Datasets:

hatakeyama-llm-team

/

PMC

like 0

Follow

Team Hatakeyama 25

In many low- and middle-income countries, cataract is the leading cause of avoidable blindness among children.1Urgent surgical intervention is necessary if children with cataract are to regain their sight. If children are born with cataracts or if cataracts occur while children are very young, the visual pathways in their brain will not develop normally. Some children may therefore be visually impaired or even blind after their cataracts are removed, especially if there has been a long delay. Fortunately, even if their visual acuity is poor after surgery, most children will regain functional vision; this will enable them to be active and independent.In order to help children make the best use of the vision they have after cataract surgery, follow-up services are essential. Children may need spectacle correction for near and distance vision as well as low vision devices .Ideally, follow-up should continue for a long time, as children's needs for low vision devices will change as they grow older and want to do more visually challenging tasks. It is also important that potential complications such as thickening of the posterior capsule, development of opacity in the visual axis, glaucoma, or retinal detachment are diagnosed and managed in time.In Tanzania, many children are not brought for surgery in a timely fashion and follow up is often poor. Research at Kilimanjaro Christian Medical Centre (KCMC) has shown that girls are more likely than boys to be negatively affected2Only half as many girls as boys received cataract surgery.Girls tended to be brought for surgery later than boys.Girls who did receive surgery were less likely than boys to be brought for the appropriate two-week follow-up visit (36 per cent of girls vs 64 per cent of boys).In order to understand why girls were at such a disadvantage, we looked at gender differences in data we had collected during two qualitative studies in Tanzania. In the first study, we had interviewed 117 parents and guardians of children brought for cataract surgery at KCMC between September 2002 and November 2004; our aim had been to uncover why parents sometimes took a long time to bring children for surgery. In the second study, we had conducted interviews with 22 of these parents or guardians, selected for either making good or poor use of follow-up services, in order to understand why follow-up was often poor.The reasons parents or carers took a long time to bring children for surgery included the following:They did not recognise the disease. Most parents or carers were not aware that a child could have cataract .They could not agree on what to do and/or when to do it.They had fears about cataract surgery based on mistaken beliefs about what it entailed ; they also had concerns about the risks associated with surgery and with the stay at the hospital.They were concerned about costs (direct and indirect) and the distance they would need to travel.In general, the reason parents and carers did not bring children for follow-up was because they did not understand that children, unlike most adults, often need low vision devices or spectacles after cataract surgery. They usually saw some improvement of vision after the intervention, and when children could see enough to function, parents were unlikely to consider it necessary to go back for follow-up (which seemed to be true for girls in particular).When we analysed the results of both studies according to the gender of the parent and the child, we found the following:Fathers (and some mothers) tended to give preference to boys, especially when family resources were scarce.Mothers often did not have the power to make decisions about health care for their children; however, those with higher education levels and more financial independence were more likely to be able to influence decisions.When asked what they would do if they were able to make such decisions, most mothers wanted to treat their children equally or give preference to daughters over sons.In poor or struggling communities, sons are often seen as a source of income and financial security for parents when they get older, whereas girls are seen as a financial burden. This can mean that boys will be more likely than girls to be taken to a clinic for health care.From our gender analysis, it was clear that fathers tended to give priority to boys. Fathers often considered that the boy would be able to contribute to family resources and would, in the future, look after his parents.“[…] the boy will be responsible for his family while the girl may stay at home with her mother. […] I would send the boy (for surgery) because he will be helpful to me in the future but the girl will be married.” However, choosing boys over girls was not exclusive to fathers. Some mothers did not hesitate to expose their preference for ‘investing’ in a son's health rather than spending money on a girl who would eventually get married and leave.“I would send the boy.” Q: Why?A: “Because a boy is more helpful in the society than a girl. ” Many women are still subject to their husbands' will and wait for his permission to access health care and services for themselves and/or for their children.6From the 117 interviews we conducted for the first study, it was clear that mothers' influence over the decision making process was closely linked to whether boys or girls were brought for cataract surgery. Less educated women and women with very limited personal financial resources had less capacity to influence decision making.“I depend on my husband for everything because I am not employed, so I think it is hard to get the money. […] I had to wait for her father to make a decision […] I would have brought her earlier but it is because her father was not ready. ” Our analysis showed that women's level of education, their socioeconomic status, and the decision-making power they had within their household and their community all played a major role in determining whether and when their children would receive cataract surgery and whether they would be taken for follow-up visits.We found that, the more educated the parents were , the higher the chances were that:a child would be brought for surgery in a timely fashiona girl would be brought for surgery (and follow-up), regardless of opposing views from her fathera child would be brought for post-operative follow-up.24Experience in TanzaniaMass media efforts may provide the first opportunity for rural villagers to learn about the need for early referral of young children with vision loss.Many health workers are not familiar with the need for early referral of children with a ‘white pupil’. Brochures and posters have been useful as a continuing medical education tool.Cost (direct and indirect) is often the most important barrier preventing use of surgical services by children. Transport reimbursement (for parents and children) is often essential, particularly for parents living quite far away from tertiary hospitals.Cell phone penetration has grown significantly in many low- and middle-income countries and phone follow-up with parents has proven to be a very useful strategy for reminding parents to bring children for follow-up visits.In addition, there are two strategies that will have a more direct impact on improving access for girls:Evidence suggests that it is helpful to use key informants to identify and refer children who need eye care. More girls are identified this way than when relying on parents alone to recognise the need for surgery.Paediatric ophthalmology tertiary facilities can benefit from having a dedicated childhood blindness coordinator who can provide high quality counselling and support services for parents and guardians. With the help of such a coordinator, parents learn the benefits of early surgery, follow-up, and rehabilitation and become more engaged in the care of their children, particularly girls. Using a tracking form helps the coordinator to monitor follow-up, counselling needs, and patient information efforts. In order to support the coordinator's work, it is important to link clinical services at paediatric ophthalmology units with general ophthalmology units and other eye care providers as well as with educational and rehabilitation services.1KishikiKShirimaSLewallenSCourtrightPImproving postoperative follow-up of children receiving surgery for congenital or developmental cataracts in AfricaJ of AAPOS(in press).

The mechanism of centrosome positioning has remained controversial, in particular the role of microtubule dynamics in it. We re-examined the issue in the experimental model of Jurkat cells presented with a T cell receptor-binding artificial substrate, which permits controlled stimulation and reproducible measurements. Neither 1-µM taxol nor 100-nM nocodazole inhibited the centrosome positioning at the “synapse” with the biomimetic substrate. At the same time, in micromolar taxol but not in nanomolar nocodazole the centrosome adopted a distinct peripheral rather than the normally central position within the synapse. This effect was reproduced in a computational energy-minimization model that assumed no microtubule dynamics, but only a taxol-induced increase in the length of the microtubules. Together, the experimental and computational results indicate that microtubule dynamics are not essential for the centrosome positioning, but that the fit of the microtubule array in the deformed body of the conjugated T cell is a major factor. The possibility of modulating the T-cell centrosome position with well-studied drugs and of predicting their effects T-killer cells of the immune system form conjugates with cells infected by viruses, as well as with tumor cells, and eliminate them via directed discharge of toxic compounds. The directionality is essential for the effectiveness of killing the intended target as well as for sparing healthy bystander cells, i.e. for specificity of cellular immune response The mechanism of centrosome positioning in T cells has not been established. It appears to be a form of rearrangement of the microtubule cytoskeleton. Other types of microtubule cytoskeleton rearrangements, for example during cell division, proceed to a large degree through disassembly and re-assembly of individual microtubules, which are termed microtubule dynamics. Microtubule dynamics is therefore a foremost candidate for the driving force of the centrosome polarization in T cells, or at least for an essential facilitating mechanism. This view has its most direct support in two experimental studies, which uncovered signal transduction pathways in T cells that might lead to promoting, alternatively, microtubule assembly and disassembly In the present work, we have examined the sensitivity of polarization to inhibitors of microtubule dynamics in an experimental model that replaces the target cell surface with the optical glass surface coated with a stimulatory clone of antibodies to the T cell receptor. This experimental model has been widely used in cellular immunology because it permits reproducible stimulation of large numbers of T cells and facilitates microscopy data collection and analysis Experimental observations are further compared in the present work with computational predictions. We have previously been able to explain the polarized location of the centrosome in conjugated T cells as arising from whole-cell structural optimization. The optimality was postulated to be multiobjective, as expressed in the several terms in the empirical energy function that is minimized: The model cell minimizes microtubule bending and cell surface area, while maximizing the area of contact with the target and maintaining the cell volume Jurkat cells were grown and prepared for observation essentially as described before After 40 min of incubation on the coverslips , the cells were fixed for 30 min at room temperature in 4% paraformaldehyde (Sigma), permeabilized in 0.5% Triton (Sigma) for 5 min, and blocked with 10% goat serum . Immunostaining was done with anti-α-tubulin mouse antibody and goat anti-mouse TRITC-conjugated antibody (Zymed). The coverslips were mounted using ProLong mounting medium (Molecular Probes). The samples were observed on a Nikon TE 200 inverted microscope . A planapochromatic 100× oil-immersion objective with numerical aperture 1.4 (Nikon) was actuated by a PIFOC 721 piezo-positioner . Images were acquired using a CARV II spinning-disk confocal attachment (BD Biosciences) and an ORCA II ERG camera . All hardware was controlled by IPLab software , which was also used for image manipulation. Three-dimensional images were acquired at a formal resolution (voxel size) of 0.129, 0.129, and 0.4 µm in the X, Y, and Z dimensions.The cells were scored and classified for the centrosome polarity and centrality by examining the three-dimensional confocal images. The position of the centrosome was determined as the point of convergence of the fluorescent microtubules, usually corresponding to the point of maximum brightness. The cells were considered polarized if they displayed the microtubule aster converging within the bottom 2 µm of the cell, i.e. within 2 µm form the stimulatory substrate effκ and simulated microtubule number Nsim (see below). Our approach is an extension of the microtubule aster optimization method proposed by Holy et al. The method of computational prediction of the T-cell structure used in this work was essentially the same as described earlier The optimization is performed in two stages, due to the limitations of the minimization algorithm. At the first stage, the optimal conformation of the microtubule cytoskeleton, without regard to its orientation as a whole, is found using an energy function that does not incorporate the term that describes the cell-target contact area. At the second stage, conversely, the proper conformation of the microtubule cytoskeleton is kept constant, and its orientation as a whole is found by minimizing the energy function that includes the attachment area term. The two stages of the algorithm may appear to model first a T cell that is freely suspended in the medium and then a T cell that develops contact with the stimulatory substrate. Despite this appearance, breaking down the computation into the two separate stages of finding the conformation and orientation is merely an empirical method of solving the optimization problem specified by our energy-minimization postulate about the T cell structure. This stepwise optimization method allows successful prediction of the structure and orientation of a conjugated T cell X of the direction angles of all microtubule segments . An aster of straight microtubules is used as the starting conformation, randomized by adding a pseudorandom angle between 0 and 0.1 radians to each element in X. The sequential quadratic algorithm of the Matlab Optimization Toolbox is tasked to find X that minimizes the following conformation energy function, cE:At the first stage of the optimization procedure, each microtubule is approximated numerically as a chain of straight, freely jointed segments of equal length and number. The surface of the cell is defined geometrically as the minimum convex hull enclosing all the microtubules. The entire model cell structure is therefore determined by the set −3 is the oncotic pressure characteristic of mammalian tissues eqV = 2.1 pL is the goal cell volume consistent with the characteristic size of the cells in our experiments V(X) is the value of the variable cell volume corresponding in the above geometrical sense to the microtubule conformation specified by X. S(X) is the cell surface area. When multiplied by the leukocyte cortical tension γ = 35 aJ µm−2C(X) is the local curvature of a microtubule, as determined by the microtubule segment directions in X. Squared and summed over all segment joints, then multiplied by the segment length l and by the effective microtubule bending rigidity effκ, it yields the microtubule elastic bending energy. This is the last term of our empirical energy function. l equals the microtubule length L divided by the number of segments into which a microtubule is broken down. This number was selected to be 6 N microtubules by a considerably smaller number of the segment chains in the simulation (Nsim). Each chain has the effective flexural rigidity effκ correspondingly higher than the rigidity of a single microtubule κ:Nsim<N to reduce the number of independent variables (elements in X), which is crucial to the success of the numerical minimization. The approximation of the microtubule cytoskeleton with the smaller number of more rigid chains of segments can be valid if the chains are sufficiently numerous to represent adequately the shapes of all microtubules in the cell (it is assumed that microtubules are not bundled). A numerical test shows that Nsim = 24, which value we employed previously Nsim beyond this number and against the intracellular oncotic pressure (second term) that changes with the cell volume due to impenetrability of the cell boundary to macromolecules. Π = 3.4 fJ µms number . In viewdity see . The MatcS, is determined by projecting the microtubule aster onto the horizontal plane that passes through the aster's lowermost point. The area of the minimal convex polygon enclosing the projection is considered to be the area of contact with the target. The cell surface is then recalculated as the minimum convex hull that encloses this projection (cell contact patch) as well as the microtubule aster (cell body). The cell structure depends now on only two variables, the two rigid-body rotation angles θ and ϕ. The optimal orientation of the aster is found as the θ, ϕ pair that minimizes the following orientation energy function, oE:cS and the mid-range estimate of the two-dimensional energy density of cell adhesion (non-specific plus receptor-mediated), adhγ = −25 aJ µm−2At the second stage of the optimization procedure, the microtubule cytoskeleton conformation that was obtained at the first stage is kept fixed. The contact area with the target, X at the chosen level of numerical approximation of the microtubule cytoskeleton.) Starting from the pseudorandom initial structures, the two-stage algorithm returns predicted cell structures that are non-identical. We consider them all to be alternative predictions of the cell structure, postulating that the origin of individuality of the microtubule cytoskeletons seen in the experiment lies in the existence of multiple energy minima. The outcomes of individual runs of the minimization algorithm are therefore referred to as computational, or predicted, “cells” in this paper.Our minimization algorithm overall remains local because of the local nature of the first stage and the very large number of variables at that stage. by the direction from the cell centroid to the centrosome is called the centrosome orientation angle Following Kuhne et al. At the same time we noticed a novel effect of 1-µM taxol on centrosome positioning. Only about 14% of untreated cells had their centrosomes at the periphery of the area of the cell's contact with the substrate. The same proximity criterion was used to classify the cell as having a peripheral location of the centrosome as for determining the polarization to the substrate: the centrosome's location was called peripheral if it was within 2 µm from the outline of the cell-substrate contact area. In contrast to the small fraction of untreated cells with the peripheral centrosome location, most cells treated with taxol exhibited the peripheral location of the centrosome 40 min after contacting the substrate , Table 1within the synaptic area may normally be under cellular control. Secondly, this perturbation may have direct implications for the therapeutic use of taxol, which will be discussed below.To our knowledge, this effect of taxol on the centrosome positioning in T cells has not been reported before. Re-examination of the published structure of a T-killer cell conjugated with a target cell after taxol treatment To test whether the peripheral centrosome localization was a consequence of inhibiting microtubule dynamics, we determined the centrosome position in cells treated with another microtubule dynamics inhibitor, nocodazole at 100 nM. This treatment did not have any effect either on polarization of the centrosome to the substrate or on the proportion of cells with centrosomes at the periphery of the cell-substrate contact zone , Table 1Although mechanisms of action of microtubule drugs are complicated, it is generally accepted that there is a significant difference between the action of micromolar taxol and nanomolar nocodazole. Micromolar taxol stabilizes microtubules by shifting the assembly-disassembly balance greatly in favor of assembly To determine whether the transition to the preferred peripheral location of the centrosome could be explained by microtubule lengthening by taxol, we resorted to our method of predicting the orientation of the T-cell microtubule cytoskeleton The new predictions of the centrosome orientation at different values of microtubule length and number in the cell are presented in N = 88 microtubules in the cell that are each L = 12 µm long predicts adequately the orientation of the normal (untreated) T cell We have previously found that the numerical optimization condition equivalent, in the terms adopted in the present work, to having The new and more extensive computations reveal a significant second peak in the orientations distribution around 75° . The exiThe prediction departs from the experiment in two ways. First, the relative weight of the two peaks predicted under this number and length of the microtubules deviates noticeably from the experiment. By the number of predicted cells that fall into these peaks, the two subpopulations comprise approximately 62% (the 0° mode) and 38% (the 75° mode). Thus, there are more of the non-central centrosomes in this predicted population than in the actual untreated cell population cf. . FurtherN = 88) only blurs the distinction between the two orientation modes without shifting their relative weight should not be the largest possible increase that could be induced by the taxol treatment. The taxol concentration used is essentially saturating Increasing the microtubule length to 18 µm preserves the dominant 45–90° peak in the centrosome orientation distribution in the range of the microtubule lengths where it was predicted with the 15-µm microtubules, especially in the 200–300 microtubule number range . At the There is a trade-off in the accuracy of the predictions between 200 and 300 microtubules. The tertiary mode of non-polarized (180°) cells is entirely absent with 300 microtubules, as it appears to be in the experiment. Its absence however is achieved at the cost of the cells with their centrosomes oriented to the side (90°) being more numerous than with 200 microtubules . StructuFinally, we illustrate the theoretical explanation of the taxol experiments using the model predictions at 300 18 µm-long microtubules . The peaIn the light of the present model (not implicating the above possibilities that other previously modeled effects might be involved), the mismatch between the model and experiment assuming 15-µm microtubules and the good match between them assuming 18-µm microtubules can be taken to indicate that the microtubule length in taxol-treated T cells exceeds 15 µm and is more likely to be near 18 µm. To arrive at this estimate, the above comparison of the model and experiment can be viewed as data-fitting. The qualitative changes in the shape of the centrosome orientation distribution as the microtubule length is varied continuously are an iN = 88). To test the prediction of the orientational randomization by microtubule shortening, we conducted experiments with nocodazole in micromolar concentrations. In agreement with the previous studies To further validate the ability of the model to predict consequences of microtubule length change, we have calculated the distributions of the centrosome orientation assuming that the microtubules were only 9 µm long (the leftmost column of histograms in The results of our experiments with taxol and nanomolar nocodazole confirm the conclusion from earlier experiments with taxol on primary cytotoxic T-lymphocytes that microtubule dynamics is not required for the immunologically functional orientation of the centrosome in T cells Our experiments reveal a subtler effect of micromolar taxol but not of nanomolar nocodazole on the centrosome positioning in polarized T cells. Micromolar taxol promoted peripheral localization of T-cell centrosomes within the contact zone of T cells with the target surface. It should be emphasized that these centrosomes are still at the interface with the target and are in this sense polarized functionally. At the same time this effect appears potentially very significant in the emerging framework that recognizes T cells as sending spatially differentiated signals to the target and “bystander” cells The results of our computational modeling demonstrate that the effect of taxol on centrosome orientation can be rigorously explained by lengthening of the stabilized microtubules, which is specific to the micromolar taxol Another effect of taxol on microtubules is promotion of acetylation Successful explanation of the subtler effects of experimental treatment on the overall microtubule cytoskeleton structure argues in favor of employing the cell structure optimization method more broadly in cell biology. It carries obvious advantages when it is the cell structure that needs explaining, and when dynamic simulations predicting the structure would necessitate more specific assumptions about quantities and mechanisms not firmly established experimentally.It should be pointed out (discussed in detail in In the light of the new experiments, however, success of the energy-minimization prediction method poses a new question. The original calculations of the conformational energy landscape by Holy et al. were made for microtubule asters confined in flat, rigid chambers Side effects of taxol as an anti-cancer drug on the immune system are widely known. They have been linked to its suppressing cell divisions that must replenish immune cells in the organism e.g, . Our finAnother line of speculation prompted by our findings is related to the fact that certain viruses attacking the T cells use the polarization of the centrosome-associated secretory apparatus during cell-cell interactions for direct propagation between cells. These include (reviewed in

The Debye-Hückel limiting law (DHL) has often been used to estimate rate constants of diffusion-controlled reactions under different ionic strengths. Two main approximations are adopted in DHL: one is that the solution of the linearized Poisson-Boltzmann equation for a spherical cavity is used to estimate the excess electrostatic free energy of a solution; the other is that details of electrostatic interactions of the solutes are neglected. This makes DHL applicable only at low ionic strengths and dilute solutions (very low substrate/solute concentrations). We show in this work that through numerical solution of the Poisson-Nernst-Planck equations, diffusion-reaction processes can be studied at a variety of conditions including realistically concentrated solutions, high ionic strength, and certainly with non-equilibrium charge distributions. Reaction rate coefficients for the acetylcholine-acetylcholinesterase system are predicted to strongly depend on both ionic strength and substrate concentration. In particular, they increase considerably with increase of substrate concentrations at a fixed ionic strength, which is open to experimental testing. This phenomenon is also verified on a simple model, and is expected to be general for electrostatically attracting enzyme-substrate systems.PACS Codes: 82.45.Tv, 87.15.VvMSC Codes: 92C30 Electrostatically steered diffusion-reaction processes exist widely in chemistry and biochemistry ,2. Ionickon, I, zero ionic strength, and infinite ionic strength, respectively. zE and zI are the charges of the enzyme and substrate involved in the interaction. The DHL says that the rate constant decays exponentially with the increase of the square root of ionic strength, as is observed under some conditions [where nditions -8. Howevnditions .The finite concentration effect was recently studied using Brownian dynamics simulation , and lat+ and Cl-), and the atomic charges of the enzyme. Usually, we use three NP equations to describe the diffusion of three mobile species respectively in the PNP model:We use a continuum model to simulate the electrodiffusion processes. The theoretical background is introduced in . In the pi(r) is the density distribution function of the diffusing particles of the i-th species with diffusion coefficient Di and charge qi, ρf is the fixed atomic charge distribution on the enzyme, β is the inverse Boltzmann energy, ε is the dielectric coefficient, ϕ is the electrostatic potential determined by the Poisson equation. The flux iswhere v is determined by integrating the flux J of substrate particles at the reactive site, i.e., v = ∫J·ndS, and the rate coefficient (for steady-state) k is defined as k = C is the bulk substrate concentration. We note that the DHL can be well reproduced in the continuum model when the substrate density is not coupled into the full electric field [The reaction between the enzyme and the diffusing substrate is modeled by an absorbing boundary condition on a reactive site represented by a molecular surface patch. It is worth noting that this treatment is due to the fact that acetylcholinesterase is considered a fast enzyme. But in the context of high concentration of acetylcholine, ca. 500 mM, the simultaneously absorbing boundary condition may not be proper due to limited diffusion speed. In such case, a more complicated boundary condition such as Robin boundary condition, or inclusion of coupled ordinary partial differential equations can serve as a better description of the reaction event. The implementation of these considerations would be a future direction. For consistency and convenience in the setup of the computational model, a same absorbing boundary condition is used in this work. The reaction rate ic field ,8,12).C+ and C- are the total bulk concentrations of cation and anion respectively, and that Csubs is the bulk concentration of substrate ACh. These bulk concentrations are used as the outer boundary conditions of the diffusion domain in solving the PNP equations [C+ + Csubs - C- = 0. As a comparison, the condition C+ - C- = 0 will lead to quite different results, which will be addressed later.Calculations of steady-state rate coefficients are performed for the enzyme catalyzed degradation of acetylcholine (ACh), which is an electrostatically steered diffusion-controlled reaction . ACh carquations . TherefoC+ + Csubs = 300 mM), the rate coefficient is 1.36 × 1011 M-1min-1 for Csubs = 1 mM and is increased to 3.28 × 1011 M-1min-1 for Csubs = 300 mM. The physical origins of the observed behavior can be explained as follows. If substrate concentration is not considered, as in most previous work based on the DHL, the concentration of the counter ion of the enzyme, i.e., C+ here, is equal to the concentration of the coion, i.e., C+ = C-. The counter ions are attracted and concentrated around the negatively charged active site, which serves to screen the Coulomb interaction between ACh molecules and AChE, hence slowing the association. When Csubs is considered in the PNP model, to maintain the same ionic strength, C+ needs to be reduced by Csubs compared with that in the familiar Debye-Hückel theory. This leads to a thinner counter-ion atmosphere around the active site, and it can not be compensated by the additional substrate (ACh) density that is relatively low due to reactant depletion that results from the absorbing boundary condition. In other words, in the resulting non-equilibrium state, the sum of counter-ion density and ACh density near the active site is lower than that obtained with the Boltzmann distribution for a +1e particle. The consequences are a reduced overall screening effect and thereby an enhanced reaction rate.The reaction rate coefficient is shown as a function of ionic strength (= "spectator" + bulk substrate) for different prescribed substrate concentrations in Figure The ionic atmosphere always screens the electrostatic interactions, and hence reduces the rate coefficients. At very high ionic strength, due to strong ionic screening effects, the electrostatic interactions become very weak. This is close to the pure diffusion case, and all the rate constants for different substrate concentrations are close to the pure diffusion-reaction rate constant.The phenomena observed above are expected to be general for attractive substrate-enzyme systems, which can be illustrated with an idealized sphere model. Figure C+ - C- = 0 and the substrate concentration is not counted into ionic strength as was done in our former work [As a comparison, if we use an aforementioned neutrality condition mer work , very diHowever, it is worth pointing out an issue in this model that the reaction products, choline and acetic acid that will ionize and generate acetate and a proton, are also charged species. The distribution and diffuse of these added ionic species will definitely affect the local ionic strength, hence the reaction rate coefficient. Therefore, a more complete treatment of some enzymes that catalyze reactions of charged substrates should include additional species such as charged products of the reaction in the model. But this brings the methodology a new issue that is how to elaborate the current PNP model to include the product diffusion originated from the reactive site, which will lead to some additional lines of work in the future. Therefore, the present work is limited to the case in which product concentrations are small, so that experimental tests of the current model would need to be in the early steady-state regime.To summarize, the DHL only applies to very dilute situations. Our numerical results show that for electrostatically steered diffusion-controlled reaction processes, the rate coefficients strongly depend on both ionic strength and substrate concentration. At the same ionic strength, the current model predicts that increasing substrate concentration results in significant increase in rate coefficients for the attractive substrate-enzyme systems in case the product concentration can be ignored (like in the early steady-state regime). We are extending the theory and simulation methods to account for finite product concentrations, which will allow for easier comparison with experiments.

Enzymes from this family perform the same post-transcriptional nucleotide modification in ribosome biogenesis, irrespective of organism. Despite this common function, divergence has enabled some family members to adopt new and sometimes radically different functions. For example, in S. cerevisiae Dim1 performs two distinct functions in ribosome biogenesis, while human mtTFB is not only an rRNA methyltransferase in the mitochondria but also a mitochondrial transcription factor. Thus, these proteins offer an unprecedented opportunity to study evolutionary aspects of structure/function relationships, especially with respect to our recently published work on the binding mode of a KsgA family member to its 30S subunit substrate. Here we compare and contrast KsgA orthologs from bacteria, eukaryotes, and mitochondria as well as the paralogous ErmC enzyme.One of the 60 or so genes conserved in all domains of life is the By using structure and sequence comparisons in concert with a unified ribosome binding model, we have identified regions of the orthologs that are likely related to gains of function beyond the common methyltransferase function. There are core regions common to the entire enzyme class that are associated with ribosome binding, an event required in rRNA methylation activity, and regions that are conserved in subgroups that are presumably related to non-methyltransferase functions.The ancient protein KsgA/Dim1 has adapted to cellular roles beyond that of merely an rRNA methyltransferase. These results provide a structural foundation for analysis of multiple aspects of ribosome biogenesis and mitochondrial transcription. Ribosome biogenesis is a fundamental process in all cells, requiring the consumption of large quantities of cellular resources under the control of an extraordinary level of regulation. In comparing prokaryotic and eukaryotic ribosome biogenesis pathways, the conservation of the KsgA/Dim1 family is unique. The presence and function of this enzyme has been maintained in every evolutionary lineage, including eukaryotic organelles.E. coli numbering) to N6,N6-dimethyladenosines [Arabidopsis thaliana, is important for chloroplast formation under chilling conditions [KsgA catalyzes the conversion of two adjacent adenosines in the small subunit rRNA serves as a transcription factor but has lost its methyltransferase activity entirely [A distinct eukaryotic ortholog, mtTFB, is transported into the mitochondria where, in addition to methylating the small subunit rRNA, it has adopted the ribosomally unrelated function of serving as a mitochondrial transcription factor ,5. In soentirely . sc-mtTFentirely .Another important offshoot of the KsgA lineage is the Erm family of methyltransferases, which confer antibiotic resistance by methylating A2058 of the 23S rRNA . The preKsgA's remarkable degree of conservation, coupled with the adaptation of new cellular functions, give us a unique opportunity to look at structural/function evolution of a single protein lineage. Previous studies have established the structural similarity between some rRNA adenosine dimethyltransferases ,12. BaseE. coli KsgA [Plasmodium falciparum Dim1 [oli KsgA , human Drum Dim1 , and sc-rum Dim1 have beeS. cerevisiae and the archaeon Methanocaldococcus jannaschii as well as h-mtTFB1 and h-mtTFB2, can all complement for KsgA function in E. coli [Divergent orthologues of bacterial KsgA, including Dim1 from the eukaryote E. coli ,14,15. T E. coli . As was et al [When 16S rRNA conservation is assessed across all three domains and the ribosome-containing organelles, regions that are important for translation show the highest evolutionary conservation . Includeet al . Figure The KsgA enzymes share the Rossman-like structural fold common to many SAM-dependent methyltransferases ,19. ThisEukaryotic Dim1 has a large insert in the C-terminal domain compared to KsgA Figure . SequencS. cerevisiae mitochondrial RNA polymerase, and this insert may also contribute to the protein's role as a transcription factor [A similar analysis can be performed by comparing KsgA and sc-mtTFB. mtTFB proteins have three inserts relative to KsgA proteins ; all of n factor . The pren factor . Notablysc-mtTFB, and possibly other fungal TFB proteins, have lost their methyltransferase activity during their evolution as transcription factors . Figure B. subtilis [Structural comparison of KsgA and ErmC' shows that the two proteins are very similar, with the most notable divergence being in the C-terminal domains Figure . These tsubtilis ; the ressubtilis ; this lisubtilis . This diTo our knowledge, the KsgA proteins are unique in both their level of conservation and their functional flexibility. KsgA was one of the first rRNA methyltransferases to be identified and has received episodic scrutiny over the last thirty years. Despite a collection of important observations, a thorough understanding of this protein family's role in ribosome biogenesis has been elusive. Certainly, the KsgA/Dim1 family has significance beyond the methyltransferase activity that was first described. Sequence and structural comparisons of these proteins, in concert with data about the binding of KsgA to the 30S subunit, implicate certain regions that might be important to the various functions of KsgA orthologs. Further experiments will help define individual characteristics of this important family of proteins.The authors declare that they have no competing interests.All authors discussed results and contributed to the manuscript. HCO compiled sequences and prepared alignments. JPR docked proteins onto the 30S subunit structure.Sequence alignment of KsgA orthologs. Archaeal, eukaryotic, and mitochondrial KsgA orthologues were identified by performing a genomic BLAST search using the E. coli protein sequence (accession number P06992) as the query sequence. Organisms were chosen to represent a broad evolutionary diversity of species. The structure-based sequence alignment was perfomed using the program Expresso [1QYR[1ZQ9 , and 2H1R[Arabidopsis thaliana (at), Dictyostelium discoideum (dd), Leishmania brazilensis (lb), Giardia lamblia (gl), Plasmodium vivax (pv), Homo sapiens (hs), Saccharomyces cerevisiae (sc), Drosophila melanogaster (dm), and Caenorhabditis elegans (ce). Archaea: Methanopyrus kandleri (mk), Methanosaeta thermophila (mth), Haloquadratum walsbyi (hw), Methanoculleus marisnigri (mma), Methanocaldococcus jannaschii (mj), Pyrococcus horikoshii (ph), Methanosphaera stadtmanae (ms), Picrophilus torridus (pt), Archaeoglobus fulgidus (af), Aeropyrum pernix (ap), Sulfolobus solfataricus (ss), Pyrobaculum aerophilum (pa), and Cenarchaeum symbiosum (cs). Bacteria: Synechococcus elongatus (se), Bacillus subtilis (bs), Mycobacterium tuberculosis (mtu), Thermus thermophilus (tt), Bacteroides fragilis (bf), Chlamydia trachomatis (ct), Borrelia burgdorferi (bb), and Escherichia coli (ec). Accession numbers for each sequence are found in Additional file Expresso . Structusso [1QYR, 1ZQ9 , Homo sapiens (hs), Drosophila melanogaster (dm), Anopheles gambiae (ag), Apis mellifera (am), Xenopus laevis (xl), Takifugu rubripes (tr), Ciona intestinalis (ci), Rattus norvegicus (rn), Pan troglodytes (pt), Mus musculus (mmu), Bos taurus (bt), Tetraodon nigroviridis (tn), Saccharomyces cerevisiae (sc), Schizosaccharomyces pombe (sp), Kluyveromyces lactis (kl), Eremothecium gossypii (eg), Candida albicans (ca), Dictyostelium discoideum (dd), Trypanosoma brucei (tb), and Leishmania major (lm). Accession numbers for each sequence are found in Additional file Expresso . The strsso [1I4W was usedClick here for fileSequence alignment of Erm enzymes. Erm enzymes were identified using the Nomenclature Center for MLS Genes, maintained by Dr. Marilyn C. Roberst [1QAM[1YUB[Staphylococcus aureus, Enterococcus faecalis, Bacillus subtilis, Bacillus licheniformis, Saccharopolyspora erythraea, Bacteroides fragilis, Lysinibacillus sphaericus, Streptomyces thermotolerans, Streptomyces fradiae, Streptomyces coelicolor, Clostridium perfringens, Aeromicrobium erythreum, Lactobacillus reuteri, Streptomyces lincolnensis, Streptomyces viridochromogenes, Micromonospora griseorubida, Corynebacterium jeikeium, Streptomyces ambofaciens, Streptomyces venezuelae, Staphylococcus sciuri, Bacillus clausii, Bacteroides coprosuis, Micrococcus luteus, Mycobacterium tuberculosis, Mycobacterium smegmatis, Mycobacterium fortuitum, Mycobacterium mageritense, and Mycobacterium abscessus, Accession numbers are found in Additional file Roberst . One mem Roberst . The str Roberst . Structurst [1QAM and 1YUB1QAM[1YUB. OrganisClick here for fileSequences used in protein alignments. Sequences were compiled from NCBI and Ensembl; organisms and accession numbers are indicated.Click here for file

A total of 121 protein sequences of pectate lyases were subjected to homology search, multiple sequence alignment, phylogenetic tree construction, and motif analysis. The phylogenetic tree constructed revealed different clusters based on different source organisms representing bacterial, fungal, plant, and nematode pectate lyases. The multiple accessions of bacterial, fungal, nematode, and plant pectate lyase protein sequences were placed closely revealing a sequence level similarity. The multiple sequence alignment of these pectate lyase protein sequences from different source organisms showed conserved regions at different stretches with maximum homology from amino acid residues 439–467, 715–816, and 829–910 which could be used for designing degenerate primers or probes specific for pectate lyases. The motif analysis revealed a conserved Pec_Lyase_C domain uniformly observed in all pectate lyases irrespective of variable sources suggesting its possible role in structural and enzymatic functions. The enzymes hydrolyzing pectic substances ubiquitously present in the plant kingdom forming major components of middle lamella are referred as pectinases. The production, purification, biochemical characterization, and application of pectinases have been extensively reviewed –10. The α-1,4 glycosidic bonds of polygalacturonic acid via a β-elimination reaction producing unsaturated ∆4, 5 bond at the nonreducing end of the polysaccharide and generates 4,5-unsaturated oligogalacturonates. Pectate lyase is widely distributed in diverse families of microorganisms and plants. The important members of bacterial family include Erwinia carotovora, Bacillus polymyxa, Klebsiella, Yersinia, Cytophaga, Pseudomonas, and Xanthomonas while in fungi Aspergillus, Fusarium, and Penicillium are the most predominant source [Pectate lyase cleaves the t source , 11–14. A number of pectate lyase genes have been cloned, sequenced, and expressed from different source organism, namely, bacteria –22, fungβ-helix domain formed by parallel-strands folded into a large right-handed helix and a major loop region. The three-dimensional structures of various extracellular pectate lyase have been reported –36. The silico analysis of pectin lyase protein sequences has been recently reported [Amino acid sequence homology-based classification of pectate lyases into distinct families suggesting the possible evolution from different lineages has been reported , 37–44. reported .in silico characterization of pectate lyase protein sequences from different source organisms for homology search, multiple sequence alignment, phylogenetic tree construction, and motif analysis using various bioinformatics tools.This paper reports http://www.ncbi.nlm.nih.gov/). The accession numbers of pectate lyases protein sequences along with the source organism are listed in A total of 121 protein sequences of pectate lyases of different source organism available in GenBank were downloaded from NCBI (http://www.sanger.ac.uk/software/pfam/search.html) was used. Domain analysis was done using MEME (http://meme.sdsc.edu/meme/meme.html) [The program ClustalW was usedme.html) . The conA total of 121 pectate lyases sequences from different source organisms subjected to phylogenetic tree construction revealed major clusters of bacterial, fungal, plant, and nematode pectate lyases. The pectate lyase from bacterial source was the predominant comprising of 87 accession numbers. The different accession of bacterial pectate lyase formed three major clusters as shown in The multiple sequence alignment of these protein sequences revealed conserved regions at different stretches, namely, from 439–467, 715–816, and 829–918 amino acid residues Figures . This reA total of five motifs labelled as 1, 2, 3, 4, and 5 were observed in only 91 sequences when subjected to MEME. The distribution of these motifs among 92 pectate lyase accession number is shown in The motifs with width and best possible match amino acid sequences are shown in Further when the motif best possible match amino acid sequence was subjected to BLAST to reveal its identity, it was observed that the motifs 1, 2, 3, and 4 represents Pec_Lyase_C superfamily while motif 5 represents pectate lyase superfamily. The exact function of these motifs in influencing the catalytic activity of the pectate lyase needs to be investigated. in silico characterization of pectate lyases protein sequences from different source organisms has revealed sequence level similarity specific for different groups which could be utilized for designing strategy for cloning the putative genes based on PCR amplification using degenerate primers. The

Individual perception of vaccine safety is an important factor in determining a person's adherence to a vaccination program and its consequences for disease control. This perception, or belief, about the safety of a given vaccine is not a static parameter but a variable subject to environmental influence. To complicate matters, perception of risk (or safety) does not correspond to actual risk. In this paper we propose a way to include the dynamics of such beliefs into a realistic epidemiological model, yielding a more complete depiction of the mechanisms underlying the unraveling of vaccination campaigns. The methodology proposed is based on Bayesian inference and can be extended to model more complex belief systems associated with decision models. We found the method is able to produce behaviors which approximate what has been observed in real vaccine and disease scare situations. The framework presented comprises a set of useful tools for an adequate quantitative representation of a common yet complex public-health issue. These tools include representation of beliefs as Bayesian probabilities, usage of logarithmic pooling to combine probability distributions representing opinions, and usage of natural conjugate priors to efficiently compute the Bayesian posterior. This approach allowed a comprehensive treatment of the uncertainty regarding vaccination behavior in a realistic epidemiological model. A frequently made assumption in population models is that individuals make decisions in a standard way, which tends to be fixed and set according to the modeler's view on what is the most likely way individuals should behave. In this paper we acknowledge the importance of modeling behavioral changes (in the form of beliefs/opinions) as a dynamic variable in the model. We also propose a way of mathematically modeling dynamic belief updates which is based on the very well established concept of a belief as a probability distribution and its temporal evolution as a direct application of the Bayes theorem. We also propose the use of logarithmic pooling as an optimal way of combining different opinions which must be considered when making a decision. To argue for the relevance of this issue, we present a model of vaccinating behaviour with dynamic belief updates, modeled after real scenarios of vaccine and disease scare recorded in the recent literature. Since early vaccination campaigns against smallpox, vaccination policies have been a matter of debate In recent years, after complete or almost complete elimination of these diseases, the debate is shifting towards issues of vaccine safety. Increased perception of vaccine risks and lowered perception of disease risks has challenged previous willingness to vaccinate Willingness to vaccinate is highly dependent on the perceived risk of acquiring a serious disease In the UK, MMR vaccine uptake started to decline after a controversial study linking MMR vaccine to autism www.who.int/csr/don/2008_02_07/en/).Sylvatic yellow fever (SYF) is a zoonotic disease, endemic in the north and central regions of Brazil. Approximately 10% of infections with this flavivirus are severe and result in hemorrhagic fever, with case fatality of 50% The importance of public perceptions and collective behavior for the outcome of immunization campaigns are starting to be acknowledged by theoreticians In the present work, we propose a model for individual immunization behavior as an inference problem: Instead of working with fixed behaviors, we develop a dynamic model of belief update, which in turn determines individual behavior.An individual's willingness to vaccinate is derived from his perception of disease risk and vaccine safety, which is updated in a Bayesian framework, according the epidemiological facts each individual is exposed to, in their daily life. We also explore the global effects of individual decisions on vaccination adherence at the population level.In summary, we propose a framework to integrate dynamic modeling of learning (belief updating) with decision and population dynamics.We ran the model as described above for 100 days with parameters given by In a different scenario, The impact of individual beliefs on vaccine coverage is highly dependent on the visibility of the rare VAE. Fixing amplification at events, . As incIn the present world of mass media channels and rapid and inexpensive communications, the spread of information, independent of its quality, is very effective, leading to considerable uncertainty and heterogeneity in public opinions. The yellow fever scare in Brazil demonstrated clearly the impact of public opinion on the outcome of a vaccination campaign, and the difficulty in dealing with scare events. For example, no official press release was taken at face value, as it was always colored by political issues The goal of this work was to integrate into a unified dynamical modeling framework, the opinion and decision components that underlie the public response to mass vaccination campaigns, specially when vaccine or disease scares have a chance to occur. The proposed analytical framework, although not intentionally parameterized to match any specific real scenario, qualitatively captured the temporal dynamics of vaccine uptake in Brasilia , a clearAfter conducting large scale studies on the acceptance of the Influenza vaccine, Chapman et al. Vaccinating behavior dynamics has been modelled in different ways in the recent literature, from behaviors that aim to maximize self-interest First, the process through which people update beliefs which will direct their decisions, was modeled using a Bayesian framework. We trust this approach to be the most natural one as the Bayesian definition of probability is based on the concept of belief and Bayesian inference methodology was developed as a representation human learning behavior The second contribution is the articulation between the belief and decision models through logarithmic pooling. Logarithmic pooling has been applied in many fields This framework can be easily used as a base to compose more complex models. Extended models might include multiple beliefs as a joint probability distribution, more layers of decision or multiple, independently evolving belief systems.The contact strucure of the model was intentionally kept as simple as possible, since the goal of the model was to focus on the belief dynamics. Therefore, a reasonably simple epidemiological model, with a simple spatial structure was constructed to drive the belief dynamics without adding potentially confounding extra dynamics.In this work we have played with various probability levels of VAEs and SDs in an attempt to cover the most common and likely more interesting portions of parameter space. However, to model specific scenarios, data regarding the actual probabilities of VAEs and SDs are a pre-requisite. Also important are data regarding the perception of vaccine safety and efficacy We set the vaccination decision problem in the context of a population experiencing a vaccine preventable disease outbreak which leads to a mass vaccination campaign. Individuals receive information regarding vaccine and disease events from local and global sources. We assume that 'good' events (prompt recovery from infection or safe vaccine events) are visible locally only while severe cases of disease or potentially adverse events from the vaccine enjoy global visibility due to the natural preference of media channels for scary stories. In order to integrate behavioral and epidemiological dynamics, an individual based model was developed. Individual's behavior regarding vaccination is represented in a belief-decision model which describes the dynamics of belief updates in response to epidemiological events and the decision making based on the person's current beliefs. The epidemiological model determines the disease dynamics in a population with hierarchical contact structure, representing a large urban setting.The belief model describes the temporal evolution of each individual's willingness to vaccinate, The belief update model takes the form:where The last term in (1), Regularly, during a mass vaccination campaign, individuals will try to infer the value of vaccinating based on available information regarding vaccine events. During a campaign, the number of safe vaccine events, Note that Each individual will make inference of he prior .To better emulate the biased availability of good versus bad news in real populations, we assume that vaccine adverse events are visible globally, while safe events are visible only within their neighborhoods. To include the effects of an exaggerated media coverage of vaccine adverse events, we considered scenarios where the the observed number of adverse events In this model, we try to emulate a scary disease, that is, a disease severe enough that a few cases will lead to a high willingness to get a vaccine shot.Disease scare is defined as an increase in the individual's The reduction term is a slow but continuous change of the mean willingness to vaccinate, Once a week, during the simulation, susceptible and exposed individuals decide whether to go vaccinate with a probability sampled from ven days .Only non-infectious individuals make the decision to whether or not they should go vaccinate. We consider that exposed individuals do not know they have been infected, so they also may seek vaccination. This is important because there is a limited amount of vaccine doses available per week and exposed individuals will compete with susceptibles for them. Only susceptibles are successfully immunized by the vaccine.We model disease spread in a hypothetical city represented by a multilevel metapopulation individual-based model where individuals belong to groups that in turn belong to groups of groups, and so on , formingThis same hierarchical structure is used to define local and global events. Locally visible events can only be witnessed by people living in the same neighborhood while globally visible events are visible to the entire population regardless of place of residence.The epidemiological model describes a population being invaded by a new pathogen. This pathogen causes an acute infection, lasting 11 days (incubation period of 6 days and an infectious period of 5 days). Once in the infectious period, individuals have a fixed probability, At the same time the disease is introduced in the population, a vaccination campaign is started, making available Once an individual is vaccinated, if he/she has not been exposed yet, he/she moves directly to the recovered class, with full immunity . If the individual is in the incubation period of the disease, disease progression is unaffected by vaccination. Vaccination carries with it a fixed chance Transmission dynamics is modelled as follows: at each discrete time step,

Alu. A large fraction of Alus are found in intronic sequences, implying extensive Alu-Alu dsRNA formation in mRNA precursors. Yet, the effect of these intronic Alus on splicing of the flanking exons is largely unknown. Here, we show that more Alus flank alternatively spliced exons than constitutively spliced ones; this is especially notable for those exons that have changed their mode of splicing from constitutive to alternative during human evolution. This implies that Alu insertions may change the mode of splicing of the flanking exons. Indeed, we demonstrate experimentally that two Alu elements that were inserted into an intron in opposite orientation undergo base-pairing, as evident by RNA editing, and affect the splicing patterns of a downstream exon, shifting it from constitutive to alternative. Our results indicate the importance of intronic Alus in influencing the splicing of flanking exons, further emphasizing the role of Alus in shaping of the human transcriptome.Examination of the human transcriptome reveals higher levels of RNA editing than in any other organism tested to date. This is indicative of extensive double-stranded RNA (dsRNA) formation within the human transcriptome. Most of the editing sites are located in the primate-specific retrotransposed element called Alu. A large fraction of Alu elements are located within intronic sequences. The human transcriptome undergoes extensive RNA editing (A-to-I), to higher levels than any other tested organism. RNA editing requires the formation of a double-stranded RNA structure in order to occur. Over 90% of the editing sites in the human transcriptome are found within Alu sequences. Thus, the high level of RNA editing is indicative of extensive secondary structure formation in mRNA precursors driven by intronic Alu-Alu base pairing. Splicing is a molecular mechanism in which introns are removed from an mRNA precursor and exons are ligated to form a mature mRNA. Here, we show that Alu insertions into introns can affect the splicing of the flanking exons. We experimentally demonstrate that two Alu elements that were inserted into the same intron in opposite orientation undergo base-pairing, and consequently shift the splicing pattern of the downstream exon from constitutive inclusion in all mature mRNA molecules to alternative skipping. This emphasizes the impact of Alu elements on the primate-specific transcriptome evolution, as such events can generate new isoforms that might acquire novel functions.The human genome is crowded with over one million copies of primate-specific retrotransposed elements, termed Alternative splicing enhances transcriptomic diversity and presumably leads to speciation and higher organism complexity, especially in mammals There are three known origins of alternatively spliced exons: 1) exon shuffling, which is a form of gene duplication Alu are ∼280 nucleotides long. These are the most abundant retrotransposed elements in the human genome with about 1.1 million copies Alu elements are located within intronic sequences, in both the sense and the antisense orientation relative to the mRNA, and can potentially form long regions of double-stranded RNA (dsRNA) Alu elements. The evidence is embedded in analyses of the RNA editing mechanism: The human transcriptome undergoes extensive adenosine to inosine RNA editing Alus in opposite orientation within 2000 nucleotides of each other may serve as substrates for ADAR The primate-specific retrotransposons called Alu elements and editing occurs in sense and antisense pairs of Alus but not in flanking non-Alu sequences Alus located within the 3′UTR of EGFP mRNA serves as a substrate for A-to-I RNA editing that stabilizes the binding of the p54 protein to the mRNA. This causes nuclear retention of the mRNA and the silencing of EGFP expression NARF gene, where formation of Alu-Alu dsRNA and its subsequent editing generates a functional 3′ splice site that is essential for exonization of that intronic Alu; moreover, editing in that Alu eliminates a stop codon and modulates the strength of exonic splicing regulatory sequences (ESRs). Interestingly, the nucleotides surrounding the editing site are important not only for editing of that particular site but also for editing at other sites located downstream in the same exon. It was also shown that the C nucleotide thought to pair with the edited site on the dsRNA is important for editing More than 90% of known editing sites are found in Alu elements on splicing. We found that different regulatory constraints act on Alu insertions into introns that flank constitutively or alternatively spliced exons. We further demonstrated that two Alu elements which were inserted into introns in opposite orientation have the potential to undergo base-pairing, as evident by RNA editing, and affect the splicing patterns of a downstream exon, by shifting it from constitutive to alternative. Finally, as Alu elements are abundant in introns, the findings we present suggest that the effect of intronic Alu elements on the transcriptome could be substantial, and could result in transcriptomic novelties. The new isoforms could then be subjected to purifying selection which will determine their fixation.In this study, we have bioinformatically and experimentally evaluated the effects of intronic Alu elements into introns on splicing of the flanking exons, we downloaded data of human introns (hg18) and Alu elements and determined the intersected set using the UCSC genome browser and GALAXY Alu elements that reside within introns and 185,534 introns were extracted. This analysis showed that there are 85,126 introns that contain at least one Alu element; of these, 5009 introns contained at least two Alu elements in opposite orientation. The median length of introns containing at least one Alu element is 3829 base pairs (bp), whereas the median length of introns that do not contain an Alu is 521 bp , the closest Alu element in the opposite orientation resided within the same intron, with an average distance of 682 bp from the edited Alu. However, we found 73 cases (8%) where the nearest Alu element in the opposite orientation was in a different intron; in 61 of these cases it is at least 500 bp closer to the edited Alu element than the nearest Alu element in the opposite orientation in the same intron . This close proximity between the two Alu elements, along with the evidence that at least one of them undergoes editing, suggests that these regions may base pair.An antisense ting see . For eace intron . In thesAlu elements, the closest Alu element in the opposite orientation resided within the same intron, we decided to examine the splicing process in these cases. But first, we set to examine the distribution of Alu elements within datasets of exons conserved within human and mouse having different splicing patterns.Since in 92% of edited Alu insertions into introns flanking these exons revealed that species-specific alternative exons exhibited the highest level of Alu insertions, followed by conserved alternative exons; the group with the fewest intronic insertions were conserved constitutively spliced exons. We calculated the density of Alu insertions, namely the number of Alus divided by the total intron length (and then multiplied by 1000 for convenience), in order to control for the fact that different intronic lengths might influence Alu insertion and also differed from that in the alternatively spliced exons .We analyzed three datasets of human-mouse orthologous exons and their flanking introns and exons: 1) conserved constitutively spliced exons , 2) conserved alternatively spliced exons , and 3) exons that are alternatively spliced in human and constitutively spliced in mouse . Analysis of tion see . On averAlus upstream of conserved constitutively spliced exons revealed a selection against the presence of Alu elements adjacent to exons, specifically, against Alu elements in the antisense orientation . Examination of the downstream intron did not reveal a significant bias . This implies that a selective pressure exists against insertion of Alus in close proximity upstream to constitutively spliced exons; this bias is stronger against Alus in the antisense orientation than against the sense orientation.Furthermore, analysis of the distribution of antisense and sense entation . There aAlu: the 7SLRNA Alus, large numbers of B1 elements reside within intronic sequences Alu and B1 containing introns are substantially longer than other introns.B1 is a rodent-specific retrotransposed element of ∼150 nucleotides that has the same ancestral origin as Alu and B1 elements within orthologous introns . Namely, orthologous introns show the same tendencies for Alu and B1 insertion, although these events happened independently after the split of the mouse and human lineages. We then set out to analyze whether insertion of B1 into rodent introns was biased in terms of location and orientation as was the case for Alu in primates. Analysis of B1 insertions within the flanking introns of conserved constitutively spliced exons, conserved alternatively spliced, and species-specific alternatively spliced exons yielded the same trend as that of Alu insertions in human. There was no statistical difference in the density of B1 between conserved constitutively spliced and conserved alternatively spliced exons; however, the upstream introns of the 258 species-specific exons were significantly more enriched with B1 elements than were the upstream introns of conserved constitutively spliced exons or constitutively spliced downstream introns . This was also the case when the regions upstream of exons that are alternatively spliced in mouse and constitutively spliced in human were compared to the upstream introns of conserved alternatively spliced exons but not the downstream introns . Therefore, insertion of retrotransposed elements into intronic sequences is correlated with the mode of splicing of the flanking exons.We observed a significant correlation between the number of insertions of de novo Alu insertions into intronic sequences in antisense orientation and in close proximity to the affected exon (between 19–50 nucleotides) cause the downstream exon to shift from constitutive splicing to full exon skipping (three cases) or to alternative splicing (two cases) and, in combination with downstream 3′ and 5′ pseudo splice sites, might act as pseudo-exon Alus that act as pseudo-exons might compete with nearby exons for the binding of splicing factors. These five cases of de novo Alu insertions imply that Alus located in close proximity to exons might affect splicing of adjacent exons. This and the finding of de-novo Alu insertions that affect splicing imply that this is an on-going evolutionary process, which may result in novel transcripts that are deleterious and inflict genetic diseases. On the other hand, a shift in the splicing pattern from constitutive to alternative might be advantageous in some cases, and could enable testing new mRNA options without eliminating the old ones. Moreover, such a shift could introduce a premature termination codons enabling the expression of truncated proteins at certain needed times or in specific cell types and could be delicately regulated by the levels of splicing regulatory proteins Five reports o cases) . This efAlu, we used the alternative splicing track in the UCSC genome browser , 491 (∼2.8%) events in which an antisense Alu was found within 150 bp , and 689 (∼4%) events in which an antisense Alu was found within 200 bp . Out of these 689 alternative exons, 525 (76.1%) are conserved between human and mouse . Within the human genome, almost 85% of alternative cassette exon skipping events are conserved in mouse, however only 76% of the cassette exon skipping events that have an adjacent Alu in opposite orientation are conserved within mouse genome. This is statistically significant, implying that there is a bias for Alu in antisense orientation in the regulation of alternative exons within non-conserved alternative splicing events .In order to determine how many alternatively spliced exons are potentially regulated by the insertion of an antisense browser . In 269 Alus into introns is associated with the mode of splicing of the flanking exons—especially the downstream exon—and that most Alu-Alu dsRNA is formed between sequences within the same intron. To test this hypothesis, exon 3 of the human RABL5 gene was analyzed experimentally to examine the connection between intronic Alu and alternative splicing. A minigene containing exons 2 through 4 of the human RABL5 gene was cloned. Exon 3 of RABL5 is alternatively spliced in human and constitutively spliced in mouse, rat, dog, chicken, and zebrafish , had the same effect as deleting all Alus .The splicing , lane 13Alu1 and Alu2 have opposite effects on splicing. Deletion of both Alus has the same effect as deleting only Alu2. Therefore, we concluded that Alu2 is dominant over Alu1. The dominance of Alu2 is also supported by two other observations. First, if all Alus except Alu2 are removed, we observe almost total exon skipping . Furthermore, deletion or replacement with a 270-nucleotide non-Alu intronic sequence of Alu2 in combination with any additional intronic Alus leads to constitutive splicing . In the absence of Alu1 and the presence of Alu2, the dominance of Alu2 over the other Alus is observed, leading to exon skipping . As expected, in the presence of both Alu1 and Alu2, deletion of Alus from the downstream intron had a marginal effect on splicing did not affect the splicing pattern , 105bp upstream to the original short Alu2 , either in the sense or antisense orientation, did not affect full skipping of exon 3. Deletion of the right arm alone or the LPPT alone had a marginal effect on splicing of exon 3 . Although Alu2 functions primarily to inhibit exon 3 selection, the above sequence within Alu2 enhances the inclusion of exon 3. Formation of a duplex between Alu1 and Alu2 is needed in order to present this intronic enhancer sequence properly for its effect on splicing of exon 3.Based on the location of the editing sites shown in tructure , lane 2.tructure . FinallyAlu elements in introns of human protein coding genes Alus are not ‘neutral’ elements; they affect splicing of flanking exons. Some of these effects can be directly linked to the shift from constitutive to alternative splicing during primate evolution. The regulation demonstrated here involves both positive and negative effects of Alu element in antisense orientation, in close proximity, and upstream to the regulated exon. This complex regulation causes the downstream exon to shift from constitutive to alternative splicing. There are several examples de novo insertions of Alu elements within introns that result in skipping of the adjacent exons. In three of the reported cases, the insertion of the Alu in the antisense orientation caused a total skipping of the adjacent exon.There are over 0.5 million copies of RABL5 gene, analyzed in this study, is alternatively spliced in human and constitutively spliced in mouse, rat, dog, chicken, and zebrafish. Six Alus have been inserted into the flanking introns of exon 3 since the last common ancestor of human and mouse. Alu2 was inserted in the antisense orientation just upstream of exon 3 and functions as a negative element that suppresses exon 3 selection. This negative effect is partially reversed by another Alu present in the same intron in the sense orientation. Although we were not able to fully resolve the mechanism by which the two Alus regulate alternative splicing of the downstream exon, we provide evidence that regulation requires the formation of a double-stranded region between the two Alus and a combination of negative and positive sequences located in Alu2. The end result of this complex regulation is a shift from constitutive to alternative splicing of the downstream exon. This results in a new primate-specific mRNA isoform that could acquire novel functions, as well as maintaining the original mRNA. Moreover, such a shift could introduce a premature termination codon resulting in truncated proteins that might have regulatory roles at certain times or in specific cell types as could be delicately determined by the levels of splicing regulatory proteins Exon 3 of Alu elements Alus in the flanking introns. First, alternatively spliced exons are flanked by introns containing more Alus compared with introns flanking constitutively spliced ones, even when controlling for the difference in intron lengths. Second, more Alus are present in human introns than are corresponding mouse B1 elements in the orthologous mouse introns. This second observation correlates with the finding that there are more species-specifically, alternatively spliced exons in human than in mouse .Introns in humans are considerably longer than their mouse counterparts, mostly due to the presence of Alu could help define and increase the splicing efficiency of very large metazoan introns It was suggested that intron complementarities formed by multiple copies of Although the effect of intronic retroelements on the splicing of flanking exons is presumably not a general trend that applies to all exons, it is relevant to a certain fraction of alternatively spliced exons .Alu elements is correlated with the mode of splicing of adjacent exons. There is an ‘exclusion zone’ in intron sequences flanking exons, where insertion of Alu elements is presumably under purifying selection. The length of this ‘exclusion zone’ is similar to that of the human-mouse conserved sequences flanking alternatively spliced exons (∼80–150 nucleotides). This is presumably indicative of regions where the presence of intronic splicing regulatory sequences can affect alternative splicing of the adjacent exon Alus might be excluded from the proximal intronic sequences flanking constitutively spliced exons because Alus were never inserted into these regions or because Alus were inserted in an equal proportion in all gene regions (intronic and exonic) but we currently observe only those Alus that have escaped purifying selection. The major burst of Alu retroposition took place 50–60 million years ago and has since dropped to a frequency of one new retroposition for every 20–125 new births Alus that are neutral, mildly deleterious, or beneficial to human fitness. Some of these beneficial intronic Alus presumably altered splicing of the flanking exons and resulted in the generation of new isoforms that presented an advantage during primate evolution and were thus fixated in our genome. The research described here sheds light on how Alu elements have shaped the human genome.Our analysis indicated that the presence of A dataset of 596 alternatively spliced exons, conserved between human and mouse, was derived from a previously compiled dataset Homo sapiens, Build 35.4) and mouse were extracted from the Exon-Intron Database (http://hsc.utoledo.edu/depts/bioinfo/database.html) www.repatmasker.org) using Repbase update files Introns and exons for human software version 3.1.0 Since 2 test with 2×2 contingency table, Fisher's exact test was used.A T-test was used to calculate statistical differences between two populations; for χAlu within the upstream intron was determined using RepeatMasker tables downloaded from UCSC. The conservation of these introns was analyzed using MAF pairwise alignments between the human genome (build hg18) and the mouse genome (build mm9) downloaded from UCSC genome browser. The intersections between these tables were done using the Galaxy sever The alternatively skipped exons in the human genome (build hg18) were extracted by downloading the knownAlt table from UCSC genome browser Alu elements in the human genome (build hg18) using the RepeatMasker Alu elements that are embedded in intronic sequences and undergo mRNA editing.We extracted data of on 10,113 nucleotides that undergo mRNA editing in the human genome from Levanon et al. RABL5 (RAB member RAS oncogene family-like 5) minigene was generated by amplifying a human genomic fragment using PCR reaction. Each primer contained an additional sequence encoding a restriction enzyme. The PCR product was restriction digested and inserted into the pEGFP-C3 plasmid (Clontech) and sequenced to confirm that the desired construct was obtained. The RABL5 minigene, contains exons 2 through 4 (2.7 kb). The intron replacements with the RABL5 Alu1, Alu2, and Alu3 were done by PCR opening of the plasmid lacking the specific Alu and ligation with a fragment of 270 intronic-nucleotides taken from a PCR amplification directed to the IKBKAP gene intron number 20 . The 800-nucleotide insertion1 was taken from PCR amplification directed to the IMP gene intron number 11 . Insertion2 is a 25-bp sequence, free of any known splicing regulatory elements, that was doubled or tripled into 50-bp and 75-bp sequences, ( 5′CTATCTGATAAGCTGCGAGCAATT3′).The . The upper PCR product was Topo-ligated (Invitrogen) and sequenced. The primers used were: forward (exon 2), 5′CAGAATCTTCTGACATCACTG3′; or forward (intron 2), 5′GTGAGCCCTGACAAATCTGTGT3′; and reverse (exon 3) 5′GTTGCTGGTAACATGCGGGTTC3′.Endogenous PCR amplification was done on a cDNA template originating from a neuroblastoma cell-line (SH-SY5Y). Amplification was performed for 30 cycles, consisting of denaturation for 30 seconds at 94°C, annealing for 45 seconds at 52°C or 56°C, and elongation for 1 minute at 72°C. The products were separated in a 1.5% agarose gelFor details see Figure S1Intron length distribution of human introns.(0.17 MB DOC)Click here for additional data file.Figure S2A screen shot created by the UCSC genome browser.(1.44 MB DOC)Click here for additional data file.Figure S3Potential dsRNA of AluJo+ and AluSx-.(0.51 MB DOC)Click here for additional data file.Text S1Minigenes' sequence.(0.03 MB DOC)Click here for additional data file.Text S2Alu intronic sequence from intron 20 of IKBKAP gene.270 nucleotides non-(0.02 MB DOC)Click here for additional data file.Text S3800 nucleotides intronic sequence from intron 11 of IMP gene.(0.02 MB DOC)Click here for additional data file.

