to the behavioral testing procedure by daily IP injections of 0.1 mL sterile saline and overnight fasting every third day for at least 2 weeks prior to treatment. Young male (6–8 weeks) Ay (n = 8) mice were anesthetized with pentobarbital . The head of the mouse was shaved and aligned in a stereotaxic apparatus such that lambda-bregma plane was horizontal. The head was cleaned with betadine and an incision made with a sterile scalpel. A hole was made according to the following co-ordinates for VTA: 3.5 mm caudal, 0.4 mm lateral and 3.0 mm ventral Adult (6–8 weeks) WT (n = 8) and Ay and WT mice were perfused with 4% paraformaldehyde 90 min after IP injection with saline-DMSO (n = 3), WIN 55,212-2 or AM251 . In this study, food was not returned to fasted animals after WIN 55,212-2 treatment. Another group of male Ay and WT mice was perfused 90 min after intra-VTA injection with saline-DMSO (n = 3), WIN 55,212-2 or AM251 . Brains were removed and 25 µm coronal sections were cut in sets of 4 adjacent series. Free floating sections were rinsed in 0.05 M potassium PBS (KPBS), preincubated in blocking buffer, consisting of KPBS containing 0.4% Triton-X100 (KPBSX) and 2% donkey serum, for 1 hour. One complete set of sections was incubated in c-Fos primary rabbit antibody in blocking buffer for 48 h. Sections were then incubated with biotinylated donkey anti-rabbit antibody followed by avidin-biotin application . c-Fos IR was visualized using a chromagen label enhanced nickel chloride. Tissue sections were mounted on gelatin-coated glass slides, counterstained with cresyl violet and coverslipped.Male AFor immunohistochemistry of c-Fos and EGFP, detection of c-Fos was carried out as described above in POMC-EGFP mice. Following washes after chromagen detection, sections were incubated in rabbit anti-GFP antibody overnight at 4°C. Sections were then incubated with fluorescein-conjugated donkey anti-rabbit secondary antibody in 1 M KPBS for 2 hours. Sections were then washed, mounted and coverslipped using Fluoromount-G (Southern Biotech).For double-labeling of c-Fos and orexin or MCH, two complete sets of sections were used. One set was incubated with c-Fos antibody and a goat polyclonal antibody directed against the C-terminus of the human orexin-A peptide. The other set was incubated with c-Fos antibody and a chicken polyclonal antibody directed against the full length 18-residue human MCH peptide for 1 hour at room temperature followed by 48 hr at 4°C. Detection of c-Fos was carried out as described above. Following washes after chromagen detection, sections were incubated with fluorescein-conjugated donkey anti-goat or rhodamine-conjugated donkey anti-chicken fluorescent secondary antibodies in 1 M KPBS for 2 hours. Sections were then washed, mounted and coverslipped using Fluoromount-G (Southern Biotech).Depending on treatment, 9–11 brain regions and 4–6 sections for each region were examined using light microscopy (Nikon Eclipse E800 series microscope. Images were captured using a CoolSnapHQ camera system and Metamorph software (using 10Xobjective). Captured images were subsequently analyzed using Adobe Photoshop software, whereby a grid was placed over regions of interest and the number of labeled cells within a standardized area was counted manually by an investigator blind to the treatment group. A neuron was classified as c-Fos-positive when the nucleus was intensely stained black in colour and appeared either round or oval. Values were expressed as the mean number of c-Fos positive cells per section for each region. Regions analyzed were anatomically matched across all animals.The number of c-Fos, EGFP-positive cells or double-labeled (c-Fos and EGFP) cells were counted from 5 sections spanning the ARH, using both light microscopy for c-Fos and fluorescence for EGFP. Values are shown as the percentage of EGFP positive cells expressing c-Fos.The number of orexin or MCH neurons or double-labeled (orexin/c-Fos or MCH/c-Fos) cells were counted from 4–6 sections spanning the LH, using both light microscopy for c-Fos and fluorescence for orexin or MCH. Values are shown as the percentage of orexin neurons expressing c-Fos.2, 5% CO2) dissection solution containing (in mM): 210 sucrose, 3.5 KCl, 1 CaCl2 dihydrate, 4 MgCl2 hexahydrate, 1.25 NaH2PO4 hydrate, 10 glucose, and 26 NaHCO3. Coronal slices (300 µm) containing the nucleus accumbens, were cut using a vibratome. Following 1 hr recovery in carbogenated ACSF , each slice was transferred into a recording chamber maintained at 37°C. Slices were continually perfused with ACSF (1 ml/min). Carbon fiber amperometry was used to record the release of neurotransmitter. A disk carbon fiber electrode, 5 µm in diameter, was placed in the posterior nucleus accumbens shell at a depth of ∼50 µm. The reference electrode (Ag/AgCl wire) was inserted into the ACSF bath. Voltage was set to +700 mV (Axopatch 200B.). The bipolar stimulating electrode was placed within a distance of 200 µm from the carbon fiber electrode. A constant monophasic current stimulus was applied through the bipolar stimulating electrode with the following stimulation parameters: single rectangular pulse for 2 msec, +500 µA amplitude. For each slice, five single pulses were given in the nucleus accumbens shell at five-minute intervals while in the ACSF bath, then the slice was washed in 3 µM AM251 (in ACSF) for 30 min. After the wash, five more single pulses in five-minute intervals were given at the same location. Amperometric electrode recordings were monitored and quantified by a locally written routine on the Superscope II platform (GW Instruments). Data was acquired at 50 kHz and digitally postfiltered at 1 kHz. Background-subtracted cyclic voltammograms calibrate the electrodes and identify the released substance as DA. Mean of signal amplitudes, widths, and number of molecules in ACSF were compared to those following the 3 µM AM251 wash by 1-way ANOVA.Sprague Dawley male rats (3–5 weeks) were anesthetized with ketamine (200 mg/kg IP)/xylazine (20 mg/kg IP). Upon removal, the brain was immediately placed into ice-cold carbogenated and WIN 55,212-2 (3 µM) on POMC neurons using POMC-EGFP mice y mice. Intraperitoneal administration of the cannabinoid agonist WIN 55,212-2 (1 mg/kg) similarly increased 1-hour food intake by 80% in both Ay and WT mice = 9.40, P<0.0001; y and WT mice compared to saline = 16.53, P<0.0001; The role of the melanocortin circuitry in cannabinoid-modulated feeding was next tested by assessing differences in feeding behavior between wildtype (WT) and Ay and WT mice = 3.98, P = 0.016; y and WT mice = 3.98, P = 0.017; y mice respond normally to peripheral and central AM251 indicates that endogenous antagonism of MC3/4 receptors (in Ay mice) does not disrupt feeding responses to cannabinoids.Central administration of the cannabinoid agonist and antagonist produced comparable responses to those of peripheral administration. Intra-VTA WIN 55,212-2 administration increased 1-hour food intake in nonfasted A = 18.67, P<0.0001, = 23.45, P<0.0001), To further investigate the role of the VTA as a potential mediator of cannabinoid-induced feeding, we assessed whether disrupting cannabinoid signaling in the VTA would prevent systemic cannabinoid agonist from inducing hyperphagia. Intra-VTA AM251 prevented the increase in food intake induced by IP WIN 55,212-2 in non-fasted WT mice . Peripheral WIN 55,212-2 or AM251 did not induce significantly different patterns of cellular activation between the genotypes, indicating that the cannabinoid agonist and antagonist activate similar brain regions despite the absence of a functional melanocortin system. These data suggest that cannabinoids may produce their effects on feeding by activating both homeostatic regulators of feeding such as the LH and PVH and reward-based areas such as the CeA and NAc that integrate and relay various properties of food to drive feeding behavior.We performed c-Fos immunohistochemistry to determine the activation of central circuitry after peripheral (IP) administration of WIN 55,212-2 and AM251 in A WT mice . c-Fos eTo further examine the potential role of reward circuitry in cannabinoid effects, we injected cannabinoids directly into the VTA . Immunohy , p<0.05, y, y, p<0.05, y mice (data not shown). Intra-VTA cannabinoids activate appetite-stimulating orexin neurons and not MCH neurons, suggesting a specific delineation of roles with respect to regulation of cannabinoid effects.We further carried out double-labeling for c-Fos and orexin or MCH. Central CB1-R agonist administration produced a significant percentage of c-Fos positive orexin neurons in the LH = 13.35, P = 0.0005; = 31.07, P<0.0001) and evoked signal width = 5.09, P = 0.033; Because the reward circuitry is more likely than the melanocortin circuitry to be responsible for the effects of cannabinoids on feeding y mice in the feeding responses to either a CB1-R agonist or antagonist. Regional brain activation by either central (intra-VTA) or peripheral (IP) cannabinoid administration was nearly indistinguishable between genotypes. Our main findings demonstrate that functional central melanocortin circuitry is not required for cannabinoid-induced modulations in feeding behavior, but rather that activation of dopaminergic reward circuitry is involved in cannabinoid's effect on feeding.Cannabinoid effects on feeding are unaffected by the absence of a functional melanocortin system–no differences were observed between WT and Ain vitro is contrary to what would be predicted based on the known anorectic role of POMC neurons and the demonstrated effects of cannabinoid agonists and antagonists on feeding. If feeding inhibition induced by the CB1-R antagonist was mediated by increasing α-MSH release (therefore stimulating MC4-R), we would predict that AM251 would produce either a decrease in IPSC frequency or an increase in EPSC frequency onto POMC cells–which was not observed. Additionally, the CB1-R agonist WIN 55,212-2 reduced both spontaneous inhibitory and excitatory inputs onto POMC neurons, suggesting that cannabinoids may have little net effect on the excitability of POMC neurons. Our findings are consistent with those of Ho and colleagues in which a dose-dependent decrease in EPSC frequency was found with WIN 55,212-2 onto POMC neurons in the guinea pig ARH y mice.Our observation that a CB1-R antagonist related to Rimonabant increased inhibitory synaptic currents onto identified POMC cells fa/fa rats, and both ob/ob and Ay mice y mice the same amount as WT mice. Signalling through MC4R is abolished in both Ay and MC4R knockout mice; as with all genetic modifications, developmental compensation cannot be excluded. There are at least three likely reasons for this discrepancy between our data and that of Verty et al. (2004). The first is the mechanism of blockade of MC4 receptors. In the Ay mice, Agouti protein binds to the MC4-R and stabilizes it in its inactive conformation, rather than simply blocking the receptor in a competitive fashion Rimonabant and AM251 reliably decrease food intake and body weight in obese In humans, cannabinoids are involved in food orosensory-based reward. Subjects increase consumption of highly palatable foods in response to marijuana In our study, intra-VTA WIN 55, 212-2 injection increased c-Fos activation in the PVH, LH, PBN, and NTS. Intra-VTA AM251 significantly increased Fos-IR in several hypothalamic nuclei, including DMH and VMH, which was not observed with peripheral AM251, suggesting that cellular activation within these regions was due to downstream activation of the VTA. The DMH and VMH are targets of converging orexigenic and anorexigenic pathways Lesion studies have also indicated that the LH regulates ingestive behavior Our findings show that the CB1-R antagonist AM251 increased electrically evoked release of DA in NAc, in acute slices. It has been shown that CB1-R antagonists in the VTA decrease activity of DA neurons induced by a CB1-R agonist At the behavioral level, AM251 suppresses food intake in mice Rats with high motivation to initiate feeding (underweight food-deprived rats and dietary obese rats) have low, not high, basal extracellular dopamine in the NAc et al. (2004) In awake, behaving rats, Cheer y and WT mice. In addition, other reward-based sites such as the CeA and NAc are activated by peripheral cannabinoids in both Ay and WT mice. An intra-VTA CB1-R antagonist inhibits food intake, blocks the effect of systemic CB1 agonist, and local slice application of AM251modifies evoked DA release in the NAc, lending support to the hypothesis that activation of mesolimbic pathways is sufficient for many of effects of the cannabinoid antagonists.Our main result is that cannabinoids exert their effects on feeding via pathways that are independent of the melanocortin system. While other homeostatic hypothalamic regions such as the PVH, LH, VMH, and DMH are likely involved in mediating cannabinoid-induced feeding behavior, one of the key sites for transducing feeding signals–the arcuate nucleus–is likely not critical. Rather, the VTA-NAc axis may well drive feeding behavior induced by cannabinoids in both AFigure S1Effects of WIN 55,212-2 and AM251 on α-MSH release from POMC neurons of the hypothalamus. There was no significant effect on α-MSH release (fmol/ml) from POMC neurons by cannabinoids. All values are expressed as mean±SEM.(0.14 MB TIF)Click here for additional data file.Figure S2Effects of IP AM251 on c-Fos and POMC-EGFP co-localization in POMC-EGFP mice. ARH slices were stained for c-Fos and EGFP expression. c-Fos staining indicated in brightfield images and POMC-EGFP neurons shown in fluorescence (FITC-green). Red arrows indicate c-Fos and POMC-EGFP co-localized cells. A, c-Fos activation in response to IP saline; B, c-Fos and POMC co-localization in response to IP saline; C, c-Fos activation in response to IP AM251 (5 mg/kg); D, c-Fos and POMC co-localization in response to IP AM251. Scale bar, 100 µm. Quantification of immunohistochemical staining for c-Fos and POMC-EGFP co-localization in the ARH. E, c-Fos expression was increased significantly by AM251 between IP saline and AM251 treated groups; F, POMC-EGFP cells counts are not different between saline and AM251; G, Percentage of POMC cells expressing c-Fos IR. All values are expressed as mean±SEM.(1.73 MB TIF)Click here for additional data file.Figure S3Representative photomicrographs showing c-Fos IR in response to IP saline, WIN 55212-2 and AM251 administration in Ay mice. A, B, C, c-Fos activation in response to saline in the NAc, PVH and NTS. D, E, F, Increased c-Fos IR in response to IP WIN 55,212-2. G, H, I, c-Fos IR in response to IP AM251. ac, anterior commissure; 3V, third ventricle, AP, area postrema. Scale bar, 100 µm.(3.03 MB TIF)Click here for additional data file.Figure S4Representative photomicrographs showing c-Fos IR in response to intra-VTA administration of AM251 in the VMH and DMH in WT mice. Inset diagram is representative of VTA cannulation placement with the arrow indicating the tip of the guide cannula; the injector extends 1 mm further for injections. A, c-Fos IR in response to intra-VTA saline. B, c-Fos IR is markedly increased in the VMH and DMH in response to intra-VTA AM251. Scale bar, 100 µm.(1.04 MB TIF)Click here for additional data file.
In many cases, prediction of family membership and even substrate specificity is possible from enzyme sequence alone, using a nearest neighbour classification rule. However, the combination of structural information and sequence information can improve the interpretability and accuracy of predictive models. The method presented here, Active Site Classification (ASC), automatically extracts the residues lining the active site from one representative three-dimensional structure and the corresponding residues from sequences of other members of the family. From a set of representatives with known substrate specificity, a Support Vector Machine (SVM) can then learn a model of substrate specificity. Applied to a sequence of unknown specificity, the SVM can then predict the most likely substrate. The models can also be analysed to reveal the underlying structural reasons determining substrate specificities and thus yield valuable insights into mechanisms of enzyme specificity. We illustrate the high prediction accuracy achieved on two benchmark data sets and the structural insights gained from ASC by a detailed analysis of the family of decarboxylating dehydrogenases. The ASC web service is available at Prediction of enzymatic function of experimentally uncharacterised sequences is an important task in annotation of sequence databases. While all the information on an enzyme's specificity is necessarily contained in its sequence, prediction methods using sequence alone often do not perform all that well. Obviously, structural information – if available – will yield precious hints on the function and relative importance of specific sequence positions with respect to substrate specificity. We propose a novel method for enzyme classification bringing together structural information and sequence information. Our ASC web server allows users to build predictive models in an automated way focused on relevant enzyme residues and furthermore to interpret the models to gain insights into the mechanism of enzyme substrate specificity. The number of protein sequences in public databases has been growing almost exponentially due to great advances in sequencing technologies and a decline in sequencing costs. However, as the number of experimentally characterised sequences does not grow at the same speed, the fraction of protein sequences without any functional annotation also increases. An experimental investigation of all these new sequences would be too time-consuming and too costly. Consequently, the fraction of enzyme sequences in current databases with experimentally characterised function is around 5% only To predict the putative function of a protein, currently established methods rely on the fact that two proteins with similarities between their sequences have similar structures and also a similar function There were several studies that tried to find a critical point for the minimum degree of similarity that is required to make a transfer of function safe when using such sequence-based tools to infer enzymatic function by similarity et al.et al.et al. combined these approaches with Support Vector machines (SVMs) for classification and achieved significantly improved prediction performance Incorporation of structural information into the process of building a predictive model for enzyme specificity was also suggested by Stachelhaus et al.Similarly, the EFICAz method devised by Tian The recent extension of this method named EFICAz2 further added a SVM-based component built upon the positions of the query sequence aligned to the MSA of the enzyme family In this work, we propose a generalisation of the approach by Stachelhaus and Challis to base function predictions on active site residues and make it amenable to any enzyme family that has associated structural information. Thus, classification errors induced by using only the simple descriptor of global sequence identity, which often fails when predicting more distant sequences, could be ameliorated by the incorporation of additional structural information about the active site configuration of the enzymes. Our new approach, called Active Site Classification (ASC), can be used for a family of enzyme sequences where all members perform the same type of reaction but with different substrates. The only requirement is a training set of annotated sequences and one homologous crystal structure. The program will then train a SVM model that can be used to predict the specificity of unclassified sequences. Furthermore, the model can be used to infer which residues and properties are important for each sub-specificity.In the following sections we will show the very good performance of ASC on two benchmark data sets and that the performance gain is achieved by concentrating on the active site residues. We will also show how the determined ASC model can be used to learn more about the importance of each active site residue and interpret their putative function in the structural context of the active site.All sequences used in this study were extracted from the UniProt release 15.8 from September 2009 The first benchmark data set was used by Hannenhalli and Russel The second benchmark was extracted from a data set compiled by Capra and Singh The nearest neighbour classifier (1NN) is an instance-based classifier. The 1NN classifier makes predictions for a test data point SVMs are supervised classification models that can be used to train a classification model on a given set of et al.et al.Kernel methods like SVMs can also operate directly on the objects to classify without prior encoding of these objects into numerical feature vectors. This is made possible by the use of kernel functions that are defined on those objects and represent a similiarity measure. Within ASC we make use of several kernel functions that are defined on the set of signature sequences. The first one is a simple string kernel Importance of specific signature positions for the classifcation models can be either quantified by calculating the primal weight vector We evaluated the performance of our ASC method in a fashion similar to the evaluation of the EFICAz method by ensuring that the training set sequences are not too similar to the test sequences (according to sequence identity) The ASC method utilises SVMs to build a model that discriminates between two or more classes of enzymatic activity. It starts with training data in the form of sequences from each sub-specificity class and a PDB structure In a preprocessing step, all sequences with a sequence identity to the template that is too low , 3-isopropymalate (EC 1.1.1.85) or tartrate dehydrogenases (EC 1.1.1.93), respectively. EC class 1.1.1.83 contains enzymes that are also members of this family and utilise D-malate. But they were not included as a separate class in this set, since these enzymes seem to be equivalent to the enzymes from EC class 1.1.1.93. The tartrate enzymes readily utilise D-malate as substrate, according to the The two top-ranked features of the model discriminating isocitrate-specific enzymes from isopropylmalate-specific enzymes were residues Leu91 (accuracy = 98.2%) and Val193 (accuracy = 97.2%) in the template structure 1A05. The enzymes acting on isocitrate, with its charged At position Val193, the ICDH enzymes prefer an isoleucine whereas IPMDH enzymes prefer valine. One possible explanation for these preferences might be that the isocitrate The two most important residues in the model that discriminates between the substrates tartrate and isopropylmalate were Glu88 (accuracy = 100%) and Val193 (accuracy = 97%). Enzymes specific for tartrate or malate prefer the large amino acid tryptophan at the position corresponding to Glu88, whereas the enzymes specific for substrates with larger substituents at the http://asc.informatik.uni-tuebingen.de/.The whole workflow for combining sequence and structural data, building the classification model and interpreting the model parameters in the context of the enzyme's structure is made available to users by the means of a web service. ASC itself is implemented in C++ and makes use of the BALL library to process protein structures We have presented our new method ASC for enzyme sequence classification, which combines sequence data and structural data. By using structural information, we can focus the classification task on features that are most likely relevant for modulating substrate specificity, namely the residues lining the active site. The two benchmarks showed that classification accuracy can be clearly improved by concentrating on the extracted active site signatures and that this improvement is not simply due to the use of SVMs, because the ASC models also outperformed the SVM models trained on the full MSA in many cases. Futhermore, ASC also provides a ranking of the active site residues based on their influence on the decision function. The application of ASC on the benchmark data set by Hannenhalli showed that the set of residues found most relevant for the ASC classification model very often coincided with those residues found relevant by experimental analysis or detected by other computational methods like the sub-profile method. Unlike sequence based classification or FDR-determining methods, ASC had of course the advantage of using structural information and could pre-filter the list of putative specificity modulating residues. Therefore, a direct comparison with those methods would be unfair. However, we think that using this additional source of information is essential for building more accurate function prediction models.In general, one has to keep in mind that ASC can fail in cases where residues modulate specificity, that are not located in the vicinity of the active site, since the premise of ASC is to use only active site residues. This is not necessarily a limitation of the method though. The absence of any active site signature differences between enzymes with differing class labels can serve as an indication to search for allosteric influences on substrate specificity or to check if the annotation really is correct and both enzymes in reality may be utilising the same substrates or show some cross-specificity.Applications for our ASC method lie especially in the use of the trained models as predictors of enzymatic function within an enzyme family for sequences that are more remote to the training set and could be predicted more reliably using the extracted active site signatures. But also detection of new subtypes is possible by searching for novel active site signatures in the pool of all extracted signatues of an enzyme family with subsequent experimental validation. Regarding the applicability of ASC, even remote structural homologs might suffice to extract active site residues for novelty detection and classification purposes. Thus, ASC models might be built for many enzyme families to further improve annotation accuracy within current genome annotation pipelines.Moreover, one can try to verify experimentally the findings gathered in the model interpretation step by mutating residues found relevant to discriminate between two specificities to design mutated enzymes with reduced or even switched substrate specificity. This was exemplified by the dehydrogenase example where we could pinpoint the influence of the residues found relevant on a detailed structural level by inspecting the superimposed active sites of the two enzymes, thereby making predictions of the model more transparent. Finally, our ASC web service allows users to interpret the learned ASC model in the context of the template structure and can yield insight into the mechanisms of substrate specificity by focusing on residues in proximity to the active site and analysing the allowed sequence variation in the corresponding columns of the family MSA.Text S1ASC performance on Hannenhalli benchmark(0.08 MB PDF)Click here for additional data file.Text S2ASC performance on Capra benchmark(0.09 MB PDF)Click here for additional data file.Text S3ASC web server result page of NRPS dataset(0.19 MB PDF)Click here for additional data file.
Since synaptic plasticity is regarded as a potential mechanism for memory formation and learning, there is growing interest in the study of its underlying mechanisms. Recently several evolutionary models of cellular development have been presented, but none have been shown to be able to evolve a range of biological synaptic plasticity regimes. In this paper we present a biologically plausible evolutionary cellular development model and test its ability to evolve different biological synaptic plasticity regimes. The core of the model is a genomic and proteomic regulation network which controls cells and their neurites in a 2D environment. The model has previously been shown to successfully evolve behaving organisms, enable gene related phenomena, and produce biological neural mechanisms such as temporal representations. Several experiments are described in which the model evolves different synaptic plasticity regimes using a direct fitness function. Other experiments examine the ability of the model to evolve simple plasticity regimes in a task -based fitness function environment. These results suggest that such evolutionary cellular development models have the potential to be used as a research tool for investigating the evolutionary aspects of synaptic plasticity and at the same time can serve as the basis for novel artificial computational systems. Much recent effort has been directed towards understanding the mechanisms that underlie neural system development and plasticity by simulating biological processes at a time- scale of individual development. Intensive attempts are also under way to develop models that evolve artificial neural networks. However, most models evolving neural systems either lack the flexibility to handle a wide range of biological phenomena or do not have the requisite foundation to be considered biologically plausible.The most common encoding used to evolve neural networks from genotypes is known as “direct encoding” where the phenotype information is directly encoded in the genome Recently, several artificial evolutionary systems that incorporate a developmental phase have been presented. Various names have been suggested for such systems, including Artificial Ontogeny In In In A similar grammar-based model for generating a neural phenotype was presented in A model of neural network biological development based on a regulatory genome was presented in In A computational model of neurogenesis based on metabolitic processes was tested in However, the drawback of all the encodings presented above is that they are either not based on biological processes, or lack the multiple interactions among different developmental phenomena that result in the emergence of biologically plausible models. Thus, despite promising progress, none of these models has succeeded in replicating a wide range of biological phenomena, including ones that demonstrate synaptic plasticity.It has been argued elsewhere Synaptic plasticity has long been regarded as a potential mechanism for memory formation and learning. The most famous synaptic plasticity principle is known as Hebbian learning Over the last 30 years, a large body of experimental results on synaptic plasticity has been accumulated. The long- lasting enhancement of synaptic transmission, Long Term Potentiation (LTP) first reported in 1973 The field of evolutionary robotics provides interesting approaches to evolving synaptic plasticity. In In However, these models are usually not designed to be based on biological specifics either at the gene to protein transcription functionality level or at the level of neural mechanisms and are usually restricted to correlation based plasticity regimes alone. To this day no evolutionary biological model has been shown to have the ability to evolve different biological synaptic plasticity rules.In our previous papers, we presented an indirect encoding framework In this paper we examine the model's ability to evolve simple virtual organisms with different biological synaptic plasticity rules, and show that the model can evolve various plasticity regimes observed in nature.In the next sections we present an evolutionary simulation model. The first section describes the chromosome model that is based on DNA and protein-like sequences. Two such chromosomes can reproduce an offspring chromosome, as detailed in the More information about the framework, together with biological rationale for the model, can be found in Each organism in the model expresses a phenotype derived from a chromosome structured according to biological conventions. Each chromosome includes a sequence of genes, in which each gene starts with a promoter sequence followed by a messenger RNA sequence.1…rnr. The chromosome is translated into a gene-protein network as detailed in the following sections.Each promoter sequence has 1–3 cis-regulatory elements which are used as binding sites that regulate the expression of the gene, and a parameter block that includes the gene parameters. The parameter block of a gene/protein represents the properties derived specifically from its spatial structure. The use of gene and protein parameters in building the network is detailed later. All experiments mentioned in this paper are based on simulations of evolutionary processes using genetic algorithm manipulations of such chromosomes. Mutation and crossover methods are discussed in the Reproduction subsection in The chromosome structure described above can also be represented as a formal artificial chemistry grammar L(〈gene〉) created from the grammar based on the derivation rules above and 〈gene〉 as the start variable represents all possible genes in the chemistry. The language L(〈mRNA〉) is based on the same grammar, but with 〈mRNA〉 as a start variable and represents all possible proteins in the chemistry.The language A molecule in the chemistry can either be a protein or a gene. Consequently, the set of possible molecules S can be written as:The model assumes that the set of molecules in an organism or cell is composed solely of the individual's genes and transcripted proteins.ijw are assigned according to the Hamming distance ijd between cis-regulatory elements and trans-acting elements. Each gene and each transcribed protein has 12 parameters (P1…P12) that are read from the chromosome and control its dynamics as detailed in The chromosome presented above is translated into a gene-protein network as illustrated in i:The gene-protein network controls three dynamic values for each protein i's concentration inside the cell. i's concentration outside the cell, and i in the cell. This value represents the extent to which the current spatial structure of the protein enables it to act on other genes and proteins.The dynamics of the system are based on the following reaction rules:The equations above are based on a threshold logic paradigm commonly used in simulations of genetic regulatory circuits x are controlled by a time constant τ, and an activation function f that processes the cumulative field induced by the other nodes.In such an equation the dynamics of a node value j on node i is the product its dynamic activity level jα, and the connection between the nodes ijw.In the model, the field induced by a node β•, thresholds θ•, and time constants τ•: aβ, aθ, aτ to control the dynamics of activation and pθ, pβ, pτ to control the dynamics of protein production.To enable the model to separate the activation dynamics and the production dynamics, for example to affect a protein's concentration without affecting its spatial structure and vice versa, each gene/protein possesses different slopes The model enables the external concentration ik is the diffusion coefficient of i, and In order to permit tissue related dynamics, the external concentration equation contains a diffusion expression. An example of a schematic simple-regulation network derived from a small chromosome is shown in m representing (i) a cellular- related event that can be triggered by the network , or (ii) values that need to be derived from the network , including modeling directional receptors for axon guidance, or (iii) values that need to be derived from the genome (such as translocation probability). The full list is shown in In order to enable the gene-protein network presented above to model processes at the tissue level, output nodes were added to the gene-protein network. A similar component was introduced in m is represented by a random-generated bit string ms. The protein nodes j in the gene-protein network that are close enough to string ms . When managing scalar values such as a translocation probability, the internal value mu may be multiplied by another pre-defined factor to obtain the actual scalar value as detailed in For nodes that trigger an event , the event is triggered when the value In cases where a receptor-ligand relationship was needed to obtain directional quantification , a two dimensional version of the above value was used, where the effect of internal factors was replaced by the effect of external gradient factors:A list of all functions used in this paper is detailed in In this paper the term ‘organism’ refers to the group of all cells that are repeated-mitosis results of the same zygote cell. Since during mitosis the gene-protein network is copied from the parent cell, all organism cells are controlled by the same network structure, but since each cell is situated in a different location, it may possess different internal and external protein concentrations.11) was added to control the protein's ability to diffuse between a cell's soma and neurite. Based on this diffusion parameter, the system decides whether a given protein in a neurite will have the same dynamic properties as the soma's and be presented by the same node in the regulatory network, or whether it will have separate properties based on a different node connected to the same regulatory network. A simple example of synapsogenesis is illustrated in axonω and dendriteω as indicated in To control dendrites and axons separately from their soma, we needed a mechanism to separate the dynamic values of the cell's soma from those of a neurite. Therefore, another basic parameter negative (LTP) or positive (LTD) was above 81%. In the above sessions we ignored samples in which Δts≤0.We also assumed that the opposite function may generate Anti-Hebbian LTD synapses:After the model successfully evolved synaptic plasticity based on pre-to-post synaptic correlations, we examined the ability of the model to evolve synaptic plasticity that was not connected to such a correlation by defining a fitness function that prefers a dependence of synaptic change on the interval since last pre- or post- synaptic spike.th generation showed that in all sessions the proportion of organisms where the regression was significantly (P<0.05) negative was above 93%.The following fitness functions were set to evolve synapses that strengthen upon single neural activity of the pre-synaptic cell:th generation showed that in these sessions the proportion of organisms where the synaptic change was significantly (P<0.05) positive or negative when the interval between the pre-synaptic and post- synaptic spikes was small and positive or negative respectively and where the regression was only significantly (P<0.05) negative in small intervals was above 83%. The STDP of one of the evolved synapses is shown in Finally, eight sessions were run in an attempt to evolve a more complicated form of synaptic plasticity which was time-dependent (STDP). By contrast to the previous plasticity regimes which evolved in fewer than 100 generations, we did not obtain such a clear plasticity rule in the STDP case using the following fitness function:typek parameter , motor neurons (that cannot have axons) and hidden neurons (that can have both dendrites and neurons) as detailed later. In order to encourage the virtual organisms to develop neural networks, they were given a life span proportional to the different cellular types they developed: a sensory neuron, a motor neuron, a hidden neuron, a dendrite, an axon, and a synapse. Hence, a maximal time span was assigned to every virtual organism that possessed a “basic” neural network, which was defined as having at least one instance of each of the six elements mentioned above. Since the system was defined as having only dendrite-to-axon synapses, the “basic” network can also be seen as a network that included at least a motor, a hidden, and a sensory neuron and one synapse. The virtual organisms were removed from the environment after completing their life span period.The population size was restricted to a predefined range by removing the eldest virtual organisms from the environment when the number of virtual organisms reached the upper bound (due to crowding), and by randomly choosing two parents from the environment and producing their offspring as a new individual in the environment when the number of virtual organisms reached the lower bound.m as detailed in Each virtual organism in the behavioral based experiments was developed on a two-dimensional 20×20 cellular grid. The physical environment included action molecules The lower and upper bounds of the population size were set to 90 and 110. Unlike previous evolutionary sessions, in this session a specific fitness function was not set and therefore a roulette wheel selection In order to incorporate behavior into the model, we needed to include the possibility for cell differentiation so that the organism could include sensor and motor cells in addition to its hidden neural cells. Briefly, when a cell differentiation messenger is triggered, the cell differentiates into one of three cell types according to its differentiation marker with the highest level , or act as a photoreceptor. Odor A is emitted into the environment by potential mate organisms, odor B is emitted by non mate organisms; the secreted current I from an odor sensitive cell is proportional to the distance between the odorant origin and the cell. Photoreceptor cells secrete a constant current if any virtual organism is placed in a region subsumed by prα radians.A hidden cell – that will embed a neural model as detailed in previous sections.In order to evolve neural based behavior, a “mating rule” was introduced in the environment, where two virtual organisms that contacted each other produced offspring according to the reproduction equation presented in the As a first step, we tested for changes in the virtual organisms' behavior along generations. As shown in In order to examine whether any of the synaptic plasticity regimes evolved in the behavioral experiment, every 0.5 generations an organism was randomly chosen from the population and tested to see whether it included (1) synapses, where the value of −10, T-test). No such findings were observed for the other synaptic plasticity types .For each of the four synapse types above we examined whether there was an increase in the proportion of virtual organisms with the specific synapse type in the first 1000 generations compared to the second 1000 generation. There was an increase in the proportion of virtual organisms that had at least one Non-Hebbian pre-synaptic LTP synapse (P<9×10This finding could be explained by (1) the tendency of the evolution to use Non-Hebbian pre-synaptic LTP synapses in this early stage for mating functionality or (2) some unrelated mechanism preferring such organisms in the latter period, such as a tendency of the organisms to include more synapses, which would increase their likelihood of including at least one instance of a specific synapse type.A manual examination of the virtual organisms that included a Non-Hebbian pre-synaptic LTP synapse gave us a clue to the use of these synapses. As illustrated in We tested the mutual information between synapse potentiation and the existence of a mate nearby. If the synapses function as a memory mechanism for “remembering” whether there are mates the virtual organism just sensed, we should observe higher mutual information values in cases of synapses recognized as Non-Hebbian pre-synaptic LTP synapses compared to randomly chosen synapses. We compared 250 virtual organisms with a Non-Hebbian pre-synaptic LTP synapse (group B) to 250 randomly chosen virtual organisms (group A). Each virtual organism was placed in an environment and we sampled 1000 instances of:td: the distance of the nearest mate at time t.tw: the value of the Non-Hebbian pre-synaptic LTP synapse weight value at time t. For Group A organisms, a synapse was chosen that had some variance in the tw values (t)>0Var(w).td, tw values were converted to Boolean values 1,d2}D = {d and 1, w2}W = {w:For each organism the I between Group A and Group B.(T-test P<10−16). This suggests that the Non-Hebbian pre-synaptic LTP synapses tend to contain more information about the existence of potential mates in the immediate vicinity.As shown in The experiments presented in this paper were designed to examine the ability of an evolutionary cellular development model to evolve various synaptic plasticity regimes. The approach described in this paper is based on a model that is both feasible in terms of running relatively complex evolutionary simulations and includes a biologically plausible gene-protein regulation functionality with an integrate-and-fire neural mechanism.By applying different fitness functions to the model in separate evolutionary sessions, different synaptic plasticity rules could be evolved by the system: Hebbian- like LTP plasticity, Anti-Hebbian-like LTD plasticity, Non-Hebbian LTP pre- and post- synaptic plasticity and Hebbian- like STDP. We also showed how Non-Hebbian LTP pre- synaptic plasticity can evolve in an evolutionary system that has no direct fitness function, but is based on behavior selection, and how this plasticity can serve as a simple memory mechanism.According to the fitness curves in the direct fitness function experiments, anti-Hebbian like plasticity regimes converge for most runs quite well, especially compared to the fitness curves of the other plasticity types, and therefore might have a selectional advantage in the last experiment.Although in this paper we focused on the model's ability to evolve various synaptic plasticity regimes, we also examined the model as a whole and did not derive the specific features in the model that enable evolving synaptic plasticity. For example, even though the diffusion functionality does not seem to be related to the abilities of the model as presented in this paper, our attempts to evolve the simplest plasticity regime without diffusion did not succeed, suggesting that the ability to regulate protein diffusion between neurites and soma is essential. We believe that future studies should examine the ability of simplified models to evolve various synaptic plasticity regimes to discover new essential components of complex mechanisms.The ability of the model to evolve various biological plasticity regimes, together with its ability to present genomic and neuronal phenomena suggest that this simulation approach can serve as a tool for investigating evolutionary aspects of synaptic plasticity. One example for such future examination is related to the connection between the time when STDP emerges on the biological phylogenetic tree and the number of generations needed to evolve it in the model. The fact that some synaptic plasticity rules such as time dependent plasticity evolved much more slowly than others as seen in the results presented here can be ascribed to unsuitable fitness functions.A different conclusion relates to synaptic plasticity as a mechanism for memory formation and learning. The fact that the model is capable of evolving a biological synaptic plasticity rule as a pre- synaptic LTP synapse in an environment where selection is based on behavior and not directly designed to evolve this specific plasticity should encourage the computational applications of such an approach. We believe that future experiments using this and similar models can shed more light on other synaptic plasticity rules and their relationship to memory and learning, both for future artificial intelligence systems, and as a research tool to account for existing neural systems. Nevertheless, the fact that some synaptic plasticity rules, such as time dependent plasticity, evolved in the direct fitness experiments much more slowly than others, implies possible computation power difficulties in larger and more complex models. We believe that statistical examination of the artificial mechanisms that lead to the creation of more complex synaptic regimes in an evolutionary environment with behavior based selection has the potential to better understand synaptic plasticity both as a biological and computational research tool.ir of the chromosome is surrounded by three other values: a crossover probability value ic, and two mutability values ir and ic respectively are likely to change is a standard normal random number, iN represents a new random number generated for each component, and ix.Reproduction of a child chromosome from its parent chromosomes is based on a self adaptive method i & j of the parents is i+cjc.Before mutation takes place, the parent chromosomes are aligned using a dynamic programming algorithm C is the membrane capacitance, I is the total current injected into the cell, and g and V values are the ion channel conductivity and reversal potential.All cells in the experiments detailed in this paper were embedded with an integrate and fire θ, and the cell is not refractory, it fires an action potential, Nag. It is then raised for one system epoch, and immediately switches to a refractory state for refτ seconds, where it cannot fire and kg is raised and later decayed back with a When the membrane potential reaches threshold I injected into the cell consists of a noise current noiseI, and incoming synapse current excI, where noiseI is a Gaussian noise causing a cell without external input to fire randomly. The noise of the various cells is uncorrelated.Current excI current injected by a pre-synaptic cell i into a postsynaptic cell j has a rise and decay time as follows:t is the time elapsed from the last action potential in the pre-synaptic cell, and τ1 & τ2 are the rise and decay time constants.Excitatory The threshold level depends on the membrane potential level, according to:i and j, ijw is calculated by the Hamming distance between rounded off values of the trans element of j and the cis element of i, the length of cis and trans elements controls the resolution in which ijw can be calculated.We used cis- and trans- elements as sequences of 16 real numbers. Since the connection strength between molecules Two evolutionary simulations were conducted to evolve Non-Hebbian pre-synaptic LTP synapses using 8 and 32 cis- and trans- lengths, and in both cases the sessions succeeded in evolving the synapses.ms representing the output nodes are set randomly during initialization of each evolutionary session.Bitstrings All regression coefficients and regression significance values presented in this paper were values derived from tests where the organism was placed in its environment and there were at least 2000 pre-synaptic and 2000 post-synaptic spikes from both sides of the synapse while sampling. No external current was injected into the neurons so as to collect spike related data. Synapses that did not have any pre-synaptic or post-synaptic spikes during the experiment were not included in the regression calculations.I was calculated according to:p is the number of samples of the joint w,d divided by the total number of joint samples. p(d) and p(w) are the number of samples of d and w respectively, divided by the total number of samples. The number of samples used was 1000. By letting the simulation progress between each two samples, two consecutive samples were not allowed to have the same closest “mate” to the examined organism.The mutual information