This variation has influenced disease progression among the infected and necessitated the search for alternative drugs with novel targets. Though successfully used in developed countries, these novel drugs are still limited in resource-poor countries. The aim of this study was to determine HIV-1 subtypes, recombination, dual infections and viral tropism of HIV-1 among Kenyan patients prior to widespread use of antiretroviral drugs.Infection with HIV-1 is characterized by genetic diversity such that specific viral subtypes are predominant in specific geographical areas. The genetic variation in HIV-1 gag, pol and env genes was carried out followed by automated DNA sequencing.Remnant blood samples from consenting sexually transmitted infection (STI) patients in Nairobi were collected between February and May 2001 and stored. Polymerase chain reaction and cloning of portions of HIV-1 Twenty HIV-1 positive samples were analyzed. The average age of males (32.5 years) and females (26.5 years) was significantly different . Phylogenetic analysis revealed that 90% (18/20) were concordant HIV-1 subtypes: 12 were subtype A1; 2, A2; 3, D and 1, C. Two samples (10%) were discordant showing different subtypes in the three regions. Of 19 samples checked for co-receptor usage, 14 (73.7%) were chemokine co-receptor 5 (CCR5) variants while three (15.8%) were CXCR4 variants. Two had dual/mixed co-receptor use with X4 variants being minor population.HIV-1 subtype A accounted for majority of the infections. Though perceived to be a high risk population, the prevalence of recombination in this sample was low with no dual infections detected. Genotypic co-receptor analysis showed that most patients harbored viruses that are predicted to use CCR5. The HIV/AIDS epidemic is a major global public health crisis. Currently, an estimated 33 million people worldwide are living with HIV-1 infection. The majority of cases 67%) are in sub-Saharan Africa . Evoluti7% are inHIV requires a co-receptor [initially chemokine (C-C motif) receptor5 (CCR5)] for entry into its host to facilitate primary infection irrespective of the transmission route and the predominant viral tropism present in the donor . Most HIStudies have shown that AIDS progression differs as a function of the infecting subtype and viral tropism ,16. StudAntiretroviral therapy (ART) using nucleoside- and non-nucleoside reverse transcriptase inhibitors (NRTIs and NNRTIs) as well as protease inhibitors (PIs) has sharply reduced HIV morbidity and mortality in developed countries but has created the problem of drug resistance. Drug resistance mutations associated with most regimens have previously been described -21. The The aim of this study was to determine HIV-1 subtypes, recombination and dual infections among Kenyan patients before antiretroviral therapy became widely available. We further investigated co-receptor use among common infecting subtypes for alternative therapy with envisaged treatment failure.The study was carried out at the special treatment center in Nairobi. The center has been specially established to offer subsidized health services to individuals with sexually transmitted infections (STIs). After informed consent and ethical approval from the National ethical committee through Kenya Medical Research Institute, sociodemographic data (age and gender) were obtained for each individual using a self-reporting questionnaire. Three mililiters of remnant blood samples from volunteer patients, aged 18 years and above, were collected and shipped to the laboratory. The patients were not followed up after the initial sample collection. At the laboratory, the samples were tested for HIV antibodies by ImmunocombII HIV1 & 2 Bispot and confirmed using an enzyme immunosorbent assay . Confirmed positive samples were separated into plasma and lymphocytes by density gradient centrifugation. Plasma and buffy coats were stored at -80°C until use. Genomic DNA was extracted from buffy coats using DNAzol lysis and ethanol precipitation.A portion of the HIV-1 gag gene (covering amino acid 132 of p24 to amino acid 20 of p7) was amplified as previously described . PortionCloning of amplified DNA fragments was performed as described before . Sequencgp120. Even though other parts of the genome seem to influence co-receptor usage, this has remained more reliable in resource-poor settings where phenotypic assays are expensive. Genotypic methods use simple rules, such as the 11/25 rule which predicts X4 merely on the basis of the presence of basic side chains in residues 11 or 25 of the V3-loop (35 amino acids). This method also uses the overall net charge of the 35 amino acids in the V3 loop; showing R5 viruses with a net charge of 5 or less and X4 viruses with a net charge of more than 5 [Genotypic predictions of co-receptor usage take the relevant parts of the viral genome - V3-loop - which is a third highly variable loop of e than 5 . Based oe than 5 . To imprTwenty HIV-1 positive blood samples were analyzed in this study. Of these, nine were from males and 11 from females. The age difference between males (32.5 years) and females (26.5 years) was highly significant . Study patients' characteristics are shown in table env gene but was classified as a pure subtype A1 since it amplified in pol and gag. Sequences from two samples (10%) were discordant, showing different subtypes in the analyzed regions. No dual infections were observed. All male patients were infected with concordant subtypes . The two samples with discordant subtypes and three with subtype D were found in females' blood samples. Table gag, pol and env are shown in figures The sample sequences were assigned to subtypes if at least two gene fragments were successfully amplified. Phylogenetic analysis revealed that 18 (90%) were concordant subtypes and clustered together with respective reference sequences from the HIV database. However, one sample did not amplify in the env gene despite having been amplified in the other two genes. In this region 11 were subtype A1, 3 were subtype A2, 2 were subtype C and 3 were subtype D. Fourteen samples (73.7%) were R5 variants, while three were X4 variants. One sample among subtype A1 had mixed co-receptor usage. One sample among subtype A2 had X4 using virus while another had mixed co-receptor usage. Among subtype D, 2 samples had X4 and one sample had R5 variants, respectively. All subtype C sequences were R5 variants (Table Nineteen samples were checked for viral tropism; one sample could not be successfully amplified and cloned in the In the current study, 20 samples were studied and found to habour diverse HIV-1 subtypes. Majority of sequences were subtype A1. This is in agreement with previous reports that have also shown continuous evolution of HIV-1 subtype A to form sub-subtypes which have been reported in different continents ,27,28. TIn this study, prevalence of recombination among STI patients was comparatively low despite the fact that STI patients are considered to be a high risk population. Although we employed a commonly used subtyping methodology, the absence or presence of recombination in the three gene fragments that were analyzed does not exclude the possibility of recombination elsewhere. Furthermore, our sample size was small. Nonetheless, the possibility of recombination and emergence of newer strains is likely as infected populations move from areas with high prevalence into Nairobi in search of better living standards. From our observation of gender and age, the likelihood that our patients were primarily female prostitutes and their male customers cannot be ruled out. Since our sample population was a self selected type, it may not reflect HIV dynamics in the general population at the time of sampling. This calls for continued monitoring of circulating HIV-1 subtypes and drug resistance in the general population as treatment options become increasingly available in resource-poor settings. This will eventually help in understanding the dynamics of HIV strains locally and in the region for better management of the infected.Co-receptor tropism of any given HIV isolate is closely associated with disease progression. HIV-1 co-receptor use in this study was predicted based on the amino acid composition of the V3 loop. Though this genotypic assay is less sensitive and need validation, it is relatively fast and less expensive especially in resource-poor settings. However, the use of this method to check for co-receptor usage might have affected the outcome. A more sensitive and reliable phenotyping assay would be ideal to elucidate this.When using entry inhibitors in therapy, monitoring viral tropism will allow prediction of drug efficacy to avoid treatment failure ,31. EvenHIV-1 diversity and viral tropism have emerged as major aspects in HIV therapy. Since different quasispecies can be present in patients, some are likely to outgrow others when subjected to non suppressive therapy leading to resistance and treatment failure. This is bound to complicate treatment options with the upscaling of ART in resource-poor settings. In Kenya, this is expected to lead to increased drug resistance among drug-naïve patients hence requirements for alternative drugs. Entry of new drugs with novel targets into the market will require that subtype and viral tropism determination be done before start of treatment. This, along with proper laboratory monitoring, will help in deciding best options for those infected with mixed viral populations at a time when more patients are presenting with HIV-1 subtypes that are resistant to available drugs.The authors declare that they have no competing interests.RWL conceived/designed the study, carried out the molecular genetic studies and drafted the manuscript. EMS and FAO participated in study design and coordination. EPM participated in designing the study and manuscript preparation. SAK participated in sequence alignments and manuscript preparation. RML participated in sequence alignments. NJL carried out blood separation. JKM performed serological assays. JGK did DNA extraction. All authors read and approved the final manuscript.Sequence dataAY706249 - AY706310; pol, AY704471-AY704549; env, AY705549-AY705652Sequences generated from this study were deposited at the gene bank under accession numbers: gag, The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2334/9/215/prepub

Schizosaccharomyces pombe Rec12 protein, the homolog of Spo11 in other organisms, initiates meiotic recombination by creating DNA double-strand breaks (DSBs) and becoming covalently linked to the DNA ends of the break. This protein–DNA linkage has previously been detected only in mutants such as rad50S in which break repair is impeded and DSBs accumulate. In the budding yeast Saccharomyces cerevisiae, the DSB distribution in a rad50S mutant is markedly different from that in wild-type (RAD50) meiosis, and it was suggested that this might also be true for other organisms. Here, we show that we can detect Rec12-DNA linkages in +Sc. pombe rad50 cells, which are proficient for DSB repair. In contrast to the results from Sa. cerevisiae, genome-wide microarray analysis of Rec12-DNA reveals indistinguishable meiotic DSB distributions in +rad50 and rad50S strains of Sc. pombe. These results confirm our earlier findings describing the occurrence of widely spaced DSBs primarily in large intergenic regions of DNA and demonstrate the relevance and usefulness of fission yeast studies employing rad50S. We propose that the differential behavior of rad50S strains reflects a major difference in DSB regulation between the two species—specifically, the requirement for the Rad50-containing complex for DSB formation in budding yeast but not in fission yeast. Use of rad50S and related mutations may be a useful method for DSB analysis in other species.The fission yeast rad50S, differs markedly from that in a dmc1 mutant, in which DSBs also accumulate and appear to have a more nearly wild-type distribution. We have detected in fission yeast a DNA–protein intermediate of recombination assumed to exist, but never before detected, in a recombination-proficient strain (+rad50). The distributions of this intermediate, and therefore those of DSBs, in +rad50 and rad50S strains are indistinguishable. rad50S-like mutations may also accurately reflect the wild-type DSB distribution in other species and may be particularly useful in species lacking Dmc1 orthologs.During meiosis, which creates haploid gametes from diploid cells, recombination between two homologous chromosomes increases genetic diversity and, in most organisms, is crucial for proper segregation of chromosomes into haploid nuclei. To better understand where recombination occurs and why it occurs there, we investigated in fission yeast the initiating step in recombination—formation of DNA double-strand breaks (DSBs). A genome-wide DSB map is crucial to understand how DNA sequence and chromatin structure affect DSB formation and may help answer these questions in other organisms, including humans. Mutants in which DSBs accumulate are particularly useful for determining the DSB distribution. As recently reported, however, in budding yeast the DSB distribution in one such widely used mutant, Sexual reproduction involves the fusion of two gametes to create diploid offspring with equal genetic contributions from each parent. To maintain the proper chromosome number (ploidy), it is therefore necessary for the gametes to be haploid. This is achieved via meiosis, where a single round of DNA replication is followed by two nuclear divisions: in the first division, homologous chromosomes (homologs) separate from each other (Meiosis I), followed in the second division by the separation of sister chromatids (Meiosis II). Meiotic recombination, a highly conserved feature of meiosis, creates between the homologs a physical connection that is necessary in most species for proper homolog segregation during Meiosis I.Saccharomyces cerevisiae or its ortholog Rec12 in the fission yeast Schizosaccharomyces pombeBefore the first meiotic division, homologs become aligned and then intimately synapsed e.g. by tiling microarray hybridization. In wild-type cells the Spo11 protein is removed from the DNA end by endonuclease action before strand resection occurs rad50S mutants, the bound Spo11 or Rec12 protein is not removed from the DNA ends, repair of the DSB by recombination is blocked, and the protein-bound DSBs accumulate rad50S mutation. These comprehensive DSB maps revealed in both organisms regions of DNA within which DSBs are made at high frequency, called DSB hotspots As a type II topoisomerase-like protein, Spo11 (or Rec12) breaks phosphodiester bonds in the two DNA strands and becomes covalently bound to each 5′ DNA end of the DSB rad50S mutant was used. It had previously been observed that DSBs in S. cerevisiae strains with a rad50S mutation did not show in many regions of the genome the same DSB pattern as that in dmc1 Δ mutants rad50S strains dmc1 mutant; dmc1 mutants lack a protein important for strand exchange, and DSBs with resected ends accumulate in these mutants. The enriched ss DNA was hybridized to a genome-wide tiling microarray of oligonucleotides to identify sites of DSBs. The results showed, in many but not all regions of the genome, a clear under-representation of DSB hotspots in rad50S-like mutants compared to the distributions in the wild type or dmc1Δ mutant, which appear similar by Southern blot analysis. Specifically, the intensity of breakage at some, but not all, DSB hotspots was greatly reduced in the rad50S-like mutants compared to that in the wild type or dmc1Δ mutant. The validity of DSB maps created with rad50S mutants, not only in S. cerevisiae but in other organisms as well, is therefore under new scrutiny.Two recent studies S. pombe are preferentially located in large intergenic regions and are widely-spaced – on average there are about 65 kb between hotspots – but these experiments were done with rad50S mutants +rad50) strain has a DSB map similar to that seen in rad50S mutants. ChIP experiments to detect the Spo11-DNA covalently linked intermediates in RAD50 strains of budding yeast have not been successful +rad50) Rec12-DNA complexes. To our knowledge, this is the first time that this protein-DNA intermediate has been detected in recombination-proficient cells. We report here that the locations of DSBs, measured as Rec12-DNA linkages, across the genome in +S. pombe rad50 meiosis are indistinguishable from those in rad50S strains, although the intensities are lower, as expected due to ongoing DSB repair in +rad50 strains. Therefore, conclusions from our earlier studies using the rad50S mutation are still valid: in particular, DSBs are separated by large distances and are preferentially located in large intergenic regions +rad50 and rad50S strains) display non-congruence in S. pombe. We discuss the significance of these observations for studies of meiotic recombination in S. pombe and in other species, including humans.Our lab has reported that DSB hotspots in +rad50 and rad50S strains by assaying DSBs using standard Southern blots. +rad50 and rad50S strains were meiotically induced . Thus, the double swi5Δ rhp57Δ mutant is an ideal candidate for assaying defective DSB repair at a stage later than the rad50S repair defect, allowing for DSB accumulation in a non-rad50S strain. Southern blot analysis of NotI fragments K , while DSB coldspots gave no detectable signal +rad50 meiosis, or if Rec12 was removed from the DNA too quickly to be detected, as appears to be the case in budding yeast ade6-3049 on chromosome III mbs1 on chromosome I, revealed that DNA isolated 3.5 h after induction of meiosis was considerably enriched by ChIP when compared to 0 h (uninduced) DNA, based on the relative abundance of PCR products. This was true for DNA from a +rad50 strain as well as from a rad50S strain, though as expected enrichment was lower in the +rad50 strain due to ongoing repair of the DSBs or at 6 h after meiotic induction (after DSB repair). The maximal signal was at 3.5 h, which is about the time of maximal DSBs detectable by Southern blots in +rad50 strains and extracted the material with phenol. Protein-linked DNA is removed from the aqueous phase by phenol extraction mbs1 and ade6-3049 DSB hotspots was removed by phenol extraction, as expected for DNA covalently linked to Rec12 protein, unless the extracted material was treated with a protease before extraction. This was true for material from both +rad50 and rad50S strains . The relative frequency of Rec12-DNA linkage at each probe position was measured as the median-normalized ratio of IP signal to WCE signal. The 0 h data [log (IP/WCE) values] were normally distributed, as expected for random background data meiosis than in rad50S meiosis, as measured by the enrichment for accumulated ss DNA ends RAD50 (dmc1Δ) the level of breakage in rad50S falls below the authors' definition of a hotspot. We note in particular that the DSB patterns surrounding the centromeres in rad50S and +rad50 strains are indistinguishable in S. pombe .Closer examination of one hotspot from each of periment . This 3- similar , suggest+rad50 and rad50S; i.e., are the probes with high IP/WCE ratios in +rad50 also high in rad50S? For each of the ∼44,000 probes on the microarray, the IP/WCE ratio from the 3.5 h +rad50 DNA was plotted against the IP/WCE ratio of the 5 h rad50S DNA; these are the times of maximal DSB levels in the two strains (rad50S 5 h (induced) DNA showed, however, no significant enrichment in the +rad50 0 h (non-induced) DNA DNA , and S9Aced) DNA and S5. d rad50+ . These d+S. pombe rad50 and rad50S meiotic datasets, the correlation between the RAD50 (dmc1Δ) and rad50S enrichment ratios of S. cerevisiae is much weaker (RAD50 (dmc1Δ) meiosis than in rad50S meiosis, as well as other probes that show similar high enrichment ratios in both. This is expected, given loci where DSBs are frequent in both RAD50 (dmc1Δ) and rad50S meiosis and other loci where DSBs are frequent only in RAD50 (dmc1Δ) Compared to the correlation between the h weaker , and S9Brad50S and +rad50 data from S. pombe, we identified regions of significant ChIP enrichment using ChIPOTle p value cutoff of 0.001. Due to the accumulation of Rec12-DNA intermediates, Rec12 ChIP enrichment over background should be greater in the rad50S experiments. As the p value that ChIPOTle attaches to peaks is dependent on their degree of enrichment over background, peaks can be detected with greater sensitivity in the rad50S experiments. Therefore, for any given significance threshold, if the same pattern of DSBs occurs in both the rad50S and +rad50 experiments, we expect some peaks (the stronger ones) to be detected in both sets of experiments but other peaks (the weaker ones) to be detected only in the rad50S experiments. This is what we observed. Combining the two independent inductions in the 5 h rad50S and the 3.5 h +rad50 data, respectively, but 4.9% of the genome was enriched in both. Therefore, there is no significant class of peaks identified in the +rad50 data that do not have equivalents in the rad50S data. In contrast, in S. cerevisiaeRAD50 (dmc1Δ) strain, and 32% in the rad50S strain, but 31% of the genome was enriched in both. Therefore, in S. cerevisiae there is a significant class of probes that are enriched only in the RAD50 (dmc1Δ) background, as well as probes that are enriched in both backgrounds.As another way of comparing the meiotically induced ductions and S2, S. pombe data, an average of 255 significant peaks was detected in the two 3.5 h +rad50 datasets, and 427 in the two 5 h rad50S datasets. Essentially all (94%) of the +rad50 peaks were present in the corresponding rad50S datasets , but only 48% of rad50S peaks were present in the +rad50 dataset. That is, there are almost no peaks detectable in the +rad50 background that are not detected in the rad50S background. The larger number of peaks identified in the rad50S background is expected from the greater peak detection sensitivity of ChIPOTle using the rad50S dataset, as discussed above. For probes showing enrichment in either the 3.5 h +rad50 or 5 h rad50S datasets, the rad50S enrichment ratio is consistently ∼3 fold higher than the +rad50 enrichment ratio (S. cerevisiaerad50S peaks overlap with RAD50 (dmc1Δ) peaks but only 60% of 1816 RAD50 (dmc1Δ) peaks overlap with rad50S peaks. That is, there is a substantial number of loci (hotspots) where significant DNA breakage is seen in the RAD50 (dmc1Δ) strain but not in the rad50S strain, as well as other loci where significant breakage is seen in both strains cells allowed us to compare the genome-wide distribution of these linkages, and hence meiotic DSBs, in +rad50 strains and the more thoroughly studied rad50S strains. Our results show that the genomic distributions of S. pombe meiotic DSBs in these strains are indistinguishable complex, binds and acts on this intermediate. In S. cerevisiae this step may be very fast.An analysis of DSBs by ChIP of the Spo11 protein in a strains , and S5 strains , and S5 rad50S mutation behave differently in these two yeasts? The answer may lie in the differential dependence on the MRN (MRX in S. cerevisiae) complex for DSB formation in these two distantly related yeasts. S. cerevisiae rad50Δ and mre11Δ mutants do not form DSBs S. pombe rad32Δ (mre11 homolog) and rad50Δ mutants form DSBs with the same kinetics as rad50S mutants, although none of these mutants repair the DSBs Why does the rad50S mutation commonly used in both organisms changes the same amino acid of the protein (Lys81→Ile81) rad50S mutant does not form the full number of DSBs in budding yeast rad50S (K81I) mutant is incompetent (or less competent) compared to RAD50 to activate DSB formation at some sites or regions but not at others. Thus, not all hotspots are revealed in S. cerevisiae rad50S (K81I) strains dmc1 mutants, a more complete spectrum of hotspots would, in this view, be activated by the wild-type MRX complex, as observed S. pombe may be the basis for the rad50S mutation having no discernible effect on the distribution of DSBs in fission yeast. The decision to make DSBs is made before MRN's meiotic activity on DNA, making MRN unnecessary for the formation – but not the processing – of meiotic DSBs. Thus, in S. pombe the entire spectrum of DSBs, with readily detectable Rec12-DNA complexes, is observed. In S. cerevisiae and other species in which Rad50 is required for DSB formation, rad50 mutants with an amino acid substitution other than Rad50 (K81I) The rad50S strains S. cerevisiae is due at least in part to a lower DSB frequency and more restricted DSB distribution in a rad50S strain than in a dmc1Δ strain, which appears to be more representative of wild-type meiosis. Our results in wild-type (+rad50) S. pombe meiosis reveal the same DSB pattern as that seen in earlier studies of rad50S mutants +rad50) meiosis have in the past been problematic, primarily because the repair of DSBs in wild-type strains prevents all of the meiotic DSBs from being analyzed and low-level breaks can be missed. While there may be low-level DSBs dispersed across the S. pombe genome and not detected in our analysis, it is clear that there are essentially no DSB hotspots in +rad50 that are not present in rad50S , GP3718 (h+ ade6-3049 pat1-114 rad50S end1-458), GP6203 (h−/h− ade6-3049/ade6-3049 pat1-114/pat1-114 rad50S/rad50S rec12-201::6His-2FLAG/rec12-201::6His-2FLAG +/his4-239 lys4-95/+), and GP6232 (h−/h− ade6-3049/ade6-3049 pat1-114/pat1-114 rec12-201::6His-2FLAG/rec12-201::6His-2FLAG +/his4-239 lys4-95/+). Alleles were described previously Strains used were GP1979 Figure S1FACS Analysis Shows the Majority of Cells Were in G1 Phase after Nitrogen Starvation at the Start of Meiosis in Both Strains GP6203 and GP6232. After meiotic induction by the addition of nitrogen and shift to high temperature, each strain underwent a nearly synchronous meiosis, with DNA replication occurring between 2 and 3 h.(0.05 MB PDF)Click here for additional data file.Figure S2+rad50 and rad50S Strains. DNA from meiotically induced strains was digested with NotI, and the fragments separated by pulsed-field gel electrophoresis. Inductions were performed concurrently with +rad50 and rad50S strains. (A) The blots were probed on the left end of the 480 kb NotI restriction fragment K of chromosome I. (B) The same blots were probed on the left end of the 1.2 Mb NotI restriction fragment D of chromosome I. On the right are lane traces of the time of maximal DSBs [3.5 h +rad50 (dark lines) and 5 h rad50S (light lines)] for each probing. Data from +rad50 are from an induction independent of that shown in NotI fragment D from rad50S are shown in Cromie et al. Southern Blots Reveal Indistinguishable DSB Hotspots in (4.6 MB TIF)Click here for additional data file.Figure S3+rad50 and rad50 Strains. DNA from meiotically induced +rad50 (GP6232) and rad50S (GP6203) cells was extracted either with or without Proteinase K digestion followed by phenol-chloroform extraction, ethanol precipitation, MluI digestion, and ethanol precipitation, similar to the method of Keeney et al. +rad50 (left panels) and rad50S (right panels) strains with Proteinase K digestion than without, indicating that a significant amount of DSB DNA was bound by Rec12 in both cases. Quantitation of the gels is shown on the far right. The MluI restriction fragments with ade6-3049 (top panels) and mbs1 (bottom panels) are 28.2 and 20.9 kb, respectively. The probe for ade6-3049 extends from bp 1309506 to bp 1310549 on chromosome III (accession # NC_003421.2); the probe for mbs1 extends from bp 768436 to bp 769496 on chromosome I (accession # NC_003424.3).Rec12 Is Bound to DSB Ends in Both (0.3 MB PDF)Click here for additional data file.Figure S4rad50S h and 3.5 h +rad50 Data. Quantile-quantile (Q-Q) plots are of IP/WCE hybridization ratios (log10) for +rad50 data closely follow this background expectation, while the 5 rad50S h and 3.5 h +rad50 data have many high IP/WCE ratios clearly above those expected from the normal distribution, as expected for Rec12-DNA enrichment at linkage sites.Rec12 IP/WCE Enrichment Is Seen Only in the 5 (0.1 MB PDF)Click here for additional data file.Figure S5S. pombe Genome. Shown are the median-normalized IP/WCE hybridization ratios from experiment 2 (+rad50 strain GP6232 at 3.5 h after meiotic induction and rad50S strain GP6203 at 5 h) are in red. Data from uninduced (0 h) cells (+rad50 strain GP6232) are in blue. Where peaks go off-scale, the peak maximum is indicated. The data are neither smoothed nor filtered for spurious values, except for removal of 25 data points for ∼10.7 kb of DNA deleted in the rad50S strain GP6203 between direct repeats at bp 2929282–2931720 and 2939711–2942292 on chromosome I (Accession: NC_003424.3) (unpublished data). These ∼2.5 kb repeats have identities at both ends but an ∼150 bp internal region of non-homology. These 25 data points have spuriously low hybridization values for DNA from the WCE, as expected for a deletion. The strong peak seen in the 0 h data for chromosome III occurs at the site of the ade6-3049 break hotspot. It is not clear why this peak is present in the 0 hr data. It is absent from the 0 hr experiments in Rec12-DNA Linkages across the Entire riment 2 . Data fr(1.9 MB PDF)Click here for additional data file.Figure S6+rad50 Are Also DSB Hotspots in rad50S; In S. cerevisiae Microarray Experiments Many Probes Show Greater Meiotic DSB Hotspot Activity in dmc1Δ Mutants Than in rad50S Mutants. The IP/WCE ratio of each probe in the +rad50 microarray hybridization is plotted against the IP/WCE ratio of the same probe in the 5 h rad50S microarray hybridization. The plots are on a log scale. Color indicates density of plotted points with yellow highest and dark blue lowest, calculated by superimposing a grid with spacing 10 0.01 on the chart and coloring all points within each grid square based on the number of points in that square. (A) The 3.5 h +rad50 IP/WCR ratios are positively correlated with those of the 5 h rad50S data. All probes enriched by IP of the +rad50 DNA are enriched in the rad50S DNA and vice versa. (B) The uninduced (0 h) +rad50 IP/WCR ratios show no correlation with those of rad50S, as expected for uninduced background signals. These data are from experiment 1 or meiotic dmc1Δ spo11-Y135F (inactive Spo11) microarray hybridization (D) is plotted against the enrichment ratio of the same probe in the meiotic rad50S microarray hybridization. The plots are on a log scale. Some probes show similar enrichment in the dmc1Δ and rad50S datasets, while others are much more highly enriched in the dmcΔ dataset (C). No probes enriched in the rad50S dataset show significant enrichment in the negative control dmc1Δ spo11-Y135F dataset (D). Color indicates density of plotted points as above. The number of points per grid square ranged from 1 to 22 in C and 1 to 6 in D.All DSB Hotspots Detected in riment 1 ; similarriment 1 . The num(2.7 MB PDF)Click here for additional data file.Figure S7rad50S Datasets of S. pombe Compared to the 3.5 h +rad50 Datasets; In Contrast, Many Probes Show Enrichment Only in the Meiotic dmc1Δ Datasets and Not the rad50S Datasets of S. cerevisiae. (A) A frequency histogram of the log10 [/] for probes showing enrichment (Rec12 IP/WCE≥10) in either the S. pombe 5 h rad50S (top) or the 3.5 h +rad50 (bottom) conditions from rad50S condition (average log10 ratio between conditions of ∼−0.5). A similar result was obtained using 10 [/] for probes showing enrichment (enrichment ratio≥10) in either the rad50S (top) or the dmc1Δ (bottom) conditions from rad50S condition, enrichment ratios are similar in the rad50S and dmc1Δ conditions (average log10 ratio between conditions of ∼0). In contrast, for many probes showing enrichment in the dmc1Δ condition, the rad50S enrichment ratio is much lower, giving significantly higher average log ratios between conditions.Enriched Probes Are Consistently ∼3-Fold More Highly Enriched in the 5 h (0.1 MB PDF)Click here for additional data file.Figure S8+rad50 Meiosis. DNA from meiotically induced cells with the ade6-3049 hotspot was treated with Proteinase K, digested with AflII, electrophoresed through an alkaline agarose gel , and analyzed by Southern blot hybridization using two probes for the right end of the 6.6 kb AflII fragment containing ade6. Each probe was specific for either the strand with 3′-ends or the strand with 5′-ends at the DSBs as indicated. DNA from three independent experiments using strains GP6232 (+rad50) and GP3718 (rad50S) harvested at the indicated time after meiotic induction was analyzed in panels A, B, and C. [32P]-labelled 1 kb Plus DNA markers (Invitrogen) were run on the gels; white arrowheads indicate the 1 kb fragment. Line traces from phosphorimage analysis are from the times and strains indicated with an asterisk. Note that the peaks with 3′-strand probes (red lines) and 5′-strand probes (blue lines) nearly coincide, indicating that the complementary strands have indistinguishable end points at the DSBs. In DNA from +rad50 DNA the peaks are sharper and more intense with 3′-strand probes than with 5′-strand probes, indicating that the 3′-ends undergo less resection than 5′-ends, as expected from ongoing DSB repair in +rad50 strains.Full-length DNA Strands with 5′ and 3′ Ends at DSBs Appear in (0.4 MB PDF)Click here for additional data file.Figure S9+rad50 and 5 h rad50S Data; A Much Weaker Correlation Is Seen between the Meiotic DSB Enrichment Ratios of dmc1Δ and rad50S Mutants of S. cerevisiae. (A) Probes were ranked by the 5 h rad50S IP/WCE ratio from S. pomberad50S and log 3.5 h +rad50 ratio values and then between the log 5 h rad50S and log 0 h +rad50 ratio values. R2 values, representing the association between the paired ratios, are plotted against the ordered five-centile groupings . (B) Probes were ranked by the meiotic rad50S IP/WCE ratio from S. cerevisiae, taken from rad50S and log meiotic dmc1Δ ratio values and then between the log meiotic rad50S and log meiotic dmc1Δ spo11-Y135F (negative control) values. R2 values, representing the association between the paired ratios, are plotted against the ordered five-centile groupings .IP/WCE Ratios for Rec12-Enriched Probes Are Highly Correlated between the 3.5 h (0.3 MB PDF)Click here for additional data file.Figure S10+rad50 and rad50S Backgrounds. (A) The 5 h Rec12 IP/WCE ratio of each probe in the second rad50S microarray hybridization (rad50S microarray hybridization (+rad50 microarray hybridization (+rad50 microarray hybridization (A Consistent Subset of Probes Shows Rec12 IP/WCE Enrichment across Hybridizations in Both dization is plottdization . (B) Thedization is plottdization . In both(0.1 MB PDF)Click here for additional data file.Dataset S1rad50S) before (0 h) and 3.5 h after meiotic induction and from strain GP6232 (+rad50) before (0 h) and 5 h after meiotic induction.Median-normalized Genome-wide IP/WCE Hybridization Ratios from Experiment 1. Data are from strain GP6203 ((7.9 MB XLS)Click here for additional data file.Dataset S2rad50S) before (0 h) and 3.5 h and 4 h after meiotic induction and from strain GP6232 (+rad50) 5 h after meiotic induction.Median-normalized Genome-wide IP/WCE Hybridization Ratios from Experiment 2. Data are from strain GP6203 ((7.8 MB XLS)Click here for additional data file.

A monoclonal antibody (MAb), 4D5, specifically recognising an extracellular epitope of the c-ErbB-2 protein, inhibited the growth of human gastric cancer overexpressing c-ErbB-2 severe combined immunodeficient (SCID) mice. This antibody also reduced the mass of established tumours xenografted into SCID mice, whereas gastric cancer not expressing c-ErbB-2 exhibited no regression in response to 4D5 treatment. In addition, administration of 4D5 prevented colonisation of cancer cells and prolonged the survival of host SCID mice inoculated i.v. with c-ErbB-2-overexpressing tumour cells. This is the first reported study to show that treatment with a single antibody specific to c-ErbB-2 prolongs the survival of host SCID mice bearing xenotransplanted tumours.

Infection control depends on adequate microbe recognition and cell activation, yet inflammatory response may lead to organ dysfunction in sepsis. The aims of this study were to evaluate cell activation in the context of sepsis and its correlation with organ dysfunction.A total of 41 patients were prospectively enrolled: 14 with sepsis, 12 with severe sepsis and 15 with septic shock. A total of 17 healthy volunteers were included as a control group. Patients were admitted to the Intensive Care Units and Emergency Rooms of Hospital Sao Paulo and Hospital Santa Marcelina, Sao Paulo, Brazil. Toll-like receptor (TLR)2, TLR4, CD11b, CD11c and CD66b expression on neutrophil surfaces and oxidative metabolism measured by non-fluorescent dichlorofluorescein (DCFH) oxidation in neutrophils and monocytes, using whole blood, were evaluated using flow cytometry. Organ dysfunction was measured using the sepsis-associated organ failure assessment (SOFA) score.Staphylococcus aureus . A strong correlation was observed between neutrophil and monocyte oxidative metabolism. A SOFA score of 7 discriminated patients between survivors and non-survivors (area under the curve for reactive oxygen species (ROS) was 0.78; p = 0.02). ROS generation in patients with sepsis and septic shock with SOFA scores > 7 was higher than in patients with SOFA scores < 7, both in neutrophils and monocytes. However, oxidative burst in patients with sepsis was as high as in septic shock.TLR2 expression on neutrophils was found to be downregulated in septic shock patients compared to healthy volunteers (p = 0.05). No differences were found in CD11b and CD11c expression. CD66b expression was increased in the patient group compared to the control group (p = 0.01). Neutrophil and monocyte oxidative burst was increased in septic patients compared to the control group at baseline and after stimulation with phorbol myristate acetate (PMA), formyl-methionyl-leucyl-phenylalanine (fMLP), lipopolysaccharide (LPS) and Surface receptors expression on neutrophils may be modulated across the continuum of sepsis, and enhanced or decreased expression may be found depending on the receptor considered. ROS generation is upregulated both in neutrophils and monocytes in septic patients, and it is differently modulated depending on the stage of the disease and the stimuli used. Severe sepsis and septic shock present with high incidence, morbidity and mortality, and are the most common causes of death in intensive care units . The oveThe pathogenesis of sepsis involves a complex interaction between host and infecting microorganism, including bacterial recognition, cell activation and transmigration, phagocytosis and destruction of the pathogen -6. BacteOnce primed by bacterial products and endogenous mediators -16, neut2-), which is in turn converted to hydrogen peroxide (H2O2) through a reaction catalyzed by superoxide dismutase. In turn, H2O2 is a substrate for the generation of other potent oxidants [Invading pathogens are phagocytosed and killed through a potent arsenal of enzymes, cationic proteins, reactive oxygen species (ROS), reactive nitrogen species (RNS), and so on, released into the phagosomes ,22. ROS oxidants ,16,23.ROS generation has been reported to be upregulated in neutrophils from septic patients compared to healthy volunteers upon stimuli with bacterial products and components such as LPS and formyl-methionyl-leucyl-phenylalanine (fMLP) ,24. ModuIn the present study, we evaluated the expression of TLR2, TLR4, CD11b, CD11c and CD66b on the cell surface of neutrophils in patients with sepsis, severe sepsis and septic shock, and compared the findings with those from healthy volunteers. We further evaluated neutrophil and monocyte activation through ROS production, and correlated cell activation and organ dysfunction measured by the sepsis-associated organ failure assessment (SOFA) score .et al. [et al. [The study population consisted of 41 patients admitted to the Hospital Sao Paulo and Hospital Santa Marcelina, who met at least three clinical criteria for sepsis (14 patients), severe sepsis (12 patients) and septic shock (15 patients) as previously described by Bone et al. and revi [et al. . PatientStaphylococcus aureus, Staphylococcus coagulase negative, Escherichia coli, Providencia spp, Klebsiella sp, Proteus sp, Acinetobacter and Enterococcus faecalis. A total of 60% of the infections were due to Gram-negative microorganisms. The 28-day mortality rate was 24.4% (10/41) and hospital mortality was 36.6% (15/41). Comorbidities were present in 58.5% of the patients, the most found been hypertension, diabetes, congestive heart failure, chronic obstructive pulmonary disease and chronic renal failure. Organ dysfunction was assessed by the SOFA score and was evaluated at day 1 of admission in the severe sepsis and septic shock groups. The median SOFA score was 4.5 in severe sepsis, ranging from 1 to 12 in this group, and 8.5, ranging from 4 to 16, in the septic shock group (p = 0.01). Demographic data, comorbidities, SOFÁ score and outcome of septic patients are expressed in Table The mean age and standard deviation of patients was 55.1 ± 20.2 years, and 69% were male. Infection was due to pneumonia (48.7%), urinary tract infection (19.5%), peritonitis (14.6%), bloodstream infection (9.7%) and/or other sources/more than one source of infection (19.5%). Cultures were positive in 10 patients for the following microorganisms: For blood samples, 5 ml of blood were drawn from both healthy volunteers and septic patients into heparin-treated vacuum tubes and 5 ml into ethylenediaminetetraacetic acid (EDTA)-treated tubes .The monoclonal antibodies used were as follows: CD66b-fluorescein isothiocyanate (FITC) clone G1OF5; CD11b-allophycocyanin (APC) clone D12; CD11c-APC clone S-HCL-3 and isotype control mIgG2b-APC clone27-35, obtained from BD Bioscience Pharmingen, San Diego, California, USA, and TLR2-PE clone TL2.1; TLR4-PE clone HTA125 and isotype control mIgG2a-PE clone MOPC-173 were obtained from eBioscience .g for 5 min at 4°C. Then, 2 ml of phosphate-buffered saline (PBS) were added to each tube and centrifuged. Supernatants were discarded and cells were resuspended in 0.3 ml PBS/1% sodium azide.The expression of cell surface receptors was performed in whole blood, drawn in EDTA tubes. A total of 100 μl of whole blood from patients and controls were stained with 4 μl of CD14-PerCP and 5 μl of CD66-FITC. The tubes were also stained with the following isotypes: 10 μl of mIgG2a-PE and 2 μl of mIgG2b-APC (tube 1); 10 μl of TLR2-PE and 2 μl of CD11c-APC (tube 2) or 20 μl of TLR4-PE and 2 μl of CD11b-APC (tube 3). Samples were incubated with fluorochrome-conjugated monoclonal antibodies for surface staining for 15 min in the dark at room temperature. Red blood cells were ruptured with 2 ml lysis solution for 10 min in the dark at room temperature followed by centrifugation at 2,500 Event acquisition and analyses were performed using the CellQuest software (BD Bioscience) in a FACSCalibur four-color flow cytometer (BD Bioscience). For each condition 5,000 events were counted in forward- and side-scatter parameters combined with CD14 positive cells. All events were acquired and stored. Neutrophil analyses were performed using forward- and side-scatter parameters combined with CD66b positive and CD14 negative stained cells. The surface receptor expression was measured as the geometric mean fluorescence intensity (GMFI), and results were expressed as the difference between the fluorescence obtained with specific antibodies and isotype controls.ROS formation was assessed by using 1 ml aliquots of heparinazed whole blood obtained from patients and healthy controls. Oxidative burst was quantified by the addition of 0.06 mM of 2',7'-dichlorofluorescein diacetate (DCFH-DA) in 100 μL of whole blood. DCFH-DA is a stable, non-fluorescent, nonpolar compound that can diffuse through cell membranes. Once inside the cell, the acetyl groups are cleaved by cytosolic enzymes to form the polar non-fluorescent dichlorofluorescein (DCFH), which is rapidly oxidized to highly fluorescent 2',7'-dichlorofluorescein (DCF) in the presence of hydrogen peroxide, thus providing an FL1 fluorescence semi-quantitative assessment of the oxidative metabolism in individual granulocytes and monocytes using flow cytometry.5 M/ml, Sigma, St Louis, MO), phorbol myristate acetate , LPS of Salmonella abortus equii , and to heat-killed S. aureus . Briefly, the tubes from each sample were incubated in a 37°C shaking water bath for 30 min. Thereafter, 2 ml of 3 mM EDTA (Sigma) was added to each tube followed by centrifugation (250 g for 10 min at 25°C). Hypotonic lyses in 0.2% saline were performed followed by addition of 1.6% saline and centrifugation (250 g for 10 min at 25°C). The supernatants were discarded and the pellets were once again incubated with 4 μL of CD14-PerCP at room temperature for 15 min in the dark. Then, 2 ml of PBS was added to each tube followed by centrifugation (250 g for 10 min at 25°C). The supernatants were discarded and the pellets resuspended in 300 μL of 3 mM EDTA to flow cytometric analysis. For each measurement, cells were acquired based on forward- and side-scatter characteristics and CD14 expression. Neutrophils were gated based on forward- and side-scatter parameters and monocytes by combining these parameters and CD14 expression. ROS generation was expressed as the GMFI in FL1.ROS production was measured constitutively and in response to fMLP was performed for the analysis of organ dysfunction assessed by the SOFA score. A p value under 0.05 was considered as statistically significant. The results were analyzed using SPSS software .There was no difference in TLR2 expression in the patient group compared to the control group. The comparison among the four groups showed a trend to significance (p = 0.08) with lower TLR2 expression in the septic shock group compared to the control group (p = 0.05), to the sepsis group (p = 0.03) and severe sepsis group (p = 0.04). There was no difference in TLR4 expression among the four groups (p = 0.297) Figure .There were no differences in the expression of CD11b and CD11c among the four groups Figure .The expression of CD66b was significantly higher in the patient group (median GMFI of 84.1 varying from 26 to 175.3) compared to the control group (median of 61.6 varying from 23.9 to 123.1) (p = 0.01). Additionally, the comparison among the four groups showed a higher CD66b expression in the severe sepsis and septic shock groups compared to healthy volunteers Figure .There was no correlation between the surface expression of neutrophil inflammatory markers and the total white blood cell count or absolute neutrophil count in these patients (data not shown).S. aureus stimulation . The median GMFI and range values in the patient group and control group at baseline and after diverse stimuli are shown in Table ROS generation was enhanced in the patient group compared to the control group constitutively and after PMA, fMLP, LPS and S. aureus (p = 0.04). ROS generation was higher in sepsis compared to septic shock after stimulation with S. aureus (p = 0.04) , except after PMA and fMLP stimuli in severe sepsis . ROS generation was diminished in severe sepsis compared to sepsis after stimulation with PMA (p = 0.04) and to septic shock after LPS p = 0.02) and and S. aS. aureus . The median GMFI and range in the patient group and in the control group at baseline and after the diverse stimuli are also shown in Table ROS generation was enhanced in monocytes from septic patients compared to healthy volunteers at baseline and after stimulation with PMA, fMLP, LPS and The comparison among the four groups showed an increased ROS formation at baseline and after diverse stimuli in all groups of patients compared to healthy volunteers (p < 0.01), except after fMLP stimulation in sepsis and after PMA and fMLP stimulation in severe sepsis . ROS generation was diminished in severe sepsis compared to sepsis after stimulation with LPS (p = 0.01) and to septic shock after fMLP 0.03) and LPS (p = 0.008) and after stimuli with PMA , fMLP , LPS and S. aureus . Results are shown in Figure A strong correlation between neutrophil and monocyte oxidative metabolism in septic patients was found at baseline and LPS (p = 0.06) stimulation. Similar results were found for monocytes . Accordingly, a positive correlation was found between fMLP-induced ROS generation and SOFA score, with increasing values being obtained in patients with SOFA scores ≥ 7 Figure .In this study we evaluated neutrophil adaptation across the continuum of sepsis. This is a single time point study where the dynamic of sepsis is pointed out by the inclusion of patients at different stages of the disease; sepsis, severe sepsis and septic shock. Data are provided showing modulation of neutrophils functions across this spectrum by assessing the surface cell expression of TLR2 and TLR4, the prototypes of PRRs for Gram-positive and Gram-negative bacteria, CD66b, a selectin with signaling functions , and CD1In the present study, the expression of cell surface receptors and ROS generation were evaluated in whole blood, with the use of CD66b and CD14 antibodies for immunophenotyping and CD14 antibodies in the assays for ROS generation to better characterize the cell population of neutrophils and monocytes. This approach avoids cellular stimulation, known to occur in cell isolation processes, while providing a good gating for both cell populations.In clinical studies an enhanced TLR2 and TLR4 expression was observed in leukocytes from septic patients compared to healthy controls . By contE. coli endotoxin infusion was also observed [We found an enhanced expression of CD66b in the groups of septic patients that was significantly higher in patients with severe sepsis and septic shock than in healthy volunteers. These results are in agreement with another clinical study where septic patients also showed a higher expression of CD66b on the neutrophil surface compared to healthy controls . An incrobserved , the samobserved .Studies using CD66 as an activation marker in sepsis are still complex; nevertheless, other studies have suggested a broader role for this molecule in neutrophil function, including regulation of integrin-mediated adhesion and poteex vivo upon LPS stimulation [et al. [et al. reported decreased expression of CD11b in septic patients compared to patients with trauma not complicated by infection [et al. [In our study, CD11b and CD11c expression did not differ among the groups of patients and controls. The expression of these integrins on neutrophils is clearly induced mulation . In a cl [et al. found in [et al. . Howevernfection . Even innfection ,39 CD11b [et al. .S. aureus as a heat-killed whole bacteria to induce respiratory burst through bacterial phagocytosis. Patients with sepsis presented ROS generation as high as those with septic shock, with somewhat lower values being observed in patients with severe sepsis. Furthermore, considering the SOFA score from patients with severe sepsis and septic shock, an increased ROS generation was found in patients with SOFA scores higher than 7, the cut-off point that discriminated survivors from non-survivors between our patients.In this report we confirm that ROS generation at baseline and on different stimuli was higher in septic patients than in healthy volunteers . ROS genet al. reported an increasing spontaneous hydrogen peroxide production upon fMLP stimulation in patients with rising sepsis severity [It may be speculated that early in the disease process a vigorous ROS generation may be desirable and important to restrain the infecting microorganisms. Later in this process, the persistence of increased ROS generation may be deleterious, as indicated by the association of ROS generation and increased SOFA score. Thus, interpretation of ROS generation must consider the clinical setting. In contrast to our results, Kaufmann severity .in vitro studies with human and murine macrophages. It has been shown that antimicrobial peptides (AMPs) inhibited TNFa and nitric oxide release by endotoxins, while pre-incubation with AMPs and endotoxin enhanced the respiratory burst [ROS production is also a function of monocytes and macrophages and has not been previously evaluated in septic patients. We found, similar to neutrophils, upregulated ROS generation in monocytes in all groups of septic patients. Indeed, a striking positive correlation was found between monocyte and neutrophil ROS production. This upregulated monocyte function contrasts with the downregulation of inflammatory cytokine production found in the same groups of patients with severe sepsis and septic shock reported elsewhere and alsory burst . The resry burst . AMPs, ery burst .In summary, we show complex neutrophil adaptation in septic patients. Surface receptors expression may be modulated across the continuum of sepsis, and enhanced or decreased expression may be found, depending on the receptor considered and possibly on the stage of the disease. ROS generation is upregulated both in neutrophils and monocytes and its pathophysiology must be interpreted considering the clinical status of septic patients.Neutrophil surface receptors are modulated across the different stages of sepsis.ROS generation is enhanced in the neutrophils and monocytes of septic patients.ROS generation in the neutrophils and monocytes of patients with severe sepsis and septic shock are associated with an increased SOFA score.ROS production by monocytes in sepsis may be differently regulated from inflammatory cytokines.There is no clear association between TLR2 and TLR4 expression and ROS generation in neutrophils from septic patients.AMP = antimicrobial peptide; DCFH-DA = 2',7'dichlorofluorescein diacetate; fMLP = formyl-methionyl-leucyl-phenylalanine; GM-CSF = granulocyte-macrophage colony stimulating factor; GMFI = geometric mean fluorescence intensity; LPS = lipopolysaccharide; PAMPs = pathogen associated molecular pattern; PMA = phorbol myristate acetate; PRR = pattern recognition receptor; RNS = reactive nitrogen species; ROS = reactive oxygen species; RR = relative risk; SOFA = sepsis-associated organ failure assessment; TLR = toll-like receptor; TNFα = tumor necrosis factor alpha.The authors declare that they have no competing interests.PSM and MKB participated in the design of the study, laboratory tests, and in the writing of the manuscript. LSWM performed the laboratory tests. FRM, MSA and SB recruited patients and discussed results. RS participated in the design of the study, inclusion of patients, discussion of results, and in the writing of the manuscript. All authors read and approved the manuscript.

In the crystal structure, mol­ecules are linked by inter­molecular N—H⋯O hydrogen bonds to form a porous three-dimensional network with solvent-free hydro­phobic channels extending along the c axis.The title compound, C Å c = 12.0742 (16) Å V = 6283.8 (11) Å3 Z = 16 Kα radiationMo −1 μ = 0.09 mmT = 293 (2) K 0.48 × 0.46 × 0.45 mm Bruker SMART APEX CCD diffractometerSADABS; Sheldrick, 1996T min = 0.957, T max = 0.963Absorption correction: multi-scan (16003 measured reflections2763 independent reflectionsI > 2σ(I)1794 reflections with R int = 0.049 R[F 2 > 2σ(F 2)] = 0.039 wR(F 2) = 0.113 S = 1.01 2763 reflections181 parametersH-atom parameters constrainedmax = 0.19 e Å−3 Δρmin = −0.12 e Å−3 Δρ SMART used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536808036106/rz2260sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536808036106/rz2260Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Hereditary artifacts in BRCA1 gene have a significant contributory role in familial cases of breast cancer. However, its germline mutational penetrance in sporadic breast cancer cases with respect to Pakistani population has not yet been very well defined. This study was designed to assess the contributory role of germline mutations of this gene in sporadic cases of breast cancer. 150 cases of unilateral breast cancer patients, with no prior family history of breast cancer and no other disorders or diseases in general with age range 35–75 yrs, were included in this study.Mutational analysis for hot spots on Exon 2, 3 and 13 of BRCA1 was done by using Single Strand Conformational Polymorphism (SSCP). Sequence analysis revealed five variants (missense) and one novel splice site mutation at exon 13. No germline mutation was observed on the remaining exons with respect sporadic breast cancer cases in Pakistani population. A vast majority of breast cancer cases are sporadic; the present study may be helpful for designing a better genetic screening tool for germline BRCA mutations in sporadic breast cancer patients of Pakistani population. Further studies involving a screening of entire coding region of BRCA1 is required to explore the merits of genetic diagnosis and counseling in breast cancer patients. Breast cancer is one of the leading causes of death in women worldwide. BRCA1 (MIM113705) is a high risk-associated gene responsible for breast cancer of both hereditary and sporadic origin. Although several studies around the world and few studies in Pakistan, have emphasized that germline mutations in BRCA1 are contributory in a significant proportion for the incidence of breast cancer, the expected ratio in relation to overall prevalence of sporadic cancer cases in our local populations has not been properly clarified.Nationwide Cancer registry records and epidemiological surveillance data regarding the various types of cancers are lacking in Pakistan. However, according to Karachi Cancer Registry report, the incidence rate of breast cancer is 69.1 per 100,000 .The estimated ratio of BRCA germline mutations in sporadic breast cancer cases is believed to vary significantly in different local populations of Pakistan, by 4.4 – 11.1% . There were limitations in these studies. In case of Leide case selThe present study was designed in order to determine the contribution of germline mutations of BRCA1 to sporadic breast cancer cases from all four provinces of Pakistan. We have selected hot spots of mutation on BRCA1 gene and tried to screen exons involved in ring finger domain formation of BRCA1 protein too.Breast cancer patients were determined from various hospitals and Nuclear Medicine Institute(s) from January 2006 – March 2007. Peripheral blood samples were collected from Nuclear and Oncology Institutes all over the country. Ethical approval was obtained from the respective research committees of these institutes.Breast cancer cases found suitable, after stringent initial screening were 150 .Blood samples from each case were collected in blood vaccutainer having EDTA as anticoagulant. For storage, transportation and preservation, recommended guidelines were followed . 100 bloGenome isolation was carried out following the recommended protocol with minPrimers for exons 2, 3 and 13 were designed from the sequences available on Genebank (113705). Primer designing was done with the aid of Primer # 3' software and intron exon junctions were also included in this study for a better identification of splice sites variation. The primer sequences for the respective exons involved in this study are given in the table For mutation detection, SSCP technique with fewAfter extensive screening, five samples were found positive showing an altered mobility shift on the exon 13 of BRCA1. No mutation was detected with respect to exon 2 and 3 of BRCA1 gene. Sequencing reveals an evidence of mis-sense variation on 1435 amino acid Ser. of BRCA1 protein. There is novel splice site mutation changing amino acid 1452 from Ala to Gln and is due to del of A' reported leading to splice site truncation which has not been reported in Breast Information Core database as well . In the et al., [Moreover inter individual variation does exist among the ethnic groups in association with various risk factor as reported by Peto et al., showing The continuing uncertainty as to the exact penetrance for breast cancer among BRCA1 mutation carriers may be due to several factors including differences owing to study design, allelic heterogeneity and to modifying genetic and or environmental factors. Pakistani population, although offers the potential to explore the contribution that consanguinity makes to breast cancer, but that seems to be specific for hereditary form of the cancer and it might not be the case for sporadic cancer. It is possible that no or marginally low germline mutations are present for BRCA1, specifically in the case of sporadic cancerFAM performed laboratory tests and prepared the manuscript; SA, IAB, AM, MA and RS contributed clinical samples and clinical information; MAK and WGJ participated in study design, coordination and manuscript preparation.

N-methyl-D-aspartate receptor (NMDAR) subunit GluRε2 (NR2B) in hippocampal synapses. Using electrophysiology and immunocytochemistry, here we analyzed the hippocampal circuitry of the inversus viscerum (iv) mouse that has a randomized laterality of internal organs. The iv mouse hippocampus lacks L-R asymmetry, it exhibits right isomerism in the synaptic distribution of the ε2 subunit, irrespective of the laterality of visceral organs. This independent right isomerism of the hippocampus is the first evidence that a distinct mechanism downstream of the iv mutation generates brain asymmetry.Left-right (L-R) asymmetry is a fundamental feature of higher-order neural function. However, the molecular basis of brain asymmetry remains unclear. We recently reported L-R asymmetry of hippocampal circuitry caused by differential allocation of Previously we demonstrated that the synaptic distribution of NMDAR ε2 subunits in the adult mouse hippocampus is asymmetrical between apical and basal dendrites of individual neurons and between the left and right hemispheres iv mouse Iv is a spontaneous mouse mutant that possesses a mutation in the gene encoding the motor protein, Left-right dynein (Lrd) iv homozygous (iv/iv) embryos, the nodal cilia are immotile and fail to produce constant leftward flow, resulting in a randomized laterality of visceral organs iv/iv mice exhibit reversed asymmetry (situs inversus), whereas the rest are normal (situs solitus).The precise specification of L-R asymmetry is essential for vertebrate development. The molecular mechanisms that generate asymmetrical patterning are well understood for the internal organs iv mouse hippocampus exhibits right isomerism of the synaptic distribution of the ε2 subunit. This laterality defect of the hippocampus is independent of the laterality of visceral organs. Therefore, the mechanisms responsible for the specification of L-R asymmetry differ between visceral organs and the brain.Here, we report that the iv (iv/+). The nodal cilia rotate as rapidly in these heterozygotes as in wild-type mice (WT) stratum radiatum or at the stratum oriens of area CA1 reduced peak amplitude of NMDA EPSCs to a similar extent in the left and right hippocampus in both the basal and apical dendrites of CA1 pyramidal neurons .P<0.01, t-test). These mice lack commissural fibers t)Basal, . Convers)Apical, . These riv/iv mice with the situs inversus phenotype. The sensitivity of NMDA EPSCs to Ro 25-6981 was comparable between the left and right hippocampus for both basal and apical synapses (situs solitus and situs inversus (n = 3 to 4 each) were combined because there were no significant differences between the two groups. The sensitivity of basal and apical synapses in iv/iv mice to Ro 25-6981 was indistinguishable from that of ε2-dominant and nondominant synapses in VHCT iv/+ mice, respectively.Next, we examined naïve synapses . However P<0.01) . Almost P<0.01) . In addi P<0.01) . In thisiv/iv mice that show the high and low sensitivity to Ro 25-6981, we analyzed the development of long-term potentiation (LTP) of field excitatory postsynaptic potentials (fEPSPs). We measured the amplitude of LTP in 7- to 9-week-old adult mice and compared it with LTP in 9- to 11-day-old pups. The ε2 subunit is the major ε subunit in the hippocampus at early postnatal ages stratum oriens or in the stratum radiatum of area CA1 (P>0.05) Basal, . In cont Apical, . Thus, Liv/iv mice was higher in the stratum oriens than in the stratum radiatum bilaterally , whereas P>0.10) .iv mouse hippocampus also contains two separable populations of synapses on apical and basal dendrites of CA1 pyramidal neurons. These two populations of synapses have complementary properties. First, the NMDA EPSCs of basal synapses exhibit a higher sensitivity to Ro 25-6981 than those of apical synapses . In iv/iv mice, synapses formed on the apical and basal dendrites of CA1 pyramidal neurons are ε2-nondominant and ε2-dominant, respectively. This localization is bilateral and independent of the laterality of visceral organs.In WT mice, the localization of ε2-doninant and ε2-nondominant synapses within hippocampal circuitry is asymmetrical , WT [1],synapses , iv/iv. iv/iv hippocampus because CA3 neurons in both hemispheres form ε2-dominant and ε2-nondominant synapses on the basal and apical dendrites, respectively (iv/iv), similar to CA3 neurons in the WT right hemisphere and iv/+ (produced by crossing the iv/iv and C57BL/6J) mice (7 to 9 W) were anesthetized with an injection of pentobarbital and positioned with a stereotaxic apparatus. A small piece of a razor blade (2.5 mm wide) was glued onto a rod that was clamped onto a micromanipulator. After removing a portion of the skull , the blade was inserted to a depth of 4.0 mm at the midline to transect the VHC. To avoid damaging the sagittal sinus, the blade was initially shifted 0.5 mm to the right and inserted 0.5 mm into the cerebral cortex and was then returned to the midline position as the blade was lowered. After slowly removing the blade, a piece of skull was replaced and the scalp was closed with sutures. Animals receiving this procedure were viable for more than 3 months. All experiments were performed under the guidance of Animal Experiments in Faculty of Sciences, Kyushu University and the law (No.105) and notification (No. 6) of the government.To examine synapses made by ipsilateral Sch fibers, VHC was transected 5 days before electrophysiological recording 2, 2.5; MgSO4, 1.3; NaH2PO4, 1.0; NaHCO3, 26; glucose, 10, saturated with 95% O2/5% CO2). Brains were fixed on an agar block, which was made by two pieces of agar (with a slope of 20°) stuck together at a right angle and mounted on the cutting stage. We lowered the left rear or right rear of the brain using the agar slopes when cutting the left or right hemisphere, respectively. Slices from a similar septotemporal level were used for experiments. Recordings were made in a submerged slice chamber perfused with ACSF at room temperature. Electrodes filled with 0.9% NaCl were used for extracellular recording. Synaptic responses were evoked at 0.1 Hz using a bipolar tungsten electrode. An LTP-inducing tetanic stimulus was given at 100 Hz for 1 s at baseline stimulus strength. The fEPSP slope was expressed as a percentage of mean slope value before the tetanic stimulation. Synaptic currents were recorded from CA1 pyramidal neurons using the blind-patch technique 2+ and Ca2+ (4 mM of MgSO4 and CaCl2) ACSF was used to increase membrane stability in the presence of bicuculline. Patch electrodes (3–5 MΩ) were filled with an intracellular solution . We recorded NMDA EPSCs at +10 mV in the presence of DNQX (20 µM) and bicuculline (30 µM). We adopted a relatively low holding potential to obtain stable recordings of NMDA EPSCs throughout the experiment t-test.Transverse hippocampal slices (450 µm thick) were cut with a vibrating microtome (VT 1000S) in ice-cold artificial cerebrospinal fluid (ACSF) and transcardially perfused with 25 mM PBS pH7.4 followed by a fixative containing 4% paraformaldehyde, 0.05% glutaraldehyde and 0.5% picric acid in 0.1 M phosphate buffer (PB) pH 7.4 for 15 min. After perfusion, the brains were removed and 100 and 500 µm-thick coronal slices were alternately cut from the left and right dorsal hippocampus.The For postembedding labeling, the middle CA1 areas (0.5×1.0 mm) were trimmed from 500-µm-thick slices of the left and right hippocampus and cryoprotected in 10, 20, and 30% glycerol in 0.1 mM PB pH 7.4 overnight. Samples were then frozen with liquid propane (−185°C) in a cryofixation unit (EM CPC). Freeze substitution and low-temperature embedding in Lowicryl HM20 were performed as described previously

Growth of mental asylums in British India was a less conspicuous form of social control which reflected the colonial mindset of the prevailing societal norms. The firsIn India, the traditional approach for the care of mentally ill patients during the last 200 years has been modeled after contemporary Britain, being custodial in nature. PatientsTo the best of my knowledge Ranchi European Asylum as it was first called was the product of a panic on the part of the government of Bengal… people of Calcutta were beginning to realize that the old Bhowanipore asylum was a disgrace to their fair city. I know as a fact that round about 1880 Indian lunatics in Bhowanipore were employed in dragging scavenger carts through the streets. Guilty conscience in Calcutta grew so numerous that at least it was decided that some thing should be done about it.”“lunatic asylum ‘ in India to ‘mental hospital ‘ in 1920.welfare iThe origins of the Psychiatric Rehabilitation in India can be traced to innovative service programs which were initiated in 1922 when Occupational Therapy Unit started at this place. It was a landmark being first such establishment in the country. In 1929, Cottages were built outside the hospital in the vicinity to keep patients with their family members for family therapy. Techniques similar to token-economy were first started in 1920 and called by the name “Habit Formation Chart” .910]9910]After Girindrashekhar Bose founded the Indian Psychoanalytical Association in 1922 in Calcutta, Berkeley-Hill started the Indian Association for Mental Hygiene at Ranchi. He was oDevelopment of convulsive therapy as an effective therapeutic modality started taking place in Europe in 1937 when von Meduna first described results of chemical induction of seizures to manage acute excitement. This was one of the first centers outside Europe to start Cardiazol-induced seizure treatment in 1938 and electroconvulsive therapy (ECT) in 1943 ushering a new era for treatment of severe mental disorders . ECT was10After independence, the name of European Mental Hospital was changed to Inter-Provincial Mental Hospital in 1948 and the hospital was opened for all Indians. It was subsequently renamed as Hospital for Mental Diseases in 1952 and in 1954 its administration was taken over by the Government of India. Despite On April 1, 1977 it was raised to the status of an Institute and was renamed as Central Institute of Psychiatry. Keeping pace with the development in mental health, the institute continued to scale new heights and various modern facilities for investigation and management of mental disorders were added.www.cipranchi.nic.in and a dedicated helpline service with toll-free telephone number and e-mail services. A high-speed leased line and broadband connectivity was acquired for efficient internet usage. In 2006, the institute acquired 64-Opteron cluster server for high-speed calculations and networking, enabling efficient data management and security with comprehensive interconnections at approved locations. Currently, the Medical Library at the institute provides modern facilities to postgraduate trainees and scholars with 52,000 books and bound journals, 510 print and electronic journals, high-speed Internet connectivity and photocopy facility. Library is also a member of National Medical Library's Consortia, namely, ERMED - India which provide online full text access to more than 1500 journals. The institute started providing deaddiction services from 1998 and a dedicated Center for Addiction Psychiatry started in 1999. It is a modern center with a bed capacity of 30 inpatients for treatment of alcohol and drug dependence. The institute also acts as the nodal center for implementation of National Mental Health Program (NMHP) [Center for Cognitive Neurosciences at the institute has witnessed substantial growth in clinical and research applications in the field of cognitive neurosciences. In 1994, the department got 32 channels quantitative EEG and eight channels evoked potential system. In 2003, facilities for 40 channels video EEG, dense array EEG acquisition and analysis systems , event related potential (ERP) acquisition and analysis units (40 and 128 channels), Polysomnography (40 channels), and a repetitive transcranial magnetic stimulation (rTMS) were added . The cenm (NMHP) .Ranchi has been synonymous with mental health world over. This year CIP celebrates its 91st Foundation Day. The journey has been long and distinguished and its contribution to Indian Psychiatry has set a tradition of excellence in the field of mental health. Berkeley-Hill wrote in his parting note,The miserable bear-garden I had taken charge of in October, 1919, had become the finest mental hospital in Asia, and a great deal finer than many mental hospitals in Europe.”“

The crossover reaction and the polymerization kinetics were investigated using matrix assisted laser desorption ionization mass spectroscopy (MALDI-TOF) and nuclear magnetic resonance (NMR), respectively. MALDI showed that there was a complete crossover reaction after the addition of 25 equivalents of the second monomer. NMR investigation showed that U3 gave a faster rate of polymerization in comparison to U1. The synthesis of block copolymers with molecular weights up to Mn = 31 000 g/mol with low polydispersities (Mw/Mn = 1.2) is reported.We report on the block copolymerization of two structurally different norbornene monomers (±)- Block copolymers are macromolecules composed of linear or non-linear arrangements of chemically different polymeric chains. If the different blocks are incompatible, a rich variety of well defined self-assembled structures both in bulk and selective solvents arises . The synG1 relative to propagation (kp) as well as considerable secondary metathesis (backbiting). Grubbs’ second generation catalyst G2 displays an activity comparable to the Schrock type initiators. It exhibits a higher functional group tolerance than G1, but initiation by catalyst G2 is often slow as a result of the slow dissociation of the phosphine group, sometimes limiting its application in polymer synthesis. Alternatively, Grubbs’ third generation catalyst G3 introduced by Grubbs et al. 0/[M]t) vs. time (t) gave a straight line as shown in 0 assuming a first order kinetics which gave kp as 18.5 l·mol−1·s−1.As the polymerization kinetics of 9 is a free stable radical, the progress of its polymerization with catalyst U3 could not be monitored by 1H NMR spectroscopy. Therefore, the conventional method of following the Mn vs. time (t) profile was carried out as shown in Mw/Mn ~1.3 was observed, clearly proving the high precision of this type of polymerization reaction.As monomer T 7 and monomer T 9 proceeded well with catalyst U3, the synthesis of the BCP was achieved by use of this initiating system to yield the respective BCP-A10T10, A20T20, A25T25 and A50T50 with the expected molecular weight and with low polydispersity , the respective crossover species AnT1, and AnT2 can be seen as the respective Na+-ions. These results demonstrate that a large amount of An-species did not participate in the crossover reaction, since due to the fast polymerization of monomer T 9, it was rapidly consumed, leading to AnT2-species and its respective higher homologues.The MALDI spectrum of the crossover reaction of A25 with exactly two equivalents of monomer T 9 is shown in n (visible as AnNa+-series) is present in the reaction mixture, the respective crossover-species AnT1, and AnT2 can be seen as the respective Na+-ions. Additionally, the respective series AnT3 is visible, indicative of the further chain growth process after the crossover reaction. Again, despite the excess of Tn-species a large amount of An-species did not participate in the crossover reaction due to the fast polymerization of monomer T 9. MALDI spectra of a further series of block copolymers A25T5 and A25T25 was carried out in order to check for the presence of residual homopolymer A25 in the polymer mixture and used as received without further purification unless otherwise indicated. Bicyclopentadiene (100%), fumaric acid (99+%), thionyl chloride , pyridine (99.8%), methanol and 4-hydroxy-2,2,6,6-tetramethyl-piperidin-1-oxyl (TEMPOL) were obtained from Sigma-Aldrich and used without further purification. Dichloromethane (CH2Cl2) was freshly distilled over CaH2 and degassed with argon prior to use. Other solvents such as hexane and ethyl acetate were used after distillation.Instrumentation: 1H NMR spectra were recorded on a Varian Gemini 400 MHz FT-NMR spectrometer, and MestRec (4.9.9.9) was used for data interpretation. The polymerization kinetics of the polymerization reactions with both catalysts U1 and U3 were measured at 25 °C on a 200 MHz FT-NMR spectrometer using CDCl3 as a solvent. GPC analysis was performed on a Viscotek VE2001 system with THF as the eluant at a flow rate of 1 ml/min and an injection volume of 100 µL. Polystyrene standards were used for conventional external calibration using a Viscotek VE3580 refractive index detector. Positive ion MALDI-TOF (matrix-assisted laser desorption ionization time-of-flight) measurements were performed on a Bruker Autoflex-III instrument equipped with a smart ion beam laser. Measurements were carried out in linear and reflector mode. Samples were prepared from THF solution by mixing matrix (20 mg/ml), polymer (20 mg/ml), and salt (20 mg/ml solution) in a ratio of 100:10:1. Dithranol -anthracetone, Aldrich 97%) was used as the matrix. Sodium trifluoroacetate , silver trifluoroacetate or lithium trifluoroacetate were added for ion formation, with sodium trifluoroacetate as the optimal salt for obtaining the highest S/N ratio.endo,exo-2,3-dicarboxylic acid dimethylester, monomer A 7 was synthesised according to reference [endo, exo-2,3-dicarboxylic acid bis ester, monomer T 9, was prepared according to references [5-Norbornene-eference , 5-norboferences –20.7 dissolved in 1 ml of CH2Cl2 was introduced into a heated and argon flushed glass tube equipped with a magnetic stirring bar. A solution of catalyst U3 dissolved in 1 ml of CH2Cl2 was then added. After 5 min of stirring at room temperature, the total consumption of monomer A 7 was confirmed by thin layer chromatography (TLC). The reaction was then quenched with 5 drops of cold ethyl vinyl ether, and the resulting polymer purified by column chromatography (SiO2). The homo-polymerization of monomer T 9 was carried out in the same manner with catalyst G2. Homopolymers (An) with different chain lengths with the catalysts G3, U1, U2 and U3 as initiators were also synthesized using the same procedure by adopting the required polymerization times.Monomer A n-b-Tn) was carried out analogously to methods developed previously in our laboratory [50T50 was performed by sequential addition of monomers. Monomer A 7 dissolved in 1 ml of CH2Cl2 was introduced into a heated and argon flushed glass tube equipped with a magnetic stirring bar. To this solution, catalyst G3 dissolved in 1 ml of CH2Cl2 was then added. The mixture was allowed to stir at room temperature for 1 h until all of the monomer A 7 was consumed as confirmed by GPC and TLC. Subsequently, monomer T 9 dissolved in 1 ml of CH2Cl2 was then added to the above reaction mixture and stirred for 2 h at room temperature until all of monomer T 9 was consumed, as confirmed by GPC and TLC. The polymerization was quenched by the addition of cold ethyl vinyl ether. The polymer was isolated by column chromatography (SiO2) (eluent: DCM).The synthesis of block copolymers dissolved in CDCl3 (0.2 ml) was first introduced into the NMR tube and then the pyrene stock solution (0.2 ml) was added. Before adding the initiator solution, the ratio of the monomer to the internal standard was determined by NMR. On the basis of this value, the monomer concentration at t = 0 was determined. A solution of the catalyst U3 , dissolved in CDCl3 (0.2 ml) ) dissolved in CDCl3 (0.2 ml) was added via a syringe to yield the desired monomer to initiator ratio. After shaking, the tube was inserted into the NMR spectrometer, and the decrease in the monomer with respect to time was monitored by integrating the resonance peaks at 6.27 and 6.07 ppm. For determination of the monomer concentration at t = 0 and the monomer consumption, the corresponding signals at 6.27 and 6.07 ppm from monomer A 7 compared with the one at 8.20 ppm from the internal standard pyrene were integrated. The time between the addition of the initiator solution and the first measurement was added to the first measuring point.A pyrene stock solution was prepared from 70 mg of pyrene dissolved in 2 ml of CDCl

Three controlled experiments were conducted with three different healers and randomised allocation of cells to five different doses of healing or control. Researchers conducting the assays and statistical analyses were blinded to the experimental conditions. Main outcome measures were MTT viability, 3H-thymidine incorporation and counts of an adherent human breast cancer cell line (MCF-7), and a nonadherent mouse B-lymphoid cell line (HB-94). Analyses of variance (ANOVAs) revealed no significant main or dose-related effects of spiritual healing compared to controls for either of the two cell lines or any of the assays . When comparing healing and control across all three experimental days, doses, assays, and cells, 34 (51.6%) of 66 independent comparisons showed differences in the hypothesised direction (P=0.90). The average effect size across cell lines, days, assays, and doses approached zero (Cohen's d=−0.01). The results do not support previous reports of beneficial effects of spiritual healing on malignant cell growth in vitro. Reported beneficial effects of spiritual healing on the well-being of cancer patients seem more likely to be mediated by psychosocial and psychophysiological effects of the healer–patient relationship.Alternative treatments such as spiritual healing and prayer are increasingly popular, especially among patients with life-threatening diseases such as cancer. According to theories of spiritual healing, this intervention is thought to influence living cells and organisms independently of the recipient's conscious awareness of the healer's intention. The aim of this study was to test the hypothesis that spiritual healing will reduce proliferation and viability of two cancer cell lines Complementary and alternative medicine (CAM) is increin vitro, and results from experiments studying the effects of spiritual healing on bacteria -2,5-diphenyltetrazolium bromide (MTT) reduction assay (MTT-assay) was used for quantification of viable cells (Cell proliferation was measured using a standard 3H-thymidine incorporation assay. Cell counts were performed independently in a haemocytometer by two researchers (BB and LS). The cells were counted and viability and proliferation assays were conducted the following day, 24 h after beginning the experiment. In the previous studies, incubation periods were 16 h (four breast cancer cell lines) (Two cell lines were used: (1) MCF-7, an adherent human breast cancer cell line , 24 h (fl lines) . In the A total of 12 plates were used in each of three experiments under identical conditions on three separate days. In all, 10 plates were randomised to an experimental or a control group, and two plates remained in the incubator during the experiment as additional control. Experimental and control plates were removed from the incubator and placed in a flow bench for the same number of minutes with the same time interval in counter-balanced order. All 10 plates were placed in a flow bench for 10 min followed by 50 min in the incubator, eight plates for an additional 10 min, six plates for 3 × 10 min, four plates for 4 × 10 min, and two plates for a total of 5 × 10 min, yielding a design with increasing doses of exposure to healing or control over a total of 4 h and 10 min for each condition. A total of 504 wells were analysed, making it possible to compare cells in 2 × 45 wells across all experimental days and doses for each cell line and assay. Setting aside a total of 84 wells for additional control, a total of 2 × 15 wells were available for cell counting for each cell line.Healing was performed by three healers with 6–18 years of experience, all reporting themselves as successful in their clinical work. None had previously worked with biological material. The healers used their own individual method to attempt to inhibit viability and growth of the cancer cells. Two thus held their hands 20–30 cm over the plates, but none of the healers touched the plates physically at any time. The sessions were video recorded, and after the sessions, the healers were interviewed concerning their experiences during the experiment. The healers were not present during control sessions.The researchers involved in the analysis of the cell cultures were blinded with respect to experimental condition and dose. The statistician (MV) was blinded to the purpose of the study and the experimental conditions.d (α: 5%) for each assay and cell line. Setting aside 84 wells for additional control cells to be kept in the incubator, a total of 2 × 15 wells remained available for cell counting for both cell lines, making it possible to detect a difference corresponding to an effect size of 1.06 with a statistical power of 80% (α: 5%).Data from the three previous experiments involving malignant cell cultures showed significant differences between healing and control corresponding to effect sizes (Cohen's d ) rangingd . With th3H-thymidine incorporation was based on the average of measurements from the three wells and included main effects of condition and dose (10–50 min), and an interaction between these factors. The effect of healing was assessed by testing the hypotheses of no interaction between dose and condition and no main effect of condition. The experimental design for the cell count experiments was different, and the analysis here was based on the difference between counts for the two conditions. The effect of healing was assessed by testing the hypotheses of no main effect of dose. The main effect of healing was evaluated by computing a confidence interval for the overall mean of the differences. In a supplementary analysis, dose was included as a covariate to assess a linear trend with dose. To investigate differences between healers these analyses were supplemented by ANOVAs, which included day and interactions with day as systematic effects. The statistical package GenStat Release 7.1 was used for all computations. To allow for comparison with previous results, effect sizes (Cohen's d) were calculated for the difference between healing and control for each assay, cell line, and dose, as well as for the pooled differences across doses for counts for both cell lines.Analysis of variance (ANOVA) methods were used to analyse the experimental data. Each cell line was analysed separately for each of the three assays. Data from the unmanipulated control plates were not included in these analyses. Non-normally distributed data were log transformed prior to analysis. The ANOVA used to analyse MTT viability and Additional information on assays, procedure and statistical analyses is available on request to the corresponding author.)(P=0.76), and the overall difference was not statistically significant (P=0.35). When dose was included as a covariate, the linear trend with dose did not differ between the two experimental conditions (P=0.41) and no overall trend with dose was found (P=0.53). The findings were very similar for the HB-94 cell line. Again, the dose dependence did not depend on experimental condition (P=0.73), the overall difference was not statistically significant (P=0.53), the trend with dose did not depend on dose (P=0.96), and the overall trend was not statistically different from zero (P=0.69). For both cell lines, we found a considerable variation between days/healers , and no statistically significant, overall difference was found . For both cell lines, these conclusions were maintained when the dose dependence was described by a linear trend. As found for MTT viability, we found considerable variation between days/healers for the 3H-thymidine incorporation activity . When dose was included as a covariate, no linear trend with dose was seen in the difference between the two experimental conditions . For cell counts, the day-to-day variation was less striking, but also present in the unexposed control measurements.d) . Of 66 independent comparisons, 34 (51.6%) yielded results in the expected direction, corresponding to a probability of 0.90 (two-tailed). The per cent differences in the expected direction for each of the 3 days were 50% (Day 1), 55% (Day 2), and 55% (Day 3), with the corresponding probabilities of 1.00, 0.83, and 0.83. The average effect size across all cell lines, days, assays, and doses approached zero (d=−0.01).Finally, standardised differences between healing and control, that is, effect sizes (Cohen's d) , were cadata not shown, details concerning raw data available on request), representing a total data loss of less than 1%.Two data points were missing and two extreme outliers were identified and the opposite of the hypothesised direction (48.4%). Our results differ from those of three previous experimental studies of healing and cancer cells in vitro .A systematic review of published healing research , increasOne explanation for our negative findings could be that the doses used (10–50 min) were inadequate. They were, however, generally not smaller than those used in previous studies reporting significant effects of spiritual healing. For example, in one study with reported effects on malignant cell growth, the healing dose was reported as 20 min was similar to the ones used in previous studies reporting effects of healing on malignant cells in culture (16–24 h). Moreover, if our negative results were a result of too extensive or insufficient timing, we should expect at least some indication of an effect in the expected direction. This was clearly not the case.In addition to conventional methodological issues, other specific issues may be relevant for healing research . However

Ovarian cancer is the most common cause of mortality of tumors from gynecologic origin and is often diagnosed after patients have already progressed to advanced disease stage. The current standard of care for treatment of ovarian cancer includes cytoreductive surgery followed by adjuvant chemotherapy. Unfortunately, many patients will recur and ultimately die from their disease. Targeted therapies have been evaluated in ovarian cancer as a method to overcome resistant disease. Angiogenesis inhibitors have shown success in many tumor types and have also demonstrated promise in trials involving patients with ovarian cancer. PARP inhibitors may be potentially active agents in patients with BRCA-associated ovarian cancer. Trials that have evaluated combinations of targeted agents have often revealed untoward toxicities, thus tempering enthusiasm for this approach. Ovarian cancer is the most common cause of mortality from gynecologic cancer and will be responsible for 14 600 cancer related deaths this year. Secondary to vague presenting symptoms and the lack of effective screening, most patients will present with advanced disease. The current standard of care for ovarian cancer therapy is surgery followed by adjuvant carboplatin and taxane-based chemotherapy. Unfortunately, these protocols often do not allow for cure at initial diagnosis, and many patients will often recur and eventually die from their disease. Chemoresistance is an important hurdle in the treatment of recurrent cancer. Targeted therapy has subsequently come to the forefront of research and clinical trials in an effort to overcome resistant disease and achieve improvement in patient outcomes.Ovarian cancer is the second most common gynecologic malignancy, but is the most common cause of mortality from gynecologic cancer. It accounts for about 3 percent of all cancers among women and is the fifth most common cause of cancer-related death in women . ApproxiSurveillance Epidemiology and End Results (SEER) database shows that the incidence of ovarian cancer has decreased over the past 30 years . Age-basUnfortunately, the initial signs and symptoms of ovarian cancer are vague. These can include nonspecific complaints of bloating, gastrointestinal symptoms, and pain . The subCytoreduction is the goal in initial surgical therapy for patients with ovarian cancer. Decreasing the remaining tumor burden has been shown to improve response to postoperative systemic chemotherapy. This finding is biologically plausible, in that small tumors are better perfused and more mitotically active, thereby allowing chemotherapeutic drugs to have better efficacy. A meta-analysis of over 53 studies with advanced stage ovarian carcinoma treated with platinum-based chemotherapy found a 5.5 percent increase in median survival for every 10 percent increase in the proportion of patients achieving maximal cytoreduction, which was defined as less than or equal to 3 cm in the analysis [The current standard of care for initial adjuvant chemotherapy in EOC is a platinum drug, usually carboplatin, and a taxane. The Gynecologic Oncology Group (GOG) evaluated the efficacy of cisplatin versus carboplatin in a noninferiority trial. The authors concluded that a chemotherapeutic regimen consisting of carboplatin plus paclitaxel results in less toxicity, is easier to administer, and is not inferior, when compared with cisplatin plus paclitaxel .Unfortunately, despite optimal cytoreduction and adequate adjuvant therapy, many patients with EOC will experience disease recurrence. Over 70–80 percent of patients will relapse and ultimately die of their disease [Patients are categorized into groups based on their disease-free period, including platinum-sensitive (those patients who recur greater than 12 months after therapy), partially platinum-sensitive (those who recur between 6–12 months after therapy), platinum-resistant (those who recur before 6 months after therapy), and platinum-refractory (those who never achieve disease free status). Traditionally, patients who recur more than 6 months after initial therapy are given a second course of platinum-taxane-based chemotherapy. Platinum-sensitive disease has a greater than 50 percent response rate to single agent carboplatin, while resistant disease has a 10–20 percent response rate and refractory disease response is even lower . The latThe bane of ovarian cancer therapy is the failure of currently established treatment protocols to allow for cure of the disease at diagnosis, even in patients with initially chemosensitive tumors. Despite efforts of clinical trials to identify more efficacious regimens to overcome the chemoresistance encountered after front-line platinum-taxane treatment, clinical response to second-line therapy continues to be short lived and results in only marginal improvements in progression free and overall survival . In respAngiogenesis is the development of new blood vessels in areas of new tissue growth. This is a normal phenomenon associated with routine processes including wound healing and embryogenesis. It is also an important process that occurs almost universally in solid tumors as a response to the expansion of the cancer mass and its subsequent growth away from existing blood supply. This causes the oxygen tension to decrease beneath physiologic levels needed for oxidative metabolism .An important interplay of proangiogenic signaling occurs in response to the hypoxic state. A protein called hypoxia-inducible factor (HIF) 1 alpha is stabilized in these conditions and enters the nucleus where it forms a complex with another protein (HIF 1 beta) . This coMolecular markers of angiogenesis have been studied in ovarian cancer. Prior studies have shown associations between VEGF-A levels and microvessel density in primary tumors and disease extent as well as progression-free and overall survival following initial antiangiogenic therapy . PreclinBevacizumab is a monoclonal antibody directed against VEGF-A. Studies evaluating this agent have shown improved survival in colorectal , breast Based on the activity of bevacizumab as documented in these phase II trials, there are currently two trials that are ongoing to evaluate the activity of bevacizumab in the setting of front line adjuvant therapy. The first is GOG 218, a study that evaluates stages III and IV EOC patients who have undergone surgery and are subsequently randomized to one of three arms; arm 1 utilizes the traditional chemotherapy regimen of carboplatin (AUC 6) and paclitaxel (175 mg/m2) and placebo, arm 2 includes the active drugs of arm 1 and adds bevacizumab , while arm 3 includes the drugs of arm 2 and adds maintenance bevacizumab given every 21 days to complete 22 cycles. A second trial is run by the Gynecologic Cancer InterGroup in Europe (ICON7) and is an open label trial. The ICON7 study population includes both high risk early stage disease (stage I-IIa with grade 3 or clear cell histology) and advanced disease IIb-IV EOC or primary peritoneal cancer. Patients are randomized to one of two arms: carboplatin and paclitaxel or carboplatin, paclitaxel, and bevacizumab. The bevacizumab arm also includes a maintenance schedule continuing the drug every three weeks for 12 cycles. The study aims to evaluate PFS as a primary endpoint and overall survival, duration of response, and response rate as secondary endpoints .Bevacizumab has also been studied in conjunction with other targeted agents. A phase I study of bevacizumab and a vascular disrupting agent (VDA) combretastatin 4A phosphate (CA4P) in patients with advanced solid tumors demonstrated no additive toxicity and the evidence for efficacy was encouraging . This isVEGF Trap is a fusion protein consisting of the extracellular domains of human VEGF-1 and -2. This protein binds to VEGF-A and placental growth factor. In mouse models VEGF Trap treatment resulted in decreased ovarian cancer growth and ascites . Tew andC-kit is a growth factor receptor of the tyrosine kinase subclass III family, the ligand of which is Stem Cell Factor, and is normally expressed in many cell lines, including gametocytes . C-kit sCediranib is an oral VEGFR-1, -2, and -3, PDGFR-B, and c-kit inhibitor. Hirte et al. performed a phase II trial of cediranib in patients with recurrent or persistent EOC, primary peritoneal or fallopian tube cancers . The triEpidermal growth factor receptor (EGFR) is overexpressed in 70% of cancers and is associated with chemoresistance, poor prognosis, and advanced disease at presentation , 33. TheP = .008) and possibly longer survival (P = .082). Gefitinib was well tolerated, with dermatologic (15%) and diarrhea (30%) the most common grade 3 toxicities [Gefitinib is a small molecule tyrosine kinase inhibitor that binds to the ATP-binding site of the EGF receptor and thereby prevents its activation. A GOG phase II study of gefitinib in patients with relapsed or persistent ovarian or primary peritoneal carcinoma assessed the activity and tolerability of a daily oral dose of 500 mg. The trial showed that only four of 27 eligible and evaluable patients exhibited progression-free survival greater than 6 months. One objective response was seen, and interestingly this patient was found to have the rare presence of an EGFR mutation. EGFR expression was associated with longer PFS tyrosine kinase inhibitor. Gordon and colleagues performed a phase II study in patients with refractory, recurrent, HER1/EGFR positive EOC . PatientDisappointment was also encountered in clinical trials examining erlotinib in combination with other agents, where toxicity led to premature termination . A phaseOverexpression of ERBB2 is also found in patients with ovarian cancer. Trastuzumab, or Herceptin, is a monoclonal antibody directed against ERBB2, and has been studied in a phase II trial by the GOG. This study evaluated the drug in patients with recurrent or refractory ovarian or primary peritoneal carcinoma with overexpression of HER2 . PatientP = .14). Two trials have evaluated the efficacy of pertuzumab when combined with chemotherapy, one phase II study in combination with carboplatin and another phase II trial in combination with gemcitabine [Pertuzumab is a monoclonal antibody that inhibits dimerization of ERBB2 with EGFR, ERBB3, and ERBB4. A phase II trial of single agent pertuzumab administered as an intravenous loading dose of 840 mg followed by 420 mg every three weeks (in cohort 1) and as 1050 mg every three weeks (in cohort 2) was performed in advanced, refractory ovarian cancer. The authors reported a 4.3% partial response rate and 6.8% of patients with stable disease lasting at least 6 months. Median PFS was 6.6 weeks [citabine , 44. TheSorafenib is an oral multikinase inhibitor that targets the mitogen-activated protein kinase (MAPK) pathway or Raf/MEK/ERK pathway . This drA phase II trial of single agent sorafenib in persistent or recurrent EOC or primary peritoneal cancer was performed by the GOG . Patient2 intravenously weekly for 7 out of 8 weeks of the first cycle, then weekly for the first 3 weeks of a 4-week cycle and sorafenib 400 mg orally twice daily continuously. Using RECIST criteria, the authors reported 1 out of 18 evaluable patients had a partial response and 5 had a confirmed partial response by CA125 criteria. An additional 10 patients exhibited stable disease. Median time to progression was 5.4 months and overall survival was 13.3 months. The most frequent grade 3 and 4 toxicities were hematologic , fatigue, hypokalemia, and hand-foot syndrome.Sorafenib has also been studied in conjunction with other medications. A Phase I dose escalation study of sorafenib and bevacizumab (5 mg/kg or 10 mg/kg intravenously every two weeks) showed six Response Evaluation Criteria in Solid Tumors (RECIST) partial responses in 13 ovarian cancer patients, with duration of response from 4 to over 22 months . UnfortuImatinib mesylate inhibits abl, c-kit, and PDGFR tyrosine kinases, thereby inhibiting tumor growth. It is FDA approved for some forms of adult and child chronic myelogenous leukemia as well as gastrointestinal stromal tumors (GISTs). Activating mutations of kit have not been found in ovarian cancers, but abnormal kit expression has been described . The actPoly(ADP-ribose) polymerase (PARP) is an enzyme involved in repair of DNA single-strand breaks using the base excision repair pathway , 53. A rOlaparib is an oral small-molecular PARP inhibitor. Preclinical studies confirmed that BRCA-deficient cells were up to 1000-fold more sensitive than wild-type cells to PARP inhibition . Cells tIn phase I trials, olaparib was well tolerated, and there were no obvious differences in the pattern of toxicities between BRCA and non-BRCA patients –61. A phA randomized phase II trial comparing olaparib with pegylated liposomal doxorubicin (50 mg/m2 monthly intravenous) in patients with BRCA-mutated ovarian cancer with a platinum-free interval of 0–12 months is currently underway (NCT00628251). Another ongoing trial is a randomized placebo-controlled study of olaparib as maintenance therapy in patients with serous/sporadic ovarian cancer at high risk of early recurrence (NCT00753545).Newer targeted therapies are undergoing evaluation in ovarian cancer. The most promising at this time are those directed towards inhibition of angiogenesis. Combining targeted therapeutics has resulted in significant toxicities, tempering enthusiasm for this approach. The finding of PARP inhibitors as potentially active agents in BRCA-associated ovarian cancer further supports the importance of screening patients for potential BRCA-associated disease and offering mutational testing when appropriate. Finally, given that the patient population who has typically entered trials evaluating targeted therapeutics includes those with recurrent or resistant disease, perhaps the finding of stable disease has some merit in the context of treatment effectiveness. Deeper understanding of biological pathways in ovarian cancer will be needed to select patients who enter these trials.

Clostridium difficile causes antibiotic-associated diarrhea and pseudomembranous colitis by production of the Rho GTPase-glucosylating toxins A and B. Recently emerging hypervirulent Clostridium difficile strains additionally produce the binary ADP-ribosyltransferase toxin CDT (Clostridium difficile transferase), which ADP-ribosylates actin and inhibits actin polymerization. Thus far, the role of CDT as a virulence factor is not understood. Here we report by using time-lapse- and immunofluorescence microscopy that CDT and other binary actin-ADP-ribosylating toxins, including Clostridium botulinum C2 toxin and Clostridium perfringens iota toxin, induce redistribution of microtubules and formation of long (up to >150 µm) microtubule-based protrusions at the surface of intestinal epithelial cells. The toxins increase the length of decoration of microtubule plus-ends by EB1/3, CLIP-170 and CLIP-115 proteins and cause redistribution of the capture proteins CLASP2 and ACF7 from microtubules at the cell cortex into the cell interior. The CDT-induced microtubule protrusions form a dense meshwork at the cell surface, which wrap and embed bacterial cells, thereby largely increasing the adherence of Clostridia. The study describes a novel type of microtubule structure caused by less efficient microtubule capture and offers a new perspective for the pathogenetic role of CDT and other binary actin-ADP-ribosylating toxins in host–pathogen interactions. Clostridium difficile is responsible for ∼20 percent of antibiotic-related cases of diarrhea and nearly all cases of pseudomembranous colitis. The pathogens produce two protein toxins (toxins A and B), which inactivate Rho-GTPases of host cells by glucosylation. Recently emerging hypervirulent strains of C. difficile release higher amounts of toxins A and B, are resistant towards fluoroquinolones and produce an additional protein toxin called C. difficile transferase (CDT). CDT is a binary toxin, which modifies G-actin by ADP-ribosylation, thereby inhibiting actin polymerization. So far the pathogenetic role of CDT is not clear. Here we studied the effects of CDT on human colon carcinoma cells and show that the toxin causes rearrangement of microtubules and formation of long cellular protrusions. The microtubule-based protrusions form a dense meshwork at the cell surface, which wrap and embed Clostridia, thereby increasing adherence of the pathogens. We observed similar effects with other members of the family of binary actin-ADP-ribosylating toxins like C. botulinum C2 toxin and C. perfringens iota toxin. Our findings show a novel type of microtubule structures induced by actin-ADP-ribosylating toxins and propose an important role of these toxins in host–pathogen interactions by their effects on adherence and colonization of Clostridia. Clostridium difficile toxins A and B, which cause antibiotic-associated diarrhea and pseudomembranous colitis C. difficile isolates produce an actin-ADP-ribosylating toxin called C. difficile transferase (CDT) C. difficile (such as Nap1/027) raises the question of its cellular function and pathogenetic role Many bacterial protein toxins affect the actin cytoskeleton by modulating the activity of Rho GTPases, including RhoA, Rac and Cdc42 Clostridium and Bacillus, including C. botulinum (C2 toxin), C. perfringens (iota toxin), C. spiroforme and B. cereus CDT belongs to the family of binary actin-ADP-ribosylating toxins In the cytosol, the enzymatic component of the toxins ADP-ribosylates G-actin at Arginine-177 C. difficile CDT, C. perfringens iota toxin and C. botulinum C2 toxin not only affect the actin cytoskeleton but induce the formation of a novel type of microtubule structures, consisting of long microtubule-based protrusions on the surface of epithelial cells, leading to increased adherence of Clostridia.Although the effects of ADP-ribosylating toxins on actin are well understood, their role as virulence factors is not clear. Here, we report that the actin-ADP-ribosylating toxins C. botulinum C2 toxin and C. perfringens iota toxin , which was not increased after disruption of the actin cytoskeleton by toxins . Also th32P-ADP-ribosylation of actin was induced by addition of the enzyme component C2I of C2 toxin, which also modifies actin at Arg177. One hour after treatment of cells with CDT, the 32P-ADP-ribosylation of actin in the cell lysate was reduced by ∼30%. At this time point the first microtubule extensions were formed at the cell surface, suggesting that formation of protrusions and ADP-ribosylation of actin are concomitant processes.To study whether formation of microtubule protrusions was accompanied and/or preceded by ADP-ribosylation of actin, we analyzed CDT-catalyzed modification of actin in Caco-2 cells in a time course by differential ADP-ribosylation . To thisTo address the question, whether the formation of microtubule protrusions was a consequence of actin disruption or an actin independent effect, we tested the microfilament destabilizing drugs cytochalasin D and latrunculin B [26]. BoC. difficile toxin B and C. limosum C3 toxin, both of which alter the dynamics of the actin cytoskeleton, did not induce microtubule protrusions , we studied +TIP end-binding protein 1 (EB1), which is a marker of polymerizing microtubules Similar results as observed for EB1 were obtained for cytoplasmic linker protein 170 (CLIP-170), which is another +TIP member To analyze the consequences of increased +TIP-association on microtubule dynamics, a GFP-version of the +TIP EB3 was expressed and the cells were analyzed by fluorescence time-lapse microscopy with high temporal resolution . Only ceWe addressed the question whether proteins, which are suggested to be involved in capture of microtubules, were affected by actin-depolymerizing toxins. Besides EB1, CLASPs (CLIP- associated proteins) appear to participate in capture processes EB1 interacts with the large spectraplakin ACF7 that functionally links microtubules to actin microfilaments C. difficile toxin B on the formation of CDT-induced microtubule protrusions that does not produce CDT was not able to induce protrusions. Moreover, addition of anti-iota B antibody, which is known to interact with the binding component of CDT C. difficile Nap1/027, indicating that the formation of protrusions depended on the actin ADP-ribosylating toxin CDT . For a long time, attempts to establish a mouse model for C. difficile-mediated antibiotic-associated diarrhea have yielded ill-reproducible results. Most likely, mouse-colony specific differences in gut flora composition have been responsible for the poor reproducibility. Only very recently, antibiotic treatment regimes have been developed which allow re-capitulating the hallmarks of antibiotic-facilitated C. difficile colitis in conventional mice C. difficile infection. Mice were treated with clindamycin (0.2 mg) 24 h previous to infection with the human pathogenic C. difficile strain Nap1/027 (107 CFU). To investigate the role of CDT in enteric infection, we neutralized CDT in Nap1/027-infected mice by oral treatment with CDT-neutralizing rabbit anti-iota antiserum. The other group of mice was treated with control serum. Notably, in contrast to mice treated with CDT-neutralizing anti-iota toxin antibody, mice treated with the control serum developed signs of diarrhea (liquid stool) at 24 h after infection. Mice were sacrificed 30 h after infection. Upon macroscopic inspection, a great part of the control mice exhibited signs of colitis and approximately half of the mice showed overt inflammation of the cecum (data not shown). As the key experimental readout, we analyzed intestinal colonization by Nap1/027. C. difficile colonized anti-iota toxin treated mice at significantly lower levels as compared to control mice also produce CDT and the number of isolates, producing CDT, is increasing − B− CDT+-strains), did not cause disease but colonize in hamster after challenge with clindamycin. On the other hand, A+B+CDT−-strains can colonize and cause disease under the same conditions CDT-induced formation of protrusions increased the adherence of Clostridia. We show that CDT induces a ∼5 fold increase in adherence of C. difficile bacteria under anaerobic conditions. Moreover, in vivo studies in mice were in line with these results. When mice were infected with a CDT-producing strain, we observed a 4 fold increase in epithelial adherence of bacteria in the large intestine as compared to mice treated with CDT-neutralizing antiserum.Our findings show that the toxin has unexpected effects on the morphology of intestinal cells, which directly affect the environment of the C. difficile colonization of the cecal content was significantly decreased when CDT was functionally neutralized in the gut. Considering the massive effects of CDT on the microtubule system and the formation of a meshwork of microtubule-based protrusions tightly covering bacteria at the surface of intestinal epithelial cells, we propose that at least one major effect of CDT is increased epithelial adherence and thereby optimization of colonization of the pathogen. It was shown that C. difficile binds to extracellular matrix proteins like fibronectin or collagen C. difficileC. difficileClostridia with extracellular matrix proteins is not possible before major alteration of epithelial cells are induced by cytotoxins. Thus, in the early phase of infection CDT-induced formation of protrusions might be of special importance for adherence of Clostridia.These data were corroborated by the finding that C. difficile. Hence our findings of the toxin effects, which are shared by all actin ADP-ribosylating toxins studied, have a major impact in understanding the role of these toxins produced by several Clostridia. Different pathogenic Clostridia might exploit this mechanism by the production of ADP-ribosylating toxins. C. botulinum type C and D produces in addition to the highly potent neurotoxins, the actin modifying C2 toxin. For this reason, C2 might be of relevance for botulism in waterfowl Taken together, our findings suggest an important role of microtubule-based protrusions in enhancing cell surface adherence and colonization by Cytochalasin D was obtained form Sigma , latrunculin B from Calbiochem and jasplakinolide from Axxora .The components of C2 toxin (C2I and C2II) E. coli TG1 pACYC IRL10 cells (CDTa) and in E. coli BL21 DE3 Rosetta cells (CDTb). The proteins were purified by affinity chromatography with glutathione-Sepharose 4B, according to the manufacturer's instructions. Glutathione S-transferase was cleaved off by thrombin (3.25 NIH units/mL of bead suspension). The inactivation of thrombin was performed by the addition of benzamidine beads. CDTb was activated by 0.2 µg of trypsin/µg of protein for 30 min at 37°C.The components of CDT (CDTa and CDTb) were purified as recombinant glutathione S-transferase proteins. GST-Proteins were expressed in All binding components used mentioned in the text were used as protease-activated proteins according to Purification of the Rho-inactivating C3 toxin, which was used as a cell permeable fusion toxin, has been described C. difficile (strain VPI 10463) toxin B was purified as described cdtb (2631 bp) was amplified by PCR, using genomic DNA from C. difficile strain 196 as a template. Used primers: BglII GGG GGG AGA TCT ACC ATG AAA ATA CAA ATG AGG AAT AAA AAG G5′CDTb- and EcoRI GGG GGG GAA TTC CTA ATC AAC ACT AAG AAC TAA TAA CTC3′CDTb-. The PCR-product was cloned into the pGEX-2T-vector.pGEX-CDTa construction was described previously C. difficile 630 were from Dr. Neil Fairweather .Mouse anti-EB1 and anti-EB3 antibodies were from BD Biosciences , mouse monoclonal anti-α-tubulin, anti-acetylated tubulin antibody were from Sigma , mouse anti-detyrosinated tubulin antibody was from Millipore . Anti-tyrosinated tubulin antibody YL1/2 was used as described before Caco-2 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum (FCS), 1% non essential amino acids and 1% Na-pyruvate, all from Biochrom . HT29 cells were cultured in Mc Coy's 5A Medium supplemented with 10% FCS. For immunostaining, cells were plated on HCl-washed coverslips. For life cell imaging, cells were plated on glass bottom dishes . Cells were transfected using Lipofectamine 2000 according to the manufacturer's protocol.C. difficile strain VPI 10463 was cultured in Brain Heart Infusion medium at 37°C under anaerobic conditions . For quantification of bacterial adherence, 100 µl of a C. difficile over night culture were added to a 3 cm dish of polarized Caco-2 monolayer, containing 2 ml cell culture medium with 15 mM HEPES-Buffer . The cells were incubated under anaerobic conditions for 4 h. After incubation the cells were washed, removed and plated on blood agar plates. After 2 days colony forming units (CFUs) were counted. Adherence of Clostridia after CDT treatment was quantified as percent of adherence on control cell monolayer.2, and Complete protease inhibitor . The reaction was stopped by boiling the sample with SDS-sample buffer. The samples were run on SDS-PAGE, and [32P]ADP-ribosylated proteins were detected by autoradiography with a PhosphorImager .ADP-ribosylation was performed at different time points after toxin treatment. 30 µg of whole-cell lysate were used. The subsequent ADP-ribosylation reaction was performed for 30 min at 30°C with 300 ng of C2I in a buffer, containing 20 mM Tris-HCl (pH 7.5), 1 mM EDTA, 1 mM dithiothreitol, 5 mM MgClCells were washed with warmed PBS, fixed in ice-cold methanol, containing 1 mM EGTA , postfixed with 4% formaldehyde, and permeabilized with 0.15% Triton X-100 in PBS. Cells were blocked by 1% BSA and 0.05% Tween 20 in PBS. Incubation with first antibody was performed over night at 4°C in 1∶200, 1∶300 or 1∶1000 dilutions in blocking buffer dependent on the antibodies. Then, samples were washed with 0.05% Tween 20 in PBS and incubated with 1∶200 dilutions of the secondary antibodies for 1.5 h at room temperature. Thereafter, cells were washed again and embedded with Prolong Gold. Fixed samples were analyzed by fluorescence microscopy, using an upright Zeiss Observer microscope system equipped with an apotom. For the measurement of +TIP length, 100 +TIPs in each group were analyzed with Metamorph software .For live cell imaging cells were observed in a chamber that provided a humidified atmosphere (6.5% CO2 and 9% O2) at 37°C on a Zeiss Axiovert 200 M inverted microscope . Specific fluorescence illumination was generated by a monochromator . Images of 16-bit depth were collected with a digital camera driven by Metamorph imaging software . For the observation of formation of microtubule protrusions time-lapse series, lasting 2–8 h, were acquired with 90 sec intervals. For quantification of formation of microtubule protrusions, the lengths of all processes were summated every 15 min and normalized by the respective section of cell perimeter . The colon was washed three times. Ions were chelated by 1 mM EDTA and 1 mM EGTA for 1 h at 21°C. To release the epithelial cells from the lamina propria, the tube was vigorously shaken. The piece of tissue was removed and the liberated epithelial cells were pelleted at 50 g for 3 min. The cells were washed in growth DMEM medium . Subsequently, cells were plated on collagen-coated dishes or coverslips. Experiments were performed after 1–2 days 2, 0.01 M MgCl2, 0.09 M saccharose, pH 6.9) and prefixed by adding paraformaldehyde to a final concentration of 5%, after 10 min glutaraldehyde was added to a final concentration of 2%. Cells were dehydrated by incubation in a graded series of acetone in 10% steps to 100%, critical-point dried with liquid CO2 and covered with a thin gold film for conductivity by sputter coating . Samples were examined in a field emission scanning electron microscope DSM982 Gemini at an acceleration voltage of 5 kV or in a LEO 435VP at an acceleration voltage of 10 kV.For scanning electron microscopy of cells the cultivation medium was replaced by ice-cold cacodylate buffer , according to the protocol published on the Taconic webpage . Gnotobiotic mice were maintained under barrier conditions in individually ventilated cages with autoclaved chow and autoclaved, acidified water.Gnotobiotic mice were created by colonizing germfree Swiss Webster mice with a donor mouse, associated with the C. difficile Nap1/027, mice were pretreated with 0.2 mg clindamycin by gavage. Mice were infected by gavage with 107 CFU C. difficile Nap1/027 in 0.2 ml PBS. Mice were treated with anti-iota or control serum by oral gavage directly after infection (or at 7 h postinfection with similar results) and at 24 h postinfection. To inactivate complement, serum was incubated for 30 min at 56°C. 30 h post infection, mice were sacrificed by cervical dislocation.24 h previous to infection with The experiments were performed on 2 independent occasions with a total of 10 Nap1/027 infected mice treated with anti-iota CDT-neutralizing serum, 11 Nap1/027 infected mice treated with control serum and 4 control mice. 2 of the control mice were also treated with control serum to exclude a serum induced inflammation.C. difficile serum. Actin was stained by TRITC-phalloidin and the nuclei by DAPI. For bacterial quantification, bacteria adjacent to the epithelium, stained with anti-C.difficile serum, within 3 µm of the epithelium were counted. If bacterial aggregations were attached to the epithelium all bacterial cells in the aggregation were counted. This was done for ≥15 optical fields per group. The number of C. difficile per µm mucosa surface was determined.For histology, intestinal tissue was cryo-embedded in Tissue Tek OCT (Sakura) and flash frozen. For immunofluorescent staining, the tissue was fixed in 4% PFA over night followed by over night equilibration in 20% sucrose and cryo-embedding. Cryosections (7 µm) of PFA-fixed and cryo-embedded tissue from cecum and colon were mounted on glass slides and air dried for 2 h at room temperature prior to immunostaining. Sections were fixed again in 4% paraformaldehyde for 5 min, washed and blocked with 1% BSA in PBS. The primary antibody was detected with an Alexa 488 labeled anti-rabbit antibody. The sections were incubated over night with a rabbit anti-C. difficile selective agar plates at different dilutions. The minimal detectable value was 10 CFU/g.For bacteriology, cecal content was removed aseptically and homogenized in 4°C PBS. The bacterial loads in cecal content were determined by plating on Student's t test was used when two groups of parametric data with normal distribution had to be compared. The Mann-Whitney U test was applied for processed data without normal distribution. Statistic evaluation was performed with the Sigma Stat software or with Prism 4 . P values <0.05 were considered statistically significant.Animal experiments were approved and performed as ethically and legally required.Figure S1Specificity of toxin-induced formation of protrusions. (A) Both CDT components are necessary for protrusion formation. Series of DIC time-lapse images of Caco-2 cells treated with 20 ng/ml CDTa or 40 ng/ml CDTb. Subconfluent Caco-2 cells were treated with each toxin component for 0, 2 and 5 h. No formation of protrusions was observed when only one toxin component was added. Bar, 20 µm. (B) A catalytic inactive mutant of CDTa E430Q did not induce protrusion formation. DIC time-lapse microscopy of Caco-2 cells. Subconfluent Caco-2 cells were treated with 20 ng/ml CDTa E430Q and 40 ng/ml CDTb. No formation of protrusions was observed. (C) The ADP-ribosylating toxins iota toxin and C2 toxin induce formation of protrusions. DIC time-lapse microscopy of Caco-2 cells. Subconfluent Caco-2 cells were treated with 100 ng/ml iota toxin Ia (enzyme component) and 200 ng/ml iota toxin Ib (binding component) or with 250 ng/ml C2I and 500 ng/ml C2II for 6 h. Bar, 20 µm. (D) Primary colonocytes from the rat gut form protrusions after toxin treatment. DIC time-lapse microscopy of primary rat colonocytes after 1.5 days in vitro. Rat colonocytes were prepared as described in the (0.71 MB PDF)Click here for additional data file.Figure S2Quantification method of toxin-induced formation of protrusions. The lengths of protrusions (indicated 1–5) were determined by using the Metamorph software and the sum normalized by the respective section of cell perimeter (indicated as dashed line). Here Caco-2 cells were used and the toxin concentration was 20 ng/ml CDTa and 40 ng/ml CDTb. Incubation time was 1 h.(0.05 MB PDF)Click here for additional data file.Figure S3Visualization microtubule-based protrusions on polarized Caco-2 cells. (A) Caco-2 cells were grown on filters for 2 weeks to ensure polarization. Cells were treated with 20 ng/ml CDTa and 40 ng/ml CDTb. Untreated control cells show microvilli at the cell surface. On CDT-treated cells, microvilli disappeared and showed pronounced formation of protrusions. Scale bar represents 10 µm. (B) Confluent Caco-2 cells were grown for 1.5 weeks. The polarized cells were treated with 20 ng/ml CDTa and 40 ng/ml CDTb and fixed after 2 h or remained untreated as control cells. Confocal images of indirect immunofluorescence of α-tubulin and occludin were acquired as a Z-stack. Yellow arrows mark microtubule bundles at the cell surface. The relative position of the picture in the Z-stack is indicated on the left. Scale bar represents 10 µm. (C) Confluent Caco-2 cells grown for 1.5 weeks (as in S3B). The polarized cells were treated with 20 ng/ml CDTa and 40 ng/ml CDTb and fixed after 2 h or remained untreated as control cells. Confocal images of indirect immunofluorescence of α-tubulin and ZO-2 were acquired as a Z-stack. Yellow dashed lines represent cell borders delineated according to the ZO-2 staining. The relative position of the picture in the Z-stack is indicated on the left. The real position is shown in the cut view below. The cut view is reconstructed along the red line in the upper picture of the Z-stack. CDT treated cells are higher. As a result the area of the nucleus is not represented in the shown Z-stack of CDT-treatment. Scale bar represents 10 µm. (D) Magnification of the white square in Figure S3C (right panel), showing the microtubule-based protrusion meshwork at the cell surface.(3.07 MB PDF)Click here for additional data file.Figure S4Staining of posttranslationally modified tubulin. Subconfluent Caco-2 cells were treated with 20 ng/ml CDTa and 40 ng/ml CDTb and fixed after 2 h or remained untreated as control cells. (A) Indirect immunofluorescence of α-tubulin (green) and detyrosinated tubulin (Glu-tubulin) (red). The amount of Glu-tubulin is not increased. Protrusions are not formed by Glu-tubulin. (B) Indirect immunofluorescence of α-tubulin (green) and acetylated tubulin (red). The amount of acetylated tubulin is not increased. Protrusions are not formed by actetylated tubulin. (C) Indirect immunofluorescence of α-tubulin (green) and tyrosinated tubulin (Tyr-tubulin) (red). The protrusions are formed by dynamic tyrosinated tubulin. Scale bar represents 20 μm .(2.19 MB PDF)Click here for additional data file.Figure S5Influence of actin stabilizing and destabilizing drugs on the formation of microtubule-based protrusions. (A) Series of time-lapse images of cells treated with 20 ng/ml CDTa and 40 ng/ml CDTb, 5 µM latrunculin B and 1 µM cytochalasin D, respectively. Scale bar represents 20 µm. Actin destabilizing drugs can also induce protrusions, but less effective compared to CDT. (B) Series of time-lapse images of cells, which were treated with 500 nM jasplakinolide (jas) for 30 min. Then 20 ng/ml CDTa and 40 ng/ml CDTb were added and the formation of protrusions was monitored. Scale bar represents 20 µm. Actin stabilization can delay and decrease the formation of protrusions. (C) DIC time-lapse microscopy of Caco-2 cells. Subconfluent Caco-2 cells were treated with 300 ng/ml toxin B (Tox B) or 300 ng/ml C3 fusion toxin (C3) and 500 ng/ml C2II (to deliver the C3-fusion toxin into the cells) for the indicated times (h). The toxins were added to the cell culture medium. Incubation with toxins was continued until major morphological changes occurred. No formation of protrusions was observed under these conditions. Scale bar represents 20 µm.(0.87 MB PDF)Click here for additional data file.Figure S6Influence of CDT on EB3 and CLIP-115 proteins. Subconfluent Caco-2 cells were treated with 20 ng/ml CDTa and 40 ng/ml CDTb and fixed after 1 h. Indirect immunofluorescence pictures of EB3 (red) by using anti-EB3 antibody and CLIP-115 (green) by using anti-CLIP-115 antibody in Caco-2 cells are shown. The nucleus was stained by DAPI (blue). Scale bar represents 20 µm. The increase of EB3 and CLIP-115 comet length after toxin treatment is seen.(0.84 MB PDF)Click here for additional data file.Figure S7C. difficile in cecal content in vivo. Mice were infected by gavage with Nap1/027 (107 CFU) and subsequently treated with control serum or CDT-neutralizing anti-iota toxin serum. Cecal content was aseptically removed and homogenized. Bacterial loads in the cecal content from uninfected untreated mice, Nap1/027 (107 CFU) infected CDT-neutralizing anti-iota toxin serum treated mice and Nap1/027 infected control antiserum treated mice were determined by plating on C. difficile selective agar plates at different dilutions. The minimal detectable value was 10 CFU/g. The experiments were performed on 2 independent occasions with a total of 10 Nap1/027 infected mice treated with anti-iota CDT-neutralizing serum, 11 Nap1/027 infected mice treated with control serum and 4 control mice. Boxes indicate 25th and 75th percentiles, black bars indicate medians, and whiskers indicate data ranges. Y-axis is scaled logarithmically (log10). * indicates p≤0.05.CDT increases bacterial loads of (0.03 MB PDF)Click here for additional data file.Figure S8C. difficile in the cecum and colon in vivo. (A) Mice were infected with Nap1/027 (107 CFU) and subsequently treated with control serum or CDT-neutralizing anti-iota toxin serum. Cryosections (7 µm) of PFA-fixed and cryo-embedded tissue from cecum and colon were immunostained for C. difficile. Actin was stained by TRITC-phalloidin and the nuclei by DAPI. M marks the mucosa and L marks the lumen of the intestine. White boxes are magnified. White arrows mark bacteria or bacterial aggregations adjacent to the epithelium. Calibration bar represents 20 µm. (B) Quantification of C. difficile directly adjacent to the epithelium in the cecum. For bacterial quantification, bacteria adjacent to the epithelium, stained with anti-C. difficile serum, within 3 µm of the epithelium were counted. If bacterial aggregations were attached to the epithelium all bacterial cells in the aggregation were counted. This was done for ≥15 optical fields per group. The number of C. difficile per µm mucosal surface was determined. Nap1/027 infected mice treated with control serum were set 100%. (C) Quantification of C. difficile directly adjacent to the epithelium in the colon. The number of C. difficile per µm mucosa was determined as in B.CDT increases adherence of (0.85 MB PDF)Click here for additional data file.Video S1DIC time-lapse microscopy movie of Caco-2 cells. Subconfluent Caco-2 cells were treated with 20 ng/ml CDTa and 40 ng/ml CDTb. The toxin was added to the cell culture medium. Thereafter, a picture was taken every 90 sec. After ∼50 min the formation of toxin-induced protrusions started. The maximum of protrusion formation was observed after ∼4 h. The incubation time (h∶min) is indicated in the movie. Scale bar represents 20 µm.(6.92 MB MOV)Click here for additional data file.Video S2Fluorescence time-lapse microscopy of Caco-2 cells transfected with EB3-GFP. Cells were treated with 20 ng/ml CDTa and 40 ng/ml CDTb for 2 h. The arrowhead marks the place where several EB3-GFP comets approach the cell cortex, cross the cell border and form a microtubule-based protrusion. Pictures were acquired every 2 sec. The elapsed time (min∶sec) is indicated in the movie. Contrast was inverted. Scale bar represents 5 µm.(0.35 MB MOV)Click here for additional data file.

KRAS oncogene have consistently been shown to predict non-response to cetuximab and panitumumab. The role of KRAS as a marker of efficacy of anti-EGFR therapies is reviewed.Survival of patients with metastatic CRC (mCRC) has improved steadily over the past several decades, due largely to the development of new combinations of standard chemotherapy, as well as to the introduction of new targeted therapies. Among the available targeted therapies are two monoclonal antibodies that target the epidermal growth factor receptor (EGFR) – cetuximab and panitumumab – which have demonstrated efficacy in the treatment of mCRC. These therapies are associated with a unique set of toxicities and costs, prompting the need for tools to select patients who are most likely to derive a benefit from them. Mutations in the This marker is of particular importance, given the prevalence of KRAS mutations among patients with CRC; up to half of patients with CRC are found to have the mutant version of the geneThere has recently been heightened interest in the relevance of several biomarkers for the selection of patients who will benefit from EGFR-targeted therapies for the treatment of CRC and other EGFR-associated cancers. In particular, mutations in the 1.1KRAS is a signal transducer downstream of tyrosine kinase receptors including EGFR – a complex signaling cascade involved in the development and progression of cancer. The EGFR pathway is activated by the binding of the cell-surface EGFR/HER family receptors to their ligands, such as transforming growth factor alpha (TGF- α) and EGF. This leads to activation of genes that regulate cell cycle progression, tumor cell survival, metastases and angiogenesis /extracellular signal-related kinase (ERK) pathway are tightly controlled. Mutated KRAS protein becomes constitutively activated, thereby making the cascade independent of upstream signaling by tyrosine kinase receptors such as the EGFR. Therefore, blocking of EGFR with cetuximab or panitumumab may not affect downstream events. Mutations within the KRAS gene resulting in constitutive protein activity are found in approximately 30% to 50% of all CRCsUpon stimulation of the EGFR, wild-type 1.21.2.1KRAS status of the tumor KRAS. Of the 84 panitumumab treated patients with KRAS mutations, none responded to the treatment. In contrast, 21 of 124 antibody-treated patients with wild-type KRAS tumors experienced a partial response. Among patients with wild-type KRAS, PFS was significantly improved with panitumumab compared with BSC alone , while no benefit was observed among those with mutant KRAS .The first study to provide conclusive data showing the relationship between KRAS mutations were identified in 35.6%KRAS, the addition of cetuximab to folinic acid, fluorouracil, and irinotecan (FOLFIRI) improved both PFS and response rate . In contrast, for patients with KRAS mutations, treatment with cetuximab did not significantly improve either PFS or response rate in comparison with FOLFIRI alone. In the OPUS study, patients were treated with first-line infused fluorouracil, folinic acid, and oxaliplatin (FOLFOX) with or without cetuximabKRAS tumors, and patients with mutated KRAS receiving cetuximab demonstrated poorer outcomes than those receiving FOLFOX alone.Similar results have been demonstrated with cetuximab. In a retrospective analysis of 540 mutation assessable patients in the CRYSTAL trial, KRAS mutations, the study group undertook correlative analyses to determine whether the mutation status of the KRAS gene modified the effect of cetuximab on the overall survival (OS) and PFS in the CO.17 patient populationKRAS analysis, accounting for 68.9% of the original study population. KRAS mutations were detected in 40.9% and 42.3% of tumors from the cetuximab and BSC groups, respectively. Among patients with wild-type KRAS, median overall survival was significantly longer in the cetuximab group (9.5 months) than in the BSC group (4.8 months), with one-year overall survival rates of 28.3% and 20.1%, respectively . However, among patients with KRAS mutations, overall survival was not improved with cetuximab, with a median survival of 4.5 months vs. 4.6 months with BSC alone, and one-year overall survival rates of 13.2% and 19.6%, respectively . These results were instrumental in defining the indication for the monoclonal antibody EGFR inhibitors in North America.The phase III CO.17 trial, conducted by the National Cancer Institute of Canada Clinical Trials Group (NCIC CTG) in collaboration with the Australasian Gastro-Intestinal Trials Group (AGITG), examined the effect of cetuximab on survival among patients with advanced CRC in whom all chemotherapy had failed and for whom no other standard anticancer therapy was available1.2.2KRAS mutations, resistance to anti-EGFR therapies may occur as a result of mutations in other signaling molecules in the RAS-RAF-MAPK pathway. Recent retrospective analyses of mCRC patients treated with cetuximab or panitumumab have shown that BRAF mutations, which are exclusive from KRAS mutations, occur in approximately14% of patients and are also associated with a lack of response to anti-EGFR therapyIn the absence of 2.2.1KRASKRAS mutations do not derive any benefit from treatment with EGFR-targeting monoclonal antibodies in the first-, second-, or third-line settings, Cancer Care Ontario (CCO) recommends the two clinically available EGFR inhibitors, cetuximab and panitumumab, be used “for the treatment of patients with advanced CRC after failure of standard chemotherapy and whose tumors have tested negative for KRAS gene mutations”In Canada, panitumumab is currently restricted to the treatment of EGFR-expressing mCRC with non-mutated (wild-type) KRAS mutations in a CLIA-accredited laboratoryKRAS gene mutations, stipulating that only patients with wild-type KRAS genes should receive treatment with cetuximab or panitumumabThe American Society of Clinical Oncology (ASCO) recently also released a provisional clinical opinion recommending that patients with mCRC who are candidates for treatment with cetuximab or panitumumab undergo tumor testing for However, BRAF testing is currently not a requirement for treatment with an EGFR inhibitor.2.2KRAS tumor status prior to initiating treatment with an anti-EGFR monoclonal antibody, unnecessary toxicity and costs can be avoided for patients who are unlikely to respond. However, there are logistical challenges in testing tumors from mCRC patients, as well as questions surrounding specimen selection, and selection of the appropriate assay.By screening patients with mCRC for 2.3The most readily available clinical specimens for mutational analysis are typically formalin-fixed, paraffin-embedded (FFPE) tissue blocks. Until recently, formalin-fixed samples were considered to be of low quality and yield for DNA testingKRAS mutation testing may be obtained from the primary tumorKRAS testing may be performed using material from the metastatic tumorKRAS status in primary and metastatic tumors are limited and have had inconsistent resultsKRAS mutational status between primary tumors and metastases in 92% of patients, suggesting that evaluation of KRAS status can be performed in either the primary tumor or metastatic sitesBased on current knowledge, the most appropriate specimens for 2.4Several mutation detection procedures have been described, all of which are based on the polymerase chain reaction (PCR) 22. Gener2.5KRAS testingKRAS in clinical samples, including methods that employ restriction fragmentation length polymorphism (RFLP), allele-specific oligonucleotide (ASO) hybridization, high resolution melting analysis (HRMA), and amplification refractory mutation systems (ARMS).Direct sequencing of PCR products detects all mutations in amplified DNA sequences, and this is currently the most commonly used method for 2.6Whereas gene sequencing compares the sequence of the sample gene with the normal sequence of the gene, nucleotide by nucleotide, RFLP methods detect differences between mutant and wild-type DNA by their susceptibility to digestion by restriction enzymes. Restriction enzymes can be selected to recognize a defined sequence which is present only in the mutated or non-mutated DNA. Knowing what specific size the digested fragment should be in mutated vs. non-mutated DNA allows one to identify if a mutation is present or not. These amplified mutant copies can then be detected by gel or capillary electrophoresis2.7Short segments of synthetically produced DNA (oligonucleotides) can be used to detect mutations in a gene segment. The oligonucleotides are complementary to a corresponding segment of the gene under investigation, hybridizing completely with the wild-type sequence or to one of the possible mutations. A single base mismatch caused by a mutation reduces the melting point temperature of the double-stranded hybridFinding rare mutant alleles in a DNA mixture can be challenging however, particularly in samples containing high levels of normal alleles. Therefore, if a sample has a low tumor burden, this may not be the best approach. This technique is also expensive, requiring specialized equipment and software for analysis2.8The presence of a mutation disrupts the affinity of two DNA chains, causing them to bind with less energy and become more easily separated by heat. High resolution melting analysis (HRMA) is performed following PCR, and measures differences in melting point temperatures between matched and mismatched double stranded DNA, caused by polymorphisms or somatic mutations2.9KRAS mutations in heterogeneous specimens at a low allelic concentration (1%) without the need for confirmation by direct sequencing. A drawback of ARMS is that it is only able to detect known mutations; separate reactions are required for each mutation, thus requiring more DNA material. However, because the amplification step and the diagnostic steps are combined, this may prove to be a time-efficient and practical method for routine diagnosis of KRAS mutationsThe amplification refractory mutation system (ARMS) – also known as allele-specific PCR or PCR amplification of specific alleles – utilizes a PCR primer which is designed to discriminate among templates that differ by a single nucleotide residue. The ARMS primer can be designed to amplify a specific allele of a multi-allelic system while remaining refractory to amplification of another allele that may differ by as little as a single base. ARMS is able to detect directly the presence of 2.10KRAS mutations in clinical practiceKRAS testing, and testing can be performed using laboratory-developed tests, provided that the laboratory is accredited by the College of American Pathologists (CAP) and the test has been appropriately validated.KRAS mutation testingKRAS gene in codons 12 and 13 in 40 colorectal tumor samples, with direct sequencing used as a reference. Two of the allele-specific PCR-based methods and one PCR/direct sequencing method demonstrated high to good agreement with direct sequencing, whereas an oligonucleotide hybridization method showed poor agreement.Because of the potential for variability among the different testing methods, a thorough analytical validation of testing methods, together with a high standard of quality assurance are critical for accurate, reliable testing of 3.KRAS mutation analysis – the TheraScreen K-RAS testing kit only (1 laboratory), the TheraScreen K-RAS testing kit in combination with direct sequencing (2 laboratories), the TheraScreen K-RAS testing kit in combination with direct sequencing and RFLP (1 laboratory), and RFLP plus sequencing (2 laboratories). In the first phase of the study, 10 DNA samples were extracted from seven KRAS mutant (positive) cell lines containing approximately 50–100% mutant cells. In the second phase, dilutions were created from each of the seven positive cell lines (approximately 10–40% mutant cells). To assess the ability of the laboratory to extract DNA from paraffin and the resulting specificity, accuracy and sensitivity of KRAS mutation testing on such samples, 8–10 samples were extracted from paraffin blocks for the third phase of the study. For each phase, KRAS-negative cell lines were used for comparison.The authors of the present article conducted a small study involving six Canadian laboratories to compare the accuracy and sensitivity of three methods of KRAS mutations in samples derived from cell lines containing 50–100% mutant KRAS cells as well as from diluted cells lines containing 10–40% mutant KRAS cells. However, two of the labs experienced some difficulty interpreting two samples from the diluted cell lines when using sequencing methodology; this is probably due to the limits of sensitivity of sequencing.All of the labs were able to detect KRAS mutation requiring a very sensitive assay, prompting the question of what the sensitivity cutoff of an assay should be. In sample six, two labs reported inconclusive results using the TheraScreen test, suggesting that labs reporting inconclusive results with this test should reconsider their delta-Ct cutoff criteria, optimize their assay, or use another method to verify the results. In sample eight, most of the labs had some difficulty in interpreting the mutation status due to the limited tumor area on the slides and a non-formalin based fixation method, resulting in low DNA yield and poor DNA quality. The labs that participated are all well-experienced in performing complex genetic analyses on various sample types. These results thus point to some of the challenges of KRAS testing in poor quality samples.Concordant results were achieved with five of the eight samples extracted from paraffin blocks. Inconsistent results with RFLP plus sequencing were seen in one lab, which was later discovered to be due to a mix-up of the samples . By treating only the estimated 64.4% of patients with wild-type KRAS, net savings were estimated to be $740 million in the U.S. Although cetuximab is used more commonly in the third-line setting where treatment duration is shorter, targeting treatment based on KRAS status is likely to result in cost savings across all lines of therapyIn all clinical trials, anti-EGFR therapies have been consistently ineffective in mCRC patients with Testing techniques need to be standardized and validated externally as well as internally. Cell line materials provided the most accurate results, while paraffin-embedded tissue may be somewhat more problematic, especially if suboptimal.KRAS testing. The pathologist is responsible for choosing the most appropriate tissue block to be tested, evaluating the tumor content of the tissue block, and ensuring that it is adequate by assessing the H&E-stained section of the tissue area and marking the area with adequate tumor density – preferably >70% carcinoma cells. Testing should be performed by an accredited and licensed testing lab that conforms to quality guidelines for KRAS testingThe role of the pathologist is very important in KRAS testing, where laboratory professionals have access to multiple methods wherever possible, especially when assessing suboptimal material. We have found that for small samples with degraded DNA, Sanger sequencing is often still the best method for mutation detection.We propose an algorithmic approach to KRAS status in patients with mCRC, the goal is for a sensitive and specific technique that has been standardized and validated externally and internally. As noted above, CAP currently has a proficiency challenge available for labs so they can assess their ability to test for KRAS mutations.Regardless of the testing method used to determine KRAS testing are obtained, which can be a long wait for a patient with advanced disease who requires treatment. Depending on the availability of funding, it would be optimal for KRAS testing to begin immediately following a diagnosis of metastatic disease; currently however, testing can only be undertaken when the Oncologist is considering third-line therapy.The anti-EGFR monoclonal antibody therapies are currently approved for the treatment of mCRC in the third-line setting. However, it may be several weeks before results of

Ching-Yuan Su and Dr. Hung Li were not included in the author byline. They should be listed as the 8th and 9th authors, respectively, and affiliated with the Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan. Ms. Ching-Yuan Su's contributions are as follows: performed the experiments, analyzed the data, contributed reagents/materials/analysis tools. Dr. Hung Li's contributions are as follows: conceived and designed the experiments, analyzed the data, contributed reagents/materials/analysis tools, wrote the paper.

Kaposi's sarcoma is a vascular neoplasm mainly affecting the skin of the lower extremities. Although it is the most common neoplasm affecting patients with AIDS, sporadic cases in HIV-negative people have been reported. It is a lesion mainly affecting men and its clinical presentation presents a challenge, as it can resemble other benign or malignant skin lesions.We report a rare case of Kaposi's sarcoma presenting in a 68-year-old Mediterranean woman with no evidence of HIV infection. The patient had a 6-month history of a slowly progressing pigmented lesion on the dorsum of her left hand. The lesion clinically resembled a squamous cell carcinoma. The patient was treated with a wide excision of the lesion and primary reconstruction with a full thickness skin graft. Histopathological and immunohistochemical analysis of the excised lesion revealed the presence of Kaposi's sarcoma. Serologic investigation for HIV was negative but polymerase chain reaction for human herpes virus type 8 infection was positive. Thorough clinical and imaging investigation of the abdomen and chest were both negative for loci of disease.Kaposi's sarcoma, although rare in its sporadic form, should be considered in the differential diagnosis of indeterminate skin lesions, especially those affecting the extremities. Kaposi's sarcoma (KS) is an angioproliferative skin lesion associated with a great number of epidemiologic and pathophysiologic factors. Due to this variability it is classified into four distinct clinico-epidemiological types: classic Mediterranean KS, African-endemic KS, immunosuppressive drug-related KS and epidemic AIDS-related KS. Despite being the most common neoplasm affecting patients with AIDS, its sporadic presentation is rare and can sometimes escape clinical suspicion.In its classic-sporadic type, KS presents as a cutaneous lesion typically affecting the skin of the extremities. Epidemiologically it is most often observed in elderly patients but it is a rare occurrence in females. The incidence is higher in Southern and Eastern European countries and the condition is more commonly found in Jewish, Italian and Greek populations.A 68-year-old woman presented with a 6-month history of a slowly evolving, asymptomatic, raised, slightly pigmented skin lesion, measuring 25–30 mm in diameter, involving the dorsum of her left hand Figure . CutaneoThe surgical specimen was submitted for pathological evaluation. Histological and immunohistological findings were consistent with a diagnosis of KS Figure and 3B. Following the diagnosis the patient was subjected to a thorough diagnostic evaluation to determine the possible spread of the disease to other sites. Chest X-ray, abdominal ultrasonography, upper and lower gastrointestinal endoscopy, as well as thoracic and abdominal computed tomography, were all negative for the presence of disease.Wide local excision with histologically negative margins is regarded as the accepted method of treating minimal cutaneous lesions of KS. Since no dissemination of the disease was demonstrated in the postoperative clinical and radiological evaluation, no further treatment modalities were considered necessary. During a 9-month follow-up, no local or distant recurrence was observed. Re-evaluation for HIV seroconversion was negative.Since its first description, KS has remained a tumour of undetermined pathogenesis. There is still doubt regarding the nature of the proliferating cells and whether the lesions represent an exuberant hyperplasia or a neoplasm. KS lesions have a number of peculiar characteristics, including a lack of aneuploidy and a strong association with immunodeficiency. Emergence of KS in transplant recipients and immunosuppressed patients is remarkable because it may regress spontaneously if immunosuppression is reduced or discontinued. These characteristics suggest that it is not a malignant neoplasm but a benign, potentially controllable and reversible hyperplasia ,2. On thThe pathogenesis of KS is still under investigation. Current studies have focused on the search for a causative infectious agent mainly due to its correlation with immunocompromised patients. HHV8 infection is widespread in Mediterranean areas with a relatively high incidence of KS . A large body of evidence has strongly linked all KS clinical variants with HHV8 infection .HHV8 DNA is present in all forms of KS but not in other mesenchymal tumours or non-specific inflammatory lesions of the skin, suggesting a strong association of HHV8 and KS . MoreoveThe presence of HHV8 infection is now considered essential for the development of KS. However, the incidence of HHV8 infection is far higher than the prevalence of KS, suggesting that viral infection per se is not adequate for the development of malignancy and that one or more cofactors are necessary. The exact interactions of HHV8 infection with other factors known to be involved in the pathogenesis of KS, including anti-apoptosis genes and cytokines, which may be mediated by virally encoded genes as well as gender, genetic susceptibility, and immunosuppression, still need clarification .A high HHV8 seroprevalence in individuals engaging in high-risk sexual activity, including homosexual men, indicates the role of sexual behaviour in the transmission of the infection in adults . On the The HHV8 reservoir in peripheral blood appears to be mononuclear cells and its detection in mononuclear cells is predictive of KS development . A sensiClinically, the classic form of KS is restricted mainly to the surface of the body. Three distinct stages of progression, which can overlap, can be recognized: patch, plaque, and nodule. In the first stage, a clinically indistinct red-to-blue macule occurs, usually in the lower extremity. KS may be mistaken in the skin for an inflammatory dermatosis, pyogenic granuloma, angiodermatitis or pseudo-Kaposi's, bacillary angiomatosis, angiosarcoma, bullous lesion in the rare cases of lymphangioma-like or bullous KS, or arteriovenous malformations. In the case we have presented here, a raised, slightly pigmented skin lesion was initially regarded as a squamous cell carcinoma. The lesion's clinical presentation, its location, the otherwise normal skin, and the lack of any predisposing factors with the exception of the patient's origin, were misleading.The best treatment modality is still a matter of debate and no standard treatment guidelines are available. Many patients have cutaneous lesions amendable to local therapy . Some patients require more aggressive local therapy (radiation therapy) or systemic therapies . Yet surgical excision has been frequently associated with local recurrence, while chemotherapy with vinblastin or bleomycin has been characterized as not very effective . In contIn our case, a wide local excision was performed because the lesion was regarded as a squamous cell carcinoma, for which standard surgical excision is the preferred treatment. If we had considered the possibility of KS, we would have chosen an incisional biopsy to determine the tumour histology. Excisional biopsy would not have been the preferable method because the lesion was too large to anticipate primary closure.No matter what treatment modality is chosen, clinicians should bear in mind that even in its classical form, KS may be a malignant, rapidly progressing tumour with visceral involvement. Although primary hand KS is a relatively uncommon disorder in patients who are negative for HIV, dermatologists, venereologists, and surgeons should consider this possibility when treating non-specific lesions involving the extremities. Since various effective treatment options are available, watchful waiting is probably inappropriate in most cases.KS is an unusual vascular tumour that, similarly to other forms of cutaneous neoplasms, has a definite evolutionary course from a low-grade slow-growing early phase, to an anaplastic malignant neoplasm. Skin biopsy is important for making the correct diagnosis, with the added use of immunohistochemistry or molecular biology in equivocal cases.Minimal hand lesions with non-distinctive clinical features may be the exclusive manifestation of KS, making clinical suspicion essential and histological evaluation necessary to establish the diagnosis.HHV8: human herpes virus type 8; KS: Kaposi's sarcoma; PCR: polymerase chain reaction.The authors declare that they have no competing interests.Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.All the authors have contributed equally to this case report. All authors read and approved the final manuscript.

Cow's milk is the most common food allergen in infants and the diagnosis of cow's milk allergy is difficult, even with the use of several diagnostic tests. Therefore, elimination diets and challenge tests are essential for the diagnosis and treatment of this disorder. The aim of this study is to report the clinical presentation and nutritional status of children evaluated by pediatric gastroenterologists for the assessment of symptoms suggestive of cow's milk allergy.An observational cross-sectional study was performed among 9,478 patients evaluated by 30 pediatric gastroenterologists for 40 days in 5 different geographical regions in Brazil. Clinical data were collected from patients with symptoms suggestive of cow's milk allergy. The nutritional status of infants (age ≤ 24 months) seen for the first time was evaluated according to z-scores for weight-for-age, weight-for-height, and height-for-age. Epi-Info software was used to calculate z-scores.The prevalence of suspected cow's milk allergy in the study population was 5.4% , and the incidence was 2.2% . Among 159 infants seen at first evaluation, 15.1% presented with a low weight-for-age z score (< -2.0 standard deviation - SD), 8.7% with a low weight-for-height z score (< -2.0 SD), and 23.9% with a low height-for-age z score (< -2.0 SD).The high prevalence of nutritional deficits among infants with symptoms suggestive of cow's milk allergy indicates that effective elimination diets should be prescribed to control allergy symptoms and to prevent or treat malnutrition. The incidence of food allergies has increased in several parts of the world, particularly in developed countries -6. Cow'sPrior to 1950, the incidence of cow's milk allergy in the first year of life was low and affected about 0.1% to 0.3% of all infants. Prospective studies conducted in 1970 and 1988 showed that the incidence of cow's milk allergy reached 1.8% to 7.5%, a wide range explained by the differences in diagnostic criteria adopted in different studies . SymptomThe aim of this study was to describe the clinical presentation and nutritional status of children evaluated by pediatric gastroenterologists for the assessment of symptoms suggestive of cow's milk allergy.An observational cross-sectional study was performed applying a questionnaire to 30 pediatric gastroenterologists from 20 different cities in 11 states of five Brazilian geographical regions . Data were collected during 40 consecutive days in 2004. Information on the number of patients evaluated for food allergies, demographic data, clinical manifestations, time of onset of symptoms, management, and anthropometric data at birth and at the first consultation was obtained and recorded.A total of 9,478 children were evaluated over the study period. Five hundred thirteen children were identified as having suspected food allergy. Each specialist evaluated a mean of 2.4 patients with cow's milk allergy per week, including 1.0 new case.The nutritional status of infants (age ≤ 24 months) seen for the first time was evaluated according to z-scores for weight-for-age, weight-for-height, and height-for-age. Epi-Info software was used to calculate z-scores and the National Center for Health Statistics (NCHS) growth charts were used as reference values . ConsideAccording to WHO, a nutritional deficit is defined when z-scores are below -2.0 standard deviations . In a no® for Windows, version 3.1, was used for statistical analysis. Differences were classified as statistically significant when the p value was < 0.05. The study was approved by the Human Research Ethics Committee at the Hospital Pequeno Príncipe - Curitiba, Brazil.SigmaStat Cow's milk allergy was suspected in 513 of 9,478 consultations in the pediatric age range. In 211 patients, suspicion of the diagnosis was made at the first medical visit, and in 302 patients the diagnosis was suspected at follow-up visits. Therefore, the prevalence of diagnosed and suspected cow's milk allergy in the study population was 5.4% , and the incidence was 2.2% . At first consultation, pediatric gastroenterologists agreed with the diagnostic hypothesis of cow's milk allergy made by the referring pediatrician in 82.0% of the cases. Among patients who had suspected cow's milk allergy (n = 211) at first consultation, 49.3% were referred to the pediatric gastroenterologist having already been switched to a substitute infant diet. The milk substitute most frequently prescribed by general pediatricians was a soy formula (58%). Other inappropriate treatments, including lactose-free cow's milk infant formula or goat' milk (11%), were also prescribed. Extensively hydrolyzed formulas were used in 11% of patients, as well as amino acid-based formulas (5%). A diet without milk substitutes was prescribed in 5% of patients.st year of life. In this group, 79 (49.7%) patients were evaluated in their 1st six months of life and 51 (32.1%) in their 2nd six months. Twenty-nine (18.2%) patients were evaluated in the 2nd year of life.The following results refer to new cases of infants (≤ 24 months of age) with symptoms suggestive of cow's milk allergy. Weight and length were recorded in 159 (90.8%) of the 175 patients < 24 months of age. One hundred thirty patients (81.7%) were evaluated in the 1Demographic data, weight and length at birth, clinical presentation, and duration of symptoms according to age group are presented in Table st six months of life than in the other age groups (p < 0.05) whereas respiratory manifestations were more frequent in the 2nd six months of life (p < 0.05).There was a predominance of gastrointestinal manifestations in all age groups Table . GastroiThe clinical manifestations of infants were grouped as follows and are presented in Table The distribution of z-scores for weight-for-age, weight-for-height, and height-for-age of the 159 infants is presented in Figure The distribution of patients according to anthropometric deficits confirmed by a z-score < -2.0 standard deviations is presented in Table The incidence and prevalence of food allergies are believed to be increasing in several countries ,2,15. Host year of life and to compare this with the rate of parental reports. A cohort of 969 infants was recruited between September 2001 and August 2002. Symptoms of food allergies were reported by 132 parents (14.2%) at 3 months, 83 parents (9.1%) at 6 months, 49 parents (5.5%) at 9 months, and 65 parents (7.2%) at 12 months of age [A study was conducted in the Isle of Wight in the United Kingdom in order to establish the rates of objectively-assessed food allergies in the 1parents 1.2% at 3 st year of life ranges from 2% to 3% and symptoms compatible with food allergies found in 5% to 15% of infants may be reasonable and close to reality [However, the actual occurrence of food allergies may be underestimated because challenge tests may be performed after the development of tolerance. This is a limitation for the method considered the gold standard for epidemiologic studies concerning food allergies. Therefore, the suggestion that the incidence of food allergies in the 1 reality ,16.Approximately one-half of the infants in the study were younger than 6 months of age. In this age group, gastrointestinal manifestations occurred at a greater frequency than in the group of infants older than 6 months of age. As expected, digestive symptoms were the most common (88.7%), including regurgitation and vomiting, colic, diarrhea, and blood in stools. A variety of gastrointestinal allergic disorders typically affect in infants and children. Infants with allergic colitis present small amounts of blood mixed with mucus in their stools. Cow's milk-sensitive enteropathy may present with malabsorption leading to diarrhea and failure to thrive. The most serious form of gastrointestinal food allergy in infants is food protein-induced enterocolitis syndrome which has a symptom complex of profuse vomiting and diarrhoea, and potentially a sepsis-like clinical picture Cutaneous and respiratory symptoms were less frequent, possibly due to the fact that patients were referred to pediatric gastroenterologists. Although the predominant type of clinical manifestation may depend on the type of specialty care where the study patients are enrolled, there is a consensus that gastrointestinal or cutaneous symptoms are the predominant forms of presentation of cow's milk allergy.A review of the literature did not yield studies with similar designs for comparisons. In a group of 204 infants with cow's milk allergy studied in the 1950s, the most common symptoms were atopic dermatitis in 43% of the cases, vomiting and regurgitation in 38%, colic in 31%, wheezing in 9%, irritability and anorexia in 22%, and constipation in 6% of the cases . The mosThe mean z-score deviations, particularly for weight-for-age and height-for-age, suggest that failure to thrive or malnutrition may occur as a consequence of cow's milk allergy. The analysis of weight and height showed greater deficits (< -2.0 standard deviations) than expected (2.5%) according to the CDC-NCHS reference values 2000): specifically, 15.1% of weight-for-age, 11.3% of weight-for-height, and 23.9% of height-for-age z-scores is an essential step in the management of these patients . After aOur data revealed the profile of infants with symptoms suggestive of cow's milk allergy and the presence of nutritional deficits in a considerable percentage of patients. These findings highlight the need to prescribe highly-effective elimination diets in order to control symptoms, to ensure fast nutritional recovery, and to avoid malnutrition. Further studies should be conducted to develop public healthcare strategies to provide adequate substitute diets and treat infants that have a diagnosis or symptoms suggestive of cow's milk allergy, a current concern in many countries .The authors have received fees from Support Advanced Medical Nutrition -Danone for technical assistance in this article.MCV: study concept and design; analysis and interpretation of data; drafting of the manuscript; study supervision. MBM: study concept and design; analysis and interpretation of data; drafting of the manuscript; statistical analysis; study supervision. JVNS: study concept and design; analysis and interpretation of data; drafting of the manuscript; study supervision. MST: study concept and design; analysis and interpretation of data; drafting of the manuscript; study supervision. ALC: analysis and interpretation of data; drafting of the manuscript; critical revision of the manuscript for important intellectual content. GTBA: study concept and design; acquisition of data; analysis and interpretation of data; critical revision of the manuscript for important intellectual content; statistical analysis; study supervision. VN: analysis and interpretation of data; drafting of the manuscript; critical revision of the manuscript for important intellectual content. MCMF: study concept and design; acquisition of data; analysis and interpretation of data; critical revision of the manuscript for important intellectual content; statistical analysis; study supervision.All authors read and approved the manuscript. The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2431/10/25/prepub

The crystal structure of SSO2064, the first structural representative of Pfam family PF01796 (DUF35), reveals a two-domain architecture comprising an N-terminal zinc-ribbon domain and a C-terminal OB-fold domain. Analysis of the domain architecture, operon organization and bacterial orthologs combined with the structural features of SSO2064 suggests a role involving acyl-CoA binding for this family of proteins. SSO2064 is the first structural representative of PF01796 (DUF35), a large prokaryotic family with a wide phylogenetic distribution. The structure reveals a novel two-domain architecture comprising an N-terminal, rubredoxin-like, zinc ribbon and a C-terminal, oligonucleotide/oligosaccharide-binding (OB) fold domain. Additional N-terminal helical segments may be involved in protein–protein interactions. Domain architectures, genomic context analysis and functional evidence from certain bacterial representatives of this family suggest that these proteins form a novel fatty-acid-binding component that is involved in the biosynthesis of lipids and polyketide antibiotics and that they possibly function as acyl-CoA-binding proteins. This structure has led to a re-evaluation of the DUF35 family, which has now been split into two entries in the latest Pfam release (v.24.0). Here, we report the crystal structure of SSO2064, the first structural representative of this family, which was determined using the semiautomated high-throughput pipeline of the Joint Center for Structural Genomics genomic DNA using PfuTurbo DNA polymerase (Stratagene) and I-PIPE (Insert) primers that included sequences for the predicted 5′ and 3′ ends. The expression vector pSpeedET, which encodes an amino-terminal tobacco etch virus (TEV) protease-cleavable expression and purification tag (MGSDKIHHHHHHENLYFQ/G), was PCR-amplified with V-PIPE (Vector) primers . V-PIPE and I-PIPE PCR products were mixed to anneal the amplified DNA fragments together. Escherichia coli GeneHogs (Invitrogen) competent cells were transformed with the V-PIPE/I-­PIPE mixture and dispensed onto selective LB–agar plates. The cloning junctions were confirmed by DNA sequencing. Expression was performed in selenomethionine-containing medium at 310 K. Selenomethionine was incorporated via inhibition of methionine biosynthesis phosphine–HCl (TCEP)] and the lysate was clarified by centrifugation at 32 500g for 30 min. The soluble fraction was passed over nickel-chelating resin pre-equilibrated with lysis buffer, the resin was washed with wash buffer and the protein was eluted with elution buffer . The eluate was buffer-exchanged with TEV buffer using a PD-10 column and incubated with 1 mg of TEV protease per 15 mg of eluted protein. The protease-treated eluate was run over nickel-chelating resin pre-equilibrated with HEPES crystallization buffer and the resin was washed with the same buffer. The flow-through and wash fractions were combined and concentrated to 14.5 mg ml−1 by centrifugal ultrafiltration (Millipore) for crystallization trials. SSO2064 was crystallized using the nanodroplet vapor-diffusion method . Initial screening for diffraction was carried out using the Stanford Automated Mounting system equilibrated in 20 mM Tris, 200 mM NaCl, 0.5 mM TCEP pH 7.5 and pre-calibrated with gel-filtration standards (Bio-Rad).Clones were generated using the Polymerase Incomplete Primer Extension (PIPE) cloning method (Klock 2.2.2), high-energy remote (λ1) and peak (λ3) of a selenium MAD experiment. The data sets were collected at 100 K with an ADSC Q315 CCD detector using the Blu-Ice data-collection environment and two zinc sites and resulted in an improved mean figure of merit (0.27). Model com­pletion and refinement were performed with Coot data were collected on beamline BL11-1 at the SSRL at wavelengths corresponding to the inflection . This server processes the coordinates and data using a variety of validation tools including AutoDepInputTool was adapted from an analysis using PDBsum . Invariant regions between the two chains were calculated using ESCET was prepared using the PDB2PQR server and are accessible under the code 3irb.Atomic coordinates and experimental structure factors for SSO2064 at 1.80 Å resolution have been deposited in the PDB (3.3.1.a) was determined to 1.80 Å resolution using the MAD phasing technique. Data-collection, model and refinement statistics are summarized in Table 1A, residues 10–27 and 29–144 for chain B, two acetate molecules, six sulfate ions, two zinc ions and 201 water molecules in the asymmetric unit (ASU). No electron density was observed for the N-terminal glycine (Gly0) which remained after cleavage of the expression and purification tag, for the first seven residues of chains A and B and for Lys8, Glu9 and Val28 in chain B. The side-chain atoms of Lys8, Glu33, Lys40, Lys69, Lys97, Lys129 and Lys131 in chain A and Glu33, Lys40, Lys69, Lys97, Lys125, Lys129 and Lys131 in chain B were omitted owing to weak or absent electron density. The Matthews coefficient . SCOP (v.1.75) classifies SSO2064 as an OB fold (residues 77–144) containing an N-terminal zinc-ribbon subdomain (residues 43–76). In the crystal structure, the zinc is coordinated by Cys49, Cys52, Cys63 and Cys66 of the rubredoxin-like, zinc-ribbon fold (http://scop.mrc-lmb.cam.ac.uk/scop/data/scop.b.c.hb.h.bf.b.html). Two N-terminal helices preceding the zinc-ribbon domain complete the structure and are involved in crystal-packing interactions. The two-domain architecture of SSO2064 is conserved in all DUF35 homologs. This structure has led to a re-evaluation of the Pfam DUF35 family which, as a result of our study, has been split into two entries in the latest Pfam release . The original DUF35 entry has been truncated and now represents the OB-fold domain. A new entry, DUF35_N (PF12172), has been created to represent the rubredoxin-like zinc-ribbon domain.The entire amino-acid sequence of SSO2064 was originally classified as part of the DUF35 family. However, the structure clearly revealed a two-domain organization and 2pi2 . Some of the most highly conserved residues among homologs line this groove, suggesting that it might serve as a binding site.Zinc ribbons, a structurally distinct group of zinc fingers, are short , zinc-stabilized structural motifs that play a diverse set of functional roles, serving as modules that bind nucleic acids, proteins and small molecules (Krishna e.g. Lys8). These interactions may serve to maintain this helix in position with respect to both the OB fold and the interfacing monomer in the dimer although, as discussed earlier, the variable length of helix H1 indicates that the conformation of loop β6–β7 is also likely to vary. The variable length of helix H1 and the different conformations of the β6–β7 loop in the two chains of SSO2064 . While loop β7–β9 directly forms part of the groove , loop β6–β7 does not as it is sterically hindered by helix H1. However, in homologs with a shorter helix H1, the β6–β7 loop would no longer be occluded and could also possibly form part of this binding site.Analysis of the OB-fold architecture revealed that the zinc ribbon inserted within the OB-fold loops is implicated in higher order oligomerization, while the OB barrel itself is involved in interactions with DNA interacts extensively with RNA . The latter is also involved in RNA binding.Several structures of proteins containing OB folds and zinc ribbons have previously been described. The structure of a fragment of the mini-chromosome maintenance (MCM) protein from a and 3b). The OB fold and the zinc ribbon are often implicated in oligomerization.To our knowledge, all combinations of OB folds and zinc ribbons, whether intramolecular or intermolecular, involve nucleic acid-binding proteins. In all cases, the zinc ribbon is located on the opposite side of the OB barrel with respect to SSO2064 indicated that the members of this family show a strong gene-neighborhood association with members of the thiolase superfamily (EC 2.3.1.9) that are involved in condensation of acyl-CoA moieties in the formation of longer chain aliphatic and cyclic skeletons. Importantly, an operon that combines genes encoding an ortholog of SSO2064 and an active, as well as an inactive, member of the thiolase superfamily is found in Pseudomonas fluorescens . The products of this operon, together with the polyketide synthase PhlD, are required for the biosynthesis of the polyketide antibiotic 2,4-diacetylphloroglucinol members of the thiolase superfamily, (ii) NAD(P)-binding Rossmann-fold domains related to the short-chain acyl-CoA dehydro­genases, (iii) the sterol-carrier protein family (SCP2) and (iv) dehydratases of the hot-dog superfamily could accommodate the acyl side chain.http://www1.jcsg.org/cgi-bin/models/get_mor.pl?key=3irbA.The SSO2064 protein family [DUF35 (PF01796)] contains around 650 homologs from both archaea and bacteria, including several pathogens, such as mycobacteria, burkholderia, firmicutes and spiro­chaetes. However, we have thus far not detected any member of this family in eukaryotes. Based on this phyletic pattern, their predicted small-molecule binding function and their presence in pathogenic bacteria, we propose that members of this family could serve as potential targets for therapeutic intervention. In addition, their role in polyketide-antibiotic biosynthesis suggests that members of this family could be used for engineering pathways for generating such biomedically important compounds. We, therefore, expect that the structure presented here should inspire further biochemical and biophysical studies on this novel family of protein implicated in lipid and polyketide biosynthesis. Models of SSO2064-family proteins can be accessed at TOPSAN (Krishna et al., 2010http://www.topsan.org/explore?PDBid=3irb. A list of all members of the DUF35 family that have been worked on by structural genomics centers is available via TargetDB (Chen et al., 2004et al., 2009http://targetdb.pdb.org/servlet/TargetSearch?which_seq=SG&format=html&pdbid=PF01796&cp=1.Additional information about SSO2064 is available from 4.The first representative of PF01796 reveals a rubredoxin-like, zinc ribbon and an OB fold in a novel arrangement that are likely to cooperate to bind an acyl-CoA moiety.S. solfataricus, 3irbSSO2064 from PDB reference: 10.1107/S1744309110002514/wd5125sup1.pdf Supplementary material file. DOI:

CD16+ Mo produce pro-inflammatory cytokines and are expanded in certain inflammatory conditions including sepsis and HIV infection.Human peripheral blood monocytes (Mo) consist of subsets distinguished by expression of CD16 (FCγRIII) and chemokine receptors. Classical CD16+ and CD16- Mo, we examined transcriptional profiles of these Mo subsets in peripheral blood from healthy individuals. Of 16,328 expressed genes, 2,759 genes were differentially expressed and 228 and 250 were >2-fold upregulated and downregulated, respectively, in CD16+ compared to CD16- Mo. CD16+ Mo were distinguished by upregulation of transcripts for dendritic cell (DC) and macrophage (MΦ) markers together with transcripts relevant for DC-T cell interaction , cell activation , and negative regulation of the cell cycle , whereas CD16- Mo were distinguished by upregulation of transcripts for myeloid and granulocyte markers . Differential expression of CSF1R, CSF3R, C1QR1, C3AR1, CD1d, CD43, CXCL16, and CX3CR1 was confirmed by flow cytometry. Furthermore, increased expression of RARA and KLF2 transcripts in CD16+ Mo coincided with absence of cell surface cutaneous lymphocyte associated antigen (CLA) expression, indicating potential imprinting for non-skin homing.To gain insight into the developmental relationship and functions of CD16+ and CD16- Mo originate from a common myeloid precursor, with CD16+ Mo having a more MΦ – and DC-like transcription program suggesting a more advanced stage of differentiation. Distinct transcriptional programs, together with their recruitment into tissues via different mechanisms, also suggest that CD16+ and CD16- Mo give rise to functionally distinct DC and MΦ in vivo.These results suggest that CD16 The h (5–15%) . Compareand IL-1 ,13, haveand IL-1 -16, and in vitro . CD16+ Mo CX3CL1 ,19, a me to CCL2 ,20, whic to CCL2 . CD16+ Mal cells and actial cells . Togethe- Mo has been reported in inflammatory pathologies such as sepsis, HIV infection, tuberculosis, and asthma [Mycobacterium leprae demonstrated that CD16+ and CD16- Mo differentiate into DC-SIGN+ MΦ and CD1b+DC-SIGN- DC, respectively, and the presence of CD1b+DC-SIGN- DC in M. leprae lesions was associated with healing [+ Mo was associated with non-healing Leishmania chagasi lesions [+ and CD16- Mo differentiation into MΦ or DC subpopulations with distinct phenotypes influences host defenses in infectious disease. Consequently, there is interest in developing therapeutic strategies that target specific Mo subpopulations [A dramatic increase in circulating CD16d asthma ,24,25. S healing . An incr lesions . Thus, Culations ,28,29.+CX3CR1low Mo (homolog of human CD16- Mo) are recruited into the peritoneal cavity or draining lymph nodes under inflammatory conditions by mechanisms dependent on CCR2 and CD62L, and subsequently differentiate into DC [-CX3CR1high (homolog of human CD16+ Mo) are constitutively recruited into peripheral tissues including spleen, gut, lungs, and brain [-CX3CR1high patrol vascular endothelium by mechanisms involving LFA-1 and CX3CR1, and are rapidly recruited into inflamed tissues where they differentiate into MΦ expressing the transcription factors cMaf and MafB and transiently producing TNF-α [high Mo play a critical role in development of atherosclerotic lesions [+ Mo may be precursors for lamina propria DC, which depend on CX3CR1 to form transepithelial dendrites, enabling direct sampling of luminal antigens [lowCX3CR1high Mo are constitutively recruited into the gut where they give rise to intestinal lymph DC [highCCR2highCX3CR1low Mo differentiate into CD103+ DC [lowCCR2lowCX3CR1high Mo give rise to CD11bhigh DC [high and CX3CR1low Mo subsets play distinct functional roles under constitutive and inflammatory conditions.Mo heterogeneity is conserved across mammalian species ,8,19,30. into DC -33. In c lesions ,35. CX3Cantigens . Furtherlymph DC . StudiesD103+ DC ,39), whebhigh DC . Thus, Chigh phenotype and gradually downregulate Ly-6C [highCX3CR1low Mo in peripheral blood traffic to the bone marrow, differentiate into Gr1lowCX3CR1high Mo, and contribute to mucosal, but not splenic, generation of DC [+ Mo and mouse Ly-6ClowCCR2lowCX3CR1high Mo differentiate from CD16- Mo and Gr1-Ly-6ChighCCR2highCX3CR1low Mo, respectively.The developmental relationship between Mo subsets is poorly understood. In mice, Mo recently emigrating from bone marrow exhibit a Ly-6Cte Ly-6C . Mo acqute Ly-6C , TGF-β [te Ly-6C ,43, or Ite Ly-6C , and uprte Ly-6C . Mo diffte Ly-6C . Engrafton of DC . These f+ and CD16- Mo subsets. Whole genome transcriptome analysis suggests that these Mo subsets originate from a common myeloid precursor, with CD16+ Mo being at a more advanced stage of differentiation and having a more MΦ – and DC-like transcription program. Upregulation of the transcription factors RARA and KLF2 in CD16+ Mo coincided with the absence of cutaneous lymphocyte associated antigen (CLA) expression, indicating potential imprinting for non-skin homing in CD16+ Mo. These results define distinct transcriptional profiles of CD16- and CD16+ Mo subsets suggesting different stages of myeloid differentiation, new markers to distinguish these Mo subpopulations, and unique roles in immune responses and inflammatory diseases.Here, we investigate the developmental and functional relationship between CD16Fluorochrome-conjugated Abs used for FACS analysis were CD14, CD16, CD19, CD16b, CD66b, CD56, and CD3 (Beckman Coulter); M-DC8 and CD1c (Miltenyi), HLA-DR, CD114, C3aR, CD1d and CD43 (BD Pharmingen), CD115 (R&D Systems), CD93/C1qR1 , and CXCL16 (R&D Systems). Matched isotype controls were from the same source as the Abs.Blood from healthy individuals was collected with informed consent and IRB approval from Dana-Farber Cancer Institute. PBMC isolated from peripheral blood by Ficoll-Paque gradient density centrifugation were stained with fluorochrome-conjugated Abs and analyzed by multi-color flow cytometry .+ and CD16- Mo fractions were further isolated using CD16 magnetic immunobeads (Miltenyi) with >85% and >95% purity for CD16+ and CD16- Mo fractions, respectively, as determined by FACS analysis after staining with CD16 Abs [Monocytes (Mo) were isolated by negative selection using magnetic immunobeads as described ,47. The CD16 Abs . Mo frac+ and CD16- Mo samples isolated from 4 different healthy donors was quality tested using an Agilent 2100 Bioanalyzer chip, reverse transcribed, and hybridized on the GeneChip® Human Genome U133 Plus 2.0 Array (Affymetrix), which includes 54,000 probe sets on a single array . Primary data analysis performed using GeneSpring software generated Excel spreadsheets with relative gene expression values for the 4 matched CD16+ and CD16- Mo subsets.Total RNA from Mo pellets was isolated by Trizol extraction and purified using RNeasy columns (Qiagen). The quality of RNA was assessed by visualization of intact bands corresponding to 18S and 28S rRNA on formaldehyde agarose gels. Total RNA (10 μg) from matched CD16+ and CD16- Mo (p < 0.05). These genes were sorted according to their t-statistics and fold change ratios, which were calculated by computing the mean expression in CD16+ and CD16- Mo. Clustering analysis using fuzzy-c-means [+ versus CD16- Mo . Heat maps for biological function categories were generated by dChip software using signal values from each of the 8 samples for genes that were > 2-fold upregulated or downregulated in CD16+ Mo compared to CD16- Mo. The entire microarray dataset and technical information requested by Minimum Information about a Microarray Experiment (MIAME) are available at the Gene Expression Omnibus (GEO) database under accession number GSE16836 .A total of 16,328 probe sets were detected in these 8 samples . Normalization was performed as described to accou-c-means ,51 was p-c-means were est-c-means by perfo were used to identify differentially expressed gene sets [Gene set enrichment analysis (GSEA) and Molecular Signature DataBase (MSigDB) ene sets . GSEA isOne step SYBR Green real time RT-PCR (Qiagen) was carried out in an iCycler BioRad EN270 PCR machine according to manufacturer's recommendations. Absolute quantification of target gene expression was performed using a 10-fold serial dilution of purified PCR products as described . Brieflyin vivo, we performed genome wide transcriptome analysis of matched CD16+ and CD16- Mo subsets in peripheral blood of four healthy individuals. We identified 2,759 probe sets that were differentially expressed and 13,569 genes that were similarly expressed in these Mo subsets . Clustering analysis separated the 8 samples into 2 groups that perfectly matched CD16+ and CD16- Mo, with 1,402 genes downregulated and 1,357 genes upregulated in CD16+ compared to CD16- Mo and CD16- Mo [+ and CD16- Mo , consistent with results obtained by flow cytometry demonstrating the purity of sorted Mo (>98%) and absence of DC , NK cell , B cell , T cell , neutrophil markers on CD16+ and CD16- Mo. The difference in relative expression of some probe sets for donor #1 probably reflects normal donor-to-donor variability, since post-sort cell viability, RNA quality, and MicroArray Quality Controls were similar for the four donors. A more stringent analysis was performed where in addition to a cut-off >2-fold and p-value < 0.05, probe sets with expression levels >3-fold higher than background were selected; by this approach, we identified 132 downregulated and 183 upregulated probe sets in CD16+ compared to CD16- Mo (data not shown). These genes were further selected for those with the highest levels of expression , cut-off >2-fold; p-value < 0.05) and two lists of top genes were generated, with 30 and 31 transcripts upregulated in CD16+ and CD16- Mo, respectively and CD33 . Thus, despite a high level of transcriptional similarity (approximately 83%), a subset of probe sets were significantly downregulated (n = 250) or upregulated (n = 228) in CD16+ compared to CD16- Mo, suggesting that these Mo subsets represent different stages of myeloid differentiation and have distinct biological functions in vivo.To define transcriptional profiles of monocyte subsets s Figure -20 . Microarray results were also validated at the protein level by flow cytometry analysis. Consistent with the microarray and real time RT-PCR results compared to classical CD14highCD16- Mo (gate R2) expressed higher levels of CD115/CSFR1 (M-CSF receptor) and C3AR1, and lower levels of CD114/CSF3R (G-CSF receptor) and CD93/C1qR1 on the cell surface and CD16+ Mo .Real time RT-PCR was used to quantify expression of nine differentially expressed genes identified by microarray analysis. Results in Figure Figures , FACS ane Figure . A third6+ gate R comparedd Figure . As exped Figure . Thus, w+ compared to CD16- Mo, were classified into eight functional categories using Gene Ontology. Heat maps for biological function categories [+ Mo that are relevant for T cell activation, and FPR1 as a chemokine receptor preferentially expressed on CD16- Mo. In addition, these results indicate the distinct trafficking potential of CD16+ and CD16- Mo , consistent with previous studies [Genes upregulated in CD16e CXCL16 . Genes dr AMICA) , and che studies -20.+ Mo expressed significantly higher levels of mRNA for the cytokines lymphotoxin beta (LTB) and leukocyte specific transcript 1 (LST1) and the cytokine receptors TNF receptor superfamily 8 (TNFRSF8), prostaglandin E receptor 4 (PTGER4), colony stimulating factor 1 receptor , and IL-12RB1. Genes downregulated in CD16+ Mo included those coding for the cytokine IL-1RA, platelet-activating factor receptor (PTAFR), and IL1B and cytokine receptors IL13RA1, IL27RA (WSX1), colony stimulating factor 3 receptor , IL6R, and IL6ST/gp130 [+ and CD16- Mo to respond to distinct cytokines including IL-12 [+ and CD16- Mo, respectively, with potential implications for their differentiation fate in vivo.CD16) Figure . These rng IL-12 and IL-1ng IL-12 and IL-6ng IL-12 ,61, resp+ Mo expressed significantly higher levels of mRNA for the low affinity Fcγ receptor FCGR3A/CD16, IFN-γ-induced surface molecules IFITM1, IFITM2 and IFITM3, complement receptor C3AR1, arrestin beta 1 , and CD97 . Genes downregulated in CD16+ Mo included those coding for the high affinity Fcγ receptor FCGR1A/CD64, complement receptor C1QR1, Ca binding proteins S100A12, S100A9, and S100A8, phospholipase A2, group VII (PLA2G7), Ig superfamily receptor TREM1, neutrophil cytosolic factors NCF1 and NCF4, heparanase (HPSE), chondroitin sulfate proteoglycan 2 , amyloid beta (A4) precursor-like protein 2 (APLP2) involved in turnover of MHC Class I molecules [+ Mo, and C1QR1 as a new marker for CD16- Mo.CD16olecules , amyloid+ Mo included genes related to protein synthesis ), protein catabolism , cathepsin C (CTSC)), stress responses 1 (HMOX1), superoxide dismutase 1 (SOD1), heat shock 105 kDa/110 kDa protein 1 (HSPH1), and monoglyceride lipase (MGLL)), and insulin induced gene 1 (INSIG1). Genes downregulated in CD16+ Mo included those coding for enzymes related to protein metabolism , microsomal glutathione S-transferase 1 (MGST1), carboxypeptidase D (CPD), ubiquitin specific protease 15 (USP15), peptidylprolyl isomerase F , and N-sulfoglucosamine sulfohydrolase (sulfamidase)/SGSH), stress responses , cytochrome P450, family 1, subfamily B, polypeptide 1 (CYP1B1), glutathione peroxidase 1 (GPX1), tumor necrosis factor, alpha-induced protein 3 (TNFAIP3), and aldehyde dehydrogenase 2 family (ALDH2)) and other enzymatic processes and lysozyme (LYZ)) Figure . Differeynthesis , while Cynthesis .+ Mo expressed significantly higher levels of transcripts for a large number of genes involved in signal transduction including the protein tyrosine phosphatase type IVA, member 3 (PTP4A3) and phosphoinositide-3-kinase, catalytic, gamma polypeptide , G protein-coupled receptor 160 (GPR160), jagged 1 , protein kinase, cAMP-dependent, regulatory, type II, beta (PRKAR2B), the CD2 binding protein proline-serine-threonine phosphatase interacting protein 1 (PSTPIP1), and mitogen-activated protein kinase kinase 6 (MAP2K6) . Genes ) Figure . Thus, C+ Mo were distinguished from CD16- Mo by upregulation of the cell cycle related genes cyclin-dependent kinase inhibitor 1C , and myeloid cell nuclear differentiation antigen , and meferation ). CD16- lineage ) 4 (CDC42EP4), microtubule-associated protein 4 (MAP4), and supervillin (SVIL) and in CD16- Mo including actinin, alpha 1 (ACTN1). , ic cells ), the Kric cells ), and reic cells and invoic cells and impric cells ,77). In n ligase and modun ligase ) transcr+ and CD16- Mo, GSEA, a knowledge based approach for interpreting genome-wide expression profiles [- compared to CD16+ Mo: HADDAD_HPCLYMPHO_ENRICHED . According to MSigDB, this set includes genes enriched in CD45RAhiLin-CD10+ versus CD45RAintCD7- and CD45RAhiCD7hi hematopoietic progenitor cells [- Mo.To extract further meaning from differentially expressed genes in CD16profiles , was appor cells . Four unor cells were sig+ or CD16- Mo, but with a lower statistical significance likely related to the limited number of samples (p < 0.001 and FDR = 1). These analyses showed that CD16+ Mo were enriched in genes related to NK cell mediated toxicity , inositol phosphate metabolism , actin binding , and oxidative stress . In contrast, CD16- Mo were enriched in genes related to hematopoietic cell lineage , receptor mediated endocytosis , arginine and proline metabolism , nontypable Haemophilus influenzae (NTHi) pathway , and lipid binding molecules . Overall, these results provide new insights into the developmental relationship between CD16+ and CD16- Mo, with CD16- Mo being more closely related to hematopoietic progenitor cells and having higher endocytosis activity, while CD16+ Mo being at a more advanced stage of Mo differentiation with more effector functions related to antigen presentation, migration, and cytotoxicity.GSEA also identified several gene sets relatively enriched in CD16+ Mo express low levels of the LPS co-receptor, CD14 [+ compared to CD16- MoBoth Mo subsets expressed TLR1, TLR2, TLR4, TLR5, and TLR8 but not TLR3, TLR6, TLR7, TLR9, and TLR10 mRNA (data not shown). Considering that CD16or, CD14 , and thaor, CD14 ,81, we tor, CD14 , in CD16+ compared to CD16- Mo , indicative of RARA pathway activation in CD16+ Mo. Activation of the RARA transcription factor pathway leads to loss of skin homing potential in lymphocytes via downregulation of the cutaneous lymphocyte-associated antigen [+ and CD16- Mo by FACS on PBMC from healthy individuals. CLA expression was undetectable on all CD16+ Mo and a fraction of CD16- Mo [+ Mo and impr PSGL-1) . CLA expo Figure . The freo Figure . CD16+ M PSGL-1) , which w PSGL-1) and provide new insights into their developmental relationship and biological functions. Despite remarkable transcriptional similarity (approximately 83%), a significant number of transcripts were differentially expressed , with 228 and 250 >2-fold upregulated and downregulated, respectively, in CD16+ compared to CD16- Mo. Differentially expressed genes related to cell-to-cell adhesion and trafficking, immune responses and inflammation, metabolism and stress response, signaling and signal transduction, cell cycle, proliferation, and differentiation, cytoskeleton, and regulation of transcription. Gene set enrichment analysis (GSEA) demonstrated that CD16+ Mo are enriched in genes related to NK-mediated cytotoxicity, inositol phosphate metabolism, actin binding, and oxidative stress, while CD16- Mo are enriched in genes related to hematopoietic cell lineage, receptor-mediated endocytosis, arginine and proline metabolism, NTHi pathway, and lipid binding. The transcriptional profiles suggest that CD16+ and CD16- Mo subsets originate from a common myeloid precursor, with CD16+ Mo being at a more advanced stage of myeloid differentiation and having distinct biological functions in vivo.In this study, we define transcriptional profiles of human CD16highCCR2highGr1+CX3CR1low and Ly6ClowCCR2lowGr1-CX3CR1high Mo , with Ly6ClowCCR2lowGr1-CX3CR1high Mo being more mature and derived from Ly6ChighCCR2highGr1+CX3CR1low Mo [-CX3CR1low Mo to differentiate into CD16+CX3CR1high Mo upon stimulation with TGF-β, IL-10, M-CSF, or CCL2 [- Mo originate from a common granulocyte-macrophage (GM) precursor and give rise to CD16+ Mo, which are more closely related to macrophages (MΦ) and dendritic cells (DC). CD16- Mo preferentially expressed granulocyte-associated transcripts , the calgranulins S100A8, S100A9, and S100A12), and myeloid markers , together with transcripts suggesting an increased potential for receptor-mediated endocytosis via molecules such as CD14 and FCGR1A/CD64 [+ Mo preferentially expressed MΦ 1-3, CD97, and C3aR) [i.e., SIGLEC10, CD43, CXCL16, and RARA) [+ Mo expressed higher levels of transcripts encoding the cysteine protease cathepsin L (CTSL), which contributes to phagocytic-endocytic proteolysis in DC for subsequent antigen presentation [+ Mo or DC derived from these cells. Although some studies classified CD16+ Mo as DC based on their increased antigen presenting ability [+HLA-DR+ cells are more closely linked to myeloid CD14+ cells than to DC subsets in peripheral blood [+ Mo share approximately 83% of their transcripts with CD16- Mo, supporting the idea that these two Mo subsets are developmentally related.Previous studies in mice provide evidence for a developmental relationship between Ly6CR1low Mo ,41,85. L or CCL2 ,43-45. OR1A/CD64 . In contnd C3aR) and DC mnd RARA) ,74,87,88entation may furtal blood . Our res+ and CD16- Mo into tissues is mediated via distinct molecular mechanisms [+ Mo and CD16- Mo [+ Mo, whereas the tetraspanin MS4A6A, adhesion molecules CD99 and junctional adhesion molecule like (JAML or AMICA) [- Mo. CD31 and CD99 are involved in distinct steps of Mo transendothelial migration [+ Mo may facilitate interaction with CXCR6+ cells , a ligand for ICAM-1 [+ Mo. CD47 ligation selectively inhibits the development of human naive T cells into Th1 effectors by decreasing IL-12 and TNF-α production by Mo-derived DC [- and CD16+ Mo may induce Th1 and Th2-like differentiation, respectively [+ Mo express IL-12RB1, which favors Th1 polarization [- Mo express receptors for the Th2 cytokines IL-6 and IL-13 [+ and CD16- Mo on Th1 versus Th2 polarization of immune responses is likely to be highly dependent on the local microenvironment within tissues.Recruitment of CD16chanisms ,8. Our gn/CD62L) -20. We an/CD62L) were prer AMICA) , and cheigration ,92. Exprigration , on the T-cells ) and ret1high Mo ,41, CD16r ICAM-1 ,94, and r ICAM-1 . CD43 har ICAM-1 , mediater ICAM-1 , and conr ICAM-1 . CD47, arived DC ,99. Consectively . Howeverrization , whereasnd IL-13 and the nd IL-13 ,61. Acco+ Mo expressed high levels of transcripts for RARA, which controls transcription of genes involved in cell trafficking and mucosal homing. RA imprints lymphocytes with non-skin mucosal homing properties by decreasing cutaneous lymphocyte-associated antigen expression [+ Mo, we demonstrated CLA downregulation on these cells, together with upregulation of two RA-induced targets: SLP-76 [+ Mo-derived MΦ and DC constitutively produce TGF-β [CD16pression and incrpression . RA alsopression , modulatpression , and regpression . Consist: SLP-76 and CXCL: SLP-76 . RA induce TGF-β ,100, but+ compared to CD16- Mo. KLF2 belongs to a family of zinc-finger transcription factors that is induced by PI3K signaling [+ Mo may confer an increased potential for trafficking.KLF2 mRNA is expressed at very high levels and significantly upregulated in CD16ignaling and contignaling , and lymignaling . CCR7 anignaling , and intignaling . Togethe+ compared to CD16- Mo express very high levels of transcripts for cyclin-dependent kinase inhibitor 1C (CDKN1C or p57/KIP2) (18.4-fold increase) and metastasis suppressor 1 MTSS1 (5.7-fold increase). CDKN1C is a potent inhibitor of several G1 cyclin-dependent kinase (cdk) complexes, and negative regulator of G1/S cell cycle transition and cell proliferation [+ Mo differentiation [+ Mo differentiation in vivo.CD16feration . CDKN1C feration and MTSSferation are candferation , a cytokntiation ,43. Thus+ Mo including LTB, TNFRSF8, leukocyte specific transcript 1 (LST1), IFITM1-3, HMOX1, superoxide dismutase-1 (SOD-1), tryptophanyl tRNA synthetase (WARS), and monoglyceride lipase (MGLL), indicating increased activation of CD16+ compared with CD16- Mo. LST1 [+ compared to CD16- Mo in vivo.Several transcripts related to cell activation were upregulated in CD16Mo. LST1 , HMOX1 [Mo. LST1 , SOD-1, Mo. LST1 . The rolMo. LST1 . WARS anMo. LST1 . WARS waMo. LST1 and DC [Mo. LST1 . These r+ Mo subset includes two subsets with distinct levels of CD14 expression: CD14highCD16+ and CD14lowCD16+ [highCD16+ Mo exhibit a phenotype intermediate between that of CD14highCD16neg and CD14lowCD16+ Mo in terms of adhesion molecule and chemokine receptor expression [highCD16+ and CD14lowCD16+ Mo contributed to the transcriptional profile of CD16+ Mo in this study. The expression of some genes we identified as markers for CD16+ Mo may be distinct on CD14highCD16+ and CD14lowCD16+ Mo. Consistent with this prediction, we demonstrated intermediate expression of CD115 and CD114 on CD14highCD16+ Mo compared to CD14highCD16neg and CD14lowCD16+ Mo, and high expression of CD93 and C3aR1, similar to that on CD14highCD16- and CD14lowCD16+ Mo, respectively . Both CDntiation .+ and CD16- Mo indicates that CD16+ Mo represent a more advanced stage of myeloid differentiation with a more MΦ – and DC-like transcription program, whereas CD16- Mo are more closely related to a common myeloid precursor. Given the ability of CD16+ and CD16- Mo to be recruited into specific tissues via distinct mechanisms, these Mo subsets are likely to give rise to DC and MΦ subpopulations with distinct phenotypes and roles in immunity and disease pathogenesis. Further studies to characterize phenotypic differences between CD16+ and CD16- Mo-derived DC and MΦ are relevant for development of DC-based vaccines, and will also provide a better understanding of their functional roles in immune responses, inflammation, and disease pathogenesis.Comparative transcriptome analysis of CD16The authors declare that they have no competing interests.PA designed and performed experiments, analyzed and interpreted data, prepared graphics, and wrote the manuscript. VM generated heat maps, performed statistical analysis for differentially expressed genes, and drafted the Methods for Figure + compared to CD16- monocytesTable S1. Genes upregulated in CD16. Calculation of expression ratios for the 2,759 differentially expressed probe sets showed upregulation of 228 probe sets (corresponding to 153 genes and 19 unknown transcribed sequences) in CD16+ compared to CD16- Mo .Click here for file+ compared to CD16- monocytesTable S2. Genes downregulated in CD16. Calculation of expression ratios for the 2,759 differentially expressed probe sets showed downregulation of 250 probe sets (corresponding to 166 genes and 23 unknown transcribed sequences) in CD16+ compared to CD16- Mo .Click here for filehighCD16-, CD14highCD16+, and CD14lowCD16+ monocytesFigure S1. Differential expression of CD114/CSF3R, CD115/CSF1R, CD93/C1qR1 and C3aR1 on CD14. Freshly isolated PBMC were stained with FITC CD14, PE-Cy5 CD16, and PE CD114, PE CD115, and PE CD93 Abs. The expression of CD3aR1 was detected after staining with unconjugated mouse C3AR1 Ab and PE rat anti-mouse Ab (RAM). CD14highCD16neg (R2), CD14highCD16+ (R3) and CD14lowCD16+ (R4) Mo (A) were analyzed for expression of CD114, CD115, CD93 and C3aR1 (B). Shown is an overlay histogram from one representative donor of 4 donors examined and graphs showing mean ± SEM for % or MFI of CD114, CD115, CD93, and C3aR1 expression on each Mo subset . .Click here for file

Sindbis virus (SV) is the prototype of alphaviruses which are a group of widely distributed human and animal pathogens. Heterogeneous nuclear ribonucleoprotein (hnRNP) A1 is an RNA-binding protein that shuttles between the nucleus and the cytoplasm. Our recent studies found that hnRNP A1 relocates from nucleus to cytoplasm in Sindbis virus (SV)-infected cells. hnRNP A1 binds to the 5' UTR of SV RNA and facilitates the viral RNA replication and translation.vitro system developed by our lab to assess the role of hnRNP A1 in SV positive strand RNA synthesis.Making use of standard molecular techniques, virology methods and an in in vitro.hnRNP A1 interacted with the genomic (G) and subgenomic (SG) RNA promoters. Knockdown of hnRNP A1 resulted in markedly decrease in the synthesis of G and SG RNA both in infected cells and Our study provides the first direct evidence that hnRNP A1 actively participates in viral RNA replication and is required for the synthesis of G and SG RNA. Alphaviruses are a group of widely distributed human and animal pathogens that includes almost 40 currently known members . In natuTogaviridae, genus alphavirus ATP.24-mer and 45-mer oligoribonucleotides representing the negative strand sequence corresponding to nt 7579 to 7602 and nt 1-45 of the SV genome were synthesized by Dharmacon Research Inc. As already noted, these are the minimal sequences that have SG and G promoter activity respectively ,48. Olig32 P-labeled RNA probes (1×104 c.p.m). The reaction was carried out in binding buffer and the final volume of the reaction mixture was 10 μl. Binding of hnRNP A1 to the G and SG promoters was recognized by a slower migration of the labeled RNA probes.An EMSA was carried out to determine the interaction between the promoters and hnRNP A1 as described previously . Briefly32 P-γ-ATP. After hybridization, the nylon membrane was washed twice with 2 × SSC and 0.1% SDS, exposed to a storage phosphor screen and scanned on a Molecular Dynamics Typhoon Phosphorimager.BSC40 cells were infected with SV at an moi of 40 pfu/cell and at 8 h post infection total RNA was extracted using RNeasy mini kit (Qiagen). Five μg of total RNA was denatured with formaldehyde, and electrophoresed through a 1.5% agarose gel. The RNAs were transferred to a nylon membrane and subjected to northern blotting. The negative-strand probe, SV7772(-), which contains the negative-strand sequence from nt 7772 to 7754 were end-labeled with BSC40 monolayers in T75 tissue culture flasks were infected with three different recombinant vaccinia virus vectors; these encode the SV nonstructural polyprotein P123 , SV nsP4, and T7 RNA polymerase, each at an moi of one pfu/cell. Twenty to twenty four hours after infection, the P15 fraction was prepared according to Lemm et al. . The P15in vitro synthesis of SV RNA (25 μl) contained 5 μl of 5 × reaction buffer , 10 mM dithithreitol, 40 units of RNase inhibitor (Promega), 2 μg negative-strand RNA which serves as promoter/template (P/T), and 12.2 μl (5.4 μg of protein/μl) of P15 extract prepared from BSC40 cells infected with recombinant vaccinia viruses expressing the T7 RNA polymerase, the SV polyprotein, P123, and the SV nsP4. Standard reaction mixtures contained 3 mM ATP, 2 mM UTP, 2 mM CTP, and 0.5 mM GTP. [32P]α-GTP was included to label the transcripts. Incubation was at 37°C for 1 hour. RNA was extracted using phenol-chloroform and electrophoresed on a 1% denaturing agarose gel containing 2.2 M formaldehyde. The gel was transferred to a Genescreen Plus Hybridization Transfer Membrane (Perkin Elmer); the membrane was then exposed to a storage phosphor screen and scanned as described previously [The reaction mixture for the eviously . The negeviously .hnRNP A1 cDNA derived from SF268 cellular mRNA was cloned into pET30a and expressed as described . The recBSC40 cells were maintained in antibiotic-free media. 100 nmol of siRNA targeting hnRNP A1 was transfected along with 3 μl FuGENE HD transfection reagent (Roche) in 0.4 ml MEM supplemented with 10% FCS following manufacturer's directions. Three days after transfection cells were co-infected with recombinant vaccinia viruses expressing T7, SV-nsP123 and SV-nsP4 at an moi of one pfu/cell. P15 fraction was prepared as described . An aliqExpression of hnRNP A1 was examined by Western blotting using anti-hnRNP A1 antibody (Abcam). Briefly, cells were lysed in sample buffer and proteins were fractionated by SDS-PAGE in 12% polyacrylamide gels and transferred to PVDF membranes by wet transfer. Membranes were blocked with PBS containing 5% low-fat dry milk. Anti-hnRNP A1 mouse antibody was then added, and the membranes were washed with PBS containing 0.2% Tween 20. Goat anti-mouse horseradish peroxidase-conjugated antibody (BioRad) and the ECL kit (Pierce) were used to detect bound antibodies.Our previous study demonstrated that knockdown of hnRNP A1 in infected cells reduces the viral RNA synthesis . To furtWhile we have good evidence that hnRNP A1 binds to the G and SG promoters, the consequences of this interaction for viral RNA synthesis are not known. Our recent studies showed that hnRNP A1 re-localizes from nucleus to cytoplasm of SV-infected cells. Knockdown of hnRNP A1 inhibits the virus replication . These fin vitro system for the synthesis of G and SG RNA developed by our laboratory [32P-α-labeled GTP in the reaction mixture, along with the four unlabeled NTPs, the P/T, and the P15 fraction as described in Materials & Methods.We made use of an boratory ,49 to exin vitro, the reaction was set up as described [The level of endogenous hnRNP A1 in BSC40 cells was knocked down by siRNA targeting of hnRNP A1 as described in Materials & Methods. The knockdown efficiency was confirmed by Western blot using anti-hnRNP A1 antibody (data not shown). The hnRNP A1-depleted BSC40 cells were then co-infected with recombinant vaccinia viruses expressing T7 polymerase, SV P123 and SV nsP4 and the p15 were prepared as described . As showescribed using eiHost factors together with viral proteins regulate virus RNA replication. The finding that mutations in the viral genome sometimes have different effects in vertebrate cells and mosquito cells has suggested that cellular factors play a role in viral RNA synthesis . Recent How does hnRNP A1 contribute to the replication of SV? As hnRNP A1 is an RNA-binding protein, we speculated that it might facilitate viral RNA synthesis via association with viral RNA. In our previous study we found that hnRNP A1 interacts with the 5'UTR of SV RNA and promotes the synthesis of negative strand RNA [, data noG and SG promoters are different in sequences. Our previous study showed that nsP4, the RDRP, has distinct sites for the binding of G and SG promoters ,48. We tHow does hnRNP A1 contribute to the viral RNA replication? hnRNP A1 is predominantly a nuclear protein. During SV infection nearly all of hnRNP A1 relocalizes to cytoplasm in association with viral RNA. Precisely what interactions lead to the recruitment of hnRNP A1 to the viral RNA replication complex is unknown. As hnRNP A1 is an RNA-binding protein, it may direct the viral RNA replication complex containing the viral RDRP, other viral and cellular factors to the sites where replication of viral RNA is initiated. Moreover, considering the reported physiological roles of hnRNP A1, we speculate that hnRNP A1 may interact with viral nonstructural proteins which comprise the viral RNA replication complex and facilitates the viral RNA replication. Further investigation is going on to address how hnRNP A1 contributes to viral RNA replication.To our knowledge, this is the first report to describe an RNA-binding protein (hnRNP A1) actively participating in SV RNA replication in molecular detail. These studies not only improve our understanding of the replication of SV, but also have the potential for use as the basis for developing antiviral agents that act by inhibiting the virus RNA replication.in vitro. Our study provides the first direct evidence that hnRNP A1 actively participates in viral RNA replication and is required for the synthesis of G and SG RNA.Our previous study and the present report demonstrate that hnRNP A1 is essential for the RNA replication of Sindbis virus. hnRNP A1 binds to the 5' UTR of SV RNA and facilitates the negative strand RNA synthesis. Moreover hnRNP A1 interacted with the genomic (G) and subgenomic (SG) RNA promoters and is required for the synthesis of G and SG RNA both in infected cells and The authors declare that they have no competing interests.HXG designed the experiments and carried out the in vitro RNA synthesis, virus titration and drafted the manuscript, CWL and SA carried out the Northern and Western blots, SA proof read the manuscript, VS and MLL designed and troubleshoot the experiments, and prepared the manuscript. All authors read and approved the final manuscript.

Hemophilia is uncommon in females and there is little knowledge about the clinical manifestation.We report here an unusual case of three hemophilic females diagnosed as factor IX deficient. Normal reports of ultrasonography (USG) and relevant endocrine investigations conducted in two adult females ruled out any usual gynecological and endocrinal causes of bleeding. Complete coagulation profiles were conducted and diagnosed these female bleeders to be hemophiliacs suffering from factor IX deficiency.Females presenting with menorrhagia and bleeding from other sites without any discernable cause require proper evaluation for congenital coagulation disorders. In the present case series, females are diagnosed factor IX deficient (Hemophilia B). Menorrhagia is a frequent clinical manifestation of several rare congenital disorders of blood coagulation and platelets . Women wAn Aryan Hindu 33-year's-old Indian married woman, complained menorrhagia since last eight years. She could not assess herself to be heavy bleeder therefore; she went to her family gynecologist to have her view regarding the inconvenience she was facing from the last eight years. The ultrasonography (USG) and relevant endocrine investigations revealed no hemorrhagic ovarian cysts or endometriosis, which may also be the common causes of bleeding in women. She has neither the family history of bleeding nor she herself bleed from any other site. Reference sent to our lab for complete coagulation profile. Pictorial blood assessment chart (PBAC) with semi quantitative assessment of blood losses method adopted to assess the real and false menorrhagia. Monthly assessment revealed flooding of blood for more than 80 ml. Screening test resulted in normal prothrombin time (PT), platelet counts (P/C) and function, fibrinogen and thrombin time (TT) with prolonged activated partial thromboplastin time (APTT). This indicated intrinsic pathway defect and ruled out deficiency of vitamin K and Factor V. Mixing study (diagnostic test) showed deficiency of factor IX and the factor assay revealed 42% factor IX activity level (mild deficiency) Table .An Arabian origin Muslim young unmarried Indian, 18-year's-old girl gave the history of prolonged gum bleeding, epistaxis along with the history of menorrhagia since menarche. She was not suffering from any gynecological problem. Nasal examination by ENT surgeon and gum bleeding examined by dental specialist disclosed no primary cause of bleeding from the effective site. She was born of consanguineous marriage, but having no family history of bleeding. Monthly assessment using PBAC showed bleeding more than 90 ml. Patient approached us for complete coagulation profile. Screening test revealed only abnormal APTT indicative of intrinsic pathway defect. Mixing study resulted in deficiency of factor IX. Factor assay revealed 37% factor IX activity level (mild deficiency) .All the three patients had Liver Function Test report normal indicating that patient does not have any acquired conditions causing factor IX deficiency. Further, a normal prothrombin test value in screening test ruled out vitamin K deficiency and vitamin K dependent factor deficiency. None of the three patients received any treatment without prior diagnosis. After detection of the deficiency; the factor IX concentrates infused to replace the defective clotting factor. This normalized the uncontrolled bleeding and improved the hemoglobin condition in all the three cases.Like other parts, haemostatic plugs also characterize homeostasis in the endometrium and more important role it plays during first 2-3 days of menstruation. Studies reported high prevalence of menorrhagia among females with von Willebrand disease . Factor Since substantial number of women complains for menorrhagia after menarche irrespective of their age, therefore investigation of such patients for inherited bleeding disorders before planning for any therapy or undergoing invasive procedures: hysteroscopy and hysterectomy that may lead to a high rate of postoperative bleeding is of utmost importance.Written informed consents were obtained from the first and second patient and written informed consent was obtained from the parents for the third patient for publication of these case reports. Copies of the written consent are available for review by the Editor-in-Chief of this journal.The author declares that he has no competing interests.

The 1,4-addition of a monofluoromethyl nucleophile to a variety of α,β-unsaturated compounds has been achieved under mild conditions using either phosphines or potassium carbonate at room temperature. α-Substituted fluoro(phenylsulfonyl)methane easily undergoes Michael addition to α,β-unsaturated ketones, esters, nitriles, sulfones, as well as propynoates at room temperature to yield the corresponding adducts in moderate to excellent yields. Compounds with a monofluoromethyl moiety are of great importance with regards to isostere-based drug design –4. Conse3) in a 1,4-manner rather than the favored 1,2-addition. Portella et al. was attempted in acetic acid at room temperature. Tuning the conditions by using 4-fold excess of H2O2 afforded 90% yield of (nitromethylsulfonyl)benzene overnight methane, which is commercially available gave [fluoro(nitro)methylsulfonyl]benzene 3a in 62% isolated yield methylsulfonyl]benzene with methyl vinyl ketone was first tested in the presence of PPh3 (50 mol%) in THF at room temperature under argon. Interestingly, 5-fluoro-5-nitro-5-(phenylsulfonyl)pentan-2-one (5a) was obtained in 93% yield as the sole product, which was characterized by 1H, 13C, 19F NMR, and HRMS. In the 19F NMR spectrum of 5a, two doublets at δ −125.94 ppm were observed. As it is known, fluoro substitution can cause problems in transformations, since fluoride can also act as a leaving group. Notably, fluorine-free products were not detected in the course of above-mentioned Michael reactions, under the reaction conditions.Alkylation of fluorine . With th3, Bu3P, (iPr)3P and PMe3. Initial experiments revealed that the catalytic activity of phosphines and phosphine loading (varying from 20% to 50%) efficiently promoted the Michael reaction. With 50 mol% catalyst loading, the reaction rates were approximately 2- to 3-fold faster than the corresponding 20 mol% PPh3 catalyzed reactions. A dramatic increase in the efficiency of the reaction came from the usage of less bulkier phosphine, PMe3 (20 mol%), which led to the best result propane-2-one (3d) -pent-3-en-2-one to undergo the Michael reaction under these conditions demonstrates that the reaction is not tolerant of substituents at the terminal position of the double bond due to steric effects.When ethyl acrylate was subjected to similar reaction conditions, the yields of the products were 60–88% after prolonged reaction time. Compared to methyl vinyl ketone, the reaction rates were slow due to the somewhat lower reactivity of ethyl acrylate 3P.On the basis of the above mentioned results, a proposed mechanism for the formation of of PMe3 . The mec2CO3/DMF system was found to be very efficient both in terms of conversions as well as reaction times.In addition, the presence of electron withdrawing groups such as the phenylsulfonyl group can be exploited to generate a carbanion that can act as a "soft" nucleophile –41. The 19F NMR even when the reaction was carried out at low temperatures. On the other hand, α,β-unsaturated nitriles underwent a second Michael addition of the product 6h. Both fluoro(bisphenylsulfonyl)methane and fluoronitro(phenylsulfonyl)methane were added to propynoates under similar conditions. As expected, a mixture of both cis and trans products were obtained as shown in trans isomer 6l was obtained in an appreciable amount while the cis product was observed only in traces.The reactions were carried out at room temperature and the completion observed within 2 h. The reaction was found to be versatile for various α,β-unsaturated compounds such as ketones, esters, nitriles and sulfones . In case2CO3/DMF system. The reaction of fluoro(bisphenylsulfonyl)methane with methyl crotonate was found to give only 50% conversion based on 19F NMR after 36 h and methyl cinnamate did not react at all at room temperature using the K2CO3/DMF system. These observations are consistent with what was observed in the phosphine case discussed earlier. Attempted reductive desulfonylation on compound 6d using Mg/CH3OH [During our study, we observed that the steric factor affects the addition of the pronucleophile to the Michael acceptor. Substitution at the α-position of the Michael acceptor affects the reactivity of the nucleophile generated by the KMg/CH3OH was not In summary, a convenient protocol for the preparation of α-substituted fluoro(phenylsulfonyl)methane derivatives has been described and its subsequent use in 1,4-addition to a variety of Michael acceptors has also been demonstrated. Further applications of fluoro(phenylsulfonyl)methane including stereocontrolled synthesis will be reported in due course.File 1Experimental procedures, full spectroscopic data and spectra.File 2Spectra.

Aspartyl-(Asparaginyl)-β-Hydroxylase (AAH) is a hydroxylating enzyme that promotes cell motility by enhancing Notch-Jagged-HES-1 signaling. Ethanol impaired cerebellar neuron migration during development is associated with reduced expression of AAH.To further characterize the role of AAH in relation to cerebellar development, structure, and function, we utilized an in vivo model of early postnatal (P2) intracerebro-ventricular gene delivery to silence AAH with small interfering RNA (siAAH), or over-express it with recombinant plasmid DNA (pAAH). On P20, we assessed cerebellar motor function by rotarod testing. Cerebella harvested on P21 were used to measure AAH, genes/proteins that mediate AAH's downstream signaling, i.e. Notch-1, Jagged-1, and HES-1, and immunoreactivity corresponding to neuronal and glial elements.The findings demonstrated that: 1) siAAH transfection impaired motor performance and blunted cerebellar foliation, and decreased expression of neuronal and glial specific genes; 2) pAAH transfection enhanced motor performance and increased expression of neuronal and glial cytoskeletal proteins; and 3) alterations in AAH expression produced similar shifts in Notch-1, Jagged-1, and HES-1 protein or gene expression.The results support our hypothesis that AAH is an important mediator of cerebellar development and function, and link AAH expression to Notch signaling pathways in the developing brain. The cDNAs were ligated into the pcDNA3.1 vector in which gene expression was under the control of a CMV promoter. Supercoiled plasmid DNA was purified using endotoxin-free columns . For each animal, 10 μg of recombinant plasmid DNA or 0.4 nmol siRNA were complexed with 10 μl of Dharmafect reagent , and injected into the right lateral ventricle using a Hamilton syringe with a 26-gauge needle as previously described ,30. All We used rotarod testing to assess long-term effects on motor function resultinWe used qRT-PCR to measure mRNA expression as previously described ,30,32. ICerebellar homogenates were prepared in radioimmunoprecipitation assay (RIPA) buffer containing protease and phosphatase inhibitors ,33. ProtQuantiTect SYBR Green PCR Mix was obtained from . Monoclonal antibodies to Notch-1, Jagged-1, β-Actin and were purchased from Abcam Inc. . Antibodies to Hu, glial fibrillary acidic protein (GFAP), myelin-associated glycoprotein 1 (MAG-1), synaptophysin, SNAP-25, and GAP-43 were purchased from Molecular Probes , Santa Cruz Biotechnology Inc. , or Chemicon International . The 85G6 AAH mAb was generated to human recombinant protein and purified over Protein G columns .Data depicted in the graphs represent the means ± S.E.M.'s for each group. Inter-group comparisons were made using Student t-tests since the siAAH and siScr groups, and the pAAH and pGFP groups were studied in separate experiments. Statistical analyses were performed using the GraphPad Prism 5 software and significant P-values (<0.05) are indicated over the graphs.Rats were weighted on P2, P9, P21, and P35 (sacrifice) and brain weights were obtained on P21 or P35. Although initial body weights were similar for the two groups, on P9 and P21, the siAAH-treated rats had significantly lower mean body weights relative to siScr-treated controls Figure . HoweverThe Rotarod test is used to assess sensorimotor coordination and provides a highly sensitive index of damage to the cerebellum . RotarodCerebella from P21 rats were examined histologically. Cerebella of siScr- Figures and pGFPWe used qRT-PCR analysis to examine expression of cell profile genes corresponding to neurons (Hu and tau), oligodendroglia , and astrocytes Figures . ResultsPrevious studies demonstrated that AAH protein interacts with and hydroxylates Notch and Jagged, leading to increased Notch signaling and expression of downstream target genes such as HES-1 . MoreoveELISA studies further demonstrated that the siAAH treatments significantly reduced mean levels of AAH and Notch-1 protein, and increased Jagged-1, the ligand of Notch, but had no significant effect on the mean level of β-actin Figures . TransfeThis study investigated the role of AAH in cerebellar development and function. The goal was to determine the degree to which ethanol's inhibition of AAH expression contributes to FASD-associated structural and functional abnormalities in the cerebellum. We demonstrated that intracerebroventricular transfection with siAAH significantly impairs motor function, while over-expression of AAH in the cerebellum enhances motor performance as demonstrated by rotarod testing. Importantly, although the siRNA and recombinant plasmid DNA transfections were performed on P2, the CNS effects persisted for several weeks, corresponding with results in a previous report utilizing this same experimental approach .The siAAH-induced impairments in motor function were associated with conspicuous structural abnormalities in the cerebellum, including reduced foliation and decreased expression of genes that mark neurons (Hu), astrocytes (GFAP), and oligodendroglia (MAG-1). In addition, siAAH brain transfections reduced tau and GFAP expression. Together, these findings suggest that siRNA-mediated inhibition of AAH expression during postnatal cerebellar development results in net losses of neurons, oligodendroglia, and astrocytes. Since tau and GFAP represent major cytoskeletal proteins expressed in neurons and astrocytes, respectively, inhibition of AAH could promote cytoskeletal collapse and reduced inter-cellular connectivity and signaling, irrespective of relatively preserved or marginally reduced expression of synaptic plasticity proteins, including SNAP-25 and synaptophysin -39. On tThe adverse effects of siAAH on cerebellar structure and function are highly reminiscent of previous findings in experimental models of FASD ,25,27. IPrevious studies demonstrated that AAH mediates its effects on cell motility by interacting with, and hydroxylating Notch and Jagged , and thaSince siAAH and pAAH transfections had no significant effects on Notch's mRNA levels, AAH's regulation of Notch is likely mediated by post-translational mechanisms. For example, AAH hydroxylation of Notch leading to its translocation to the nucleus reflects post-translational regulation of Notch protein. Jagged is a ligand for Notch, and its binding to Notch is needed for Notch cleavage and release from the membrane for translocation to the nucleus ,43,44. TTogether, these studies demonstrate a pivotal role for AAH in cerebellar development, structure, and function, and confirm that AAH expression is integrally tied to Notch-Jagged-HES-1 signaling, which regulates target genes that mediate neuronal migration and cerebellar cortical foliation in the brain. Moreover, the findings herein support the concept that ethanol inhibition of AAH expression during development mechanistically contributes to the cerebellar dysgenesis, and attendant impairments in motor function.AAH: Aspartyl(Asparginyl)-β-Hydroxylase; BCA: bicinchoninic acid; EGF: epidermal growth factor; FASD: fetal alcohol spectrum disorders; GFAP: glial fibrillary acidic protein; GSK-3β: glycogen synthase kinase 3β; HES-1: Hairy and Enhancer of Split 1; IGF: insulin like growth factor; IRS: insulin receptor substrate; MAG-1: myelin-associated glycoprotein 1; P: postnatal day; pAAH: recombinant plasmid DNA expressing AAH mRNA; PI3 kinase: phosphatidyl-inositol 3-kinase; qRT-PCR: quantitative Reverse Transcriptase Polymerase Chain Reaction; siAAH: siRNA targeting AAH; siRNA: small interfering RNA; SNAP-25: synaptosome-associated protein of 25 kD; TBS: Tris buffered saline, pH 7.4.The authors declare that they have no competing interests.ES performed the qRT-PCR and ELISA studies. PM and NB performed the neurobehavioral tests and helped analyze the data. MT generated the model, harvested the tissues, and helped with data analysis. SMD conceived of the idea, planned the experiments, supervised the research, performed statistical analysis, and generated the manuscript. All authors read and approved the final manuscript.E. Silbermann, P. Moskal, and N. Bowling are all young investigators who worked diligently to complete their first research project as pre-medical and medical students.

Analogues which act predominantly as A1 (e.g. N6-cyclopentyladenosine) or as mixed A1/A2 receptor agonists adenosine) caused mast cell degranulation, whereas a predominantly A3 receptor agonist (IB-MECA) was inactive. Pre-treatment of the omentum with the A1/A2 receptor antagonist 8-phenyltheophylline or with the more specific A1 receptor antagonist 8-cyclopentyl-1,3-dipropylxanthine significantly reduced agonist-induced degranulation. Pre-treatment with disodium cromoglycate or with BN52021 also reduced degranulation of mast cells in response to N6-cyclopentyladenosine. In the rat isolated omental mast cell we conclude that degranulation is an indirect result of A1 receptor stimulation. Platelet-activating factor release appears to mediate at least part of the degranulation.The haemodynamic effects of adenosine are thought to result in part from a release of mast cell amines via A3 receptor stimulation. To investigate the nature of the receptors involved in adenosine-induced mast cell degranulation in the rat isolated omentum we have used adenosine analogues with varying specificities as activators of the A

Beta-lactamases are one of the most serious threats to public health. In order to combat this threat we need to study the molecular and functional diversity of these enzymes and identify signatures specific to these enzymes. These signatures will enable us to develop inhibitors and diagnostic probes specific to lactamases. The existing classification of beta-lactamases was developed nearly 30 years ago when few lactamases were available. DLact database contain more than 2000 beta-lactamase, which can be used to study the molecular diversity and to identify signatures specific to this family.http://59.160.102.202/DLact were classified using graph-based clustering of Best Bi-Directional Hits. Non-redundant protein sequences from each group were aligned using T-Coffee and annotated using information available in literature. Motifs specific to each group were predicted using PRATT program.A set of 2020 beta-lactamase proteins available in the DLact database The graph-based classification of beta-lactamase proteins resulted in the formation of six groups . Based on the information available in literature, we found that each of the four major groups correspond to the four classes proposed by Ambler. The two minor groups were novel and do not contain molecular signatures of beta-lactamase proteins reported in literature. The group-specific motifs showed high sensitivity (> 70%) and very high specificity (> 90%). The motifs from three groups had a high level of conservation at DNA as well as protein level whereas the motifs from the fourth group (corresponding to class B) showed conservation at only protein level.The graph-based classification of beta-lactamase proteins corresponds with the classification proposed by Ambler, thus there is no need for formulating a new classification. However, further characterization of two small groups may require updating the existing classification scheme. Better sensitivity and specificity of group-specific motifs identified in this study, as compared to PROSITE motifs, and their proximity to the active site indicates that these motifs represents group-specific signature of beta-lactamases and can be further developed into diagnostics and therapeutics. Beta lactamases are enzyme responsible for resistance to penicillin, cephalosporin and related beta lactam compounds. The enzymes hydrolyze the beta-lactam ring of these antibiotics and thus inactivate these drugs . Almost i.e. class A, the active site serine beta lactamases and class B the metallo-beta lactamases that require a bivalent metal ion, usually Zn2+ for their activity. Later class C and class D were added to this classification. Enzymes from class A, C and D contain serine-based active site. Proteins from class A, C and D show sufficient structural similarity indicating that these may have descended from a common ancestor [Beta lactamases show extensive molecular and functional diversity. Based on the characteristics of the enzymes and their substrate profile, a number of classification schemes have been proposed ,4. Amongancestor . Class Bancestor . In receancestor .i.e. S-X-X-K, S-D-N and K-T-G at positions 70, 130 and 234 respectively. Sequence belonging to class C contains S-X-S-K, Y-S-N and K-T-G at position 64, 150 and 314 respectively. Class D lactamase contains S-X-X-K, Y-G-N and K-T-G at positions 70, 144 and 214 respectively. Sequences belonging to class B contain H-90, D-92, L-117, H-168, G-204 and H-236 as conserved residues located at the bottom of the active site. Among these H-80, H-90 and H-168 accommodate Zn2+ which is required for the activity of class B beta-lactamases [Each class contains specific signature or motifs . For exaHowever, the above mentioned classification and identified class-specific motifs are useful; these have been identified using a limited set of sequences. Recently we have developed a database of beta-lactamase genes, identified from sequenced bacterial genomes and plasmids . This dahttp://59.160.102.202/DLactProtein and DNA sequences of 2020 lactamase genes available in DLact database were useThe protein sequences of lactamase genes were separated according to their source genome. Each lactamase protein from a genome was compared to all proteins from another genome using BLASTP. Pair of sequences that were best hits when either sequence was used as query was identified as BeTs , and the sequences in pair were considered as functionally related. BeTs relationship is one of the bare operational definitions of orthology. If the best hit was in only one direction, then no relationship was assumed between the sequence pair. BeTs pairs were clustered using a procedure adopted for developing COG (Cluster of orthologous groups) database . In addiRedundancy in sequence from each group was removed using CD-HIT with a cWhere TP(True Positive) is the number of sequences from a selected group containing a given motif, FP is the number sequences from other groups containing given motif and FN is the number of sequences from selected group that do not contain given motif.The graph-based classification of beta-lactamase proteins resulted in the formation of six highly interconnected groups Figure . The proBased on the information available in literature about the molecular characteristics of beta-lactamase proteins , we founRedundant sequences from each group were removed using CD-HIT and the non-redundant sequences from each group were aligned using T-Coffee . The groMapping of the group-specific motifs on the crystal structures showed that motifs identified in this study mapped in close proximity to the active site Figure .Group A specific motif identified from this study was present on the S-D-N functional element responsible for catalytic activity of class A lactamase whereas Motifs specific to group C and D identified in this study overlapped with the PROSITE motifs specific to corresponding classes Table . Motifs 2+), required for activity of this class of beta-lactamase [Motifs specific to group B (corresponding to class B in ambler classification) showed conservation at only protein level Figure . Proteinactamase .Proteins from group E lack lactamase domain. Motifs specific to group E showed conservation at protein level. Lack of conservation at DNA level and BeTs links to group B indicates that proteins from this group are likely to be highly divergent proteins belonging to group B. Length of proteins belonging to group E is similar to proteins from group B. Both groups E and B showed conserved histidine (H) and aspartic acid (D) at the sequence level.Motifs from group F showed higher conservation at both protein and DNA level Figure . The proMotifs found in class E and F were very specific to beta-lactamase, but we were unable to find any lactamase domain because these classes are highly divergent. However, we suspect proteins belonging to these groups as beta-lactamase because group E and F proteins showed similarity to experimentally identified lactamase proteins which we used in initial screening. Proteins from both groups showed Bi-Directional Best Hit (BeTS) relationships with beta-lactamases from other characterized classes e.g. both group E and F has BeTS links with B. The BeTs are generally considered as criterion for defining orthology .The present work was carried out with two objectives (i) to evaluate the classification of lactamase genes on a large dataset and (ii) to identify specific motifs/regions which can be further developed to diagnostic primers and probes. The results show that the graph-based classification of beta-lactamase proteins from DLact database corresponds with the classification proposed by Ambler , thus thThe group-specific motifs identified from this study showed better sensitivity and specificity in comparison to the motifs available in PROSITE. It is likely that the motifs identified using larger dataset have identified stronger consensus regions and suppressed weakly conserved regions. Proximity of these motifs to the class specific active sites indicates that these regions are either structurally of functionally important for the lactamase activity. The sequence logos of regions containing class-specific motifs show that these regions have lesser substitution rates as compared to the other regions in proteins. Thus it is likely that these regions can be used to develop diagnostic probes. We are studying the co-occurrence profiles of motifs in order to identify non-overlapping regions which can be developed into sensitive class-specific primers.The study has achieved its objectives in terms of evaluating classification of beta-lactamases proposed by Ambler on a larThe graph-based classification of beta-lactamase proteins from DLact database corresponds with the four group classification proposed by Ambler, thus there is no need for formulating a new classification. However, further characterization of two small groups may require updating the existing classification scheme. Group-specific motifs identified from six groups in this study had high sensitivity (> 70%) and very high specificity (> 90%), as compared to PROSITE motifs, and their proximity to the active site indicates that these motifs represents characteristic group-specific signature of beta-lactamases and can be further developed into better diagnostics and therapeutics.The authors declare that they have no competing interests.RS has made substantial contributions to the analysis and interpretation of data, and drafting the manuscript. AS has participated in the mapping of patterns on the structure. HS has conceptualization of idea and has provided directions for the work.

IEKO) still occasionally show increased inflammation. This indicates that TAK1 is important for TNF-independent regulation of intestinal integrity.We have previously reported that intestinal epithelium-specific TAK1 deleted mice exhibit severe inflammation and mortality at postnatal day 1 due to TNF-induced epithelial cell death. Although deletion of TNF receptor 1 (TNFR1) can largely rescue those neonatal phenotypes, mice harboring double deletion of TNF receptor 1 (TNFR1) and intestinal epithelium-specific deletion of TAK1 . We found that loss of TAK1 significantly augments DSS-induced experimental colitis. DSS induced weight loss, intestinal damages and inflammatory markers in TNFR1KO/TAK1IEKO mice at higher levels compared to the TNFR1KO control mice. Apoptosis was strongly induced and epithelial cell proliferation was decreased in the TAK1-deficient intestinal epithelium upon DSS exposure. These suggest that epithelial-derived TAK1 signaling is important for cytoprotection and repair against injury. Finally, we showed that TAK1 is essential for interleukin 1- and bacterial components-induced expression of cytoprotective factors such as interleukin 6 and cycloxygenase 2.In this study, we investigated the TNF-independent role of TAK1 in the intestinal epithelium. Because the inflammatory conditions were sporadically developed in the double mutant TNFR1KO/TAK1Homeostatic cytokines and microbes-induced intestinal epithelial TAK1 signaling regulates cytoprotective factors and cell proliferation, which is pivotal for protecting the intestinal epithelium against injury. The intestinal epithelium is a single cell layer that separates lamina propria immune cells from luminal components including food antigens and commensal or pathogenic bacteria Transforming growth factor-β activated kinase 1 (TAK1) is a member of the mitogen activated protein kinases kinase kinase (MAPKKK) family and plays an essential role in tumor necrosis factor (TNF), interleukin 1 (IL-1), and Toll-like receptor (TLR) signaling pathways IEKO) spontaneously developed intestinal inflammation IEKO) developed ileitis and colitis around the age of 14–17-days-old IEKO mice, this protective signal is derived from epithelial cells. As described above, TAK1 is activated by cytokines and TLR/NLR ligands. Taken together, we hypothesize that intestinal epithelial TAK1 is activated by cytokines and TLR/NLR ligands and maintains the epithelial barrier. In this study, we tested this hypothesis by analyzing TNFR1KO/TAK1IEKO mice. The inflammatory conditions in TNFR1KO/ TAK1IEKO mice at the late neonatal stage were transient and widely varied in each mouse IEKO mice lost weight and developed ileitis and colitis at 14–17 days as reported previously IEKO mice grew normally and were indistinguishable from TNFR1KO control mice after the age of 6-weeks-old. We speculate that the inflammatory conditions at 14–17 days is associated with stress caused by increased bacterial microflora in the intestine when the mice start having solid food IEKO mice and examined sensitivity to chemical-induced acute colitis. We found that TAK1 deficiency caused hypersensitivity to chemical-induced colitis involving increased apoptosis and dysregulated cell proliferation, suggesting that epithelial TAK1 signaling is cytoprotective.In addition to this proinflammatory function in immune cells, we have recently demonstrated that TAK1 has a completely opposite role in the skin and intestinal epithelium. TAK1 is important for preventing inflammation in the skin and intestinal epithelium IEKO mice to dextran sulfate sodium (DSS), a chemical disrupting the epithelium. TNFR1KO/TAK1IEKO and littermate control TNFR1KO mice were fed with 2.5% of DSS and sacrificed at Day 5. The severity of DSS-induced colitis was monitored by daily loss of body weight and observation of clinical signs of acute inflammation such as rectal bleeding. DSS treatment caused little weight loss or no apparent injury phenotype in the control TNFR1KO mice. In contrast, the double mutant TNFR1KO/TAK1IEKO mice showed significant weight loss and rectal bleeding starting from Day 4 in the double mutant mice that was injected 2 h prior to harvesting distal colon. Immunohistochemical analysis was performed to detect BrdU labeled cells. Interestingly, we found significantly increased proliferating cells in TAK1 deficient intestinal epithelium during the isolation procedure In this study, we demonstrated that intestinal epithelium-derived TAK1 signaling plays a pivotal role in preventing injury-induced intestinal inflammation. In the absence of TAK1-derived signaling, the intestinal epithelium is exquisitely sensitive to DSS-induced injury, a process involving increased epithelial cell apoptosis and reduced regenerative proliferative responses. This pathologic response further induces damage-associated inflammation. In addition, ablation of TAK1 leads to an increased expansion of the epithelial cell proliferative zone under steady-state conditions, and causes impaired reparative proliferation after injury. Finally, we showed that loss of TAK1 abolishes production of cytoprotective factors in response to proinflammatory cytokines and bacterial components. Taken together, we propose that TAK1 is essential for preventing injury-associated intestinal inflammation by the following two mechanisms. One is that TAK1 is responsible for maintenance of homeostatic proliferation of the intestinal epithelium, and that dysregulated cell proliferation causes hypersensitivity to cytotoxic insults. Intestinal epithelial cells are originated from stem cells located in the bottom of crypts TAK1 can activate two major transcription factors, NF-κB and AP-1. NF-κB is a key transcription factor implicated in the regulation of both IL-6 and COX2 gene expression IEKO mice. It has been reported that NF-κB p50-deficient intestinal epithelium also shows extensive proliferative zones How does TAK1 deletion cause increased basal cell proliferation in the intestinal epithelium? It has been established that proliferation of the intestinal epithelium depends on the concerted action of several factors including Wnt (positive regulator of cell cycle) and TGF-β signaling (negative regulator of cell cycle) IEKO mice that are characterized by increased susceptibility to DSS-induced injury, dysregulated steady-state levels of cell proliferation and impaired production of cytoprotective factors TLR- or MyD88-deficient mice and commensal bacteria-depleted mice showed very similar phenotypes observed in our TNFR1KO/TAK1Loss of intestinal epithelial barrier is associated with chronic inflammatory diseases such as inflammatory bowel diseases (IBD). Mutations in NOD2 gene are highly associated with IBD susceptibility IEKO mice and control FL/FL TNFR1TAK1−/− were generated as described in our previous study IEKO mice and littermate control TNFR1KO (FL/FL TNFR1TAK1−/−) were fed with 2.5% of DSS. Mice were weighed daily and sacrificed at time points indicated. Mice were bred and maintained under specific pathogen-free conditions. All animal experiments were done with the approval of the North Carolina State University Institutional Animal Care and Use Committee.TNFR1KO/TAK1FL/FL1 mice. The cells were spontaneously immortalized and infected with pMX-puro-CRE retroviral vector to delete tak1 gene. Uninfected cells were removed by puromycin selection and the deletion of TAK1 was confirmed by immunoblotting. The cells were maintained in DMEM containing 10% bovine growth serum (HyClone) and 1% penicillin/streptomycin. TAK1 WT and KO keratinocytes were isolated from epidermis-specific TAK1 deletion mice and maintained in keratinocyte medium as described in our previous publication Dermis fibroblasts were isolated from TAK1After 5 days of DSS treatment, distal colons were isolated and fixed in 10% formalin. Paraffin-embedded sections were stained with H&E for histological analysis. Sections were scored in a blinded fashion on a scale from 0 to 4, based on the degree of lamina propria mononuclear cell infiltration, crypt hyperplasia, goblet cell depletion, and architectural distortion, as previously described Total RNA was prepared from distal colons or cells using RNeasy minikit (Qiagen). To obtain cDNA, 200 ng of each RNA samples were reverse-transcribed using TaqMan reverse transcription reagents (Applied Biosystems). Real-time PCR analysis was performed using the ABI PRISM 7300 sequence detection system (Applied Biosystems). All samples were normalized by the amount of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression.2, 2 mM EGTA, 10 mM NaF, 2 mM DTT, 1 mM Na3VO4, 1 mM PMSF, 100 U/ml aprotinin, 0.5% Triton X-100). Proteins from cell lysates were electrophoresed by SDS-PAGE and transferred to Hybond-P . The membranes were immunoblotted with a polyclonal antibody against caspase-3 and a mouse antibody against β-actin (Sigma-Aldrich). Bound antibodies were visualized with HRP-conjugated antibodies against rabbit or mouse IgG using the ECL Western blotting system .After DSS exposure, distal colons were harvested and homogenized in an extraction buffer (20 mM HEPES (pH 7.4), 150 mM NaCl, 12.5 mM β-glycerophosphate, 1.5 mM MgClStatistical comparisons were made using paired or independent two-tailed Student's t tests assuming equal variance and two-tailed Welch's t tests assuming unequal variance.