Amniocentesis is the accepted mode of attaining amniotic fluid to perform tests for fetal lung maturity. The purpose of this study was to validate a non-invasive fetal lung maturity test by counting lamellar bodies from a vaginal pool among women with preterm premature rupture of membranes.In a prospective study, amniotic fluid specimens were collected from a vaginal pool from women after preterm premature rupture of membranes with gestational age between 27 and 36 completed weeks. Receiver operating characteristics curve was estimated to assess the threshold of lamellar bodies' count that may predict fetal lung maturity.Seventy-five specimens were collected of which 17 were between 32 to 34 weeks. A lamellar bodies' count of 28,000 or more predicted mature fetus 100% of the time (specificity) among all women and also among women between 32 to 34 weeks. The sensitivity was 72% among all and 92% when gestational age was between 32 to 34 weeks. A count of 8,000 or less, predicted respiratory distress syndrome with a sensitivity of 98% among the whole group.Counting of lamellar bodies in amniotic fluid from a vaginal pool may be used to predict fetal lung maturity. Respiratory distress syndrome (RDS) is the most common complication suffered by preterm neonates . PretermAmniocentesis is the accepted mode of attaining amniotic fluid to perform tests for fetal maturity. However, it is an invasive procedure with risks that include placental abruption, fetal maternal hemorrhage, infection and early onset of delivery . The proThe purpose of this study was to test the validity of a non-invasive method for predicting fetal lung maturity among women with P-PROM. To do so, we performed a lamellar bodies (LB) count by drawing amniotic fluid from a vaginal pool and calculated a cutoff for LB concentration above which fetal lung maturity is likely. Among all fetal lung maturity tests, LB count was selected because the test can be performed with equipment found in most clinical analysis laboratories. Furthermore, such counting had been reported as reliably predicts fetal lung maturity, simple, rapid and inexpensive .A prospective study was held in the labor and delivery ward of the department of Obstetrics and Gynecology at Ha'Emek Medical Center in Afula, Israel, a university teaching hospital from January 2005 to January 2008. Pregnant women diagnosed to have P-PROM at a gestational age of 27 to 36 completed weeks were offered to participate in the study. Amniotic fluid was collected with a sterile speculum inserted into the posterior fornix. Only one specimen per subject was included. When twin gestations were included, the sample was drawn only from the presenting twin diagnosed with ruptured membranes and only the sampled twin was considered for analysis. Specimens, usually 0.5 cc or more, were transferred directly to test tubes and were processed within an hour of collection through a platelet channel of the cellular counter ADVIA 2120 . Visual examination by a laboratory technician identified only clear specimens and therefore they were non-centrifuged. The test tube was placed on a stand in the cell counter and an automated aspiration of 157 μL of fluid was held. The test sample was separated into 5 different channels: 1) a channel for hemoglobin quantification, 2) a channel for quantifying red blood cells and platelets, 3) a basophil channel, 4) a peroxidase channel which gives the total white blood cell count and their differential count and 5) a reticulocyte channel. A platelets count was achieved by using a laser diode as a light source after spherization and fixation. The use of reagents and calibration of the cell counter were done according to the manufacturer's instruction.Samples were excluded from analysis when an inadequate sample volume of amniotic fluid was collected or when the samples were otherwise unsatisfactory . Samples stained with meconium were also excluded from analysis because its presence usually provides a compelling reason for prompt delivery, irrespective of lung maturity status.Other exclusion criteria included delivery more than two days after fluid analysis, maternal or fetal conditions that warrant expedite delivery before the sample collection, clinical amnionitis and cases with inaccurate gestational age. Women who received betamethasone after the fluid analysis were also excluded.The charts of mother-infant pairs were reviewed for demographic factors, diabetic status, betamethasone administration, and the presence of neonatal pulmonary and non-pulmonary morbidities. Gestational age was confirmed by either documented first trimester ultrasound or by known regular last menstrual period and a documented ultrasound in the second trimester.The presence of RDS was defined clinically when the newborn developed tachypnea and grunting, had a chest radiography showing a diffuse reticular pattern and air bronchogram, and required oxygen for 24 hours or more. Neonates classified as having transient tachypnea of the newborn were not considered to have RDS. To investigate whether the frequency of non-pulmonary morbidity is related to the presence of lung maturity, we recorded all other cases of non-pulmonary morbidity. These included neonatal sepsis, necrotizing enterocolitis, intraventricular hemorrhage, neonatal hypoglycemia, anemia and thrombocytopenia. The time from delivery to discharge was also recorded. Obstetricians, neonatologists and radiologists were blinded to the results of the LB count attained from the exam.The study was approved by the local institutional review board and the Israeli ministry of health research committee. Only women who agreed to sign an informed consent form were included in the analysis.P value < 0.05 was considered significant. The SAS software was used for the analyses.Statistical analysis was based on logistic regression. A receiver operating characteristics (ROC) curve was estimated to assess the threshold of LB count that may predict RDS. The log transformation on LB was applied in the analyses where LB was used as a predictor. Stepwise logistic regressions were applied with RDS and with non-pulmonary morbidity as dependent variables to examine their relationships with other explanatory variables. Exact logistic regression was used for non-pulmonary morbidities. A During the study period there were 12,653 deliveries at our institution, with an 8.2% rate of preterm deliveries. Among all preterm deliveries, 282 (2.2%) were due to P-PROM between 27 to 36 completed weeks. Unsatisfactory samples, inadequate sample volume, cases where betamethasone was administered after the fluid analysis, delivery more than two days after fluid analysis, cases with maternal or fetal conditions that warranted expedite delivery, clinical amnionitis, inaccurate gestational age and cases in which women declined to participate were excluded. The remaining 75 mother-infant pairs were included in the analysis and made up our study cohort.Maternal demographic and obstetric characteristics are presented in table Neonatal outcomes are presented in table The LB count ranged from 6,000 to 187,000 per microliter of amniotic fluid. When only the LB count was examined as a predictor of RDS, it showed that a count of 28,000 or more predicted fetal maturity 100% of the time (specificity) with a sensitivity of 72% table . A countLogistic stepwise regression analysis excluding LB count showed that the best predictors of lung maturity were advanced gestational age (p = 0.02) and whether neonates were delivered vaginally or abdominally at the same gestational age (p = 0.03). Neonatal weight was found to be an additional significant explanatory variable in the model (P = 0.009) where log (LB) was used as a predictor for RDS (P = 0.0003). When comparing a model of predicting RDS with gestational age and mode of delivery with a model using LB count, the latter model had a superior AUC (0.9318 vs. 0.7940). There was no difference in the AUC when neonatal weight was added to LB count in the model (0.9318 vs. 0.9442).The association between RDS and all the non-pulmonary morbidities was estimated by applying exact logistic regression with non-pulmonary morbidities as the dependent variable and RDS as the explanatory variable. A borderline significant positive association was found (P = 0.056). When applying logistic stepwise regression analysis, the only variable found to be significant in predicting the probability of non-pulmonary morbidities was the gestational age at delivery (P < 0.001).Counting LB in amniotic fluid from a vaginal pool may be used for assessing fetal lung maturity among pregnant women admitted with P-PROM. A cutoff level of 28,000 predicted fetal lung maturity in 100% of the time with a sensitivity of 72%. A count of 8,000 or less predicted RDS with a sensitivity of 98%. As expected the incidence of RDS decreased significantly with advancing gestational age and was less common in neonates delivered vaginally compared with those delivered abdominally at the same gestational age. However, LB count was a stronger predictor of RDS than both gestational age and mode of delivery.We also found a trend toward a reduced incidence of non-pulmonary morbidities among mature compared to immature neonates. This issue has been discussed previously in the literature, however, contradicting results were reported ,6. The mDifferent cutoff values for the LB count that predicts fetal lung maturity or RDS have been established and reported in the literature. Cutoffs that were established in this study are in concordance with other reports ,8. DiscoThe decision to deliver women with P-PROM is based on the gestational age and fetal status. At 32 to 33 completed weeks of gestation, the risk of severe complications of prematurity is low if fetal pulmonary maturity is proven . Beyond Amniocentesis is the accepted mode of attaining amniotic fluid for testing fetal lung maturity. However, it is an invasive procedure with risks and is often technically more complex when amniotic fluid volume is reduced, not to mention with oligohydramnios that may accompany P-PROM ,3. ObtaiThe validity of amniotic fluid collected vaginally to predict fetal lung maturity has been reported previously ,15,16. SCounting amniotic fluid LB from a vaginal pool is simple, quick, accessible and is readily useful in determining fetal lung maturity among pregnant women with P-PROM.The authors declare that they have no competing interests.RS and NZ conceived and designed the study, supervised the data collection, assisted in the analysis and drafted the manuscript; ZN and GG assisted in collection and maintenance of the data; ES assisted in conceiving, designing and analysis, and edited the manuscript. All authors read and approved the final manuscript.
Cockroach exposure is a major risk factor for the development of asthma. Inhalation of fecal remnants (frass) is the likely sensitizing agent; however isolated frass has not been tested for its ability to induce experimental asthma in mice.Mice were sensitized and challenged with GC frass or GC frass devoid of proteases and measurements of airway inflammation and hyperresponsiveness were performed (interleukin (IL)-5, -13, and interferon gamma (IFNγ) levels in bronchoalveolar lavage fluid, serum IgE levels, airway hyperresponsiveness, cellular infiltration, and mucin production).Sensitization and challenge of Balb/c mice with GC frass resulted in increased airway inflammation and hyperresponsiveness. C57Bl/6 mice were not susceptible to this model of sensitization; however they were sensitized to GC frass using a more aggressive sensitization and challenge protocol. In mice that were sensitized by inhalation, the active serine proteases in GC frass played a role in airway hyperresponsiveness as these mice had less airway hyperresponsiveness to acetylcholine and less mucin production. Proteases did not play a role in mediating the allergic inflammation in mice sensitized via intraperitoneal injection.While both strains of mice were able to induce experimental asthma following GC frass sensitization and challenge, the active serine proteases in GC frass only play a role in airway hyperresponsiveness in Balb/c mice that were susceptible to sensitization via inhalation. The differences in the method of sensitization suggest genetic differences between strains of mice. Blattella germanica). During infestation, cockroaches (CR) produce a variety of substances that may be allergenic including exoskeleton, secretions, egg castings and fecal remnants (frass). Of these, the whole body CR and frass have been shown to contain significant and similar allergenic activity [The principal domestic cockroach species that commonly infests homes in the United States are the German cockroaches and thaMuch of the work in murine models of allergen-induced allergic inflammation has been performed using ovalbumin (OVA) as a sensitizing agent. In order to elicit an allergic response to OVA, mice must be immunized by intraperitoneal injection of OVA bound to an adjuvant such as aluminum hydroxide . While allergen-induced allergic inflammation is detected, these studies do not mirror human susceptibility of this disease. Therefore in this report we attempt to address not only the use of GC frass as a sensitizing agent, but also to demonstrate a model of allergic sensitization in mice that mirrors the human etiology of allergic asthma. We will use two methods of sensitization to confirm the role of GC frass in mediating allergen-induced allergic inflammation in mice. The first method is sensitization and challenge by intratracheal inhalation, and the second method is sensitization by intraperitoneal injection with GC frass bound to alum with an intratracheal challenge. In addition, since GC frass contains active serine proteases we will Blattella germanica) and reconstituted as previously described [Fecal remnants (frass) were collected from German cockroaches and housed in a laminar hood in a virus-free animal facility. These studies conformed to the principles for laboratory animal research outlined by the Animal Welfare Act and the Department of Health, Education, and Welfare . These studies were approved by the Cincinnati Children's Hospital Medical Center Institutional Animal Care and Use Committee.Murine strains are known to exhibit different immune responses, with Balb/c mice being more responsive and C57Bl/6 mice being less responsive to allergen challenge. Therefore, we compared a sensitization by inhalation only protocol to the standard sensitization by intraperitoneal injection followed by inhalation challenge. In one method, GC frass was delivered via intratracheal aspiration challenge. Briefly, anesthetized mice (45 mg/kg ketamine and 8 mg/kg xylazine) were suspended on a 60 degree incline board. With the tongue gently extended, a 40 μl aliquot of PBS or GC frass is placed in the back of the oral cavity and aspirated by the mouse . Balb/c 2O × sec-1) was followed for 5 minutes.Allergen-induced AHR was determined as we have previously described . BrieflyLungs were lavaged thoroughly with 1 ml of Hanks balanced salt solution without calcium or magnesium. The lavage fluid was centrifuged , the supernatant was removed for cytokine analysis and immediately stored at -80°C. Total cell numbers were counted on a hemocytometer. Smears of BAL cells prepared with a Cytospin II were stained with Diff-Quick solution for differential cell counting.5) were incubated for 72 hours in culture medium (RPMI) or in RPMI treated with Conconavalin A (10 μg/ml) and supernatants were analyzed by ELISA for TH2 cytokine (IL-5 and IL-13) or TH1 cytokine (interferon (IFN) γ) expression as previously described [Liberase/DNase I digests of the lung were prepared to obtain single lung cell suspensions. Single cell suspensions and Periodic Acid Schiff (PAS). To quantify mucin production, we counted airways and determined the percentage of mucin stained airways . Next, we picked representative airways and counted total and mucin positive cells in that airway and determined the percentage of mucin positive cells .When applicable, statistical significance was assessed by one-way analysis of variance (ANOVA). Differences identified by ANOVA were pinpointed by Student-Newman-Keuls' multiple range test.Mice were sensitized and challenged mice with GC frass via intratracheal inhalation as depicted in Figure Balb/c mice were sensitized via intratracheal inhalation with PBS, aprotinin-treated PBS, GC frass, or aprotinin-treated GC frass (which we refer to as protease-free GC frass). Inhalation of protease-free GC frass resulted in reduced airway hyperresponsiveness to acetylcholine compared to protease-containing GC frass Figure . RemovalNext we asked if GC frass was able to induce allergic asthma in C57Bl/6 mice Figure . Using tUsing the same sensitization and challenge protocol for C57Bl/6 mice Figure , we inveUsing a method which reflects the natural exposure to environmental allergens, inhalation of GC frass induced allergic asthma as determined by increased TH2 cytokines in the BAL fluid, increased serum IgE levels, increased responsiveness to acetylcholine challenge, increased cellular infiltration into the airways and increased mucin production in Balb/c mice. The same inhalation protocol resulted in increased TH2 cytokines in C57Bl/6 mice, with the other parameters not being affected. C57Bl/6 mice were susceptible to sensitization and challenge with GC frass; however this required an aggressive sensitization and challenge protocol. The difference in allergen challenge suggests an inherent difference in the airways between these mice. In the Balb/c mice, which were susceptible to sensitization via intratracheal inhalation, we found that active serine proteases in GC frass played a role in regulating airway hyperresponsiveness to acetylcholine and mucin production. Removal of proteases from GC frass had no effect on the C57Bl/6 mice which required sensitization via intraperitoneal injection. Together these data show that in mice susceptible to sensitization by inhalation, GC frass related proteases play a role in augmenting the allergic asthma phenotype and suggests functional differences in the airways of the strains of mice tested in this study.While both mouse strains were able to induce allergic experimental asthma following sensitization and challenge with GC frass, the mice differed in their susceptibility to GC frass. C57Bl/6 mice have a tendency towards TH1 and consistently produce high levels of IFNγ . Balb/c in vitro [in vitro [The airway epithelium is the first contact between the lung and aeroallergens, viruses and irritants, and as such, the airway epithelium needs to respond appropriately. In response to these stimuli, airway epithelial cells produce inflammatory chemokines. That the airway epithelium can respond to allergen treatment has been shown in a number of studies. The house dust mite cysteine protease Der p 1 caused disruption of intracellular tight junctions, detachment of lung epithelial cells, and epithelial release of cytokines in vitro ,25. We hin vitro . PARs arOther studies have investigated the role of proteases in modulating the experimental asthma phenotype in mice. In the highly responsive A/J mouse strain, proteolytic activity in the house dust mite allergen Der p 1 was shown to induce sensitization toward IgE responses by a cysteine protease-dependent mechanism . Der p 1A crucial step in mediating a T cell immune response is the uptake, processing and presentation of antigen by antigen presenting cells. It is possible that genetic differences in airway epithelial cells between the murine strains could lead to differences in allergen uptake and processing. The epithelium produces a number of chemokines which regulate cellular recruitment, and as such the epithelium could alter the immune response to allergens. Differences in airway epithelial biology could dampen the damaging effects of proteases inherent in allergens, or from the release of oxygen radicals, proteases and soluble mediators of inflammation from neutrophils. This could be accomplished by the synthesis of variable levels of endogenously expressed proteins such as alpha-1 antitrypsin or secretory leukoprotease inhibitor, both of which protect tissue against the destructive action of neutrophil elastase at the site of inflammation. Our data suggests that the airway epithelium plays an important role in the sensitization of mice to allergen, as exemplified by the different susceptibility of the Balb/c and C57Bl/6 mouse strains to induce experimental asthma.In susceptible humans and animals, allergens induce TH2 driven production of IgE, airways hyperresponsiveness and peribronchial inflammation. But the question remains, what makes some humans susceptible? Our data show that lung susceptibility to allergen is different from other routes of sensitization, i.e. active proteases play an important role in the sensitization process in the inhalation model used for Balb/c mice. Sensitization via intraperitoneal injection of allergen with adjuvant also induces experimental asthma, but in a fashion independent of active proteases. The sensitization protocol for Balb/c mice mimics the natural route of allergen sensitization, i.e. inhalation of the allergen. In the allergen inhalation model of asthma we present, allergen-derived proteases play an important role in mediating allergic susceptibility. It will be of considerable interest to determine the role of active proteases in modulating human asthma.APTI; airway pressure time indexBAL; bronchoalveolar lavageCR; cockroachFrass; fecesGC; German cockroachIL; interleukinOVA; ovalbuminThe author(s) declare that they have no competing interests.KP designed and performed the experiments and drafted the manuscript. KML performed the immunoassays and analysis of the slides. NH performed the animal work. MWK participated in the design of the study and helped to draft the manuscript. All authors read and approved the final manuscript.
Temozolomide shows activity against medulloblastoma, the most common malignant paediatric brain tumour. Poly(ADP-ribose) polymerase (PARP) inhibitors enhance temozolomide activity in extracranial adult and paediatric human malignancies.We assessed the effect of AG-014699, a clinically active PARP inhibitor, on temozolomide-induced growth inhibition in human medulloblastoma models. Pharmacokinetic, pharmacodynamic and toxicity assays were performed in tumour-bearing mice.in vitro was consistent with methylguanine methyltransferase (MGMT) and DNA mismatch repair (MMR) status; MGMT+ MMR+ D384Med cells (temozolomide GI50=220 μM), representative of most primary medulloblastomas, were sensitised fourfold by AG-014699; MGMT− MMR+ D425Med cells were hypersensitive (GI50=9 μM) and not sensitised by AG-014699, whereas MGMT+ MMR− temozolomide-resistant D283Med cells (GI50=807 μM) were sensitised 20-fold. In xenograft models, co-administration of AG-014699 produced an increase in temozolomide-induced tumour growth delay in D384Med xenografts. Consistent with the in vitro data, temozolomide caused complete tumour regressions of D425Med xenografts, whereas D283Med xenografts were relatively resistant. AG-014699 was not toxic, accumulated and reduced PARP activity ⩾75% in xenograft and brain tissues.Sensitivity to temozolomide in vitro chemosensitisation and toxicity data, these findings support further evaluation of the clinical potential of AG-014699–temozolomide combinations in intra-cranial malignancies.We show for the first time central nervous system penetration and inhibition of brain PARP activity by AG-014699. Taken together with our Medulloblastoma is the most common malignant paediatric brain tumour and accounts for almost 10% of all childhood cancer deaths. The clinical outcome for patients with medulloblastoma is variable and overall ∼40% of children with medulloblastoma will die of their disease , 2009. CTemozolomide shows significant single-agent activity in adult oligodendrogliomas and high-grade astrocytomas and evidence of activity in pre-clinical medulloblastoma models polymerase-1 and -2 (PARP-1 and PARP-2). These enzymes are activated by DNA single- and double-strand breaks and promote their repair through the relaxation of chromatin and recruitment of other repair proteins. We have previously shown that PARP inhibitors can restore temozolomide sensitivity to MMR-defective cells tumours can be more difficult to treat because of the blood–brain barrier (BBB) that limits drug uptake into CNS tissues. The BBB is a physical and biochemical impediment to the transport of drugs into the CNS by virtue of highly impenetrable vascular endothelial cells and an abundance of drug efflux pumps was a gift from Pfizer Oncology . Temozolomide was dissolved in dimethyl sulphoxide (DMSO) before addition to cell cultures at a final concentration of 0.5% (v v−1) DMSO. For in vivo evaluation, temozolomide was dissolved in saline immediately before administration. 10H mouse monoclonal antibody to ADP-ribose polymers was a kind gift from Dr Alexander Burkle . Other chemicals and reagents were obtained from Sigma , unless otherwise stated.Temozolomide was a gift from Cancer Research UK , and AG-014699 . D283Med was obtained from the American Type Culture Collection . Published cell line karyotypes and genetic features were confirmed in each cell line before use; all three lines harboured genetic lesions consistent with primary medulloblastomas . Lysates were also blotted for cell line expression of MGMT and the MMR proteins MLH1, MSH2, MSH3, MSH6 and PMS2 .Protein lysates were prepared from each cell line using standard methods and examined for the presence of the PARP-1 protein and μM), in comparison with DMSO-only controls. Maximally stimulated PARP activity was measured in replicate samples (n⩾3) of permeabilised cells by immunological detection of the amount of poly(ADP-ribose) (PAR) formed, using 10H anti-PAR antibody, during a 6-min incubation with NAD+ and oligonucleotide (substrate and activator) by reference to a PAR standard curve using a GCLP-validated assay described previously or 48 h (D283Med and D425Med) after seeding, cells were exposed to varying concentrations of temozolomide, as described in the Results, in the presence or absence of 0.4 μM AG-014699, a concentration previously shown to enhance temozolomide cytotoxicity in adult tumour cell lines was calculated from computer-generated curves . The potentiation factor50 (PF50) is defined as the ratio of the GI50 of temozolomide in the presence of AG-014699 to the GI50 of temozolomide alone. All data were from at least three independent experiments.Cell growth inhibition was estimated in exponentially growing D425Med, D283Med and D384Med cells in 96-well plates. Seeding densities of 1 × 10in vivo experiments were reviewed and approved by the relevant institutional animal welfare committees, and performed according to national law. Female athymic nude mice used for anti-tumour studies were maintained and handled in isolators under specific pathogen-free conditions. D425Med, D283Med and D384Med xenografts were established by sub-cutaneous implantation into CD-1 nude mice. Before use in experiments, xenograft establishment was defined as when two-dimensional calliper measurements of tumours reached approximately 5 × 5 mm2. Treatment was initiated when sufficient number of mice had established tumours to allow randomisation into treatment groups: day 17 for D425Med, day 26 for D384Med and day 32 for D283Med. Tumour-bearing mice were killed 100 days after the start of treatment or when two dimensions of a tumour xenograft reached 10 mm or one dimension reached 15 mm, whichever was the earliest.All of the −1 intraperitoneally (i.p.)) were given to CD-1 nude mice bearing established D283Med xenografts. At 0.5, 2, 6 and 24 h after the initial or fourth daily dose of AG-014699, three animals per time point were bled by cardiac puncture under general anaesthesia, and then killed. Plasma was separated from the blood samples using standard methods and stored at −80°C. The brains and tumours were removed, snap frozen in liquid nitrogen and stored at −80°C before analysis. Blood, tumour and brain tissue were removed from three untreated control animals and processed in the same way.One or four daily doses of PARP inhibitor AG-014699 (1 mg kg−1) in PBS) of brain and tumour after protein precipitation with acetonitrile by liquid chromatography/mass spectrometry/mass spectrometry using a turbo ion spray interface and multiple reaction monitoring in the positive ion mode and a deuterated internal standard as described previously of a 1 : 1000 dilution of the homogenate as described for permeabilised D283Med cells (see above). Data were calculated as pmol PAR per mg protein by reference to the PAR standard curve and protein content of the sample and expressed as a percentage of the corresponding tissue from the saline-treated control animals. The mean PARP activity in xenograft and brain samples taken at each time point was expressed as a percentage of the mean PARP activity of control xenografts from untreated mice (n=3).PARP activity was determined in homogenates of subcutaneous D283Med xenografts and brain tissue (see above). Maximally stimulated PARP activity was measured in replicate samples (−1per os (p.o.)) or AG-014699 (1 mg kg−1 i.p.) alone or in combination, daily for 5 days (five mice per group). For drug combinations, AG-014699 was administered immediately after administering temozolomide. Tumour volumes, determined from two-dimensional calliper measurements and the equation a2 × b/2 (where a is the length and b is the width of the tumour), were monitored for the experimental period (up to 100 days), and are presented for each group of mice as median relative tumour volume (RTV) values. Relative tumour volume 1 is the tumour volume on the initial day of treatment (day 0), and RTV4 is the tumour volume four times that on the initial day of treatment. Tumour growth delay (TGD) is defined as the time to RTV4 in drug-treated mice compared with the time to RTV4 in control mice. Median tumour volume is shown, rather than the mean, as this is generally accepted as the most statistically reliable representation of the average growth rate of tumours in a small group of mice, if a normal distribution of tumour volumes cannot be assumed. Tumour growth delay was calculated as: median time to RTV4 in treated group−median time to RTV4 in control group. Percentage enhancement was calculated as 100 × −100 , temozolomide (data not shown). Temozolomide alone caused a concentration-dependent inhibition of growth in all three cell lines. Cell lines exhibited variable levels of sensitivity to temozolomide alone. The MGMT-deficient D425Med cells were hypersensitive to temozolomide, and the MMR-defective D283Med cells were nearly 100 times less sensitive, as expected. The D384Med cells, which were proficient in both pathways, displayed intermediate sensitivity. There was also considerable variation in the degree of chemosensitisation by AG-014699 between the cells, with almost 20-fold sensitisation of the MMR-defective, D283Med, cells compared with >3-fold sensitisation in the MMR- and MGMT-competent D384Med cells, but no sensitisation of the MGMT-deficient, D425Med, cells.We measured the growth of cells exposed to increasing concentrations of temozolomide alone or in combination with 0.4 D425Med , D283Med D425Med and D384 D425Med are show−1 AG-014699 daily five times has previously been shown to be non-toxic and sufficient for profound chemosensitisation of human colon and neuroblastoma cancer xenografts to temozolomide (A dose of 1 mg kg−1 (172±39 μM) AG-014447 was detected at the earliest time point after injection. Thereafter, the levels decreased rapidly, such that at 24 h they were below the level of quantitation.After the first dose of AG-014699 , a peak M in the tumour compared with 131–209 nM in plasma at 30 min. There was also significant and prolonged retention within the tumour, such that at 24 h after injection, levels of between 74 and 196 nM were still detectable. Surprisingly, given its physical and chemical properties, significant levels of AG-014447 were also detected in the brain tissue. Although these were initially lower than those in the plasma (20–40 nM at 30 min), there was some degree of retention such that at 24 h the levels were up to 10-fold higher than that in the plasma (1–30 nM in brain compared with 1.9–2.4 nM in plasma). After the fourth daily dose of AG-014699 (M) were retained in the tumour for the entire period. In the plasma, AUCs (26.4 and 21.9 μmol l−1 min on days 1 and 4) and half-life (299 and 254 min) were similar to those reported previously (μmol l−1 min on days 1 and 4) were comparable to those in the plasma, whereas AUCs in tumour were substantially higher (582.0 and 509.6 μmol l−1 min).Levels in the tumour were higher than that in the plasma at all time points , for exaG-014699 , peak plConsistent with the AG-014447 distribution data, PARP activity was suppressed in both brain and tumour tissue following administration of AG-014699. In the brain, PARP activity was reduced by around 75% for the first 2 h, recovering gradually thereafter, such that it was approximately 40% reduced at 24 h . After t−1 i.p.), TMZ alone (68 mg kg−1 p.o.) or the combination of TMZ (68 mg kg−1 p.o.)+AG-014699 (1 mg kg−1 i.p.) data are summarised in We examined the effect of AG-014699 on the anti-tumour activity of temozolomide in mice bearing established subcutaneous D425Med, D283Med or D384Med xenografts. Mice were treated daily for 5 days with either vehicle control alone, AG-014699 alone and, as expected from the in vitro data, were very responsive to temozolomide alone with complete tumour regressions seen in all mice . Temozolomide alone caused a significant TGD (P=0.016), extending the time to RTV4 to 44.5 days (P=0.11 Mann–Whitney test). There was one transient complete response seen in both the temozolomide alone and the temozolomide+AG-014699 groups. Temozolomide alone caused a modest (5±4%), but statistically significant, weight loss relative to control . AG-014699 was not toxic per se (1±1% body weight loss), but caused a modest, but significant, enhancement of temozolomide-induced body weight loss .At 1 mg kgall mice . These rall mice . In cont4.5 days , and theIn the work described here, we sought to address the need for new therapeutic approaches to improve outcome in medulloblastoma. Temozolomide shows good activity in adult glioblastomas and encoin vivo experiments. The sensitivity of D425Med to temozolomide alone may limit the usefulness of this cell line in assessing sensitisation by inhibition of PARP.We initially investigated in our models the status of molecular pathways implicated in the modulation of temozolomide sensitivity make to the overall cytotoxicity of temozolomide in the individual cell lines.Previous studies in paediatric xenografts have also concluded that MGMT status is the major determinant of sensitivity to temozolomide, but that MMR defects also confer resistance . In comparison, the D425Med tumours grew relatively slowly and responded well to temozolomide alone, with all mice showing complete tumour regressions, two of which were sustained until the termination of the experiment at 100 days. Xenografts from MGMT-deficient SW620 cells show similar sensitivity to temozolomide alone, but are sensitised further by AG14361 and AG-014699 were lower than were used for in vitro chemosensitisation, the inhibition of PARP activity over the 24-h period was 50–80%. This level of inhibition is in general agreement with the 80% inhibition of activity seen in permeabilised cells exposed to 100 nM AG-014699, and is sufficient to cause in vivo chemosensitisation in models of both adult and paediatric malignancies . Therefore, higher drug levels and greater PARP inhibition should be achievable in the brains of patients treated with a safe dose of AG-014699. The observed accumulation of AG-014447 in xenografted medulloblastomas, which is consistent with our data for other tumour types coupled with a potentially compromised blood–brain tumour barrier suggests that drug accumulation in the tumours may be even higher. Further investigations in orthotopic or spontaneous transgenic models of medulloblastoma could provide useful insights in this regard, although the limitations of these models as representative of primary tumours and an intact BBB must also be taken into account.We have not previously determined the CNS penetration of AG-014447, the free drug of which AG-014699 is the phosphate salt, nor its inhibition of PARP activity in the brain. We saw clear evidence of AG-014447 penetration into brain tissue, and accompanying evidence of PARP inhibition, in mice with an intact BBB. PARP activity in the brain was higher than expected for a non-dividing tissue, with the activity being in the range 88–106 pmol PAR per mg protein per min. Although significantly lower than that detected in the associated tumour xenografts (1402–3236 pmol PAR per mg protein per min), it was comparable with the activity detected in normal mouse liver and kidney . Although concentrations of AG-014447 achieved in the brain (20–60 nSeveral PARP inhibitors have been shown to penetrate CNS tissue and to have a pharmacological effect, either in terms of an enhancement of the anti-tumour activity of temozolomide against intra-cranial tumours or reduction in focal ischaemia in a stroke model . HoweverIn summary, the data we present here shows encouraging enhancement of temozolomide activity in pre-clinical cell line models of medulloblastoma, representative of the spectrum of sensitivity to single-agent temozolomide. Furthermore, following a non-toxic dose of AG-014699, good CNS penetration and correspondingly substantial inhibition of PARP activity in nervous tissue was observed in association with AG-014699 plasma levels 1/10th of those detected in patients treated with the recommended Phase II dose, and without significant toxicity. Further validation of these observations in a wider range of cell lines and in orthotopic models are required before a clinical evaluation of AG-014699 in combination with temozolomide for intra-cranial malignancies would be indicated.