Effector secretion is a common strategy of pathogen in mediating host-pathogen interaction. Eight EPIYA-motif containing effectors have recently been discovered in six pathogens. Once these effectors enter host cells through type III/IV secretion systems (T3SS/T4SS), tyrosine in the EPIYA motif is phosphorylated, which triggers effectors binding other proteins to manipulate host-cell functions. The objectives of this study are to evaluate the distribution pattern of EPIYA motif in broad biological species, to predict potential effectors with EPIYA motif, and to suggest roles and biological functions of potential effectors in host-pathogen interactions.Lawsonia intracellularis, Plasmodium falciparum and Leishmania major) are suggested.A hidden Markov model (HMM) of five amino acids was built for the EPIYA-motif based on the eight known effectors. Using this HMM to search the non-redundant protein database containing 9,216,047 sequences, we obtained 107,231 sequences with at least one EPIYA motif occurrence and 3115 sequences with multiple repeats of the EPIYA motif. Although the EPIYA motif exists among broad species, it is significantly over-represented in some particular groups of species. For those proteins containing at least four copies of EPIYA motif, most of them are from intracellular bacteria, extracellular bacteria with T3SS or T4SS or intracellular protozoan parasites. By combining the EPIYA motif and the adjacent SH2 binding motifs , we built HMMs of nine amino acids and predicted many potential effectors in bacteria and protista by the HMMs. Some potential effectors for pathogens (such as Our study indicates that the EPIYA motif may be a ubiquitous functional site for effectors that play an important pathogenicity role in mediating host-pathogen interactions. We suggest that some intracellular protozoan parasites could secrete EPIYA-motif containing effectors through secretion systems similar to the T3SS/T4SS in bacteria. Our predicted effectors provide useful hypotheses for further studies. As a complex and interesting relation between organisms in ecology and evolution, host-pathogen interaction is a basis of infectious diseases . PathogHelicobacter pylori (H. pylori), which is one of the major pathogens of upper gastrointestinal diseases . Filamentous hemagglutinin, the major virulence factor of Bordetella pertussis, not only has adhesion function, but also plays a critical role in immunomodulation. Since filamentous hemagglutinin has the sequences EDIYATINK (Y-2792), which is similar to the KK motif, EHIYADIRD (Y-2550) and ENLYAEISD (Y-2651), both of which are similar to the R4 motif, and EHLYAEINE (Y-2387), which is similar to the Tir motif, we suggest that filamentous hemagglutinin being the effector of Pasterurella multocida and it might be secreted by the TPS (Two-Partner Secretion) system [Pasterurella multocida.(5) system . PfhB2 Haemophilus ducreyi: Haemophilus ducreyi is a facultative anaerobic Gram- negative coccobacillus and could cause the sexually transmitted disease chancroid. Large supernatant protein2 (NP_873623) of Haemophilus ducreyi has six copies of EPIYA motif. Its sequence and filamentous hemagglutinin of Bordetella pertussis share 41% sequence identity. Its sequences EPVYADLHF and EPVYADLRF are similar to the R4 motif. Hence, we suggest large supernatant protein2 (NP_873623) is a potential effector of Haemophilus ducreyi and it could be secreted by T4SS [(6) by T4SS -44.Haemophilus somnus: Haemophilus somnus can survive in host cells and is the cause of a variety of systemic diseases in cattle, including thrombotic-meningoencephalitis, pneumonia, arthritis, myocarditis, septicemia and other reproductive diseases [Bordetella pertussis share 42% sequence identity. The sequence EPIYATLDK (Y-2933) in YP_001784809 is similar to the KK motif, EHIYEQIGE (Y-2358) similar to the Tarp motif, and EPVYDKVSA (Y-2287) similar to the Tir motif. Thus, YP_001784809 might be the effector of Haemophilus somnus to cause immunosuppression [(7) iseases ,46. Cysression .Chlamydophila pneumonia: Hypothetical protein CPj0472 (NP_300527) contains three copies of EPIYA motif. EPIYANTPE (Y-647) is similar to the KK motif, EPIYEEIGG (Y-346) is similar to the Tir motif and EPIYDEIPW (Y-681) is similar to the R4 motif. Although we did not find any similar protein through BLAST search, hypothetical protein CPj0472 (NP_300527) is a good candidate for the effector of Chlamydophila pneumonia.(8) Leishmania major: Leishmania major could parasitize into phagocyte of human or other mammals and is responsible for the disease leishmaniasis, which is a serious zoonosis. Leishmania major have 6 proteins containing at least two copies of EPIYA motif and 4 of them are proteins with unknown functions. Among these 6 proteins, Cytochrome C oxidase subunit VI (XP_001683136) contains two copies of EPIYA motif. One is at position Y-107 with sequence EPLYQPVKK, which is similar to the KK motif. Another one is at position Y-130 with sequence EPLYDVDAA, which is similar to the Tir motif. Hence, XP_001683136 might be an effector. Hypothetical protein (XP_001686159) has three copies of EPIYA motif and the sequences are all EPLYAVTIE, which is similar to KK and R4 motifs. Hypothetical protein (XP_001686160) also has three copies of EPIYA motif and the sequences are all EPLYAVTID, which is similar to the R4 motif. In addition, hypothetical protein XP_001686159 and XP_001686160 share 43% sequence identity. Hypothetical protein (XP_001686356) has 29 copies EPIYA motif (the one with most EPIYA motifs in our data) and all sequences are the same as EPLYAVTLE, which is similar to the R4 motif. Microtubule-associated protein (XP_001687515) contains two copies of EPIYA motif. One is at Y-1543 and another is at Y-1589. The sequences for both of them are ESIYAKDYK, which is similar to the KK motif. Thus, we predict hypothetical protein (XP_001686159), hypothetical protein (XP_001686160), hypothetical protein (XP_001686356) and Microtubule-associated protein (XP_001687515) might also be the effectors of Leishmania major. For another potential effector hypothetical protein (XP_001683914), although it contains two copies of EPIYA motif (ESLYE is at Y-1006 and EHLYD is at Y-1047), they are not similar to KK, R4, Tarp or Tir motif and hence less likely to be an effector than the above five proteins.(9) Plasmodium falciparum: Plasmodium falciparum can invade human liver cells and RBC to cause dangerous infection malaria. It contains many proteins with the EPIYA motif and 47 proteins with at least two copies of EPYIA motif. Among them, Plasmodium exported protein (XP_001347309) has three copies of motif which are all similar to the Tarp motif. The sequences and the corresponding pY sites are ESIYKNKLK (Y-331), ESIYKNKLK (Y-359), and ESIYKNKLE (Y-387). Thus we predict it as the effector of Plasmodium falciparum. Conserved Plasmodium protein (XP_001347469) has eight copies of EPIYA motif, RNA pseudouridylate synthase (XP_001350676) has nine copies of EPIYA motifs and hypothetical protein (XP_001351018) has three copies of EPIYA motif, but none of them contains any of KK, R4, Tir and Tarp motifs, and therefore is less likely to be the effector than Plasmodium exported protein (XP_001347309).(10) http://cello.life.nctu.edu.tw). All the associated bacteria are “gram negative”. As a real effector should be secreted from a gram-negative bacterium and then enter a eukaryote host, we perform subcellular localization by using both gram-negative bacterium and eukaryote, respectively. When using gram-negative bacteria as hosting species, 9 out 11 effectors were predicted as extracellular or outer-membrane . We excluded “other” sequences and “unclassified” sequences” in the database (as labelled in http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Root).1. Protein sequence data: We used the NR (non-redundant) protein database at the National Center for Biotechnology Information (NCBI) in this study. All protein sequences in the FASTA format were downloaded from the NCBI site .2. Taxonomy data: The taxonomy data was obtained from the NCBI website (http://hmmer.janelia.org). We used selected sequences to run the command hmmbuild.exe for building and calibrating the HMM. We then used the HMM to run the command hmmsearch.exe for searching protein sequences. We used a natural cutoff of HMM score such that the last of the all known motifs is retrieved.A hidden Markov model was built by using Hmmer 2.3.2 (http:/http://www.sas.com) as the statistical analysis tool and chose p<0.01 as the significant threshold.We used Perl (release ActivePerl 5.8.8) as the programming language to analyse the data and build the database. We applied SAS 9.0 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html), Lasergene 7 (http://www.dnastar.com/products/lasergene.php), and Blast [http://blast.ncbi.nlm.nih.gov/Blast.cgi) were used to compare and analyse the protein sequences. Sequence logos were constructed using Weblogo [BioEdit 7.0 (d Blast (http:/Weblogo .SX conceived the study, carried out the programming, built EPIYA-motif HMM, performed data analysis and drafted the manuscript. CZ built EPIYA-motif HMM, performed data analysis and drafted the manuscript. YM conceived the study. JG participated in data analysis. DX conceived the study, analyzed the results, and supervised the project. All authors revised and approved the final manuscript.The authors declare that they have no competing interests.Top 10 genuses and species containing most proteins with at least two copies of EPIYA motif for each group.Click here for fileList of proteins that contain at least 4 EPIYA motifs. Parenthesis under Lotus: number of sequences; “*”: effector confirmed by experiment; “Repeats”: occurrence of EPIYA motif in a protein sequence.Click here for fileEPIYA motif, together with the corresponding functions of those effectors. *: predicted effectors; **: predicted motifs.Click here for fileThis file contains a list of sequences that are similar to the KK motif in bacteria and protista.Click here for fileThis file contains a list of sequences that are similar to the R4 motif in bacteria and protista.Click here for fileThis file contains a list of sequences that are similar to the Tarp motif in bacteria and protista.Click here for fileThis file contains a list of sequences that are similar to the Tir motif in bacteria and protista.Click here for fileThis file contains top three subcellular localization prediction results of each predicted effector using gram-negative bacterium or eukaryote as the hosting organism, respectively. The values indicate the confidence of the predictions and “*” represents most likely localization.Click here for file

Xylella fastidiosa is a Gram negative plant pathogen causing many economically important diseases, and analyses of completely sequenced X. fastidiosa genome strains allowed the identification of many prophage-like elements and possibly phage remnants, accounting for up to 15% of the genome composition. To better evaluate the recent evolution of the X. fastidiosa chromosome backbone among distinct pathovars, the number and location of prophage-like regions on two finished genomes (9a5c and Temecula1), and in two candidate molecules (Ann1 and Dixon) were assessed. Based on comparative best bidirectional hit analyses, the majority (51%) of the predicted genes in the X. fastidiosa prophage-like regions are related to structural phage genes belonging to the Siphoviridae family. Electron micrograph reveals the existence of putative viral particles with similar morphology to lambda phages in the bacterial cell in planta. Moreover, analysis of microarray data indicates that 9a5c strain cultivated under stress conditions presents enhanced expression of phage anti-repressor genes, suggesting switches from lysogenic to lytic cycle of phages under stress-induced situations. Furthermore, virulence-associated proteins and toxins are found within these prophage-like elements, thus suggesting an important role in host adaptation. Finally, clustering analyses of phage integrase genes based on multiple alignment patterns reveal they group in five lineages, all possessing a tyrosine recombinase catalytic domain, and phylogenetically close to other integrases found in phages that are genetic mosaics and able to perform generalized and specialized transduction. Integration sites and tRNA association is also evidenced. In summary, we present comparative and experimental evidence supporting the association and contribution of phage activity on the differentiation of Xylella genomes. Xylella fastidiosa is a gram-negative gamma-proteobacterium known to cause several economically important diseases in cultivated crops and many other plant species. The strain 9a5c (Xf-CVC) was the first plant pathogen whose genome was completely sequenced Xylella strains reveal interesting biological and evolutionary aspects regarding genome structure and gene content. Previous studies demonstrated that 98% of the Xf-PD genes are shared with Xf-CVC, with an average amino acid identity (considering only the coding regions) of 95.7%, and the main differences are from bacteriophage-derived regions. These bacteriophage-derived regions are responsible for chromosomal rearrangements and deletions in X. fastidiosa strains, thus playing a decisive role on the genome evolution of this plant pathogen 7 particles/ml in coastal sea water and even higher in some other habitats, such as freshwater ponds Recently published work demonstrate that virus particles, including bacteriophages, appear to be strikingly abundant, with a typical estimated concentration of 10attP, and a short sequence of bacterial DNA, the bacterial attachment site attB. Phage integrases all fall into a category of enzymes known as site-specific recombinases attB sequences and are grouped into two major families, based on their mode of catalysis: the tyrosine and the serine recombinases To accomplish integration, temperate bacteriophages encode a phage integrase enzyme that mediates recombination between short sequences of phage DNA, the phage attachment site X. fastidiosa strains, Xf-CVC, Xf-PD, Xf-OLS, and Xf-ALS, were compared with regard to their prophage content and respective predicted integrase genes. A total of 56 predicted integrases were identified, and network analysis and phylogenetic reconstructions support the existence of five major lineages related to known bacteriophages that infect gamma and beta-proteobacteria. By Bidirectional Best Hit (BBH) analysis (against 402 bacteriophage genomes), the integrases were all found to be associated mainly to phages containing structural genes of Caudovirales viruses. In silico gene expression analysis of Xf-CVC prophage-like regions reveals these prophages are probably actively transcribed, and this finding is supported by the presence of putative phage-like particles in Xylella cells both in planta and in vitroX. fastidiosa strains.In this work, the genomes of four Identification and definition of prophage-like elements is not trivial task, but an empirical approach that needs a lot of insight X. fastidiosa genomes were scanned for the presence of predicted integrases associated to clusters of genes related to phages. Regions encompassing more than 10,000 bases and at least 80% of phage-related genes in their constitution were defined as prophage-like regions; the smaller ones were defined as prophage remnants. This strategy enabled the identification of 46 chromosome fragments in X. fastidiosa genomes predicted to be descended from ancestral invading bacteriophages composition, it is possible to infer the candidates to be a probable complete or a defective prophage, for each strain . The prodnaA gene), some of them positioned near the putative terminus of replication . This particular distribution is suggestive that these prophage elements may represent recent acquisition in the X. fastidiosa genome probably relating to the moment in the cell cycle that insertion occurs as previously demonstrated for other prokaryotic genomes (20).Most of the prophage-like regions (60%) are localized between the position 900 kb and 1,800 kb of the chromosome and the two candidate molecules (Xf-ALS and Xf-OLS), starting from the putative origin of replication, reveals at least 16 chromosomal regions in the four genomes that are translocated and/or inverted. The Xf-ALS strain presents 16 disruptions in its candidate molecule compared to the other three strains, followed by Xf-CVC strain with 14, and 13 chromosomal breaks in Xf-OLS and Xf-PD strains, suggesting that Xf-ALS strain is the most divergent in terms of genome structure and this divergence is directly associated to phage insertions. The association of phage related regions with breaks in chromosomal colinearity has been previously described when comparing Xf-CVC and Xf-PD genomes genomes . Taken tThis analysis enables us to trace a possible evolutive scenario for each group of prophages-like elements. This analysis enables to hypothesize the most ancient insertions relative to the most recent ones. Firstly we report the elements inserted in the same genome context in different strains, indicating preferred sites of insertion; that, the ones related to common ancestral events.There is only one prophage insertion shared by the four strains with mostly the same gene content and genome borders: xpd6, xop10, cvc-r4 and al-r2. These regions possess the same upstream genome border located near an epsP synthase, and the downstream border near a tonB-dependent receptor, except for the xop10 element, where the downstream gene is located close to a methyltransferase. The cvc-r4 and al-r2 remnant regions appear to be degenerate regions that originated from a xop10-like ancestor. Region xpd6 appears to be a degenerate form of xop10, mainly by the presence of a frameshift in the xpd6 integrase, suggesting that xop10 might be the closest to the common ancestor of this group. The xpd6 and xop10 regions share 76.1% nucleotide identity and carry 49% of putative non-essential phage ORFs, 45% of hypothetical ORFs and only 6% of essential phage ORFs. The gene content of these regions includes a copy of virulence-associated protein I and a hicA/hicB toxin-anti-toxin system. Neither of these regions contains structural phage genes. The xpd6, cvc-r4 and xap10 elements have a tRNA-GLY in their constitution, suggesting a mechanism of acquisition of this tRNA by transduction.Another site of insertion is shared by three different strains, and it involves the remnants pd-r1, ol-r1, and the xap2 element. They are inserted between a fumarate hydratase and glucose inhibited division protein, in the vicinity of a tRNA-CYS. These three regions are most probably defective prophage in the process of genome decay, and pd-r1 and ol-r1 appear to be degenerated versions of xap2.In these two cases, the analysis strongly suggests an evolutionary mechanism of negative pressure in order to delete or fully inactivate these regions of the chromosome, in accordance with to previous studies in others prophage regions Acyrthosiphon pisumSeven prophage-like elements, xfp1, xfp2, xpd1, xop3, xap1, xap5 and xap6 are involved in large genome rearrangements and share at least 80% of nucleotide identity. These appear to be complete phages. Gene order and orientation is highly conserved among all the seven elements, the integrases being followed by non-structural and structural genes with both classes separated by an endolysin gene. It is interesting to note that the DNA-packaging and head genes resemble in organization and sequence the lambda-like phages, and the baseplate, tail, and tail fibers genes resemble the P2-like phages. This architecture suggests a hybrid phage (as previously observed for xfp1 and xfp2 Listeria innocua (derived from the phage Sfi11), and the phage AaΦ23 from Actinobacillus actinomycetemcomitans, generally associated to human oral infections Another class of related prophage regions display 80% nucleotide identity but it is restricted to the structural genes The endolysin gene separates the non-structural genes from the structural ones, resembling in organization and sequence the prophage 4 that infect The fact that these elements are inserted at different genomic positions in the four strains, and that they share extensive sequence similarity suggest recent and independent acquisitions. This similarity also implies that these bacteriophages are frequent entities in the environment including the riparian vegetation, insect vector or any of the infected plants.Escherichia coli, Vibrio cholerae and Staphylococcus aureus by Boyd et al The hybrid origin of the prophage regions is probably the result of illegitimate recombination in the process of the horizontal genetic exchange, as observed in Mycobacteriophages by Pedulla et al From a total of 1,728 prophage-like genes in the four strains, 1,388 (80.5%) belong to 290 different best bidirectional hit (BBH) clusters, while 339 (19.5%) are not present in any BBH cluster. The latter group represents strain-specific prophage-like genes. In this specific group, 66 (19.5%) are ORFs with putative functions related to essential phage genes, and 28 (8.25%) to non-essential phages genes , while the remaining 245 ORFs (72.25%) are hypothetical or conserved hypothetical genes, representing an abundant number of ORFs that can be related to genomic differentiation.X. fastidiosa share 55% identity with orthologs found in the filamentous phage phiLf of Xanthomonas campestris pv. vesicatoria and phage phiSMA9 of Stenotrophomonas maltophilia, and with less than 30% identity to orthologs of X. campestris pv. campestris and RSM1 phage of Ralstonia solanacearum and R. pickettii genome. These organisms are necrogenic plant pathogens, except Stenotrophomonas, a human pathogen also able to colonize diverse plants, especially those in the Brassicaceae family Stenotrophomonas strains only recently after infection by a filamentous phage, which probably came after certain changes in its adsorption protein from plant-pathogens The most interesting cases of prophage-like ORFs in BBH clusters, and potentially related to bacterial pathogenicity, are the putative phage-related PI protein (Zonular occludens toxin- like protein) present in xop7, xap10 and xpd5 ; and the virulence-associated protein E, present in xfp5, xfp6, xpd8, xop6, xap8. The products of these ORFs may be related to interactions between the plant and the bacteria. Phage PI protein (zot) is required for phage assembly A group of toxin and anti-toxin proteins in prophage-like regions (higA/higB and relE/relB) was also found. These proteins are very common in plasmids, where they increase effective stability Xylella strain.Furthermore, the group of specific ORFs (belonging to no BBH cluster) related to non-essential phage functions have some interesting components: (a) virulence-associated protein in xfp3 (VapB-like), exclusive for the Xf-CVC strain; (b) modification methylase NspV and restriction NspV enzymes in xpd8; (c) the restriction enzyme NgoMIV and modification methylase NgoMIV in xap4; and (d) virulence-associated protein I in xop10, . All these ORFs may be involved in interactions between plant and bacteria (a and d), or between bacterial and phage genomes (b and c). On the other hand, these ORFs do not have BBH pairs against the 402 phage genomes, suggesting they are not necessary for phage biology, but with exclusive roles in each Xylella strains from symptomatic and asymptomatic plants isolated in South American (using as reference the 9a5c strain genome) . High coXylella strains.Region xfp4 is present in low copy number in both symptomatic and non-symptomatic strains and in equal copy numbers in the other strains. The principal feature of this region is the presence of three systems of toxin and anti-toxin genes. Despite the xfp4 appearing to be a defective prophage, this element apparently is not active at least in strains 56a, 9.12c and CV21. This supports the idea that this element is stable, under lysogenic state, being subject of genome decay or stabilization in the host by a selective negative pressure. These findings indicate that: (1) enrichment in the number of copies of ORFs in prophage-like regions compared to the core genome ORFs in different strains, (2) the different prophage-like regions have diverse hybridization profiles, and (3) a lytic cycle activity with the formation of new phage particles. Thus, element xfp4 may play an important, but different, role in different Previous microarray analyses of Xf-CVC strain 9a5c described the expression profile under stress conditions, particularly under heat shock conditions more frequently than those that are down-regulated (34%). Anti-repressor genes are over-expressed (5 out of 6 genes), followed by genes involved in phage replication and structural genes, as well some integrases , while repressor genes are under-expressed. This suggests that under stress conditions the prophage-like regions are activated and may trigger induction of the lytic cycle, which ultimately results in the formation of virus-like particles (VLPs). Both switches from 25°C to 40°C and from 29°C to 40°C result in clear induction of gene expression of prophage genes which could be indicative that changes in the temperature in the orchard along the growing season of the plants could result in bursts of phage induction within the plant.Along the line, but in a distinct relation, the combined analysis of the DNA-DNA hybridization array It is also worth noting that genes not directly related to the phage structure, as anti-toxin and virulence-associated genes, are also induced under these conditions. For example, over-expression of the virulence protein present inside the xfp3 element, a protein that occurs exclusively in this element and strain, indicates a role in heat-shock conditions. Accordingly, the high number of hypothetical phage-related genes that are also differentially expressed suggests some important, yet unknown, roles for this class of genes.An extensive analysis of the 250-bp upstream and downstream regions of each prophage-like ORF reveals that the prophages and remnant regions have an increased number of single nucleotide polymorphism and insertions and deletions, as well a reduced percentage of overall nucleotide identity when compared to the core genome . The nucXanthomonas genus have at least 35 types of tailed phages, where 25 (72%), 9 (25%) and 1 (3%) and are from Siphoviridae, Myoviridae and Podoviridae families respectively.All prophage-like ORFs with putative functions related to structural phage genes are grouped in BBH clusters. The phage family represented the most in these BBH pair groups of BBH is the Siphoviridae family (51%), followed for Myoviridae (32%) and Podoviridae (10%) families (7% of the BBH pairs are from unclassified Caudoviridae phages). The most important and studied phage within the Siphoviridae family is phage lambda, widely found in the chromosome of enterobacteria, where it plays diverse biological roles, most of them related to acquisition of virulence genes by the bacteria through LGT in planta were observed by transmission electron microscopy full-length gene; (2) ORF with a frameshift (FS) or a stop codon in the frame (SCF); or (3) small fragments (less than 150 residues). There are 33 full-length integrases: ten in the Xf-ALS, nine in the Xf-OLS, and seven each in the Xf-CVC and Xf-PD strains. Most of these are associated with the largest prophage-like regions and the genomic islands (giCVC and giPD). There are ten integrases with FS/SCF three each in the Xf- PD and Xf-OLS, and two each in the Xf-CVC and Xf-ALS strains, all associated to prophage-like regions with length less than 20 kb. Finally, there are 13 integrase fragments, with five each in the Xf-CVC and Xf-ALS, two in the Xf-PD, and one in the Xf-OLS strains, most of them associated with phage remnants.Integrases are useful markers for identifying prophages and potential indicatives of LGT events in bacterial genomes se genes . The intThere are three main relationships between the integrases and these prophage elements: (1) all the complete and the largest prophage elements carry full-length integrases, (2) truncated integrases (with SCF/FS) are present in probable defective and smaller prophages and (3) fragments of integrases are found mainly in phage-remnants, while non-remnant regions always bear another full-length integrase when a fragment is present. These results suggest the existence of a selective negative pressure associated with the integrase inactivation with further genome decay of the most ancient prophage elements.From the alignment with model tyrosine-recombinases, the conserved active residues R [212], K [225], H [308], R [311], H [333] and Y [342] by pairwise sequence diversity, and are presented in a spring-embedded layout . This neXylella phage integrases share at least 60% of identity, xop5 shares a maximum of 45% of identity with the other ones. The main feature of xop5 prophage is the presence of a Tfp pilus assembly protein in the region related to putative structural phages genes. However, this element does not have any well-characterized structural phage gene. This suggests an ancient and defective prophage element, but exclusively in the Ann1 strain genome.To further evaluate such diversity, the integrase sequences were aligned against 186 integrases present inside phage particles and agaiPseudomonas, Actinobacillus and Nitrosomonas (Burkholderia ssp. (a beta-proteobacterium) and Archaea species (Methanobacterium and Methanothermobacter).Integrase group A comprises the largest number of integrases, all of them related to probable complete prophages. This integrase group is related to prophages from few beta- and gamma-proteobacteria species, such as osomonas , revealiosomonas , being rEscherichia, Yersinia, Marinomonas and several Xanthomonas species). This is probably a restricted group of integrases, emerging late in the evolutionary scale , all from Siphoviridae viruses.Group D comprises eight integrases (including one from a remnant phage region), and it is related phylogenetically to a broader class of prophages infecting Gram-positive and Proteobacteria species . InteresXylella integrases over a broad range of tree branches. Four integrases branched together, along with integrases of prophages infecting several species of beta- and gamma-proteobacteria are related to a large group of integrases from prophages of several beta- and gamma-proteobacteria, including several species . Moreove species . It was Xylella integrases are able to do generalized and specialized transduction, suggesting an import role in the genomic evolution of their hosts. Collectively, these results suggest a broad evolutionary history for each group of integrases identified in the Xylella genomes. They are related to several groups of prophages, infecting different groups of bacteria, including the closely related groups of beta- and gamma-proteobacteria, as well distantly related groups, such as Firmicutes and Actinobacteria. There is a large diversity of putative X. fastidiosa prophages related to Siphoviridae, Podoviridae or Myoviridae viruses. Moreover, the fact that X. fastidiosa prophage-like elements are related to several groups of phages, may be potentially misleading and be due to wrong models of viral taxonomical classification (currently based on features encoded by a minority of their genes), as long debated in the literature. For example, Lawrence and colleagues Most of the phages associated with Xylella 72% of these sites are associated with tRNAs associated with prophage elements. These fragments are probably relics of an insertion with disruption of the ancestral tRNA without the reconstitution. With respect to tRNA-Gly, present inside prophage elements cvc-r4, xpd6, xop10 and xap3 and not directly involved as site of insertion, it may be a product of phage-mediated LGT to bacteria. This is supported by comparative analysis showing that at least 81 (19%) of a total of 430 phage genomes analyzed bear a tRNA in their genomes and have no direct viral function . They arXylella.It is interesting to note that the largest (in length) prophage-like regions, and probable complete and active prophages, are associated with tRNAs with higher numbers of copies in the chromosome . This indicates that they are preferred sites of insertion and markers for genome rearrangement of recent phage acquisitions. On another hand, none of the inherently unsuitable tRNAs described previously X. fastidiosa genome organization and differentiation. The data presented in this work clearly demonstrate the role of the phages in the diversification and speciation of X. fastidiosa, both in a short time-scale promoting local and global rearrangements and activation/inactivation of host genes, and in a large evolutionary time-scale promoting speciation within the group by the acquisition of novel “cargo” components. This is highlighted by the diverse and common insertions for the diverse prophages elements, indicating a differential impact of common and diverse prophages in the Xylella genomes. Accordingly, it is still unknown if these prophages are functional or if they represent ancient insertions and are stalled in the bacterial chromosomes. Moreover, there is also evidence supporting that the phage activity perhaps is still in process: (1) higher levels of expression of phage-related genes, including those related to induction of the lytic cycle under stress conditions; and (2) direct observation of putative phage-like particles associated with Xylella cells in vitroin planta by transmission electron microscopy.This is the first extensive study showing that the prophage-like elements have a role or function in the process of X. fastidiosa genomes, the prophages are also capable of carrying some “cargo” genes with function not directly related to the phage propagation. In fact, the no assignment of a known phage function may be solely due to our current lack of knowledge concerning these genes. This is supported by the fact that most of these genes are strain specific, and thus they may be associated to specialization of the phage to the host, suggesting an important role in the generation of new variants of bacterial strains.Besides being responsible for abrupt large-scale alterations in the structure and organization of Xylella integrases are mostly related to lambda-like phage integrases. These phages are widely known as genetic mosaics, and some are able to perform generalized transduction that may confer drastic changes in their hosts. These findings suggest a combined model of evolution to Xylella integrases and their elements, in which site specific and illegitimate recombination take place, and the mosaic architecture of the prophage elements represent a creative process in order to generate genetic variation, driving forces to the evolution of this genera.On the other hand, Xylella strains genomes. Also, the data support that phage regions are transcriptionally active and may be producing virus-like particles; however, the association between expression and disease development remains to be demonstrated. Also, whether the enrichment of phage related ORFs is associated with gene duplication or virus-like particle formation is unknown. These observations open avenues to functional studies that may result in alternative strategies of disease control.Taken together, these results helped to determine the role and diversity of each prophage-like region, disclosing the mechanism and integration sites of the integrases associated to these regions and their influence in the differentiation of Potential ORFs with gene products assigned as integrases were identified by keyword and protein domain searches with BLAST program −5.Two-dimensional distance-constrained, spring-embedded and cluster-based phage-integrase network layouts were constructed with InterView program All previously described prophages in the Xf-CVC and Xf-PD genomes Functional annotation of ORFs within potential phage regions was carried out by using the SABIA package X. fastidiosa prophage-like elements and 402 phage genomes deposited in GenBank (http://www.ncbi.nlm.nih.gov/genomes/static/phg.html)). All the comparative analyses were based on the Bidirectional Best Hit (BBH) methodology −5. Comparisons between the prophage-like full-length elements were carried out with the M-GCAT program http://www.perl.com), by the methodology proposed by Souza R.C. (unpublished data).SABIA Comparative software http://www.php.net) were written in order to generate the prophage gene maps . Further information and all supplementary material are available on the project website: http://gracilaria.ib.usp.br/integraseDB.Scripts in PERL and PHP (http://www.ncbi.nlm.nih.gov/geo) site http://www.r-project.org]). Differentially expressed transcripts or differentially gene contents were identified by using the Significance Analysis of Microarray (SAM) method http://blasto.iq.usp.br/~tkoide/Xylella/Heat_shock).Meta-analyses of independent microarray datasets were performed in order to study the gene expression pattern of prophage-like elements in CVC strain in different heat shock conditions. Microarray data were extracted from series GSE3044, GSE4161, GSE4960, GSE6619 and GSE8493 Figure S1Xylella phage integrases primary sequence (groups A to E). Alignment done with CLUSTALX 2.0 program and manually adjusted. Red boxes, the conserved catalytic residues. Only part of each alignment, containing the conserved residues, is shown.Multiple alignment of (0.15 MB DOC)Click here for additional data file.Figure S2Distribution of tRNAs in 81 phage genomes (out of 430 available in the NCBI database) (detection by tRNAscan-SE). Frequency is given in relation to the number total of tRNAs identified in all genomes.(0.03 MB DOC)Click here for additional data file.

Non-excitable muscle membrane indicates critical illness myopathy (CIM) during early critical illness. We investigated predisposing risk factors for non-excitable muscle membrane at onset of critical illness.We performed sequential measurements of muscle membrane excitability after direct muscle stimulation (dmCMAP) in 40 intensive care unit (ICU) patients selected upon a simplified acute physiology (SAPS-II) score ≥ 20 on 3 successive days within 1 week after ICU admission. We then investigated predisposing risk factors, including the insulin-like growth factor (IGF)-system, inflammatory, metabolic and hemodynamic parameters, as well as suspected medical treatment prior to first occurrence of abnormal dmCMAP. Nonparametric analysis of two-factorial longitudinal data and multivariate analysis were used for statistical analysis.P = 0.002).22 patients showed abnormal muscle membrane excitability during direct muscle stimulation within 7 (5 to 9.25) days after ICU admission. Significant risk factors for the development of impaired muscle membrane excitability in univariate analysis included inflammation, disease severity, catecholamine and sedation requirements, as well as IGF binding protein-1 (IGFBP-I), but did not include either adjunctive hydrocortisone treatment in septic shock, nor administration of neuromuscular blocking agents or aminoglycosides. In multivariate Cox regression analysis, interleukin-6 remained the significant risk factor for the development of impaired muscle membrane excitability , Systemic inflammation during early critical illness was found to be the main risk factor for development of CIM during early critical illness. Inflammation-induced impairment of growth-factor mediated insulin sensitivity may be involved in the development of CIM. ICU-acquired muscle weakness is a serious complication of critical illness. It has been recognized as the clinical manifestation of an ICU-acquired peripheral neuromuscular pathology that, wiDiagnosis of critical illness myopathy (CIM) is either based on clinical proof of muscle weakness after awakening from analgesia and sedation, measurement of short duration low amplitude muscle unit potentials, depending on voluntary muscle contraction, or histological confirmation of muscle pathology . As muscRecent studies described measurements of muscle membrane excitability after direct muscle stimulation as a valid electrophysiological marker indicating CIM in critically ill patients -5. As thMeasurement of muscle membrane excitability during early critical illness offers a unique opportunity to better understand and investigate early markers and potential risk factors for non-excitable muscle membrane.The objective of this study is to investigate predisposing risk factors for the development of non-excitable muscle membrane during early critical illness, particularly considering concentration patterns of the insulin-like growth factor (IGF)-system prior to first proof of pathologically reduced muscle membrane excitability.This study presents a subanalysis of 40 patients of a recent prospective observational study that invDetails of electrophysiological measurements are reported elsewhere , in briePatients were treated following standard operating procedures of intensive care incorporating severe sepsis bundles . SystemiInflammatory cytokines (IL-6 and IL-10), IGF-I and its binding proteins were analysed from blood samples, drawn between days 3 and 7 as well as between days 8 and 10 after ICU admission.Hemodynamic parameters and blood glucose levels were recorded four times daily considering least favorable values within six-hour intervals. Illness severity, SAPS-II , sepsis-Results are expressed as median and 25th/75th percentiles for continuous variables and proportions for qualitative parameters, respectively. We used nonparametric tests for statistical testing.Changes in interesting clinical outcomes with respect to time were analyzed using nonparametric analysis of longitudinal data in a two-factorial design normal versus dmCMAP abnormal patients, 2nd factor: repetitions in time), focusing on values during the first eight days after ICU admission or within a first interval between days 3 and 7, and a second interval between days 8 and 10 after ICU admission. Therefore, we compared all time points simultaneously on the corresponding response curves .P values were calculated for each risk factor. P values less than 0.05 (two-sided) were considered as statistically significant.In univariate and subsequently in multivariate Cox' proportional hazard regressions (stepwise backward procedure), we tested risk factors impairing muscle membrane excitability (as a dependent variable). For all parameters we included values from days of first IL-6 measurements in the analysis. Hazard ratios (HR) with their 95% confidence intervals (CI) and the corresponding We evaluated the diagnostic test performance of IL-6 and SOFA to indicate the development of myopathy by receiver operating characteristics (ROC) analysis using abnormal dmCMAP amplitude less than 3 mV as electrophysiological parameter for diagnosis of myopathy and IL-6 as well as SOFA as test variables. We combined the diagnostic tests regarding sensitivity and specificity of SOFA and IL-6 to indicate myopathy with the help of the known 'believe-the-positive' rule.All tests should be understood as constituting exploratory data analysis, such that no adjustments for multiple testing have been made. We used SPSS, Version 14 , and SAS, Version 9.1 .P < 0.0001). ICU length of stay was significantly prolonged in dmCMAP abnormal patients (26 (18 to 38) days) compared with dmCMAP normal patients (13 (8 to 18) days; P < 0.0001). Patients' characteristics upon admission and within the first eight days after ICU admission are shown in Table Forty patients at the onset of critical illness were enrolled in the study. Twenty-two patients developed abnormal muscle membrane excitability in terms of reduced compound muscle action potential after direct muscle stimulation within 7 5 to 9.25) days after admission to ICU as reported earlier [ to 9.25 Risk factors of critical illness myopathy in dmCMAP normal and dmCMAP abnormal patients within the first week after ICU admission.Within the first eight days after ICU admission, patients with abnormal dmCMAP had significantly more days with systemic inflammatory response syndrome, severe sepsis, and dysfunction of two or more organs compared with patients with normal dmCMAP Table .Moreover, patients with abnormal dmCMAP received significantly higher doses of norepinephrine within the first week after ICU admission Figure . HemodynDmCMAP abnormal patients received significantly higher doses of analgesics and sedation and more neuromuscular blocking agents; however, the cumulative dosage of neuromuscular blocking agents was low within both groups Table .IL-6 plasma levels were significantly higher within the first week (day 5 3 to 7)) in patients with abnormal dmCMAP. In the second week (day 8 (6 to 10.25)), IL-6 decreased in both groups but remained significantly higher in dmCMAP abnormal patients. There was no difference between the two groups regarding IL-10 plasma levels inDaily blood glucose levels Figure , total cIGF-I was reduced in dmCMAP abnormal patients at both test intervals (87.2 ng/ml (65.9 to 119.5) versus 104.5 ng/ml (74.4 to 136.9) and 76.1 ng/ml (55.1 to 119.5) versus 87.2 ng/ml (65.8 to 122)), but differences did not reach statistical significance. Plasma levels of IGFBP-III were not different between both groups whereas IGFBP-I as a marker reflecting impaired insulin sensitivity was significantly higher in dmCMAP abnormal patients at both test intervals Cox regression analyses for risk factors impairing muscle membrane excitability are shown in Table In univariate analysis severity of illness, sepsis-related organ dysfunction, inflammation, catecholamine requirements, sedation requirements and an impaired insulin sensitivity turned out as significant risk factors for the development of impaired muscle membrane excitability within the early course of critical illness. An increased osmolarity, adjunctive hydrocortisone treatment in septic shock, administration of neuromuscular blocking agents and aminoglycosides were not significantly correlated with the development of impaired muscle membrane excitability.In the backward selection of multivariate Cox regression analysis Figure the exteSensitivity and specificity of SOFA score to predict abnormal membrane excitability was highest on day 4 at a cut-off value of 10 (sensitivity = 65% and specificity = 93.8%). The cut-off value for IL-6 predicting abnormal membrane excitability was observed at 230 pg/ml, featuring sensitivity of 71.4% and specificity of 93.3%. According to the 'believe the positive' rule applied in a combined cross tabulation of patients with SOFA scores of 10 or more at day 4 after ICU admission and/or IL-6 plasma levels of 230 pg/ml or more, we observed a sensitivity of 85.7% and a specificity of 86.7% of this combination for predicting development of abnormal dmCMAP.In this observational study we investigated predisposing risk factors leading to non-excitable muscle membrane indicating CIM during early critical illness. The main finding was a significant relation between muscle membrane inexcitability, disease severity and IL-6 plasma levels.In the absence of a reliable clinical parameter identifying patients at risk of developing CIM during early critical illness, when motor function is not assessable due to analgesia and sedation, current data on risk factors leading to CIM are derived mostly from prospective cohort studies relating data from ICU admission with patients' motor function once assessable . One excUnivariate analysis indicated illness severity, IL-6, hemodynamic impairment, decreased insulin sensitivity as well as analgesia and sedation as predisposing risk factors. However, only IL-6 and dosage of analgesia emerged as independent risk factors from multivariate analysis. Interestingly, we did not observe any significant relation between development of non-excitable muscle membrane and application of low-dose hydrocortisone, aminoglycosides or neuromuscular blocking agents, which have frequently been incriminated as being involved in the development of CIM.Large prospective randomized studies have shown that glycemic control is associated with the development of neuromuscular dysfunction ,12. In oIn parallel, dmCMAP abnormal patients revealed a significant hyperosmotic state within the first days of critical illness. Hyperosmolality is related to illness severity and has However, alteration of insulin sensitivity and plasma osmolality are most likely related to systemic inflammation in our study. Our data are in agreement with the general perception that systemic inflammation and sepsis-related organ dysfunction are major triggers for the development of CIM ,8,9,26. In vitro [in vivo [IL-6 seems to be an important mediator leading to muscle protein breakdown . One mecIn vitro and late[in vivo , it has Corticosteroids are controversially discussed as aggravating factors of CIM ,7,9,34. Nevertheless, these reports refer to steroid myopathy as a result of high-dose steroid application. A link between 'low-dose hydrocortisone' treatment as adjunctive therapy during septic shock and development of CIM has been postulated , but nevFurthermore, dosage of analgesics and sedatives was significantly associated with the development of non-excitable muscle membrane. Interpreting higher doses of analgesics and sedatives as higher degrees of immobilization, this finding is in line with recent studies describing that immobilization aggravated neuromuscular weakness in an experimental setting and thatFor clinicians it is difficult to estimate patients at risk for the development of CIM. The APACHE-III score has been cited as being able to identify patients at risk for critical illness neuromyopathy . In our The following limitations of this study need to be addressed. Although we observed a statistically significant effect for IL-6 as a main risk factor for non-excitable muscle membrane, it has to be stressed that the overall effect was small, which may be due to small sample size. It also needs to be mentioned that blood samples were collected at two different time points only and that the course of inflammatory parameters was not followed daily. However, this was designed as a pilot study for hypothesis generation. The clinical significance has to be addressed in further studies.Systemic inflammation during early critical illness turned out to be the main risk factor for the development of non-excitable muscle membrane indicating CIM. It may be hypothesized that inflammation-induced impairment of growth factor-mediated intracellular signaling is involved in the pathophysiology of CIM. Furthermore, adjunctive treatment with low-dose hydrocortisone during septic shock was not associated with development of CIM.• Non-excitable muscle membrane indicates CIM during early critical illness.• Inflammation, disease severity, decreased insulin sensitivity, catecholamine and sedation requirement turned out to be significantly related to the development of impaired muscle membrane excitability.• IL-6 and dosage of analgesia emerged as independent risk factors from multivariate analysis.• Inflammation-induced impairment of growth-factor-mediated insulin sensitivity may be involved in the development of CIM.• In contrast to prior assumptions we could not observe any significant relation between development of CIM and application of low-dose hydrocortisone in septic shock.APACHE: acute physiology and chronic health evaluation; CI: confidence interval; CIM: critical illness myopathy; dmCMAP: compound muscle action potential after direct muscle stimulation; HR: hazard ratio; IGF: insulin-like growth factor; IGFBP: insulin-like growth factor binding protein; IL: interleukin; MRC: Medical Research Council; ROC: receiver operating characteristic; SAPS: simplified acute physiology score; SOFA: sepsis-related organ failure assessment.The authors declare that they have no competing interests.SW-C conceived of the study, performed data and statistical analysis, wrote the final manuscript and is head of the project, which is funded by the Deutsche Forschungsgemeinschaft. MD and DK participated in the design of the study, in data analysis and in writing the final manuscript. SK performed the electrophysiological measurements and analysis. JS and DK performed laboratory data measurements and analysis. FB programmed the data base and participated in data collection and analysis. KW prepared the statistical part of the manuscript and performed the statistical analysis. CS critically revised the manuscript and gave final approval. SS critically revised the electrophysiological data analysis and participated in writing the paper. All authors read and approved the final manuscript.Further description of methods and definitions. The additional file contains additional information on exclusion criteria, electrophysiologic measurements, general ICU care, and laboratory testing [ testing . Two tabClick here for file

Sudden limb paresis is a common problem in White Leghorn flocks, affecting about 1% of the chicken population before achievement of sexual maturity. Previously, a similar clinical syndrome has been reported as being caused by inflammatory demyelination of peripheral nerve fibres. Here, we investigated in detail the immunopathology of this paretic syndrome and its possible resemblance to human neuropathies.Neurologically affected chickens and control animals from one single flock underwent clinical and neuropathological examination. Peripheral nervous system (PNS) alterations were characterised using standard morphological techniques, including nerve fibre teasing and transmission electron microscopy. Infiltrating cells were phenotyped immunohistologically and quantified by flow cytometry. The cytokine expression pattern was assessed by quantitative real-time PCR (qRT-PCR). These investigations were accomplished by MHC genotyping and a PCR screen for Marek's disease virus (MDV).Spontaneous paresis of White Leghorns is caused by cell-mediated, inflammatory demyelination affecting multiple cranial and spinal nerves and nerve roots with a proximodistal tapering. Clinical manifestation coincides with the employment of humoral immune mechanisms, enrolling plasma cell recruitment, deposition of myelin-bound IgG and antibody-dependent macrophageal myelin-stripping. Disease development was significantly linked to a 539 bp microsatellite in MHC locus LEI0258. An aetiological role for MDV was excluded.The paretic phase of avian inflammatory demyelinating polyradiculoneuritis immunobiologically resembles the late-acute disease stages of human acute inflammatory demyelinating polyneuropathy, and is characterised by a Th1-to-Th2 shift. With an incidence of about 1.5 per 100.000 citizen, Guillain-Barré syndrome (GBS) is the most common cause of acute flaccid paralysis in the western hemisphere and probably worldwide . ChronicBoth GBS and CIDP are immune-mediated disorders involving humoral and cellular effector mechanisms . TherebyTo date, most insights into the immunobiology of inflammatory demyelinating neuropathies (IDP) have been gained from experimental animal studies. The most frequently employed model for GBS is experimental autoimmune neuritis (EAN) generated in Lewis rats. These animals are immunized with peripheral myelin or with the purified myelin proteins P0, P2 and/or PMP22. Alternatively, EAN can be induced by adoptive transfer of activated P2-specific neuritogenic T-lymphocytes . VariousHence, a spontaneous animal model would be useful to gain deeper insights into the complex immunological aspects of disease development, if it were to prove reproducible and broadly available for translational research.To date, spontaneous forms of CIDP have been described in dogs and cats , but theBeing alerted by own observations and previous reports on a sporadic paretic syndrome in up to 4% of young White Leghorn layer chickens , we addrWe demonstrate here that the avian neuropathic disease bears striking similarities to late stage of human AIDP. Even though the primary immunologic trigger has not been identified, we identified an MHC-linked genetic factor, rendering the animals susceptible to this avian inflammatory demyelinating polyradiculoneuropathy (AvIDP).The present investigation enrolled 40 female White Leghorn chickens that originated from a commercial hybrid flock comprising 5000 individuals. The chickens were sorted into AvIDP-affected and disease-free individuals, following neurological examination . All aniThe cranial vaults and cranial nerve emergences were carefully dissected and the brain and cranial nerve roots were inspected in situ. Thereafter, the trigeminal and oculomotor nerve roots were harvested for further processing.The brains were gently removed and immersed in 10% neutral-buffered formalin for 48 hours. Fixed samples were trimmed in transverse sections at the following landmarks: (1) the caudal border of the olfactory bulbs, (2) the optic chiasm, (3) the emergence of the oculomotor nerve from the midbrain, (4) the cerebellar peduncles, and (5) the obex.The entire spinal cord was approached through laminectomy. The spinal nerve roots and associated dorsal root ganglia (DRG) were freed from overlying soft tissue and inspected in situ. Samples of the spinal cord, nerve roots and DRG of three consecutive segments of the widest part of the cervical and lumbosacral intumescence were taken for further investigations.Morphological examination of the above mentioned cranial and spinal nerves, the brachial plexus, sciatic nerve and abdominal branch of vagus nerve included paraffin and semithin histology, teased fibre evaluation and transmission electron microscopy (TEM).®, Tyco Healthcare Group LP, Mannsfield, U.S.A.), sectioning at 5 μm (PNS) and 8 μm (CNS), mounting on triethoxysilane-coated slides and staining with haematoxylin & eosin (HE).For routine histology, brain, spinal cord, DRG and peripheral nerves underwent fixation in 10% neutral-buffered formalin, processing in an automatic tissue processor, embedding in paraffin , trigeminal nerve (CNVm/o), brachial plexus, sciatic and vagus nerve were cut into 1- to 2-cm segments and immersed in 2.5% glutaraldehyde in 0.1 M Soerensen's phosphate buffer (ph 7.4) for 1 hour. After fixation, the samples were rinsed with Soerensen's phosphate buffer containing 0.2 M buffered D(+)-saccharose. The spinal nerves were cut into 10-mm pieces for nerve fibre teasing and blocks of 2 mm length were harvested from all nerve and DRG probes for epoxy embedding.Teasing samples were postfixed in 2% osmium tetroxide for 1 hour and, after repeated buffer rinses, placed into 100% water-free glycerol for 24 hours. After that, a total number of 50 single-nerve fibres and/or small fibre clusters were teased apart under a stereo magnifying glass .Evidence of increased endoneurial round cells and Schwann cell hyperplasia was further verified by toluidine blue staining and subsequent teasing in aqueous medium.®, Heidelberg, Germany). Semithin sections (0.5 μm) were mounted on microscope slides and stained with azur II methylenblue and safranin O.The 2-mm pieces were postfixed in 1% osmium tetroxide for 2 hours and underwent repeated buffer rinses and a graded alcohol series before being embedded in epoxy resin and contrasted with lead-citrate and uranyl-acetate.Moreover, ultrathin sections (80 nm) were mounted on copper rings covered by Formvar® by two separate investigators blinded for the origin of these samples. HE-stained paraffin sections were inspected for interstitial and vascular changes as well as for abnormalities affecting myelinated fibres and fibre groups. The histological assessment was accomplished using semithin sections that allowed a deeper insight into single fibre pathology through better preservation of the myelin substance, and served as scout samples for subsequent electron microscopy. Evaluation criteria were in accordance to established protocols for peripheral nerve examination or mouse anti-IgG1 [1:300]) for 2 h at room temperature. Thereafter, R-phycoerythrin (RPE)-conjugated goat anti-mouse antiserum and, at last, DAPI (1:50) were applied to the sample for 30 min.® 510 (see above) at wavelength settings of 495 nm (track 1/RPE) and 365 nm (track 2/DAPI).Examination took place using the scanning microscope Zeiss LSM® was used according to the manufacturer's protocol. The quantity of extracted RNA was determined by photometry, while the RNA quality was analysed using a 2100 Bioanalyzer® . Only RNA samples with an RNA integrity number (RIN) exceeding 7.0 were used for qRT-PCR analysis.Pieces of spinal nerve roots, including DRG, were extracted, immediately snap frozen in liquid nitrogen, and stored at -80°C until further processing. For RNA isolation, TRIzol™ Reagent® according to the manufacturer's instructions. The reverse transcription reaction was carried out for 30 min at 42°C and terminated by incubating the samples for 3 min at 95°C.Genomic DNA elimination and reverse transcription were performed using a QuantiTect Reverse Transcription Kit® and were obtained from MWG-Biotech® .Primers for qRT-PCR Table were des® with SYBR-Green as a double-stranded DNA-specific fluorescent dye. Amplification mixes contained 1 μL cDNA, 12.5 μL QuantiTect SYBR Green PCR Kit® , 1.5 μL forward and reverse primer , and 8.5 μL water. The detector system was programmed to start with an activation step for 15 min at 95°C followed by PCR program with 40 cycles of DNA denaturation (15 sec at 94°C), primer annealing (30 sec at 59°C), and elongation (30 sec at 72°C). Each qRT-PCR was run in triplicate. Specificity of the resulting qRT-PCR products was verified by melting curve analysis.Quantitative RT-PCR was performed using a 7300 Real-Time PCR SystemTo normalize the data, the cycle threshold (CT) values of the housekeeping gene 18S rRNA were subtracted from the target gene CT value of the sample (= dCT).For MHC genotyping, commercial White Leghorn layer hybrids were used, all originating from the same variety of commercial hybrids. The first set of samples was collected from clinically affected chickens at an age of six weeks. Furthermore, a sampling from healthy animals was performed. In total, samples from 152 healthy and 113 affected chickens were collected.The microsatellite marker LEI0258 is known to be located within the MHC, between the BG and BF regions, and an association between LEI0258 alleles and serologically defined MHC haplotype has been reported . The aim® filter cards , and dried and stored in an aluminium foil envelope at room temperature until analysis. DNA isolation was carried out using the phenol-chloroform method ; Genotype [261/539]; Genotype [357/539]; Genotype [261/357]. The frequency of these different genotypes in association with healthy and clinically diseased animals is presented in Table [261/539] and [261/357] occurred in significantly higher numbers of observation than genotypes [261/261] and [357/539] . There was a marked difference between the genotypes in the occurrence of AvIDP symptoms. While the percentage of sick animals was 16.7% and 9.4% in genotypes [261/261] and [261/357], this proportion was significantly higher in genotypes [261/539] and [357/539], with frequencies of 64.7% and 41.7%, respectively.The three alleles at locus LEI0258 found in the chicken flock under study corresponded to allele sizes of 261 bp, 357 bp, and 539 bp, respectively Figure . AccordiResults of a likelihood ratio test revealed a highly significant effect (p < 0.001) of explanatory variables. The factor 'Genotype' is the only one that can be significantly substantiated (p < 0.0001).[261/539] genotype had a 9.15-fold higher risk of AvIDP compared to genotype [261/261] (CI 2.50-33.04). Compared to genotype [261/357], the risk of showing AvIDP symptoms was even higher for genotype [261/539] . Furthermore, the likelihood of genotype [357/539] to be affected by AvIDP was higher than those of genotype [261/357] by a factor of 6.8. There were neither significant difference between animals of the genotype [357/539] and [261/539], nor between animals of the genotypes [261/357] and [261/261] and amplification of detectable PCR-products.During the last decade, an acute paretic syndrome of unclear origin was increasingly reported from flocks of White Leghorn chickens worldwide . In an eAll birds of our collective that presented with limb paresis showed severe demyelination of peripheral nerves, with a predilection for craniospinal nerve roots and associated ganglia. This demyelination was associated with multifocal endoneurial infiltration by lymphocytes, plasma cells and macrophages. TEM provided evidence of macrophages invading myelin spirals at the outer mesaxon, between the paranodal loops and Schmidt-Lanterman incisures, leading to stripping off of myelin lamellae from morphologically intact axons. This picture closely resembles human AIDP, which leads us to denote this disease as avian inflammatory demyelinating polyradiculoneuritis (AvIDP) ,47.Several pathways have been proposed by which the attention of macrophages is directed towards the myelin sheath. Firstly, autoreactive T-helper cells may secret chemokines attracting macrophages to the endoneurium and, subsequently, activate them via macrophage-activating factors. Activated macrophages also are capable of recognising the Fc-region of auto-antibodies that opsonise myelin epitopes and/or activate the complement system . In AvIDOn the other hand, one may ask if the high density of endoneurial plasma cells and deposition of myelin-bound IgG lend credence to a simultaneous recruitment of humoral effector mechanisms . IL-10 eThe increase in mRNA expression of IL-10 is suggestive of down-regulation of the immune response ,58,59 anFurthermore, there was no elevation of IL-1 and IL-6, which contrasts with common observations of an acute inflammatory reaction ,61. EvenIn accord with recent data on AIDP and on rodent GBS models , it may Concerning the natural history of the disease, however, we have launched preliminary longitudinal trials in order to clarify whether AvIDP resembles an acute monophasic disease or a chronic progressive, stagnant or even remitting-relapsing disease with sudden onset. Our preliminary observations indicate that remission and relapse of clinical signs is possible.In GBS and CIDP, several auto-antibodies have been demonstrated to react with myelin proteins and peripheral nerve gangliosides. Auto-antibodies against myelin proteins P0, P2 and PMP-22 are assoIn analogy to EAN models, the main fraction of recruited T-cells carried αβ T-cell receptors . Even thSo far, the aetiology of AvIDP is still undetermined. Preceding events associated with the onset of GBS range from viral, mycoplasmal and bacterial infections to surgery, vaccination, fever treatment and other stressful conditions ,76. All Thus, an association with preceding infection, as well as with vaccination, may be involved in disease development via molecular mimicry as has been documented in GBS ,77.Outbreaks of viral, mycoplasmal and bacterial infections in chicken flocks are generally limited by strict vaccination programs and by routine health monitoring. However, worldwide distribution, paired with neurotropism and some overlapping clinical and histopathological features, render Marek's disease herpesvirus an important candidate amongst avian infectious agents . PreviouIn addition to preceding infections, vaccinations have been reported risk factors for GBS and CIDP in humans. Anteceding immunizations with vaccines against influenza, hepatitis, measles, mumps, and rubella and others infrequently have been associated with GBS ,87-89. A[261/539] compared to others. In addition, genotype [357/539] also showed higher risk of AvIDP compared to genotype [261/357], and, to a lesser extend, compared to genotype [261/261] as well.While external triggers still remain uncertain, we were able to identify a genetic susceptibility factor confined to the avian major histocompatibility complex (MHC), the so called B-complex. The four genotypes studied displayed marked differences in risk of being affected by AvIDP. Most obvious was the increased risk of genotype [261/539] and [357/539] than for the other two haplotype combinations. Results suggest an association of marker LEI0258, located in the MHC region of the chicken, with the occurrence of AvIDP as earlier indicated by Bacon et al. [Moreover, the percentage of AvIDP-affected animals was significantly higher for genotypes n et al. . TherebyLikewise, in the highly susceptible Lewis rats that are commonly used in EAN trials, a certain allele of a MHC-linked gene - amongst further, non-MHC regions - is necessary in the MHC or RT1 region to confer EAE susceptibility in the F2 progeny . FurtherTo date, EAN is the most frequently used animal model for investigation of immunopathological mechanisms in acute inflammatory demyelinating diseases of the PNS . Even thLike AIDP and EAN, AvIDP is characterised by infiltration of nerve roots and peripheral nerves with macrophages and lymphocytes and, most importantly, a cell-mediated demyelination ,95. In ACompared to experimental immunization with mimicked epitopes, the spontaneous disease development of AvIDP is much closer to the field situation and provides an opportunity to investigate aetiological factors through purposed-based exposure and manipulations of the environment.A drawback of AvIDP as a disease model lays in the difficulty to identify pre- or subclinical animals and thereby the very early stages of immunopathology, before switching from Th1- to Th2-mediated cascades. However, scientific approaches to AvIDP are facilitated by its availability, reproducibility and economic considerations. In a flock of up to 5000 animals, a mean number of 50 to 200 chickens is affected per 18 weeks of the breeding cycle. In addition, the availability of the chicken genome sequence now greatly facilitates genetic and immunological studies and has lead to the availability of numerous molecular tools for detailed studies . This anSporadic paralysis in juvenile White Leghorn chickens is caused by an inflammatory demyelination of cranial and peripheral nerves. Paralytic stages are associated with humoral immune events that resemble the late stage of AIDP in humans. The natural development of AvIDP is an advantage over EAN regarding research on disease causing factors. MHC-related genetic factors are involved in disease susceptibility. Taken together, AvIDP may serve as a valuable model for further investigations on the aetiology and immunobiology of AIDP as well as its therapy.(AIDP): Acute inflammatory demyelinating polyneuropathy; (AvIDP): avian inflammatory demyelinating polyradiculoneuritis; (CNS): central nervous system; (CN): cranial nerve; (CTL): cytotoxic T cell; (DRG): dorsal root ganglion; (CIDP): chronic inflammatory demyelinating polyneuropathy; (EAN): experimental autoimmune neuritis; (GC): germinal centre; (GSB): Guillain-Barré syndrome; (mAb): monoclonal antibody; (iNOS): inducible nitric oxide synthase; (MHC): major histocompatibility complex; (MD): Marek's disease; (MDV): Marek's disease herpesvirus; (PNS): peripheral nervous system; (TCR): T-cell receptor; (Th): T helper cell.The authors declare that they have no competing interests.KM and BK provided the study concept, design and supervision. SB, SK, ST, SCNS, SW, ARS, and H-CP participated in acquisition of data. SB, SK, KM, and H-CP provided analysis and interpretation. SB, SK, KM, and BK participated in drafting of the manuscript. WS and RP provided critical revision for important intellectual content. All authors read and approved the final manuscript.

Medial clavicle fractures are uncommon, accounting for approximately 5 percent of all clavicle fractures. Vascular injuries are uncommon but are recognised as either an immediate complication due to transection of the vessel by the displaced fracture, or as a late complication, secondary to compression from abundant callus formation. We present an unusual case of positional venous insufficiency in the upper limb as an immediate complication of a closed, minimally displaced clavicle fracture, with secondary subclavian venous thrombosis formation eleven days following the injury. Injuries to the clavicle are very common and account for up to 10% of all fractures. MidshafMuch of the literature and research has concentrated on midshaft and distal clavicle fractures and acromioclavicular joint injuries. We aim to highlight the difference in mechanism of injury and complications associated with medial third clavicle fractures.In general, vascular injuries following clavicle fractures are uncommon but are recognised as either an immediate complication due to transection of the vessel by the displaced fracture ,7, or asIsolated injuries of the medial end of the clavicle are uncommon and are usually part of multisystem injuries. ThrockmIn children, physeal fracture of the medial end of the clavicle has been documented with a range of associated complications occurring acutely by the initial injury or chronically following a missed diagnosis . HoarsenMedial clavicle fractures are uncommon injuries and have therefore been largely overlooked. The available literature points out that medial third clavicle fracture, like scapular body fractures, are commonly associated with a high-energy blunt trauma mechanism of injury and should therefore prompt the treating physician to look for other associated poly-trauma. There is a high association with mortality from multi-system trauma. In such situations, cardio-respiratory injuries and compromise appear to be the most frequent and most serious associated injuries. Other injuries to neck/thoracic viscera have been reported.While there have been several reports of vascular injury following fractures of the clavicle, the vast majority have been due to displaced fractures of the midshaft or lateral end. However, most midshaft and lateral clavicle fractures are not associated with injuries to other structures. Such fractures heal completely without complication with non-operative management. This review reiterated the inherently different nature of medial third clavicle compared to the more common midshaft or lateral third fractures. Medial third clavicle fractures are more likely to be associated with poly-trauma and serious complications, which can easily be overlooked, particularly after the immediate post-injury phase. This paper also emphasises the need for repeated vigilance following initial clinical assessment.The authors declare that they have no competing interests.TK conceived the idea and wrote the paper. CJ, JS and EG were instrumental in analysing the notes, collecting the data and inserting images. KS was responsible for editing and approving the final manuscript.

Lutzomyia (L.) longipalpis, a Leishmania infantum chagasi vector, in the induction of LBs and eicosanoid production by macrophages in vitro and ex vivo.Sand fly saliva contains molecules that modify the host's hemostasis and immune responses. Nevertheless, the role played by this saliva in the induction of key elements of inflammatory responses, such as lipid bodies and eicosanoids, has been poorly investigated. LBs are cytoplasmic organelles involved in arachidonic acid metabolism that form eicosanoids in response to inflammatory stimuli. In this study, we assessed the role of salivary gland sonicate (SGS) from L. longipalpis SGS were injected into peritoneal cavities of C57BL/6 mice. SGS induced increased macrophage and neutrophil recruitment into the peritoneal cavity at different time points. Sand fly saliva enhanced PGE2 and LTB4 production by harvested peritoneal leukocytes after ex vivo stimulation with a calcium ionophore. At three and six hours post-injection, L. longipalpis SGS induced more intense LB staining in macrophages, but not in neutrophils, compared with mice injected with saline. Moreover, macrophages harvested by peritoneal lavage and stimulated with SGS in vitro presented a dose- and time-dependent increase in LB numbers, which was correlated with increased PGE2 production. Furthermore, COX-2 and PGE-synthase co-localized within the LBs induced by L. longipalpis saliva. PGE2 production by macrophages induced by SGS was abrogated by treatment with NS-398, a COX-2 inhibitor. Strikingly, SGS triggered ERK-1/2 and PKC-α phosphorylation, and blockage of the ERK-1/2 and PKC-α pathways inhibited the SGS effect on PGE2 production by macrophages.Different doses of L. longipalpis saliva induces lipid body formation and PGE2 production by macrophages ex vivo and in vitro via the ERK-1/2 and PKC-α signaling pathways. This study provides new insights regarding the pharmacological mechanisms whereby L. longipalpis saliva influences the early steps of the host's inflammatory response.In sum, our results show that Lutzomyia (L.) longipalpis, a widespread Leishmania vector, induces early production of eicosanoids. Intense formation of intracellular organelles called lipid bodies (LBs) was noted within those cells that migrated to the site of saliva injection. In vitro and ex vivo, sand fly saliva was able to induce LB formation and PGE2 release by macrophages. Interestingly, PGE2 production induced by L. longipalpis saliva was dependent on intracellular mechanisms involving phosphorylation of signaling proteins such as PKC-α and ERK-1/2 and subsequent activation of cyclooxygenase-2. Thus, this study provides new insights into the pharmacological properties of sand fly saliva and opens new opportunities for intervening with the induction of the host's inflammatory pathways by L. longipalpis bites.After the injection of saliva into the host's skin by sand flies, a transient erythematous reaction is observed, which is related to an influx of inflammatory cells and the release of various molecules that actively facilitate the blood meal. It is important to understand the specific mechanisms by which sand fly saliva manipulates the host's inflammatory responses. Herein, we report that saliva from Lutzomyia (L.) longipalpis, the main vector of visceral leishmaniasis in South America, has been extensively studied. During the inflammatory response, L. longipalpis saliva induces cellular recruitment, modulates both antibody production and the formation of immunocomplexes LeishmaniaL. longipalpis salivary protein with vasodilator properties, down-regulates LPS-induced TNF-α and NO release through a mechanism dependent on PGE2 and IL-10 To obtain a blood meal, sand flies locate blood by introducing their mouthparts into the vertebrate host's skin, tearing tissues, lacerating capillaries and creating hemorrhagic pools upon which they feed. During this process, sand flies need to circumvent a number of the host's homeostatic responses, such as activation of blood coagulation cascades, vasoconstriction, platelet aggregation and immune responses 2 is an eicosanoid derived from arachidonic acid (AA) metabolism by the enzyme cyclooxygenase (COX). Prostanoids and leukotrienes can be intensely produced by macrophages during inflammatory responses 4 induces neutrophil recruitment 2 and PGD2 attract mainly macrophages L. longipalpis saliva induces an influx of neutrophils 4 and PGE2 release nor the involvement of these mediators in this process has been fully addressed.PGEUnder inflammatory and infectious conditions, prostaglandins and others lipid mediators are mainly produced by cytoplasmic organelles called lipid bodies (LB) L. longipalpis salivary gland sonicate (SGS) on the induction of LB formation as well as PGE2 and LTB4 production in vitro and ex vivo. Moreover, we explored the role of peritoneal macrophages in the production of these lipid mediators in response to L. longipalpis SGS in vitro. Finally, we found that the PGE2 production induced by L. longipalpis saliva is dependent on intracellular mechanisms involving the phosphorylation of signaling proteins such as PKC-α and ERK-1/2 and subsequent activation of COX-2.Herein, we evaluated the effect of 2 and LTB4 enzyme-linked immunoassay (EIA) Kits, anti-murine COX-2 and PGE-synthase antibodies were all from Cayman Chemical . 4,4-difluoro-1,3,5,7,8-pentamethyl-4-bora-3a,4a-diaza-s-indacene (BODIPY 493/503) was obtained from Molecular Probes . Osmium tetroxide (OsO4) was obtained from Electron Microscopy Science . Aqua Polymount was from Polysciences . Thiocarbohydrazide, Ca2+-Mg2+-free HBSS(−/−), HBSS(+/+) with Ca2+-Mg2+, LPS from Escherichia coli (serotype 0127:b8), and N-ethyl-N'-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDAC) were purchased from Sigma-Aldrich . Rabbit anti-mouse kinase proteins were from Santa Cruz Biotechnology . PD 98059, 2′-Amino-3′-methoxyflavone and Bisindolylmaleimide-I, 2-[1-(3-Dimethylaminopropyl)-1H-indol-3-yl]-3-(1H-indol-3-yl)-maleimide were obtained from Merck-Calbiochem .Dimethylsulfoxide (DMSO) was purchased from ACROS Organics . RPMI 1640 medium and L-glutamine, penicillin, and streptomycin were from Invitrogen . Nutridoma-SP was from Roche . A23187 calcium ionophore, was from Calbiochem/Novabiochem Corp. . NS-398, PGEInbred male C57BL/6 mice, age 6–8 weeks, were obtained from the animal facility of Centro de Pesquisas Gonçalo Moniz, Fundação Oswaldo Cruz . All experimental procedures were approved and conducted according to the Animal Care and Using Committee of the FIOCRUZ.Lutzomyia longipalpis captured in Cavunge were reared at the Laboratório de Imunoparasitologia/CPqGM/FIOCRUZ as described previously L. longipalpis females under a Stemi 2000 Carl Zeiss stereoscopic microscope and stored in groups of ten pairs in 10 µL of endotoxin-free PBS at −70°C. Immediately before use, the glands were sonicated with a Branson Sonifier 450 and centrifuged at 10,000× g for four minutes. The supernatant from salivary gland sonicate (SGS) was used for experiments. The level of LPS contamination of L. longipalpis SGS preparations was determined using a commercially available LAL Chromogenic Kit ; negligible levels of endotoxin were found in the salivary gland supernatant (0.1 ηg/mL). We measured 0.7 micrograms of protein in an amount equivalent to 0.5 pair of salivary glands and used SGS dilutions (2.0–0.2 pairs) in our experiments Adult L. longipalpis SGS, we used the well-established peritoneal model of inflammation because the peritoneal cavity is a self-contained and delineated compartment and thus provides a large number of post-stimulus leukocytes. As previously established in the air pouch murine model L. longipalpis SGS (0.5 pair/cavity), endotoxin-free saline (negative control) or 0.1 mL of LPS . At 1, 3 and 6 h post-stimulus, leukocytes inside the peritoneal cavity were harvested by injection and recovery of 10 mL of endotoxin-free saline. Total counts were performed on a Neubauer hemocytometer after staining with Turk's solution. Differential cell counts were carried out microscopically on cytospin preparations stained with Diff-Quick.To assess the leukocyte recruitment induced by L. longipalpis SGS (0.5 pair/cavity), endotoxin-free saline or LPS (20 µg/mL) were centrifuged at 400× g and the lipid bodies within the leukocytes were stained with BODIPY 493/503 (5 ug/mL) according to Plotkowisk et al.Cells harvested by peritoneal lavage 1, 3, 6 or 24 h after i.p. injection of 0.1 mL of Macrophages adhered to coverslips within 24-well plates were fixed with 3.7% formaldehyde and stained with osmium tetroxide as described previously in vitro assays, macrophages were obtained by peritoneal lavage with cold RPMI 1640. Then, cells were centrifuged at 400× g for 10 minutes. Macrophages (3×105/well) were cultured in 1 mL of RPMI 1640 medium supplemented with 1% Nutridoma-SP, 2 mM L-glutamine, 100 U/mL penicillin and 100 µg/mL streptomycin in 24-well plates for 24 hours. Next, the macrophages were stimulated with different doses of L. longipalpis SGS . In some experiments, LPS (500 ng/well) was used as a positive control. One, 6, 24, 48 and 72 hours after stimuli, supernatants were collected and cells were fixed with 3.7% formaldehyde. For inhibitory assays, macrophages were pretreated for one hour with 1 μM NS-398, a COX-2 inhibitor; 20 ηM BIS, a PKC inhibitor; or 50 μM PD98059, an ERK-1/2 inhibitor. Then, the cells were stimulated with SGS (1.5 pairs/well) or medium containing vehicle (DMSO) for 24 hours, and the supernatants were collected for eicosanoid measurement. Cell viability as assessed by trypan blue exclusion was always greater than 95% after the end of treatment.For L. longipalpis SGS (1.5 pair/well) as described above. After 24 h, the cells were washed twice with 500 µl of HBSS−/− and immediately fixed with 500 µL of water-soluble EDAC (1% in HBSS−/−), used to cross-link eicosanoid carboxyl groups to amines in adjacent proteins. After 15 min of incubation at room temperature (RT) with EDAC to promote both cell fixation and permeabilization, macrophages were then washed with HBSS−/− and incubated with 1 µM BODIPY 493/503 for 30 min. Then, the cover slips were washed with HBSS−/− and incubated with mouse anti-COX-2 (1∶150) or anti-PGE-synthase (1∶150) for 1 h at RT. MOPC 21 (IgG1) was used as a control. After further washes, cells were incubated with biotinylated goat anti-rabbit IgG secondary Ab, washed twice and incubated with avidin conjugated with PE for 30 min. The cover slips were then washed three times and mounted in Vectashield medium containing DAPI . The samples were observed by fluorescence microscopy and images were acquired using the software Image-Pro Plus .Resident peritoneal macrophages were cultured on coverslips in the presence of et al.Macrophages were treated or not with SGS (1.0 pair/well) for 40 min. Next, the cells were washed once with phosphate-buffered saline, homogenized in lysis buffer containing phosphatase inhibitors and a protease inhibitor cocktail . Protein concentrations were determined using the method of Lowry Quantification of the level of proteins in the western blotting membranes was determined by densitometry. Briefly, bands were scanned and processed using Adobe Photoshop 5.0 software (Adobe Systems Inc.), and arbitrary values for protein density were estimated. Ratios between phosphorylated and unphosphorylated proteins were obtained to calculate the difference between groups.L. longipalpis SGS (0.5 pair/cavity), endotoxin-free saline or 0.1 mL of LPS (500 ηg/mL). At 1, 3 and 6 h post-stimulus, leukocytes were harvested by peritoneal washing with HBSS−/− and 1×106 cells/mL were resuspended in HBSS+/+ and stimulated with A23187 (0.5 µM) for 15 min ex vivo or those of in vitro assays were collected for measurement of PGE2 and LTB4 by enzyme-linked immunoassay (EIA) according to the manufacturer's instructions .C57BL/6 mice were inoculated i.p. with 0.1 mL of in vivo assays were performed using at least five mice per group. Each experiment was repeated at least three times. Data are reported as the mean and standard error of representative experiments and were analyzed using GraphPad Prism 5.0 software. Disparities in leukocyte recruitment, lipid bodies and lipid mediator quantification were explored using Student's t test. Means from different groups from the in vitro assays were compared by ANOVA followed by Bonferroni's test or a post-test for linear trends. Differences were considered statistically significant when p≤0.05.The 4 ±0.027) and negligible amounts of neutrophils (0.018×104 ±0.027). At this time, macrophages are the major cells within the mononuclear population in the peritoneal cavity besides lymphocytes, which represent ∼10% of mononuclear cells (data not shown). As shown in 2 , and 1, 3 and 6 hours after injection, we enumerated total leukocytes recruited to the peritoneal cavity. Most of the cells recruited were mononuclear cells and neutrophils . In thisown in 2 and LTB4 in 2 for different time periods . At 24 hours post-stimulus, SGS strongly induced LB formation compared with the untreated group . LB formProstaglandins are produced by cyclooxygenases, which occur in constitutive (COX-1) and inducible (COX-2) forms 2 and LTB4 production in the supernatant of macrophage cultures. SGS induced PGE2 production starting at 1.0 pair/well (4 was not detectable under any conditions (data not shown). As expected, PGE2 production by macrophages stimulated with SGS was reduced to basal levels when the cells were pre-incubated with NS-398, a COX-2 inhibitor and PD98059, PKC-α and ERK-1/2 inhibitors, respectively , which are formed in leukocytes and other cells involved in the inflammatory and infectious responses to several stimuli in vivo sand fly bites L. longipalpis SGS induces an inflammatory infiltration composed mainly of macrophages and neutrophils. Moreover, we showed that the cellular recruitment induced by L. longipalpis saliva is concomitant with PGE2 and LTB4 production. In this scenario, lipid mediators could be triggering cellular recruitment. Secretion of LTB4 by resident macrophages plays an important role in neutrophil migration 2 and prostaglandin E2Previous investigations have demonstrated that sand fly saliva plays an important role in cellular recruitment in multiple experimental models 2 is an abundant eicosanoid produced by inflammatory cells, and it is known to exert anti-inflammatory and vasodilator effects. PGE2 is found in Ixodes scapularis saliva and is also implicated in the immunomodulatory activity of tick saliva on dendritic cell and macrophage activation Phlebotomus species have suggested that the anti-inflammatory properties of sand fly saliva could be attributed to PGE2 and IL-10 released by dendritic cells 2L. longipalpis saliva, is able to induce LPS-activated macrophages to release PGE2 via COX-1, an enzyme that is constitutively active L. longipalpis SGS triggers PGE2 production in resident macrophages by an inducible pathway, since this effect was completely abrogated when the cells were incubated in the presence of NS-398, a COX-2 inhibitor. Nevertheless, whether sand fly saliva contains other molecules involved in PGE2 production or pharmacological amounts of this mediator similarly to tick saliva remains unknown.Prostaglandin EL. longipalpis saliva, eicosanoid production and lipid body formation. Under inflammatory and infectious conditions, lipid mediators are mainly produced within LBs, which compartmentalize both the substrate and the enzymatic machinery required for eicosanoid production in vivo and in vitro, suggesting that L. longipalpis saliva acts directly on these cells, but not on neutrophils. Indeed, L. longipalpis SGS triggered LB formation in macrophages committed to PGE2 production via COX-2 and PGE-synthase.Our study is the first to establish a direct link between L. longipalpis SGS triggers ERK-1/2 and PKC-α phosphorylation in macrophages. Other studies have shown that COX-2 activation and PGE2 production in LPS stimulated-macrophages is dependent on the phosphorylation of protein kinases such as PKC-α 2 production induced by SGS is dependent on both ERK-1/2 and PKC. This association between the activation of kinases and the metabolism of eicosanoids within lipid bodies may serve to enhance rapid eicosanoid production in response to extracellular stimuli such as sand fly saliva. Of note, in addition to their role in regulating the host response to infection by modulating inflammatory mediator production, lipid bodies may also serve as rich sources of nutrients for intracellular pathogens, thus favoring intracellular pathogen replication Data regarding the direct effects of sand fly salivary compounds on host signaling pathways cells are scarce. The extracellular signal-regulated kinases (ERKs) and protein kinase C (PKC) are among the key enzymes implicated in signaling pathways of diverse cellular responses, including eicosanoid production. The MAP kinases ERK1 and ERK2 induce activation of cPLA2, an enzyme that hydrolyzes arachidonic acid, which is metabolized to prostaglandin H2 by COX L. longipalpis saliva, including LB formation and the signaling pathways that trigger PGE2 release. Although the roles of the newly formed LBs and PGE2 induced by sand fly saliva in the pathogenesis of leishmaniasis have not yet been addressed, several studies have shown that PGE2 is essential to the infection of macrophages 2 production by sand fly saliva demonstrated herein can influence the initial steps of host infection by favoring less intense macrophage activation. Our group and others have been providing strong evidence that saliva components are immunogenic and have potential as markers of exposure to sand fly vectors In brief, the present work provides new insights into the mechanisms involved in macrophage responses to

We applied a penalized regression approach to single-nucleotide polymorphisms in regions on chromosomes 1, 6, and 9 of the North American Rheumatoid Arthritis Consortium data. Results were compared with a standard single-locus association test. Overall, the penalized regression approach did not appear to offer any advantage with respect to either detection or localization of disease-associated polymorphisms, compared with the single-locus approach. Penalized regression approaches are an attractive option for the analysis of large numbers of predictor variables (such as genotypes at many genetic loci) that may influence a response variable (such as disease status). Most genome-wide studies use single-locus association tests such as the Cochran-Armitage trend test, or, equivalently, logistic regression with a single predictor variable (encoding the effect of a particular locus) included in the regression equation at any given time. Theoretically, regression methods allow the simultaneous inclusion of several different variables in the regression equation, e.g., variables coding for genotype rather than allele effects (thus modeling "dominance"), or variables that encode effects at several different loci. However, standard regression methods fail when the sample size (the number of people) is small compared to the number of predictors.β of parameter estimates (regression coefficients) βj at p predictors that minimizes the sum of squared differences Standard linear regression can be formulated as finding the vector i, yi is a quantitative outcome variable and xij is a predictor variable . In penalized regression, one minimizes this function subject to a constraint on the coefficients such as where, for person gcorresponds to the original sum of squared differences, his a penalty term, and λ is a tuning parameter (or vector of parameters) that controls the strength of penalization. Ridge regression [2 penaltywhere gression uses a sproducing coefficients that are scaled down or "shrunk" towards zero and prediction models that often perform better that least-squares owing to a bias-variance trade-off . All pre1 penalty, resulting in both shrinkage and variable selection, in that many of the coefficients become set to zero. Zou and Hastie [hthat is a convex combination of the lasso and ridge penaltiesuses an Ld Hastie proposedλ1 or λ2 is close to 0. Zou and Hastie [λ2).which they termed the naïve elastic net. However, this method can over-shrink the coefficients and performs poorly unless either f = g + h withThe naïve and modified elastic net approaches enjoy a grouping property whereby predictors that are highly correlated tend to have similar coefficient estimates . An alte and penalty termG groups and fg and lgindicate the first and last predictor in group g. The penalty term in the group lasso is intermediate between the L1 penalty of the lasso and the L2 penalty used in ridge regression and, as pointed out by Wu and Lange [f = g + h, with g equal to either half the sum of squared differences as above (denoted l2 regression) or to l1 regression), with the penalty term taking the formHere, the predictors are divided into nd Lange , providend Lange actuallyβg||2 instead of λ2.This is similar in form to the naïve elastic net penalty, except that, like the group lasso, it uses ||f = g + h with the penalization term h taking one of the forms above, and gequalling minus one [Penalization is an attractive option in genetic studies because it allows the grouping of predictors that relate to the same genetic variant or region, and also because we genuinely expect the vast majority of loci to have regression coefficient 0. Although originally developed for quantitative outcomes, penalization methods have been extended to deal with binary outcomes (such as disease). Penalization is achieved by minimizing an objective function inus one or two [inus one times thHLA and PTPN22, and also reporting a new locus on chromosome 9. We therefore focused on these regions for application of our penalized regression approach.We analyzed the North American Rheumatoid Arthritis Consortium (NARAC) data, consisting of 868 rheumatoid arthritis (RA) cases and 1194 controls genotyped at 545,080 single-nucleotide polymorphisms (SNPs) across 22 autosomal chromosomes. These data were recently used in combination with additional samples [p-value < 10-7. We also removed individuals with >5% missing genotypes. We used multidimensional scaling of the Genetic Analysis Workshop (GAW) 16 data, together with publicly available HapMap data on 210 unrelated individuals from four populations, to confirm that the individuals from the GAW data had European ancestry and were not related.We used the software PLINK to perfoWe used PLINK to perform a Cochran-Armitage trend test at each SNP. Unlike Plenge et al. , we madeWe applied the group lasso procedure proposed by Meier et al. implemenConsideration of groups of predictors simultaneously could be useful if one wished to include more than one predictor per SNP or to impose some other grouping based on (for example) biological function. However, in our analyses, we used only a single predictor variable per locus , and thus each SNP formed a group by itself.β of the convex functionThe group lasso estimator is definl is the logistic regression log-likelihood function and the function g (not relevant here). The choice of the tuning parameter λ controls the amount of penalization. A natural way to estimate λ is to use cross-validation [λ equal to log(G), where G is the number of groups, in our case the number of SNPs to be fitted in the model. Thus, λ varied from log(1000) = 6.9 to log(7000) = 8.85 in the results described below.where lidation , howeverlidation to take z-score at each locus by dividing the observed regression coefficient by its estimated standard error, and converted this to a p-value, assuming the z-score to be normally distributed. This procedure is not, strictly speaking, correct, because penalized regression does not enjoy the asymptotic properties of standard regression procedures: shrinkage of the regression coefficients means their distribution cannot be assumed to be asymptotically normal. However, we hoped that this procedure would provide us with a ballpark estimate of the relative significance of the regression coefficients (relative to one another), even if the exact significance levels could not be considered reliable.The output from a penalized regression procedure consists of an estimated regression coefficient for each predictor in the model: model selection is performed by estimation rather than hypothesis testing . Becauseλ) took between 10 and 12 hours; this increased significantly with the number of markers . The penalized regression procedure did not appear to offer any great advantage over the single-locus analysis with respect to either detection or localization of the putatively associated polymorphisms. We also examined the value of the estimated penalized regression coefficient at each SNP (for which no bootstrapping was required) when using windows of either 1000, 2000, 5000, or 7000 SNPs (data not shown). Again, no clear advantage over single-locus analysis, with respect to either detection or localization of putative causal variants, was observed.Figure detection of disease-associated polymorphisms. A more promising application is the fine-mapping problem, in which one is interested in determining from a smaller set of strongly correlated predictors in a region, which ones drive the association and are thus potentially causal or lie close to causal variant(s). Simulations suggest that penalized regression may offer some improvement over single-locus methods in this regard [p-values, across the regions investigated. Further investigation (data not shown) suggests that use of a higher penalty may produce better results: ideally one might wish to use cross-validation to choose the best value of λ from a range of possible values; however, this is likely to be prohibitively time-consuming on a genome-wide scale. Further investigation of alternative penalization algorithms and of methods for choosing penalization parameters and assessing significance is warranted.Penalization approaches are an appealing alternative to standard regression techniques for analysis of large numbers of predictor variables in the context of genome-wide association studies. Use of such techniques is just beginning to emerge: ridge regression has beens regard ,13, althGAW: Genetic Analysis Workshop; WE: Hardy-Weinberg equilibrium; LD: Linkage disequilibrium; NARAC: North American Rheumatoid Arthritis Consortium; RA: Rheumatoid arthritis; SNPs: Single-nucleotide polymorphisms.The authors declare that they have no competing interests.PC participated in the design of the study, carried out the statistical analysis, and helped draft the manuscript. HJC conceived of the study, participated in its design, and drafted the final manuscript. Both authors read and approved the final manuscript.