Cancer risks of migrants might differ from risks of the indigenous population due to differences in socioeconomic status, life style, or genetic factors. The aim of this study was to investigate cancer patterns among children of Turkish descent in Germany.We identified cases with Turkish names (as a proxy of Turkish descent) among the 37,259 cases of childhood cancer registered in the German Childhood Cancer Registry (GCCR) during 1980–2005. As it is not possible to obtain reference population data for children of Turkish descent, the distribution of cancer diagnoses was compared between cases of Turkish descent and all remaining (mainly German) cases in the registry, using proportional cancer incidence ratios (PCIRs).The overall distribution of cancer diagnoses was similar in the two groups. The PCIRs in three diagnosis groups were increased for cases of Turkish descent: acute non-lymphocytic leukaemia 1.02–1.47), Hodgkin's disease and Non-Hodgkin/Burkitt lymphoma . Age, sex, and period of diagnosis showed no influence on the distribution of diagnoses.No major differences were found in cancer patterns among cases of Turkish descent compared to all other cases in the GCCR. Slightly higher proportions of systemic malignant diseases indicate that analytical studies involving migrants may help investigating the causes of such cancers. The population of migrants in Germany comprises more than 7 million people with a Non-German nationality, and about 8 million national Germans with a migrant background. Thus, about 15 million or 19% of the resident German population have a migration background. This figure includes former guest workers, who came to Germany in the 70ies and 80ies mostly from south east Europe, refugees from all over the world and naturalised or ethnic German migrants from the former Soviet Union . On the So far knowledge about the cancer risk of children with a migrant background in Germany is scarce. However, the available evidence indicates that the question is worth studying. There is evidence of world wide geographic variation in the incidence of childhood cancer . In the In Germany, most routine health data do not contain valid and complete information on migrant status. Information on citizenship is unhelpful because it excludes the large and increasing number of migrants with German nationality. For example, the GCCR routinely collects no information relevant to migration status of registered cases. The underlying reasons are practical – the notifying physician or pathologist is often not aware of the migrant status of the diagnosed patient – rather than ethical. There is no legal requirement concerning in – or exclusion of indices of migrant status in a case report to the cancer registry. In consequence, migrant-specific analyses of cancer patterns or cancer risk are not available. This study, for the first time, presents data about childhood cancer for children with Turkish names in Germany.In Germany, all cases of childhood cancer are registered in a central register, the German Childhood Cancer Registry (GCCR) in Mainz. Between 1980–2005, 37,259 cancer cases below 15 years of age have been registered with open names based on parental consent. The completeness of registration and the quality of data are high and comply with international standards. More than 95% of all childhood cancer cases are registered; only for brain tumours the proportion is slightly lower . This hiWe applied a recently developed name-based approach to identify children of Turkish origin in the data base of the GCCR, which has been successfully used in previous studies ,8. The nThe name algorithm uses a list of more than 13,000 known Turkish family and first names to identify Turkish persons in the data base. It has an automatic part and a manual part. In the first automatic part, persons with names, which are definitely Turkish, were identified. Persons with names that are possibly Turkish or so called "doublets", i.e. rare names common in the German and Turkish language, were assessed in a second manual step by a native Turkish person, using all other available information as far as available from patient records. To examine the performance of the name algorithm, all cases were checked again manually by a Turkish expert to create a 'gold standard'. A more detailed description of the methodology and performance of the name algorithm is published elsewhere .We classified the cancer cases into 12 diagnosis groups , age (in age groups), sex, and time period of diagnosis (in years) as independent variables. Incidence (or risk) ratios, like the PCIR, are in general more conservative than odds ratios due to the larger denominator in incidence ratios. Therefore we calculated the proportional cancer incidence odds ratios in a regression model only to check for confounding or interaction between the independent variables. Here we only show the crude and stratified PCIRs.We considered different ways to conduct not only proportional analyses but to estimate actual incidence rates. For this purpose we evaluated different approaches to estimate the population under risk for the Turkish cases. However, only population data on children with Turkish nationality in Germany are available, which exclude the naturalised children of Turkish descent. We decided not use these data as this would have led to a substantial overestimation of the true cancer risk of the Turkish cases due to an underestimation of the population at risk.The name algorithm performed well with a high sensitivity and specifity, and we identified 1774 childhood cancer cases of Turkish descent as well as a common migration experience in the 1st or 2nd generation. This operationalisation of migrant status by descent from a country is commonly used in migrant research. It is, of course, a surrogate for a multidimensional set of factors including genetic, behavioural and contextual variables. The individual measurement of these factors was not possible in our retrospective, registry-based study.Our study provides insight into the distribution of cancer among Turkish migrant children in Germany. This group of Turkish migrant children defined by their Turkish names stands for a group that has in common a descent from Turkey. Most of these children are the offspring of Turkish migrants who came to Germany after the 1960ies and hence are 2The cancer diagnoses in our study are generally similarly distributed among Turkish and non-Turkish children and there is no evidence that the proportion of Turkish cases differs by age or sex group. For acute non-lymphocytic leukemia, Hodgkin's disease and Non-Hodgkin/Burkitt lymphoma, the proportions are slightly increased for Turkish children. This might be the result of a truly different cancer risk of Turkish children, for which possible causes or causal pathways are not yet known, or due to chance. The confidence intervals presented here are not adjusted for the testing of several subgroups. As we used 12 subgroups, about one spuriously significant result is likely.Our study has several other limitations. We performed an explorative 'case only' analysis. The PCIR for one diagnosis group is by definition dependent on the PCIRs in the other diagnosis groups as all proportions jointly always have to sum up to 1. The PCIR is therefore not a measure of relative risk and is somewhat difficult to interpret. An increased PCIR for one cancer site could be the expression of lower case frequencies for other cancer sites. Even if the PCIR for one cancer site is increased, the overall cancer risk can still be much lower than in the comparison group.Misclassification due to inaccurate classification of children with binational parents could also be a cause of bias. Binational marriages between Turkish and German persons have been scarce in the past but are becoming more frequent over the last years. Currently there are about 79,000 Turkish-German marriages in Germany, representing about 10% of all marriages of Turkish persons.Our findings are internally consistent. The increased PCIRs remained elevated after stratification for sex and age; no confounding by or interactions between these independent variables was found.As a first step, epidemiologic studies on cancer among migrants such as ours frequently use a descriptive comparative approach and analyse the differences of cancer patterns between migrants and an indigenous/reference population. However, most studies on cancer among migrants focus on adult cancer -16, and In terms of aetiogical explanations for possible risk differences, migrant children might, besides their possibly different genetic background or different life style, be exposed to different patterns of infections. Concerning acute lymphoid leukaemia, an influence of infectious exposures caused by unusual population mixing, e.g. in heterogeneous and transient populations, is being discussed ,18. On tOur study of cancer patterns, however, does not lend support to the hypothesis that migrant children of Turkish descent might have increased risks for acute lymphoid leukemia due to differing patterns of exposure to infectious agents. However, more detailed information is necessary for an in-depth assessment of this issue.The increased PCIRs for lymphomas in our study are consistent with the findings of studies in migrant populations in other countries. Hemminki et al. found an increased risk for non-Hodgkin lymphoma for children of Turkish parents, especially for those less than 5 years of age . CumminsBecause of the small number of Turkish cases for some cancer diagnoses and the resulting limited explanatory power of the respective PCIRs, we grouped the cancer cases in 12 diagnosis groups, including a group 'others'. A detailed analysis of the cancer diagnoses in this latter group showed an increased PCIR for cancer of the nasopharynx among Turkish migrants . This estimate is based on only five Turkish cases and could be a chance finding. However, the result is consistent with the SIR of 8.2 for cancer of the nasopharynx that Visser and Leeuwen found among Turkish migrants in the Netherlands . The incOur data on lymphoma and nasopharyngeal cancer could tentatively be interpreted as supportive of a higher proportion of cancers associated with the Epstein-Barr virus in children with a Turkish name. Indeed, data on childhood cancer from the Izmir registry in Turkey computed through the ACCIS system indicateWe were restricted to the 'case only' PCIR analysis, because of the difficulty to define the reference (denominator) population for the children of Turkish descent. The estimation of incidence rates was thus not possible in this study. A valid reference population for the Turkish cases would have been all children of Turkish descent living in Germany in the years 1980–2005. However, such a population estimate is not available. Population registries routinely collect information only on nationality but not on descent. Thus, naturalised children of Turkish descent are no longer identifiable. An earlier effort in the framework of this study to estimate the number of children of Turkish descent in the 'population under risk' using the name algorithm in a representative sample of the population of Germany was not successful due to major changes in the naturalisation law in the study period (1980–2005) and large geographical variances in the proportion of Turkish migrants. In addition, population figures from the past are available only in very few regions of Germany. The large and changing differences between the proportion of Turkish children defined by their names and defined by nationality would introduce a considerable and uncontrollable numerator-denominator bias in estimating incidence rates.The name-based approach once more proved to be a useful way to identify persons with Turkish descent in Germany. The name algorithm performed well and had high positive and negative predictive values . The appst, 2nd Generation, country of birth, ethnicity etc.) would enable a comparable collection of migrant data in health-related and general population data bases and thus allow for linking data from different data sources. Thus further research on migrant health would be facilitated. In the case of childhood cancer, further research should focus on factors influencing the cancer incidence of Turkish children and other migrant or ethnic minority groups, and investigate etiological hypotheses for specific cancers .In the future, harmonized and standardized definitions in European countries, clearly defining who is classified as a migrant and who is not, would be very helpful. A harmonized definition of migrant populations based on a standardized set of variables and 95% confidence intervals (95% CI) of children with Turkish names versus children with non-Turkish names in the German Childhood Cancer Registry by age groups, 1980–2005.Click here for file
Down-regulation of 14-3-3σ, which has been demonstrated in various carcinomas, may contribute to malignant transformation. However, the exact role of 14-3-3σ in the pathogenesis of vulvar carcinoma is not fully characterized, and the prognostic impact of 14-3-3σ protein expression is still unknown.We investigated the 14-3-3σ expression in a series of 302 vulvar squamous cell carcinomas using immunohistochemistry and its associations with clinicopathological factors and clinical outcome.p = 0.001, p = 0.002 and p = 0.001, respectively) and deep invasion . Variations of 14-3-3σ protein expression were not associated to disease-specific survival.In cytoplasm, nucleus and cytoplasm/nucleus of vulvar carcinomas high 14-3-3σ protein expression was found in 72%, 59% and 75% of the carcinomas, respectively, and low levels in 28%, 41% and 25% of the cases, respectively. High level of 14-3-3σ in cytoplasm, nucleus and cytoplasm/nucleus was significantly correlated to large tumor diameter (Our results indicate that 14-3-3σ may be involved in the development of a subset of vulvar squamous cell carcinomas by down-regulation of 14-3-3σ protein. Neither cytoplasmic nor nuclear level of 14-3-3σ expression was associated with prognosis. Vulvar carcinoma represents 3–5% of all female genital cancer and was XpSXP and RX(Y/F) XpSXP sequences (pS represents phosphoserine or phosphothreonine) [In mammals, 14-3-3 proteins are composed of a highly conserved multigene family of small acidic proteins, including seven 14-3-3 isoforms . As a phreonine) and therreonine) -9.14-3-3σ, also named stratiffin, is mostly expressed in human epithelial cells . ResponsEpigenetic change in the 14-3-3σ gene by CpG hypermethylation followed by down-regulation of 14-3-3σ expression has been demonstrated in various carcinomas -22. FurtA retrospective study was performed, in which 302 patients with squamous cell carcinoma of vulvar underwent surgery at The Norwegian Radium Hospital in the period 1977–2006. Before surgery, radiotherapy was given to 9 (3%) of the patients, additionally, 3 (1%) of the patients received chemotherapy. Radical vulvectomy was performed on 201 (67%) of the patients. Postoperative irradiation was given to 63 (21%), chemotherapy to 3 (1%) and irradiation/chemotherapy to 4 (1%) of the patients. One hundred and eight (36%) patients suffered from a relapse. The median age at diagnosis was 74 years (range 35–96 years). All patients were followed until death or 31. December, 2006. One hundred and twenty patients (40%) died of vulvar cancer. The median follow-up time for all patients was 52 months (range 0.4–346 months), whereas the median follow-up time for patients alive at last observation was 131 months (range 11–346 months). All tumors were staged according to the International Federation of Gynecology and the Obstetrics (FIGO) classification . The RegHistological specimens were reviewed by one of the authors (J.M.N.) who had no access to clinical information. The tumors were classified according to World Health Organization recommendations and 284 Human vulvar squamous cell carcinoma cell lines SW-954 and CAL-39 were grown as monolayer cultures recommended by the suppliers. For RNA analysis, cells from monolayer culture were harvested by using 0.01 M EDTA solution and washed in PBS. For immunohistochemstry, cells were fixed in 4% formalin and embedded in paraffin.2O2) for 5 min to block endogenous peroxidase. Monoclonal 14-3-3σ antibody from NeoMarkers, CA, U.S.A were applied on the sections for 30 min at room temperature. The primary antibody is highly specific to 14-3-3σ and shows no cross-reaction with other isoforms of 14-3-3 (information from NeoMarkers). Subsequently, the slides were incubated with horseradish peroxidase (HRP) labeled polymer conjugated goat-anti-mouse for 30 min, followed by incubation with 3'3-diaminobenzidine tetrahydrochloride (DAB) for 10 min. The sections were counterstained with hematoxylin, dehydrated and mounted in Diatex.Sections (4 μm) from formalin-fixed, paraffin-embedded tissue were processed for immunohistochemistry using the Dako EnVision™ + System, Peroxidase (DAB) . Deparaffinized sections were microwaved in 10 mM citrate buffer pH 6.0 to unmask the epitopes and treated with 0.3% hydrogen peroxidase and extent of staining . Scoring results of intensity and extent were multiplied to give a composite score ranging from 1 to 9 for each section. Protein expression in cytoplasm was defined as high when composite scores were ≥ 6, and low when composite scores were < 6, whereas, protein expression in nucleus were classified as high when any 14-3-3σ staining was observed in the tumor and low when no staining was seen. This is based on staining pattern observed in normal vulvar epithelium. We later verified all other cutoff values. Examination of immunostaining was performed by two independent observers (Z.W. and R.H.) with no knowledge of patient outcome. All discordant scores were reviewed until final agreement was obtained. Reproducibility in the semiquantitative scoring was controlled. The kappa values were 0.72 for both extra- and intra-observer variability when determined on a subset of 40 patients.Eleven vulvar carcinomas frozened at -70°C were selected for LMC and RNA isolation.First, 8 μm frozen sections were fixed in ethanol, stained with hematoxylin-eosin (HE), dehydrated in graded ethanol and zylene and air-dried for 5 min. Then, by using a PixCell laser capture microscope , 30–200 pure tumor cells were captured on caps by focal melting of the membrane through laser activation. The LMC parameters were as follows, a laser power of 70–80 mW, laser pulse duration of 1.2–3.5 ms, and laser spot size of 7.5–15 μm in diameter. Finally, the caps with the selected cells were covered with lysis buffer in Eppendorf tubes and rotated several times for homogenization before RNA isolation.4 cells, was employed to extract and purify RNA from cells captured on caps by LCM. Total RNA and Protein Isolation Kit was used to isolate total RNA form cell line SW-954 and CAL-39 as recommended by the manufacturer.An Absolutely RNA™ Nanoprep Kit , which was special designed to purify RNA from 1 to 1018 Primer, 2 μl Water (PCR Grade), and 10 μl RNA. (2) RNA form cell line: 4 μl 5 × Transcriptor RT Reaction Buffer, 0.5 μl Protector Rnase Inhibitor, 0.5 μl Transcriptor Reverse Transcriptase, 2 μl dNTP Mix (PCR grade), 1 μl Anchored Oligo (dt)18 Primer, 10 μl Water (PCR Grade), and 2 μl RNA. The reaction condition was: 65°C for 10 min for mixture of cDNA and primer pre-denaturation, followed by 55°C for 30 min for reverse transcription of RNA, ended by 85°C for 5 min for inaction of reverse transcriptase.Transcriptor First Stand cDNA Synthesis Kit was used to synthesis cDNA. The total reaction volume was 20 μl and the reaction systems were: (1) RNA from LMC tissues: 4 μl 5 × Transcriptor RT Reaction Buffer, 0.5 μl Protector Rnase Inhibitor, 0.5 μl Transcriptor Reverse Transcriptase, 2 μl dNTP Mix (PCR grade), 1 μl Anchored Oligo (dt) ® TaqMan® Master kit and gene specific Hydrolysis (TaqMan) Probes, according to the manufacturer's instruction. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control for relative gene expression quantification and for each gene amplification. Cp values (reading obtained at 530 nm) were normalized to the Cp of the GAPDH using the LightCycler analysis software. The following sets of primers were used to amplify gene products for Real-Time PCR reactions: GAPDH forward-5'-AGC CAC ATC GCT CAG ACA, reverse-5'-GCC CAA TAC GAC CAA ATC C; 14-3-3σ forward-5'-GAC ACA GAG TCC GGC ATT G, reverse-5'-ATG GCT CTG GGG ACA CAC.Five μl cDNA from LMC samples and 2 μl cDNA from cell lines were used as templates in subsequent Real-Time reaction performed on LightCycler 2.0 system using LightCycler2 test. The Kaplan and Meier method and the log-rank test were used to estimate and compare survival rate. Disease-specific survival was defined as the interval between diagnosis and death due to vulvar cancer. A Cox proportional hazards regression model was used for multivariate evaluation of survival rates. A backward stepwise regression with a p = 0.05 in univariate analysis as the inclusion criterion was used. All calculation was performed using the SPSS 15.0 statistical software package . Statistical significance was considered as p ≤ 0.05.The association between 14-3-3σ protein expression and clinicopathologic variables, and that between 14-3-3σ protein expression and 14-3-3σ mRNA expression levels were evaluated by the Person χIn normal vulvar epithelium, none of the 11 cases showed nuclear 14-3-3σ immunostaining. Nevertheless, high level of cytoplasmic staining (score ≥ 6) was present in 11/11 (100%) cases. The 14-3-3σ immunostaining was found in the basal, parabasal, middle and top layers of the vulvar epithelium Figure . In vulvIn the vulvar carcinoma cell lines SW-954 and CAL-39 high levels (score ≥ 6) of cytoplasmic 14-3-3σ immunostaining were observed Figure and 1d.p = 0.242), nucleus (p = 1.000) or cytoplasm/nucleus (p = 0.242) in vulvar carcinomas. Both cell lines showed low levels of 14-3-3σ mRNA expression and did not correlate to the high (score ≥ 6) 14-3-3σ protein expression.Expression of 14-3-3σ mRNA was found in all laser-microdissection-captured vulvar carcinomas and in both vulvar carcinoma cell lines SW-954 and CAL-39. However, the mRNA expression levels were variable Figure . No signp = 0.001, p = 0.002 and p = 0.001, respectively) and deep invasion . 14-3-3σ was neither associated to the cell cycle proteins p14, p16, p21, p27, p53 and cyclin A1, D1, D3 and E, nor to HPV.The levels of 14-3-3σ immunostaining in relation to clinicopathological parameters are shown in Table p = 0.002), tumor diameter (p < 0.001), depth of invasion (p = 0.007), lymph node metastasis (p < 0.001), FIGO (p < 0.001) and infiltration of vessel (p < 0.001) were correlated to disease-specific survival. There was no significant association between disease-specific survival and 14-3-3σ expression in cytoplasm (p = 0.23), nuclear (p = 0.51) and cytoplasm/nuclear (p = 0.21). In multivariate analysis, FIGO, lymph node metastasis, age and depth of invasion were of independent prognostic significance (Table In univariate analysis, with the variables defined in Table In our study normal vulvar squamous epithelium showed high cytoplasmic positivity for 14-3-3σ protein in the whole layer, which is similar to the findings in normal squamous epithelium of skin, esophagus and cervix . HoweverMhawech et al have stuGasco et al identifiInterestingly, we found different subcellular distribution of 14-3-3σ protein in cells in normal tissues and in cancer tissues. The high 14-3-3σ expression in cytoplasm but not in nucleus was found in all the 11 normal tissues, whereas, in vulvar carcinomas 72% and 59% of the cases had high expression of 14-3-3σ in cytoplasm and nucleus, respectively. Previously, Van Hermet and coworkers showed tIn our study, we found that high 14-3-3σ protein expression in cytoplasm, nuclear, and both cytoplasm/nuclear was significant correlated with large tumor diameter and deep invasion. This is in disagreement with the findings in colorectal carcinomas and gastFor the first time, 14-3-3σ protein expression and its prognostic importance has been examined in vulvar squamous cell carcinomas. No significant association was found between disease-specific survival and 14-3-3σ expression, which was in line with the findings in breast carcinomas . HoweverIn the present work, 14-3-3σ was not associated to p53 protein expression, which was similar to the findings in a variety of cancers from bladder, prostate, endometrium, ovarium, breast and neurTo our knowledge, the relationship between levels of 14-3-3σ mRNA and protein expression in vulvar carcinomas has not been studied previously. Gasco et al found a Low levels of 14-3-3σ protein expression in 25% of the cases may indicate that 14-3-3σ protein expression may be associated with tumorigenesis in a subset of vulvar squamous cell carcinomas. However 14-3-3σ protein expression was not associated with prognosis.The authors declare that they have no competing interests.ZW participated in the design of the study, carried out the microdissection, protein, mRNA, statistical and data analysis and draft the manuscript. CGT collected clinical data, participated in interpretation of data and helped to draft the manuscript. ZS participated in microdissection and mRNA analysis and interpretation and revised the manuscript critically. GT participated in microdissection and mRNA analysis and interpretation and revised the manuscript critically. GY was involved in the project design and manuscript revising. JMN performed systematic pathologic review of vulvar carcinomas and revised the manuscript critically. RH participated in the design of the study, protein, statistical and data analysis and helped to draft the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:
In addition, there is lack of information on the cellular effects of telomere shortening in human cells.The ends of chromosomes, termed telomeres consist of repetitive DNA. The telomeric sequences shorten with cell division and, when telomeres are critically abbreviated, cells stop proliferating. However, in cancer cells, by the expression of telomerase which elongates telomeres, the cells can continue proliferating. Many approaches for telomere shortening have been pursued in the past, but to our knowledge, cutting telomeres in vitro assay demonstrated that the TRAS1EN-TRF1 chimeric endonucleases (T-EN and EN-T) cut the human (TTAGGG)n repeats specifically. The concentration of TRAS1EN-TRF1 chimeric endonucleases necessary for the cleavage of (TTAGGG)n repeats was about 40-fold lower than that of TRAS1EN alone. When TRAS1EN-TRF1 endonucleases were introduced into human U2OS cancer cells using adenovirus vectors, the enzymes localized at telomeres of nuclei, cleaved and shortened the telomeric DNA by double-strand breaks. When human U2OS and HFL-1 fibroblast cells were infected with EN-T recombinant adenovirus, their cellular proliferation was suppressed for about 2 weeks after infection. In contrast, the TRAS1EN mutant (H258A) chimeric endonuclease fused with TRF1 (ENmut-T) did not show the suppression effect. The EN-T recombinant adenovirus induced telomere shortening in U2OS cells, activated the p53-dependent pathway and caused the senescence associated cellular responses, while the ENmut-T construct did not show such effects.Here, we created novel chimeric endonucleases to cut telomeres by fusing the endonuclease domain (TRAS1EN) of the silkworm's telomere specific non-long terminal repeat retrotransposon TRAS1 to the human telomere-binding protein, TRF1. An n specifically in vitro and in vivo. Thus, the chimeric endonuclease which is expressed from an adenoviral vector can suppress cell proliferation of cancer cells.A novel TRAS1EN-TRF1 chimeric endonuclease (EN-T) cuts the human telomeric repeats (TTAGGG) Telomeres are specialized structures that protect chromosomal ends from gene erosion at cell divisions, nonhomologous chromosomal end joining and nuclease attack . The DNABombyx mori, is a typical sequence-specific LINE, which inserts between the T and A of the (TTAGG)n telomeric repeats of the silkworm adenosine triphosphate (ATP) with T4 polynucleotide kinase. The oligonucleotide concentration was fixed at 100 nM with adding nonlabelled oligonucleotides. The reaction buffer for chimeric endonucleases contained 5 mM HEPES-KOH (pH 7.9), 10 mM NaCl, 2 mM MgCl2, 100 μg/ml BSA and 500 nM non-specific oligonucleotide, NTR to suppress non-specific binding of misfolded chimeric endonuclease to non-telomeric sequence. This mixture was treated with a purified chimeric endonuclease in 10 μl of reaction buffer for 1 h at 25°C. The reaction mixture was denatured in a loading buffer containing 75% formamide for 5 min at 95°C, immediately chilled on ice and run on a 28% Long Ranger polyacrylamide denaturing sequencing gel . Quantitation of the reaction products was carried out with a BAS 5000 imaging analyser system (Fujifilm).The telomeric repeat plasmid pTR80 was constructed from a PCR product of an extended primer dimer of (TTAGGG)32P] ATP and were used as molecular size markers: dG8, dG14, dG20, dG26, dC9, dC15, dC21 and dC27 . Transfections were performed with FuGene HD (Roche) according to the manufacturer's procedure. Four separate microscope images were used for counting the number of cells with CellProfiler . After the cells were further incubated at 37°C for 24 h, the percentage of stained cells was counted. The number of blue structures was counted in four fields .Senescence-associated beta-galactosidase activity at pH 6.0 is a commonly used cellular senescence marker . Positivet al. . The monFokI cleavage domain; LINE: long interspersed nuclear element; LTR: long terminal repeat; NLS: nuclear localization signal; NTR: non-telomeric repeat; PBS: phosphate buffered saline; PCR: polymerase chain reaction; SA: senescence-associated; SDS: sodium dodecyl sulfate; SSC: saline-sodium citrate; ZFN: zinc finger nuclease.AP: apurine/apyrimidine; APT: adenosine triphosphate; EN: endonuclease-like domain; FN: The authors declare that they have no competing interests.KY carried out the molecular genetic studies and contributed to the manuscript. HA participated in the design of the study. HF conceived and coordinated the study and helped to write the manuscript. All authors read and approved the final manuscript.Figure S1 - The amino acid sequences of protein linkers. The protein linker sequences of T-EN, M-EN, EN-T, EN-NM, EN-M, T-FN and FN-T are shown. The second structures of these proteins are predicted by SSpro http://scratch.proteomics.ics.uci.edu/. 67 -267 a.a. of the linker of EN-T and FN-T are TRF Homology domain (TRFH) which has tight structure, so we calculated linker length except this domain. Most of these linkers are nonstructural peptide.Click here for fileFigure S2 - SDS-PAGE of purified chimeric endonucleases. (a) Selection of an appropriate E. coli strain for the effective expression of human protein (TRF1). Recombinant TRF1 protein was purified with a His tag. Protein extracts produced from bacterial cells were purified using Ni-NTA (nitrilotriacetic acid) agarose beads, and separated on a sodium dodecyl sulphate (SDS)-PAGE gel and stained with Coomassie brilliant blue. We confirmed that the molecular mass of overexpressed protein is identical to TRF1 (53.6 kDa). * indicates non-specific protein bound to Ni-NTA beads. The expression of human protein TRF1 increased with chaperon and rare tRNA. (b) SDS-PAGE of purified chimeric endonucleases using Rossetta2/pLysSRARE2 (Kmr) strain in (a). The molecular weight of each purified protein was the same as the calculated weight. Arrows shows purified protein.Click here for fileTable S1. Cleavage activity of chimeric endonucleases.Click here for fileFigure S3 - Cleavage of telomeric repeats by chimeric endonucleases. RI-labelled double-strand oligo DNA substrate, TR5 containing 5 TTAGGG repeats was digested with chimeric endonuclease, and separated on polyacrylamide gels. The DNA concentration was 100 nM, and protein concentration was about 0.3 μM except for EN (6 μM), and FN-T (0.02 μM). The (TTAGGG)5 strand of TR5 was labelled in (a) and the (CCCTAA)5 strand was labelled in (b). Black arrowheads show major cleavage bands which were cleaved in every telomeric repeat; gray arrowheads show minor cleavage bands. (c) Schematic cleavage sites are shown based on the results of (a) and (b).Click here for fileFigure S4 - Binding activity of chimeric endonucleases to telomeric repeats. In order to examine the binding capacity of chimeric endonuclease to the telomeric repeats, we performed electrophoretic mobility shift assays. Approximately 1 nM RI-labelled double-strand oligo DNA was added with fusion protein at 0.04, 0.2, 1 μM except for T-FN and FN-T from left to right in each gel. Target oligo DNA used as probe was TR5, (TTAGGG)5 in (a), and NTR in (b).Click here for fileTable S2. Primer list.Click here for fileFigure S5 - The map of recombinant adenovirus genome. The maps of recombinant adenoviruses, Ad-G, Ad-EN, Ad-GT, Ad-T-EN, Ad-EN-T, Ad-ENmut-T, Ad-T-FN and Ad-FN-T are shown. pAxCAwtit vector contains adenovirus genome between NspV sites. Adenovirus vectors are replication defective by deletion of the E1A and E1B genes which are required for virus replication in mammalian cells, and lack E3 gene which is not essential for virus replication in 293 cells. Recombinant proteins have HA epitope tag at the N-terminal end.Click here for file
Mirizzi syndrome is a rare complication of long standing cholelithiasis. The purpose of this study is to retrospectively estimate the diagnostic and treatment methods applied in patients with Mirizzi syndrome.Our experience with 27 cases with Mirizzi syndrome is presented. They were diagnosed either by imaging techniques, or during surgical operation. All of the patients were managed surgically.8 patients were diagnosed preoperatively and the rest intraoperatively. Morbidity rate after surgery was 18,5%, and mortality rate was zero. The patients presented free of symptoms three months after surgery during the follow-up.Mirizzi syndrome is rarely diagnosed preoperatively and US proved inadequate for this purpose. Surgery is the only therapy and usually provides additionally definitive diagnosis. Mirizzi syndrome is an unusual complication of gallstone disease and occurs in approximately 1% of all patients with cholelithiasis . The majThus a constant vigilance during intraoperative dissection of Calot's triangle is required in order to avoid injury of the bile duct.nd Department of Propaedeutic Surgery, Medical School, University of Athens. A total of 2,978 cholecystectomies were performed during this period. Among the 27 patients with Mirizzi syndrome, 21 patients had type I disease, 5 patients had type II disease and one patient had type II/III disease. The records of these 27 patients were reviewed for clinical symptoms, diagnostic methods, surgical procedures, complications and follow-up. The Csendes classification was followed to categorize the patients. For types II, III or IV when cholecystobiliary fistula existed, the classification was made intraoperatively. All patients were seen in the surgical department within 3 months from their discharge from the hospital and every 6 months thereafter for a mean period of five years (range: 3–13 years). Four patients were lost from follow-up 1–2 years after surgery. All were symptom free with normal liver function tests through the last follow-up visit. None of the patients with Mirizzi syndrome had previous hepatobiliary surgical intervention prior to diagnosis. Females outnumbered males by sixteen to eleven. The age of patients ranged from 48 years to 86 years. Upper abdominal pain, fever and jaundice were the most frequent symptoms and signs. The diagnosis of Mirizzi syndrome was achieved preoperatively in 8 patients . The other 19 patients were diagnosed intraoperatively. For preoperative evaluation of the patients the technological advancements of the last three decades were employed.This is a retrospective study of 27 consecutive patients with Mirizzi syndrome in the last 20 years (1986–2005), treated at the 2Despite arguments in the literature about the usefulness of ultrasonography (US) in diagnosis, it proved to be of limited value, as in only 8 patients was US indicative for Mirizzi syndrome. In these 8 cases, the diagnosis was confirmed by endoscopic retrograde cholangiopancreatography (ERCP) in 6 cases, while by magnetic resonance cholangiopancreatography (MRCP) and percutaneus cholangiography (PC) the remaining two cases. The diagnostic value of the employed non-invasive imaging techniques in our series is shown in table Surgical treatment was applied in all patients with Mirizzi syndrome. In 21 patients with type I disease, partial cholecystectomy was performed in 15 cases and complete cholecystectomy in 6 cases. In 4 cases laparoscopic cholecystectomy was attempted but only in one case it was achieved. Among the six patients with cholecystobiliary fistula, in five patients with type II disease T-tube insertion from the fistula or directly to the common bile duct using the gallbladder as a pedicled graft in either case was performed.th postoperative day was necessary. All patients had a tube drain left in the subhepatic space that remained for 2 to 15 days. Furthermore, two patients developed wound infection necessitating open drainage. Overall morbidity was 18,5% (5 cases). The mortality rate in our series was zero. Histology did not reveal concomitant carcinoma of the gallbladder in any of the patients.In the remaining patient with type II or III disease with a particular appearance of the fistula opening after extraction of the gallstone (photo) and considering the risk of postoperative biliary stricture increased, a Roux-en-Y cholecysto-choledochal-jejunostomy was carried out Fig. . No bile2. McSherry in 1982 suggested a subclassification of the Mirizzi syndrome into two types.Mirizzi syndrome (MS) was described in 1948 as obstructive jaundice due to gallstone/s impacted in the cystic duct or Hartmann's pouch, compressing the common hepatic ductType I regards the external compression of the common hepatic by a calculus in the cystic duct or Hartmann's pouch whereas, in type II the stone has eroded partially or completely into the common hepatic bile duct and a cholecystocholedochal fistula has resulted .In 1989 a new classification of patients with Mirizzi syndrome and cholecystobiliary fistula was presented. Type I lesions are those with external compression of the common bile duct; in type II lesions a cholecystobiliary fistula is present with erosion of less than one third of the circumference of the bile duct; in type III lesions, the fistula involves up to two thirds of the duct circumference; and in type IV there is complete destruction of the bile duct .Therefore, Mirizzi syndrome and cholecystobiliary fistula appear to be different, evolving stages of the same pathological condition; thus, it is reasonable that Lubbers proposes that the term Mirizzi syndrome could not be abandoned, as it is only the first stage of a more complete process .2 sections can differentiate a neoplastic mass from an inflammatory one, which U/S or CT scan may not be capable of doing.Nevertheless, gallstone erosion into the common duct is a rare complication of cholelithiasis and is mainly the result of the long-standing gallstone disease. Cholecystocholedochal fistula is an important complication of Mirizzi syndrome but it occurs only in 1% of all biliary operations . ClinicaThe association of Mirizzi syndrome and gallbladder carcinoma is also of interest; in such cases it is obvious that complex surgical procedures should be avoided ,8. HowevIn fact, surgery is the treatment of choice for patients with diagnosis of Mirizzi syndrome. The surgical strategy includes complete removal of the gallbladder or partial cholecystectomy for MS type I, while various surgical approaches have been used for MS type II, where cholecystobiliary fistula is present and requires treatment.The following approach is rather more accepted for type II. After the gallstone has been removed and partial cholecystectomy has been performed, the remaining gallbladder is used for choledochoplasty. A T-tube is introduced into the common hepatic duct above the repair site. Furthermore, in our department, in order to close the hole in the common bile duct, we have used, besides the gallbladder cuff, a pedicled graft of the round ligament of the liver ,12. ReceIn our opinion, an 8–15 mm cuff of the gallbladder or round ligament is sufficient in order to close the defect in the common bile duct.The role of laparoscopic approach in the treatment of Mirizzi syndrome remains controversial. Some authors consider the condition unsuitable for laparoscopic surgery since the inflammatory tissue in the area of Calot's triangle offers a high operative risk in dissection ,14,15. OIn high-risk patients suffering from MS, biliary drainage by endoscopic sphincterotomy and placement of a stent in the choledochal duct has been carried out . MoreoveAlthough the diagnostic imaging techniques have been perfected, preoperative diagnosis of MS is not an easy affair and continues to be a challenge for the surgeon. Therefore, even intraoperative precautious recognition of the condition and application of the appropriate surgical method according to the characteristics of each case will lead to successful treatment. In conclusion, it is important to identify patients with Mirizzi syndrome preoperatively but it seems even more important to consider its diagnosis during surgical dissection.U/S: Ultrasonography; ERCP: Endoscopic retrograde cholangiopancreatography; MRCP: Magnetic resonance cholangiopancreatography; PC: Percutaneous cholangeography; MS: Mirizzi Syndrome; CT: Computed tomographyThe authors declare that they have no competing interests.M.Safi Surgeon who performed the operation and edited a part of the manuscript.MSta who performed the operation and prepared the draft.PS Literature search, revision of bibliography.AS Surgeon who contributed to the performance of the operation.CR Radiologist who made the diagnosis of the laboratory findings.CS Literature search, revision of bibliography.All authors have read and approved the final manuscript.
Clinical studies demonstrate that this immune response may play an important role in the host defense against HIV infection. In this study, we examined the distinct steps in viral gene expression for inhibition by noncytolytic CD8+ T cells. A primary HIV-1 infection system of CD4+ enriched peripheral blood mononuclear cells was utilized to examine the HIV-1 life cycle as a relevant ex vivo system. Established CD8+ T cell lines from two HIV+ long-term nonprogressors were used to examine differences at the level of transcriptional initiation and elongation of the HIV genome. This infection system coupled with the results from real-time measurement of newly transcribed RNA transcripts determined that there was a significant decrease (5-8 fold) in short intracellular viral RNA transcripts. These data strongly favor a role for the initiation of virus transcription in noncytolytic CD8+ T cell mediated suppression.The replication of human immunodeficiency virus type 1 (HIV-1) can be inhibited by noncytolytic CD8 The use of a single-cycle infection prevented subsequent rounds of virus replication and allowed the observance of a single viral replication cycle. At 48 hours post infection, the initiation ratio demonstrated that the JR HVS CD8+ and HS HVS CD8+ cells executed significant suppression at the initiation stage of viral transcription, on average 7.3 fold and 5.1 fold inhibition respectively . The HIV-naïve CD8+ cells also exhibited inhibition, 3.7 fold on average, albeit not to the strength of LTNP CD8+ cells. Interestingly, this lower level of inhibition of initiation was consistent regardless of the level of infection in the presence of HIV-naïve CD8+ cells. Both the JR HVS CD8+ and HS HVS CD8+ cells suppressed transcriptional initiation to a significantly higher level than the HIV-naïve CD8+ cells .To define whether or not suppression occurred at transcriptional initiation the + cells had a general effect on suppressing host cell transcription. From the same RNA isolates for every experiment, real-time PCR was used to quantify early transcription of the housekeeping gene. The data as shown in Fig. (3) illustrates there was no suppression of the housekeeping gene, RPS9 supporting the finding that CD8+ T cell mediated suppression is unique to HIV transcription.The housekeeping gene, ribosomal protein S9 (RPS9), was measured to determine if the CD8+ T cell mediated suppression affects transcriptional elongation. An equation NSL/[SL x [NSS/SS]] was derived so that any contributing factors from transcriptional initiation could be included. Fig. (4) shows data from HIV short and 3 kb primers with the resulted values of JR = 0.6, HS = 0.6, and EW = 0.8. The lack of significant effect at approximately 3 kb from the start of viral transcription indicates that suppression of virus replication is likely limited to the initiation of transcription. In addition, RT-PCR was also used to quantify the late transcription products of the housekeeping gene, RPS9. There was no significant effect on RPS9 elongation. Because both RPS9 transcriptional initiation and elongation are both near a 1:1 ratio between non-suppressed and suppressed systems, this supports that there is no global effect of CD8+ inhibition on general host cell gene expression. This supports previous data that non-cytolytic CD8+ suppression is specific to HIV replication , which measures the progression from initiation [HIV short] to elongation (HIV long-3 kb), on average there are 3.8 times as many HIV short transcripts than 3 kb transcripts in positive controls (N = 16). The addition of JR HVS CD8+ and HS HVS CD8+ effector cells to infected CD4+ T lymphocytes resulted in greater HIV short to 3 kb ratios, however, this was to a lesser degree, 2.9 and 2.1, respectively (N = 16 and N = 12). There were fewer 3 kb copies than 7 kb or 9.7 kb copies in all samples tested and this was interpreted to be a consequence of the alternative splicing of HIV-1 transcripts.The analysis of viral transcript elongation (including splicing) was extended further along the HIV genome to test for possible amplification of smaller effects downstream from those potentially present at shorter distances from the start of virus transcription. Fig. to increase the level of transcription by greater than 2-logs [via one of P-TEFb’s components, CDK9 (a CTD kinase), phosphorylates the C-terminal heptapeptide repeate domain (CTD), of the largest subunit of RNAPII. Phosphorylation of CTD is thought to mediate the increase in transcript elongation.HIV-1 transcription is regulated by a complex interaction of cellular and viral proteins. Sequences within the HIV-1 genome that are involved in viral gene transcription can be divided into the core promoter elements, the enhancer, the modulatory and negative regulatory elements and the tat responsive element (TAR). HIV transcription is primarily regulated by the viral promoter which contains a canonical RNA polymerase II (RNAPII) TATA box, transcription factor binding sites and an initiator element . Subsequn 2-logs , 32. Pos+ T cells act to modulate Tat activity to inhibit HIV replication will be important to consider as potential pathways for the inhibition of viral transcriptional initiation are explored.Our work suggests that anti-viral CD8 T cells may suppress the transition from the initiation of viral transcripts to elongation of these same transcripts. The mechanisms and factors that could be involved include the alteration of CTD phosphorylation sites or modulation of Tat activities. Tat is primarily thought to be involved in transcriptional elongation, but several labs have presented evidence that Tat is likely to be involved in initiation by aiding in the assembly of the transcription complex (TC) (reviewed in ). Unders+ suppressive activity at elongation and/or splicing, it is important to note that this possibility cannot be fully eliminated. The role of C-terminal heptapeptide repeat domain (CTD) of RNAP II, CA150 and/or the Tat-P-TEFb complex (which includes cyclin T1) has yet to be fully investigated for their potential roles in inhibition of HIV.Although the data generated here do not support CD8+ cells to suppress HIV infection. It is reported here that HIV-naïve CD8+ cells inhibit transcriptional initiation of HIV, but the magnitude is less than that of the CD8+ T lymphocytes derived from long-term nonprogressors. This is in agreement with the lower level of suppression of virus infection by these HIV-naïve CD8+ T cells observed here. We can not exclude the possibility that the transformation of the CD8+ lymphocytes may have contributed to the transcriptional effects demonstrated here, although we consider it unlikely as previous work by our group demonstrated that the transformed cells recapitulated the phenotype of the primary cells from which they were derived [There is some controversy as to the ability of HIV-naïve CD8 derived .+ cell suppression of viral replication are permissible. Previous studies have shown that CD8+ T lymphocytes express and secrete soluble molecules capable of suppressing viral replication. The most notable of these molecules are the natural ligands for the CCR5 coreceptors, the β-chemokines RANTES, MIP-1α and MIP-1β, which do in fact inhibit viral replication by blocking viral entry. Since their discovery, however, several groups have shown that these soluble anti-viral factors cannot adequately explain the viral suppressive activity of CD8+ T cells [In the system presented here both soluble and contact mediated non-cytolytic CD8 T cells , 35. Her+ cell suppression activity [tat-mediated enhancement of viral transcription is a characteristic that differentiates HIV transcription from Hepatitis B transcription. HIV and Hepatitis B are both inhibited by non-cytolytic CD8+ T lymphocyte suppression as both also use host cell transcriptional machinery for transcription of viral RNA. Considering that HIV utilizes a unique means of enhancing transcription through the HIV tat-protein and TAR-sequence (tat-activating region), and both HIV and Hepatitis B virus use host cell transcription machinery, non-cytolytic CD8+ suppression could be mediated by altering host cell transcription machinery that may act specifically in concert to target viral transcription. This idea is further supported by the complexity of cellular transcription and the numerous possible targets for modification by host cell defense mechanisms.Other than HIV-1, Hepatitis B virus is another virus described as sensitive to non-cytolytic CD8activity . The useex vivo system provides strong data showing that CD8+ T cell suppression occurs at viral transcription. Future studies will focus on in vitro transcription and protein expression analysis to identify the molecular players. This discovery may provide some insight into how CD8+ T cells from long-term nonprogressors and exposed uninfected individuals may suppress HIV replication. Further uncovering of the exact mechanism around the initiation of viral transcription may lead to the development of novel therapeutics for HIV infection or innovative means to elicit this CD8+ activity as part of a vaccine strategy.As provided in this report, the use of an
Its compact molecular size should provide for an efficient tissue penetration, yet suitable to a prolonged serum half-life.A new human, compact antibody was engineered by fusion of a human, antitumour ErbB2-directed scFv with a human IgG1 Fc domain. Overexpression of the ErbB2 receptor is related to tumour aggressiveness and poor prognosis. This new immunoagent meets all criteria for a potential anticancer drug: it is human, hence poorly or not immunogenic; it binds selectively and with high affinity to target cells, on which it exerts an effective and selective antiproliferative action, including both antibody-dependent and complement-dependent cytotoxicity; it effectively inhibits tumour growth Immunotherapy represents an effective strategy to fight cancer, mainly based on antibodies specifically directed to selected cancer cells , a transmembrane tyrosine kinase receptor, overexpressed in breast carcinomas, for which it is a marker of poor prognosis and complement-dependent cytotoxicity (CDC). Yet, such a compact antibody is expected to have .The SKBR3 cell line from human breast cancer, the A431 cell line from human epidermoid carcinoma, and Chinese hamster ovary (CHO) cells were cultured in RPMI 1640 . The TUBO cell line from a BALB-neu T mouse-derived mammary lobular carcinoma was grown in DMEM (Gibco BRL). The media were supplemented with 10% foetal bovine serum (20% for TUBO cells), 50 U mlThe antibodies used were: Herceptin ; monoclonal anti-human IgG1 ; horseradish peroxidase-conjugated goat anti-mouse immunoglobulins ; horseradish peroxidase-conjugated goat anti-human affinity-isolated IgG (Fc specific) (Sigma).Peripheral blood lymphocytes (PBL) were obtained from peripheral blood mononuclear cells (PBMC) isolated by centrifugation on Lymphoprep gradients from normal donor buffy coats obtained from the Blood Bank of the Medical School of the University of Naples ‘Federico II’. After the separation, PBL were washed twice and incubated in RPMI 1640 medium (Gibco BRL) for 2 h at 37°C to remove adherent cells. The nonadherent cells were used as natural cytotoxic effectors without any additional treatment.HindIII site and a BamHI site, respectively: . The PCR fragment was then digested with HindIII and BamHI for cloning into the corresponding sites in plasmid pIg1plus , downstream to the leader sequence and upstream to the hinge-CH2-CH3 sequence, respectively, of a human IgG1 heavy chain constant region (Fc).In a previous paper . Stable transfectants were selected in the presence of G418 (Sigma) at a concentration of 1 mg ml−1. Expression of the antibody construct was determined in the culture medium by quantitative ELISA. For recombinant protein production, transfected CHO cells were expanded to near confluence in selective medium containing neomycin, and then were grown for 3–4 days in serum-free medium.The fusion protein was produced by transfecting CHO cells with the recombinant vector. In brief, cells grown in RPMI containing 10% FCS at 70–80% confluency were transfected with 5 M Tris-HCl, pH 8.0 containing 0.5 M NaCl, and 10 volumes of 10 mM Tris-HCl, pH 8.0. The protein eluate was obtained with 50 mM glycine pH 3.0, and immediately neutralised with 1/10 volume of 1 M Tris-HCl, pH 8.0.The recombinant fusion protein, henceforth termed Erb-hcAb, secreted by transfected CHO cells, was purified from culture medium by affinity chromatography on a protein A-Ceramic Hyper D®F column loaded with 300–500 ml of conditioned medium, washed with 10 volumes of 100 m5 cells per well). After blocking with PBS containing 6% bovine serum albumin (BSA), cells were incubated with conditioned medium or purified immunoagents in ELISA buffer (PBS/BSA 3%) for 90 min. The pelleted cells were washed, resuspended in 100 μl of ELISA buffer, and incubated with an anti-human IgG (Fc-specific) mAb (Sigma) or anti-myc mAb 9E10 , were washed and transferred to U-bottom microtitre plates . For ADCC assays, target or control cells were treated with the immunoagents (3 μg ml−1 of serum-free medium) and peripheral blood lymphocytes (PBL) at 37°C for 3–4 h. For CDC assays, cells were incubated at 37°C with human serum. Cultures were performed in triplicate in a final volume of 200 μl. Controls included target cells incubated in the absence of effector, or in the presence of either serum or immunoagent alone. Tumour cell lysis was determined by measuring the release of lactate dehydrogenase (LDH) using a LDH detection kit . ADCC or CDC were calculated as the percent of cytolysis measured in the presence of immunoagent and PBL or human serum, for ADCC and CDC, respectively, taking as 100% the maximal LDH release determined by lysis of target cells with 1% Triton X-100.Target and control cells were detached from culture dishes with a cell dissociation solution (Sigma) and transferred to round-bottom 96-well plates (2 × 105) were suspended in 0.2 ml sterile PBS and injected subcutaneously (day 0) in the right paw. At day 7, when tumour started to appear, the mice were divided into two groups. At day 15, when tumours were clearly detectable, Erb-hcAb dissolved in PBS was administered at a site remote from that of tumour implantation, at doses of 2.5 mg kg−1 of body weight for 7 times at 72 h intervals. The second group of control animals was treated with identical volumes of sterile PBS. During the period of treatment, tumour volumes (V) were measured with caliper and calculated by the formula of rotational ellipsoid V=A × B2/2 . All mice were maintained at the animal facility of the Department of Cellular and Molecular Biology and Pathology, University of Naples Federico II. Animal studies were conducted in accordance with the Italian regulation for experimentation on animals. All in vivo experiments were carried out with ethical committee approval and met the standards required by the UKCCCR guidelines . TUBO cells (5 × 10−1. The immunoagent was named Erb-hcAb (anti-ErbB2 human compact antibody). When Erb-hcAb was analysed by SDS–PAGE . As shown in Figure 3ATo investigate whether Erb-hcAb was capable of recruiting immune effector functions μg ml−1 concentrations) in the absence or the presence of human serum as a source of complement. As illustrated in μg ml−1 of Erb-hcAb in tumour volume. During the period of treatment, the animals did not show signs of wasting or other visible signs of toxicity.When administered to mice, TUBO cells induce tumours very similar to the alveolar-type human lobular mammary carcinomas (Figure 4in vitro and in vivo. Furthermore, its size should be better suited to therapeutic applications than either a small scFv, or full-size IgG-like molecules.The results described in this report show that the Erb-hcAb immunoagent has a high therapeutic potential, as it fully satisfies the conditions required for a successful anticancer agent: it is a fully human immunoagent, hence presumably with a reduced or no immunogenicity; it recognises with high affinity one of the most specific tumour-associated antigens, such as ErbB2; it displays effective antibody effector functions; it is effective in inhibiting target cell growth both in vitro ADCC and endure a much longer serum half-life in vivo when compared to its parental scFv. However, the protein was produced in yeast with yeast-controlled glycosylation; furthermore, it was found to be heterogeneous, obtained in very low yields, and only partially glycosylated. It should be noted that Erb-hcAb, as reported above, was prepared instead in CHO cells, a mammalian model certainly closer than yeast to human cells.Previous reports have shown the feasibility of cloning single-gene constructs encoding fusion proteins made up of murine scFv and Fc fragments (Herceptin, currently used for treatment of advanced breast cancer (Taken together, the data reported here suggest that Erb-hcAb is a promising new anticancer agent, and supports the concept that, after humanised monoclonals and scFvs, a third generation of immunoagents, human compact antibodies, may represent the format of choice for the therapy of solid tumours.
The mechanism by which vitrectomy improves macular edema in patients with branch retinal vein occlusion remains unclear, although intraocular levels of vascular endothelial growth factor have been suggested to influence the visual prognosis and macular edema.A series of 54 consecutive patients (54 eyes) with branch retinal vein occlusion was studied prospectively. All patients underwent pars plana vitrectomy for treatment of macular edema. Best corrected visual acuity and retinal thickness were assessed before and after surgery. The level of vascular endothelial growth factor in vitreous fluid harvested at operation was determined. Patients were followed for at least 6 months postoperatively.Both the visual acuity and the retinal thickness showed significant improvement at 6 months postoperatively . The vitreous level of vascular endothelial growth factor was significantly higher in patients who showed less improvement of visual acuity compared with those who had a better visual prognosis (p = 0.0135). In contrast, a high vitreous level of vascular endothelial growth factor was associated with greater improvement of macular edema (p = 0.0064).These results suggest that the vitreous level of vascular endothelial growth factor might influence the visual prognosis and the response of macular edema to vitrectomy in patients with branch retinal vein occlusion. Branch retinal vein occlusion (BRVO) is a common retinal vascular disease that often causes macular edema, which is the main reason for visual impairment in these patients,2. We haWe recently reported that higher VEGF levels in the vitreous fluid were associated with more marked improvement of macular edema after PPV in patients with BRVO. HoweverThe subjects all underwent PPV at Tokyo Women's Medical University Hospital or Eguchi Eye Hospital and undiluted vitreous fluid samples were harvested at the start of surgery. Written informed consent was obtained from each subject after an explanation was given about the purpose and potential adverse effects of the procedure. This study was performed in accordance with the Helsinki Declaration of 1975 (1983 revision). The institutional review boards of Tokyo Women's Medical University and Eguchi Eye Hospital both approved the protocol for collection and testing of vitreous fluid. Consecutive patients presenting with BRVO between June 2005 and November 2008 were screened according to the following criteria and 56 patients were enrolled. The indications for pars plana vitrectomy were: (1) clinically detectable diffuse macular edema or cystoid macular edema persisting for more than 3 months, (2) best-corrected visual acuity worse than 20/40, and (3) macular edema that persisted after retinal photocoagulation. Significant macular edema was defined as retinal thickening that covered at least one optic disc area and involved the fovea[Best-corrected visual acuity was measured before and after PPV in decimal units and the data were converted to the logarithm of the minimum angle of resolution (log MAR) scale. Biomicroscopic examination was performed with a fundus contact lens. Fundus findings were confirmed preoperatively by standardized fundus color photography and fluorescein angiography, which was performed with a Topcon TRC-50EX fundus camera, an image-net system , and a preset lens with a slit-lamp.A masked grader independently assessed ischemic retinal vascular occlusion on fluorescein angiograms. The ischemic region of the retina was measured with the public domain Scion Image program, as reported previously,4,10. InOptical coherence tomography (OCT) was performed in each subject within 1 week before surgery. The fundi were scanned with the beam focused on horizontal and vertical planes that crossed the central fovea, which was located on the fundus photograph and by the patient fixing on the central landmark during OCT. (All subjects were able to maintain fixation.) Cross-sectional images were collected by a single experienced examiner, who continued each study until reproducible scans were obtained. The thickness of the central fovea was defined as the distance between the inner limiting membrane and the retinal pigment epithelium , while the thickness of the neurosensory retina was defined as the distance between the inner and outer neurosensory retinal surfaces. The sevUnder local anaesthesia, all patients underwent standard three-port PPV. All epiretinal material, the residual cortex, and the posterior hyaloid were removed from the retina around the macula as completely as possible with the assistance of triamcinolone acetonide, which was injected into the eyeball at the minimum amount required and then was removed as thoroughly as possible at the end of surgery, because it can influence cystoid macular edema. Scatter laser photocoagulation was also applied intraoperatively to the ischemic region of the retina in 24 eyes . Peeling of the internal limiting membrane was not performed. All patients were followed for at least 6 months postoperatively.121 and VEGF165). The minimum detectable concentration of VEGF was 15.6 pg/ml , so the VEGF level in vitreous fluid samples was within the detection range of the assay.Samples of undiluted vitreous fluid 300-500 μl) were collected into sterile tubes at the time of surgery and were rapidly frozen at - 80°C for storage until VEGF was measured by an enzyme-linked immunosorbent assay using a kit for human VEGF 00-500 μl,10. Thist-test was used to compare the retinal thickness and the best-corrected visual acuity between the preoperative values and those obtained 6 months after surgery. To investigate the relation between each of the factors assessed and macular edema, Spearman's rank-order correlation coefficients were calculated. To identify factors with an influence on the visual prognosis, multiple linear regression analysis was performed, with the effects of profile, linearity, interaction, and collinearity on the multiple linear models being examined by regression diagnostic analysis. In all analysis, a two-tailed P value of less than 0.05 was taken to indicate statistical significance.Analyses were performed with SAS System 9.1 software . Data are presented as frequencies or as the mean ± SD. The paired Of the 56 patients who were enrolled, 2 patients were lost to follow-up because of transfer to another hospital for personal reasons. The remaining 54 patients included 21 men and 33 women. Their mean age was 64.6 ± 10.0 years (range: 40-87 years), and the mean duration of BRVO before surgery was 4.5 ± 2.1 months (range: 3-10 months). Preoperative photocoagulation was done in 26 eyes . Retinal photocoagulation was done within 2.3 ± 1.5 months (range: 1 to 5 months) before surgery. None of the subjects received treatment with anti-VEGF agents or triamcinolone acetonide prior to surgery.At the initial examination, the mean best-corrected visual acuity was log MAR 0.84 ± 0.40, and it improved significantly to log MAR 0.54 ± 0.39 by 6 months after PPV (P = 0.0002). Four patients (7%) showed deterioration of their visual acuity, including two who had persistent macular edema after surgery and two with macular atrophy. The initial mean foveal thickness was 554. ± 182. μm and it decreased significantly to 308. ± 130. μm by 6 months after PPV (p < 0.0001). During PPV, a peripheral retinal tear occurred in three eyes, but these tears were successfully managed by endolaser photocoagulation and sulfur hexafluoride gas tamponade. Postoperatively, neovascular glaucoma was not detected in any of the patients after follow up for six months.The percent change of macular edema (%ΔME) was calculated as follows:pr and MEpo correspond to the foveal thickness before vitrectomy and 6 months after surgery, respectively. There was a significant positive correlation between the vitreous level of VEGF and %ΔME, with VEGF levels being significantly higher in patients who showed more marked improvement of macular edema after PPV . This may have been because 26 eyes was too small a sample. There was no significant difference of the VEGF level between the 26 eyes that received retinal photocoagulation and the 28 eyes without retinal photocoagulation (p = 0.3634).Analysis of the 25 patients who did not have cataract surgery revealed that the vitreous level of vascular endothelial growth factor was not associated with improvement of macular edema or improvement of visual acuity , also possibly because of the small sample size. There were no significant differences of VEGF levels, improvement of macular edema, or improvement of visual acuity when we compared the group that did not undergo cataract surgery with the group that had cataract surgery .The present study demonstrated that the vitreous level of VEGF was significantly higher in BRVO patients who showed less improvement of their best-corrected visual acuity after PPV Figure . As a reThe Branch Vein Occlusion Study was a multicenter randomized clinical trial that established guidelines for use of retinal photocoagulation in the treatment of macular edema. The effectiveness of argon laser photocoagulation was demonstrated, but it was not recommended within 3 months of the onset of BRVO because spontaneous improvement can occur. HoweverThe macula is important for detailed vision, especially the fovea that consists entirely of cones. In humaThe present study demonstrated that a higher VEGF level in the vitreous fluid at the time of surgery was significantly associated with more marked improvement of macular edema after PPV, which was in agreement with our findings in a previous study of PPV for BRVO. The vitInterestingly, the improvement of visual acuity and the improvement of macular edema did not occur in parallel. Although the retinal thickness at the central fovea has been reported to influence visual acuity, ,28 we foIn the present study, multivariate analysis showed that the vitreous VEGF level and retinal photocoagulation were significantly correlated with improvement of visual acuity and with the decrease of foveal thickness. Aiello et al. previousin vivo, coinciding with the peak of macrophage infiltration. They suggested that the difference from in vitro data arose because infiltrating macrophages contributed more to upregulation of VEGF than RPE cells or because secretion of VEGF was induced by the interaction of macrophages with RPE cells. Furthermore, changes of retinal VEGF mRNA expression after laser photocoagulation were confined to RPE cells in miniature pigs, with reduced mRNA expression immediately after photocoagulation and a return to normal by 42 days[The present study had several limitations. One major problem was the performance of laser photocoagulation prior to surgery. For the following reasons, we performed a combined analysis of the groups with (n = 26) and without (n = 28) laser photocoagulation. The first reason is that there was no significant difference of the VEGF level between the 26 eyes that received retinal photocoagulation and the 28 eyes without it . Secondly, laser photocoagulation increases the expression of various cytokines, including VEGF, by cultured human retinal pigment epithelial (RPE) cells, but upregulation of VEGF occurs from 6 hours after photocoagulation and there is a return to the basal level by 72 hours. In conty 42 days. These rThe present study showed that the vitreous level of VEGF was significantly higher in BRVO patients with less improvement of best-corrected visual acuity after PPV. In contrast, patients with high vitreous VEGF levels displayed greater improvement of macular edema than those with low VEGF levels. These results suggest that VEGF in the vitreous fluid might influence both the visual prognosis and the response of macular edema to vitrectomy in patients with BRVO.None.The authors declare that they have no competing interests.HN, and HF were involved in the design and conduct of the study. Collection and management of the data were done by HN, and SE, while analysis and interpretation of the data were performed by HN, HF, TM, and KS. Preparation of the first draft of the manuscript was done by HN, and review and approval of the manuscript was performed by HF, TM, and SE.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2415/10/11/prepub
Although the human genome database has been completed a decade ago, ∼50% of the proteome remains hypothetical as their functions are unknown. The elucidation of the functions of these hypothetical proteins can lead to additional protein pathways and revelation of new cascades. However, many of these inferences are limited to proteins with substantial sequence similarity. Of particular interest here is the Tectonin domain-containing family of proteins.We have identified hTectonin, a hypothetical protein in the human genome database, as a distant ortholog of the limulus galactose binding protein (GBP). Phylogenetic analysis revealed strong evolutionary conservation of hTectonin homologues from parasite to human. By computational analysis, we showed that both the hTectonin and GBP form β-propeller structures with multiple Tectonin domains, each containing β-sheets of 4 strands per β-sheet. hTectonin is present in the human leukocyte cDNA library and immune-related cell lines. It interacts with M-ficolin, a known human complement protein whose ancient homolog, carcinolectin (CL5), is the functional protein partner of GBP during infection. Yeast 2-hybrid assay showed that only the Tectonin domains of hTectonin recognize the fibrinogen-like domain of the M-ficolin. Surface plasmon resonance analysis showed real-time interaction between the Tectonin domains 6 & 11 and bacterial LPS, indicating that despite forming 2 β-propellers with its different Tectonin domains, the hTectonin molecule could precisely employ domains 6 & 11 to recognise bacteria.By virtue of a recent finding of another Tectonin protein, leukolectin, in the human leukocyte, and our structure-function analysis of the hypothetical hTectonin, we propose that Tectonin domains of proteins could play a vital role in innate immune defense, and that this function has been conserved over several hundred million years, from invertebrates to vertebrates. Furthermore, the approach we have used could be employed in unraveling the characteristics and functions of other hypothetical proteins in the human proteome. Advances in sequence genomics have resulted in an accumulation of a large number of protein sequences derived from genome sequences. Although the human genome database has been completed a decade ago, about 50% of the human proteome still remains hypothetical as their functions are unknown Physarum polycephalum. The Tectonins I and II were characterized to have repeats of Tectonin domains Tachypleus tridentatus, also has Tectonin domain classification Suberites domuncula, also revealed a possible LPS-binding function Carcinoscorpius rotundicauda), a protein consisting of only 6 Tectonin domains revealed that the Tectonin domains function to differentiate host from pathogen and simultaneously bridge a host-pathogen interactome .The prime targets for the discovery of functional proteins are those which show homology to counterparts in lower species by way of sequence similarities and domain conservation. An alternate approach is to examine the proteins of invertebrates that do not have homologs in the vertebrate system. One example of such a group of proteins is the Tectonin domain-containing proteins in humans. Tectonin domain containing proteins, which belong to a subclass of proteins of the larger β-propeller family, have thus far only been studied in the fish, horseshoe crab, slime mold and sponge An exhaustive search in the databases for vertebrate proteins failed to reveal any potential homologs with significant sequence similarity, indicating that perhaps these Tectonin domain-containing proteins (henceforth referred to as Tectonin proteins) have evolved through the species, although more recently, other proteins with Tectonin domains are being uncovered, for example, the human leukolectin (GenBank Accession No. ACM77812). There are many examples of other families of meiosis-related proteins, kinetochores, cell gap contacts and nuclear pore complexes which show no homology at the primary amino-acid sequence level. However, they hint at the conservation of their domain architecture organization. Furthermore, the three-dimensional structure of functionally important domains in proteins in the budding yeast, nematode, Drosophila, Arabidopsis, and human have been conserved By using known invertebrate Tectonin proteins, we performed domain- and conserved position-specific iterated sequence searches, and identified a potential human homolog, which we dubbed the hTectonin. We also discovered that the domain architecture of hTectonin is well conserved throughout the different species, suggesting that it is an important functional protein. Sequence motif analysis, and prediction of the secondary and tertiary structures suggests that hTectonin is a β-propeller protein, in accordance to the definition of the Tectonin domain. Specifically, only the Tectonin domains of hTectonin were found to interact with the fibrinogen-like domain of M-ficolin, an important complement initiator In mammals, the identity and role of proteins with Tectonin domains are unknown. Those identified or studied in the invertebrates From the multiple sequence alignment (MSA) of the Tectonin domains, we confirmed a pattern of sequence repeats of 40 to 50 residues in length, which is a unique characteristic of β-propellers hypothetical hTectonin and M-ficolin is not random, but structurally and positionally specific, and that the hTectonin is potentially involved in immune regulation, acting through its Tectonin domains.Based on our observations that a Tectonin protein, GBP (GenBank Accession No. AAV65031.1), interacts with two complement proteins, C-reactive protein (CRP) and carcinolectin (CL5), and is therefore immune-related, we reasoned that the hTectonin might play a similar role in immune defense. We tested and showed that the hTectonin gene is expressed in the human T cell line (A549), monocytes (U937) and the human leukocytes , corroboth and 11th Tectonin domains of the hTectonin and found that these motifs were well-conserved among the mammalian homologs of hTectonin in addition to being in a region of high sequence conservation is a prominent and well-studied representative pathogen-associated molecular pattern. Proteins harboring LPS-binding motifs, with alternating basic-hydrophobic/polar residues (BHB(P)HB), have been shown to bind LPS via the lipid A moiety ervation . Represeervation , where speptides . We alsopeptides . Table 1In order to classify and complete the functional characterization of the human proteome, many of the unknown proteins are usually inferred from their counterparts in other species. This seems to be an easy option if the proteins share high sequence similarity, as they can be matched to each other by performing a simple sequence matching. However, the task is more complicated if the proteins do not show homology in their primary sequences. Nevertheless, many related proteins show conserved functionality more in terms of domain and structural conservation.In this paper, we report our discovery of a human Tectonin protein, hitherto classified as being hypothetical. By structure-function analyses, we inferred its function as an immune-related protein. We showed that similar to its invertebrate counterparts, the hTectonin protein functions via its Tectonin domains. Furthermore, a distance PSI-BLAST sequence matching indicates that although the hTectonin shows low sequence homology, it is phylogenetically related to known proteins with Tectonin domains, functioning as immune proteins. By SMART domain comparison, we show that hTectonin contains multiple homologs widespread in the vertebrate kingdom, implying that it is not a one-off protein in the human proteome, but rather, an important one conserved throughout many species. We also discovered that the hTectonin gene is expressed in the human leukocytes. This is interesting, as a recent addition to the human database of proteins showed another human leukocyte Tectonin protein called the leukolectin (GenBank Accession No. ACM77812.1) Tectonin domain containing proteins were identified using domain search on the SMART database The hTectonin (Q7Z6L1) cDNA was obtained from iDNA OpenBiosystems (MHS1010-9205594). The cDNA was subcloned into pGBKT7 and pGADT7 vectors for the yeast 2-hybrid experiments.S. cerevisiae AH109 strain were performed in accordance to Co-transformations of the different bait and prey plasmids into LSLSCCESRKVQGRPSPQAI and hTec11 was IGGGWDHISVRANATRAPRS. For comparison, one BHPHB site was found in the limulus GBP, Tectonin domain 1 (HINGK). The GBP peptides are: GBP6-1(tail) KSCWLNPFLAEWTHINGKLSH and GBP6-1(no tail) FESVPASKAEWTHINGKLSH, which are annotated based on the amino acid residues which encompass the domains 6-to-1. Peptides were also designed from the combination of GBP Tectonin domains 1 and 6. The peptides were synthesized by Genemed Synthesis, Inc., USA, and purified to >95% under pyrogen-free conditions.The hTectonin protein sequence was scanned for LPS-binding motif. Two potential sites with the BHPHB pattern were found in hTectonin domains 6 (KVQGR) and 11 (HISVR). Henceforth, these peptides are referred to as hTec peptides (hTec6 and hTec11). The hTec peptide length and region surrounding the LPS-binding motif was chosen and optimized based on hydrophilicity and solubility values. The h-Tec6 was: Salmonella minnesota were diluted to 0.25 mg/ml in 20 mM sodium phosphate, 150 mM NaCl, pH 7.4 and immobilized on the surface of an HPA sensor chip (Biacore AB) according to the manufacturer's specifications. Binding of the Tectonin peptides to the immobilized ligands was measured at a flow rate of 20 µl/min in 10 mM Tris, 150 mM NaCl, pH 7.4. Regeneration of the chip surface was achieved by injection of 20 µl 0.1 M NaOH until steady baseline was achieved. The dissociation constant, KD was calculated using BiaEvaluation software, version 3.2.Surface plasmon resonance analysis for real-time biointeraction between the Tectonin peptides and bacterial LPS was performed using a Biacore 2000 instrument (Biacore AB). LPS, ReLPS and lipid A from Figure S1(A) Structure of the bacterial LPS. LPS structure and the truncated forms, ReLPS and lipid A. (B) The structure of GBP, with the tail (circled) at the C-terminal end, which does not form the β-propeller structure of GBP. (C) Control Tectonin peptides which do not harbor the LPS-binding motif of BHPHB do not bind lipid A.(0.24 MB TIF)Click here for additional data file.