Experimental results for heterogeneous phantom and mouse atlas model demonstrate its effectiveness and potentiality in the application of quantitative BLT.Bioluminescence tomography (BLT) is a promising tool for studying physiological and pathological processes at cellular and molecular levels. In most clinical or preclinical practices, fine discretization is needed for recovering sources with acceptable resolution when solving BLT with finite element method (FEM). Nevertheless, uniformly fine meshes would cause large dataset and overfine meshes might aggravate the ill-posedness of BLT. Additionally, accurately quantitative information of density and power has not been simultaneously obtained so far. In this paper, we present a novel multilevel sparse reconstruction method based on adaptive FEM framework. In this method, permissible source region gradually reduces with adaptive local mesh refinement. By using sparse reconstruction with In vivo bioluminescence imaging (BLI) is a low-cost, noninvasive, and valuable tool for studying physiological and pathological processes at cellular and molecular levels. This technology has been applied to various biological models to diagnose disease, monitor therapies, and facilitate drug development –5. HowevMathematically, BLT is a severely underdetermined and ill-posed problem, which is mainly caused by insufficient measurement and the highly diffusive nature of the photon propagation in tissue , 9. Therl2 norm regularization, which tends to yield nonsparse solutions. In order to obtain a satisfactory result, threshold approach is typically used to remove those artificialities caused by l2 regularization . Th. Th25]. ν ∈ RM. We say ν is dual feasible if it satisfies the constraints of max  G(ν)aints of , from anl1-regularized least squares problem . Next, we solve a sequence of of source density and power. Here, the reconstructed power is estimated by computing the integral of the source density over its support domain, and the corresponding RE of density and power are calculated by |l1-regularized multilevel AFE method. The structure of the heterogeneous phantom is shown in μa = 0.007 mm−1 and μs′ = 1.031 mm−1for muscle, μa = 0.023 mm−1 and μs′ = 2 mm−1 for lung, μa = 0.011 mm−1 and μs′ = 1.096 mm−1 for heart, μa = 0.001 mm−1 and μs′ = 0.060 mm−1 for bone [A cylindrical mouse chest phantom with 30 mm diameter and 30 mm height was employed to evaluate the performance of the for bone .In the simulations, the phantom was discretized into a fine tetrahedral-element mesh to generate the synthetic measurements on the surface using FEM. To simulate the noise involved in real BLT experiment, 10% random Gaussian noise was added to synthetic measurements.3. The forward mesh of the phantom consisted of 11288 nodes and 62069 tetrahedral elements with 10832 boundary elements.Firstly, reconstruction for a single source target was attempted. A solid spherical source with 0.5 mm radius was centered at inside the right lung. The initial power source was 0.5236 nano-Watts, and the power density was 1 nano-Watts/mma priori information of BLT reconstruction, the initial PSR was defined as {  8 < (x2 + y2)1/2 < 12, 13.5 < z < 16.5} [PSR strategy was incorporated to the reconstruction algorithm to decrease the ill-posedness of BLT. As < 16.5} . The subl2 regularization. The quantitative results in single source case are summarized in The reconstruction was carried out using the proposed algorithm. The maximum mesh level was set to 4. The reconstructed results with regularization on multilevel adaptive meshes are shown in Figures l1 regularization at different mesh levels stay at , with a location error of 0.25 mm. By the adaptive mesh refinement scheme introduced in The reconstructed source positions by l1 results are 0.56% and 10.94%, respectively. In the reconstruction procedure with l2 regularization, the location error is up to 1.24 mm at the initial coarse level. Despite the fact that the position and shape of reconstructed source with l2 regularization are improved with the mesh refinement, the final deviations of density and power from the initial values are comparatively bigger than those of l1 results.It is noted that the quantitative information of source density and power is remarkably enhanced as the mesh became finer due to the multilevel meshes strategy. The final REs of density and power in l1 regularization, l2 regularization tends to yield a nonsparse solution, which is demonstrated in l1 regularization method provides a better initial localization than l2 does at the first mesh level, it thus yields a superior final reconstruction result to that of l2 method.As aforementioned, compared with In order to investigate the spatial resolution capability of the proposed multilevel reconstruction method, we performed a multisource simulation experiment. Beside the spherical source located in right lung, two spatially close sources were added to the previous phantom with their centers at and , respectively. The two sources located in left lung were 2 mm apart. The size, density, and power of each source were the same as in the single source case. The initial PSR was-same those that of single source case in this experiment. The final quantitative reconstruction results and the comparison with the actual sources are summarized in l1 regularization method, which lays a good foundation for the subsequent reconstruction. The figures in l1-regularized reconstruction method can provide very satisfied results in terms of spatial resolution and quantitative information about the sources.Incorporating PSR into the reconstruction algorithm, the proposed method can always accurately distinguish these sources at different mesh levels. The reconstruction results in 3, respectively.The numerical experiment with a 3D digital mouse atlas was also performed to further demonstrate the performance of the proposed reconstruction method on a real animal-shaped model. A mouse atlas of CT and cryoSection data was employed to provide anatomical information . The optx, y, z) | 10 < x < 26,3 < y < 9,12 < z < 19, ∈ liver} as the initial PSR.This torso model was discretized into tetrahedral-element mesh to generate the synthetic measurements on the boundary. The forward mesh consisted of 112795 elements and 21277 nodes, as shown in Figures l1-regularized reconstruction for this mouse atlas model on a laptop with Intel Pentium M processor (1.7 GHz). The detailed results on different mesh levels are given in It took about 120 seconds to complete the multilevel l1 regularization is effective for sparse source reconstruction. Combined with multilevel adaptive FEM, the image resolution and the quantitative information of source distribution can be remarkably enhanced.In this paper, we present a sparse reconstruction method based on multilevel adaptive FEM and evaluated its performance in numerical simulation. Numerical simulation results suggest that the It is well known that the density as well as position and shape of reconstructed source are significantly affected by the degree of discretization –17. The l2 regularization method in l2-regularized solution is commonly remedied by a big threshold.In the existing adaptive FEM based reconstruction methods, although the source density can be remarkably improved as the mesh became finer, the reconstructed power tends to decline. The reconstruction results by using l1-regularized solution on a coarse mesh can provide a good initial localization with better numerical stability, which guides the subsequent reconstruction on finer meshes to obtain more accurate location and quantitative information of sources. We observed that relatively accurate power and density can be simultaneously recovered when the mesh dimension is commensurate to the source size by the proposed method. There are two key points contributing to the superior performance of the proposed reconstruction method: (1) Multilevel adaptive local mesh refinement and progressively reduced PSR can avoid the large datasets caused by uniformly fine mesh and reduce the ill-posedness of BLT, while retaining the desired accuracy in the region of interest. (2) In view of the sparsity of the source distribution, in vivo studies with the multilevel l1-regularized reconstruction method will be reported in another paper.The experiment on a mouse-shaped model with heterogeneous optical properties demonstrates the potentiality for animal experiments. Physical phantom and

This fMRI study explored the functional neural organisation of seen speech in congenitally deaf native signers and hearing non-signers. Both groups showed extensive activation in perisylvian regions for speechreading words compared to viewing the model at rest. In contrast to earlier findings, activation in left middle and posterior portions of superior temporal cortex, including regions within the lateral sulcus and the superior and middle temporal gyri, was greater for deaf than hearing participants. This activation pattern survived covarying for speechreading skill, which was better in deaf than hearing participants. Furthermore, correlational analysis showed that regions of activation related to speechreading skill varied with the hearing status of the observers. Deaf participants showed a positive correlation between speechreading skill and activation in the middle/posterior superior temporal cortex. In hearing participants, however, more posterior and inferior temporal activation was positively correlated with speechreading skill. Together, these findings indicate that activation in the left superior temporal regions for silent speechreading can be modulated by both hearing status and speechreading skill. In hearn = 6), and so there may not have been sufficient statistical power to detect activation in this region. Furthermore, while the speechreading task in Deaf people can outperform hearing people in comprehending seen speech . NeverthThe present study is the first to examine patterns of activation in deaf people who are proficient speechreaders while they searched for a speechread target embedded in lists of unrelated words. We anticipated that both hearing status and speechreading ability, measured outside the scanner, may determine the extent of activation in perisylvian regions. This was explored in two complementary ways. First, the group comparison between deaf and hearing activation patterns was assessed with speechreading skill entered into the analysis as a covariate. Speechreading skill was assessed using the Test of Adult Speechreading TAS, . By ‘parTo summarise, this study examines cortical correlates for the perception of lists of speechread words under lexical target detection conditions. We aimed to identify regions that may be activated during observation of silently spoken lexical items that are not drawn from a closed set, and when the contrast (baseline) condition was a speaker at rest. The questions posed were: (1) To what extent do prelingually deaf people who are proficient signers and speechreaders show activation in superior temporal regions, including auditory cortical processing regions? (2) Are the patterns of activation different in deaf and hearing people? (3) In which regions is speechreading ability positively correlated with activation?22.1t-tests showed that deaf and hearing participants did not differ on non-verbal IQ (p > 0.1). However, deaf participants scored significantly higher than hearing non-signers on the TAS (t (24) = 4.779, p < 0.001), confirming earlier findings (z-scores) were derived from the populations reported in Thirteen deaf adults were tested. All were congenitally (severely or profoundly) deaf . Across the group, the mean hearing loss in the better ear was 103 dB. They were all native signers, having acquired British Sign Language (BSL) from their deaf signing parents. Thirteen hearing, monolingual speakers of English were also tested. All participants were right-handed with no known neurological or behavioural abnormalities. Non-verbal IQ was measured using the Block Design subtest of the WAIS-R. Speechreading was measured using the Test of Adult Speechreading (TAS). The TAS comprises three subtests of silent speechreading in English: word identification, sentence identification, and short story identification . Indepenfindings with an All participants gave written informed consent to participate in the study according to the Declaration of Helsinki and the study was approved by the Institute of Psychiatry/South London and Maudsley NHS Trust Research Ethics Committee.2.2Stimuli were full-colour motion video of silently mouthed English words. Stimuli were modelled by a deaf native signer of BSL, who spoke English fluently . The model was viewed full-face and torso. The words to be speechread were piloted on adult hearing volunteers who were not scanned. The final stimuli comprised only those words that were speechreadable by the hearing pilots. Stimuli consisted of both content words (nouns) and descriptive terms .2.3The speechreading task was one of four conditions presented to participants. The other three conditions comprised signed language (BSL) material (not reported here). The speech stimuli were presented in blocks, alternating with blocks of the other three experimental conditions (30-s blocks for each condition), and with a 15-s baseline condition. The total run duration for all four conditions and baseline was 15 min. Both deaf and hearing participants were given the same target-detection task and instructions. During the speechreading condition, participants were instructed to watch the speech patterns produced by the model and to try to understand them. They were required to make a push-button response whenever the model was seen to be saying ‘yes’. This relatively passive task was chosen in preference to a ‘deeper’ processing task (such as semantic classification) for several reasons. First, it allowed for relatively automatic processing of non-target items to occur (as confirmed in post-scan tests). Second, it ensured similar difficulty of the task across stimulus conditions. As hearing non-signers would not be able to perform a semantic task on the sign stimuli, using a sparse target detection task enabled all participants to perform the same task during all experimental conditions. Over the course of the experiment, participants viewed 96 stimulus items, 24 in each of the four experimental conditions. Items were not repeated within the same block and were pseudorandomised to ensure that repeats were not clustered at the end of the experiment. Each participant saw five blocks of the speechreading condition.The baseline condition comprised video of the model at rest. The model's face and torso were shown, as in the experimental conditions. During the baseline condition, participants were directed to press a button when a grey fixation cross, digitally superimposed on the face region of the resting model, turned red. To maintain vigilance, targets in both the experimental and baseline conditions occurred randomly at a rate of one per block. Prior to the scan, participants practiced the tasks and were shown examples of the ‘yes’ targets outside the scanner using video of a model and words that were similar but not identical to those used in the experiment. Following the experiment, a sample of the hearing participants (8 of 13) and all of the deaf participants were asked to identify the items they had seen.Stimuli in the experimental conditions appeared at a rate of 15 items per block. The rate of articulation across all experimental conditions, including the speechreading blocks, was approximately one item every 2 s. All stimuli were projected onto a screen located at the base of the scanner table via a Sanyo XU40 LCD projector and then projected to a mirror angled above the participant's head.2.4Gradient echoplanar MRI data were acquired with a 1.5-T General Electric Signa Excite with TwinSpeed gradients and fitted with an 8-channel quadrature head coil. Three hundred ch space . These c2.5The fMRI data were first corrected for motion artefact, then smoothed using a Gaussian filter (FWHM 7.2 mm) to improve the signal to noise ratio over each voxel and its immediate neighbours prior to data analysis. In addition, low frequency trends were removed by a wavelet-based procedure in which the time series at each voxel was first transformed into the wavelet domain and the wavelet coefficients of the three levels corresponding to the lowest temporal frequencies of the data were set to zero. The wavelet transform was then inverted to give the detrended time series. The least-squares fit was computed between the observed time series at each voxel and the convolutions of two gamma variate functions (peak responses at 4 and 8 s) with the experimental design . The besF statistic suggested by Following computation of the model fit, a goodness of fit statistic was derived by calculating the ratio between the sum of squares due to the model fit and the residual sum of squares (SSQ ratio) at each voxel. Permutation testing, as well as its freedom from many of the distributional assumptions of parametric tests, also offers the possibility of testing a number of statistics that are not easily testable parametrically. The SSQ ratio is such a statistic and is a simplified substitute for the The data were permuted by the wavelet-based method described by Significant values of the SSQ were identified by comparing this statistic with the null distribution, determined by repeating the fitting procedure 20 times at each voxel and combining data over all intracerebral voxels. This procedure preserves the noise characteristics of the time series during the permutation process, and the global assessment of the null distribution performed in this way provides good control of Type I error rates . The vox2.6Identification of active 3-D clusters was performed by first thresholding the median voxel-level SSQ ratio maps at the false positive probability of 0.05. The activated voxels were assembled into 3-D connected clusters and the sum of the SSQ ratios was determined for each cluster. This procedure was repeated for the median SSQ ratio maps obtained from the wavelet-permuted data to compute the null distribution of statistical cluster masses under the null hypothesis. The cluster-wise false positive threshold was then set using this distribution to give an expected false positive rate of <1 cluster per brain .2.7Y = a + bX + e, where Y is the vector of BOLD effect sizes for each individual, X is the contrast matrix for the particular inter-group contrast required, a is the mean effect across all individuals in the groups, b is the computed group difference and e is a vector of residual errors. The model is fitted by minimising the sum of absolute deviations rather than the sums of squares to reduce outlier effects. The null distribution of b is computed by permuting data between groups (assuming the null hypothesis of no effect of group) and refitting the above model. This permutation method thus gives an exact test (for this set of data) of the probability of the value of b in the unpermuted data under the null hypothesis. The permutation process permits estimation of the distribution of b under the null hypothesis of no mean difference. Identification of significantly activated clusters was performed by using the cluster-wise false positive threshold that yielded an expected false positive rate of <1 cluster per brain were inferred at each voxel using the linear model, R = a0 + a1H + a2X + e, where H codes the contrast(s) of interest between groups, X is a covariate and e is the residual error. Maps of the standardized coefficient (size of group difference) (a1), were tested for significance against the null distribution of a1 (no effect of group membership) generated by repeatedly refitting the above model at each voxel following randomization of group membership (H).Analysis of covariance was used to address behavioural differences between the deaf and hearing participants in relation to the patterns of activation for the speechreading condition see . Differe2.9z-score. These were calculated separately for each group. Pearson product–moment correlation coefficients were calculated between the observed behavioural and BOLD effect data. The null distribution of correlation coefficients was then computed by permuting the BOLD data 100 times per voxel and then combining the data over all voxels. Median voxel-level maps were computed at the false probability of 0.05 and cluster-level maps, where r was significant, were computed such that the expected false positive rate was <1 cluster per brain.In order to examine the relationship between brain activation and speechreading skill, correlational analysis was performed between the BOLD effect data for each individual and the Test of Adult Speechreading (TAS) 33.1t(24) = 2.99, p = 0.007). Speechreading target identification was slower in deaf than hearing participants  = 4.15, p < 0.001). Following scanning, participants were presented with the experimental stimuli. The deaf participants identified more words than the hearing participants , t(19) = 4.11, p = 0.001). The behavioural data suggest that deaf participants’ greater accuracy in identification of non-target items (as indicated by the post-scan test) may have interfered with their processing of the target (as indicated by the relatively slow reaction times to targets in the scanner).All participants completed the behavioural (target detection) task in the scanner reasonably accurately. Deaf participants identified the speechreading targets more accurately than hearing participants (mean accuracy (max = 5), deaf = 4.69, hearing = 3.85, 3.23.2.1In both deaf and hearing groups, extensive activation was observed in fronto-temporal cortices, bilaterally , Fig. 1.In hearing participants, we observed activation focused in the left middle temporo-occipital junction (BA 37) and in the right superior/middle temporal gyrus BA 22/21). These clusters of activation extended to include the superior and transverse temporal gyri , the postcentral gyri (BA 43) and the middle and inferior temporal and cerebellar gyri. In the left hemisphere, this cluster also extended to the supramarginal gyrus (BA 40). In both hemispheres, clusters in the inferior parietal cortex were focused in the supramarginal gyrus (BA 40). These clusters extended to angular (BA 39) and middle occipital (BA 19) gyri. The cluster in the right hemisphere extended medially to the border of the dorsal posterior cingulate gyrus (BA 31). Activation in frontal cortices was focused in the precentral gyrus (BA 4/6) of the left hemisphere and in the inferior frontal gyrus (BA 44) of the right hemisphere. In both hemispheres, frontal activation included the inferior middle (BA 46) and superior (BA 9) frontal gyri and the precentral gyrus . In the right hemisphere, the frontal cluster extended anteriorly to the border of the frontal pole (BA 10). Additional activation was observed in the right medial frontal gyrus (BA 6), extending to medial BA 8 and anterior cingulate gyrus (BAs 24 and 32).2/21. The3.2.2x = −54, y = −22, z = 10). In the right hemisphere, the cluster (61 voxels) was focused at the border between the superior and middle temporal gyri . Hearing non-signers showed greater activation than deaf signers in the right prefrontal cortex .Deaf native signers displayed significantly greater activation in left and right superior temporal cortices than hearing non-signers. In the left hemisphere, the cluster of activation (116 voxels) was focused at the border between the posterior superior temporal gyrus and the transverse temporal gyrus was focused at the border between the posterior superior temporal gyrus and the transverse temporal gyrus . The focus of this cluster was verified using probabilistic maps provided by When speechreading performance, as indicated by individual TAS 3.2.3z-scores in both deaf and hearing groups.Speechreading skill, as measured by performance on the Test of Adult Speechreading (TAS), varied considerably across participants . Several3.2.4In the deaf group, ten clusters of activation (≥5 voxels) were positively associated with speechreading skill see . In the 3.2.5z-scores included the fusiform (BA 37) and lingual (BA 18) gyri of the right hemisphere and the right postcentral gyrus (BA 4). Additional positive correlations were observed in the posterior cingulate gyrus (BA 23).In the hearing group, clusters of activation that were positively correlated with TAS 4Deaf participants were better speechreaders than hearing participants, both in terms of their TAS performance and, wheThe group-level analyses, conducted separately for the deaf and hearing groups, contrasted silent speechreading with a low-level target detection task. As such, these analyses cannot allow unambiguous interpretation of the specificity of such activation in relation to speechreading alone, but they do suggest a general pattern against which the group differences can be explored. In hearing people, the pattern of activation replicates that which has been observed in many previous studies, showing extensive activation across the temporal cortex. While some of this activation must relate to visual movement detection and to the perception of biological motion, especially in posterior and inferior regions was entered as a covariate greater A non-mutually exclusive possibility is that greater activation in superior temporal regions for deaf than hearing individuals reflects a more general plasticity of these regions in deaf people. Several studies suggest that brain regions considered specialised for audition can be recruited for processing stimuli from other modalities in deaf people e.g., . While t4.2r = 0.476, p(1-tailed) = 0.05; hearing: r = 0.673, p(1-tailed) = 0.034); thus we can infer that the higher the TAS score, the more likely it is that participants would have processed the speechread material lexically. However, TAS scores were not normally distributed across the two groups. For this reason, standard scores (TAS-z) derived for each group formed the basis for exploring the relationship between speechreading skill and cortical activation. Within each group, different patterns of association were observed. In deaf participants, the correlational analyses showed that activation in the posterior portion of the superior temporal gyri was positively associated with speechreading.TAS speechreading scores and post-scan speechreading of the items seen in the scanner were positively correlated , however, require that this interpretation should be provisional. Taken together, these data show that hearing status is an important determinant of activation in left superior temporal regions when words are speechread. In particular, silent speechreading elicits greater activation in the left middle and posterior portions of the superior temporal cortex, including the superior and middle temporal gyri and the lateral portion of the transverse temporal gyrus in deaf than hearing people, even when speechreading skill is held constant. However, speechreading skill can moderate this activation, showing a positive relationship in deaf but not hearing participants. The relatively small group sizes used in the correlational analysis (We have shown that, when auditory regions are not activated by acoustic stimulation, they can nevertheless be activated by silent speech in the form of speechreading. This finding may have some practical as well as theoretical significance. Current practice in relation to speech training for prelingually deaf children preparing for cochlear implantation emphasises acoustic processing. In auditory-verbal training, the speaking model is required to hide her or his lips with the aim of training the child's acoustic skills e.g., . Thus, aSpeechreading gives access to spoken language structure by eye. It therefore has the potential to impact positively on the development of auditory speech processing following cochlear implantation. While there are few consistent correlates of improved post-implant speech processing in prelingually deaf cochlear implantees, efficiency in speechreading is implicated. For example, pre-implant silent speechreading skills are positively associated with general speech and language outcomes . The pos

Nephropathy is serious complication of diabetes. We have previously shown that level of the proteoglycan syndecan-1 in blood is associated with ultrastructural kidney changes in young persons with type 1 diabetes. Dysregulation of matrix metalloproteinases (MMPs) and tissue inhibitors of matrix metalloproteinases (TIMPs) may contribute to the development of nephropathy. The aim of this study was to investigate if the levels of MMPs in blood samples are potential markers of early nephropathy in type 1 diabetes.Blood samples were collected from type 1 diabetes patients after 11 years of diabetes (n = 15) and healthy volunteers (n = 12) and stored at ÷80°C until measurement. Levels and activities of serum MMP-2, MMP-9, TIMP-1 and TIMP- 2 were analyzed and compared to those of control individuals using ELISA, SDS-PAGE gelatin zymography, and Western blot analysis.The serum levels of both MMP-9 and MMP-2 were significantly higher in subjects with type 1 diabetes, compared to controls (p = 0.016 and p = 0.008 respectively). Western blotting revealed no differences between the two groups in the levels of TIMP-1 or TIMP-2, respectively.Our MMP analysis of serum from a limited number of patients with type 1 diabetes suggest that such analysis is potentially useful as markers in studies of people at risk of progression to chronic kidney disease. Chronic hyperglycaemia, measured clinically as elevated glycosylated hemoglobin A1c in the kidney has been shown in studies of type 1 diabetes ,3. TheseThe extracellular matrix (ECM) in the basement membrane of the kidney glomeruli is of particular importance for the filtration properties. Structural changes in mesangial and basement matrix are related to proteinuria and hypertension and thus the progression of clinical diabetic nephropathy and kidney failure. One important class of molecules found in ECM and on cell surfaces and with functions in kidney filtration are the proteoglycans (PGs). We have recently shown that serum concentrations of the proteoglycan syndecan-1 is higher in subjects with type 1 diabetes and microalbuminuria than in those without microalbuminuria suggestiNumerous classes of proteolytic enzymes probably participate in ECM degradation, and one class that appears to play a major role is MMPs and theiOur studies on cultured human endothelial cells have established that primary human umbilical cord endothelial cells (HUVEC) exposed to hyperglycaemic conditions reduced secretion of MMP-2. MMP-9 secretion was negligible or very low in these cells, irrespective of treatment .The aim of this study was to investigate if the activities and/or levels of MMPs in blood samples are markers of early nephropathy in type 1 diabetesBlood samples were obtained from subjects with type 1 diabetes and microalbuminuria who participated in a prospective study. The study focused on blood glucose control and on morphological changes in the glomeruli. The inclusion criteria in this study were persistent microalbuminuria, defined as an AER between 15-200 μg/min in at least two out of three overnight urine samples taken during 1 year. At the time when the blood samples were obtained the mean duration of diabetes was 11.3 (7-18) and the mean age was 22 (19-30). The mean age of the controls was 31 (26-35) years. Details from this study have been presented . In shorSDS-PAGE gelatin-substrate zymography was used to analyze for gelatinases and urokinase. To detect gelatinases, SDS-PAGE gels contained 0.1% gelatin . Positive control for proMMP-9 monomer (92 kDa) and homodimer (225 kDa) was conditioned serum-free medium from THP-1 cells. Positive control for active (62 kDa) and pro (72 kDa) forms of MMP-2 was conditioned serum-free medium from an osteosarcoma cell line.2 and 0.02% wt/vol Brij-35) overnight at 37°C to allow possible enzymes in the samples to degrade the gelatin matrix. In some experiments, wash and assay buffers contained the metalloproteinase inhibitor EDTA (10 mM).The serum samples were mixed with sample buffer and loaded on 7.5% gels containing 0.1% gelatin. Protein concentrations of the samples were determined using the BC assay from Uptima . After electrophoresis, the gels were incubated in 2.5% Triton X-100 to wash out SDS and then in assay buffer . Areas containing gelatinolytic activity appeared as clear white zones on the blue-stained background. To obtain quantitative information the areas containing gelatinolytic activity were analysed in a Phosphoimager .The concentrations of MMP-2 and MMP-9 were determined in blood samples using ELISA kits from Amersham Biosciences, where the use of serum for these analyses was recommended.Samples were mixed with Laemmli sample buffer, heated and electrophoresed in 10% (to detect MMP-9 and MMP-2) or 15% (to detect TIMP-1 and TIMP-2) SDS-PAGE gels and subjected to Western blotting as previously described [Because variables were not normally distributed, nonparametric statistical analyses (Mann-Whitney tests) were used. Data are presented as means ± SEM or median values as indicated. Comparison between groups of data was done by using box-plots. Statistical significance was defined as p < 0.05. All analyses were performed with SPSS for Windows version 16.Blood samples from controls and subjects with type 1 diabetes were analyzed by SDS-PAGE gelatin zymography. In all blood samples, bands with gelatinase activities were detected at positions that corresponded with monomeric (92 kDa) and homodimeric (225 kDa) forms of proMMP-9, and proMMP-2 (72 kDa) in the standards Figure . These gWe further determined the concentrations of MMP-2 and MMP-9 in samples from subjects with type 1 diabetes and controls using ELISA. As can be seen in Figure To investigate if TIMP concentrations differed in the obtained control and diabetes samples we performed Western blotting with antibodies against TIMP-1 and TIMP-2. Samples from both patients and controls contained detectable levels of TIMP-1 and TIMP-2. However, no apparent differences in the respective TIMPs could be observed in blood samples from the two different groups tested Figure .In the present study serum from controls and from subjects with type 1 diabetes have been analysed for content of MMPs. The results presented show that the concentrations of MMP-9 and MMP-2 in serum were elevated in the patients. The results presented are from a limited number of patients with type 1 diabetes and conclusions should therefore be drawn with caution.Results published on the use of MMPs as markers in relation to diabetic complications are somewhat conflicting. Increased MMP-2 levels, in particular in urine, have been related to increased risk of nephropathy . Also, tChanges in the extracellular matrix are evident in the diabetic kidney ,3. It haIn a previous study syndecan-1 was shown to be elevated in blood samples from the same subjects studied here, who all had microalbuminuria . We did Our MMP analysis of serum from a limited number of patients with type 1 diabetes suggest that such analysis is potentially useful as markers in studies of people at risk of progression to chronic kidney disease.The authors declare that they have no competing interests.HJB and SOK are responsible for conceiving and designing the study. HJB collected the blood samples and SG, KS and JOW acquired the data. SG made the figures and performed the statistical analyses. SOK drafted the manuscript which was revised by all authors.The pre-publication history for this paper can be accessed here:

Most hypotheses on population limitation of small mammals and their predators come from studies carried out in northern latitudes, mainly in boreal ecosystems. In such regions, many predators specialize on voles and predator-prey systems are simpler compared to southern ecosystems where predator communities are made up mostly of generalists and predator-prey systems are more complex. Determining food limitation in generalist predators is difficult due to their capacity to switch to alternative prey when the basic prey becomes scarce.Falco tinnunculus over 15 years in a mountainous Mediterranean area. In addition, we have recorded over 11 years the inter-annual variation in the abundance of two main prey species of kestrels, the common vole Microtus arvalis and the eyed lizard Lacerta lepida and a third species scarcely represented in kestrel diet, the great white-toothed shrew Crocidura russula. We estimated the per capita growth rate (PCGR) to analyse population dynamics of kestrel and predator species.We monitored the population density of a generalist raptor, the Eurasian kestrel Multimodel inference determined that the PCGR of kestrels was better explained by a model containing the population density of only one prey species (the common vole) than a model using a combination of the densities of the three prey species. The PCGR of voles was explained by kestrel abundance in combination with annual rainfall and mean annual temperature. In the case of shrews, growth rate was also affected by kestrel abundance and temperature. Finally, we did not find any correlation between kestrel and lizard abundances.Our study showed for the first time vertebrate predator-prey relationships at southern latitudes and determined that only one prey species has the capacity to modulate population dynamics of generalist predators and reveals the importance of climatic factors in the dynamics of micromammal species and lizards in the Mediterranean region. The study of demographic patterns in animal populations is a basic, as well as puzzling, research subject, important from a purely scientific perspective, up to conservation as well as from management points of view. A general conviction shared by ecologists is that trophic interactions are key factors affecting temporal oscillations (regular or irregular) of population numbers Small mammals and their predators, are among the most studied species and systems. The regular inter-annual fluctuations or cycles detected in many of rodent populations have been the subject of a great number of studies developing hypotheses about this striking phenomenon Falco tinnunculus is considered a nomadic rodent-specialist predator in northern Europe The change in the type of predator from more specialized in the north to more generalist in the south may not be strictly due to a change in the predator community, but also to a change in predator behaviours. For example, the Eurasian kestrel To our knowledge, no time series of small-mammal abundances have been described in the southern Mediterranean area of Europe. In the case of avian predators, the role of trophic interactions or food-limitation has mainly been documented in vole-specialists Lacerta lepida, the herbivorous common vole Microtus arvalis and insectivorous white-toothed shrew Crocidura russula. We analyse the feedback structure (intrinsic processes) and exogenous factors (climate) determining population dynamics in kestrel and prey species by analysing the per capita changes in population abundances.In this study, we analyse a demographic time-series in a Mediterranean predator-prey system. We first describe inter-annual population numbers of Eurasian kestrels for a 15-year period. Next we describe the population dynamics of three kestrel prey species over 11-year period, including prey occupying different ecological niches: the insectivorous eyed lizard The study was performed in the Campo Azálvaro region, a highland grassland of central Spain . The area is a treeless flat valley at 1300 m a.s.l. located between Malagón and Ojos Albos mountain ridges and devoted mainly to cattle raising 2 . For 1999 only the abundance for autumn was given.t, B and D per capita birth and death rates, respectively and tR is the realized logarithmic per capita growth rate (PCGR) or rate of change of the population of the time interval. Rainfall or water in the broader sense is a surrogate for primary productivity t on each new term included in the model as derived from Lotka-Volterra equations in the logarithmic Gompertz version Estimates of the roles of density dependence and exogenous factors on the per capita growth rate log_e(N_t/N_t-1) were done by fitting different models of the form:1, b1, c1, d1, e1, f1 and g1 are constant parameters estimated by multiple linear regression, Nt−1 is one-year lagged population densities of prey species, R is rainfall, T is temperature and Kt−1 is one-year lagged density of kestrels. The term tε,is the noise term, normally being distributed N . All terms are log transformed.In the case of prey species:2, b2, c2 and d2 are constant parameters estimated by multiple linear regression, and N1, N2 are lagged population densities of prey species. In addition, once we knew what prey species showed significant correlation with kestrel PCGR, we also included the sum of prey species as independent variables In the case of kestrels:Finally, an alternative approach to modelling trophic interactions is to relate the PCGR to the ratio of consumers to their food resources, these models being known as logistic food webs 4, b4, c4, d4 and e4 are constant parameters estimated by multiple linear regression. In this model the terms were a combination of the ratio of trapped species and their food resources in the way Nt−1/Raint or Nt−1/Raint−1In the case of prey species:5, b5 and c5 are again constant parameters estimated by multiple linear regression.In the case of kestrels:We used corrected the Akaike's information criterion corrected for small sample size (AICc) r = 0.87, F1,13 = 42.74, P<0.0001, t-test t1,9 = 0.65, P = 0.56) from those breeding during the last three years (37.3±2.7). Even so, we did separate models considering first the seven-year period (“short period”: 1998–2004) during which the number of nest boxes where constant described kestrel growth rate as a function of the self-regulation and trophic (ratio of kestrel density to vole density) terms .Vole results showed that the best approximating model for the data was a logistic model (model 27v) including both trophic terms arising from the density ratios of predator to prey (kestrels/voles) and prey to food resource (voles/rain) and a positive effect of mean annual temperature . The secredation , food reredation and air redation . The aburedation , so thatAICc of the best model, and can thus be considered as a candidate model. This model is similar to the first but includes temperature as an additive climatic force. Shrew growth rate increased when the density of shrews (density dependence) and kestrels of the preceding year was low (The most parsimonious model found for shrew PCGR (model 16s) described a logistic food web composed of the self-regulation term (shrew density of the preceding year) and the ratio of kestrel to shrew densities . We foun was low and when was low .P>0.11). By exploring in more detail the incidence of precipitation on lizard abundance variation, we found that August precipitation of the previous year positively affected lizard population size . The response of lizard abundance to August precipitation of the preceding year was however better adjusted to a hyperbolic rather than to a linear function, since the former explained more variance .Missing summer data from 1999 did not allow us to perform PCGR models for the eyed lizard with the methods employed here. Meteorological variables were not significantly correlated to lizard abundance prompted population numbers of this predator species to increase to habitat carrying capacity through the provision of nesting sites. Eurasian kestrels in our study area predate on the three species considered in the study: common voles, eyed lizards and white-toothed shrews, however, only common vole densities showed an effect on kestrel population rate of change. We first analysed kestrel population dynamics during a seven-year period in order to avoid the effect of nest-box management on kestrel numbers. The results obtained from these analyses coincided with those found when analysing the whole 11-year period studied. This lends more merit to our short time series. Nevertheless, the results did not allow us to select a specific model that defines kestrel growth rate. In any case, our models indicate that self-regulation and vole density seems to be important factors modulating kestrel population dynamics. The sum or a conjunct variable of the densities of the three prey-species included in the model would identify the most parsimonious PCGR-function for the population dynamics of a generalist predator. However, this was not the case, probably because the common vole is a major key species in this predator-prey system. Even when common voles represent 1.8% of the prey consumed and 7% of biomass in general, its consumption can increase drastically in years of high vole abundance with respect to the rest of the prey species (unpublished data), suggesting that it is a preferred prey species. Another explanation is the association between precipitation and vole density. Rain had a positive effect on vole densities but also had positive effects on other kestrel prey species, such as Orthoptera insects that can fluctuate in a similar way to voles (see below).The study site is located in a mountainous Mediterranean area with cold winters where the ground may be covered by snow from 22 to 51 days of the year and with warm and dry summers. Rainfall is a prime stimulus for increased primary productivity The common vole is the studied rodent species showing the greatest variability in patterns of population dynamics. An analysis performed of 36 populations from Eastern Europe showed that 10% of them did not show clear periodicity in their inter-annual oscillations, and in the remaining populations the length of the dominant period (cycle) varied between 2 and 10 years Vole growth rate was negatively correlated with the ratio of kestrel to vole density. This shows that vole population grows the least when kestrels are abundant and suggests that kestrels could integrate an endogenous explanation (inter-population negative feedback) of vole dynamics, this being the effect observed when climatic factors are controlled for. This explains the asymmetrical interaction Great white-toothed shrew is predated by kestrels in very low proportions (0.1%). In fact, shrew prey remains in kestrels nests are only found when shrew density peaks, such as in years 1997 or 2004 (unpublished data). This could explain why a non mutual effect has been found between both species. The two best models defining shrew PCGR (17s and 22s) show a kestrel effect (integrated in the consumer/resource ratio) in addition to a self-regulation effect. Shrew dynamics are explained by a first-order feedback structure determined by one-year lagged shrew densities and influenced by kestrel predation that is not translated, however, to a second-order structure. The other best model (22s) adds an additive influence of mean annual air temperature. Together with the potential effect of temperature indicated above, in the case of shrews, warmer years can benefit shrew population growth by providing longer seasons of insect activity, thus increasing carrying capacity of the habitat for shrews.Although the eyed lizard represents an important prey species in the kestrel diet during the breeding season (19% of biomass), we did not find an effect of this species on kestrel PCGR. The real role of lizards in kestrel diet is lower as lizards are not predated during autumn, winter and early spring in our study area (unpublished data). The abundance of eyed lizards was described by a hyperbolic function associated with rainfall at the end of summer (August) of the preceding year. A positive effect of rainfall during the preceding summer has been observed in other lizard species from arid environments Asio otus in the same study area. Climatic variables modulated vole and shrew PCGRs in combination with kestrel density. Our results support expected from generalist predation, that is, a stabilization of prey populations as generalist predators prey on a particular species when this species is abundant. Predators may change to other prey when their primary prey becomes scarce, preventing outbreaks and crashes This study shows an analysis of preliminary 11-year data regarding population dynamics of a generalist predator and some of its prey species in a Mediterranean region. The most striking result of this study is the lack of second-order structure in the population dynamics of the three studied species. In the common vole we did not even find a first-order feedback or density dependence. The absence of this kind of dynamic could be due to the dominance of stochastic influence arising from climatic effects. In this sense, this study reports for the first time the effect of rainfall and ambient temperature on the population dynamics of the common vole. Veiga

Purpose. A common pediatric dilemma involves management of children with recurrent febrile urinary tract infections (UTIs) who have normal voiding cystourethrograms. Vesicoureteral reflux (VUR) has been demonstrated in such cases by performing a cystogram which positions the instillation of contrast (PIC) at the ureteral orifice. We describe the evidence supporting this diagnostic test. Materials and Methods. The literature was searched to identify and subsequently evaluate all studies investigating PIC cystography. Results. In patients with febrile UTIs and negative VCUGs, the PIC cystogram has been demonstrated to identify occult reflux (PIC-VUR). When identified and treated, these patients have a significant reduction in the incidence of febrile UTIs. Conclusions. Although the current literature on PIC cystography is limited, it appears to be a clinically useful test in a select group of patients with recurrent febrile UTIs, that are not found to have VUR on a conventional VCUG. A prospective randomized trial is underway to further define its role in the treatment algorithm of febrile UTIs. UTIs result in over1 million physician visits annually, affecting from 2.4% to 2.8% of children. Reference [Less than 50% of patients with febrile UTIs demonstrate VUR.Despite an adequate work up to include characterization of the type andsource of bacteria, upper tract evaluation to include renal ultrasound and DMSArenogram, and lower tract evaluation to include voiding cystography anddiagnosis of dysfunctional elimination syndrome (DES), the etiology ofrecurrent febrile UTIs often remains elusive. Theempiric management of these patients often involves administeringantimicrobials intermittently when infections occur or chronically asprophylaxis.Because we havebeen dissatisfied with such empiric management, we have pursued further testingfor reflux in such patients with recurrent febrile UTIs who show no evidence ofreflux on a conventional VCUG. This testing is known as the positionedinstillation of contrast (PIC) cystogram. This is done during cystoscopy bypositioning the instillation of contrast at the ureteral orifice under fluoroscopiccontrol. This is a test to check for VUR that may be clinically significant yetwas not identified on the conventional VCUG. The historical evolution of thistest was based upon observations that many of these children were found to havepatulous orifices that easily distended with the flow of water when they were evaluated endoscopically. Noted hydrodistentionwas then followed by checking for VUR using radiographic contrast fluid. As thereflux was demonstrated on PIC, but not by conventional VCUG, it is termedoccult. We detail the current knowledge regarding the test and our view on itsplace in the current management scheme of children with recurrent febrile UTIswho do not have VUR on conventional VCUG.the bladderis emptied,thecystoscope beak is positioned facing the ureteral orifice, close enough to theureteral orifice so that the orifice fills the cystoscopic view but not insidethe orifice,contrast tobe instilled is placed at a height of 1 meter above the level of the bladder.This is the height of contrast flow done for a conventional VCUG,via theirrigation port of the cystoscope, contrast is flowed toward the ureteralorifice while fluoroscopy is done,the bladderis then emptied and the procedure is repeated on the contralateral side . If the ureteral orifice isinsufficient to prevent reflux of contrast, hydrodistention will be noted atcystoscopy and VUR will be imaged by fluoroscopy.PIC cystography is performed at the time of cystoscopy. After induction of general anesthesia, thechild is placed in the dorsal lithotomy position. Using a rigid cystoscope, theurethra and bladder are systemically evaluated for anatomical abnormalitiessuch as ureteroceles, diverticuli, and mucosal abnormalities. The ureteralorifices are identified and evaluated for their position and trigonalappearance. The ureteral orifices are then evaluated for insufficiency, VUR, asfollows:In 2003, Rubenstein et al. introduced the technique and their experience in using thistest. Fifty seven children who underwent cystoscopy were evaluated. The data wasanalyzed by comparing the results in a control group versus those in the studygroup. The control group was comprised of 2 sets of patients: (a) patients not expected to demonstrate VUR as therewas not a history of febrile UTI, the ultrasound was normal, and theconventional VCUG was normal and (b)patients expected to demonstrate VUR on a PIC cystogram as there was a historyof febrile UTI and VUR was seen on conventional VCUG . The study group was comprisedof patients with recurrent febrile UTIs, a normal ultrasound, and a normal VCUG [In the study group, all 30 patients had at least one orifice with abnormal morphology. PIC-VURwas identified in all these patients with a history of febrile UTIs. All weretreated for VUR with either antimicrobial prophylaxis or reimplantation. During 8-month followup, no patientsexperienced a recurrent febrile UTI .More recently, Tareen et al. performed a similar study in a small number of patients resulting intheir recommendation that the PIC cystogram should be part of the algorithm inevaluating patients with recurrent febrile UTIs without VUR on VCUG. All 5 patientsin this study with radiographic confirmation of pyelonephritis showed PIC-VUR. Allwere treated with endoscopic injection of dextranomer/hyaluronic acid copolymeror vesicoureteral reimplantation. In a followup from 11 to 16 months, nopatient has had recurrence of febrile UTIs .From these initialreports, it is concluded that occult VUR identified by PIC cystography mayprovide an explanation for recurrent febrile UTIs in patients with otherwisenegative radiographic studies.These initial experiences with treatment of VUR demonstrated by PIC cystography for febrile UTIssparked the establishment of a multi-institutional registration of cases byEdmondson et al. . Four ceThis multi-institutional registry demonstrated a similar and reproducible incidence of PIC-VUR inpatients with recurrent febrile UTIs as Rubenstein's inaugural study. Thestudy also further established a correlation between orifice location andmorphology.To further examinewhether PIC-VUR is simply a radiographic observation or an entity with clinicalrelevance, the following studies were performed.Hagerty and the PIC Cystography Group concluded that PIC-VUR is clinically significant bydetermining that the incidence rate of febrile UTI is lowered significantly bytreatment of VUR identified by PIC. 14 centers enrolled 118 patients withrecurrent febrile UTIs, who demonstrated PIC-VUR. Patients were treated with underwentendoscopic injection (104), ureteral reimplantation (3), or antimicrobialprophylaxis (11). Overall, the incidence rate for febrileUTI decreased significantly from 0.16 per case/mo before PIC-VUR treatment to0.008 per case/mo after treatment. The post treatment rate of febrile UTIin cases treated with antibiotic versus surgery was not significantly different.Noe and Williams alsodescribed their experience with PIC cystography and simultaneous dextranomer/hyaluronicacid copolymer injection in 47 children with a history of pyelonephritis and negativeVCUG. Success was defined as no further febrile UTIs. Repeated VCUGs were not performed as in theprior studies, as they were negative prior to treatment. A total of 75% of thepatients had PIC-VUR and were treated endoscopically with dextranomer/hyaluronicacid copolymer. Three of the patients developed febrile UTIs after surgery andunderwent ureteral reimplantation. None of these patients have had recurrentfebrile UTIs. Only one patient has had an afebrile UTI during followup. Of the12 patients who did not have PIC-VUR, each only had 1 febrile UTI, not recurrentUTIs, prior to cystoscopy [Both of these studies further demonstrate that when a patient with febrile UTIs,with no other clear diagnosis, is identified as having PIC-VUR and is treated,they do not have recurrent febrile UTIs. This reinforces the concept thatoccult reflux identified by PIC cystography in patients with febrile UTIs isclinically significant and that the PIC cystogram is an important testingmodality that should be included in the present algorithm of the evaluation ofpatients with recurrent febrile UTIs.Pinto et al. researched the feasibility of avoiding the need to perform a VCUG on an awakechild after reflux treatment by performing a PIC cystogram immediately afterendoscopic injection. Pinto found the PIC cystogram was not useful for thispurpose in a study involving 61 patients with VUR identified on VCUG. Patients underwentdextranomer/hyaluronic acid copolymer injection followed by PIC cystography. Ifthe PIC cystogram was positive, no further injection of dextranomer/hyaluronicacid copolymer was given. The results of the PIC cystogram were compared to theVCUG done at 3 months postoperatively. Three ureters had positive PICcystograms. None of these patients werefound to have VUR on postoperative VCUG. Also, 14 patients had persistent VURon VCUG despite a negative PIC cystogram at the time of injection . Our aneCurrently, there is no evidence to support the use of PIC cystography after endoscopic injectionto predict postoperative outcomes. Therefore, it is not recommended to replacea postoperative VCUG with a PIC cystogram at the time of endoscopic correctionof VUR.The impact of intravesical pressure upon the status of PIC-VUR wasexamined from historical clinical considerations, in vitro simulation study,and clinical examination. Historically,it is commonly held that VUR may be induced in a normal ureteral orifice byconditions which chronically impose supraphysiological pressure such asneuropathic or nonneurogenic neurogenic bladder; however it is commonly heldthat VUR is not able to be induced by acute application of elevated intravesicalpressure . We haveCurrently, there are several widely accepted explanations for recurrent UTIs including thepresence of various host and bacterial virulence factors, as well asinadequately treated DES. Nevertheless, it is becoming widely accepted that itis also possible that this type of patient may have occult reflux, notidentified on conventional VCUG, that can allow ascent of a lower tractinfection to an upper tract infection that is febrile in nature. If so,identification and treatment of this form of occult reflux, PIC-VUR, results ina decrease in recurrent febrile UTIs. The PIC cystogram represents a relativelysimple objective way to identify this type of occult VUR that may be clinicallysignificant.In a recent debate on PIC cystography at the Society of Pediatric Urology it wasargued that there is little data evaluating whether or not occult VURidentified by PIC cystography can cause renal injury. In addition, febrile UTIsas described in most of this research on PIC cystography, do not necessarilyequate pyelonephritis . While tTo more definitively define the clinical significance of PIC cystography, a prospective randomized trial is now underwayin which patients who are identified as having PIC-VUR are being randomized into 2 study groups: observation (no antibiotics orsurgery) and treatment .Many children with recurrent febrile UTIs do not demonstrate VUR on conventional VCUG.Thus, in such children, there is neither a treatable diagnosisnor an evidence-based treatment plan. This scenario may become associated with significantmorbidity such as the need for hospitalization and renal damage. A treatable diagnosis could improve structuring a management strategy. Thecurrent research on PIC cystography shows that the PIC cystogram can identifyclinically significant occult VUR. Whenthis occult reflux is treated, the incidence of recurrent febrile UTIs issignificantly reduced. We conclude that including the performanceof PIC cystography in the present algorithm management of patients with recurrentfebrile UTIs and normal conventional VCUGs will aid structuring an evidence-basedtreatment plan. Future prospective randomized studies are currently underway torefine our understanding of the natural history of occult reflux and the rolethat PIC cystography has in identifying this type of reflux.

Each of these units forms polymeric chains along the c axis. Each Na+ ion is surrounded by six O atoms from four glucose mol­ecules, forming a distorted octa­hedral geometry. All glucose mol­ecules adopt chair conformations. The constituent units are linked into a three-dimensional framework by O—H⋯Cl and O—H⋯O hydrogen bonds, utilizing all the O—H groups.The asymmetric unit of the title compound, {[Na(C H. sagittifolia and its use in folk medicine, see: Duke 2]Cl = 0.042 wR(F 2) = 0.111 S = 1.06 27007 reflections715 parameters1 restraintH-atom parameters constrainedmax = 0.80 e Å−3 Δρmin = −0.40 e Å−3 ΔρAbsolute structure: Flack 1983, 13472 FFlack parameter: 0.02 (3) APEX2 used to solve structure: SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL and PLATON (Spek, 2009Data collection: 10.1107/S1600536809039993/ci2906sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809039993/ci2906Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

The accuracy of malaria case reporting is challenging due to restricted human and material resources in many countries. The reporting often depends on the clinical diagnosis because of the scarcity of microscopic examinations. Particularly, clinical malaria case reporting by primary health care facilities , which constitutes the baseline data of surveillance, has never previously been sufficiently evaluated. In order to improve the malaria reporting system to the level required to eventually eliminate this disease, this study estimates the gaps between the records of clinics and government statistics regarding the incidence of clinical malaria, and then also examines some factors that might explain the data discrepancy, including such variables as clinic staffing and record keeping.All medical records for outpatients in 2007, handwritten by nurses, were collected from local clinics in Honiara, the capital of the Solomon Islands. The all-monthly clinical malaria cases were then recalculated. The corresponding monthly data in official statistics were provided by the government. Next, in order to estimate any data discrepancy, the ratio of the cases recorded at clinics to the cases reported to the government was determined on the monthly basis. Finally, the associations between the monthly discrepancy and other variables were evaluated by a multiple regression analysis.The mean data discrepancy between the records of clinics and government statistics was 21.2% (n = 96). Significant associations were observed between the discrepancy and the average number of patients , illegible handwriting , the use of tally sheets , and the clinic level .The findings of this study demonstrate the huge data discrepancy between the records of clinics and government statistics in regard to clinical malaria case reporting. Moreover, the high numbers of patients, illegible writing, the disuse of tally sheets, and insufficient resources at some clinics are likely to be related to the increase in the discrepancy. The clinical malaria case reporting at the local clinic level therefore urgently needs improvement, in order to achieve both better malaria surveillance and to also eventually eliminate this disease in the Solomon Islands. At the clinic level, nurses handwrite patients' information into "outpatient books" reporting in 2007 , although total in SI was 60% . The definition, however, was often misunderstood by nurses as confirmed cases and only fever cases, which can potentially cause the misreporting of clinical malaria cases.As for government data to compare with clinics' data in the outpatient books, the unpublished data of clinical malaria in HIS were graciously provided by the Ministry of Health of the government in SI. Regarding the accuracy of data processing by the government following the submission of the paper copies of handwritten monthly reports from clinics to the government, it was verified that government correctly input the numbers of cases in the copies of monthly reports into their HIS system. It was because that all numbers of monthly cases in government statistics were the same as correspondent numbers of cases in the monthly reports of clinics. This means, in order to evaluate whether the data accurately reflect the true burden of clinical malaria, this study could focus on only the accuracy of reporting by nurses filling in the reports, not the accuracy of the following data processing by the government.Next, some factors such as clinic staffing and record keeping which were potentially related to the data discrepancy between clinics' outpatient books and government statistics were estimated. According to the monthly records in the outpatient books, the following variables were estimated: (a) average number of patients (per nurse and day), which is as a proxy of nurses' busyness; (b) number of illegible writing (per 100 patients); (c) number of omitted data regarding clinical diagnosis (per 100 patients); (d) slide confirmation (per 100 patients), and (e) treatment (per 100 patients). In (b), the illegible handwriting was counted, in case that the handwriting and the case could not be identified by both the author and nurses of the clinic. Also, (c) omitted data of diagnosis, (d) confirmation, and (e) treatment, were counted respectively, when there was no record of patients in the outpatient books. Furthermore, after pre-testing for two clinics to examine the validity of the interview thorough local interviewers, some variables were examined by the structured interviews to nurses who had worked in 2007 in all eight clinics: (f) percentage of registered nurses among both registered nurses and nurse aides; (g) whether monthly report was filled in by registered nurses; (h) use of tally sheets; (i) daily count of malaria cases; (j) whether correct definition of "clinical malaria" was shared by all nurses, and (k) weekly meeting of nurses and microscopists. For (g) to (k), were asked in a scale of four: almost always, often, sometimes, and almost never. With regard to (h), tally sheets are the sheets with a lot of blank circles divided into ten to help nurses to count, which is distributed by the government to all clinics. Variable (i) was included since some clinics were suspected to count a lot of cases on weekly or monthly basis, which might cause miscounting and miscalculation. Last, (l) clinic level " for upper two clinics given more resources such as nurses by the government and other six "Urban Health Clinic (UHC)") and (m) rainy season (from November to March), as a proxy of nurses' busyness besides (a), were also included. (a)-(f), (g)-(k), and (l)(m) were respectively continuous, ordinal, and categorical variables.For the analysis of the data discrepancy between clinics' outpatient books and government statistics and the association between the discrepancy and related variables ((a)-(l)), monthly data of the discrepancy and variables were used, because the values differed among months even in the same clinics. Therefore, the original sample size was 96, since each eight clinic has twelve values from January to December in 2007.The magnitude of data discrepancy between clinics' data and corresponding government data were computed as:| - 1 | (%)The clinics' data can be used as the reference which is more reliable than government data, because the discrepancy may be caused when nurses filled in the monthly report to the Ministry of Health according to clinics' data in outpatient books. At the same time, the monthly "direction" of data discrepancy or "negative" ) were recorded.Then, the mean of the monthly data discrepancy and variables among eight clinics in 2007 were compared using repeated measures analysis of variance (ANOVA) for normally distributed variables illegible handwriting and (e) omitted data of treatment) and Friedman's ANOVA test for non-normally distributed variables average numbers of patients (per nurse and day), (c) omitted data of diagnosis, (d) omitted data of slide confirmation, (f) registered nurses (%)) and all ordinal variables (g)-(k). Normality of was tested by Skewness/Kurtosis test. If the overall P value obtained from repeated measures ANOVA and Friedman test was significant, then post hoc multiple comparisons were performed by using Tukey-Krammer pairwise method.Finally, the associations between the monthly data discrepancy and measured variables were evaluated by a multiple regression analysis, after checking of the assumptions such as normality, overfitting, and multicollinearity. Data was entered, processed and analysed using Stata, version 10.0 . P < 0.0The monthly data discrepancy between clinics' data recorded in outpatient books and government statistics in clinical malaria case reporting stratified by eight clinics at Honiara are presented in Table When the "positive" (government data is larger than clinics' data) and "negative" directions of the data discrepancy were considered, the average of the discrepancy was -0.7% (Standard Error: 3.7%). The discrepancy with positive and negative direction also significantly differed among clinics . The post hoc comparison, however, indicated that no clinic had significantly greater discrepancy than other seven clinics.Table The post hoc comparison showed that Mbokona clinic had significantly larger (b) illegible handwriting and (e) omitted data of treatment than all other seven clinics, and (d) omitted data of slide confirmation than six clinics except Rove clinic. Also, Mbokona clinic had significantly smaller value in (h) use of tally sheets than all other clinics. White river clinic had significantly higher value on (j) shared definition of clinical malaria, and (k) weekly meeting by nurses and microscopists, compared to other clinics. Regarding (g) registered nurse filled in reports, White river and Rove clinic had significantly larger values than remaining six clinics. Rove clinic had significantly higher (a) average numbers of patients than other six clinics except Kukum clinic. There was a significant value of (f) registered nurses (%) in Mbokonavera clinic, compared to all other clinics. As for other values, there was no apparent significance among clinics.Next, the results of multiple regression for the relationship between the monthly data discrepancy in the reporting of clinical malaria and potentially variables related to the discrepancy are presented in Table This study demonstrated insufficient accuracy of clinical malaria case reporting through significant gaps between clinics' records and government statistics in HIS system. The average data discrepancy was large at 21.2%, indicating that one fifth of the numbers was over or underestimated when nurses reported the cases to the Ministry of Health of the government in SI. This finding suggests that there could be numerous reporting errors made by nurses in local clinics.Moreover, when the "positive directions" (government data is larger than clinics' data) and "negative directions" of the data discrepancy were estimated, the average discrepancy were -0.7%, which means there were almost the same chances of positive and negative directions to be cancelled out. As a result, the seeming discrepancy summarizing the monthly numerical superiority of the cases between clinics and the government was much smaller than the true discrepancy, namely 21.2%. This suggests that certainly nurses made a lot of reporting errors leading to the actual huge discrepancy; however, occasionally such errors would have randomly occurred among nurses, thereby reducing the magnitude of the data discrepancy. One of the possible explanations to both directions is nurses' misunderstanding of the definition of clinical malaria. According to the interview data, 62.2% of all nurses (n = 45) misunderstood the definition. Among the 62.2% of all nurses, 42.9% of the nurses overestimated clinical malaria cases, because they included fever cases into clinical malaria, which caused the positive direction of the discrepancy. By contrast, 57.1% of the nurses confused clinical malaria with slide-confirmed malaria, which caused the negative direction of the discrepancy. An example is that, in Mbokonavera clinic having -12.5% of the discrepancy ) were associated with the decrease in the data discrepancy between clinics' outpatient books and government statistics in clinical malaria case reporting.First of all, tally sheets can be one of the most reasonable and practical solution to accurate reporting. The Ministry of Health distributed tally sheets with a lot of blank circles divided into ten, which helped nurses to correctly count the cases by marking circles according to the records in outpatient books. Some nurses, however, lost the tally sheets, which may easily cause miscalculations. Particularly, Mbokona clinic with significantly smaller value in the variable of use of tally sheet than all other clinics never used the sheets in 2007. Thus, in Honiara, the usage of tally sheets should be encouraged in especially Mbokona clinic, aiming to reduce the significant data discrepancy of the clinic.Next, the increase in numbers of patients per nurse and day negatively associated with the accuracy of the reporting. The number of patients would be a proxy of nurses' busyness, since outpatients care may be their main work, even though they have additional work, such as home-visiting, meeting, and administrative things. When nurses do not have enough time to fill in the books due to many patients, they are likely to make more mistakes. Increasing the numbers of nurses to reduce the work-load per person could be a solution in the future. With regard to clinics in Honiara, Rove clinic, one of Area Health clinic (AHC) given more resources by the government, should be focused on, because the clinic had significantly greater number of patients than other clinics except Kukum clinic, the other AHC. At the time, however, for the accurate reporting, an increase in the percentage of registered nurses might be unnecessary, since the result indicated that the percentage of registered nurses was insignificantly related to the discrepancy. One possible reason is that the good data management to reduce the discrepancy depends on the skill of some chief registered nurses directing other nurses rather than the number of registered nurses. This implies that even registered nurses have different levels of clinical management skill, and then some clinics could have the better outcomes in months when careful registered nurses were moved in.In addition, the illegible handwriting in outpatient books was a significant problem that led to an increase in the discrepancy. In contrast, omission of data about diagnosis, investigation, and treatment were also often seen in the books, but they were not significant factors related to the frequency of the discrepancy. Perhaps this is because even if nurses omit specific data , they can successfully distinguish clinical malaria cases according to other data of the same patients. Moreover, unexpectedly the illegible handwriting and omission of data did not have strong correlations to nurses' work-load, such as the numbers of patients. This suggests other potential factors related to the illegible handwriting and omission. For a practical immediate solution, easier recording, like a chart with a scale allowing nurses to fill in just numbers into spaces of diagnosis, investigation, and treatment on the outpatient books, may prevent the illegible handwriting and omission. Among eight clinics in Honiara, Mbokona clinic had significantly larger illegible handwriting, which means that Mbokona clinic would need special efforts to improve their handwriting in order to reduce the huge data discrepancy.Last, it was observed that two upper level clinics (AHC), Kukum and Rove, given more resources by the government are likely to decrease the data discrepancy. This point, however, had debatable results: as mentioned above, Rove clinic had significantly larger patients related to the increase in the discrepancy. One of the reasons of this contradiction could be unknown potential confounders which associate with clinic level.Therefore, this study strongly implied that the central government and Honiara city council in SI should strengthen the supervision and training to nurses regarding clinical malaria reporting, in order to achieve the reliable surveillance and malaria elimination. In the supervision and training, encouragement of the use of tally sheets, legible handwriting, and the understanding of the official definition of clinical malaria ought to be emphasized. Also, further efforts to avoid large numbers of patients per a nurse and day in the current health system would be important. Such supervision and training to nurses should be introduced in some stages of their careers.This study potentially has memory bias, because some variables, such as use of tally sheets, and proportion of registered nurses were based on the memory of the nurses who have worked since 2007 in the same clinics. Also, the possibility that some clinics have additional outpatient books besides the collected ones cannot be denied. Furthermore, there can be some factors, like nurses' clinical diagnostic skill, which might correlate with the data discrepancy. In the interviews of this study, actually 38.9% of nurses recognized the insufficiency of their own diagnostic skills. This study, however, focused on the reporting accuracy, which is a separate issue from diagnostic accuracy as mentioned in background. In addition, this result cannot be generalized to other provinces in SI, because the study area is only in Honiara, the capital of SI, which has more human and material resources than other provinces.Finally, even though clinical malaria case reporting HIS could be improved, HIS is a kind of passive case detection (PCD), which could underestimate the burden of malaria because of the patients' poor access to clinics and self-medication. For the estimation of true burden, further study such as active case detection (ACD) will be needed -12.This study found insufficient accuracy of clinical malaria case reporting through significant gaps between clinics' records and government statistics. The average monthly data discrepancy was large with 21.2%, which shows one fifth of the numbers were over- or underestimated when nurses reported the cases to the Ministry of Health. This suggests that clinics made numerous errors leading to such huge discrepancy.Moreover, the study also suggests that the high numbers of patients, disuse of tally sheets, illegible writing, and some clinics given fewer potential resources by the government are significantly related to the frequency and magnitude of the data discrepancy. Additionally, in Honiara, certain clinics should be focused on to improve the reporting accuracy because of the significantly problematic status among clinics in some respects.In the end, the clinical malaria case reporting at local clinics urgently needs improvement for malaria surveillance and the disease elimination in SI.The author declares that they have no competing interests.The author initiated the study, led the field survey, analysed data and drafted the manuscript.

The incidence and mortality of hepatocellular cancer (HCC) complicating alcoholic and non-alcoholic fatty liver diseases (ALD and NAFLD) is rising in western societies. Despite knowing the at risk populations for HCC development, the lack of sensitive and specific means of surveillance hampers disease detection at curable stages. The most widely used serum HCC marker is alpha-fetoprotein (AFP), while PIVKA-II, glypican-3 (GP3) and Squamous Cell Carcinoma Antigen -1 (SCCA-1) have been proposed as new biomarkers. Assessment of these HCC biomarkers has largely been performed in patients with viral hepatitis. We conducted a cross sectional study assessing the value of these serum proteins, as well a novel candidate biomarker -follistatin – in patients with HCC arising on a background of ALD or NAFLD.Pre-treatment serum samples from 50 patients with HCC arising on a background of ALD (n = 31) or NAFLD (n = 19) were assessed by specific ELISA assay for PIVKAII, Glypican-3, SCCA-1 and Follistatin. Results were compared and contrasted with a control patient group with biopsy proven steatohepatitis-related cirrhosis (n = 41). The diagnostic accuracy of each of the candidate biomarkers was evaluated using receiver operating characteristic (ROC) curve analysis, reporting the area under the curve (AUC) and its 95% confidence interval (CI). Performance was compared to that of the established biomarker, AFP.Serum levels of all proteins were assessed by specific ELISA assays. GP3, SCCA-1 and follistatin had no HCC surveillance benefit in these patients. AFP and PIVKAII were superior to the other markers, particularly in combination.We conclude that while novel means of surveillance are urgently required, the combination of AFP and PIVKAII for HCC is an improvement on AFP alone in ALD/NAFLD patients. Furthermore, our data in this homogenous subset of patients- particularly that confirming no role for SCCA-1 – suggests that the choice of optimal biomarkers for HCC surveillance may be determined by the aetiology of underlying chronic liver disease. Hepatocellular carcinoma (HCC) is a major health problem worldwide, with more than 500,000 cases diagnosed annually . While tPIVKA-II is an abnormal prothrombin identified as an HCC biomarker in 1984 and sincOn a global scale, viral causes of chronic liver disease are the commonest predecessors of HCC and these proposed biomarkers have larOur data indicate differences in biomarker performance in NAFLD and ALD patients compared to performances reported in viral hepatitis. Neither PIVKAII, GP3, SCCA-1, nor the novel candidate Follistatin, has a role independent of AFP in HCC surveillance in steatohepatitis related cirrhosis. We show that the combination of AFP and PIVKAII is more valuable than AFP alone and suggest this approach be adopted as standard surveillance in this disease group.All patient serum and clinical information were collected with patient consent after approval by The Newcastle and North Tyneside Ethics Committee approved this study. Patients were diagnosed as having HCC as per guidelines proposed by the European Association for the Study of the Liver . Pre-treThe biochemical serum tests, including serum AFP, were measured using routine automated methods in the Biochemistry Laboratory at the Freeman Hospital, Newcastle upon Tyne. No patient positive for either HBsAg or HCV were included in this study.PIVKA-II was measured using a commercially available ELISA kit , according to the manufacturer's instructions. The detection limit is 01 ng/ml. The cut-off value was set as 20 ng/ml for differentiation between HCC and cirrhosis based on the findings in this study. Glypican-3 was measured using commercially available ELISA kit (Biomosaics limited) following the manufacturer's protocol. Serum SCCA-1 was measured as previously described an ELISA kit purchased from Xeptagen and following the manufacturer's instructions. Follistatin was selected for study based on its marked expression in HCC cell lines on microarray analysis and literature review identifying it as a secretory protein with a previously suspected role in hepatocarcinogenesis. Ten samples each from patients with NAFLD, NAFLD and cirrhosis, or NAFLD with cirrhosis and HCC were immunedepleted by multiple affinity removal and desalted using 5 K molecular weight cut off spin filters (Agilent technologies). Subsequently, 50 μg of protein was separated by SDS-PAGE and transferred to PVDF membrane (250 mA for 90 min). The membrane was then probed with mouse anti-follistatin antibody (R&D Systems) at 1:500 dilution at room temperature overnight. After washing in Tris Buffered Saline (0.1% Tween), the membranes were incubated with secondary peroxidase conjugated rabbit anit-mouse immunoglobulin and developed using ECL (Amersham). Subsequently, a direct ELISA assay for quantitative analysis, was developed using different concentrations of serum with serial dilution of primary antibody. Optimal conditions were using a raw serum dilution of 1:10 and an antibody dilution of 1:250.Quantitative variables were expressed as mean and standard deviation. Comparison between groups was by Pearson Chi-square, Wilcoxon or Student's t-test, as appropriate. Qualitative variables were expressed as count and percentage and comparisons between independent groups was by Pearson Chi-square. The diagnostic accuracy of each of the candidate biomarkers was evaluated using receiver operating characteristic (ROC) curve analysis, reporting the area under the curve (AUC) and its 95% confidence interval (CI). The diagnostic cut-off and the related sensitivity and specificity were determined. Statistical analysis was performed with SAS V8.2 software for PC, MedCalc version 7.4.3.0, as well as SPPS version 14.Serum AFP, PIVKA-II, GP3 and SCCA-1 levels were determined in 50 patients with HCC arising in a background of ALD or NAFLD cirrhosis. A control group of 41 patients with cirrhosis from ALD/NAFLD was used for comparison. The clinical characteristics of the patients in these groups are shown in Table The median AFP value determined in our patients with HCC and those with cirrhosis were 92.4 ng/ml and 5.96 ng/ml respectively. These data are represented using a log scale in Figure Mean PIVKA-II levels were also significantly different between patients with HCC and liver cirrhosis, as shown in 1B and Table The data for GP3 and SCCA-1 in this group of ALD/NAFLD patients with and without HCC is also presented in Figures Levels of follistatin were studied in immune depleted serum from individuals with either NAFLD (n = 10), NAFLD with cirrhosis (n = 10), or NAFLD with cirrhosis and HCC (n = 10) by western blot analysis. Representative data from 24 of these individuals is presented in Figure The increasing incidence of HCC, compounIn our study, serum AFP performs moderately well as a biomarker of HCC in ALD/NAFLD patients, with a sensitivity of 58% (15 ng/ml) in combination with a specificity of 100%. The AASLD recommended cut off level for diagnosis of HCC is 200 ng/ml , althougBoth the sensitivity and specificity for PIVKAII as an HCC biomarker were in the order of 80% at a level of 20 ng/ml. The addition of PIVKAII serum analysis to that of AFP increases the combined sensitivity to 94%. While this is at the modest expense of the specificity (reduced to 80.5%), the combination of both AFP and PIVKAII analyses may well be justified in our patients. It should be noted, however, that the added benefit is only in the detection of more advanced disease – as indicated in previous viral hepatitis studies and confirmed in our own NAFLD/ALD patients -the encouraging performance of PIVKA-II is predominantly a result of detection of larger, more advanced cancers.Assessment of the other candidate biomarkers was disappointing. Both the sensitivity and specificity of GP3 were poor in our patient set, indicating that it has no role at all in the surveillance of HCC in individuals with steatohepatitis related cirrhosis. Follistatin is an expressed transcript in fetal liver and has previously been identified by microarray as an up-regulated gene in HCC relative to dysplastic nodules . AlthougIn summary, while we propose the combination of AFP and PIVKAII for HCC surveillance in NAFLD/ALD patients, the search for novel biomarkers of early HCC disease should continue.The authors declare that they have no competing interests.DC has collected samples and with supervision performed the western blotting and the majority of ELISA assays, GB has directly supervised the ELISA assay optimisation and data collection, JG has optimised the method of serum preparation for subsequent analysis, SS, MH, CD have contributed to the study design and recruited patients to the study, PT has contributed to the study design and performed much of the statistical analysis, GG has performed all of the SSC1 biomarker ELISA assays and contributed substantially to data analysis and manuscript preparation, DM and HR conceived the study, contributed to its design and co-ordination, HR has completed final data analyses and written the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

Runt-related (Runx) transcription factors control diverse aspects of embryonic development and are responsible for the pathogenesis of many human diseases. In recent years, the functions of this transcription factor family in the nervous system have just begun to be understood. In dorsal root ganglion neurons, Runx1 and Runx3 play pivotal roles in the development of nociceptive and proprioceptive sensory neurons, respectively. Runx appears to control the transcriptional regulation of neurotrophin receptors, numerous ion channels and neuropeptides. As a consequence, Runx contributes to diverse aspects of the sensory system in higher vertebrates. In this review, we summarize recent progress in determining the role of Runx in neuronal development. Runt related (Runx) genes are evolutionarily conserved developmental regulators in metazoa, where they play diverse roles in several different biological systems, including cell differentiation. One of the Drosophila pair-rule genes, Runt, controls segmentation, sex-determination and neuronal development ..Runx3 haRunx3-/- DRG. One group proposed that Runx3 controls the appropriate axon targeting of trkC-expressing proprioceptive DRG neurons to motor neurons [+ neurons in Runx3-/- DRG in apparent contradiction to the previous proposition [Runx3 and Bax-double knockout mouse revealed clearly that the axonal projection of propioceptive DRG neurons to motor neurons is still lost in the Runx3 mutant even in the absence of apoptosis [+ and Runx3+ neurons were clearly segregated at embryonic day 16.5 (E16.5) but almost all Runx3+ neurons co-synthesize Runx1 at E18.5 and P0 [Runx3 and Bax compound mutants support a role for Runx3 in the control of axonal projection, although the molecular mechanisms remain unknown [Runx3-knockout mouse embryos extended short neurites in the presence of NT3, a ligand for TrkC, but not in the presence of NGF, a ligand for TrkA [et al. [tour de force method, that Runx3 activity determines the dorso-ventral position of axonal termination of DRG neurons in the spinal cord. DRG neurons with high Runx3 activity extended their axons far into the ventral spinal cord like proprioceptive neurons, whereas those neurons with low Runx3 activity extended their axons into the dorsal spinal cord. Ectopic expression of Runx3 is sufficient to drive axons from the dorsal to the ventral spinal cord, indicating that Runx3 per se has instructive roles in central axon targeting in DRG neurons.Second, the axonal outgrowth and/or axonal guidance of propiroceptive DRG neurons are also regulated by Runx3. Two different interpretations were proposed for the phenotype of the neurons . Howeverposition . A recenpoptosis . The stupoptosis . They obpoptosis . Of note5 and P0 . It is p5 and P0 . Overall unknown . Prior s [et al. revealedThus, Runx3 controls the neurotrophin receptor phenotype as well as the axonal projection of proprioceptive DRG neurons. The two functions may not be mutually exclusive but closely related to each other. For example, NGF/TrkA signalling and NT3/TrkC signalling are required for proper axonal projection ,32.+ DRG neurons. However, recent studies have investigated the roles of Runx1 in DRG neurons using different experimental models.In contrast to Runx3, the study of Runx1 function in DRG development was delayed owing to the early embryonic lethality of the targeting mouse ,23,33. TtrkA-expressing neurons differentiate into two subpopulations of nociceptive neurons; trkA-retaining peptidergic neurons, and non-peptidergic neurons that repress trkA and instead activate Ret, a receptor for glial-derived neurotrophic factor [p21 [Stifani and his colleagues ,23 have Ns) [p21 ,23.et al. [+ neurons in the trigeminal ganglion survive in contrast to DRG neurons in Runx3-/- mouse. Most Runx3 knockout mice of the C57/B6 strain die within one day after birth [Runx3 is strongly expressed in cranial ganglia, including the glossopharyngeal ganglion [The study of the neurological function of Runx3 other than in DRG is very limited. Levanon et al. reporteder birth ,16. The er birth . As thisganglion . It is pRunx1/Runx3 are tightly regulated and DRG is one of the tissues in which Runx1/Runx3 display their highest protein levels among the entire body; how do DRG neurons achieve such a high protein level for Runx1/Runx3? Second, the molecular bases of tissue specificity are largely unknown. Runx1 and Runx3 are highly homologous but they control the development of distinct subpopulations of sensory neurons. In particular, Runx1+ neurons and Runx3+ neurons project axons into totally different target tissues; how is this specificity achieved? Third, transcriptional regulation is not the only determinant of DRG neurogenesis. Ectopic synthesis of TrkC receptor per se influences the lineage commitment of DRG neurons [Although the roles of Runx in neural development have just begun to be investigated, studies in gene knockout mice indicate that the roles of Runx in the nervous system are as important as its roles in other, non-neuronal tissues. However, a number of open questions should be addressed in the future. First, upstream signalling cascades remain elusive. The mRNA expression and protein synthesis for neurons , while R neurons ,45. It i neurons .The authors declare that they have no competing interests.The first draft of this review was written by KI together with TS, which was then complemented by YI. The figure was composed by KI.