Peroxisome proliferator-activated receptor gamma (PPAR- Other isotypes of this family include PPARalpha (PPAR-α) and PPAR beta/delta (PPAR-β/-δ). Each of these isotypes is encoded by a differentgene and has different functions and different tissue distribution [The peroxisome proliferator-activated receptor gamma [γ2 by its ligand [γ2 plays inadipocyte differentiation is recognized by its early and tissue-specific expression[PPAR-odcells . The genmosome 3 and therer usage , 15. PPAxpressed . Of thesogenesis –18 and iogenesis . PPAR-γ2se (LPL) ,phosphose (LPL) , fattyase (LPL) , andstese (LPL) . Functios ligand , 25 indus ligand –29. Thuspression and its pression, 30.γinsufficiency in mice (PPAR-γ+/−) results in adramatic decrease (by 50%) in adipogenesis with a concomitant increase inosteogenesis through osteoblast formation from marrow progenitors [γpathway as a novel treatment of osteoporosis.Mostimportantly, a recent in vivostudy has demonstrated that PPAR-genitors . This stα[Mesenchymal stem cells (MSCs) are multipotent cells that, under appropriate cultureconditions, can differentiate into multiple cell lineages, includingosteoblasts, myoblasts, and adipocytes –35.Consα that stiα. The negα,and womα.Clinically, much recent attention has focused on drugs belonging to the thiazolidinedioneclass. These medications are PPAR agonistsused to treat patients with diabetes mellitus, and have recently beenassociated with impaired bone quality, increased marrow fat, and increasedfracture rates , 48.γ2in MSC differentiation into adipocytes or osteoblasts, we will briefly discusssome of the regulators of the PPAR-γ2receptor.Understandingthe regulators of MSC differentiation between fat and bone has gainedincreasing importance with increasing human longevity since, as humans age, thenumber of adipocytes increases and the number of osteoblasts decreasesresulting in weakened bone, age-related osteoporosis, and fragility fractures. Becauseof the importance of PPAR-γ receptor activity can occur via (1)changes in receptor expression levels or (2) changes in transcriptionalactivity (see Regulation of the PPAR-vity see .γ receptor expression in adipocytes [γ receptor expression includeCCAAT/enhancer-binding protein (C/EBP) family of transcription factors andthese have been reviewed extensively elsewhere [β) play important roles in PPAR-γregulation, they will not be discussed in this review.A number of transcription factors can either positively or negatively modulatePPAR-ipocytes .Major tlsewhere , 50. Alγ receptor transcriptional activity isregulated by two distinct processes: repression of receptor activity byphosphorylation and increased receptor activity by ubiquitination. Agonistsfor the nuclear PPAR-γ receptor include protein kinase A,natural fatty acids, eicosanoids, and oxidized lipoproteins.Less well studied are negative regulators of the nuclear PPAR-γreceptor. Activators of MAPK and thusinhibitors of PPAR-γ receptor transcriptional activityinclude growth factors like epidermal growth factor (EGF), platelet-derivedgrowth factor (PDGF), transforming growth factor β's(TGF-β's) 1 and 2, and GILZ. Both insulin and glucocorticoid induce the expression of C/EBP-β and -δ, which in turn induce the expression of PPAR-γ and C/EBP-α and initiate the adipogenesis program.PPAR-Enteric hormones represent themechanism by which ingested nutrients are distributed to the various tissues inthe body so as to maximize their utilization.These hormones play a key role in regulating the energy balance, in partthrough modulation of PPAR expression. In fact, elevation of incretin hormones,through use of inhibitors of the enzyme that breaks them down (DPP-IVinhibitors), has been shown to increase PPAR expression in the kidney .Intestinal Hormones such as (1) GIP, (2) Ghrelin, and (3)Glucagon-like peptide (GLP-2); (b) Pancreatic Hormones such as (1)Insulin, (2) Amylin, (3) Adrenomedullin, and (4) Preptin; (c) Adipocyte-secreted Hormones such as (1)Leptin, (2) Adiponectin, and (3) Resistin, as recently reviewed by Clowes etal. [Nutritional hormones are also known to be important in boneturnover as evidenced by the fact that as soon as a meal is ingested, bonebreakdown is suppressed. Many nutrition-related hormones have been shown tohave effects on bone turnover through invitro or in vivo studiesincluding (a) s etal. and Reids etal. . For purGhrelin is a 28-amino acid peptide expressed predominantly in thegastric epithelium and small intestine, though it is also expressed to a lowerextent in the brain, pancreatic islets, adrenal cortex, kidney, and bone . GhrelinGLP-2 is a 33-amino acid peptide expressed mainly in the L cellsof the small intestine. GLP-2 is secreted in response to nutrient ingestion andits physiologic function appears to be to regulate intestinal motility andstimulate intestinal cell growth; it is also antiapoptotic . GLP-2 rInsulin has long been considered the main anabolic hormone,stimulating bone formation in vitro. However, in vivo, although insulin infusion is known to decreasemarkers of bone breakdown, this effect is only about 30% of the decline inresorption markers that occurs postprandially.In fact, it has been suggested that this effect is due to hypoglycemiaand the attendant impairment in skeletal cellular activity rather than to adirect antiresorptive effect .β cells with insulin in response to ameal. Amylin lowers serum calcium,inhibits bone resorption, and increases bone mass in mice [Amylin is a 37-amino acid hormone cosecreted from the pancreatic in mice –66.Adrenomedullinis a 52-amino acid peptide related to amylin; it is expressed in the adrenalmedulla, vasculature brain, kidney, and bone . AdrenomPreptinis a 37-amino acid peptide cosecreted from the pancreatic islet with amylin andinsulin. Preptin stimulated osteoblastic proliferation, and the daily injectionof this peptide for five days over the calvaria resulted in increased bone area and mineralized surface through increased boneformation rather than through inhibition of bone breakdown .γ agonists are potent stimulators of adiponectin expression. Adiponectinsuppresses both cell proliferation and release of other inflammatory cytokines [Adiponectin is a 247-amino acid protein strongly expressed in mature adipocytes and the levelscorrelate with the degree of differentiation .Thus, Pytokines . Both thytokines , 73. In ytokines ,particuytokines .γ with PPAR-γ agonists such as rosiglitazoneresulting in an inhibition of resistin expression [Resistin is a 137-amino acid protein secreted from adipocytes . In addipression .Resistipression and resipression .There are two major intestinal hormones that potentiate glucose-induced insulinsecretion (incretin effect), that is, GIP and glucagon-like peptide-1 (GLP-1). GLP-1receptors are not present in bone cells . GIP was−/− versus 4-fold increase in WT). Furthermore, if −/−/The GIP receptor knockout mouse was developed by Miyawaki and colleagues, and it In our studies, we found that if the GIP receptor is downregulated, bone massdecreases and bone marrow adipocyte content increases . These fα-MSH), and suppresses theactivity of orexigenic genes such as neuropeptide Y (NPY) and agouti-relatedpeptide (AgRP), that are involved in regulating food intake [The cytokine-like hormone leptin isrecognized as a powerful regulator of appetite and energy balance . Adipocyd intake .Leptin d intake , andintd intake . Adipocyd intake ,and actd intake .γ or Cbfa-1 expression despite increasing osteogenesis and decreasingadipogenesis presumably by acting at a later stage in osteoblastdifferentiation. Bone marrow adipocytessecrete leptin themselves [Leptin also appears to regulate adipocyte populations in bone marrow directly, in additionto the central effects of leptin on adipocyte apoptosis. Leptin-deficient ob/ob mice show asignificant increase in bone marrow adipocytes compared to lean mice ,and peremselves , raisingemselves , and as Myostatin was initially identified as a factor regulating myogenicdifferentiation because its expression was localized to developing skeletalmuscle, and because myostatin loss-of-function was observed to have dramaticeffects on muscle mass in mice. It was,however, also noted that mice lacking myostatin showed decreased body fat , 102, anγexpression. A study by Artaza et al. [γ, although they did not actuallyexamine PPAR-γexpression. These data are consistent with previousreports showing increased bone mineral density in the bones ofmyostatin-deficient animals [γ and C/EBP alpha expression in bovinepreadipocytes. Thus, myostatin effects on PPAR-γmay be cell-type-dependent.Although the in vivo data consistently show that myostatin has an adipogeniceffect, and that myostatin deficiency has an anti-adipogenic effect, the in vitro data are less clear. Myostatinhas been observed to promote adipogenesis in multipotential mouse C3H 10T (1/2)mesenchymal stem cells , but myoa et al. demonstr animals –115. Fu animals found thβ-stimulated clone-22(TSC-22) family of transcription factors [GILZ, which is also induced by estrogen and sonic hedgehog (Shh),is a new member of the leucine zipper protein , 118 and factors , 120.Me factors –123. Stu factors . GILZalγ2 gene. Because glucocorticoids induce adipocyte differentiation, and GILZ is induced by glucocorticoids and binds to adipogenic PPAR-γ2 promoter, it washypothesized that constitutive expression of GILZ would activate PPAR-γ2 expression and enhanceadipogenesis. Contrary to expectations, overexpression of GILZ inhibited PPAR-γ2 transcription and blocked adipocyte differentiation of C3H10T1/2mesenchymal cells and 3T3-L1 preadipocytes. These results demonstrated thatGILZ functions as a transcriptional repressor of PPAR-γ2. Studies by Zhang et al. (unpublished data)show that overexpression of GILZ in mouse bone marrow MSCs can enhance MSC osteoblastdifferentiation. These data suggest that, by modulating PPAR-γ expression, GILZ may serve as an important regulator of the MSClineage commitment between osteoblast and adipocyte. This role of GILZ may have potential clinicimportance since as humans age, the number of adipocytes increase and the number of osteoblastsdecrease resulting in weakened bone and age-related osteoporosis and fragilityfractures. All these may have direct connection to the increased PPAR-γ expression and activity in aging bone marrow as it is known thataging activates marrow adipogenesis and fat secretes large amounts of cytokinesthat will, in turn, inhibit osteogenesis as mentioned earlier.Studies by Shi et al. found thγ is regulated byphosphorylation (by kinases such as the mitogen-activated protein kinase(MAPK), which activate Jun N-terminal kinase, or JNK, and extracellularsignal-regulated kinase 2, or ERK 2), and GILZ can directly interact with Raf1,one of the MAPK members, resulting in the inhibition of Raf-1 phosphorylationand, subsequently, the suppression of both MEK/ERK-1/2 phosphorylation andAP-1-dependent transcription [As previously mentioned, the transcriptional activity of PPAR-cription .It has been a long standing paradox that glucocorticoids, while required forosteoblast differentiation of primary bone marrow stromal cells in vitro –128,indUnder normal conditions, GC levels fluctuate in response to environmental stressors. When the GC level is increased, GILZ isinduced and prevents adipogenic differentiation. Under pathophysiological orpharmacological conditions, however, GC is elevated for a prolonged period of time and thenegative feedback network is overwhelmed, resulting in harmful GC side effects,such as bone loss.Adequate nutrition and apositive energy balance are clearly important for bone growth. A reduction in caloric intake willretard growth plate expansion . In addiOne of the challenges inusing recombinant leptin therapy to either reduce body weight, suppressappetite, or stimulate bone formation is that most individuals are relativelyresistant to exogenous leptin treatment due to relatively high levels ofendogenous leptin , 96. HowTreatment of normal rodentsand dystrophin-deficient mdx mice with factors that block myostatin signaling,such as a soluble myostatin receptor, a propeptide, or follistatin, showedsignificant increases in muscle mass and improved muscle regeneration , 140.Thγ pathway not only regulates adipocytedifferentiation, but also inhibits osteoblast differentiation from mesenchymalprogenitors [γ pathway as a novel treatment ofosteoporosis. GILZ, induced transientlyby GC, is a sequence-specific transcriptional repressor of PPAR-γ [γhave been reported so far. Thus, GILZ may be a novel therapeutic target fordrug development for a variety of conditions characterized by an altered adipocyte/osteoblast balance.Bone cells are derived from marrow MSCs, and the best way to increase the number ofbone-forming cells is to modulate differentiation pathways so that more MSCsare directed to the osteoblastogenesis pathway.The PPAR-genitors , suggestf PPAR-γ .No tranγ2receptor, thus favoring osteoblastic instead of adipocytic differentiation,might be an attractive therapeutic target for prevention and treatment ofosteoporosis.In summary, current therapeutic targets for prevention and treatment ofosteoporosis involve anabolic agents stimulating osteoblastic activity orantiresorptive agents targeting the osteoclasts. Our data would suggest that modulating theMSC differentiation pathway, particularly via inhibition of the PPAR-
A ubiquitous dilemma in medical education continues to be whether and how to integrate research competencies into the predoctoral curriculum. Understanding research concepts is imbedded in the six core competencies for physicians, but predoctoral medical education typically does not explicitly include research education. In an effort to quickly report academic research findings to the field, this is the second in a series of articles reporting the outcomes of a research education initiative at one college of osteopathic medicine. The first article described the competency model and reported baseline performance in applied understanding of targeted research concepts. This second article reports on the learning outcomes from the inaugural year of a course in basic biomedical research concepts.This course consisted of 24 total hours of classroom lectures augmented with web-based materials using Blackboard Vista, faculty moderated student presentations of research articles, and quizzes. To measure changes in applied understanding of targeted research concepts in the inaugural year of the course, we administered a pretest and a posttest to second year students who took the course and to first year students who took an informatics course in the same academic year.We analyzed 154 matched pretests and posttests representing 56% of the 273 first and second year students. On average, the first year (53) and second year students (101) did not differ in their mean pretest scores. At posttest the second year students showed significant improvement in their applied understanding of the concepts, whereas the first year students' mean posttest score was lower than their mean pretest score.This biomedical research course appears to have increased the second year students' applied understanding of the targeted biomedical research concepts. This assessment of learning outcomes has facilitated the quality improvement process for the course, and improved our understanding of how to measure the benefits of research education for medical students. Some of the course content and methods, and the outcome measures may need to be approached differently in the future to more effectively lay the foundation for osteopathic medical students to utilize these concepts in the clinical setting. A recent historical review of how physician-scientists and clinical researchers have trained for their work recommends increasing research content in the medical school curriculum . The NatAs residency programs expand their expectations for research participation, and students are increasingly expected to apply evidence based medicine (EBM) principles in their clinical rotations, research competencies may become essential rather than optional. Research, EBM and statistics are of necessity interrelated, and to meaningfully navigate the medical research literature, practicing physicians may benefit from an applied, conceptual grasp of research concepts more than from a quantitative statistical rubric ,4. In faRegardless of the theoretical value of including research content in the medical school curriculum, there are numerous obstacles to its implementation. For example, the six core competencies required in post graduate medical education and questions in national licensure exams tend to focus on understanding the statistics of research versus understanding research design suitable to answer a particular study question. Also, the methods traditionally used to instruct medical students in research outside of a dual-degree track have included short statistics courses, or elective experiences in bench or clinical research labs. Interestingly, the literature indicates that statistics courses and brief immersion in on-going research are among the least recommended methods for effectively preparing future physicians to be proficient in the language of biomedical research .While methods for medical education are evolving to more sophisticated teaching paradigms, increasing efficiencies with electronic technology and assessing more than knowledge outcomes such as measures of critical thinking skills, these trends tend to occur more as evolutions, not revolutions. To rapidly impact the dearth of clinical researchers nationally we may need a revolution in how we define research competencies for medical students. The hypothesis is that that early career familiarity with the world of biomedical research at a minimum can improve critical thinking skills, better prepare students for expectations of residency training programs, and improve performance on national exams. Teaching research concepts only to answer questions on an exam may miss important opportunities to inspire early career physicians in the language of research.It has been generally accepted that biomedical research competencies for physician scientists develop along a continuum, ideally beginning with early career exposure to research concepts, extending through post-doctoral research training, culminating in the quintessential practice of research and conducting independent multi-center clinical trials . This suThe three tiers of this model can be briefly defined in the following way. Tier-one competencies represent a basic, foundational understanding of research. A tier-one individual would be a proficient professional consumer of biomedical research information. Tier-two competencies are associated with an intermediate research realm such as a master's degree or a predoctoral research track in which the individual conducts mentored research. Tier-three encompasses advanced research skills acquired in a dual-degree doctoral program or a post-doctoral clinical research fellowship.Tier-one appears to be the most suitable competency level for research-naïve medical students because it targets a basic, foundational understanding of research language and emphasizes applied understanding of commonly used biomedical research concepts. These concepts are those most often tested in national exams and most frequently used in the medical literature . The tiedata sheets provided as Additional file All articles assigned to the students corresponded to the medical topic or system the students were studying at that time. To critique the articles, students used specified guidelines and completed templates guiding them through the critique process. Students also had access to classroom lectures and Blackboard Vista slides addressing the research concepts contained in each article. Small groups of students each presented a critique to their classmates and expert faculty, with slides and lecture materials of their own development. The templates are two Several studies have reported residents' and practicing physicians' understanding of and attitudes toward biostatistics ,9,10 butWe have presented the results of the pretests and posttests of applied understanding of research concepts for the second year students who took the course, and the results of the same pretests and posttests for first year students who took a basic informatics course during the same academic year. The informatics course focused on search methods and case-studies presentations. While students in the informatics course included at least one research article in their search to develop their case presentations, they were not instructed on research concepts in that course. No pretests or posttests were administered to measure the outcomes of that course independently from this study. We have also provided the 20-item test as Additional file With the support of an NIH R25 grant and a grant from the Osteopathic Heritage Foundation, a 20-item test was developed by a panel of biomedical researchers and academic physician faculty at the medical school. The initial list contained 50 items taken from published studies of research competencies, national databases, and original questions developed by local research and physician scientists ,2,11. ThEach final question presented four choices with one preferred correct answer, and a no-response (NR) option. We chose to include a NR option to examine several dimensions of the learning outcomes and examine the value of this form of testing. Attempting to measure research readiness, Windish reported that medicine residents did not perform well on a similar test . Our proWe asked, with IRB approval, all 335 enrolled first (177) and second (158) year medical students to take the test at the beginning (July) and end (May) of academic year 2008-09. Students completed the 20-item test on-line using the school's secure on-line testing web site with the course director present. Students were instructed to attempt to answer only the questions for which they believed they knew the correct choice.Questions on the course quizzes were associated with the same competencies covered in the 20-item pretest and posttest but did not contain an NR, and were directly linked to the four to five articles critiqued in the class period immediately previous to the quiz. Brief recaps of each student presentation were provided by faculty immediately following the presentation, reviewing the research concepts contained in that article that would be covered on the next quiz. The underlying philosophy of the course was that we wanted students to learn the material and succeed.Data were compiled using the school's secure on-line testing platform and exported to an excel file. Academic services provided demographic data and matching for pretests and posttests. Data were exported to an SPSS file for analysis. Analyses included calculating proportions of correct responses for each of the 20 items and corresponding confidence intervals, and t-Tests and Chi-Square tests to examine differences between groups for demographics and performance scores.There were 273 (81%) students who completed the posttest. Among these 273 students seven were dropped from the analysis because of having marked all NR choices on their posttests, although they had answered some questions on their pretests. After excluding these students and matching all remaining students who had complete data on both pretest and posttest questionnaires, we retained 154 students (56%) in the final analysis. Among the 154 students in this sample, 101 were second year and 53 were first year students representing 65% and 34% of each class respectively.According to the data reported nationally by this school, the gender, racial, and ethnic composition of all medical students in 2008 was 54% males and 46% females; 48% White, 6.5% Hispanic, 19% Asian, and 2.7% Black. Academic services provided the race and gender data for the students in this sample reporting 55% (85) were males and 45% (69) were females; 59.7% (92) of the sample were White, 9.7% (15) Hispanic, 23.4% (36) Asian, and 5.2% (8) Black. Thus the sample is comparable to the student body.t tests examining gender, race, ethnicity, previous education and MCAT scores found no significant differences between the two classes.In our baseline analysis we assessed the impact of pre-enrollment degree status on test scores. Thus we report that among these 154 students in this sample 112 (73.7%) had a pre-enrollment bachelor's degree only, and 40 (26.3%) had a pre-enrollment master's or doctoral degree, and two were missing complete information. Using the highest reported MCAT score for each student, the average MCAT score for this sample was 27.49 (SD 3.08). Chi-square and t 152 = -1.56, P = .12), but at posttest the second year students scored significantly higher than the first year students in this sample .In order to determine if second year students improved their applied understanding of the targeted research concept, we used the proportion of correct answers out of all 20 questions. In this study sample of 154 students the overall mean pretest score out of a possible 100, was 28.90 , and the mean posttest score was 35.58 . The two classes did not differ in the pretest scores . This change is the equivalent of an increase of 2.5 out of 20 questions answered correctly by the second year students, and almost one less question answered correctly at posttest by the first year students.The second year students' overall average score improved by 12.5%, compared to the average decrease of almost 4.4% for the first year students t 152 = .495, P = .62). At the posttest however, second year students made significantly fewer NR choices with a mean of 5.11 (SD 5.53), compared to first year students who selected a mean of 8.53 (SD 5.91), . The change in number of NR responses from pretest to posttest reflects significant improvement (based on a reduced reliance on the NR choice) for the second year students compared to the first year.Because the frequency of NR choices could impact both the student's score and the percent of students responding correctly to each question, we also examined NR choices. NR was provided as a response option to encourage students to attempt only questions they believed they could answer without guessing. We found no difference between the two classes in the frequency of NR choices at the pretest, at 8.56 (SD 5.98) for second year students, and 8.08 (SD 5.50) for the first years .To explore this observation further, we next considered how students performed relative to the number of questions out of 20 that they attempted (non NR). At pretest, the percent of correct answers for only the attempted questions was 47.5% for the second year students compared to 51.3% for the first year students. At posttest the second year students had significantly increased the proportion of correct answers out of the attempted questions with 54.4% correct. The first year class at posttest however, reflected a significant decrease in the percent of correct answers out of the attempted questions to 48.8% Last we examined performance on each of the 20 items. Table essential parts of published research, and item 14) validity of results. From pretest to posttest, second year students improved their performance in 18 of 20 competencies with significant improvement in seven of those areas including statistical significance, recognizing a Type II error, defining sensitivity and specificity, recognizing phases of clinical trials, human subjects' protection, positive predictive value of a test, and recognizing continuous variables. Interestingly, the first year students exhibited significantly diminished performance in recognizing nominal variables. Students' performance was lowest in both pretest and posttest responses to item 8) recognizing the research design and item 11) understanding power and sample size.Referring to Table In addition to the 20-item pretest and posttest second year students in the course completed seven quizzes during the academic year. Quiz questions assessed knowledge of the research concepts found in the research articles reviewed in the previous period. Average quiz scores for the second year class improved from 73.3% in the first semester to 86.8% by the end of the inaugural year of the biomedical research course. The second semester's mode score was 100 compared to the first semester mode of 73.This study included students in the first and second year classes who had complete pretests and posttests at one osteopathic medical school. Only one class completed the research course; and although the students in this sample appear representative of all students in both classes, we do not know whether students whose scores were not included due to incomplete or unmatchable tests were different.Also, the questions used to measure pretest and posttest applied understanding of the targeted concepts have not been validated. Our questions used both novel and published questions and attempted to target a tier-one level of applied understanding of research, a level of difficulty lower than that presumed to be suitable for graduate physicians .Although the second year students improved their applied understanding of all but two targeted concepts, posttest performance in a number of areas remained low, with less than 50% of respondents answering the majority of questions correctly. This suggests that this course was not yet achieving its full potential.We used the findings of this study to strengthen the course for its second year by augmenting lecture materials, increasing web-based resources, and strengthening guidelines to reinforce learning. In May 2010 these two classes will take the posttest at the end of the second year of teaching the course: the class of 2011 to examine retention, and the class of 2012 to measure their learning outcomes from the course. Following that assessment, the 20-item questionnaire, the course content and the teaching methods will undergo a formal academic quality review for possible future modifications.While the literature emphasizes the need to prepare future physician scientists to understand the relationship between EBM, statistics and research -18, natiIn a recent critical review of the history of clinical research training in the US, Teo makes eight powerful and empirically based recommendations . Four ofAs the second in a series of articles this paper reports improvements in second year medical students' applied understanding of targeted tier-one research concepts. The third article will provide the results of the second time the year long biomedical research course has been taught, focusing on the iterative nature of achieving these competencies and the tension between quantitative statistics learning and clinical research understanding. The next article will examine the application of these competencies in clerkship rotations, and the following article will report on our collaborations with other schools in examining learning outcomes from other models of research education.Innovations in teaching biomedical research concepts have been reported as successful in British medical schools and other health professions training programs ,21, but If this method increases students' appreciation of research in medicine, enhances their life-long learning perspective, and also better prepares them for national licensure exams it will have achieved its goals. Improved research competencies also mean students will be better prepared for post graduate training research requirements.The authors declare that they have no competing interests.dAC led the development of the test questionnaire and developed the manuscript with the team. SKB performed the statistical analysis and contributed to the discussion and conclusions. JRI cleaned the data and contributed to the interpretation of the analysis. ALP, BDD, and RJB contributed to the crafting of the questions and the interpretation of the results. JSC participated in the course and applies concepts learned to his teaching responsibilities in the manipulative medicine predoctoral fellowship and contributed to the interpretation of the results.All authors have read and approved the final manuscript.Appendices. Appendix I and II.Click here for file
The D-mannose binding lectin ArtinM is known to recruit neutrophils, to degranulate mast cells and may have potential therapeutic applications. However, the effect of ArtinM on mast cell recruitment has not been investigated.Male Wistar rats were injected i.p. with ArtinM or ConA (control). The ability of the lectin to degranulate peritoneal and mesenteric mast cells was examined. Recruitment of mast cells to the peritoneal cavity and mesentery after ArtinM injection was examined with or without depletion of peritoneal mast cells by distilled water.in vitro. Three days after i.p. injection of the lectin there were reduced numbers of mast cells in the peritoneal lavage, while at 7 days post injection of ArtinM, the number of peritoneal mast cells was close to control values. Since immature mast cells are recruited from the bone marrow, the effect of the lectin on bone marrow mast cells was examined. Injection of ArtinM resulted in an increased number of mast cells in the bone marrow. To determine if degranulation of mast cells in the peritoneal cavity was required for the increase in bone marrow mast cells, the peritoneal cavity was depleted of mast cells with ultrapure water. Exposure to ArtinM increased the number of mast cells in the bone marrow of rats depleted of peritoneal mast cells.ArtinM degranulated both peritoneal and mesentery mast cells The ArtinM induced recruitment of mast cells from the bone marrow to the peritoneal cavity may partially explain the therapeutic actions of ArtinM. Leishmania majorLeishmania amazonensisParacoccidioides brasilensisThe D-mannose binding lectin, ArtinM, previously called KM+ or Artocarpin, is known modulate the immune response, activating macrophages ArtinM is known to activate mast cells either by binding IgE bound to the high affinity IgE receptor (FcεRI) or by binding directly to FcεRI Mast cells play a role in many physiological and pathological processes in vivo in rats. The ability of ArtinM to degranulate mast cells in the peritoneal cavity and mesentery and the recruitment of mast cells from the bone marrow to the peritoneal cavity were examined. The results demonstrate that ArtinM is highly efficient in recruiting mast cells from the bone marrow to the peritoneal cavity and indicate the value of ArtinM as an immunomodulatory agent.Because of the potential pharmacological applications of ArtinM, the present study was undertaken to examine the effect of ArtinM on mast cell degranulation and recruitment The research was conducted in accordance with “Ethical principles in the use of experimental animals” adopted by the Brazilian College of Animal Experimentation. Experimental protocols were approved by the Commission on Ethics on Animal Experimentation of the Faculdade de Medicine de Ribeirão Preto (Protocol numbers 019/2005 and 152/2005). Animals were anesthetized with ketamine 80 mg/kg plus xylazine 12 mg/kg prior to experimental treatment.The lectin ArtinM was purified by affinity chromatography as previously described Male Wistar rats, weighing 150 g, were obtained from the Central Animal Facility of the Faculdade de Medicina de Ribeirão Preto. All experiments were conducted according to the guidelines of the Faculdade de Medicina de Ribeirão Preto (Protocol numbers 019/2005 and 152/2005). Animals were anesthetized with ketamine 80 mg/kg plus xylazine 12 mg/kg prior to experimental treatment. All experiments were done in triplicate.g) in PBS prior to use. The cells were placed on coverslips coated with Biobond fixed in 2% formaldehyde (EM Sciences) and stained for 15 min in 0.1% Toluidine blue-1% acetic acid, pH 2.8.Peritoneal cells were obtained by injecting rats i.p. with 15 ml PBS . The peritoneal washing was collected with a Pasteur pipette after laparotomy and the cells washed by centrifugation (x201g) in PBS prior to use.Bone marrow cells were obtained by flushing the marrow cavity with PBS containing 2% BSA (Sigma-Aldrich), 1000 U/ml deoxyribonuclease I (Sigma-Aldrich) and 1000 U/ml heparin . The marrow was dissociated by aspirating the cells with a Pasteur pipette and passing the suspension through a 25 µm nylon filter. The cells were washed by centrifugation in PBS and stained for 15 min in 0.1% Toluidine blue-1% acetic acid, pH 2.8. Mesentery fragments were stretched over glass slides, dried on a heating plate at 45°C, dehydrated in a graded series of ethanol (Merck), cleared in xylene (Merck), and coverslips mounted with Permount .in vivo, animals were injected i.p. with 4 ml of PBS containing either 10 µg or 200 µg ArtinM or ConA . For in vitro experiments the peritoneal lavage or mesentery fragments were incubated in 1 ml Iscove's Modified Dulbecco's Medium (Sigma-Aldrich) containing 10 µg or 200 µg of ArtinM or ConA at 30°C for 1 h. The lectin concentrations chosen were based on data in the literature For experiments Mast cell depletion of the peritoneal cavity by distilled (ultrapure) water is a widely used method Animals were injected i.p. with 200 µg of Compound 48/80 (Sigma-Aldrich) (50 µg/ml) in 4 ml of 0.02 M Tyrode-Tris buffer, pH 7.2 Repopulation of the mesentery by mast cells was examined in animals with or without depletion of the peritoneal mast cells. In animals not depleted of peritoneal mast cells, 10 µg or 200 µg of ConA in 4 ml PBS was injected i.p. Seven days later, the mesentery was removed, fixed in 2% formaldehyde (EM Sciences), and stained for 15 min in 0.1% Toluidine blue-1% acetic acid, pH 2.8. Control animals received only PBS. Animals depleted of mast cells by ultrapure water received 10 µg ConA or 10 µg ArtinM in 4 ml PBS i.p. 24 h after injection of the water. Control animals received only ultrapure water. Seven days after injection of the lectins, the mesentery was removed, fixed in 2% formaldehyde (EM Sciences), and stained for 15 min in 0.1% Toluidine blue-1% acetic acid, pH 2.8.in vitro degranulation assays, prior to fixation, mesentery fragments were incubated with 10 µg/ml of either lectin. Controls were incubated in medium without lectin. After incubation, the fragments were rapidly washed in PBS, fixed in 2% formaldehyde (EM Sciences) and, stained for 15 min in 0.1% Toluidine blue-1% acetic acid, pH 2.8.For Images were acquired by bright field microscopy with a 40X objective using a Nikon Eclipse E800 microscope equipped with a Nikon DXM1200 digital camera. Images from 10 or 16 (mesentery) separate fields from 3 separate rats for each experimental condition were acquired. All fields of the mesentery included a mesenteric blood vessel. For the peritoneal lavage, the number of granulated and degranulated mast cells in each field was determined. For the mesentery the number of mature and immature mast cells, based on degree of metachromasia, was analyzed.Tosyl activated Dynabeads were conjugated with mAb AA4, that recognizes unique gangliosides on the surface of granulated rodent mast cells Mast cells were immunomagnetically isolated from the peritoneal lavage and from the bone marrow using mAb AA4 coupled to tosylactivated Dynabeads M-450 as previously described The percentage of mast cells was determined by counting the cells using a Neubauer Camera. Cells attached to the magnetic beads (positive population) as well as the negative population were counted.CellTracker Red CMTPX . After labeling, the cells were incubated for an additional 30 min at 37°C in Iscove's Modified Dulbecco's Medium with 10% heat inactivated fetal bovine serum . Cell labeling was monitored by fluorescence microscopy using a Nikon Eclipse E800 fluorescent microscope.After immunomagnetic isolation, bone-marrow derived mast cells were incubated for 30 min at 37°C in Iscove's Modified Dulbecco's Medium without serum containing CellTracker labeled cells, the peritoneal cavity was depleted of mast cells by i.p. injection of 15 ml of purified water. Then, 2.5×105 cells/rat, labeled with CellTracker Red CMTPX in 500 µl Iscove's Modified Dulbecco's Medium were injected via the caudal vein. Control animals were injected with only 500 µl Iscove's Modified Dulbecco's Medium. Two hours after cell infusion, some animals received i.p. 10 µg ArtinM in 4 ml PBS. Control animals received only PBS. At 24 h and 48 h after cell infusion, cells were collected from the peritoneal cavity by laparotomy using a Pasteur pipette after injecting 15 ml PBS into the cavity. Cells were also collected from the bone marrow as described above. The cells were rinsed by centrifugation 5 times in PBS, fixed with 1% formaldehyde and analyzed by flow cytometry .Before the infusion of p≤0.05 and *p≤0.01.The experimental results were analyzed using non paired Student's t-test. Differences were considered significant at In the present study the ability of ArtinM to recruit mast cells from the bone marrow to the peritoneal cavity of rats was examined. In order to determine if mast cell recruitment was due solely to lectin induced degranulation of peritoneal mast cells, the effect of ArtinM was also examined in a model system in which the peritoneal cavity was depleted of mast cells prior to administration of the lectin. The specificity of the effects of ArtinM was analyzed by comparing the results with ArtinM to those with ConA. ConA, a glucose/mannose binding lectin, is well characterized for its ability to degranulate mast cells in vitro. Incubation with PBS did not elicit degranulation of Con A conjugated to FITC. At a concentration of 10 µg/ml of Con A there was only a faint labeling of the extracellular matrix and none of the mast cells were labeled and 7 days after lectin injection, mast cells were isolated immunomagnetically from the bone marrow using mAb AA4 . In the CellTracker™, and infused into animals whose peritoneal cavities had been depleted of mast cells and high doses (200 µg) while mesentery mast cells degranulate only at high concentrations. The higher doses of lectin required for degranulation of mesenteric mast cells may be due to the fact that the lectins bind to the extracellular matrix surrounding the mast cells, thus lowering their effective concentration. The results of the present study confirm previous observations concerning mast cell degranulation induced by ArtinM The increased numbers of mast cells in the bone marrow 7 days after treatment with ArtinM and to a lesser extent with ConA indicate that i.p. injection of these lectins is stimulating mast cell proliferation in the bone marrow. The bone marrow serves as a reservoir of immature mast cells that can be recruited to peripheral sites in vitro and in vivoin vitro. The attraction occurs by haptotaxis rather than chemotaxis. The hemagglutination activity of ArtinM as well as its inhibition by carbohydrates suggests that ArtinM has at least two carbohydrate binding sites. One of the two binding sites may interact with carbohydrates on the neutrophil surface, and the other site binds to glycoconjugates in the extracellular matrix. The binding of ArtinM to the extracellular matrix results in a lectin gradient that directs the migration of neutrophils The migration of mast cells is important in many different processes such as inflammation, allergy, tissue repair and tumorigenesis in vitroin vivo due to the lack of mast cell markers. The results of this study showed that ArtinM stimulated mast cell migration and resulted in an increase in mature and immature mast cells in the bone marrow. Because the mechanisms underlying mast cell recruitment to peripheral sites are poorly understood, ArtinM may be an important tool for elucidating the molecular mechanisms involved in recruitment and migration of mast cells as well as other hematopoietic cells.The interaction of mast cells with lectins has been studied
This paper examines work in deliberative approaches to community engagement used in Western Australia by the Department of Planning and Infrastructure and other planning and infrastructure agencies between 2001 and 2005, and considers whether the techniques could be applied to the development of health policy in Australia.Deliberative processes were used in WA to address specific planning and infrastructure problems. Using deliberative techniques, community participants contributed to joint decision making and policy development. Outcomes from deliberative processes were seriously considered by the Minister and used to influence policy decisions. In many cases, the recommendations generated through deliberative processes were fully adopted by the Minister.The experiences in WA demonstrate that deliberative engagement processes can be successfully implemented by government and can be used to guide policy. The techniques can be adapted to suit the context and issues experienced by a portfolio, and the skills required to conduct deliberative processes can be fostered amongst the portfolio's staff. Health policy makers may be able to learn from the experiences in WA, and adopt approaches to community engagement that allow for informed deliberation and debate in the community about the future of Australia's health system. This paper examines the application of deliberative techniques as a method for engaging the community in policy development. The paper reviews the deliberative approaches to community engagement used in Western Australia (WA) by the Department of Planning and Infrastructure (DPI) and other planning and infrastructure agencies between 2001 and 2005. The examples from WA are unusual because they show deliberative engagement techniques being integrated into the government policy development process with such enthusiasm during her term of office. ... This situation confirms the catalytic nature of combining a skilled process champion with an enabling leader.' The examples from DPI and the other portfolio agencies are unusual because they were developed and implemented within government departments. In most overseas examples, deliberative techniques have been developed either by non-government organisations or academics who may work with government on a consultancy basis. For example, the citizens' jury, which is one of the most popular deliberative techniques, was developed in the USA by The Jefferson Center, a non-profit and non-partisan organisation. In WA, departmental staff were involved right throughout the process and in the implementation, and part of the purpose was to develop the department's ability to undertake this form of engagement.The rhetoric of community engagement has been present in government language in Australia for some time. For example, at the State and Territory level there are explicit commitments to engaging with the community about health issues and health services, as evidenced through Departmental strategic plans . HoweverCommunity engagement can operate at a variety of levels, ranging from simple information gathering exercises that involve listening to the community's perspective, through to more complex processes that are built around two-way conversations, deliberation, and collaborative decision making. The continuum of engagement developed by Health Canada provides a useful tool for defining engagement levels; their five-level continuum describes a spectrum from low level to high level public involvement, and provides examples of when each level might be useful . The fivDeliberative approaches to engagement are characterised by a process of reasoning, where participants are given an opportunity to reflect, discuss, question, and think . Some keThe definition used by the Deliberative Democracy Consortium is useful:'Deliberation is an approach to decision-making in which citizens consider relevant facts from multiple points of view, converse with one another to think critically about options before them and enlarge their perspectives, opinions, and understandings .Deliberation involves ordinary citizens being willing to tackle difficult, often value-laden problems. To achieve this, they need access to information from all perspectives, and the time required to question, reflect, and have dialogue, preferably with those who think differently to them. That way, they learn to understand and work through the trade-offs that are often integral to policy development.One value of deliberative techniques is that participants are exposed to a range of perspectives . ResearcThe possibility of engaging in meaningful deliberation is significantly enhanced if participation is diverse, inclusive, and descriptively representative. Engaging with a cross-section of the community, including people who are unaligned to specific interest groups, increases the likelihood of achieving a deliberative space, particularly when compared to engaging with 'ghettos of the like-minded', the 'squeaky wheels', and the 'usual suspects' .While the like-minded tend to reinforce their shared views , diverseThe other element integral to judicious deliberation is that of participant influence. Participants who understand that their deliberations will influence policy development or decision making are more likely to participate in a meaningful way ,18. IndeIn Australia, deliberative engagement is the exception, not the rule. Carson and Hartz-Karp note that, in Australia, community engagement has been institutionalised through legislation, regulation, policy, and accepted practice . But theAbelson, Forest et al note that deliberative processes are well suited to the health field because they can meet the broader objectives of stimulating debate, improving public understanding of complex issues, and encouraging consensus about health service priorities . But, toSome countries have adopted deliberative processes as part of their health policy making. For example, The Romanow Commission on the Future of Health Care in Canada used a deliberative process called ChoiceWork to engage consumers in discussions about health reform. Participants considered alterative scenarios for reform of health services and created their own vision of the health system they would like to see in 10 years' time . In the The Australian Health Care Reform Alliance (ACHRA) has called for a large-scale deliberative engagement process to develop principles and priorities for health reform.McBride and Korczak argue that strong government commitment is required for a rigorous, systematic, national engagement process . They su).A discussion of the methods and techniques of community engagement is integral to understanding the differences between the deliberative experiences in WA and the traditional consultation techniques frequently used by health and other government agencies. In order to understand the methods from different perspectives, this section is based on Hartz-Karp's analysis of the methods within the planning and infrastructure portfolios, interviews with four DPI staff who participated in the work and had varying opinions of it, participant reports (accessed by Hartz-Karp), and summary reports written about the deliberative processes , and issues where there is considerable community concern or division about the alternatives (such as the Albany Administrative Centre Citizens' Jury – which addressed the divided city's concerns about the location of the new centre – or the Road Train Summit – which used four consensus forums to address community concern about the incursion of long vehicles and road trains into metropolitan areas).Traditional approaches to engagement in both health and planning and infrastructure tend to involve mainly those people who are likely to experience an immediate impact from the policy change or project development. Distinctively, deliberative, inclusive approaches aim to engage a representative sample of the community in whatever technique is being used. At DPI and the other portfolio agencies, each process was guided by a steering committee that included community representatives working alongside government and industry representatives and any relevant stakeholder groups. One of their key tasks was to ensure the representativeness of participants. Though most of the deliberative processes were built around one-off events such as deliberative forums, there was considerable effort to ensure these events were part of a process that extended from framing the issues through to implementation. The process also aimed to include the broader population whenever possible.Two different approaches were used to select participants for events:• Random selection of participants, conducted by the WA Electoral Commission.• A recruitment formula that included 1/3 participants who responded to invitations to a random sample of residents, 1/3 participants who responded to invitations to a broad range of relevant stakeholders, and 1/3 participants who responded to broadly placed advertisements.The recruitment formula was developed as a way of ensuring inclusiveness in the process. It combined random selection with some purposive selection to ensure that key stakeholders and the broader community voice were included. The recruitment formula was successful for some events, but in some instances it created problems – particularly for controversial issues that involved divided community opinions and single-issue lobby groups. In these instances, lobby group invitees often tried to dominate the proceedings rather than share the deliberative space. To counteract this, rather than involving lobby groups and other stakeholder groups as invited participants at events, the agencies in WA moved towards full random selection of participants and involved these groups in other ways – such as expert witnesses, steering team representatives, and observers of the proceedings.Random sampling, done by the independent WA Electoral Commission, drastically improved the likelihood of deliberation with voices that reflected the wider population. However, achieving truly demographically and attitudinally representative participation was elusive. Difficult to reach groups were often under-represented. Even including the time-poor, working majority was difficult. In most cases, the agencies did not pay participants for their time, and it is possible that this contributed to recruitment difficulties.While the deliberative processes were generally built around a specific one-day event, the processes themselves extended over a longer period. The lead-up to the event was typically around three months. After the event, the work extended into further planning and implementation, often over many months. Community representatives who had participated in the deliberative events were often involved in this ongoing work. DPI staff noted that the workload developed by a deliberative event is enormous, and often invisible to the community.A variety of techniques were used, including citizens' juries, consensus conferences, deliberative surveys, televotes, consensus forums, multi-criteria analysis conferences, and 21st century town meetings [see Additional file DPI staff recognised that deliberative techniques should be chosen to suit the issue being addressed. Issue definition happens first, before the engagement techniques are chosen. For example, the Project Director of Network City pointed out that a large scale project like developing a strategic plan for Perth required a large scale engagement exercise like Dialogue with the City. In contrast, more tightly focused issues may benefit from a different approach. But while there was flexibility to choose appropriate techniques, some staff felt that the techniques chosen were imposed on them by the Minister's Office. They noted there was a tendency to rely on large-scale, one-off deliberative forums and some of the staff interviewed felt that other techniques such as focus groups and surveys might have been more appropriate.Many of the deliberative processes implemented by the agencies in WA involved large groups of people meeting for a limited time. The Minister noted that, by including a larger, more diverse spectrum of people in deliberations, there would be a better reflection of the whole community's needs and, concomitantly, the outcomes reached would hold greater legitimacy with the broader public . For exaBut these large-group meetings consistently used a small-group approach, with participants sitting at round tables of 10 (or less) and taking part in a facilitated discussion. Small group discussion was maximised by:• Seating people in small groups and arranging the seating in a way that maximised diversity. At many events, participants were placed next to someone that they did not know and were unlikely to agree with. For example, at the Road Train Summit, a person who lived on the freight route was seated next to a truck driver, and at the same table as a regulator and an environmentalist.• Providing trained facilitators for each small group.• Designing activities to encourage discussion and maximise deliberation.• Collecting data from each small group and feeding it back to the larger group in real time. Scribes at each table entered into networked computers the key themes emerging from their group's discussion; in a back room, a 'theme team' pulled out the key themes from each group and projected them back to the entire group. The Project Director for Network City described the way that this process acted as a catalyst for further discussion in the small groups and also gave an opportunity for the forums' facilitator to direct the discussions with further questions.st Century Dialogue rely on a combination of quantitative surveys and qualitative deliberation. In one citizens' jury conducted in WA, the jurors chose to use a combination of quantitative multi-criteria analysis and qualitative deliberation.The engagement processes used in WA involved a combination of qualitative and quantitative techniques. Deliberations that were open-ended and qualitative were often supported by quantitative data collection and analysis techniques. For example, both the deliberative survey and 21st century dialogue uses a networked computer methodology that enables the recording and initial analysis of the small group deliberations to be relayed to the larger group virtually in real time. Participants can then quantitatively prioritise the themes developed by the room. A preliminary report recording all of the deliberation outcomes is given to participants at the end of the event.Data collection supports both the qualitative and quantitative analysis. While consensus forums rely on butchers paper and sticky notes to record and group data, 21The storage and further analysis of data generated through engagement processes was the responsibility of the Manager of Applied Research and Modelling at DPI. Over time, a set methodology was designed to achieve this.A key principle underlying deliberative approaches to engagement is that participants are involved in informed discussion. Participants spend time learning about the issue so that they are able to discuss, question, and draw conclusions. In many cases, this means that extensive learning is required at the beginning of the deliberative process. DPI's Community Engagement Team Leader commented on the way that many participants seemed to value the education component of the deliberative events; they appreciated learning about the complexities of planning and hearing others' points of view.For each deliberative process, a stakeholder steering team developed background material, usually with support from the agencies. For example, before the Road Train Summit's forums, participants received background papers developed by community groups, industry groups, local government, and state governments. At the forums, participants listened to a short presentation from each group, and had an opportunity to ask questions.DPI staff noted that the work that went into developing the background material and preparing for the deliberative event was extensive. The background information needed to present a balanced view of all the arguments, in a form that was easily understandable to lay people but comprehensive enough to provide some depth. The various stakeholders needed to be provided with an equal opportunity to state their case to participants.Generating goodwill amongst participants is an essential element of implementing successful deliberative engagement processes. Participants need to feel confident that everyone is participating in good faith, their input will be valued, the process is fair, and the outcomes will influence policy and be put into action. At the engagement initiatives conducted by the agencies in WA, participants' confidence was built through ongoing agency commitment to deliberative events, the seriousness with which the event was treated, and the commitment of the Minister and senior bureaucrats who were an integral part of each deliberative event from beginning to end.Each deliberative process at DPI was evaluated through written responses from participants. The evaluations were designed to check whether participants' expectations had been met, see whether participants felt the process was worthwhile, and provide feedback for future processes.Participants' feedback consistently showed that they enjoyed the process and would be prepared to volunteer again. For example, the Dialogue with the City evaluation showed that 99.5 per cent of participants felt that the deliberations were either OK or great, and that 97 per cent would participate in a similar event again. Participants tended to express increased trust in government at the end of the process.Measuring the effectiveness of deliberative processes is complex. Participant evaluation of the process offers one perspective on how the engagement was carried out, but it is obviously an inadequate measure of deliberative engagement. Similarly, while before and after survey data indicates whether attitudes and preferences have changed as a result of deliberation, it does not explain why or, specifically, what caused any changes in views . Moreover, neither method is useful to determine the extent of inclusiveness or influence of the process, nor whether the process has achieved any lasting effect in terms of social capital or participant political efficacy.This section examines the impact that the deliberative processes conducted in WA had on policy development.Each of the deliberative initiatives conducted in WA resulted in policy or infrastructure development. DPI's Manager of Applied Research and Modelling argued that the department would only go ahead with a deliberative engagement process if there was some value in it with regard to policy direction. The whole point of the engagement is to air an issue openly and develop policy options that are realisable. Deliberative processes allow the department to develop policy by working with community representatives, instead of the traditional approach of developing policy options within the department and then approaching the community for comment.The deliberative approaches used by the agencies in WA involved a representative group of citizens in discussions about difficult issues that involved differing viewpoints and values, or complex issues. The participants helped to shape policies and influence outcomes, and the options that they generated were taken seriously. While this offers a high level of engagement to the community, the agencies in WA did not offer the community a decision-making opportunity nor a partnership approach. At each engagement event, the Minister publicly committed to take the community's views seriously and, in some cases, to implement the recommendations that the community gave. But decision-making power ultimately rested with the Minister. As MacTiernan pointed out:'Regardless of the consultation processes we use, at the end of the day, it is my responsibility to make the final decisions. But I don't have all the answers and even if I did – I couldn't be sure I would get broad support for my "answers". With community ownership of the solution and the implementation, there is far greater likelihood that change can be achieved .'Carson and Hart (2007) note that the level of decision-making input offered to citizens by MacTiernan is usual:'What is remarkable about MacTiernan is the way in which she delivers on her promise to citizens – if she promises that their decision will be final, she delivers on that promise. She has demonstrated how an elected representative can integrate citizens' common sense and their willingness to learn in a manner which strengthens rather than diminishes the current political system .'DPI staff agreed that policy outcomes clearly resulted from the deliberative engagement processes conducted. Some examples of these outcomes include:• The community plan 'Network City', developed by participants before the conclusion of the Dialogue with the City process, was accepted by Cabinet and is now the planning framework for Perth. This document binds and guides all State government agencies, local government, and industry in the development of the metropolis.• The Scarborough Deliberative Survey resulted in new height planning guidelines for coastal nodes.• The Albany Citizens' Jury administration site recommendation was accepted by the Minister even though the WA Planning Commission had recommended otherwise.• Over a two year period, the outcomes of the Freight Network Review were all implemented, resulting in sweeping new road freight policies that are now being applied across Australia. Participants in the process received progress reports until each of their priority recommendations had been implemented.• The Reid Highway Extension Citizens' Jury proposed a specific road option and a series of safety measures, all of which were fully implemented.• The Bassendean Enquiry-by-Design Dialogue's recommendations concerning a new railway station bridge and upgrades were accepted and have now been built.• Recommendations from the Gascoyne Musters led to new guidelines for pastoralist leases and land use.st Century Dialogue formed the basis for the new plan for the region.• The recommendations from the Bunbury Regional Open Space 21• Using the recommendations from consensus forums and deliberative surveys, a number of sites were planned and are now built or being developed including Leighton, Scarborough Senior High School site, and the Cockburn Sound industrial area.These experiences in WA demonstrate that deliberative engagement processes can be successfully implemented by government and can be used to guide policy. Moreover, the techniques can be adapted to suit the context and issues experienced by a department, and the skills required to conduct deliberative processes can be fostered amongst departmental staff. Within the planning and infrastructure portfolio in WA, deliberative engagement processes have successfully been used to resolve community issues and concerns, identify key issues for policy development, generate consumer input into policy development, and inform major decisions.The experiences at these portfolio agencies show that deliberative engagement processes require extensive commitment at all levels of the organisation. Most important is a high level champion, in this case the Minister, who believes that deliberative processes will facilitate better decision making and are worth the time and effort that they require. Champions are also needed throughout the organisation to help ensure that deliberative processes are implemented in ways that demonstrate a real commitment to thoroughly engaging with the community.Building a commitment to deliberative processes throughout a portfolio takes time and effort. A move towards deliberation requires a culture change, and this tends to be slow to develop. At DPI, staff movement and the loss of skills and experience within the Department seemed to be a major impediment to this ongoing process. More importantly, such a culture change is rarely aligned with Departmental priorities or funding.DPI's experiences show that, while the deliberative processes themselves may take significant time to implement, the work that they generate is often far more extensive. The outcomes from a deliberative event may generate work for many different sections of the Department, and across other government departments. This work is often slow to develop, complex, and invisible to the people who participated in the original event. It can also be difficult not to move away from participants' original consensus outcomes. Finding ways to communicate with participants – as DPI did in most cases through newsletters, updates, and a stated commitment to developing a concrete outcome – is critical for maintaining community support for the approach.Hartz-Karp has noted that critics of deliberative processes suggest that they minimise the influence of informed experts and prioritise the views of the uninformed community . Critics• In many deliberative processes, DPI worked to include the voices of informed experts alongside the general community through the one-thirds recruitment approach. In addition, they put extensive effort into ensuring that community participants were well informed prior to the deliberation. Including the voices of informed experts is not without difficulty, particularly when those experts have a pre-determined idea about the best outcome.• Deliberative processes are time-consuming and costly, but within the portfolio the techniques were adapted in ways that suited the time and money available. Although case study participants felt that they needed more time for each process, they felt that the money was well spent in developing a community-focused solution to the issue.• The deliberative processes in the portfolio fulfilled a variety of purposes, including increasing social capital, allowing for informed decision making, and heightening public visibility and awareness of issues – including, as one officer noted, 'developing an element of political theatre' . There is no reason to assume that democratic ideals and political outcomes can not work together.The examples from WA show that deliberative processes can be used as part of government policy making, and there is good reason to believe that the processes could work well in health. Deliberative processes can improve the quality of decision making and engage the broad community in the policy development process. They can be used to resolve divisive issues and generate discussion about big picture policy issues.Other disciplines, such as environmental management and urban planning, have a strong history of community engagement – both at the project level and the policy level. But even in those disciplines, deliberative approaches to engagement are seen as an innovative alternative to more traditional consultation techniques. While there is considerable experience in community engagement at the health service level in Australia, experience with community engagement about health policy is sparse and experience using deliberative processes is negligible. Health policy makers may be able to learn from the experiences in other disciplines, and experiences overseas with community engagement about health (particularly in Canada and the UK), and adopt approaches to community engagement that allow for informed deliberation and debate within the community about the future of Australia's health system. At a time when calls for health system reform are gathering momentum, Australian policy makers may be faced with a real opportunity to develop innovative approaches to community engagement.For the planning and infrastructure agencies in WA, an ongoing question is how deliberative processes can be institutionalised so that they become a standard element of the engagement toolbox used by the departments. In health, the questions are centred around whether and how deliberative processes can be used to guide health policy. This requires commitment from government and strategic thinking about how deliberative processes can best be applied. It is possible that a deliberative approach to engaging the community in discussion about Australia's health policy could lead to practical approaches for health reform, based on a combination of community and stakeholder input. A robust process could develop sound policy options and provide government with a strong mandate for implementation.Janette Hartz-Karp was employed as a consultant to the Minister for Planning and Infrastructure in WA during the time covered by this case study. She organised and facilitated the community engagement activities discussed in this paper. Judy Gregory was employed as a research consultant by AIHPS to conduct research into consumer engagement in Australian health policy.The authors contributed equally to the development of this paper. JHK conducted the work discussed in this paper. JG was employed as the principal researcher for a larger research project about consumer engagement conducted by the Australian Institute of Health Policy Studies (AIHPS), and wrote a series of case studies from which this paper is drawn. RW provided research assistance and administrative support for the AIHPS consumer engagement project.Key deliberative techniques used in Western Australia. This is a chart describing some key deliberative techniques used in Western Australia.Click here for file
The btmf ligands link adjoining MnII atoms into a zigzag chain along the a axis. The crystal structure is stabilized by intermolecular O—H⋯N hydrogen bonds, which link the chains, forming a two-dimensional layer parallel to (10In the title complex, [FeMn(C DOI: 10.1107/S1600536809053823/dn2521Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:
Accumulating evidence suggests that self-renewal and differentiation capabilities reside only in a subpopulation of tumor cells, termed cancer stem cells (CSCs), whereas the remaining tumor cell population lacks the ability to initiate tumor development or support continued tumor growth. In head and neck squamous cell carcinoma (HNSCC), as with other malignancies, cancer stem cells have been increasingly shown to have an integral role in tumor initiation, disease progression, metastasis and treatment resistance. In this paper we summarize the current knowledge of the role of CSCs in HNSCC and discuss the therapeutic implications and future directions of this field. Head and neck squamous cell carcinoma (HNSCC) ranks sixth worldwide for cancer-related mortality, with an estimated 500 000 new cases diagnosed yearly . For theOver the last 15 years, advances in tumor biology have led to the discovery that many cancers, including HNSCC, appear to be supported by cells with stem-like properties. Studies in a wide variety of malignancies have demonstrated that only a distinct subpopulation of tumor cells, termed cancer stem cells (CSCs), contain the ability to undergo self-renewal and differentiation and hence have the ability to initiate tumorigenesis and support ongoing tumor growth. Furthermore, it appears that, like their normal stem cell counterparts, CSCs have increased resistance to standard cytotoxic therapies. These findings have coalesced into the cancer stem cell theory of tumorigenesis, which has remarkable implications on our understanding of tumor initiation, disease progression, and treatment response. Here we review the basics of the cancer stem cell theory as it applies to HNSCC.The cellular and molecular requirements for initiation of tumorigenesis are a series of mutations resulting in the acquisition of replication and growth-factor independence, resistance to growth-inhibitory signals, tissue invasion, and metastasis . The mecAs with normal somatic stem cells, CSCs are defined by their ability to self-renew and to give rise to a heterogeneous population of tumor cells. This population of tumor cells consists of rapidly dividing cells (similar to the transient amplifying (TA) cell population in normal tissue) as well as additional CSCs and more differentiated tumor cells. In addition to their replicative capacity, CSCs, like their somatic counterparts, are also more resistant to the effects of cytotoxic chemotherapies and radiation damage –16. Defihi CD38low) into immunodeficient mice was not only able to recapitulate AML but it was phenotypically and pathologically similar to the patient's original leukemia. In contrast, the remaining cell populations (CD34low and CD34hi CD38hi) failed to give rise to new leukemia cells.CSCs were first experimentally defined in hematopoietic malignancies by John Dick and colleagues in 1994 . Transplhi CD24low breast cancer cells were able to recapitulate phenotypically heterogeneous breast cancers at very low limiting dilutions in mouse xenograft experiments [in vitro assays and in vivo monitoring for effectiveness of new experimental cancer therapies are based on reduction in cell number or tumor size. It is therefore theoretically possible that therapies which result in tumor cell death, as currently assayed, will not have any significant effect on the CSC and will therefore not result in long-term disease control or eradication. The ability of the CSC to produce phenotypically diverse tumor cells may also contribute to increased metastatic potential with new mutations selecting for migratory and invasive properties of the tumor.In the 15 years since the identification of the leukemic stem cell, a number of investigators have identified CSCs in solid malignancies. In 2003, Michael Clarke and colleagues were the first to identify a CSC population in a solid tumor. A subpopulation of CD44eriments . Since teriments –23. The eriments . AdditioThe origin of the cancer-initiating cell has long been presumed to be the normal endogenous tissue stem cell. This is based upon their similar behaviors and the notion that only accumulated mutations within a long-lived cell could ultimately result in tumorigenesis. In colorectal cancer there is a strong correlation between induced loss of the Wnt signaling molecule APC in a putative stem cell population and the formation of benign intestinal polyps , providihi normal oral keratinocytes were shown to exhibit a G2-block associated with apoptosis resistance, a potential stem cell feature [With the primary focus on identifying CSC markers in HNSCC, little is known about the identity or the location of the normal endogenous stem cell or the stem cell microenvironment. Several studies have examined the putative HNSCC CSC marker CD44 in normal head and neck epithelia with differing conclusions. In one study, isolated CD44 feature , suggest feature . The hea feature , 33, air feature and esop feature may guidin vivo is an intracellular enzyme normally present in the liver. Its known functions include the conversion of retinol to retinoic acids and the oxidation of toxic aldehyde metabolites, like those formed during alcohol metabolism and with certain chemotherapeutics such as cyclophosphamide and cisplatin –47. ALDHgenicity . Hoechst 33342 is a fluorescent DNA-binding dye that preferentially binds to A-T rich regions. It is actively pumped out of cells by members of the ATP-binding cassette (ABC) transporter superfamily. Once stained with Hoechst dye, cells can be sorted by fluorescent-activated cell sorting (FACS) based upon the activity level of these multidrug transporters. Originally noted to enrich bone marrow for long-term hematopoetic stem cells , this mehi [hi [Under serum-free culture conditions CSCs can be maintained in an undifferentiated state, and when driven toward proliferation by the addition of growth factors, form clonally derived aggregates of cells termed tumor spheres . The abihi , Oct-4, hi [hi , 60, as While there exists significant data defining the presence of CSCs within a variety of tumor types and many aspects of the cell and molecular biology of CSC have been elucidated, the manner in which this unique cell population influences clinical disease progression remains unclear. Given that metastases can be formed from implantation of a single tumor cell , it seemhi appears to be tightly linked with metastases [hi cells found in both primary and metastatic tumors, but the presence of CD26hi cells in the primary tumor predicted future development of metastases. In a mouse xenograft study, CD26hi CSCs implanted into the cecal wall of a nude mouse formed a tumor in the colon as well as liver metastases, while CD26low CSCs formed a tumor at the site of implantation without developing liver metastases. Similarly, injection of CD26hi CSCs into the portal vein led to liver metastases, while similar injection of CD26low CSCs did not. Thus, these CD26hi CSCs appear to be the cells responsible for metastatic spread in this tumor population.The strongest evidence that CSCs are responsible for metastases comes not in HNSCC but in colorectal cancer. In this tumor, a unique CSC population that is CD26tastases . Not onlAnother stem cell marker, CD44, has also been implicated in metastatic spread and disease progression in HNSCC, although the CD44 story is more complex. Recently, three different isoforms, CD44 v3, v6, and v10, have been shown to be associated with progression and metastasis of HNSCC . IncreasAside from providing a model of disease progression and metastasis, CSCs have important implications regarding cancer treatment. While current chemotherapy and radiation treatment for HNSCC are focused on indiscriminate cytoreduction, the CSC hypothesis suggests that only by eliminating CSCs can cancer be treated effectively . Howeverhi CSCs [hi CSCs appears to be mediated through enhanced repair of DNA damage via the Chk1 and Chk2 kinases [The presence of a CSC population has thus far been implicated in radioresistance of multiple tumor types. For example, glioblastoma tumors that recur after radiation have been found to be enriched in CD133hi CSCs . Further kinases and thro kinases . Similar kinases . However kinases , 16.In addition to radioresistance, CSCs also appear to mediate chemoresistance in multiple tumor types. There is evidence for chemoresistance of CSCs in lung , pancreaWhile the CSC theory is revolutionizing our understanding of tumor biology, many things remain to be elucidated regarding the role of CSCs in HNSCC. For starters, additional markers that enrich CSCs in other epithelial malignancies need to be evaluated in HNSCC. Only a limited number of CSC markers have been examined in HNSCC, and for each of these the reported number of marker-positive cells needed for tumor formation is significantly higher than what has been reported for other solid malignancies. It is clear that further purification of the CSC population in HNSCC is necessary. To date, only a few studies have used primary human HNSCC tissue for CSC marker identification , 54. PriIt is becoming more clear that the cellular heirarchy defined by the CSC theory is likely more complex than originally realized. Single marker identification may not be sufficient to identify a pure CSC population. In fact, as demonstrated in glioblastoma, CSCs can express or lack the traditional CSC marker CD133 yet still retain the functional characteristics that define a CSC . It may Additional work is also needed in defining the expression patterns of CSC markers in the endogenous setting. Little is known, especially in the head and neck, about the endogenous expression patterns of putative CSC markers. Further, it is unknown if the stem cell niche of head and neck mucosa is similar to that of cutaneous skin or if regional differences in CSC marker expression exist between subsites of the upper aerodigestive tract. Clearly an understanding of normal head and neck mucosal CSC marker expression is critical if attempts are to be made to selectively target CSCs as part of a treatment regimen for HNSCC. To date, most studies have focused on the identification of tumor cell populations enriched for cells with stem-like properties. We have little understanding of the significance of the markers used to identify these cells—whether they are simply markers of convenience or whether they have functional significance remains unknown. Examining the role these molecules may play in the tumorigenic, metastatic, and treatment resistance properties of CSCs is certainly a logical step on our way to discovering the mechanisms by which CSCs differ from the remaining tumor cell population.The CSC theory offers an intriguing insight into why currently available therapies for head and neck cancer so often fail. While increasing evidence suggests that CSCs display increased resistance to multiple treatment paradigms inclusive of chemotherapy and radiation, the exact mechanisms by which they do this are incompletely understood. Focused research on mechanisms of treatment resistance in CSCs and whether they can be overcome will prove equally important as efforts to improve CSC identification.Increasing our knowledge of the differences between CSCs, their differentiated progeny and normal endogenous stem cells, will translate into our ability to understand the seemingly complex cellular hierarchy in tumors. Ultimately an understanding of CSCs has the potential to identify novel targets for therapy and impact patient care.