Major depression disorder (MDD) significantly increases the risk for coronary heart disease (CHD) which is a leading cause of mortality in patients with MDD. Moreover, depression is frequently observed in a subset of patients following acute coronary syndrome (ACS) and increases risk for mortality. Here evidence implicating omega-3 (n-3) fatty acid deficiency in the pathoaetiology of CHD and MDD is reviewed, and the hypothesis that n-3 fatty acid deficiency is a preventable risk factor for CHD comorbidity in MDD patients is evaluated. This hypothesis is supported by cross-national and cross-sectional epidemiological surveys finding an inverse correlation between n-3 fatty acid status and prevalence rates of both CHD and MDD, prospective studies finding that lower dietary or membrane EPA+DHA levels increase risk for both MDD and CHD, case-control studies finding that the n-3 fatty acid status of MDD patients places them at high risk for emergent CHD morbidity and mortality, meta-analyses of controlled n-3 fatty acid intervention studies finding significant advantage over placebo for reducing depression symptom severity in MDD patients, and for secondary prevention of cardiac events in CHD patients, findings that n-3 fatty acid status is inversely correlated with other documented CHD risk factors, and patients diagnosed with MDD after ACS exhibit significantly lower n-3 fatty acid status compared with nondepressed ACS patients. This body of evidence provides strong support for future studies to evaluate the effects of increasing dietary n-3 fatty acid status on CHD comorbidity and mortality in MDD patients. In the year 2000, the World Health Organization (WHO) identified major depressive disorder (MDD) as the fourth ranked cause of disability and premature death globally and projected that by 2020 MDD and ischemic heart disease will be the two most important causes of disability worldwide , 2. ThesThe pathoaetiology of MDD –12 and CTo evaluate the hypothesis that n-3 fatty acid deficiency is a risk factor for CHD morbidity and mortality in MDD, it is important to consider that the age at onset for unipolar and bipolar depression peaks in young adulthood (15–19 years) , 25, whede novo and are therefore entirely dependent on dietary sources to procure and maintain adequate concentrations in peripheral and central phospholipid membranes. Dietary sources of the vegetable n-3 fatty acid precursor α-linolenic acid include flaxseed, rape, linseed, canola, soy, and perilla oils. The biosynthesis of eicosapentaenoic acid and docosahexaenoic acid from ALA requires a series of microsomal elongation and delta-5 and delta-6 desaturase-mediated reactions [FADS1) and delta-6 (FADS2) desaturase genes are colocalized to chromosome 11 (11q12-13.1), and are highly expressed in liver, heart, and brain [As background, mammals are incapable of synthesizing n-3 fatty acids eactions , 33, andeactions , and this index was an independent risk factor for coronary artery disease [Emerging data also indicate that common single nucleotide polymorphisms in position –54. For disease . Taken cThere are large cross-national variations in per capita fish/seafood consumption, a surrogate for EPA+DHA intake. For example, annual seafood consumption in Japan (148 lb/person) is approximately 3-fold higher than in the USA (48 lb/person) , and thiOn a smaller scale, cross-sectional studies have also observed an inverse relationship between dietary n-3 fatty acid intake and prevalence rates of MDD, and that this relationship is stronger among women –72. For Another approach taken to evaluate the contribution of n-3 fatty acid status to the pathoaetiology of MDD and CHD is prospective longitudinal observational studies using baseline dietary n-3 fatty acid intake or membrane n-3 fatty acid composition as the predictor variable. In one of the largest prospective studies conducted to date, EPA+DHA intake was determined at baseline in 3317 young adult men and women (mean age: 32 years) residing in the USA, and depressive symptoms determined at a 10-year follow-up. It was found that among both men and women, the highest quartile of EPA+DHA intake at baseline was associated with a lower adjusted risk for depression at 10 years relative to the lowest quintile, and this association was stronger in women . Other sSeveral large prospective longitudinal studies have evaluated the relationship between baseline n-3 fatty acid status and the emergence of CHD mortality. In the Physicians' Health Study, a prospective case-control study of 14,916 healthy adult male physicians (aged 25–74 years) found that 94 men experienced sudden cardiac death (SCD) over the following 17 years. Whole blood long-chain n-3 fatty acid composition in SCD cases was compared with 184 demographically matched controls. It was found that the adjusted risk for SCD was reduced by 80% in subjects with the highest blood n-3 fatty acid levels compared with those with the lowest levels . SimilarTogether, these data indicate that low or no EPA+DHA intake is an independent risk factor for both CHD and MDD. However, only one prospective longitudinal study has evaluated the interrelationship between baseline n-3 fatty acid intake, baseline depressive symptom severity, and the emergence of CHD. The Zutphen Elderly Study, a prospective cohort study conducted in 332 elderly men (aged 70–90 years) residing in the Netherlands, found that higher baseline dietary EPA+DHA intake (mean: 407 mg/d) was associated with a 54% lower adjusted risk for mild to severe depression relative to lower dietary EPA+DHA intake (mean: 21 mg/d). However, baseline dietary EPA+DHA intake was not associated with a significant difference in the adjusted risk for CHD mortality during the 10-year follow-up period . The autmonotherapy significantly reduced symptom severity in pediatric and adolescent (8–12 years) patients with MDD [A method used to evaluate the causal relationship between n-3 fatty acid status and the pathophysiology of MDD and CHD is double blind randomized placebo-controlled n-3 fatty acid intervention trials. The results of randomized controlled n-3 fatty acid intervention trials in patients with unipolar or bipolar depression have been systematically reviewed previously , 86–90. with MDD . Indepenwith MDD , 93. In with MDD . TogetheCase-control studies have compared the n-3 fatty acid status of patients with demographically similar healthy controls using plasma, RBC, and adipose n-3 fatty acid composition. Importantly, RBC membrane EPA+DHA composition is highly correlated with habitual dietary EPA+DHA intake and plasma phospholipid EPA+DHA composition , 96. Morn = 17, mean age: 35 years) exhibited RBC EPA+DHA composition that was significantly lower than healthy adult controls [n = 548) exhibit RBC or plasma EPA+DHA values that are 21% lower than healthy controls (n = 218) n-3 fatty acid composition in MDD patients and healthy controls. In all of these studies, significantly lower plasma or RBC EPA+DHA composition was observed in MDD patients relative to healthy controls –107 Tab. In a sm = .006) . In thisP = .01) . These fP = .01) . n = 759), those with depression exhibited significantly lower RBC EPA+DHA composition relative to those without depression [To date there have been three studies that have determined the interrelationship between n-3 fatty acid status and depression in patients with established CHD. In the first study, ACS patients diagnosed with MDD exhibited significantly lower plasma EPA+DHA levels compared with nondepressed ACS patients . In a se = .002) . Taken cThere are several plausible biological mechanisms that could potentially link membrane n-3 fatty acid deficiency observed in MDD with increased risk for CHD. In addition to emerging clinical and preclinical evidence that n-3 fatty acids are protective against cardiac arrhythmias –114, oth2A receptors, and elevated 5-HT2A receptor binding density has been observed in platelets, as well as postmortem prefrontal cortex, of depressed suicide victims [2A receptor binding density in the rat prefrontal cortex [2A receptors are coupled to the phosphoinositide (PI) signal transduction pathway, and platelets obtained from MDD patients exhibit several indices consistent with PI-signaling hyperactivity, including elevated basal and/or stimulated intracellular inositol triphosphate, diacylglycerol, and/or calcium concentrations [2A receptors may also be coupled to phospholipase A2 (PLA2) which liberates membrane acetylated arachidonic acid, a precursor for proinflammatory prostaglandin synthesis, and chronic dietary n-3 fatty acid deficiency is associated with significant elevations in PLA2 activity in the rat prefrontal cortex [2A receptor-mediated signaling secondary to n-3 fatty acid deficiency may increase risk of thromboembolic events in patients with MDD and CHD [The antithrombotic actions of n-3 fatty acids have been well documented , and pla victims –122. Morl cortex , 124. Pltrations . It is rtrations –129. Morl cortex . Togethe and CHD .lower levels of inflammatory marker including CRP and IL-6 in both unadjusted and adjusted models [The mechanisms by which EPA+DHA reduce inflammatory signaling have been reviewed in detail previously and incld models .Elevated triglyceride levels (200–500 mg/dL) have been found to be an independent, albeit modest, risk factor for CHD –150. It n = 100) relative to healthy controls (n = 100) [Surprisingly few studies have investigated fasting triglyceride levels in patients with MDD, and the existing results are mixed. For example, one small case-control study found that although fasting triglyceride levels in male and female MDD patients did not differ from healthy controls, triglyceride levels were greater in male patients with melancholic features compared with men with atypical features . A seconn = 100) . Moreoven = 100) , and anon = 100) . Howevern = 100) , and patn = 100) . Althougn = 100) , 164. Mon = 100) . Future There is now a substantial body of evidence linking n-3 fatty acid deficiency with both MDD and CHD. Support for the hypothesis that n-3 fatty acid deficiency represents a preventable risk factor for comorbid CHD in MDD includes (1) cross-national and cross-sectional epidemiological surveys finding an inverse correlation between n-3 fatty acid status and prevalence rates of both CHD and MDD, (2) prospective studies finding that lower dietary or RBC EPA+DHA levels increase risk for both MDD and CHD, (3) case-control studies finding that a large subset of MDD patients exhibit an RBC EPA+DHA level that places them at high risk for emergent CHD morbidity and mortality relative to the general population, (4) meta-analyses of randomized controlled secondary n-3 fatty acid intervention studies finding significant advantage of n-3 fatty acids over placebo for secondary prevention of cardiac events in CHD patients and depression symptom severity in MDD patients, (5) cross-sectional and controlled intervention studies finding that n-3 fatty acid status is inversely correlated with other documented CHD risk factors, including increased platelet reactivity and aggregation, augmented inflammatory signaling, and elevated fasting triglyceride levels, and (6) ACS patients diagnosed with MDD exhibit significantly lower plasma EPA+DHA levels compared with nondepressed ACS patients. n = 332), and larger prospective trials have observed an inverse relationship between baseline n-3 fatty acid status and long-term CHD risk (reviewed above). Lastly, this study used a dietary n-3 fatty acid questionnaire to define baseline n-3 fatty acid status, and no objective measures were collected to corroborate accuracy. The most direct refutation of this hypothesis comes from a prospective longitudinal study finding that baseline n-3 fatty acid intake was inversely correlated with baseline depressive symptoms but was not associated with increased long-term CHD risk . HoweverIn view of the weight of current evidence, additional studies are clearly warranted to directly evaluate the interrelationship between n-3 fatty acid deficiency and CHD comorbidity in MDD. A definitive test of the proposed hypothesis would be to determine in a prospective longitudinal controlled trial whether increasing the n-3 fatty acid status of MDD patients decreases indices of CHD risk and emergent cardiac events and mortality. Increasing RBC EPA+DHA composition to ≥8%, which is associated with the greatest protection from CHD mortality , would r

Progression in disability as measured by increase in the Expanded Disability Status Scale (EDSS) is commonly used as outcome variable in clinical trials concerning multiple sclerosis (MS). In this study, we addressed the question, whether there is a linear relationship between disability status and health related quality of life (HRQOL) in MS.7305 MS patients were sent a questionnaire containing a German version of the "Multiple Sclerosis Quality of Life (MSQOL)-54" and an assessment of self-reported disability status analogous to the EDSS. 3157 patients participated in the study. Patients were allocated to three groups according to disability status.Regarding the physical health composite and the mental health composite as well as most MSQOL-54 subscales, the differences between EDSS 4.5-6.5 and EDSS >= 7 were clearly smaller than the differences between EDSS <= 4 and EDSS 4.5-6.5.These results indicate a non-linear relationship between disability status and HRQOL in MS. The EDSS does not seem to be interval scaled as is commonly assumed. Consequently, absolute increase in EDSS does not seem to be a suitable outcome variable in MS studies. Progression in disability as measured by increase in the Expanded Disability Status Scale (EDSS) is a frequently used outcome variable in clinical trials concerning multiple sclerosis (MS) -5.However, EDSS represents only a part of health related quality of life (HRQOL) in MS. HRQOL comprises several domains in addition to physical impairments like social functioning and psychological well-being ,7. ThereResults from several studies suggest a non-linear relationship between EDSS and HRQOL in MS. In a study by Vickrey et al., the difference between patients who walked with an aid and wheelchair-bound patients was smaller than the difference between patients walking without help and patients being dependent on a walking aid in most HRQOL domains . SimilarIn this study, comprising a large sample with a broad spectrum of patients, we addressed the question, whether there is a linear relationship between disability status and HRQOL in patients with MS. We therefore explored the difference regarding HRQOL between patients with differing ambulation status. Three groups of patients were compared for this purpose: patients who are confined to a wheelchair, patients who are impaired in ambulation without being wheelchair-bound, and patients with largely unimpaired ambulation.Data were collected using a postal survey of all 7305 MS-patients registered as patient members of the German MS Society in North Rhine-Westphalia. 3157 patients volunteered to participate, giving a response rate of 43.2%.The survey included a German version of the Multiple Sclerosis Quality of Life (MSQOL)-54 Questionnaire and a structured demographic and clinical questionnaire .The MSQOL-54 comprises questions from the Short Form 36-Item Health Survey as a generic measure of quality of life, and 18 additional MS specific items ,31,32. TSelf-report questions about ambulation status were developed which were analogous to information from the Expanded Disability Status Scale (EDSS) . The EDSDuration of disease was expressed as years of time since diagnosis instead of time since onset of disease.In July and August 2004, patients were sent the questionnaires and a cover letter which asked for participation, explained the importance of participation and clearly stated that all information would be treated in strict confidence. A pre-stamped and pre-addressed envelope was included. Patients were invited to call if they required further information.Univariate analyses of covariance were computed to evaluate differences regarding MSQOL subscales and composite scores between subgroups with different ambulation status. Gender was included as an additional factor while age and duration of disease were considered as covariates.Due to multiple comparisons the results were considered statistically significant only if p values were <.01.Statistical analysis was performed with the Statistical Package for Social Sciences (SPSS), version 15.The research protocol of the study was reviewed and approved by the Committee of Research Ethics at the Medical Faculty of the Technical University of Dresden. It was carried out in accordance with the Declaration of Helsinki. All subjects received written information on the study and gave written informed consent prior to participation.Proportions of missing results varied between 3.8% and 7.8% for the mentioned demographic and disease-related variables and between 1.9% (cognitive function) and 16.5% for MSQOL-54 subscales after replacing missing values as described above.71.7% of the 3045 respondents were women scale and the role limitations scale, there were so called floor and ceiling effects .As shown in figure The mean subscale scores of the MSQOL-54 are presented in table Men and women differed significantly in role limitations , pain and sexual function , with men having the higher score in pain and the lower scores in role limitations as well as sexual function table . Gender Regarding sexual function, there was a significant interaction effect between gender and ambulation status subgroup (p = .000). As can be seen in figure The goal of the study was to explore the nature of the relationship between disability as measured by EDSS and HRQOL in MS. Therefore, we assessed the differences between patient groups with differing disability status regarding their MSQOL-54 scale scores.The physical and the mental health composite of the MSQOL-54 as well as all subscale scores but cognitive function decreased with worsening disability status. However, while patients with an estimated EDSS score between 4.5 and 6.5 differed markedly from patients with a lower EDSS (0 - 4.0), the difference between the two groups of patients with higher EDSS scores was smaller on all of these scales, not even being significant on the mental health composite and most of the subscales. Hence, the results suggest, that whereas impaired ambulation (without confinement to a wheelchair) is accompanied by striking deteriorations in HRQOL, being bound to a wheelchair does not lead to decisive additional decreases in most HRQOL domains.The results are in agreement with those of previous studies. In a study by Patti et al. patients with EDSS scores lower 3.0 scored significantly better than two groups with higher EDSS scores in all dimensions of the SF-36 . In the Interestingly, in our study this pattern was found for sexual function only in men. In women the difference between groups 1 and 2 was smaller than in men, whereas the difference between groups 2 and 3 did not differ from the one found in men. Hence, the relationship between ambulation status and sexual dysfunction seems to be different in men and in women.Consistently with the results of other studies, cognitive function scores did not vary significantly between groups ,44. HencGender effects were only observed in three subscales. Likewise, other studies reported gender effects in only few or none of the HRQOL domains, respectively ,26,44-46The data obtained in this study clearly suggest a non-linear relationship between HRQOL and disability status as measured by EDSS. This is the case for physical as well as for mental quality of life. The EDSS does not seem to be interval scaled as is commonly assumed. The step from largely unimpaired ambulation to impaired ambulation status and the next step towards restriction to a wheelchair are not equal in distance. Therefore, absolute increase in EDSS, e.g. one point per year, is not suited for outcome variable in clinical trials in which the effectiveness of MS immunotherapy is examined. This outcome measure has been used in a number of decisive clinical trials -3. FolloAssessing EDSS scores based on self-ratings of ambulation status can be seen as one limitation of this study. Yet, the EDSS itself relies heavily on ambulation. Besides, a number of authors emphasize that a self-rating of disability status can be seen as a good substitute for neurological assessment if this is not available ,26,48. TThe German MS Society is divided into parts similar to the federal states of Germany and supports around 50,000 MS patients. The patients from the North Rhine-Westphalian section represent the largest proportion compared to the other German sections. The question is to which extent these patients are representative for the whole German MS community. On the other hand a possible selection bias has to be discussed. Thus, members of the MS Society could form a special subgroup and patients working on the questionnaire could be especially motivated. The response rate obtained in this study was not as high as was hoped for, but the sample nonetheless is relatively large and covers a brought spectrum of patients. With regard to age, gender and duration of disease the distribution given in this sample is in line with the one found in other studies of MS patients ,45,46,49In conclusion, the results of the present study indicate a nonlinear relationship between disability status and HRQOL. They therefore contradict the assumption that the EDSS is interval scaled. Consequently, absolute increase in EDSS does not seem to be a suitable outcome variable in MS studies.The survey was funded by the German MS Society "Deutsche Multiple Sklerose Gesellschaft" (DMSG) in North Rhine-Westphalia, Germany.There are no redundant publications or conflicts of interest.ST and SW performed the statistical analysis and drafted the manuscript. MS helped to draft the manuscript. MW conceived the study and drafted its design. SS helped to conceive the study and participated in the data collection. DP gave advise and helped to draft the manuscript. JKl developed the design of the questionnaires, helped to conceive the study and managed the project. JKu conceived the study, drafted its design and helped to manage the project.All authors read and approved the final manuscript.

With conventional radiation technique alone, it is difficult to deliver radical treatment (≥ 60 Gy) to gliomas that are close to critical structures without incurring the risk of late radiation induced complications. Temozolomide-related improvements in high-grade glioma survival have placed a higher premium on optimal radiation therapy delivery. We investigated the safety and efficacy of utilizing highly conformal and precise CyberKnife radiotherapy to enhance conventional radiotherapy in the treatment of high grade glioma.® image-guided radiosurgical system. The majority of patients (88%) received concurrent and/or adjuvant Temozolmide.Between January 2002 and January 2009, 24 patients with good performance status and high-grade gliomas in close proximity to critical structures were treated with the CyberKnife. All patients received conventional radiation therapy following tumor resection, with a median dose of 50 Gy (range: 40 - 50.4 Gy). Subsequently, an additional dose of 10 Gy was delivered in 5 successive 2 Gy daily fractions utilizing the CyberKnifeDuring CyberKnife treatments, the mean number of radiation beams utilized was 173 and the mean number of verification images was 58. Among the 24 patients, the mean clinical treatment volume was 174 cc, the mean prescription isodose line was 73% and the mean percent target coverage was 94%. At a median follow-up of 23 months for the glioblastoma multiforme cohort, the median survival was 18 months and the two-year survival rate was 37%. At a median follow-up of 63 months for the anaplastic glioma cohort, the median survival has not been reached and the 4-year survival rate was 71%. There have been no severe late complications referable to this radiation regimen in these patients.We utilized fractionated CyberKnife radiotherapy as an adjunct to conventional radiation to improve the targeting accuracy of high-grade glioma radiation treatment. This technique was safe, effective and allowed for optimal dose-delivery in our patients. The value of image-guided radiation therapy for the treatment of high-grade gliomas deserves further study. High-grade gliomas are generally aggressive tumors with poor prognosis . They tePresently, it is our clinical practice to treat high-grade glioma patients with maximum safe surgery followed by 6 weeks of chemoradiation . It has been generally feasible with conventional radiation technique to deliver such "full dose" treatment while respecting institutional peritumoral critical structure maximum point dose tolerances Table . However®, a commercially available frameless image-guided radiosurgery system , was installed at Georgetown University Hospital in late 2001. Standard components include a light weight linear accelerator, a robotic manipulator and an automated x-ray image-guided computer targeting system. Generally, the treatment planning system with input from the user selects hundreds of small non-isocentric circular radiation beams to deliver a highly conformal radiation treatment with steep dose gradients to a defined target in order to spare normal tissues [The CyberKnife tissues ,18. SubsPatients with newly diagnosed resected unifocal high-grade gliomas (WHO Grade III and VI) in close proximity (<1 cm) to critical structures Table were evaThe extent of surgical resection was documented as total tumor resection or subtotal tumor resection following review of operative reports and post operative MRI imaging Table . SalvagePatients were placed in the supine treatment position with their heads resting on a standard support. A custom thermoplastic mask was crafted. Thin-sliced (1.25 mm) high-resolution CT images were obtained through the cranium for conventional and CyberKnife treatment planning. Treatment planning MRI imaging was completed selectively to enhance target and critical structure delineation when clinically indicated. Target volumes and critical structures were contoured by team neurosurgeons. Treatment volumes were generous including the contrast enhancing tumor volume when present and the surgical defect with a 3 cm margin. Critical structures in close proximity to the target volume were not excluded from the treatment volume during conventional radiation treatment. Forty to 50.4 Gy was delivered in 1.8 to 2.0 Gy fractions 5 days a week for a total of 4 to 5 1/2 weeks. Treatment was delivered using linear accelerators with nominal energies ≥ 6 MV. Intensity modulated radiation therapy (IMRT) technique was not permitted.® radiosurgical system for cranial tumors have been described in detail [® radiosurgical system. An inverse planning method with non-isocenteric technique was used. The treating physician and physicist input the specific treatment criteria, limiting the maximum dose to critical structures describes the uniformity of dose within a treated target volume, and is directly calculated from the prescription isodose line chosen to cover the margin of the tumor:HI = Maximum dose/prescription doseThe new conformity index (NCI) as formulated by Paddick , and modPTC = The percentage of the target volume covered by the prescription isodose line.Image-guided radiosurgery was employed to eliminate the need for stereotactic frame fixation. Using computed tomography planning, target volume locations were related to cranial landmarks. With the assumption that the target position is fixed within the cranium, cranial tracking allows for anatomy based tracking relatively independent of patient's daily setup. Position verification was validated every third beam during treatment using paired, orthogonal, x-ray images ,24.Patients received concurrent and/or adjuvant chemotherapy at the discretion of their medical oncologist. Typically, patients were administered Temozolomide with concurrent radiation at a dose of 75 mg/m2/d, given 7 d/wk from the first day of conventional irradiation until the last day of CyberKnife treatment. After a 4-week break, patients generally received 6 cycles or more of adjuvant Temozolomide on a 5-day schedule of 150 to 200 mg per square meter every 28 days.Clinical evaluation and MRI imaging were performed at 3-6 month intervals following CyberKnife treatment for 5 years. Evaluation frequency beyond 5 years was determined by the medical oncologist. Throughout the follow-up period, a multidisciplinary team of neurosurgeons, radiation oncologists, medical oncologist and radiologists reviewed outcomes at a weekly central nervous system tumor board. Toxicity was scored according to the National Cancer Institute Common Terminology Criteria for Adverse Events, Version 3.0 The follow-up duration was defined as the time from the date of surgery to the last date of follow-up for surviving patients or to the date of death. Actuarial survival and local control was calculated using the Kaplan-Meier method.Twenty four consecutive eligible patients were treated over a seven year period extending from January 2002 to January 2009 . Upon completion of conventional treatment, an additional dose of 10 Gy was delivered in five successive 2 Gy daily fractions utilizing the CyberKnifeThe median follow-up was 23 months for glioblastoma multiforme patients and 63 months for anaplastic glioma patients Table . No patiUltimately, 16 patients experienced local progression during follow-up Table . SalvageHigh grade gliomas adjacent to critical structures are difficult to treat with conventional radiation therapy technique alone . When ir® radiosurgical system has several advantages over conventional radiation delivery systems. Since hundreds of non-isocentric treatment beams are available, the CyberKnife is capable of delivering a highly conformal treatment [In this study, we utilized the highly conformal and accurate fractionated CyberKnife radiotherapy to enhance conventional radiotherapy and investigated the safety and efficacy of this technique. The CyberKnifereatment ,18. Cranreatment -31. FurtThis is the first study to evaluates CyberKnife enhanced conventionally fractionated radiation therapy and chemotherapy for high-grade gliomas. Twenty-four patients were treated with encouraging 2 year and 4 year overall survival rates of 37% and 71% for the glioblastoma multiforme and anaplastic glioma cohorts, respectively. There were no severe late toxicities attributed to this technique using conventional total radiation doses of approximately 60 Gy. Our results demonstrate the feasibility, tolerability and efficacy of delivering CyberKnife enhanced conventionally fractionated radiation therapy and chemotherapy. Unfortunately, local progression remains the predominant pattern of failure for these patients despite optimal radiation treatment and chemotherapy Figure . NonetheBC is an Accuray clinical consultant.EO participated in data collection, data analysis and manuscript preparation. BC participated in drafting the manuscript, treatment planning, data collection and data analysis. KE participated in data collection, data analysis and manuscript revision. XY participated in treatment planning, data collection and data analysis. SL participated in treatment planning, data collection and data analysis. SS created tables and figures and participated in data analysis and manuscript revision. HH participated in data collection, data analysis and manuscript revision. JK participated in data collection, data analysis and manuscript revision. HP created tables and figures and participated in data analysis and manuscript revision. AE participated in data collection, data analysis and manuscript revision. CK participated in treatment planning, data analysis and manuscript revision. KM participated in treatment planning, data analysis and manuscript revision. DS participated in data analysis and manuscript revision. WJ participated in treatment planning, data analysis and manuscript revision. SC participated in drafting the manuscript, treatment planning, data collection and data analysis. All authors have read and approved the final manuscript.

We demonstrated that CREB is overexpressed in acute myeloid and leukemia cells compared to normal hematopoietic stem cells. CREB knockdown inhibits leukemic cell proliferation To understand downstream pathways regulating CREB, we performed expression profiling with RNA from the K562 myeloid leukemia cell line transduced with CREB shRNA.By combining our expression data from CREB knockdown cells with prior ChIP data on CREB binding we were able to identify a list of putative CREB regulated genes. We performed extensive analyses on the top genes in this list as high confidence CREB targets. We found that this list is enriched for genes involved in cancer, and unexpectedly, highly enriched for histone genes. Furthermore, histone genes regulated by CREB were more likely to be specifically expressed in hematopoietic lineages. Decreased expression of specific histone genes was validated in K562, TF-1, and primary AML cells transduced with CREB shRNA.We have identified a high confidence list of CREB targets in K562 cells. These genes allow us to begin to understand the mechanisms by which CREB contributes to acute leukemia. We speculate that regulation of histone genes may play an important role by possibly altering the regulation of DNA replication during the cell cycle. Several proto-oncogenes have been demonstrated to be deregulated in human cancer. In particular, the development of the hematologic malignancies such as leukemia, is associated with aberrant expression or function of proto-oncogenes such as c-myc, evi-1, and c-abl. Many translocations with cytogenetic abnormalities that characterize leukemias involve rearrangement of transcription factors, including AML-ETO and Nup98-hox. Some of these leukemia-associated fusion proteins predict prognosis, e.g. t, t, and inv(16) are associated with a good prognosis in acute myeloid leukemia (AML) [We identified that the cyclic AMP Response Element Binding Protein (CREB) was overexpressed in the majority of bone marrow samples from patients with acute leukemia ,3. CREB To understand the role of CREB in normal and neoplastichematopoiesis we investigated the expression of CREB in primary cells from patients with acute lymphoblastic (ALL) and myeloid leukemia and found that CREB was overexpressed in the majority of leukemia cells from patients with ALL and AML at the protein and mRNA levels ,3,12. Fu based on ChIP chip data [CREB target genes have been published on the website developed by Marc Montminy hip data . Additiohip data . In theihip data . These sin vitro and in vivo [Since CREB is overexpressed in bone marrow cells from patients with acute leukemia compared to normal HSCs, this provides a potential target for leukemia therapy. To this end, we stably transduced myeloid leukemia cells with CREB shRNAlentivirus. CREB kn in vivo . However in vivo . To undeThe following human leukemia cell lines were transduced with shRNAs: K562 (Iscoves + 10% FCS) and TF-1 , shRNA-2 (5'GTACAGCTGGCTAACAATGG3'), shRNA-3 (5'GAGAGAGGTCCGTCTAATG3'), LuciferaseshRNA (5'GCCATTCTATCCTCTAGAGGA3'), Scramble shRNA (5'GGACGAACCTGCTGAGATAT3'). Short-hairpin sequences were synthesized as oligonucleotides and annealed according to standard protocol. Annealed shRNAs were then subcloned into pSICO-R shRNA vectors from the Jacks laboratory at MIT [The CREB specific shRNA sequences were selected and validated based on accepted parameters established by Tuschl et al. -19; CREBy at MIT . The secy at MIT .Total RNA (10 μg) was extracted from K562 cells transduced with vector alone or CREB shRNA was submitted to the UCLA DNA Microarray Facility. RNA samples were labeled and hybridized by standard protocol to Affymetrix Gene Chip Human Genome U133+ Array Set HG-U133A array. Gene expression values were calculated using the MAS5 software. The expression values are quantile normalized across all arrays. We obtained the expression profiles for a control set and CREB downregulated K562 cells. A t-test is performed between the two groups to identify significantly differentially regulated genes. The analysis was performed using Matlab . We find a significant number of differentially expressed genes, which are either direct or indirect targets of CREB.[To further characterize the data we have aligned CREB binding data from chromatin immunoprecipitation studies with our expression data. The chromatin immunoprecipitation data was obtained from the website . To iden to identify Gene Ontology terms that were enriched in the list.We characterize these genes using three types of analyses: Ingenuity Pathway Analysis (IPA), Gene Ontology term enrichment analysis and tissue distribution. For the former analysis, we used the Ingenuity Pathways Analysis tool on the lists of significant downregulated genes. We then identified functions that were overrepresented among these genes. For the second, we used the DAVID website HG_U133A/GNF1H and GNF1M Tissue Atlas Datasets.[Finally, we compute the tissue distribution of the 200 genes we identified as functional CREB targets. The tissue specific expression profiles of each gene are obtained from Datasets.. We firs6) were lysed in Trizol and stored at -80°C prior to RNA extraction. RNA extraction was performed according to a standard protocol supplied by the manufacturer (Invitrogen) and pellets were resuspended in RNAse free water. The cDNA was transcribed with a Superscript RT III based-protocol. DNAse treatment was not performed due to the selection of intron-spanning primers. Quantitative real-time PCR was performed with the SyberGreen reagent (Bio-Rad) in triplicates and analyzed by the standard curve method standardized to the housekeeping gene beta actin[K562 transduced with CREBshRNA.Since CREB has been described as both a transcriptional activator (when phosphorylated) and a repressor, we were interested in genes that were both up and downregulated in CREB shRNA transduced cells. The resulting rank ordered list allows us to sort genes by their likelihood of being functional CREB targets in K562 cells. It is difficult to determine, however, where to draw a threshold between the true and false targets. We have decided to restrict our analysis to the top several hundred targets that had both significant changes in expression and binding, as we deemed these to be highly enriched for true versus false targets. However, we do not claim that these are the only functional CREB targets in K562 cells, as the exact number of true targets is difficult to determine. The top down and upregulated genes revealed by this analysis are listed in Tables Genes within the downregulated list were BECLIN 1, UBE2B. Both these genes have a cAMP responsive element binding site(s) in their promoters. These genes were selected for further validation because they are known to be involved in autophagy/apoptosis (BECLIN 1), cell cycle/DNA repair (UBE2B) -28. QuanHaving confirmed the validity of our microarray results in these two test cases we set out to characterize the function of the complete list of CREB target genes using two annotation schemes. The first utilizes the annotation contained in the Ingenuity Pathway Analysis software (IPA). This analysis showed that there is a significant enrichment for cell cycle P < 1e-3) and cancer (P < 1e-3) genes. The full list of genes associated with cancer is shown in Table and cancIPA also allows us to study CREB target genes in the context of protein-protein interactions networks. A network for downregulated genes interacting with CREB is shown in Figure The second analysis that we performed used the terms from Gene Ontology to identify common characteristics among the top K562 CREB targets. Here we find the striking and unexpected result that ten percent of the downregulated targets code for histone genes (P < 1e-10, Table To further validate the hypothesis that CREB is an activator of these 20 histone genes, we utilized previously published analyses of the gene promoters to identify consensus CREB binding sequences. The results shown in Table We examined the distribution of expression of these 20 histone genes across human tissues. The expression data were obtained from the GNF body atlas. We were able to extract expression profiles for 81 histone genes contained in the human genome. Fifteen of these overlapped with the 20 histone CREB targets. We show the expression of all 81 histone genes in Figure We examined the expression of three histones that are putative targets of CREB by real time PCR with mRNA from K562, TF-1, and primary cells from patients with AML. The three histones selected were based on our microarray analyses. Our results demonstrated a statistically significant decrease in histonesHIST1H2Bj, HIST1H3B, and HIST2H2AA in K562 and TF-1 cells Figure . InteresWe have identified a high confidence list of CREB target genes in K562 myeloid leukemia cells. Several important CREB target genes that function in DNA repair, signaling, oncogenesis, and autophagy were identified. These genes provide potential mechanisms by which CREB contributes to the pathogenesis of acute leukemia. Expression of the genes beclin-1 and ube2b was found to be decreased in myeloid leukemia cell lines and primary AML cells in which CREB was downregulated. In addition, we speculate that CREB may have more global effects on transcription, primarily through the regulation of histone genes thereby altering the regulation of DNA replication during the cell cycle.The authors declare that they have no competing interests.MP and SFN analyzed the microarray data, performed the statistical analysis, and drafted the manuscript. JCC, JC, DJ, and JT performed the real-time PCR experiments. KMS supervised the experiments and wrote the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:Supplementary table 1Click here for fileSupplementary table 2Click here for file

In virus-infected cells, RIG-I-like receptor (RLR) recognizes cytoplasmic viral RNA and triggers innate immune responses including production of type I and III interferon (IFN) and the subsequent expression of IFN-inducible genes. Interferon-β promoter stimulator 1 is a downstream molecule of RLR and is expressed on the outer membrane of mitochondria. While it is known that the location of IPS-1 is essential to its function, its underlying mechanism is unknown. Our aim in this study was to delineate the function of mitochondria so as to identify more precisely its role in innate immunity. In doing so we discovered that viral infection as well as transfection with 5′ppp-RNA resulted in the redistribution of IPS-1 to form speckle-like aggregates in cells. We further found that Mitofusin 1 (MFN1), a key regulator of mitochondrial fusion and a protein associated with IPS-1 on the outer membrane of mitochondria, positively regulates RLR-mediated innate antiviral responses. Conversely, specific knockdown of MFN1 abrogates both the virus-induced redistribution of IPS-1 and IFN production. Our study suggests that mitochondria participate in the segregation of IPS-1 through their fusion processes. Virus-infections, such as influenza and chronic hepatitis C, are prominent diseases and outbreaks of newly emerging viruses are serious problems for modern society. Higher animals, including humans, are genetically equipped with mechanisms, collectively known as innate immunity, to counteract viral infections. RIG-I-like receptor (RLR), a cytoplasmic sensor, contributes to immune regulation by detecting infections by RNA viruses and triggering a series of responses which results in the activation of innate antiviral genes. Furthermore, it has been demonstrated that IPS-1, the adaptor protein of RLR, is expressed on mitochondrial outer membrane. Mitochondrion is an organelle of prokaryotic cell origin; it regulates energy production, and is involved in cell growth and cell death. Why IPS-1 is located on the mitochondrial outer membrane and how mitochondria are involved in antiviral signaling are yet to be explained clearly. In this report, we discovered that mitochondrial fusion protein MFN1 plays a novel function to mediate IPS-1 redistribution, which appears to be a critical step in RLR signaling. Type I and III interferons (IFNs) play central roles in innate immune responses to viral infections IFNB1, IL29, IL28A, IL28B and CXCL11) and interferon-stimulated genes . Furthernd OASL) . The lowLike endogenous IPS-1, FLAG-tagged IPS-1 is expressed on mitochondria in uninfected cells as shown by co-staining with MitoTracker , Mock. HWe also examined the distribution of IPS-1 in 5′ppp-RNA-transfected cells. Unlike synthetic single stranded RNA (5′OH-RNA), 5′ppp-RNA is a chemical ligand for RIG-I and is known to mimic viral signaling In order to activate RLR signaling, we used NDV to infect cells because it is available an anti-nucleocapsid protein (NP) antibody, a probe for the viral RNA-NP complex. NDV infection resulted in foci of NP in the cytoplasm and induced foci of RIG-I to form [16]. RITo determine if the observed redistribution of IPS-1 is functionally relevant, we used a point mutant of RIG-I (K270A), which normally recognizes ligand RNA but functions as a dominant negative inhibitor [14]. ItRIG-I was originally identified by screening an expression cDNA library Mfn1 or Mfn2 gene was used to confirm the specific involvement of MFN1 in virus-induced antiviral signaling is expressed on, and implicated in the fusion of the mitochondrial inner membrane To explore the molecular mechanism of how IPS-1 is regulated by MFN1, co-immunoprecipitation was performed using cells stably expressing IPS-1. FLAG-IPS-1 was precipitated by anti-FLAG and the associated proteins were analyzed by immunoblotting . Both MFNext, we examined what effect the knockdown of MFN1 would have on the virus-induced redistribution of IPS-1. Three independent siRNA efficiently knocked down MFN1 expression resultinRIG-I mediated antiviral signaling is a critical antiviral response which is initiated when the RIG-I sensor recognizes viral RNA. A signal is relayed to IPS-1, a mitochondrial regulator which delivers the signal downstream. Interestingly, the IPS-1-HeLa clones in this study exhibited very low basal expression of IFN genes, which led us to speculate that IPS-I inhibitory protein(s) is up regulated in these clones. We also examined the expression level of NLRX1, an IPS-1 inhibitor We observed that the IPS-1 level did not change for up to 12 h in virus-infected cells and no specific modification of IPS-1 was identified up to that point. We therefore hypothesize that the activation status of IPS-1 is determined by its localization pattern. We speculate that the mechanism of mitochondrial fusion is mediated by MFN1, and that IPS-1 translocates from some mitochondria and finally accumulates densely on others. On the other hand, forced overexpression of full-length IPS-1 results in constitutive signaling MFN1 and MFN2 are structurally similar and both occur on the outer membrane of mitochondria. Their functions however are not redundant, as the single knockout of either produces a certain mitochondrial phenotype We demonstrated that the redistribution of IPS-1 is induced by various viral infections and 5′ppp-RNA transfection and is dependent on a functional MFN1. The precise mechanism of the IPS-1 redistribution is not known, however we propose a model described in In summary, our study provides new insight into why the mitochondrial localization of IPS-1 is essential to its function. We demonstrated that MFN1 regulates the redistribution of IPS-1 in a RIG-I-signal-dependent manner. The mitochondrion provides a platform for the coordination of antiviral signaling by receiving the initial signal from the activated RIG-I. The signal is amplified through the accumulation of IPS-1, and other essential molecules such as tumor necrosis factor receptor-associated factors (TRAFs) and signaling protein kinases are recruited to mobilize active transcriptional regulators. In this regard, another organelle, the late endosome, functions similarly as a platform for antiviral signaling by recruiting different signaling components. This is initiated by Toll-like receptors , another subtype of nucleic acid sensors.HeLa, SKHep1, MEF, and 293T cells were maintained in Dulbecco's modified Eagle's medium with 10% fetal bovine serum and penicillin–streptomycin . L929 cells were maintained in minimum essential medium with 5% fetal bovine serum and penicillin-streptomycin. Immortalized wild-type MEFs and MEFs deficient in Mfn1 or Mfn2 were obtained from Prof. David Chan . HeLa, L929, and 293T cells were transfected with Lipofectamine 2000 (Invitrogen). Stable transformants of IPS-1-HeLa cells were established by transfection of a linearized empty plasmid (pEF-Tak) or expression plasmid for FLAG-IPS-1 (pEF-Tak-FLAG-IPS-1), and selected with G418 (1mg/ml). We used HeLa IPS-1#2 clone for most experiments because IPS-1#2 clone showed higher induction of IFN among the stable clones, but we confirmed that other clones also showed the same phenotype. IPS-1/RIG-Iwt and IPS-1/RIG-I K270A-expressing HeLa cells were generated by transduction using a lentivirus system. cDNA for RIG-I wt or RIG-I K270A was cloned into the multi-cloning site of a lentiviral vector, pCSII-CMV-MCS-IRES2-Bsd. The recombinant lentiviruses were generated by co-transfection of the lentiviral vector together with lentivirus constructs, pCMV-VSV-G-RSV-Rev and pCAG-HIVgp, into 293T cells. At 48 h post-transfection, the culture supernatant was collected, and then added to IPS-1#2 HeLa cells. Three days later, the cells were selected with Blasticidin (10µg/ml).Cells were treated with culture medium or infected with SeV, NDV, Sindbis virus, EMCV, Influenza virus, or VSV at a MOI of 1 or 0.5 for qRT-PCR or immunofluorescence, respectively. The yield of EMCV in the culture supernatant was determined with a standard plaque assay pEF-Bos-FLAG-RIG-I CARD and pEF-Bos-FLAG-IPS-1 have been described previously Nucleotide sequences of the synthetic RNA were described previously The preparation of cell extracts, luciferase assay, and immunoblotting have already been described The siRNA negative control and siRNAs targeting MFN1, OPA1, or DRP1 were purchased from Invitrogen, and transfected with RNAi MAX (Invitrogen) according to the manufacturer's recommendation . At 48 or 72 h post-transfection, cells were harvested or infected with NDV or SeV, then subjected to qRT-PCR, immunofluorescence, or SDS-PAGE followed by immunoblotting.IFNB1, human OPA1, murine Ifna4, murine Ifnb1, and 18s rRNA were purchased from Applied Biosystems. The RNA copy numbers were normalized to that of internal 18s rRNA. In the microarray analysis, we used the Genopal microarray system according to the manufacturer's instructions (Mitsubishi Rayon). Biotin-labeled RNA was prepared with a MessageAmp II-Biotin Enhanced kit (Ambion).Total RNA was prepared with TRIZOL (Invitrogen) and treated with DNase I (Roche Diagnostics). A High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) was used for cDNA synthesis, and mRNA level was monitored with the Step One plus Real Time PCR system and TaqMan Fast Universal PCR Master Mix (Applied Biosystems). TaqMan primer-probes for human For immunofluorescence analysis, cells were fixed with 4% paraformaldehyde for 10 min, permeabilized with an acetone: methanol (1∶1) solution, and blocked with 5mg/ml of BSA in PBST for 1 hour. The cells were next incubated with relevant primary antibodies overnight at 4°C, and then incubated with relevant Alexa Fluor 405, Alexa Fluor 488, or Alexa Fluor 594-conjugated secondary antibodies. Mitochondria were stained with MitoTracker Red CMXRos according to the manufacturer's instructions (Molecular Probes). Nuclei were stained with DAPI (4.6-diamidino-2-phenylinodole). The fluorescence image was quantified by software provided by Leica Microsystems. The percentage of IPS-1 redistribution among NDV-infected cells was scored by 3 persons, and data are shown as means ± s.d. of the three independent scores. Cells were analyzed with a Leica confocal laser-scanning microscope (TCS-SP2). For immunoelectron microscopy, cells were fixed with 4% paraformaldehyde and 0.05% and 0.01% glutaraldehyde for 10 min to detect NP and the FLAG tag, respectively, and then incubated with PBS containing 20% normal goat serum (NGS) and 0.075% Photo-Flo (Kodak) for 30 min at room temperature. The cells were incubated with the anti-NDV NP antibody or anti-FLAG antibody in PBS containing 2% NGS and 0.075% Photo-Flo overnight. After several washes with PBS, the cells were further incubated with a 1.4 nm gold-conjugated anti-mouse IgG goat IgG Fab fragment (Nanoprobes) in PBS containing 2% NGS and 0.075% Photo-Flo overnight. They were then washed with PBS and postfixed with 0.1 M phosphate buffer containing 1% (v/v) glutaraldehyde for 10 min at room temperature. After washing in distilled water, the gold particles were silver-intensified with an HQ silver kit (Nanoprobes) for 10–15 min. Then, the immunostained cells were incubated with 0.5% osmium tetroxide in 0.1M phosphate buffer for 40 min at room temperature. After dehydration with ethanol, cells were embedded in epoxy resin . Once the resin was polymerized, the cells were cut into ultrathin sections on an ultramicrotome, Reichert-Nissei Ultracut S (Leica). The ultrathin sections were mounted on mesh grids, and stained by the Reynolds method. Finally, the ultrathin sections were examined with an electron microscope .

Obtaining synchronous cell populations is essential for cell-cycle studies. Methods such as serum withdrawal or use of drugs which block cells at specific points in the cell cycle alter cellular events upon re-entry into the cell cycle. Regulatory events occurring in early G1 phase of a new cell cycle could have been overlooked.fos, atf3 and tceb) by qPCR to further validate the newly identified genes.We used a robotic mitotic shake-off apparatus to select cells in late mitosis for genome-wide gene expression studies. Two separate microarray experiments were conducted, one which involved isolation of RNA hourly for several hours from synchronous cell populations, and one experiment which examined gene activity every 15 minutes from late telophase of mitosis into G1 phase. To verify synchrony of the cell populations under study, we utilized methods including BrdU uptake, FACS, and microarray analyses of histone gene activity. We also examined stress response gene activity. Our analysis enabled identification of 200 early G1-regulated genes, many of which currently have unknown functions. We also confirmed the expression of a set of genes candidates (Genome-scale expression analyses of the first two hours of G1 in naturally cycling cells enabled the discovery of a unique set of G1-regulated genes, many of which currently have unknown functions, in cells progressing normally through the cell division cycle. This group of genes may contain future targets for drug development and treatment of human disease. Our studies of histone gene regulation have fostered a long term interest in events occurring in G1 phase and G1/S phase transition of the cell cycle To study events occurring in the cell division cycle, it is essential to be able to obtain synchronous populations of cells. Researchers have used different methods to achieve this goal. The most common technique used in the past was serum starvation Our interest in studying events occurring in G1 and early S phase led us to develop a robotic mitotic shake-off apparatus. Since serum starvation blocks cells in G0 and they reenter the cycle in late G1 upon readdition of serum to the growth medium Here we describe a new approach to an old technique, mitotic selection, described years ago We wanted to examine gene activity in early G1 phase of the cell cycle in human cells moving naturally from mitosis into a new cell cycle. Most of what is known about G1 phase regulation came originally from studies utilizing cells synchronized by serum starvation, contact inhibition, thymidine blocks or drugs We used an automated mitotic shake-off machine to collect mitotic cells 2-adapted media and returned to standard growth conditions. Ten to fifteen minutes after plating, the cells exit mitosis and proceed into a new cell cycle.Mitotic cells were collected every 10 minutes into 250 ml-conical tubes and stored on ice. Since microtubule polymerization is inhibited at temperatures below 4°C Post-mitotic pairs of CHO cells, 1 hour after plating are shown in We also examined cell synchrony in mitotically selected cell populations by flow cytometry of propidium iodide (PI) labeled cells. We then examined the synchrony of mitotically selected cells by obtaining the gene expression profiles of the replication-dependent histone genes. The temporal regulation of expression of the histone gene family is well characterized shake 1, which includes RNA samples collected over a period of fourteen hours after mitotic selection at intervals of two hours (8 slide arrays) and shake 2, where samples were collected in fifteen-minute intervals over a period of two hours after mitotic selection (9 slide arrays). Thus, shake 1 examines gene activity from mitosis to the midpoint and beyond of S phase. Shake 2 is a close examination of the first two hours of G1. In a study that was published previously shake 1.We used human genome-scale microarray analyses of RNA samples obtained from populations of cells progressing into the cell cycle after mitotic selection. The two genome scale microarray experiments are referred to here as shake 1 and shake 2. Note that replication-dependent genes do not produce polyadenylated mRNA and are not in standard EST collections, but were deliberately included on these arrays. shake 1. The RD histone gene activity shows 7–8 fold upregulation of these genes at the expected time, 6 hours and beyond, when the cells are entering S phase of the cell cycle. The replication-independent genes such as h2afx and h2av show a relatively constant expression profile across all time points (0 to 14 hours). shake 2 which includes most of the histone genes shown in shake 1). All of the RD histone genes on the shake 2 arrays show no evidence of upregulation as expected for cells in early G1 phase. Upregulation of the RD genes does not occur at this early point in the cell cycle, which spans from telophase through early G1. The RD histone gene expression data observed in shake 2 correlates very well with histone gene activity observed in the early time points of shake 1, i.e., 0 h and 2 h and cycs (cytochrome c). shake 1) and 3B (shake 2) profile the relative change in gene expression of these stress genes shake 1 and the first two hours of G1 phase (shake 2). None of these mechanical stress genes show significant upregulation in gene expression by mitotic selection. These data indicate that the mitotic selection method is a stress-free system as it does not activate the mechanically-induced genes. Shake 2 results are particularly important, since these gene arrays profile gene activity every 15 minutes from collection of late telophase cells by shake-off through the first two hours of G1 phase.Since our goal was to examine gene activity in early G1 of normal, unperturbed cycling cells, it was important to inspect the activity of genes which might be activated by stress, in particular, mechanical stress, in cells obtained by mitotic shake-off. In the analyses presented in To validate the comparison of our gene profiles for early G1 phase to the many studies involving the restriction point later in G1, we examined the set of genes identified as being activated in response to serum stimulation shake 2) was based upon 9 gene arrays. Total RNA was isolated every 15 minutes from 0 time (late telophase) to 2 hours after mitotic selection. RNAs from populations harvested at these time points were hybridized to slides containing 29,000 gene targets. Our goal for this study was to identify those genes whose activity was the most highly variable over the two hour period of early G1.Our analysis of genome activity over the first two hours of a new cell cycle identified the two hundred genes whose activity was the most variable over the two hour period examined. This list is available as a supplementary data , which was shown to not vary in previous studies shake 2. Similar results were observed when using total RNA with no amplification step (data not shown). Specific primers for c-fos, atf3, tceb3 and a hypothetical protein were used to quantitate the relative amounts of RNA in the 9 experimental samples from shake 2. The results are presented graphically. The profile of gene activity for these genes is directly comparable to that observed in Verification of the variable gene expression we observed in the array experiment shake 2 . Knowledge of events occurring after mitosis and before the R point in mammalian cells has come primarily from cells blocked, then released, in S phase or at G2/M by inhibitory drugs We used a well-characterized human cancer cell line in which Rb and p53 are inactivated, but genes involved in cell cycle progression, DNA replication, chromosome segregation and cell adhesion show appropriate activity in the cell cycle Methods which involve limitation of growth factors and use of drugs alter cellular events upon re-entry into the cell cycle once the block is removed. For example, cells synchronized using aphidicolin or mimosine show highly elevated levels of checkpoint regulatory proteins, p53 and p21, and these elevated protein levels persist even after the cells are released from the block shake 1) that spans a period of 14 hours after plating mitotic cells. The dataset shows that the upregulation of these replication-dependent genes occurs 6 hours after plating, which coincides with G1/S transition in HeLa cells shake 2), we show that neither replication-dependent or -independent histone genes present on the human gene arrays vary in activity over the first 2 hours of G1 or throughout the first 14 hours of a new cell cycle (shake 1). We then examined a set of well-characterized genes that were identified as being activated in serum starved cells, in response to serum stimulation shake 2) is likely due to its involvement in signaling pathways essential for cells to progress in the cell cycle, and particularly beyond G1. The exact role of CTGF in the cell cycle is not completely understood. One study showed that use of anti-sense approach against CTGF reversed angiotensin II-induced renal hypertrophy by releasing renal cells from angiotensin II-induced G0–G1 arrest Next, we examined stress-response gene activity among those known genes which could be considered pertinent to our selection method, gene products associated with mechanical stress. Researchers have identified genes activated under various types of mechanical stress In contrast to the histone genes, the stress response genes, and genes activated in starved cells upon serum addition to the growth medium, a set of genes was identified as having high variation in activity in early G1 of the cell cycle. We have identified the 200 most highly variable genes among the 29,000 genes represented on the arrays, showing up- or down-regulation over the 2 hours of early G1 phase see . Many geshake 2 experiment. Taken together with the gene activity profiles of the families of genes which serve to validate both the temporal window of the cell cycle we examined and the stress-free method by which we synchronized cells, the G1-regulated genes identified here should provide new information and understanding of important events occurring early in the cell cycle.In In summary, we have shown here that the mitotic shake-off technique is a reliable method to study cell cycle events, particularly those occurring early in a new cell cycle. As we have demonstrated, this is a relatively stress-free system. The limitation of the use of this approach is that many cell types, those which attach too tightly to the growth substrate, or alternatively, those which do not shake off in a predictable fashion due to lack of adhesion to the growth surface, can not be synchronized by this technique. Our selection method spans a window of 10 minutes, and ensures that most of the selected cells enter S phase within a relatively short period where over 95% of the selected cells reenter the cell cycle synchronously. We have included data obtained by a variety of experimental methods to show synchrony of the cell populations, ranging from genome-wide scale microarray analyses to FACS analysis of DNA content of the cell populations, proving the merit of the technique. We have also identified a number of potential G1 regulators which may play essential roles in cell cycle progression, normal growth and proliferation, as well as tumorigenesis. We are currently using mitotic selection to obtain cells for the examination of subcellular localization of interesting proteins, and are searching for new regulators of the cell cycle, primarily those essential for progression into and beyond the G1 phase of the human cell division cycle.2. At the time of the experiment, the flasks are removed from the growth incubator and placed inside the temperature-regulated chamber (37°C), on the vibration platform. A motor under the control of a computer chip vibrates the platform for 15 seconds at 10-minute intervals. After each vibration, cells detached from the flasks were collected and stored on ice. Thus, we select cells detaching from substrate during the previous 10 minutes. The intensity/force of shaking can be adjusted based upon the cell type. HeLa or CHO cells were cultured in 75 cm2 flasks. HeLa cells were grown in Dulbecco's Modified Eagle Medium, 10% fetal bovine serum and 1% MEM non-essential amino acids (Sigma M7145). CHO cells were grown in McCoy's 5A medium supplemented with 10% calf serum. Penicillin-streptomycin (Gibco-BRL) at 1% is added to the culture media. For FACS analysis, the cells were harvested at indicated times after mitosis. Cells were stained with propidium iodide as described by others Prior to the time of the mitotic selection experiment, cells are grown to the appropriate density in a humidified chamber at 37°C, 5% COHeLa cells were cultured as described above. For bromodeoxyuridine (BrdU) incorporation, the cells were pulse-labeled with the BrdU agent for 30 min before harvest at the designated time post-mitotically. Cells were fixed with 70% ethanol in glycine for 20–30 min at −20°C, and then washed 3 times with PBS. Fixed cells were prepared for immunocytochemistry as described earlier http://genome-www5.stanford.edu//) to analyze, sort and cluster microarray raw data. For data retrieval, the normalized ratio of mean intensities from the experimental and control samples was considered. The genes selected for analysis were chosen using their corresponding clone IDs. Gene names and accession numbers displayed in all figures were generated from the SMD online analysis software, and accession numbers were further verified using the S.O.U.R.C.E online tool (http://genome-www5.stanford.edu/cgi-bin/source/sourceSearch). Two shake-off experiments were used in these analyses, shake 1, which was conducted over 14 hours and samples collected every 2 hrs, and shake 2 which was conducted over 2 hours and samples collected every 15 minutes. A previous paper shake 1, from double-thymidine blocked cells, and from thymidine-nocodozole blocked cells and compared data from all three synchronization methods to identify cell cycle regulated genes common to all three experimental sets. Here we analyze changes in gene expression over the course of shake 1 and shake 2 to identify G1-regulated genes, producing data sets unique to this analysis. The data discussed in this manuscript have been deposited in NCBI's Gene Expression Omnibus http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?accGSE12473)Mitotic cells were collected using mitotic shake-off. Total RNA was prepared using ULTRASPEC RNA isolation system . Reference RNA was prepared from asynchronously growing HeLa cells using TRIzol (Invitrogen). For cDNA synthesis and microarray hybridization, refer to Whitfield et al. http://source.stanford.edu), and Gene Ontology analysis was conducted using the Database for Annotation, Visualization, and Integrated Discovery (DAVID) http://david.abcc.ncifcrf.gov/gene2gene.jsp). GO biological process annotations were analyzed using the Functional Annotation Tool. GO biological process terms that were at least 2-fold enriched and had a false discovery rate of less than 10% are shown in UniGene mRNA accession numbers, representative of identified genes, were generated from Clone IDs using SOURCE of ratio of experimental to control normalized intensities. We calculated the standard deviation of the log2 ratio of these intensities amongst the nine times at which expression was determined for each spot on the array. We then ordered these standard deviations and focused on those genes with the highest variability.Microarray data was confirmed using either total or amplified RNAs from original samples. Total RNAs were amplified using MessageAmp™ aRNA Kit (Ambion) per instructions of the manufacturer. RNA samples were quantified by UV absorbance spectrophotometry at 260 nm, or NanoDrop® (ND-1000 spectrophotometer) and were stored in RNase-free water at −70°C. The aRNAs were run on 1.25% agarose gel to check integrity and correct size of the synthesized aRNA products as determined by ethidium bromide staining. For reverse transcriptase (RT) - reaction, equal amounts (250 ng) of total RNA or 1 µg of aRNA from each sample were used. First strand cDNA synthesis was done in 20-µl reaction containing a random hexamer, dNTPs at 10 mM, and RT enzyme (New England Biolabs) at 15 units and standard buffer. The cycle was 65°C for 5 minutes, ice (2–5 minutes), 25°C for 10 minutes, 37°C for 45 minutes, 85°C for 5 minutes and 4°C for 10 minutes. One-tenth (2 µl) of the cDNA reaction volume was amplified in 25-µl reactions containing the SYBR Green mix and each primer set designed to amplify specifically the transcribed region of the candidate genes, or α-actin (see below) using the BioRad iCycler iQ real-time PCR detection system. The cycles were 95°C for 5 minutes, repeated 40 times, 95°C for 1 minute and 55°C for 1 minute, followed by a cycle of an increment increase of 0.4°C repeated 100 times for melt curve data collection and analysis. α-actin primers were used to verify changes in experimental RNAs across the time points and α-actin was chosen because it is not regulated in the HeLa cell cycle fos (forward primer) 5′ AGA TTG CCA ACC TGC TGA AGG AGA 3′;fos (reverse primer) 5′ TGG ATG ATG CTG GGA ACA GGA AGT 3′;tceb (forward primer) 5′ AGA AAT CAC ACA AGG CCC TCT CCA 3′;tceb (reverse primer) 5′ TTT ACC TTG GGC AAC AGG TCT CCT 3′;hypothetical protein (forward primer) 5′ TCG TAT GCA GAA TCT GTG GGA GCA 3′;hypothetical protein (reverse primer) 5′ TGG TCT GGG CTT GAG GTT CAT CAT 3′;atf3 (forward primer) 5′ TCA AGG AAG AGC TGA GGT TTG CCA 3′;atf3 (reverse primer) 5′ CTT CTT GTT TCG GCA CTT TGC AGC 3′;actin (forward primer) 5′ GTG CGT GAC ATT AAG GAG AAG 3′;α-actin (reverse primer) 5′ GAA GGT AGT TTC GTG GAT GCC 3′.α-Table S1http://genome-www5.stanford.edu/), and accession numbers were further verified using the S.O.U.R.C.E online tool (http://genome-www5.stanford.edu/cgi-bin/source/sourceSearch). The full data is available online (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?accGSE12473)List of 200 highly variable genes (Shake 2). Genome-scale analysis of G1-regulated genes. The identified genes are presented using their corresponding clone IDs. Gene names and accession numbers displayed in all tables were generated from the SMD online analysis software ((0.25 MB DOC)Click here for additional data file.Table S2http://genome-www5.stanford.edu/), and accession numbers were further verified using the S.O.U.R.C.E online tool (http://genome-www5.stanford.edu/cgi-bin/source/sourceSearch). The full data is available online (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?accGSE12473)List of 100 genes with highest expression at any time point (Shake 2). Genome-scale analysis of G1-regulated genes. The identified genes are presented using their corresponding clone IDs. Gene names and accession numbers displayed in all tables were generated from the SMD online analysis software ((0.13 MB DOC)Click here for additional data file.Table S3http://genome-www5.stanford.edu/), and accession numbers were further verified using the S.O.U.R.C.E online tool (http://genome-www5.stanford.edu/cgi-bin/source/sourceSearch). The full data is available online (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?accGSE12473)List of 100 genes with lowest expression at any time point (Shake 2). Genome-scale analysis of G1-regulated genes. The identified genes are presented using their corresponding clone IDs. Gene names and accession numbers displayed in all tables were generated from the SMD online analysis software ((0.14 MB DOC)Click here for additional data file.Table S4GO analysis. Gene ontology analysis of G1 genes Click here for additional data file.

Caenorhabditis elegans presynaptic specializations. Nine presynaptic proteins were GFP-tagged, allowing visualization of multiple presynaptic structures. Changes in the distribution and abundance of these proteins were quantified in 25 mutants that alter different aspects of neurotransmission. Global analysis of these data identified novel relationships between particular presynaptic components and provides a new method to compare gene functions by identifying shared protein localization phenotypes. Using this strategy, we identified several genes that regulate secretion of insulin-like growth factors (IGFs) and influence lifespan in a manner dependent on insulin/IGF signaling.Cells are organized into distinct compartments to perform specific tasks with spatial precision. In neurons, presynaptic specializations are biochemically complex subcellular structures dedicated to neurotransmitter secretion. Activity-dependent changes in the abundance of presynaptic proteins are thought to endow synapses with different functional states; however, relatively little is known about the rules that govern changes in the composition of presynaptic terminals. We describe a genetic strategy to systematically analyze protein localization at Cells are divided into multiple subcellular compartments that perform diverse functions. In neurons, synapses mediate transmission of information between cells and they comprise hundreds of proteins dedicated for this purpose. Changes in the protein composition of synapses are thought to produce changes in synaptic transmission, such as those that occur during development, learning, and memory. Here, we describe a systematic genetic strategy for analyzing the protein composition of synapses. Using this strategy, we identified sets of genes that alter synapses in similar ways, and identified novel regulatory relationships between particular synaptic proteins. One set of genes regulated secretion of insulin-like hormones from neurons and had corresponding effects on lifespan, which is controlled by insulin signaling. These results illustrate how changes in synaptic composition can be utilized as a probe to explain changes in physiology. Our approach can be expanded to include a larger set of synaptic proteins or to analyze other subcellular compartments. Differentiation and organization of eukaryotic cells require regulated localization of specific proteins into subcellular compartments where they perform discrete functions. Global analysis of protein localization in yeast revealed that >40% of proteins localize to specific subcellular compartments The large variety of proteins in subcellular compartments implies substantial genetic and biochemical complexity. Therefore, addressing these questions will require comprehensive and systematic approaches beyond the study of single genes or proteins. Such approaches have been successful in identifying groups of functionally related genes based on similarities in their expression patterns, or similarities in the phenotypic consequences of disrupting gene function In neurons, presynaptic specializations are estimated to contain approximately one thousand proteins that are configured into discrete compartments; these compartments contain different organelles and perform different cellular functions in neurotransmitter release Synapses are able to operate over a broad range of functional states, which endow circuits with the capacity to store and process information. Relatively little is known about how the protein composition of synapses is altered across these functional states, nor how these changes contribute to differences in synaptic transmission. Is the abundance of proteins associated with the same subsynaptic structure (e.g. SVs) always correlated across physiological states? To what extent do the binary interactions between presynaptic proteins govern changes in presynaptic composition? Can changes in protein localization profiles be linked to changes in behavior and physiology of the whole animal?C. elegans by measuring in vivo changes in the abundance and distribution of a panel of fluorescently tagged presynaptic proteins. These proteins label distinct subsynaptic compartments and are involved in diverse aspects of neurotransmitter release The mutations selected for this analysis affect diverse aspects of synaptic transmission, including G-protein signaling pathways and components of exocytic or endocytic machinery involved in the SV cycle. Some of these mutations are well characterized, based on previous behavioral, electrophysiological or ultrastructural studies. These well-characterized mutations served as positive controls to validate our approach, and provide canonical protein localization profiles for comparison to less-characterized mutations. The majority of the mutations we analyzed decrease neurotransmission, but we also selected four mutations that increase neurotransmission required to coordinate particular aspects of synaptic function. Fourth, this dataset could be used as a basis for classifying uncharacterized genes. We provide several examples to illustrate these analytical techniques in the following sections.We used hierarchical clustering to identify groups of related genes based on similarities among their protein localization profiles. Six gene clusters were detected robustly across multiple clustering strategies and consisted of profiles that were significantly and positively correlated (see below) . To gainunc-26 synaptojanin and unc-57 endophilin A and intersectin/DAP160 (ITSN-1) . We obsesynapses , consistsynapses . Thus, iunc-13, unc-18 nSec1, unc-2 α1 voltage gated calcium channel (VGCC) subunit A second cluster was comprised of three genes required for exocytosis, syd-2 α-Liprin and sad-1 kinase syd-2 α-Liprin and sad-1 kinase mutants are similar to those previously described in other classes of neurons A third cluster comprised two genes involved in synapse formation, Hierarchical clustering utilizes positive correlations to generate a single representation of relationships among genes. For this reason, certain kinds of information are not represented in hierarchical clustering strategies. First, significant similarities beyond those within the gene clusters are not illustrated. Second, mutations in two genes may have opposite phenotypic effects on synapse structure, which would lead to anti-correlated phenotypes. To address these issues, we made pairwise comparisons of all twenty-five mutant profiles using the Pearson's Correlation to measure similarity . The sigunc-13, unc-18 nSec1, and unc-2 (tomo-1 tomosyn and goa-1 Gαo (unc-13 and unc-18 nSec1) were anti-correlated with those of genes that inhibit exocytosis (tomo-1 tomosyn and goa-1 Gαo) . Thus, tTo identify relationships between pairs of protein markers, we conducted systematic pairwise comparisons of the punctal fluorescence of each protein, using the Pearson's Correlation to measure similarity . Most ofsyd-2 α-Liprin mutants (egl-30(gf) constitutively active Gαq, aex-3 RabGEF, and tomo-1 tomosyn, all had significantly reduced UNC-10 RIM1α punctal fluorescence . In factrescence . Taken trescence , suggestunc-10 RIM1α mutant worms, the reduced SV fusion rate is accompanied by decreased SV docking and priming C. elegans, UNC-10 and RAB-3, are also binding partners p = 0.049) that indicate UNC-10 RIM1α and RAB-3 synaptic abundance are coordinately regulated.In worm and mouse knockouts lacking RIM1α, SV fusion is impaired but not eliminated R = 0.59, p = 0.17), although this correlation was not significant. Three mutants, egl-30 Gαq, unc-11 AP180 and aex-3 RabGEF, were outliers in this plot . Thus, across many conditions (22/25 mutants examined), SNB-1 and RAB-3 synaptic abundance was coordinately regulated.SNB-1 Synaptobrevin and RAB-3 are two proteins associated with SVs and both are required for normal levels of SV exocytosis. To determine whether the synaptic abundance of these two proteins are differentially regulated, we plotted the punctal fluorescence of RAB-3 against that of SNB-1 synaptobrevin . This reaex-3 mutant lacks the GEF responsible for activating RAB-3 egl-30 Gαq also caused a significantly greater decrease in RAB-3 punctal fluorescence than was observed for SNB-1 synaptobrevin , suggesting that these two mutations disrupt one or more processes in common. Thus, RAB-3 may be responsive to extracellular signals that couple to egl-30 Gαq.The three outliers in the SNB-1 versus RAB-3 plot identifytobrevin . This rerrelated (SV precursors are transported to synapses by anterograde transport mutants . The incmutants) . Taken tDuring the SV cycle, SVs undergo fusion with the plasma membrane to release neurotransmitters and are recycled locally by endocytosis. We examined several proteins that associate with SVs at various points during the SV cycle. SNB-1 synaptobrevin is a v-SNARE protein required for SV exocytosis. RAB-3 is a GTPase that reversibly associates with SVs in a manner that depends upon its bound nucleotide The abundance of a protein associated with endocytic intermediates (APT-4 α2 adaptin), was negatively correlated with one associated with the pool of SNB-1 synaptobrevin positive vesicles . The simC. elegans NMJ, SNN-1 synapsin primarily associates with vesicles as they transit from the recycling endocytic intermediates, however this association is not maintained in the pool of SVs labeled by SNB-1 synaptobrevin and RAB-3. This result is consistent with prior studies showing that lamprey Synapsin-1 primarily associates with SVs distal from the active zone at rest and with peri-synaptic zones where endocytic recycling occurs during stimulation The pattern of SNN-1 synapsin abundance in our mutant panel was anti-correlated with that of exocytic proteins SNB-1 synaptobrevin and RAB-3 . MoreoveNeuropeptides and classical neurotransmitters are secreted by a similar calcium-dependent mechanism; however, the detailed mechanisms by which neuropeptides are synthesized and packaged into vesicles are quite distinct. Neuropeptides are initially synthesized as large proproteins that are packaged into dense core vesicle (DCV) precursors in the trans golgi network. Classical neurotransmitters are packaged in small clear synaptic vesicles (SV) that are clustered near release sites whereas large DCVs filled with neuropeptides are not restricted to nerve terminals. Moreover, exocytosis of DCVs can occur from both axons and dendrites. Different patterns of activity are typically required for evoking secretion of SVs versus DCVs, with higher frequencies or amplitudes required for the latter R = 0.43, p = 0.03) and INS-22 insulin/IGF (a DCV marker) . We prev = 0.03) , suggest18 nSec1 .unc-57 endophilin A strongly affected SNB-1 synaptobrevin punctal fluorescence but had a relatively weaker effect on INS-22 insulin/IGF fluorescence . This diutations , consist mutants . These rpkc-1 protein kinase C η/ε (PKCη/ε), which regulates DCV secretion but not SV secretion egl-8 phospholipase Cβ (PLCβ). EGL-8 PLCβ is predicted to catalyze hydrolysis of phosphatidyl inositol bisphosphate to produce DAG, an activator of PKC. This suggests that DAG produced by EGL-8 PLCβ may activate PKC-1 PKC η/ε to specifically regulate DCV secretion.Two mutations resulted in increased INS-22 insulin/IGF fluorescence while having little effect on SNB-1 synaptobrevin fluorescence (unc-31 CAPS and unc-36 α2δ subunit of a voltage-gated Ca2+ channel (α2δ VGCC) unc-31 CAPS is a multi-domain protein that has been previously implicated in DCV exocytosis in several systems egl-30 Gαq pathway, including egl-30 Gαq, egl-8 PLCβ and pkc-1 PKCη/ε Relatively few genes have been shown genetically to regulate insulin/IGF secretion in vivo. Clustering analysis of protein localization profiles identified two robust gene clusters predicted to be involved in DCV secretion . The firTo verify that the genes in these clusters are required for INS-22 insulin/IGF secretion from DCVs, we measured secretion of INS-22 insulin/IGF from neurons in the corresponding mutants by quantitating steady-state fluorescence in coelomocytes. Coelomocytes are scavenger cells that take up secreted proteins. Secreted fluorescently tagged neuropeptides are endocytosed by coelomocytes, where they accumulate within endolysosomal organelles, which can be visualized as large internal fluorescent patches [53],II, nuIs159III, nuIs163II, nuIs165II, nuIs168IV, nuIs169III; nuIs184X, nuIs190 X and nuIs195IV, nuIs214III. All integrated transgenes were outcrossed 10 times to wild type N2. For each marker, we selected one out of several integrated transgenes that displayed the most consistent and representative pattern of synaptic localization. Strains were genotyped by sequencing or PCR where appropriate. All mutants are described in www.wormbase.org.All strains were cultivated at 20°C using standard methods. The following mutations or transgenes were used in this analysis: Punc-129 promoter. All plasmids used to label presynaptic compartments are derivatives of pPD49.26 containing an SphI/BamHI unc-129 promoter fragment. All constructs were sequenced as to ensure that they contained wild type sequences. For the following constructs, all GFP or Venus fragments were cloned in-frame to the synaptic genes and the fusions were subcloned as NheI/KpnI fragments: KP#1283 Punc-129::GFP::snb-1Punc-129::GFP::syd-2 (gift of D. Simon); pDS171 Punc-129::snn-1::Venus (snn-1 cDNA fragment was used); pDS203 Punc-129::unc-10::GFP [unc-10::GFP (gift of D. Simon) was subcloned as an NheI/KpnI fragment]; pDS165 Punc-129::Venus::rab-3 ; pDS233 Punc-129::itsn-1::GFP (itsn-1 cDNA::GFP was a gift from J. Bai); and pDS210 Punc-129::apt-4::GFP (apt-4 cDNA was used and is flanked by gateway attL1 and R1 sites).All GFP/YFP-labeled markers were expressed in the DA class of motorneurons under the Punc-129::gelsolin::Venus and KP#1496 Punc-129::ins-22::Venus.For the following constructs, entry clones from the ORFeome project corresponding to the gene used was cloned into the destination vector KP#1284 Pttx-3::mRFP or pPD118.33 Pmyo-2::GFP were used as transgenic markers. Presynaptic marker constructs were injected at 10–25ng/ul, and transgenic markers were injected at 50 ng/µl for KP#708 and 10 ng/µl for pPD118.33.KP#708 nuIs152 data for this analysis was obtained from Sieburth et. al., Young adult animals were paralyzed using 30 mg/ml BDM (Sigma) and mounted on 2% agarose pads for imaging. Images were acquired on a Zeiss Axiovert 100 microscope using an Olympus Planapo 100× objective (NA = 1.4) and an ORCA 100 CCD (Hamamatsu) controlled by Metamorph 4.5 software . Animals were imaged as previously described C. elegans. For these markers, we excluded the axonal fluorescence in our analysis. Similarly, we excluded the FWHM for diffraction limited or near-diffraction limited markers where the physical limitations of conventional light microscopy might prevent an accurate estimate of these values.Under the conditions used for imaging, we determined that UNC-10::GFP, GFP::SYD-2 and APT-4::GFP were exclusively or predominantly localized to synaptic puncta, as we could detect little or no difference between their axonal fluorescence and the autofluorescence of The Student's T-statistic was used as a numerical score to represent the difference between wild type and mutant animals for each parameter of each marker ; this crp<0.05 with Bonferroni Correction). See Supporting Information in We identified several robust clusters based on unbiased, stringent criteria, requiring these clusters be detected in 12 or more out of 24 different clustering strategies used to analyze this dataset. Also, the phenotypic profiles in these clusters had to be significantly correlated were deemed as important to that cluster , goa-1 and tomo-1 strains and controls, animals were transferred to a fresh plates each day during their fertile period to separate them from their progeny. For egl-3, egl-30 and egl-8 strains and controls, animals were assayed on plates containing 0.1mg/ml 5-fluorodexoyuridine (Sigma) to kill their progeny Lifespan assays were performed essentially as previously described Figure S1Influence of parameters in generating clusters. See (0.55 MB PDF)Click here for additional data file.Figure S2egl-3 PC2 and genes involved egl-30 Gαq signaling. P values are calculated from bootstrapping analysis and indicated below each comparison.Comparison of phenotypic profiles between (0.22 MB PDF)Click here for additional data file.Figure S3ctrA401ts. Significant correlations are highlighted as indicated by the legend.Simulation of (0.26 MB PDF)Click here for additional data file.Table S1Clustering outcomes across multiple clustering methods.(0.12 MB PDF)Click here for additional data file.Table S2Quantitative imaging of presynaptic markers.(0.77 MB PDF)Click here for additional data file.Table S3Scores for clustering.(0.05 MB PDF)Click here for additional data file.Text S1Supporting information. Calculating the importance of each parameter to a cluster.(0.16 MB PDF)Click here for additional data file.