In contrast, femtosecond laser dissociative ionization results in many large mass ion peaks. Evidence is found for various competing dissociation and ionization pathways. Variation of the nanosecond laser intensity does not change the fragmentation pattern, while at high femtosecond intensities large changes are observed in relative ion peak sizes. The total ionization yield and fragmentation ratios are presented for a range of wavelengths and intensities, and compared to the changes observed due to a linear chirp variation.Changes in the laser induced molecular dissociation of 1,1,1-trichloroethane (TCE) were studied using a range of intensities and standard laser wavelengths with nanosecond and femtosecond pulse durations. TCE contains C-H, C-C and C-Cl bonds and selective bond breakage of one or more of these bonds is of scientific interest. Using laser ionization time of flight mass spectrometry, it was found that considerable variation of fragment ion peak heights as well as changes in relative peak ratios is possible by varying the laser intensity (by attenuation), wavelength and pulse duration using standard laser sources. The nanosecond laser dissociation seems to occur The laser control of the dissociative ionization of 1,1,1-trichloroethane was investigated using nanosecond and femtosecond laser sources, in order to determine the possibility and extent of control of bond breaking due to nonresonant multiphoton excitation. The resulting trends observed could potentially be applicable to other molecules. Practical application of laser controlled molecular dissociation is more likely when standard commercial laser wavelengths are used.et al. [Femtosecond coherent control has been a topic of increasing interest in the last two decades and numerous experimental studies of the effects of laser control of the dissociation of small molecules in the gas phase have been reported. A good summary of the current status of this research field is given by Dantus and Lozovoy , Lozovoyet al. . The goaet al. [2X and found optimized pulse shapes for enhancing and minimizing selective bond breaking of different bonds in these molecules. Damrauer et al. [2BrCl, they could favour the C-Cl bond breakage rather than the C-Br bond breakage by a factor of 1.7/1. Graham et al. [et al. [3COCF3, CH3COD3, CH3COCCl3 and CH2BrI using closed loop coherent control. They found that control over the ratio of CCl3/CH3 was possible and the optimized and minimized ratios were roughly 1.0 and 0.2 respectively [Assion et al. studied r et al. found thm et al. studied [et al. studied ectively .et al. [Numerous studies have been conducted for the purpose of comparing nanosecond and femtosecond laser dissociation and ionization using high intensity laser ionization coupled to time of flight mass spectrometry ,11. Wein13–1015 W/cm2, there are a few exceptions reported in which extensive fragmentation occurs at all intensities and a negligible amount of the parent ion is observed. Harada et al. [15 W/cm2), processes such as field ionization resulting in highly charged ions and Coulomb explosions, tunneling ionization and over-the-barrier ionization, may occur. An early review of field ionization and Coulomb explosion of diatomic molecules is given by Posthumus et al. [There is also a fundamental interest in laser-molecule interactions at the high intensities available from femtosecond lasers ,13. Thesa et al. describes et al. .3CCl3) is a chlorinated hydrocarbon comprising a methyl group (CH3) bonded to a carbon trichloride group (CCl3) through a C-C bond. Its chemical structure and calculated electron density distribution are shown in et al. [et al. [1,1,1-Trichloroethane . The maximum pulse energy from the CPA is 1.05 mJ. The beam has a Gaussian radius w = 3.6 mm at the focusing lens of the time of flight mass spectrometer, and its M2 was measured as 1.2 ± 0.15. An uncoated fused silica lens of f = 150 mm was used, which results in focused beam waist radii given in The femtosecond laser system is a chirped pulse amplifier (CPA) femtosecond Ti:sapphire laser with central wavelength 795 nm, bandwidth ranging from 6.5 to 10.5 nm FWHM, pulse duration between 130 and 160 fs when transform limited, and with a repetition rate of 1 kHz (Coherent Legend). The CPA is pumped by a 1 kHz frequency doubled Nd:YLF laser (Coherent Evolution) and seeded by a femtosecond Ti:sapphire oscillator (Coherent Mira 900F), which itself is pumped by the 2.2.−1. Beam radii were estimated from energy transmission through an accurately positioned variable aperture (86% transmission) as 4.0 mm , 4.0 mm (532 nm), 3.3 mm (355 nm) and 2.5 mm (266 nm).A Continuum Surelite Nd:YAG nanosecond laser with maximum pulse energies at each harmonic: 120 mJ (1064 nm), 32 mJ (532 nm), 6 mJ (355 nm) and 6 mJ (266 nm) was used. The pulse duration was measured as 8 ns and the bandwidth is specified as 1 cm2.3.−7 mbar. Sample gas is introduced effusively through a needle valve and then passed through a skimmer into the ionization region. The unit mass resolution was measured as Δm/m = 240 for peaks of mass 117 amu (CCl3+), and 232 amu for peaks with mass 36 amu (H35Cl+). A liquid sample is placed in a stainless steel sample holder connected to the inlet system with Swagelok fittings and frozen with liquid nitrogen while pumping away the residual air above the sample, followed by sample melting. Once this procedure is completed, the needle valve is slowly opened and an equilibrium pressure in the vacuum chamber is eventually reached, determined by the pumping capacity, the vapour pressure of the sample at room temperature and the needle valve setting. The optimum sample pressure, at which space charge effects were not yet observed, but significant signals were obtained, was in the range 2–3 × 10−5 mbar in the ionization region. All experiments reported here were kept within this range.A home-built reflectron time of flight mass spectrometer was used. This instrument consists of two chambers separately pumped by two turbomolecular pumps (60 l/s) backed by mechanical rotation pumps. The base pressure of the system in both chambers is approximately 5 × 10The laser beam was focused using an uncoated lens of f = 150 mm, through the entrance window (UV fused silica 3 mm thick) into the centre of the ionization region. The flight tube axis, molecular beam and laser beam directions are all perpendicular to each other. The lens was mounted in a manual XYZ micrometer stage combination for precise translation of the lens and hence the focus position in the ionization region. Before each experiment, the optimum is found in all these directions manually by observing the mass spectrum.The laser polarization is linear and parallel to the flight tube and attenuation was done in this work using a set of neutral density filters (double filter wheel). The ionization region is between the TOF repeller plate, which is maintained at 1.4 kV, and the first extraction plate at 960 V. This is followed by a second extraction plate at 0 V. The three plates are separated by 1 cm each and the extraction apertures are 8 mm and 3.5 mm in diameter. This choice was made to ensure all ions generated were collected, irrespective if these were resultant from the highest intensity focus spot, or from regions around the focus at lower intensity (the Rayleigh Range for the 795 beam focused with 150 mm lens was 742 μm). Therefore our mass spectra are integrated over a range of intensities, close to the peak intensity. The reason for this choice was due to our final aim of coherent control of molecular dissociation, not only in the small focus region, but rather achieving control over such a process over the entire focus region. The ions pass through the extraction holes into the field-free flight tube and into the reflectron, which consists of a set of 14 plates with central apertures of 60 mm, except for the final plate without aperture. The voltage difference between the first and final plates is 1.3 kV and the plates in between have intermediate voltages. The reflected ions travel at an angle of 3.5 degrees relative to the original direction until they reach a set of steering plates to which a potential of 500 V is applied, to steer the ions into the detector assembly. This consists of a microchannel plate (Hamamatsu F1552-01) followed by an electron multiplier (Hamamatsu R2362). The signals are collected on a 500 MHz digital oscilloscope (Tektronix) and mass spectra are averaged over 512 for the 1 kHz femtosecond laser and over 64 for the 10 Hz nanosecond laser.+ peak signal in the nanosecond experiment was 5.7% for 10 measurements over 1 hour. In a similar femtosecond experiment over 1 hour this value was 3.4%.The stability of the entire system is crucial and before each series of experiments, after sufficient warm-up and stabilization, a series of measurements are taken to ensure stability. The standard deviation of the Cl14 to 3 × 1015 W/cm2. The observed ionization threshold is approximately 1 × 1015 W/cm2, which is in good agreement with that of Lozovoy et al. [15 W/cm2.As a check of the calculated laser intensity, the ionization of Helium was studied as a function of laser intensity with the 795 nm femtosecond laser over the intensity range 1 × 1014 W/cm2 was calculated using the formula in Posthumus [−7 cm3. At our pressures this results in an estimated 4 × 105 ions, similar to that reported by Lozovoy et al. [The focal spot size for 795 nm ionization is 13.7 μm, with a corresponding Rayleigh range of 742 μm. The ionization volume above 1 × 10osthumus as 6.8 ×3.3.1.12 W/cm2 and fluence 2.09 × 104 J/cm2.Nanosecond laser ionization was attempted with all four fundamental Nd:YAG laser wavelengths at maximum pulse energies. No ionization was achieved using the available pulse energy of the 1064 nm wavelength, at a peak intensity of 2.6 × 103.1.1.12 W/cm2 is given in +, second is H+ and third is 35Cl+. The peaks CH+, CH2+ and CH3+ are identified. The CH3+ peak could be due to bond breaking of the C-C bond in neutral or ionized CH3CCl3 but could also result via other dissociation and dissociative ionization pathways, for example sequential dissociation of chlorine atoms, the C atom and subsequent ionization. The H+ peak is clearly the result of many possible dissociation and ionization pathways, as is the C+ peak. Also visible here are the C2+, C2H+, C2H2+ and C2H3+ peaks. The C2H3+ peak could be the result of the dissociation of the 3 chlorine atoms from neutral or ionized CH3CCl3. The 35Cl+ and 37Cl+ isotopes are clearly distinguishable, as are the HCl+ combinations. These indicate HCl elimination as a possible dissociation pathway. In the higher mass region we observe CCl+ peaks of the two isotopes of chlorine. CCl+ could be the result of a number of potential dissociation pathways. At masses 97, 99 and 101, the chlorine isotopes of CH3CCl2+ are identified, although these are weak. These are the result of the dissociation of a single chlorine atom from the neutral or ionized parent molecule. No peaks are observed in the higher mass region where the parent molecular peak would be expected at mass 132 for the most abundant chlorine isotope.A detailed presentation of the 532 nm ionization at 2.8 × 1012 W/cm2 and the fragmentation pattern was reasonably unchanged across this intensity regime as shown in The intensity dependence of 532 nm ionization was studied up to 2.8 × 10+, CH3+, C2H3+, 35Cl+ and C35Cl+ ion peaks are shown in + ion peak in comparison to the slower increase of the 35Cl+ ion peak. Furthermore, the slopes are different for different fragments, also indicating changes in the relative fragmentation ratios.The ion peak signals as a function of laser intensity for the C3.1.2.11 W/cm2. It is clear that all peaks have roughly the same ratio as in the 532 nm case. The strongest peaks are H+ and C+, followed by the Cl+ isotopes. H2+ is observed which was not observed at 532 nm, the CCl+ peaks are clear as well as the peak at mass 62 which can be explained as the CH3CCl+ fragment, although it is very weak. The CH3CCl2+ peaks are observed as before, but no higher mass peaks are observed. The observation of CH3CCl2+ and CH3CCl+ peaks, and lack of other high mass peaks, identifies sequential Cl dissociation as a possible first dissociation reaction, before further fragmentation occurs. The lack of parent ion peak also indicates that this Cl-dissociation could take place before ionization, resulting in neutral dissociation followed by ionization of the fragments.11 W/cm2 and the fragmentation pattern was reasonably unchanged across this intensity regime as shown in The intensity dependence of 355 nm ionization was studied up to 6.8 × 103.1.3.11 W/cm2. The fragmentation pattern is similar to that seen in +, C+, 35Cl+ and 37Cl+. All peaks present in the other nanosecond experiments presented above are also present here in roughly the same ratios. In particular the C+ > CH+ > CH2+ but the CH3+ peak is in this case only slightly larger than CH2+, not as much larger than in the other nanosecond experiments. C2+ is clearly visible as before but C2H+, C2H2+ and C2H3+ are much weaker in relation. Also the HCl+ peaks are much weaker than in the other experiments. The CCl+ peaks are strong but there are no higher mass peaks observed. In this case, in contrast to the experiments at 355 nm and 532 nm, we do not observe the large mass peaks of CH3CCl2+ at 99, 101 and 103 amu. These results indicate that stronger fragmentation has occurred under these conditions, in comparison to 355 nm and 532 nm.11 W/cm2 and the fragmentation pattern was unchanged across this intensity regime as shown in The intensity dependence of 266 nm ionization was studied up to 9 × 103.2.3.2.1.15 W/cm2 resulted in mass spectra as shown in + peak is observed, as well as C+, C2+ and C3+. Background gas peaks are considerably intense with peaks of N+, O+ and H2O+ identified, as well as very strong molecular N2+ and O2+ peaks. Also identified are the 35Cl+ and 37Cl+ peaks and the corresponding HCl+ peaks, as well as C2+, C2H+, C2H2+ and C2H3+. It is interesting to note that highly charged ions are observed for some species.Femtosecond ionization at the fundamental 795 nm wavelength up to 2.3 × 104+ around m/z = 9. Of particular interest is the peak splitting observed on some peaks, in particular on the Cl+ peaks (but not the HCl+ peaks), H+, N+, O+ and on the highly charged ion peaks described above. Peak splitting is indicative of explosive dissociation, and can be due to a Coulomb explosion process occurring at high intensities. In this case the Coulomb explosion of the parent molecule or large fragments can result in these small mass peaks such as Cl+. The splitting occurs due to the ions which have initial velocity components in the direction of the flight tube and those in the opposite direction which are also collected. However, no peak splitting is observed on any of the large mass molecular fragments. Therefore the first dissociation processes resulting in fragment ions as observed do not seem to occur explosively. Furthermore, the lack of a parent molecular peak is interesting and indicates the possibility that the first dissociation process takes place from the neutral parent molecule. The higher mass peaks of CCl+ are observed similar to the previous nanosecond experiments, but also observed are very strong peaks of CH2CCl+ and combinations of these with varying numbers of H’s attached. It is interesting to note that the CH2CCl+ peak is stronger than the CH3CCl+ peak. This is an indication that a direct dissociation process resulting in this particular fragment could be dominant. This can possibly be explained by direct HCl elimination from CH3CCl2. In this figure we observe CCl2+ peaks, probably arising from dissociation of the CCl3 fragments (starting at the higher mass of 117 amu). The CH3CCl2+ peaks are also observed very strongly with different combinations of H’s attached. The CH3CCl2+ is a direct dissociation fragment by the dissociation of a single chlorine atom from the parent molecule or ion. No parent molecular peak is observed at the expected mass 132.As mentioned above, doubly and triply charged C is observed. Also observed are doubly charged Cl ions of both isotopes around the mass 18. Triply charged Cl is also observed around mass 12 as well as ClMass spectra recorded as a function of laser intensity show significant changes in relative fragment peaks, although all major peaks identified above are present at lower intensities and no additional peaks are observed. Mass spectra at three different intensities are shown in 2CCl+) becomes dominant compared to all other peaks, which is not the case at higher intensities. The change in peak sizes is shown quantitatively in Although the absolute signals of all peaks seem to decrease with decreasing intensity as expected, some relative changes are observed qualitatively. For example in the lowest intensity spectrum shown here, the mass 61 ion show almost identical mass spectra, as shown in 13 W/cm2 followed by a reasonably linear increase. As observed before, the slopes differ, resulting in different fragmentation ratios as a function of laser intensity.The intensity dependence of small mass ion peaks are shown in 3.2.3.+, C+, N+, O+ and Cl+ and all higher charged species. A closer look at the observed splitting in our experiment is provided in Peak splitting was observed on the ion peaks H35Cl+ ion peak as a function of laser intensity as shown in 14 W/cm2, no peak splitting is observed within of the resolution of our instrument. The increase in split peak amount with increasing intensity may be explained by an increase in the number of ions generated in the ionization volume. As the number of ions increases, each ion is subjected to a larger Coulomb force, resulting in a larger velocity in directions away from the ionization region. As the velocity increases, the amount of splitting increases. The presence of multiply charged ions as observed indicates the presence of multiply charged explosive precursor ions. This could also result in increased peak splitting, in which case higher charge precursors will result in larger Coulomb forces. In our experiment, we find the thresholds for the observation of various 35Cl charge states to be 7.8 × 1013 W/cm2 (35Cl+1), 1.8 × 1014 W/cm2 (35Cl+2), 2.3 × 1014 W/cm2 (35Cl+3), 7 × 1014 W/cm2 (35Cl+4). No higher charge states for 35Cl or 37Cl were observed.The peak splitting was studied for the 3.2.4.+ are due to the decreasing laser intensity with increasing linear chirp. In both cases the chirp was adjusted over a range of chirp settings both positive and negative corresponding to pulse durations from 150 fs up to approximately 300 fs. The total pulse energy was kept constant using neutral density filters (to within 5–10%). The results over the range studied here (for both He+ in the Helium experiment and for the CCl3+ peak in the trichloroethane experiment) are shown in + peak intensity is maximum at the shortest pulse setting and decreases towards the higher chirp settings. The CCl3+ peak shows the same behaviour and varies by a factor of 3 in this range. Other peaks in the trichloroethane mass spectra vary similarly but by smaller margins. In Linear chirp was introduced using a Dazzler acousto-optic programmable dispersive filter and the resulting mass spectra recorded. Two experiments were carried out, one with pure helium and one with trichloroethane. The Helium experiment may be seen as a reference experiment, and the only changes expected in ion signal of He3+ / CH3+ ratio in the chirp experiment was calculated in the same manner as for the intensity variation study. This is an example of a ratio for controlled dissociation, similar to Cardoza et al. [3+ value changes much less than the CCl3+ value over this range. This demonstrates a reasonable amount of control induced by the chirp variation, although no unexpected ratio changes are observed in this range.The CCla et al. . This ra4.3CCl2+ peaks), in contrast to the 266 nm case in which case these peaks are not present. The observed spectra are similar to those reported by Ma et al. [+ peaks as the heaviest mass ions detected. Since the Cl+ peaks are strong in all these cases, as well as CH3+ and C2H3+, the dominant primary dissociation reaction could be C-Cl bond breaking, followed by further dissociation and ionization pathways to produce the observed peaks. The small amounts of the heavy mass CH3CCl2+ observed, and the lack of any other heavy mass fragments, confirm this proposed mechanism, as does the lack of parent ion peak.A comparison of the nanosecond ionization mass spectra for the three wavelengths 532 nm, 355 nm and 266 nm is presented in a et al. for chlo+ peaks are similar. This confirms the identical fragmentation pattern and indicates a striking similarity in the dissociative ionization for the two wavelengths. It is due to this striking similarity that particular care was taken to ensure only 397 nm component in the beam, using a combination of 2 filters.As shown in et al. [et al. [2H5Cl, C3H7Cl and C4H9Cl) by Kaziannis and Kosmidis [In a study of the femtosecond dissociative ionization of halogenated ethylenes by Castillejo et al. , extensi [et al. . Recent Kosmidis show theKosmidis .From this data, the total ionization can be estimated in each experiment by summation over these most important ion peaks. This total ionization yield as a function of laser intensity for all the wavelengths studied is shown in et al. [3+/CH3+ ratio from dissociative ionization of trichloroacetone (CH3COCCl3) with optimized and minimized ratios of roughly 1.0 and 0.2 respectively. In addition they note that no parent molecular peak is observed for this molecule, although a strong parent molecular peak is observed for trideuterated acetone. In our experiment, even though the molecule is different, this same ratio was chosen as an example to indicate the relative changes that can be induced in the fragmentation process. We found that this ratio (CH3+/CCl3+) is strongly dependent on laser intensity and varies from 0.35 to 1.72 over the range of 795 nm intensities studied here, and from 0.74 to 0.92 over the range of 397 nm intensities. The same ratios for our nanosecond experiments are zero due to the lack of CCl3+ peaks. Similarly the chirp variation experiment produced changes in this ratio of 0.8 to 1.5.Cardoza et al. reported5.3CCl2+ in some of these spectra and lack of any other large fragments, and also due to the strong Cl+ peaks observed. In the femtosecond experiments at low intensity there are numerous large fragments, most notably CCl3+, CH3CCl2+ and CH2CCl+. The dominance of the CH2CCl+ peak identifies direct HCl elimination from CH3CCl2 as a possible dissociation reaction after Cl dissociation from the parent molecule. The presence of CCl3+ does indicate that some C-C bond breaking may occur as a primary dissociation reaction. These speculations are complicated by the various possibly competing ionization and dissociation pathways, including dissociation from the neutral parent molecule, dissociation of these fragments , ionization of the parent molecule followed by dissociation from the ionized parent molecule, as well as different mechanisms of excitation and ionization. Ionization mechanisms include multiphoton ionization (most likely non-resonant due to the lack of absorption features at the wavelengths employed here), as well as strong-field ionization mechanisms such as field ionization.The trichloroethane parent molecular peak was not observed in any of the experiments reported here. The lack of parent ion indicates the possibility that a primary dissociation reaction takes place from the neutral molecule. In the nanosecond regime, indications are that Cl dissociation is the primary reaction due to the presence of CHExtensive fragmentation is observed in all experiments reported here (both nanosecond and femtosecond), and this fragmentation varies considerably as a function of laser intensity. At the highest intensities in the femtosecond experiment, highly charged atomic ions and peak splitting was observed on numerous peaks. This is explained by Coulomb explosion of larger fragments. Comparison between nanosecond and femtosecond dissociative ionization at lower intensities show an increased amount of fragmentation at nanosecond pulse durations.3+/CH3+ taken from these measurements yield strong variation with laser intensity, and some degree of variation but less than the intensity over a small range of linear chirp values induced in the 795 nm femtosecond laser experiment. As another example of control, the absolute signal size of various ion peaks (such as C+ and Cl+) are strongest in the 266 nm experiment, even though the intensity is 3 orders of magnitude lower than the 795 nm femtosecond experiment.In terms of laser control of dissociation, an example ratio of CCl3 and CCl3 fragments followed by ionization. The fragmentation pattern shows dependences on laser intensity and chirp. Such changes can be manipulated to either optimize a relevant peak ratio, or optimize one or more fragment ion peaks. This is demonstrated for the CCl3+/CH3+ ratio over a wide range of intensities (ratio 0.35 to 1.72) and over a linear chirp variation (ratio 0.8 to 1.5). The implications for laser control of molecular dissociation is that both nanosecond and femtosecond lasers provide a reasonable variation of the mass spectra (which may be seen as a form of control over the dissociative ionization processes) using only intensity and wavelength.In conclusion, trichloroethane dissociation and ionization efficiency is higher with nanosecond laser pulses of 8 ns and most efficient at shortest wavelengths . In the nanosecond experiment, the increased efficiency of ionization of 266 nm is expected due to the lower number of photons required, and the lower order of the expected multiphoton ionization mechanism. However, even though the thresholds are higher, the same order of nonlinear process is found for the longer wavelengths – this may be explained by relatively increased efficiency above that expected due to resonances with dissociative states or states in the neutral or ionized fragments. In the femtosecond experiment, the intensity regime covers values of the Keldysh parameter ranging from roughly γ = 1 to γ = 0.2 (solidly in the strong-field regime of over-the-barrier ionization). This results in entirely different fragmentation patterns. In particular, the difference is the lower amount of fragmentation, which may be useful if selective bond breaking is the goal, for example C-C bond breakage may yield CH
Apis mellifera (Hymenoptera: Apidae), vitellogenin has recently attracted much interest as this protein, in addition to a classical function in oocyte development in the reproductive queen caste, has evolved functions in the facultatively sterile female worker caste not documented in other species. However, research on the spatial dynamics of vitellogenin in various tissues is not easily performed with available tools. Here we present an immunogold staining procedure that visualizes honeybee vitellogenin in resin embedded tissue. To establish the protocol, we used ovaries of worker bees from colonies with and without a queen. Under the first condition, vitellogenin is assumed not to be present in the workers' ovaries. Under the second condition, the ovaries of worker bees become vitellogenic, with abundant opportunities for detection of complex patterns of vitellogenin uptake and storage. By use of this experimental setup, the staining method is shown to be both sensitive and specific. To demonstrate the functional significance of the protocol, it was subsequently used to identify vitellogenin protein in the hypopharyngeal glands (brood food producing head glands) of nursing worker bees and in adjacent head fat body cells for the first time. Localization of vitellogenin in these tissues supports previously hypothesized roles of vitellogenin in social behavior. This protocol thus provides deeper insights into the functions of vitellogenin in the honeybee.Vitellogenin is a yolk precursor protein in most oviparous females. In the advanced eusocial honeybee, Apis mellifera) has only one yolk precursor protein, which is a very high-density lipoprotein with a molecular weight of 180 kDa .Vitellogenin has been thoroughly studied in the context of oocyte maturation . The rec2O) before the 180 kDa vitellogenin band . Eggs were gathered and pooled, 800 eggs per ml 50 mM Tris buffer, pH= 7.1. The samples were sonicated, homogenized and boiled for 2 minutes under non-reducing conditions (without DTT) before they were separated on 7% SDS-PAGE gels. Gels were stained briefly with Servablau W at adult emergence and introduced into colonies with and without a queen in an apiary at University of California, Davis. After 10–15 days, marked workers were collected and anesthetized on ice before ovaries were dissected and classified according to ovarian developmental stage: 1, previtellogenic non-activated ovary; 2, previtellogenic activated ovary; 3, vitellogenic ovary with developing oocytes; 4, mature ovary with at least one egg, as previously described by Hartfelder and co-workers and modiwww.sigmaaldrich.com) until further processing.To obtain samples of head tissues including hypopharyngeal glands for immunohistochemistry, newly emerged workers were marked with a spot of paint and introduced into colonies with a queen in the apiary of the Norwegian University of Life Sciences, Aas. After 8 days, marked workers presumably engaged in nurse tasks were collected by gathering marked bees with their heads and thoraxes in cells containing larvae. The heads of the bees were stored at 4°C in 0.1 M HEPES buffer supplemented with 0.2% Triton X-100 for 12 hours at room temperature. Fixed tissue was thoroughly washed in 0.1 M PIPES buffer (Sigma-Aldrich) before dehydration in an ethanol series , each step for 15 min. After dehydration the tissues were infiltrated with a graded series of London Resin-White and polymerized over night at 6o°C. For conventional light microscopy and immuno labeling, semi-thin sections (1–2 μm) were cut with a diamond knife on an ultramicrotome and dried onto SuperFrost©Plus slides .Ovaries and heads were fixed in 4% formaldehyde solution over night at 4°C. The sections were washed 4 × 15 min with PBS and 4 × 15 min with distilled water before enhancing withsilver adjusted from Holgate et al. , etched with 0.2% Hfer only –3 or witfer only –5 and 7.e et al. , see Mile et al. for furtAll sections were counterstained with Stevenel's blue before they were mounted in DePex (Electron Microscopy Sciences) and examined by a Leitz Aristoplan light microscope. Stevenel's staining solution is a polychromophore that stains all tissues , which iwww.bioexpress.com). Separated proteins were transferred to nitrocellulose paper, incubated in polyclonal antibody against vitellogenin , visualized by horse radish peroxidase conjugated secondary antibody (1:150) (Amersham) and developed by chemiluminescence .Queen ovaries, abdominal fat body and head fat body tissue were thoroughly washed in a 5 times repeated wash cycle, homogenized and centrifuged in Tris-buffer supplemented with proteinase inhibitors (see above). Hypopharyngeal glands were pooled in replicate from 40 individual nurse bees and 40 individual foragers before washing, homogenization and centrifugation. The supernatants were subjected to one dimensional SDS-electrophoresis using 10% polyacrylamide gels compared to queens (180–200 ovarioles), the data confirmed that development of worker oocytes corresponds to the process reported for queens . SpecifiHigher magnification images of vitellogenic oocytes seem to visualize import of vitellogenin , and is After validating the staining method –4, it wavitellogenin mRNA . The presence of head fat body cells in honeybee workers, queens and drones was documented previously by Snodgrass system close to the brain, and thereby the social behavior of worker bees . As yet f adults , and thef adults . In honeNote that during the development of the protocol, it was found that optimal temperature and time for exposure to the silver enhancement step is critical for the immunogold procedure (see Methods). The efficiency of this step is sensitive to ambient temperature, and care must be taken to obtain a particle size that is adequate for observation in light microscopy. Overexposure leads to precipitation of silver that covers the tissue and obscures positive signals. Underexposure leads to small particles that are incompatible with bright field detection at lower magnifications. In this context, it is useful to note that dark field detection is less sensitive to particle size than bright field detection. As a rule, dark field is a valuable tool for detection of low density staining at lower magnifications (16 × 40 ×), whereas bright field detection is more than adequate at higher magnifications (63 x- 100 x) i.e. .A major advantage of immunohistochemical methods is that they are relatively easy to replicate once a protocol has been established i.e. . This ro
To find mRNAs whose expression differs between thyroid follicular adenomas and carcinomas, a high-throughput analysis of mRNAs in these two tumours was performed. This method, named high-throughput differential screening by serial analysis of gene expression (HDSS), combines a modified method of serial analysis of gene expression (SAGE) and real-time quantitative reverse transcription polymerase chain reaction (RT–PCR). A total of 40 candidate tag sequences that showed extremely different expression levels between a follicular carcinoma and a follicular adenoma in the SAGE analysis were analysed by real-time quantitative RT–PCR, using RNAs from an additional four typical follicular carcinomas and adenomas. One sequence tag that represents trefoil factor 3 (TFF3) mRNA showed a clear difference in its expression level between adenomas and carcinomas. The expression levels of TFF3 mRNA in 48 follicular adenomas and 29 follicular carcinomas were measured by real-time quantitative RT–PCR using a specific probe for TFF3. They were significantly decreased in follicular carcinomas, especially in widely invasive types and those with evident metastases. These results indicate that the decreased expression of TFF3 mRNA is a marker of follicular carcinomas, especially those with a high risk of invasion or metastasis. Modern advances in molecular technology have given us the chance to establish new strategies in diagnosing cancer. In order to implement such molecular-based technology, it is crucial to identify a distinct difference between benign and malignant cells . ThyroidIn the light of this, we developed a new method of preoperative molecular-based diagnosis of malignant tumours, named aspiration biopsy RNA diagnosis (ABRD), which utilises extracted RNAs from leftover cells within the needle used for FNAB for reverse transcription–polymerase chain reaction (RT–PCR) analysis , 2000a.Follicular carcinoma of the thyroid is a relatively uncommon malignancy and it accounts for about 15% of all thyroid cancer. One of the most difficult distinctions in thyroid pathology is the differentiation between benign follicular adenoma and the encapsulated low-grade follicular carcinoma called minimally invasive carcinoma. The principal differentiating feature is capsular invasion. Even this, however, may not be definitive, because a slight capsular penetration can also be observed in benign tumours. Further, both types of tumours have varying degrees of cellular atypia, and extensive invasion into vascular spaces is not usually observed in minimally invasive carcinomas. Preoperative diagnosis of follicular carcinoma is even more difficult, since the feature that separated the benign and malignant follicular tumours is the presence of capsular invasion, which is not possible to determine cytologically .A promising tool for solving this problem is molecular-based diagnosis, such as ABRD. However, at present, ABRD cannot be applied to the preoperative diagnosis of follicular carcinomas because no mRNAs that distinguish adenomas from carcinomas have been reported so far. By relying on 14–15 base cDNA sequences for gene identification, serial analysis of gene expression (SAGE) can generate a quantitative transcript profile easily, a task currently not possible using alternative transcript imaging technologies , 75 mM KCl, 10 mM dithiothreitol, 3 mM MgCl2, 0.5 mM dNTPs, 200 U M-MLV reverse transcriptase , 2 U μl−1 RNase inhibitor , and 2.5 μM oligo dT (Gibco) in a total volume of 20 μl at 37°C for 60 min.Reverse transcription was performed using either 1 μg of total RNA from a follicular adenoma and a widely invasive follicular carcinoma were used for the construction of gene expression profiles. Modified SAGE was performed as described previously using the ABI PRISM 7700 Sequence Detection System was performed as described previously (μM): 5′-AATGCACCTTCTGAGGCACCT-3′ (base 265–285); TFF3R (0.5 μM): 5′-CGTTAAGACATCAGGCTCCAGAT-3′ (base 414–436); and TFF3-TM (10 pmol): 5′-FAM-CATCTCAGCTTTTCTGTCCCTTTGCTCCC-TAMRA-3′ (base 359–387); ACF (0.5 μM): 5′-TGGACATCCGCAAAGACCTG-3′ (base 901–920); ACR (0.5 μM): 5′-CCGATCCACACGGAGTACTT-3′ (base1047–1066); and AC-TM (10 pmol): 5′-FAM-CACCACCATGTACCCTGGCATTGCC-TAMRA-3′ (base 947–971), respectively. The conditions for the TaqMan PCR were as follows: 95°C for 10 min and 40 cycles of 95°C for 15 s and 60°C for 1 min. Recombinant pGEM Easy T-Vectors containing either TFF3 or β-actin cDNA were constructed by PCR-cloning with the same set of primers used in TaqMan PCR and were used as standard samples.TFF3F , according to the manufacturer's instructions. For the generation of the sense and antisense probes of the TFF3 sequence, a sequence of human TFF3 cDNA (base 100–359) obtained from a thyroid tissue was subcloned into pGEM Easy plasmid.U-test. P's of <0.05 were considered significant.Statistical analysis of differences between the groups was carried out using the Mann–Whitney β-actin mRNA. TFF3 mRNA was abundantly expressed in normal thyroid tissues, adenomatous goitres, and medullary carcinomas, whereas decreased expression was observed in follicular adenomas, follicular carcinomas, and especially in papillary and anaplastic carcinomas the primer sets amplify different cDNA from that detected in the SAGE analysis, or (2) real-time RT–PCR is less sensitive than SAGE in the detection of the different expression levels of each gene, thus, differences between those genes whose expression differs slightly can be detected by SAGE but not by real-time RT–PCR. Among the 26 primer sets that proceeded to the second screening, only a primer set to amplify TFF3 cDNA showed a clear difference between adenomas and carcinomas. It is not likely that this fact indicates the limitation of HDSS as a tool for the rapid differential screening of mRNA. Rather, considering the fact that no mRNAs that distinguish follicular adenoma and carcinoma have been reported, there is probably a rarity of differentially expressed genes between follicular adenomas and carcinomas.Using HDSS, we detected TFF3 as a differentially expressed gene between follicular adenomas and carcinomas. In a recent study using DNA arrays, The reason for the differential expression of TFF3 in follicular adenomas and carcinomas is not clear. Normal thyroids, adenomatous goitres and medullary carcinomas overexpress TFF3 mRNA. As these tissues are known to produce hormones, such as T3, T4 and calcitonin, the TFF3 peptide might play some roles in hormone secretion in the thyroid; thus, TFF3 mRNA can be regarded as a marker of cell differentiation.Pathological diagnosis of follicular carcinoma is quite difficult and it usually requires a demonstration of vascular or full-thickness capsular invasion in a surgical specimen. In fact, in many cases, discrepant diagnoses are made by different pathologists. Further, by classification of WHO, which does not refer to the biological characteristics of the tumour cells but only to the minute sign of invasion, it is not surprising that a considerable number of ‘biological’ follicular carcinomas are diagnosed as ‘pathological’ follicular adenomas. However, to what extent this has happened is quite difficult to estimate because evident malignant features of follicular carcinoma such as distant metastasis often appear many years after surgery. Thus, some kind of objective molecular criteria that distinguish benign and malignant follicular tumours, which reflect the biological characteristics of the tumour cells, are necessary for making more correct diagnoses. Differentially expressed mRNAs between follicular adenomas and carcinomas can be a good indicator in such molecular-based classification.The expression of TFF3 mRNA is decreased significantly in follicular carcinomas compared with follicular adenomas. Eight definite carcinomas with wide invasion or distant metastasis showed greatly decreased expression. These results indicate that the decreased expression of TFF3 is closely related to the malignant features of follicular cells. Interestingly, as shown in in situ hybridisation study since both tumour cells showed a positive staining of TFF3 mRNA (data not shown). These results were not surprising, however, since even in widely invasive follicular carcinomas, TFF3 mRNA was expressed at almost the same level as β-actin mRNA. This fact suggests that the use of TFF3 mRNA or peptide in the diagnosis of follicular tumours by morphological methods, such as in situ hybridisation or immunohistochemistry, might be difficult, although in some cases, modifications of the methods to reduce the sensitivity might work.In our preliminary study, differentiation of follicular adenomas from follicular carcinomas was not possible by the et al. measured the expression levels of telomerase reverse transcriptase (hTERT) in follicular tumours and showed that this method was to some extent useful in diagnosing follicular carcinomas, although they also described interference due to contamination by lymphocytes, which expressed a considerable copy number of hTERT mRNA (et al reported some promising data in which PAX8-PPARγ1 fusion mRNA and protein were detected in 60% of thyroid follicular carcinomas but not in follicular adenomas, papillary carcinomas, or multinodular hyperplasias. However, because their study employed only a small number of follicular carcinomas, additional examination is necessary (Several trials have been performed to diagnose follicular carcinomas preoperatively, but unfortunately most of them were not satisfactory for clinical use. A recent study showed the usefulness of immunohistochemical study of galectin-3 for the diagnosis of thyroid follicular carcinoma (
Dendritic cells (DC) linking innate and adaptive immune responses are present in human lungs, but the characterization of different subsets and their role in COPD pathogenesis remain to be elucidated. The aim of this study is to characterize and quantify pulmonary myeloid DC subsets in small airways of current and ex-smokers with or without COPD.Myeloid DC were characterized using flowcytometry on single cell suspensions of digested human lung tissue. Immunohistochemical staining for langerin, BDCA-1, CD1a and DC-SIGN was performed on surgical resection specimens from 85 patients. Expression of factors inducing Langerhans-type DC (LDC) differentiation was evaluated by RT-PCR on total lung RNA.Two segregated subsets of tissue resident pulmonary myeloid DC were identified in single cell suspensions by flowcytometry: the langerin+ LDC and the DC-SIGN+ interstitial-type DC (intDC). LDC partially expressed the markers CD1a and BDCA-1, which are also present on their known blood precursors. In contrast, intDC did not express langerin, CD1a or BDCA-1, but were more closely related to monocytes.Quantification of DC in the small airways by immunohistochemistry revealed a higher number of LDC in current smokers without COPD and in COPD patients compared to never smokers and ex-smokers without COPD. Importantly, there was no difference in the number of LDC between current and ex-smoking COPD patients.In contrast, the number of intDC did not differ between study groups. Interestingly, the number of BDCA-1+ DC was significantly lower in COPD patients compared to never smokers and further decreased with the severity of the disease. In addition, the accumulation of LDC in the small airways significantly correlated with the expression of the LDC inducing differentiation factor activin-A.Myeloid DC differentiation is altered in small airways of current smokers and COPD patients resulting in a selective accumulation of the LDC subset which correlates with the pulmonary expression of the LDC-inducing differentiation factor activin-A. This study identified the LDC subset as an interesting focus for future research in COPD pathogenesis. Chronic Obstructive Pulmonary Disease (COPD) is characterized by destruction of alveolar walls (emphysema) and obstructive bronchiolitis resulting in a progressive airflow limitation that is not fully reversible . In induDendritic cells (DC) form the crucial link between the innate and adaptive immunity. Immature DC form a network in the different layers of the airway mucosa, specialized in internalizing antigens. Upon recognition of antigen in the context of a pathogen- or damage- associated danger signal, DC undergo a maturation process and migrate towards the draining lymph nodes. Mature DC present the processed antigen on Major Histocompability Complex (MHC) molecules and interact with naïve T lymphocytes to form an immunological synapse, selecting T cells that will target the presented antigen with specialized effector functions. In this key position, DC are able to orchestrate the nature and magnitude of the adaptive immune response to different antigens ,12.Several groups already identified different subsets of DC in the human lung, mainly using antibodies against epitopes also present on circulating blood DC (such as Blood Dendritic Cell Antigen (BDCA) 1-4 and CD11c) -16. HoweEvidence from experimental mouse models suggests a role for DC in the pathogenesis of COPD . RecentlIn this study, we aimed to identify and characterize tissue resident pulmonary LDC and intDC, investigating the interrelationship of different myeloid DC markers such as langerin, BDCA-1, BDCA-3, CD1a and DC-SIGN. In addition, we aimed to quantify immature myeloid DC in small airways of never smokers and smokers with or without COPD, taking into account whether they were current or ex- smokers. Finally, we examined the pulmonary expression of factors such as activin-A , Notch lThis study shows the presence of two segregated myeloid tissue resident pulmonary DC populations: the intDC and the LDC. In the small airways of current smokers without COPD and in COPD patients, there is a selective accumulation of the LDC subset correlating with the pulmonary expression of the LDC inducing differentiation factor activin-A. This evidence is compatible with an altered differentiation process of myeloid DC in the small airways and identifies the LDC as an important focus for future research in COPD pathogenesis.Lung tissue was obtained from surgical lung resection specimens of patients diagnosed with solitary pulmonary tumours at the Ghent University Hospital. Lung tissue at maximum distance from the pulmonary lesion and without signs of retro-obstructive pneumonia or tumour invasion was collected by a pathologist. None of the patients operated for malignancy were treated with neo-adjuvant chemotherapy. Lung tissue from end-stage COPD was obtained from explant lungs from patients undergoing lung transplantation . The study population from which tissue was obtained partially overlaps with and extends the one described in our previous study . All patBetween the year 2002 and 2008, small tissue blocks from the peripheral lung tissue of 85 patients were stored for immunohistochemical analysis. Samples were immediately placed in OCT , snap-frozen in liquid nitrogen cooled isopentane and stored at minus 80° Celsius. Other samples from the same specimen were fixed in paraformaldehyde 4% during 12 hours and embedded in paraffin wax. In 44 of the 85 patients, RNA was extracted from a part of the resection specimen which was stored in RNA stabilizing agent at minus 80° Celcius. At the moment of designing the PCR experiments in total lung RNA, a set of 11 RNA samples from new subjects was additionally included.In a separate study, the lung tissue sample from 6 individual cases (included in 2008-2009) was processed to obtain single cell suspensions for flowcytometry as described previously . There wFlowcytometric data acquisition was performed on a FACS Calibur equipped with 488 and 633 nm lasers and running Cellquest Software . Flowjo software was used for data analysis .7 μm thick cryosections were cut on poly-L-lysine-coated microscopic slides . Sections were dried for 24 hours and stored at minus 80° Celsius until use. Prior to the immunohistochemical procedure, cryosections were defrosted to room temperature, dried and fixed in aceton for 10 minutes. After fixation, tissue sections were rinsed with phosphate-buffered saline .Sections were incubated with mouse anti-human monoclonal antibody directed against BDCA-1 (AD5-8E7) following incubation with normal goat serum . Sections were then incubated with biotinylated goat anti-mouse antibody . Next, sections were incubated with streptavidin alkaline phosphatase . Sections were then rinsed with PBS containing TRIS buffer and incubated with new fuchsine substrate , counterstained with hematoxylin and mounted in Vecta Mount .Aceton-fixed cryosections were stained with mouse anti-human DC-SIGN ((clone DCN46), BD Biosciences, Erembodegem, Belgium) following incubation with blocking reagent . Sections were then incubated with poly-alkaline phosphatase goat anti-mouse . Sections were incubated with new fuchsine with levamisole during 7 minutes, counterstained with Mayer's hematoxylin , rinsed with distilled water and mounted in Aquatex (Klinipath).Immunohistochemical staining for langerin was carried out on cryosections as described previously .For immunohistochemical double staining, aceton fixed cryosections were incubated with blocking reagent (Ultra V Block : Klinipath: TA-125-UB), followed by the first monoclonal antibody or anti human DC-SIGN during 1 hour at room temperature. Sections were then incubated with poly-Alkaline phosphatase stained with new fuchsin as described above. After rinsing, streptavidin/biotin blocking was applied followed by blocking reagent . Sections were incubated overnight with mouse anti-human CD207 diluted in PBS. Sections were rinsed with PBS and incubated with biotinylated goat-anti-mouse IgG1 . Sections were rinsed in PBS and incubated with streptavidin-AP . Finally, sections were stained with Vector Blue diluted in PBS with 0.3% Triton at pH 8.2 combined with levamisole. After terminating the staining process with PBS with 0.3% Triton at pH 7.5, sections were rinsed with distilled water and covered with Aquatex as described above.3 μm thick paraffin embedded sections were cut on poly-L-lysin coated slides. After dewaxing with Ultra Clear and rehydration, antigen retrieval was performed using preheated Citrate buffer pH 6.0 10% at 78°C. After blocking of endogenous peroxidase activity with 3% hydrogen peroxide and application of blocking reagent 1% in PBS with 0.3% Triton, sections were incubated with mouse anti-human CD1a monoclonal antibody followed by incubation with biotinylated link antibody and application of streptavidin-HRP . Slides were rinsed in PBS containing 0.3% Triton. Finally, diaminobenzidine substrate was added for 30 minutes, sections were rinsed in demineralised water, counterstained with Mayer's hematoxylin , dehydrated and mounted in DPX .Immunohistochemical staining for for Activin-A was also performed on paraffin-embedded sections, using the same dewaxing and rehydration protocol as described above. Antigen retrieval was performed using EDTA-buffer. After blocking for endogenous peroxidase activity and application of Fc block, slides were incubated with anti-human Activin-A ((Clone E4) ABD Serotec, Kidlington, United Kingdom) during 12 h at 4°C. Next, sections were further stained as described in the protocol for CD1a.For each primary antibody used, appropriate isotype control stainings were performed.Images of tissue sections were recorded using a computerized image analysis system . Airways without cartilage that had a perimeter of the basement membrane of less than 6000 μm were selected for analysis . The arehttp://medgen.ugent.be/~jvdesomp/genorm/[Total lung RNA was extracted with the RNeasy Mini Kit . RNA quality was checked on a bioanalyser and samples with an RNA-integrity number (RIN) below 5.5 were excluded from the analysis. Subsequently cDNA was obtained by reverse transcription of RNA with the Transcriptor First Strand cDNA synthesis kit following manufacturer's instructions and using a 2:1 ratio of hexa:oligodT primers. Expression of target genes Activin A (Inhibin beta A), RANKL, Notch Ligand Delta-1 and IL-15 and reference genes GAPDH , HPRT1 (hypoxanthine phosphoribosyltransferase 1) and PPIA (peptidylprolyl isomerase 1) mRNA was analysed with the TaqMan Gene Expression Assays . Real-time PCR reactions were performed in duplicate using diluted cDNA template and the LightCycler480 Probes Master . A standard curve derived from the serial dilutions of a mixture of all samples was included on each plate. Amplifications were performed on a LightCycler480 detection system with the following cycling conditions: 10 min incubation at 95°C and 50 cycles of 95°C for 10 sec and 60°C for 15 sec. Data were processed using the standard curve based method. Expression of target genes was corrected by a normalisation factor that was calculated based on the expression of three reference genes , using the geNorm applet according to the guidelines and theoretical framework previously described p/genorm/ In 44 paStatistical analysis was carried out in SPSS 16.0 . When evaluating differences in continuous variables between multiple independent groups, the Kruskal-Wallis test was used. Where values of probability were <0.05, selected pairs of groups were investigated by the Mann-Whitney U test. Correlation coefficients were calculated using Spearman's rank method. Linear regression analysis was performed on log-transformed data, using the enter method. P values < 0.05 were considered significant.Figure LDC and intDC were consistently identified as two separate populations figure . A largeImmunohistochemical double staining on cryosections of lung resection specimens confirmed the segregation of LDC and intDC, the former mainly present in the epithelium, the latter in the lamina propria and the adventitia figure . Double IntDC showed a completely different expression profile compared to LDCs. Representative histograms comparing the expression profile on LDC and intDC are shown in figure Both intDC and LDC expressed BDCA-3 on flowcytometric analysis, which is the previously described marker for the pulmonary myeloid DC type 2 subset . HoweverTable Figure Representative cryosections showing langerin+ DC are displayed in figure s -0.39; p < 0.001), lamina propria , adventitia and total airway wall . This association between FEV1 (% predicted) and the number of langerin+ DC in the small airways remained significant, even after adjustment for possible confounders by linear regression analysis and in the epithelium (p = 0.062) compared to ex-smokers without COPD. When the number of cells in the epithelium was expressed per unit of length of the basement membrane, significantly higher numbers were observed in the epithelium of current smokers compared to ex-smokers without COPD (p = 0.012) (data not shown). In addition, the number of langerin+ DC was significantly higher in the lamina propria and adventitia of current smokers without COPD compared to never smokers (p = 0.008 and p = 0.033). There were no significant differences between never smokers and ex-smokers without COPD in any layer of the small airway. Importantly, there were also no differences between current and ex-smoking COPD GOLD stage I/II. There were significant negative correlations between the forced expiratory volume in 1 second (FEV1) % predicted and the number of langerin positive cells in the epithelium , lamina propria , adventitia and total airway wall . The association between FEV1 (% pred) and the number of BDCA-1 positive DC in the small airways was investigated by linear regression analysis .Importantly, there was a trend towards an inverse correlation between the number of langerin+ DC in the total airway wall and the number of their known BDCA-1+ precursors: involved in LDC differentiation and survival are shown in figure This is the first study characterizing langerin+ Langerhans-type and DC-SIGN+ interstitial type DC as two separate populations in single cell suspensions of digested human lung tissue. Moreover, the extensive immunohistochemical study showed a selective accumulation of the LDC subset in small airways of current smokers and COPD patients, which correlated with its differentiation factor Activin-A. These data suggest a role for the LDC subset in the initiation of airway inflammation in susceptible smokers and perpetuation of this destructive process in COPD, even after smoking cessation.Flowcytometric characterization of the segregation of LDC and intDC was confirmed in small airways using immunohistochemical double staining, which also showed that LDC are mainly present in the epithelium, whereas intDC are mainly localized in the lamina propria and adventitia. These findings are parallel to the known distribution of these two DC subsets in human skin .A schematic overview of the interrelationship between different pulmonary myeloid DC markers is provided in figure In contrast, pulmonary intDC do not express BDCA-1 and CD1a, indicating that these DC are in a separate differentiation axis, more closely related to monocytes and macrophages, as hypothesized previously .Although BDCA-3 can be expressed at an intermediate level on both the mDC1 related LDC and on intDC, BDCA-3 high expression is confined to a separate population of DC, that does not express BDCA-1, langerin, DC-SIGN or the pDC marker BDCA-2. This separate BDCA-3 high DC population could be regarded as a more accurate definition of the previously described myeloid DC type 2 (mDC2) . It is uA recent study by Tsoumakidou et al addressed the issue of different myeloid DC subsets in human lung digests by immunocytochemical staining of in vitro adhered pulmonary cells . The tarImportantly, the relative proportions of different DC subsets differ, depending on the technique used for quantification. As lung digests contain cells from the different compartments of the lung specimen , the proportion of DC markers which are both expressed on circulating blood DC and tissue resident DC (such as BDCA-1) is generally higher compared to the tissue resident DC markers langerin and DC-SIGN in flowcytometric experiments. In contrast, when the focus is strictly on the small airway , the tissue resident DC markers outnumber the BDCA-1 positive DC.The immunohistochemical study of the different myeloid DC subsets in the small airways revealed a shift of the myeloid DC population towards a Langerhans phenotype with higher numbers of LDC in COPD patients compared to never smokers and ex-smokers without COPD. Moreover, the number of LDC further increased with the severity of the disease, confirming the results of our previous observations . In accoQuantification of BDCA-1 positive DC revealed a completely different result with a significantly lower number of these DC in COPD patients compared to never smokers, especially in the lamina propria. Moreover, the number of BDCA-1+ DC further decreased with the severity of the disease. In line with the results of Soler et al , we founQuantification of CD1a, a marker present on both the BDCA-1+ precursors of LDC and on a subset of LDC, showed no differences between groups, indicating that smoking or COPD does not alter the number of CD1a positive DC in the small airways. These data confirm and extend the data of Soler et al in bronchiolar epithelium of smokers and non-smokers , and theTo our knowledge, this is the first study evaluating the number of IntDC in small airways of smokers and COPD patients. Importantly, our study showed no significant differences in numbers of intDC in small airways between groups.Taken together, these data suggest an alteration of the differentiation process of myeloid DC in small airways of COPD patients resulting in a selective accumulation of the LDC subset. The predominant accumulation of LDC in COPD patients is an important finding, as LDC are known to be potent activators of T helper1 cells and cytotoxic T cell responses, both involved in COPD pathogenesis . FreemanMultiple factors such as chemokines and cytokines expressed by the airway epithelium, stromal cells and inflammatory cells under the influence of cigarette smoke and microbial stimuli can modulate the influx of DC precursors, their differentiation towards a certain phenotype and their capability to mature. It is also possible that in vivo, cigarette smoke could directly modulate certain DC functions. Previously, we reported an activation of the CCL-20/CCR6 axis in COPD which contributes to the influx of CCR6 expressing myeloid DC . MonocytRecently, other factors capable of inducing LDC differentiation and survival such as activin-A, notch ligand delta-1, RANK-ligand and IL-15 were identified in vitro and in the human skin. This study identifies pulmonary expressed activin-A as the differentiation factor correlating with the accumulation of LDCs in the small airways, highlighting its importance especially in current smokers. In addition, we describe for the first time the expression of activin-A in the small airways of human lungs, especially in the area that contains the highest concentration of langerin positive cells: the airway epithelium. Activin-A is a TGFβ superfamily member known for its activity on growth and differentiation of various cell types during organogenesis, and for its role in wound healing and inflammation . Apart fThere are several factors that strengthen this study. First of all, this study is, to our knowledge, the largest study (85 patients) addressing the quantification of myeloid DC in human lungs, using different markers and taking into account not only the disease-effect (COPD), but also the current smoking effect. Secondly, as COPD is defined as a small airway disease, assessing the number of DC in this location yields more relevant results compared to endobronchial biopsies, which only sample the central airways. Thirdly, the interrelationship of the different myeloid DC markers was elucidated by flowcytometry and crucial segregations were confirmed on immunhistochemical staining. Finally, this study provides insight in new mechanisms that contribute to the alterations in the composition of the DC population in the small airways.However, there are also several limitations to this study which should be addressed.Firstly, tissue was obtained from surgical resection specimens from patients undergoing thoracotomy for solitary pulmonary lesions. In theory, the presence of this pathologic lesion could influence the number of DCs in the small airways. However, samples were obtained at maximum possible distance of this lesion, assuring the absence of retro-obstructive pneumonia or tumour invasion. Moreover, all groups, except GOLD stage III&IV contained patients with these lesions, minimizing their influence.1 were not influenced by adjusting for gender in the linear regression model, suggesting that our findings regarding LDC and BDCA-1 DC are not due to gender differences between groups.Secondly, the difference in gender ratio between the study groups could influence the results of this study. Recent publications suggest indeed a role for sex and gender in the susceptibility and pathogenesis of COPD . However1, even after adjustment for possible confounders such as the treatment with inhaled and oral corticosteroids. In contrast, we found that FEV1 was no longer associated with the number of BDCA-1 positive DC in lamina propria of the small airways when the treatment with corticosteroids was taken into account, suggesting that the lower number of BDCA-1 positive DC observed in COPD patients could at least be partially attributed to the treatment with corticosteroids, as these medications are mainly prescribed in the more severe stages of COPD.Thirdly, the use of inhaled and systemic corticosteroids, especially in the most severe stages of COPD, could influence the DC numbers and differentiation. Indeed, several studies reported a decrease of circulating myeloid BDCA-1+ DC in patients treated with systemic corticosteroids ,50. MoreFinally, identification of DC using immunohistochemical staining for a single marker is hazardous as some markers are also expressed on other cell types. For instance, BDCA-1 is also expressed on B cells, whereas DC-SIGN expression is also reported on macrophages. Therefore, only cells with a morphology compatible with a DC were regarded as positive cells.This flowcytometric and immunohistochemical study characterized for the first time pulmonary Langerhans-type DC, which are related to their known BDCA-1+ precursors and which are segregated from interstitial-type DC. In addition, we showed that DC differentiation is altered in small airways of current smokers and COPD patients with a selective accumulation of the Langerhans-type DC, correlating with the expression of Langerhans-type DC-inducing differentiation factor activin-A. This study identified the Langerhans-type DC subset as an interesting focus for future research in COPD pathogenesis.The authors declare that they have no competing interests.GRVP carried out the design and coordination of the study, performed flowcytometric analyses, carried out the immunohistochemical stainings for langerin, CD1a and DC-SIGN, quantified all immunohistochemical stainings, participated in the RNA extraction and RT-PCR, performed all statistical analysis, interpreted the data and drafted the manuscript. KRB participated in the RNA extraction, carried out the RT-PCR and helped to draft the manuscript. IKD participated in the design and coordination of the study, participated in the immunohistochemical stainings, helped to interpret the data and critically revised the manuscript. KDR participated in the quantification of the immunohistochemical staining and critically revised the manuscript. SMR participated in the immunohistochemical staining (BDCA-1) and critically revised the manuscript. CMVD critically revised the paper. GMV participated in the coordination of the study and critically revised the paper. FEV participated in the coordination of the study and critically revised the paper. GFJ participated in the coordination of the study, helped to interpret the data and critically revised the paper. GGB conceived the design of the study, participated in the coordination of the study, helped to interpret the data and helped to draft the manuscript. All authors read and approved the final manuscript.
The association between baseline seropositivity to human adenovirus (HAdV) type 5 and increased HIV acquisition in the Step HIV Vaccine Study has raised questions concerning frequency of acquired and/or persistent Adenovirus infections among adults at high risk of HIV-1 infection.To evaluate the frequency and pattern of HAdV shedding from the lower GI tract, we retrospectively tested rectal swabs for HAdVs in a cohort of 20 HSV-2 positive HIV-positive Peruvian men who have sex with men (MSM) undergoing rectal swabbing three times/week for 18 consecutive weeks, in a prospective study of HSV-2 suppression in HIV infection. Viral DNA was extracted and amplified using a sensitive multiplex PCR assay that detects all currently recognized HAdV types. Molecular typing of viruses was performed on selected samples by hexon gene sequencing. Baseline neutralizing antibody titers to HAdVs −5, −26, −35 and −48 were also assessed.15/20 individuals had HAdV detected during follow up. The median frequency of HAdV detection was 30% of samples (range 2.0% to 64.7%). HAdV shedding typically occurred on consecutive days in clustered episodes lasting a median of 4 days (range 1 to 9 days) separated by periods without shedding, suggesting frequent new infections or reactivation of latent infections over time. 8 of the 15 shedders had more than one type detected in follow-up. 20 HAdV types from species B, C, and D were identified, including HAdV-5, −26 and −48, HAdV types under development as potential vaccine candidates. 14/20 subjects were seropositive for HAdV-5; 15/20 for HAdV-26; 3/20 for HAdV-35; and 2/20 for HAdV-48. HAdV shedding did not correlate with CD4 count, plasma HIV-1 viral load, or titers to HAdV-5 or HAdV-35. The sole individual with HAdV-5 shedding was HAdV-5 seropositive.HAdV shedding was highly prevalent and diverse, including types presently under consideration as HIV vaccine vectors. Subclinical HAdV infection of the GI tract is common among MSM in Peru; the prevalence of HAdV in the enteric tract should be evaluated in other populations. The association between ongoing recent enteric HAdV and the immune response to recombinant HAdV vaccines should be evaluated. Human adenoviruses (HAdVs) are non-enveloped, moderate-sized DNA viruses that cause asymptomatic infection and clinical syndromes, including upper respiratory tract infection, conjunctivitis, gastroenteritis, infections of the urinary tract, and serious systemic infections in immunocompromised individuals HAdVs have been widely explored as vector systems for the delivery of therapeutic and immunogenic gene products because of their ability to infect a range of mammalian host cells, their capacity to accommodate substantial genetic inserts, and their generally favorable safety profile. HAdV type 5 (HAd-5) has been most extensively investigated for applications in gene therapy. In the past ten years, recombinant HAdVs, including type 5, have also been used as vectors in the development of vaccines against several human pathogens, including human immunodeficiency virus (HIV)Recent studies have indicated that pre-existing humoral immunity to HAdV-5 is associated with reduced immunogenicity to vaccination with recombinant Ad5 vaccines. In the Step Vaccine Study, a phase II test-of-concept study trial of the Merck HIV-1 gag/pol/nef vaccine, men who have sex with men (MSM) with previous exposure to HAdV-5 through natural infection appear to have had at least transiently increased risk of acquiring HIV after vaccination Several HAdV types, including HAdV-5, −26, −35 and −48 are presently under active investigation for use as novel HIV, malaria and TB vaccine vectors The human experimentation guidelines of the US Department of Health and Human Services and the individual institutions were followed in the conduct of the clinical research. The institutional review boards of the University of Washington and the Asociación Civil Impacta Salud y Educación approved the protocol. Participants provided written informed consent and were compensated for travel and related expenses.We retrospectively examined genital and anoscopy swab samples obtained from a cohort study of twenty HIV positive MSM in Lima, Peru participating in a prospective randomized, placebo-controlled cross-over study to determine the effect of HSV-2 suppression with acyclovir on plasma HIV levels Study subjects returned to the clinic 3 times per week for a total of 18 weeks. Swabbing of the anal and genital regions for viral pathogens was performed by two methods. Rectal mucosal swabbing was performed via anoscopy by placing a sterile Dacron-tipped plastic applicator against the rectal mucosa 3 to 4 cm above the squamocolumnar junction and rotating for approximately 20 seconds. Surface swabbing of the anogenital region was performed by rubbing the swab over the glans and full length of the penis, the scrotum, perianal skin and completed by inserting the swab in the anus and rotating once (360 degrees). Rectal and anogenital swabbing was performed at each clinic visit. To characterize viral shedding between visits, anogenital swabbing was also self-performed by participants at home. Applicator tips were placed in vials containing 1.0 ml proteinase K digestion buffer and stored at −20°C until processing by the laboratory. Home swabs were maintained at room temperature until the nearest clinic visit and then stored as above.DNA was extracted from 200 uL of proteinase K digestion buffer using the QIAamp 96 DNA Blood Kit according to manufacturer instructions and eluted in a total of 100 uL AE buffer. Ten uL of the extract was used to amplify adenoviral DNA using a multiplex PCR assay previously validated to detect 51 recognized HAdV types An aliquot of DNA from all episodes of HAdV was designated for molecular typing based on nested PCR amplification and sequencing of a partial region of the HAdV hexon gene 50 units of pretitered virus in 50 µl was added to each well and incubated for 1 h at room temperature after gentle agitation. Fifty µl of A549 cell suspension was then added to each well and mixed thoroughly. After incubation for 5 days at 37°C in 5% CO2, the plate was stained with crystal violet. The neutralization titer was defined as the highest serum dilution that fully inhibited 4 TCID50 units of virus.Neutralizing antibody titers for prototype HAdVs −5, −26, −35 and −48 were determined using a modified microneutralization assay A total of 969 rectal swabs were obtained . HAdV wa10 HAdV concentration was 4.1/ml buffer (range 2.2–8.3). The pattern of HAdV shedding in all 15 persons in whom virus shedding was detected is shown in 10 copies/ml. CD4 count and plasma HIV-1 load did not differ between participants with and without HAdV shedding . HAdV shedding patterns did not correlate with shedding of HSV2 or cytomegalovirus (CMV), nor with use of oral acyclovir (data not shown).HAdV shedding in the rectal mucosa occurred on 21.1% of days sampled (range 2.6–52.5). Mean logMolecular typing was attempted on a representative subset of samples from each shedder, selected to cover all observed shedding episodes in this cohort (N = 116 samples). Fifty samples could not be definitively assigned to a known HAdV type due to insufficient amplified DNA for sequencing, the presence of a mixed virus infection that could not be resolved or, in a few cases, to significant differences between the sequenced strain and known reference sequences. Among the 56 positive samples successfully sequenced, numerous HAdV types distributed among species B, C, and D were identified . MultiplBaseline serum neutralizing antibodies to HAdV-5, −26, −35 and −48 were assessed in all study participants. Fourteen of 20 individuals (70%) were seropositive for HAdV-5; 15 of 20 (75%) for HAdV-26; three of 20 (15%) for HAdV-35; and 2 of 20 (10%) for HAdV-48 .In this study, we examined the prevalence and shedding patterns of HAdV from the lower gastrointestinal tract of HIV-positive Peruvian MSM through intensive longitudinal sampling over 18 weeks. We observed viral shedding in 75% of study participants, who collectively yielded at least 20 different HAdV types including four potentially new types and two additional variants of type 48. Several previous studies have examined the prevalence of enteric viruses in a variety of populations One striking difference between this report and prior studies is the remarkably high prevalence of HAdV shedding observed in our study. Earlier work has suggested shedding rates ranging from 0–4% in healthy adults and from 0–28% in selected individuals with HIV infection. In contrast, we observed shedding in 75% of study subjects. This large disparity is likely due to the detection methods employed. Few studies have utilized sensitive molecular methods and the frequent sampling entailed in this protocol; past studies have generally relied on electron microscopy, enzyme immunoassays and cytopathogenicity assays for detection of HAdVs, and employed relatively sparse sampling. In our study, HAdV shedding was episodic, occurring on only 30% of days sampled among those excreting virus at any time. It is therefore likely that many instances of viral shedding were missed in studies relying on limited sampling, due to the short duration of viral shedding episodes. We also note that in this study, we have examined HIV-positive persons who might also manifest more frequent or prolonged HAdV reactivity In this study, we have defined several previously underappreciated aspects of enteric HAdV infection, including an extremely high prevalence of viral shedding, a high rate of serological immunity to “rare” serotypes, the frequent occurrence of mixed infections, and several new adenoviral serotypes. The methods used in this study do not permit us to conclusively distinguish between incident infection, persistent infection with intermittent viral reactivation, and passive shedding of viral nucleic acids associated with latently infected cells in the absence of viral replication. However, in several subjects, the presence of discrete shedding episodes with rising and falling viral loads is highly suggestive of active replication. PCR detection of adenovirus from the enteric tract has been shown to correlate with presence of infectious virus in non-human primates and humans This study is limited by modest cohort size, relatively narrow geographical sampling and by the limited serological data presently available. However, our serology results suggest that infection with “rare” HAdVs with and/or without persistent shedding may be more prevalent than previously thought