Pneumocystis jirovecii pneumonia might be a contributing reason. We therefore assessed the prevalence of P. jirovecii by PCR in oral wash specimens among TB patients and healthy individuals in an HIV- and TB-endemic area of sub-Saharan Africa.In tuberculosis (TB) endemic parts of the world, patients with pulmonary symptoms are managed as "smear-negative TB patients" if they do not improve on a two-week presumptive, broad-spectrum course of antibiotic treatment even if they are TB microscopy smear negative. These patients are frequently HIV positive and have a higher mortality than smear-positive TB patients. Lack of access to diagnose A prospective study of 384 patients initiating treatment for sputum smear-positive and smear-negative TB and 100 healthy household contacts and neighbourhood controls.P. jirovecii. All patients delivered sputum for TB microscopy and culture. Healthy contacts and community controls were clinically assessed and all study subjects were HIV tested and had CD4 cell counts determined. Clinical status and mortality was assessed after a follow-up period of 5 months.DNA from oral wash specimens was examined by PCR for 3 and no specific PCP prophylaxis. Only a single patient (0.3% of the patients) was PCR positive for P. jirovecii. None of the healthy household contacts or neighbourhood controls had PCR-detectable P. jirovecii DNA in their oral wash specimens regardless of HIV-status.384 patients and 100 controls were included, 53% and 8% HIV positive respectively. A total number of 65 patients and controls (13.6%) were at definitive risk for PCP based on CD4 counts <200 cells per mmP. jirovecii as detected by PCR on oral wash specimens was very low among TB patients with or without HIV and healthy individuals in Tanzania. Colonisation by P. jirovecii was not detected among healthy controls. The present findings may encourage diagnostic use of this non-invasive method.The prevalence of Pneumocystis jirovecii pneumonia (PCP) remains a relatively common and serious opportunistic infection among HIV infected in Western countries, even in the era of antiretroviral therapy (ART) [P. jirovecii prevalence varying from 9% to 38% among smear-negative, mainly HIV-positive TB patients.py (ART) ,2. In Afpy (ART) . Data repy (ART) , Malawi py (ART) and Ethipy (ART) have shoThe present study was inspired by results of a study performed in Mwanza, Tanzania, in which we observed a HIV prevalence of 63% among patients with smear-negative TB, according to WHO classification . Among tP. jirovecii DNA has been reported to be a non-invasive and easy-to-perform procedure with a diagnostic sensitivity up to 89% [P. jirovecii colonisation we decided to conduct a study on the applicability of an oral wash procedure in an HIV- and TB-endemic region of sub-Saharan Africa including both healthy community controls, household contacts, and clinically-ill patients suspected of pulmonary TB.Oral wash specimens with subsequent PCR detection of p to 89% . BecauseThe study was conducted in Mwanza City, North-western Tanzania from April 2007 to March 2009. The study was a part of a TB and nutrition study in which pulmonary TB (PTB) patients were treated according to the national guidelines for TB [P. jirovecii treatment of HIV-positive adults with co-trimoxazole is offered to WHO stage 3 (which includes PTB) patients, to patients with symptomatic HIV disease and to asymptomatic HIV-positive individuals with CD4 count <200 cells per mm3 [The patients were treated according to national guidelines. In Tanzania, HIV testing is offered as part of the routine medical management of TB patients in line per mm3 .PTB patients diagnosed at two hospitals and two health centres and about to start treatment under the national TB programme were approached for participation in the study. Exclusion criteria were: age below 15 years, pregnancy, terminal illness (judged unlikely to survive for 48 hours), and not staying in Mwanza for the entire 5 month follow-up period. Patients who did not show up for 5 month follow-up and could not be traced were considered as defaulted.ten-cell-leaders among eligible residents of the area.One household contact and one neighbourhood control was recruited for each sputum smear-positive TB patient. With the acceptance from the PTB patient, staff from the study team visited the house of the PTB patient and chose a participant by lot among the eligible household members. Lot-selected sex- and age-matched neighbourhood controls were identified with the assistance of the local The national ethics committees in Denmark and Tanzania approved the study. All participants were informed orally in their local tongue (Kiswahili or Sukuma language) and in writing (Kiswahili) before written consent were obtained and they were free to withdraw from the study at any time. Pre-HIV test counselling was provided to the study subjects. All study subjects who were tested for HIV received post-HIV test counselling regardless of the result. If the HIV test was positive the subject was referred to the local HIV programme.All patients produced three sputum samples, of which at least one was a morning sample, for microscopic examination after Ziehl-Neelsen staining. As part of this study, an extra sample was obtained for control microscopy (Auramine-O staining) and culture on Lowenstein-Jensen solid media at the Zonal Reference Laboratory at Bugando Medical Centre.PTB positive patients had a positive culture and/or microscopy positive result. PTB negative patients had a negative culture and were found negative by microscopy but were considered eligible for TB treatment on clinical suspicion and chest X-ray, often after lack of improvement following two weeks of presumptive broad spectrum antibiotic treatment. The choices of antibiotics varied and a presumptive curative treatment was expected to cure bacterial pneumonia.HIV testing was performed using Determine HIV 1/2 and Capillus HIV-1/HIV-2 . If discordance was found between the two tests a confirmatory ELISA test was performed . CD4 cell count was determined using Partec Cyflow counter .All patients enrolled in the study had the oral wash procedure performed within the first week of diagnosis and treatment initiation of TB. The controls had the oral wash procedure performed at the same day as all other measurements were taken. The participants were fasting since midnight and were asked to postpone brushing their teeth until after the oral wash, which included rinsing/gargling the mouth with 10 ml of sterile saline for 1 min. The procedure was monitored by a staff member. The samples were collected in sterile tubes and centrifuged at 3000 × g for 30 min. One ml of sediment was stored frozen at -80°C until transfer to Denmark on dry ice.P. jirovecii mitochondrial large subunit rRNA gene as previously described [Taq DNA polymerase inhibitors or suboptimal reaction conditions. Positive results were confirmed by two different PCRs amplifying mitochondrial small subunit rRNA and major surface glycoprotein of P. jirovecii [DNA was extracted from oral wash specimens by Chelex extraction and 2 μl of the supernatant was used for touch-down-PCR detecting a fragment of the escribed ,11. An iirovecii , respectP. jirovecii when at least two of the tests were positive. If inhibition was observed, the test was repeated with 1 μl of the sample as template.A specimen was regarded as positive for In order to validate the presence of human DNA in the samples an additional PCR was performed for the detection of a 307 bp fragment of human betaglobin.Data were collected daily onto data collection forms, checked for accuracy and entered into EpiData version 3.1 . Data were exported to STATA 10.1 for statistical analysis. Fishers exact test was used to assess significant associations among categorical variables. For numerical data Wilcoxon-Mann-Whitney test was used.p = 0.08). The gender distribution was even with 220 (45.5%) of the study subjects being female. Mortality and loss to follow up was assessed after five months.Totals of 396 PTB patients and 103 healthy controls were enrolled. Twelve patients were excluded: One because of lacking HIV result, 11 because of poor quality sample material containing no detectable betaglobin DNA . Three controls were excluded because of poor sample material (one household contact and two neighbourhood controls) and 538 cells per mm3 in the control group (p < 0.01).A total of 205 (53.4%) patients and 8 (8%) controls were found to be HIV positive. 118 (57.6%) of the HIV-positive suspected TB patients were diagnosed with smear-positive TB i.e. PTB positive. The median CD4 count for the HIV-positive patients was 208 cells per mm3 was noted in 112 (23%) of all the participants, of which 94 (84%) were HIV positive. Fifteen (8%) of the HIV-negative patients and 3 (3%) from the control group also had CD4 counts below 200 cells per mm3. The median CD4 count did not differ in the HIV-positive, PTB negative group (219 cells per mm3) compared to the HIV-positive, PTB positive group (203 cells per mm3) (p = 0.89).CD4 count <200 cells per mmP. jirovecii tested positive with PCR for i Figure . This 37p = 0.35). 18% of the HIV-positive patients had received cotrimoxazole as opposed to 5.9% of HIV-negative patients (p < 0.01).None of the household contacts or neighbourhood controls had received antibiotics within two weeks before enrolling the study. In contrast 175 (47%) of the TB suspects had received one or more presumptive curative courses of antibiotic treatments for two weeks before enrolling the study. The most commonly used antibiotics were amoxycillin, erythromycin and cotrimoxazole. There was no difference between the pre-treatment frequencies of the HIV-positive versus the HIV-negative group had not received prophylaxis (data missing for 5 persons). Eight (53.3%) of the HIV-positive patients, who died, knew their HIV status at study entry. Four of them had received prophylaxis, three of them for a median of 30 days (range 21-330) (information on duration missing for one patient).Prophylactic cotrimoxazole was used by 57 (58%) of the patients, known to be HIV positive before study entry with a median of 60 days (range 2-1095) (data missing for 12 patients). Among study subjects at risk with a CD4 cell count <200 cells per mm3 and had neither received prophylactic nor curative treatment with cotrimoxazole and were therefore susceptible to P. jirovecii infection (data missing for 5 persons).65 study participants (62 patients and 3 controls) had a CD4 count <200 cells per mmp = 0.04).Twenty patients (5.6%) had died at 5 months follow-up, 12 patients defaulted and 12 patients had moved away from the region. Significantly more patients died in the HIV-positive group, 15 (7.8%) than in the HIV-negative group, 5 (3.0%) (p = 0.43).No significant difference was found in the number of patients who died between the HIV-positive, PTB negative group, 7 (8.8%) and the HIV-positive, PTB positive group, 8 (7.1%) fluid from 9% of smear-negative, mainly HIV-positive, TB patients in Malawi [Recent studies have indicated that the incidence of symptomatic PCP may have been underreported in sub-Saharan Africa. n Malawi . In simin Malawi ,6. In a n Malawi . The difP. jirovecii. Reported carrier frequencies vary in different populations using different PCR methods. A study from Spain found Pneumocystis DNA in 20% of oral wash specimens from 50 healthy - but hospital-affiliated persons [P. jirovecii DNA was detected in 18% of BAL fluids from HIV-negative pulmonary patients undergoing bronchoscopy for other reasons especially if treated with prednisolone [P. jirovecii DNA detectable by a sensitive, nested PCR method in 42 of 91 subjects [Obviously, the technical requirements and resources needed for bronchoscopy-based procedures prevent BAL as a routine option in low-income settings. Induced sputum procedures are aerosol inducing and difficult to handle safely especially when applied to patients suspected of TB. A diagnostic method based on oral wash specimens is a non-invasive, easily-obtained procedure but the sensitive PCR entails the risk of also detecting DNA in persons only colonised with persons . A smallnisolone . A studysubjects .P. jirovecii. The patient was HIV positive with a CD4 count of 83 per mm3, no prior prophylactic or curative treatment attempts with cotrimoxazole, and the clinical course resulting in death after two months of TB treatment supports the diagnosis. The low infection rate may be ascribed to a higher PCP prophylaxis coverage in this study compared to the Ethiopian, Ugandan and Malawian studies [P. jirovecii infection. Recalculating the PCP prevalence for the TB patient subgroup results in a rate of 1.6% (CI: 0-9.8), which is overlapping the rates found in the Malawian study by Hargreaves et al. [p = 0.04), but in this study only part of the excess mortality could be explained by PCP.In this study only one of 384 patients suspected of TB tested positive for studies . In thiss et al. . Twenty P. jirovecii. The carrier frequency seems to be low or at least below the detection limit of the PCR method applied in this study. The sensitivity of the P. jirovecii specific PCR used in this study has in other settings been shown to detect 89% of PCPs using Giemsa and immunofluorescence staining of bronchoalveolar fluid as reference material [P. jirovecii target. Only 14 participants were excluded from the study due to absence of amplifiable DNA in the samples, suggesting that the performance of the present study is similar to other studies in which the same PCR method was used. Colonisation may occur transiently and therefore some studies have examined repeated samples obtained at different time points [None of the 100 healthy household contacts and neighbourhood controls tested positive for e points . The relP. jirovecii is widespread, at least not in this sub-Saharan region although larger studies would be needed to support this. If confirmed, this may increase the applicability of the very easy-to-perform oral wash procedure as a supplement in the diagnosis of the otherwise lethal PCP in HIV-positive patients with respiratory symptoms.This study did not support the hypothesis that colonization with The authors declare that they have no competing interests.LJ and AVJ conducted the oral wash sampling and processing. LJ, JHL, and JSJ performed the PCR analyses. GP, JK, DFJ, JC, HF, NR, and ABA conducted the background study and designed the present study. LJ prepared the first draft of this manuscript and all authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2334/10/140/prepub

Cytosine-5 methyltransferases of the Dnmt2 family are highly conserved in evolution and their biological function is being studied in several organisms. Although all structural DNA methyltransferase motifs are present in Dnmt2, these enzymes show a strong tRNA methyltransferase activity. In line with an enzymatic activity towards substrates other than DNA, Dnmt2 has been described to localize to the cytoplasm. Using molecular and biochemical approaches we show here that Dnmt2 is both a cytoplasmic and a nuclear protein. Sub-cellular fractionation shows that a significant amount of Dnmt2 is bound to the nuclear matrix. Sub-cellular localization analysis reveals that Dnmt2 proteins are enriched in actively dividing cells. Dnmt2 localization is highly dynamic during the cell cycle. Using live imaging we observed that Dnmt2-EGFP enters prophase nuclei and shows a spindle-like localization pattern during mitotic divisions. Additional experiments suggest that this localization is microtubule dependent and that Dnmt2 can access DNA during mitotic cell divisions. Our results represent the first comprehensive characterization of Dnmt2 proteins on the cellular level and have important implications for our understanding of the molecular activities of Dnmt2. The methylation of cytosine residues plays an important role in the regulation of nucleic acids. Cytosine-5 RNA methylation is one among many different RNA modifications and has been detected in tRNA, rRNA and mRNA DrosophilaEntamoebaAspBased on the conservation of catalytic cytosine-5 DNA methyltransferase motifs, Dnmt2 has been assigned to the DNA methyltransferase enzyme family Drosophila and in zebrafish Arabidopsis thaliana) have been described to be viable and fertile Expression analyses of Dnmt2 in various model systems have suggested that Dnmt2 might be developmentally and tissue-specifically regulated. For example, human and mouse Dnmt2 have been shown to be expressed at relatively high levels in the heart, lung, kidney and testis Entamoeba has been associated with the nuclear matrix Because of their annotation as DNA methyltransferases, Dnmt2 enzymes have been expected to be nuclear proteins. However, ectopically expressed human Dnmt2 has been shown to localize in the cytoplasm of transiently transfected cells Drosophila in more detail we created specific antibodies to biochemically trace Dnmt2 as well as fusion proteins to EGFP and GAL4:VP16, that allowed us to study the sub-cellular dynamics and localization of Dnmt2. We show that Dnmt2 is also a nuclear protein, which is part of the insoluble nuclear matrix. Dnmt2-EGFP could be predominantly visualized in endo-replicating and dividing nuclei. These findings show that the sub-cellular distribution of Dnmt2 is fundamentally different from that of other DNA or tRNA methyltransferases and provide experimental support for the notion that Dnmt2 enzymes have multiple molecular activities.Because the identification of sub-cellular compartments associated with individual proteins is important for understanding their molecular activities, a systematic analysis of the sub-cellular localization of Dnmt2 should provide valuable information to define the function of these enzymes. In order to characterize Dnmt2 in Drosophila development and that a fraction of cellular Dnmt2 resides in nuclei.As an initial step towards the characterization of Dnmt2, we affinity purified antibodies against a peptide epitope encompassing amino acids 78–93 of the annotated protein . These aDrosophila development we asked whether Dnmt2 displays a tissue-specific expression. Our affinity purified antibodies against Dnmt2 were not suitable for indirect immunofluoresence experiments, which was most likely due to epitope masking (data not shown). We therefore created several independent transgenic fly lines harbouring a Dnmt2-EGFP fusion gene in the genomic sequence context of the Dnmt2 locus (pGeno-Dnmt2-EGFP). Since Dnmt2 mutant animals are viable and fertile and do not display obvious phenotypes we could not positively test whether the genomic Dnmt2-EGFP contstruct is functional. On the other hand, co-immunoprecipitation experiments using both endogenous Dnmt2 as well as Dnmt2-EGFP constructs revealed that Dnmt2-EGFP is contained in similar protein complexes, suggesting that part of the functionality of Dnmt2 is retained in the fusion protein (unpublished observations). In order to test whether these constructs express tagged Dnmt2 similarly to endogenous Dnmt2 we performed Western blot analysis of protein extracts from various developmental stages and adult tissues using antibodies against Dnmt2. We found that Dnmt2-EGFP was expressed during all stages of development and at levels that were comparable with those of the endogenous Dnmt2 protein and cell-specific promoters driving GAL4 (asense-GAL4) in flies carrying a UAS-Dnmt2-EGFP transgene we observed that the Dnmt2 fusion protein also accumulated around chromosomes in mitotic cells, such as in neuroblasts in the embryonic neuroectoderm . In contIn order to further analyze the mitotic localization of Dnmt2 we used the developing larval brain, which contains a high number of proliferating neuroblasts giving rise to ganglion mother cells (GMC). Analyzing third instar larval brains of animals expressing pGeno-Dnmt2-EGFP we foundTo study the localization of Dnmt2 in living tissue we used transgenic flies expressing a Dnmt2-EGFP fusion protein under the control of the ubiquitin promoter (pUbq-Dnmt2-EGFP). This allowed for sufficiently high levels of Dnmt2-EGFP in early embryos and overcame the technical problems described previously. To follow nuclear divisions we crossed Dnmt2-EGFP expressing flies with animals expressing the histone H2A variant fused to red fluorescent protein (His2Av-mRFP1) which served as a chromatin marker.Imaging Dnmt2-EGFP through consecutive cleavage cycles revealed that the fusion protein is distributed diffusely during S-phase but rapidly localizes to prophase nuclei at the onset of mitosis. During meta- and anaphase Dnmt2-EGFP formed spindle-like structures and re-localized to midbody structures during karyokinesis. During the following S-phase Dnmt2-EGFP was diffusely distributed throughout the syncitial cytoplasm until the start of the next mitotic phase. .The mitotic localization of Dnmt2 was reminiscent of microtubule (MT) structures that form the spindle apparatus during cell divisions. We co-stained embryos for Dnmt2-EGFP and tubulin and found that the signals overlap only partially fused to Dnmt2. The GAL4-VP16 protein contains the DNA-binding domain of the yeast transcription factor GAL4 linked to the transcriptional activating domain of the viral VP16 protein Drosophila Dnmt2 is both cytoplasmic and nuclear and therefore more complex than previously anticipated Dnmt2 proteins are highly conserved enzymes that function as cytosine-5 methyltransferases. Their ability to methylate both DNA and RNA distinguishes Dnmt2 enzymes from other cytosine-5 methyltransferases, and might provide a mechanistic link between RNA and DNA modifications. Proteins belonging to the Dnmt family of enzymes have traditionally been viewed to reside in the nucleus. Interestingly, cytoplasmic localization of Dnmt1 has also been described Drosophila null mutants for Dnmt2 are viable and fertile In contrast to previous work, which used either unpurified antibodies against Dnmt2 peptides Entamoeba. In the latter organism, Dnmt2 has been biochemically associated with the nuclear matrix It has been shown that epitope-tagged human DNMT2 localizes to the cytoplasm of transiently transfected NIH3T3 cells and this observation has been interpreted to reflect a general cytoplasmic localization of Dnmt2 Entamoeba Dnmt2 homologue binds in vitro to EhMRS2, a DNA element containing the consensus scaffold/matrix attachment region (S/MAR) bipartite recognition sequences suggesting that Dnmt2 like molecules can interact directly with DNA Our sub-cellular fractionation experiments showed that a significant amount of nuclear Dnmt2 was insoluble after micrococcal nuclease digest, DNAse treatment and salt extraction. This suggested that nuclear Dnmt2 is tightly bound to structures such as the nuclear matrix. The nuclear matrix as a non-chromosomal scaffold within the nucleus remains a controversial concept in cell biology Live imaging analysis revealed that Dnmt2-EGFP is ubiquitously localized in the syncitial cytoplasm but condenses around mitotic chromosomes. This is reminiscent of the mitotic scaffold proteins Skeletor The ability of Dnmt2 to methylate both DNA and tRNA predicts a complex localization pattern for this class of enzymes. While DNA methylation would be catalyzed in the nucleus, tRNA modifications have been shown to occur both in nucleoli and on the surface of the nuclear envelope in yeast yw was used as a wild-type strain. Hs-GAL4 Drosophila medium at 25°C.The Dnmt2 mutant allele has been described previously The construct for GAL4-inducible Dnmt2-EGFP expression was generated by replacing H2B in pH2B-EGFP (a gift from Peter Becker) with the ORF of Dnmt2. The construct was subsequently sub-cloned into pUAST 78CQPHTRQGLQRDTEDK93) was synthesized and coupled to SulfoLink gel (Pierce), according to the manufacturer's instructions. Peptide-specific antibodies were purified using high-salt conditions and elution in 0.1 M glycine (pH 3.5) followed by dialysis. Affinity purified Dnmt2 antibody was diluted 1∶500 for Western blots. Other antibodies used in Western blots (WB) or immunofluorescence (IF) were: armadillo (Hybridoma bank-N2 7A1) 1∶100 for IF; α-tubulin (Sigma DM1A), 1∶10.000 for WB and 1∶200 for IF, lamin C Polyclonal antibodies against Dnmt2 peptide epitopes were raised in rabbits and have been described elsewhere 2PO4/K2HPO4 (pH 6.8), 450 mM KCl, 150 mM NaCl, 20 mM MgCl2) and fixed for 20 minutes at room temperature (RT), followed by treatment as used in embryo stainings. Fixed tissue was incubated overnight at 4°C with primary antibodies followed by incubation with secondary antibodies. Cy5 anti–mouse (Jackson ImmunoResearch Laboratories) were used 1∶250 and Alexa 488 anti–rabbit (Molecular Probes) antibodies were used at 1∶500. RNase A was included in procedure to 2 mg/ml for 1 hour if propidium iodide was used to stain DNA . DNA was stained with DAPI (1 ng/ml) or propidium iodide . After mounting in Fluoromount (Biozol), samples were analyzed by confocal laser scanning microscopy or Nikon C1Si . Images were converted to Photoshop CS format , pseudo-colored and merged.Embryo immunostainings were performed essentially as described 2, 1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.34 M Sucrose, 10% w/v glycerol, 1 mM PMSF, 1× Roche complete proteinase inhibitors). Larvae (collected according to instar stage) and adult flies (dissected in PBS) were processed as described for embryonic tissue. After homogenization using a syringe (25 G), Triton-X-100 was added to 0.1% and proteins were extracted at 4°C for 30 minutes. The homogenate was filtered through gaze and processed as described previously 2 and homogenized in IP-buffer glycerol, 0.5% Nonidet P40, 1 mM PMSF, 1× Roche complete proteinase inhibitors). To obtain soluble protein, extracts were spun at 16.000 g for 30 minutes at 4°C. For immunoprecipitation experiments, Protein A beads were incubated with 3 µg anti-Dnmt2 antibodies and 1 µg/ml insulin (Sigma) for 1 hour at 4°C, washed 3×5 minutes in IP-buffer before whole cell protein extracts were added to the beads for 3 hours at 4°C. Peptide block was added in parallel at a concentration of 150 ng/ml to control for specificity of the IP-reaction. Beads were collected by centrifugation and washed 4 times 10 minutes at 4°C with IP-buffer, followed by 4 minutes at 94°C in SDS-sample buffer and Western analysis.For cytoplasmic and nuclear protein extracts, embryos were de-chorionated, snap frozen in liquid N2, homogenized in buffer A . Lysed extracts were cleared of debris by low speed centrifugation at 400 g for 10 min at 4°C. Supernatants were spun at 1.700 g for 10 min 4°C to obtain crude nuclei. Crude nuclei were resuspended in buffer A and spun through a sucrose cushion containing 15 mM Tris pH 7.5, 60 mM KCl, 15 mM NaCl, 5 mM MgCl2, 1 M sucrose, 0.5 mM DTT, 1 mM PMSF, 1× Roche complete proteinase inhibitors) at 16.000 g for 30 minutes at 4°C. For whole nuclear protein extraction, nuclei were homogenized in urea extraction buffer for 10 minutes at room temperature (RT), spun at 16.000 g for 10 minutes at RT and analyzed by Western blot. Nucleoli isolation was performed as described previously 2, diluted to a concentration of 200 µg/ml chromatin. MNase was added to 10 U/50 µg chromatin, incubated for 8 min at 37°C and stopped by addition of EDTA to 10 mM. Nuclei were pelleted and resuspended in 0.2 mM ice-cold EDTA, pH 7.0 for 1 hour (this hypotonic treatment forces nucleosomes into the supernatant). Remaining chromatin was pelleted by centrifugation and supernatant and nuclear pellet subjected to SDS-PAGE. For nuclear matrix extraction, purified nuclei were resupended in cytoskeletal buffer and was considered the nuclear matrix-containing fraction.Tissue was homogenized in hypotonic buffer A using the 488 and 561 nm laser lines at low power (1–5%). Recording was carried out at 1 minute intervals and data was analyzed using ImageJ software.Figure S1Overexpression of EGFP does not lead to mitotic accumulation of EGFP. (A) Actin5C-GAL4 driven UAS-EGFP expression in the embryonic neuroectoderm shows no signs of a mitotic accumulation of EGFP at chromatin . Scale bar: as in (0.76 MB TIF)Click here for additional data file.Movie S1Live imaging of nuclear division cycles 10-11 of an embryo expressing pUbq-Dnmt2-EGFP and His2Av-mRFP1. Embryos were mounted on an open coverslip and viewed by dual wavelength time-lapse LSCM. Frames were recorded in 1 min intervals and images were merged with Dnmt2-EGFP in green and His2A-mRFP1 in red. Scale: as in (1.83 MB MPG)Click here for additional data file.

Embelia ribes, in focal ischemic brain.The present study was carried out to evaluate the neuroprotective effect of the aqueous extract of Embelia ribes for 30 days. After 30 days of feeding, all the animals were anaesthetized with chloral hydrate . The right middle cerebral artery was occluded with a 4-0 suture for 2 h. The suture was removed after 2 h, to allow reperfusion injury. The animals were used for grip strength measurement, biochemical estimation in serum and brain tissue and cerebral infarct size measurement.Adult male Wistar albino rats were fed with the aqueous extract of P < 0.01) alteration in the markers of oxidative damage (thiobarbituric acid reactive substances (TBARS); reduced glutathione (GSH); glutathione peroxidase (GPx); glutathione reductase (GR); and, glutathione-S-transferase (GST)) was observed in the hippocampus and frontal cortex, as compared to sham operated rats. We observed that the animals treated with the aqueous extract of Embelia ribes had a significant (P < 0.01) increase in the poststroke grip strength activity. Further, supplementation with aqueous extract of Embelia ribes reversed the levels/activities of the above mentioned biochemical parameters significantly (P< 0.01) and also resulted in decreased cerebral infarct area, as compared to the ischemic group.In the ischemic group, a significant (Embelia ribes pretreatment ameliorates cerebral ischemia/reperfusion injury and enhances the antioxidant defense against middle cerebral artery occlusion-induced cerebral infarction in rats; it exhibits neuroprotective property.The results of our study, for the first time, provide clear evidence that aqueous extract of Among the neurological diseases, stroke accounts for the largest number of hospitalizations. A varietf stroke.The lack of effective and widely applicable pharmacological treatments for ischemic stroke patients may explain a growing interest in traditional medicines, for which extensive observational and anecdotal experience has accumulated over the past years. It has been suggested that some herbal medicines, or their products, may improve microcirculation in the brain, protect Embelia ribes Burm (Myrsinaceae), commonly known as Vidanga, is a large woody climbing shrub and is widely distributed throughout India. It is highly esteemed in Ayurveda as a powerful anthelmintic.[Embelia ribes is also reported to have antifertility action.[et al.[Embelia ribes Burm in streptozotocin-induced diabetes in rats, using gliclazide as the positive control drug. Recently, Bhandari et al.[Embelia ribes in isoproterenol induced myocardial infarction in albino rats.elmintic.Embelia ry action. Analgesiy action. The plany action. The fruiy action. Bhandarin.[et al.17 have rri et al. have repMiddle cerebral artery occlusion (MCAO) is most commonly model used to induce experimental focal cerebral ischemia. The advaEmbelia ribes in MCAO-induced focal cerebral ischemia in albino rats, using biochemical markers and cerebral infarct size measurement.The objective of the present study is to induce focal cerebral ischemia by MCAO and to investigate the neuroprotective potential of the aqueous extract of Triphenyl tetrazolium chloride (TTC) dye used in the study was obtained from Sigma chemicals . All other chemicals used were of analytical grade. Double distilled water was used for all biochemical assays.Embelia ribes Burm were purchased from the local market, New Delhi, India, in August 2006 and botanical authentification was carried out by the Department of Botany, Faculty of Science, Hamdard University, New Delhi, India (voucher specimen no. UB 2). The dried and coarsely powdered drug (100 g) was packed in a soxhlet apparatus.Dried fruits of ° C for further use. The average yield of the aqueous extract ofEmbelia ribes was approximately 5.261%. The aqueous extract of Embelia ribes (ER) – 100 and 200 mg/kg body weight – was dissolved in 1% Tween 80 in distilled water and administered to adult male Wistar albino rats by oral route, since earlier studies reported the effectiveness of Embelia ribes extracts in doses of 100 and 200 mg/kg body weight.[Water (300 ml) was placed in a round bottom flask and a reflux condenser was attached above the soxhlet. The water was heated to boil on heating mantle and was subjected to extraction for 72 hours . The filtrate was evaporated under a vacuum drier and the brown mass residue obtained was stored at 4y weight.Embelia ribes fruits was carried out for the detection of phytoconstituents, using standard chemical tests. Alkaloids, carbohydrates, phenolic compounds, flavonoids, proteins and saponins were detected in the extract. Further, high performance thin layer chromatography (HPTLC) fingerprints of the aqueous extract was established using CAMAG HPTLC and benzene: ethyl acetate (6: 4) as solvent system, which showed the presence of seven spots at 520 nm wavelength. It can, thus, be concluded that the antioxidant effect of Embelia ribes can be due to the presence of alkaloids, flavonoids, phenolic compounds and saponins.Preliminary phytochemical screening of the aqueous extract of The experimental protocol was approved by the Institutional Animal Ethics Committee (IAEC) of Hamdard University, New Delhi, which is registered with the Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA), Government of India, . Healthy male adult Wistar rats (200-250 g), procured from the Central Animal House Facility, Jamia Hamdard, New Delhi, and acclimatized under standard laboratory conditions at 25 ± 2°C, relative humidity (50 ± 15 %) and normal photoperiod (12 h light dark cycle) for seven days, were used for the experiment. The animals were fed with commercial rat pellet diet and water ad libitum. Adequate measures were taken to minimize pain or discomfort and the experiments were conducted in accordance with the international standards on animal welfare; the measures were also compliant with local and national regulations.et al.[° C, with a thermostatically controlled infrared lamp. In sham rats, the ECA was surgically prepared for the insertion of the filament, but the filament was not inserted.The right middle cerebral artery occlusion (MCAO) was performed using an intraluminal filament model and the method described by Longa et al. In briefMale Wistar rats (200-250g) were randomly divided into six experimental groups (n = 10 each). The first group served as sham and 1% Tween 80 in distilled water was given orally for 30 days. The second and third groups were sham rats that had been pretreated with ER 100 mg/kg and 200 mg/kg p.o. respectively for 30 days. The fourth group was the MCAO group in which ischemia was induced for 2 h, followed by reperfusion for 22 h. The fifth and sixth groups were treated by ER 100 mg/kg and 200 mg/kg p.o. respectively for 30 days, followed by MCAO induced cerebral ischemia.et al.[g for 5 min at 4°C, to separate the nuclear debris. The supernatant was further centrifuged at 10,000 × g for 20 min at 4°C, to get the postmitochondrial supernatant (PMS), which was used for the estimation of reduced GSH and antioxidant enzymes activity.After 24 h of the lesioning, grip strength in all the animals was measured, using the grip strength meter for evaluation of neuromuscular strength, as described by Ali et al. After gret al.[et al.[et al.[In serum, lactate dehydrogenase (LDH) was estimated using a method described by Lum et al. A 10% hol.[et al. and modil.[et al. The PMS l.[et al. glutathil.[et al. glutathil.[et al. and glutl.[et al.° C, as described by Joshi et al.[The brains were sectioned coronally (thickness – 2 mm) and stained with 1% 2, 3, 5-triphenyl tetrazolium chloride (TTC) in phosphate buffer for 30 min at 37ANOVA), followed by Dunnett t-test. The values of P < 0.01 were considered as significant.The data are expressed as mean±SEM. Statistical differences between means were determined by one-way analysis of variance (Embelia ribes on grip strengthThe effect of aqueous extract of P < 0.01) decrease in the grip strength was observed in the ischemic (MCAO) group, as compared to the sham rats. Aqueous extract of Embelia ribes treated rats showed a significant (P < 0.01) increase in grip strength, as compared to the ischemic (MCAO) group. However, no significant change in grip strength was observed in the rats treated only with the aqueous extract of Embelia ribes, as compared to the sham rats [The basal grip strength was found to be 0.942 ± 0.006 kg units. A significant (ham rats .P < 0.01) increase in the activity of LDH in serum was observed in the ischemic (MCAO) group rats, as compared to the sham group; whereas, aqueous extract of Embelia ribes treatment significantly (P < 0.01) resulted in decreased serum LDH levels when compared with the ischemic (MCAO) group rats. However, no significant changes in LDH activity were observed in the rats treated only with the aqueous extract of Embelia ribes, as compared to the sham rats [The basal serum LDH levels were found to be 74.356 ± 3.493 IU/L. A significant (ham rats .P < 0.01) higher in the ischemic (MCAO) group, as compared to the sham rats, while aqueous extract of Embelia ribes treatment significantly (P < 0.01) decreased these elevated levels when compared with the ischemic (MCAO) group rats. However, no significant changes in TBARS levels were observed in the rats treated only with aqueous extract of Embelia ribes, as compared to the sham rats [TBARS level in frontal cortex and hippocampus were found to be significantly (ham rats .P < 0.01) reduction in GSH, GPx, GR and GST content of hippocampus and frontal cortex were observed in the ischemic (MCAO) group, as compared with the sham group rats. This reduction is significantly (P < 0.01) reversed by the aqueous extract of Embelia ribes treatment, when compared with the ischemic (MCAO) group rats. However, no significant changes in GSH, GPx, GR and GST levels of hippocampus and frontal cortex were observed in the rats treated only with the aqueous extract of Embelia ribes, as compared to the sham rats [Tables As a result of cerebral ischemia for two hours, followed by reperfusion, a significant , which can cause oxidative damage to cellular macromolecules. IncreasiEmbelia ribes, which is a potent antioxidant, has protected neurobeha-vioral deficits of animals by scavenging free radicals. The exact mechanism of this hypothesis is to be explored yet.Free radicals are thought to cause behavioral deficits in experimental animals. In the pEmbelia ribes extract. Twenty-four hours after ischemia/reperfusion injury, significant (P < 0.01) rises in LDH was observed in the ischemic rats, as compared to the sham group. In the MCAO group, treatment with the aqueous extract of Embelia ribes significantly (P < 0.01) decreased the LDH levels, as compared to the MCAO group.Lactate dehydrogenase was measured to evaluate the role of antioxidative stress in the protection of aqueous The large numbers of polyunsaturated fatty acids (PUFAs) make cell membranes particularly vulnerable to lipid peroxidation. The oxidation of PUFAs causes them to be more hydrophilic, thereby altering the structure of the membrane with resultant changes in fluidity and permeability. Lipid peroxidation can also inhibit the function of membrane bound receptors and enzymes.36Embelia ribes on lipid peroxidation, which was measured in terms of MDA, a stable metabolite of the free radical-mediated lipid peroxidation cascade. The MDA levels increased significantly (P < 0.001), following cerebral ischemia reperfusion injury. Aqueous extract of Embelia ribes reversed the increase of MDA levels to a considerable extent, thereby confirming its antioxidant role in ischemia reperfusion injury.We assessed the effect of aqueous extract of P < 0.01) in the MCAO group, as compared to the sham group. In the MCAO group, the animals treated with the aqueous extract of Embelia ribes produced a significant (P < 0.01) increased activity of endogenous antioxidant enzymes.It has been proposed that antioxidant changes reflect an altered redox balance in several pathological states. In otherEmbelia ribes at both the doses (100 and 200 mg/kg) had increased GSH levels in various brain regions, but the mechanism involved is not known.Reduced glutathione (GSH) is one of the primary endogenous antioxidant defense systems in the brain, which removes hydrogen peroxide and lipid peroxides. Decline Embelia ribes administration to the normal rat did not show any effect on the activity of endogenous antioxidant enzymes and oxidative stress markers in various brain regions of normal rat.This study suggests that aqueous extract of Embelia ribes appears to work by restoring the altered antioxidants enzymes activity as well as by decreasing the production of lipid peroxides in frontal cortex and hippocampus regions of brain. Interestingly, aqueous Embelia ribes extract exerts its antioxidant effect by decreasing LDH, total cholesterol, triglycerides, LDL-C and lipid peroxide levels, which are implicated in cerebral ischemic reperfusion injury. Therefore, on the basis of the present observations of the study, Embelia ribes could be an important herbal drug for neuroprotection.The activity of aqueous extract of

The effect of apo-cytochrome b5 on this enzymatic system has not been investigated in details, because preparation of cyt b5 as a pure protein failed in many laboratories. In order to prepare the native apo-cytochrome b5 in a large scale we utilized a protein with higher affinity toward the heme; the apo-myoglobin from the equine skeletal muscle. In the first step, we extracted heme moiety from the native myoglobin by butanone extraction. Than the effect of pH on spontaneous heme release from both proteins was investigated: purified rabbit cyt b5 as well as equine skeletal muscle myoglobin. The prepared apo-myoglobin was incubated with the cyt b5 and heme transfer was monitored as a shift of absorption maximum from 413 to 409 nm in pH varying between 3–6 . Here, we obtained 43 mg of the equine skeletal muscle apo-myoglobin (43% yield). The optimal pH range for heme transfer from cyt b5 into apo-myoglobin was between 4.2 and 5. Native apo-cytochrome b5 was successfully prepared using procedure described here.Cytochrome b It is composed of two functional domains, a soluble heme-containing core, and a short hydrophobic C-terminal tail, which anchors the protein into the microsomal membrane -mediated reactions. There are two major theories explaining this effect: (i) direct electron transfer from cyt b5 to CYP and (ii) conformational effects of cyt b5 on CYP without contribution of electron transfer on Sudan I oxidation is necessary to be evaluated.To study the mechanism of this modulation, not only the effect of native cyt b–10–10–15 M region First it is a butanone extraction method . pH of the myoglobin solution adjusted to pH 2.5 by 1 M HCl. The solution was moved to the separation funnel and equal volume of 2-butanone was added. Mixture was slowly shaked 3 times for 5 minutes and than placed for 10 minutes into the cold room (8°C). Aqueous phase was dialyzed at 8°C against 2 l of water, than 2 days against 2 l of 10 mM Tris, pH 8.0. The solution was concentrated in an Amicon stirred cell using a PM-10 membrane. In order to prevent the precipitation of the apo-myoglobin, pH was adjusted to 5 using 2 M CH3COOH before it was stored at –80°C.In the first step, heme moiety was extracted from the native myoglobin by butanone extraction .The effect of pH on spontaneous heme release from rabbit cyt bUnder the more acidic conditions (pH 3.6–3.8) heme cofactor readily dissociated from the molecule of myoglobin. This process was observed as a shift of heme absorption maximum from 409 to 397 nm within 30 s of the incubation . No chan5 with apo-myoglobin in various pH. The initial spectrum eliciting maximum at 413 nm corresponds to pure cyt b5. Both proteins are loosing heme spontaneously at pH 3.7, therefore the heme transfer at this pH was not observed , the heme transfer should be nearly complete ~99%, due to a significantly higher affinity of myoglobin to heme cofactor, ~2 orders of magnitude more than cyt b5.The absorption maximum of heme chromophore in the incubation mixtures was shifted from 413 nm to 409 nm . This fi5 to apo-myoglobin is much slower compared to release of free hemin observed in more acidic conditions . This heme transfer is also extremely sensitive to pH. It tooks 10 minutes at pH 4.2 and 4.3, but at slightly less acidic conditions (pH 5), the transfer was completed in 30 min (5 to apo-myoglobin at pH 5.25 is extremely slow and required 6 hours to complete (data not shown).The heme transfer from cyt bn 30 min . Besideset al., et al., et al., –7/s to rabbit cyt b5 used in this study, is 7.7 × 10–5/s . We investigated the effect of pH on spontaneous heme release from both proteins: purified rabbit cyt b5 as well as equine skeletal muscle myoglobin. These realize shows that the optimal pH for heme transfer from cyt b5 into apo-myoglobin is 4.2–5.0.In order to prepare the apo-cytochrome b

Interstitial lung disease (ILD) in infants and children comprises a large spectrum of rare respiratory disorders that are mostly chronic and associated with high morbidity and mortality. These disorders are characterized by inflammatory and fibrotic changes that affect alveolar walls. Typical features of ILD include dyspnea, diffuse infiltrates on chest radiographs, and abnormal pulmonary function tests with restrictive ventilatory defect and/or impaired gas exchange. Many pathological situations can impair gas exchange and, therefore, may contribute to progressive lung damage and ILD. Consequently, diagnosis approach needs to be structured with a clinical evaluation requiring a careful history paying attention to exposures and systemic diseases. Several classifications for ILD have been proposed but none is entirely satisfactory especially in children. The present article reviews current concepts of pathophysiological mechanisms, etiology and diagnostic approaches, as well as therapeutic strategies. The following diagnostic grouping is used to discuss the various causes of pediatric ILD: 1) exposure-related ILD; 2) systemic disease-associated ILD; 3) alveolar structure disorder-associated ILD; and 4) ILD specific to infancy. Therapeutic options include mainly anti-inflammatory, immunosuppressive, and/or anti-fibrotic drugs. The outcome is highly variable with a mortality rate around 15%. An overall favorable response to corticosteroid therapy is observed in around 50% of cases, often associated with sequelae such as limited exercise tolerance or the need for long-term oxygen therapy. Interstitial lung disease (ILD) in infants and children represents a heterogeneous group of respiratory disorders that are mostly chronic and associated with high morbidity and mortality around 15%) ..2]. ThesThere have been many different approaches to the classification of ILD, with major shifts based on clinical investigation, improvement in chest imaging, and collaboration with pathologists. In 1998, Katzenstein and Myers proposed four histopathologically distinct subgroups of idiopathic interstitial pneumonias: usual interstitial pneumonia (UIP), desquamative interstitial pneumonia (DIP) and a closely related pattern termed respiratory bronchiolitis-associated ILD, acute interstitial pneumonia (formerly Hamman-Rich syndrome), and non specific interstitial pneumonia (NSIP) . In 2002Among the proposed classifications for pediatric ILD, one strategy frequently used is to separate the primary pulmonary disorders and the systemic disorders with pulmonary involvement. Recently, an additional group has been introduced which is based on the concept that some pediatric ILD are observed more frequently in infants, while others are more specific to older children. The last ERS monography on ILD provided a chapter on pediatric classification which is based on a clear distinction between children aged 0-2 years and children over 2 years-old . Indeed i.e. the terminal bronchioles. Terminal bronchioles are lined with a simple cuboidal epithelium containing Clara cells, basal cells and a limited number of ciliated cells. Clara cells secrete nonsticky proteinaceous compounds to maintain the airway in the smallest bronchioles, which constitute the quiet zone between the conducting and the respiratory lung zones [It is important to point out that the pathologic processes underlying the so-called diffuse lung diseases involve not only the alveolar structure but also the distal part of the small airways and the conducting zone, ng zones . The terng zones . TherefoThe present review focuses on ILD in immunocompetent children, and excludes pulmonary consequences of previous lung injury in situations of chronic aspiration syndromes, resolving acute respiratory distress syndrome, and bronchopulmonary dysplasia.An estimated prevalence of 3.6 per million has been reported by Dinwiddie and coworkers through a national survey of chronic ILD in immunocompetent children in the United Kingdom and Ireland over a three year period 1995-1998) 995-1998 . In addiThe understanding of the mechanisms underlying the development and progression of ILD remains elusive ,14. IndeBased on clinical and experimental observations, a new paradigm has progressively emerged with the alveolar epithelium being viewed as a key actor in the development of ILD -19. FollILD may be caused by myriad etiologies with differing prognoses and natural history. Indeed, multiple factors may injure the alveolar epithelium and initiate the development of ILD . The iniApotosis plays a central role in lung remodeling associated with ILD . An impoRecently, it has been suggested that genes associated with lung development and embryonic pathways could be involved in aberrant epithelium-mesenchymal crosstalk and epithelial plasticity, and could therefore participate in the development of chronic ILD. Selman and coworkers reported that lung fibrosis is characterized by enrichment for genes associated with cell adhesion, extracellular matrix, smooth muscle differentiations, and genes associated with lung development -31. DuriRecent reports strongly suggest that the ER stress may represent an important mechanism of the altered repair process observed in the alveolar epithelium of fibrotic lung . SituatiIt is now well established that surfactant dysfunction plays an important role in the development and progression of ILD. Pulmonary surfactant is a multimolecular complex constituted of phospholipids and proteins secreted by type 2 AEC into the alveolar space. It assures alveolar stability by reducing surface tension along the epithelial lining and this role involves mainly the lipids and the specific hydrophobic SP, SP-B and SP-C. Other important players in surfactant metabolism include the ATP-binding cassette, sub-family A, member 3 (ABCA3) and the thyroid transcription factor 1 (TTF-1).SFTPB) as well as genes coding for SP-C (SFTPC), ABCA3, and TTF-1 [SFTPB (located on chromosome 2) mutations have been identified among patients with a congenital deficiency in SP-B. For SFTPC located on chromosome 8, at least 35 mutations have been described, localized primarily in the COOH- terminal Brichos domain [Surfactant deficiency can be induced by a number of primitive and secondary mechanisms. Among them are genetic defects with mutations in SP-B gene cells and their differentiation to replace the damaged cells . HoweverThe frequency of lung fibrotic disorders is much lower in children than in adults. Some clinical situations have features certainly unique to children, but many of these diseases overlap their adult counterparts with the primary event being injury and damage of the alveolar epithelium ,13. Yet,The prevalence of children ILD is higher in the younger patients: more than 30% of patients are less than 2 years at diagnosis, as recorded by the recent ERS Task Force. 7% have parental consanguinity and nearly 10% of case siblings were affected by similar diseases. There is a male predominance with a sex ratio of 1.4. The presenting clinical manifestations are often subtle and non-specific. The onset of symptoms is, in most cases, insidious and many children may have had symptoms for years before the diagnosis of ILD is confirmed. However, the majority of patients has symptoms for less than one year at the time of initial evaluation. The clinical manifestations vary from asymptomatic presentation with radiological features suggestive of ILD to more characteristic presence of respiratory symptoms and signs such as cough, tachypnea and exercise intolerance ,60. ThesThe frequent clinical findings are inspiratory crackles (44%), tachypnea and retraction. In a child with a normal birth history, these are strongly suggestive of ILD. Other findings associated with an advanced stage of lung disease include finger clubbing (13%) and cyanosis during exercise or at rest (28%) ,61. DuriPlain radiographs are usually performed in a child suspected of ILD at first presentation, but the information provided is often limited and the key chest imaging tool for diagnosis is the High Resolution Computed Tomography (HRCT), which can visualize the parenchymal structure to the level of the secondary pulmonary lobule.HRCT technique for ILD diagnosis has been extensively discussed -64. To oPulmonary function testing (PFT) techniques are well established in children and adolescents. However, children aged 2-6 years represent a real challenge in pulmonary function assessment as they cannot be sedated and find it difficult to cooperate with all respiratory manoeuvres. In 2007, an ATS and ERS statement on PFT in preschool children summarized the current knowledge on the PFT techniques suitable for young children ,66.2) or a reduced resting arterial oxygen tension is often present. Hypercarbia occurs only late in the disease course. During exercise the above described dysfunctions become even more pronounced. Thus, gas exchange during exercise might be a more consistent and sensitive indicator of early disease [Although PFT does not provide specific information, it represents a useful investigation for both the diagnosis and the management of ILD . General disease .Bronchoalveolar lavage (BAL) usefully provides specimens for cytological examination, microbial cultures, and molecular analysis. Besides infections, BAL can be of diagnostic value in several situations. In the context of pulmonary alveolar proteinosis, BAL abnormalities are characterized by milky appearance fluid, abundant proteinaceous periodic acid schiff positive material, and presence of foamy alveolar macrophages (AM) . BAL canIn other pathological situations, BAL can usefully serve to direct further investigations. Accumulation of BAL T-lymphocytes with prevalence of CD4+ cells is suggestive of sarcoidosis, whilst prevalence of CD8+ cells is suggestive of hypersensitivity pneumonitis . Also, aWith increasing recognition of the different patterns of ILD and their clinical significance, histological investigation has become increasingly important. Depending on disorder presentation, biopsy may concern more accessible organs than the lung such as the skin or the liver in sarcoidosis. Histological evaluation of lung tissue usually represents the final step in a series of diagnostic approaches.Different methods may be used to obtain lung tissue. The major difference between individual methods lies mainly in balancing invasiveness against the potential for obtaining adequate and sufficient tissue for diagnosis. The techniques of choice are open lung biopsy and video assisted thoracoscopy biopsy. In children, open lung biopsy usually provides sufficient tissue with few complications related directly to the biopsy procedure . Video aThe lung histological patterns that can be observed in ILD have been reviewed by the ATS/ERS . In chilLaboratory tests are used to exclude a number of respiratory diseases in childhood that does not typically present with ILD such as chronic aspiration syndromes, resolving acute respiratory distress syndrome, tuberculosis, cystic fibrosis, bronchopulmonary dysplasia and diffuse pulmonary disease such as cystic fibrosis. Laboratory tests also verify the absence of immunodeficiencies .When these conditions have been eliminated, the spectrum of investigations that should be performed for the diagnostic approach will be guided by the history and clinical presentation in each individual child. These investigations are discussed below for the various disorders. In addition, an increasing number of blood and BAL biomarkers for evaluation of disease severity and progression is currently investigated. The studied molecules include various cytokines and chemokines, surfactant protein D, Krebs von den Lungen-6 antigen (KL-6), matrix metalloproteinases MMP1 and MMP7 and defensins -92.A large number of pathological situations can impair gas exchange and contribute to progressive lung damage and ILD. Consequently, diagnosis approaches need to be organized by cause, with a clinical evaluation requiring a careful history paying attention to exposures and systemic diseases. Indeed, in a number of pathological situations, no final diagnosis is proposed and the conclusion reported by the physician in charge of the patient is ILD of unknown cause. However, information from recent studies highlights the concept that lung insults caused by substances from the environment or in the context of systemic diseases are largely under-estimated and should be more often discussed considered in the diagnostic process. Based on this consideration, the following diagnostic grouping for pediatric ILD can be considered 1) exposure-related ILD; 2) systemic disease-associated ILD; 3) alveolar structure disorder-associated ILD; and 4) ILD specific to infancy.Accordingly, a step-by-step etiological diagnostic approach is required and is summarized in Figure Exposure-related disease refers to diseases caused by a sufficient level of exposure (dose) to components with target organ contact, and subsequent biologic changes and clinical expression. Many agents have been associated with pulmonary complications of various types including ILD. The adult literature has provided extensive lists of candidate molecules . In chilHypersensitivity pneumonitis (HP) is a cell-mediated immune reaction to inhaled antigens in susceptible persons ,95. In cAs HP is believed to be an adult disease, children are often diagnosed at the chronic stage of the disease resulting of a long-term exposure to low levels of inhaled antigens. Children can develop subtle interstitial inflammatory reactions in the lung without noticeable symptoms for months . ClinicaAt the present time, there is no diagnostic test that is pathognomonic for HP, and only significant predictors of HP are identified. The most significant diagnostic tool is a detailed environmental exposure history. Other diagnostic features include: positive precipitating antibodies to the offending antigen; recurrent episodes of symptoms; symptoms occurring 4-8 h after exposure; occurrence of diffuse parenchymal lung disease by lung function and HRCT; BAL abnormalities with lymphocytic alveolitis and increased CD8+ T cells.Drugs used in inflammatory or cancer pediatric diseases can cause ILD. They include anti-inflammatory agents , immunosuppressive and chemotherapeutic agents , antibiotics, cardiovascular agents, and, for teenagers, illicit drugs ,100. TheExposure to therapeutic radiation in the management of pediatric cancer may also results in ILD. Patients presenting within 6 months of therapy generally have radiographic abnormalities with ground glass patterns in both radiation-exposed and unexposed tissue .The association between tobacco use and ILD is less well appreciated than the relation with chronic obstructive pulmonary disease (COPD). In addition, pediatric patients do not usually have a significant smoking history to develop respiratory disorders .Connective tissues disorders (CTD) are a heterogeneous group of immunologically mediated inflammatory diseases. Their origins are multifactorial with genetic, constitutional and environmental elements contributing to their development. CTD refers to any disease that has the connective tissues of the body as a primary target of pathology. The connectives tissues are composed of two major structural proteins, elastin and collagen, with different types of collagen proteins in each tissue . Many CTRheumatoid arthritis (RA) is an inflammatory disorder defined by its characteristic di-arthroidal joint involvement. It is the most common CTD in children, but pulmonary involvement is less frequent than in adults. Genetic and environmental factors seem to be important contributors of disease progression, with influence of sex , presence of two copies of the HLA-DRB1 "shared epitope" (HLA-DR SE) and anticyclic citrullinated peptide antibody (anti-CCP), and possibly tobacco exposure ,107.AlmoSystemic sclerosis (SSc) is characterized by a progressive dermatologic abnormality . Its etiSystemic lupus erythematosus (SLE) is an auto-immune disorder characterized by the involvement and dysfunction of multiple organ systems. The mechanisms of tissue injury involve autoantibody production and immunocomplex formation leading to an inflammatory process. Diverse clinical phenotypes are observed, including a variety of mucocutaneous lesions, non erosive arthropathy, renal disease , lung disease, pericarditis, and a spectrum of neurologic disorders. Laboratory abnormalities are characterized by the presence of antibodies reactive to nuclear (ANA) and cytoplasmic antigens.Pulmonary vasculitis are observed in vasculitic syndromes that preferentially affect small vessels . They include the anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis that share histologic similarities without immune deposits; anti-glomerular basement membrane (GBM) disease; Henoch-Schönlein purpura and cryoglobulinemia vasculitis. Vasculitic syndromes that affect large/medium vessels only occasionally affect the lung .Wegener's granulomatosis (WG) is a rare disease of uncertain cause. It seems to affect children as much as adults with an increasing reported incidence around 2.75 cases/million/year, mostly in teenagers with a reported median age of 14.2 years (4-17 years) ,113. It Churg-Strauss syndrome (CSS) is a granulomatous small-vessel vasculitis. The cause of this allergic angiitis and granulomatosis is not known, but autoimmunity is evident with the presence of hypergammaglobulinemia, increased levels of immunoglobulin E (IgE), and perinuclear-staining (p)-ANCA. The diagnosis relies on biopsy evidence for vasculitis and at least 4 criteria among the following: moderate to severe asthma, blood eosinophilia (at least 10%), and nonfixed pulmonary infiltrates with extravascular eosinophils on biopsy . Twenty-Goodpasture syndrome is a rare disease that involves rapidly progressive kidney failure along with lung disease and is characterized by the deposition of anti-GBM antibodies. Several cases have been reported in the pediatric literature. The autoantibodies mediate tissue injury by binding to their reactive epitopes in the basement membranes. This binding can be visualized as the linear deposition of immunoglobulin along the glomerular basement membrane. The principle component of the basement membrane is type IV collagen which can be expressed as 6 different chains, from alpha1 to alpha6. The Goodpasture antigen has been localized to the carboxyl terminus of the noncollagenous domain of the alpha3 chain of type IV collagen. The anti-GBM antibody can usually be found in serum . Strong Granulomatous disorders are characterized by the presence of granulomas defined as a focal, compact collection of inflammatory cells in which mononuclear cells predominate. Granulomas form as a result of tissue injury by a wide variety of agents including micro-organisms, antigens, chemical, drugs and other irritants. In other situations including sarcoidosis, the etiologic factors remain to be determined.Sarcoidosis is a chronic inflammatory disease in which granulomatous lesions can develop in many organs, mainly the lung. Its cause remains obscure, and most likely involves environmental and host factors . The curThe incidence and prevalence of sarcoidosis are reported to be influenced by age, race and geographic localization . AlthougClinical manifestations in sarcoidosis are the consequences of local tissue infiltration with sarcoid granuloma. Therefore, disease expression depends on the organ or system involved and a variety of symptoms and physical findings can be observed . The modStaphylococcus aureus, Aspergillus, Burkholderia cepacia, and enteric gram negative bacteria [A number of pathological situations are associated with granulomatous disorders defined by the presence of non-caseating granuloma in biopsied tissues. Infections are the main causes of other granulomatous diseases, and are in some cases related to disorders of neutrophil function such as chronic granulomatous disease (CGD) . Most chbacteria . The mosThe other granulomatous diseases can be seen in other described diseases, such as immune disorders (including Crohn's disease and histiocytosis X), HS pneumonitis, vasculitis disorders or neoplasms.Gaucher's disease is an autosomal recessive disease and the most common of the lysosomal storage diseases. It is caused by a genetic deficency of the enzyme lysosomal gluco-cerebrosidase that catalyses the breakdown of glucocerebroside, a cell membrane constituent of red and white blood cells. The consequence is an accumulation of glucocerebroside in reticuloendothelial cells, leading to excessive deposition of fatty material in the spleen, liver, kidneys, lung, brain and bone marrow. Pulmonary expression is mainly characterized by physiologic involvement . Lung imaging may show interstitial changes .Niemann-Pick diseases are genetic diseases primarily due to deficiency of sphingomyelinase resulting in the accumulation of sphingomyelin within lysosomes in the macrophage-monocyte phagocyte system, mainly the brain, spleen, liver, lung, and bone marrow. Histology demonstrates lipid laden macrophages in the marrow, as well as "sea-blue histiocytes" on pathology. The infantile form with a dominant neurologic expression is rapidly fatal. In older patients, cases of ILD have been reported .Hermansky-Pudlak syndrome is a heterogeneous group of autosomal recessive disorders associated with accumulation of a ceroid-like substance in lysosomes of a variety of tissues. It is characterized by albinism, bleeding tendency associated to poor platelet aggregation and systemic complications associated to lysosomal dysfunction. A chronic inflammatory process may explain the progressive development of ILD and fibrosis .Familial hypercalcemia with hypocalciuria is caused by autosomal dominant loss-of-function mutations in the gene encoding the calcium-sensing receptor (CASR), a G-protein coupled membrane receptor expressed in many tissues . Loss-ofLangerhans'-cell histiocytosis is part of the histiocytosis syndromes, which are characterized by an abnormal proliferation of Langerhans' cells . The LanChildren with pulmonary Langerhans'-cell histiocytosis present in a variety of ways. They can be asymptomatic or present common symptoms such as nonproductive cough and dyspnea. HRCT of the chest is a useful and sensitive tool for the diagnosis. Indeed, the combination of diffuse, irregularly shaped cystic spaces with small peribronchiolar nodular opacities, predominantly in the middle and upper lobe, is highly suggestive of pulmonary Langerhans'-cell histiocytosis . Other aSeveral forms of ILD have been reported to occur with inflammatory bowel diseases (Crohn's disease) and celiac disease . PrimaryDepending on the causes, the components of the alveolar structure can be involved differently and can serve as primary targets of the underlying pathological processes. Based on history, clinical presentation, BAL data, and, most important, on information from lung tissue studies, the disorders can be gathered in groups according to predominant structural targets Figure .The disorders affecting primarily the alveolar epithelium and the alveolar space share common histopathological description, with preserved pulmonary architecture, hyperplasia of type 2 AEC, interstitial infiltrates composed of immuno/inflammatory cells and scattered myofibroblasts, and the alveolar space filled with either immuno/inflammatory cells, desquamated materials, or components derived from surfactant lipid and protein complex. In the coming years, it is likely that the list of disorders will expand rapidly with the availability of specific tissue markers. Currently, the following grouping can be proposed: infections, surfactant disorders, and eosinophilic lung diseases.The role of infection, mainly viral, in the development and progression of ILD is sustained by a number of human and experimental reports. From recent knowledge, it is strongly suggested that latent viral infections may be involved in the pathogenesis of ILD, through targeting of the alveolar epithelium. The main virus implicated include adenovirus, members of human herpes virus family , and respiratory syncitial virus . Number Human adenovirus being predominantly respiratory pathogens, adenovirus infections can cause a variety of pulmonary symptoms and can persist for long periods of time. Several studies in adult patients have indicated that the adenovirus gene product E1A could be detected in lung tissues by in situ hybridization in up to 16% of cases of idiopathic pulmonary fibrosis. The causative role of the virus in the initiation of the disease remains uncertain, but it may be an important factor in its progression as treatment with corticosteroids may make patients more susceptible to adenovirus infection or reactivation from latency. E1A has been shown to increase the production of TGF-β and to induce lung epithelial cells to express mesenchymal markers, thereby contributing to remodeling of the alveolar structure . IsolatiEpstein-Barrr virus (EBV) and cytomegalovirus (CMV) are widespread pathogens that share the characteristic ability of herpesviruses to remain latent within the body over long periods. In mice, the control of herpesviruses replication have also been reported to be associated with the arrest of lung fibrosis . EBV is Respiratory syncytial virus (RSV) is the most common cause of viral lower respiratory tract infection. It affects people of all ages, and can cause severe disease in infants, in older immunodeficient children and the elderly. An intriguing feature of RSV infection is the susceptibility of previously infected individuals to reinfection with antigenically closely related viruses or the identical virus strain. Recently, increased interest has been focused on the contribution of persistent RSV in several chronic lung diseases including chronic obstructive pulmonary disease . The rolhlamydophila pneumoniae and Mycoplasma pneumoniae are currently drawing increasing consideration. They are frequent causes of community acquired pneumonia in children. Before the age of 10 years, almost 70% of children have had Chlamydophila pneumoniae infection based on serological studies [Legionella pneumophilia infection, progression towards ILD has been infrequently reported in adult patients.Among the other pathogens, C studies . These p studies . RegardiResults from recent studies provided evidence that viruses can infect the alveolar epithelium and may be documented in lung tissues from patients using virus DNA detection and immunohistochemistry. A number of specific antibodies are currently available and should prompt to investigate the presence of the above cited viruses in the lung tissues from children with ILD.Surfactant disorders include mainly genetic surfactant protein disorders and pulmonary alveolar proteinosisSFTPC mutation I73T (c.218 T > C) is the more prevalent mutation. Others are described in only one family. The phenotype associated with SFTPC mutations is extremely heterogeneous leading from neonatal fatal respiratory failure to children and adults chronic respiratory disease with ILD [ABCA3 gene were first attributed to fatal respiratory failure in term neonates but are increasingly being recognized as a cause of ILD in older children and young adults. Over 100 ABCA3 mutations have been identified in neonates with respiratory failure and in older children with ILD [TTF-1 gene are associated with "brain-lung-thyroid syndrome" which combines congenital hypothyroidism, neurological symptoms , and ILD of variable intensity [The deficiency in SP-B is a rare autosomal recessive condition known to be responsible for lethal neonatal respiratory distress. Rare survivals have been described in partial deficiencies ,154. Thewith ILD . Recessiwith ILD ,155-161.ntensity -168. So ntensity ,170.Pulmonary alveolar proteinosis (PAP) is a rare lung disorder characterized by alveolar filling with floccular material derived from surfactant phospholipids and protein components. PAP is described as primary or secondary to lung infections, hematologic malignancies, and inhalation of mineral dusts. Recently, the importance of granulocyte/macrophage colony-stimulating factor (GM-CSF) in the pathogenesis of PAP has been documented in experimental models and in humans. GM-CSF signaling is required for pulmonary alveolar macrophage catabolism of surfactant. In PAP, disruption of GM-CSF signaling has been shown, and is usually caused by neutralizing autoantibodies to GM-CSF. Therefore, the emerging concept is that PAP is an autoimmune disorder resulting in macrophage and neutrophil dysfunction. In a recent report, it has been reported that GM-CSF autoantibodies are normally present in healthy individuals, but at lower levels than in PAP patients . In addiEosinophilic lung diseases constitute a diverse group of disorders of various origins. The diagnosis is suggested by the presence of pulmonary infiltrates on chest imaging and peripheral eosinophilia. It is confirmed by the presence of increased amounts of eosinophils in BAL and/or lung tissue eosinophilia. In this section, eosinophilic vasculitis will not be discussed (see chapter 6.2.2). The search for an etiology includes a combination of clinical and laboratory investigations. Eosinophilic lung diseases of known cause in children include mainly allergic bronchopulmonary aspergillosis, parasitic infections and drug reactions. Eosinophilic lung diseases of unknown cause comprise Loeffler syndrome (characterized by migrating pulmonary opacities), acute eosinophilic pneumonia, and chronic eosinophilic pneumonia ,175. TheThe pulmonary capillaries form a dense sheet-like meshwork composed of short interconnected capillary segments. The capillary meshes are wrapped over the alveoli, with only a single sheet of capillaries between adjacent alveoli on the same alveolar duct. Impaired development of this vascular network can be caused by genetic defects, prematurity or injury. Aberrant angiogenesis documented in pediatric patients include mainly alveolar capillary dysplasia, and pulmonary capillary hemangiomatosis . AlveolaAlveolar structure formation is characterized by refinement of the gas exchange unit and functional adaptation of endothelial cells into vessels including pulmonary lymphatics. The pulmonary lymphatic network promotes efficient gas exchange through maintaining interstitial fluid balance. Lymphatic disorders can be classified as primary or secondary.Congenital errors of lymphatic development can lead to primary pulmonary lymphatic disorders that include lymphangiomas and lymphangiomatosis, lymphangiectasis, and lymphatic dysplasia syndrome ,184. LymDiffuse alveolar hemorrhage (DAH) syndromes are caused by the disruption of alveolar-capillary basement membrane as a consequence of injury to the alveolar septal capillaries, and less commonly to the arterioles and veinules. The hallmarks are intra-alveolar accumulation of red blood cells, fibrin, and hemosiderin-laden macrophages. It is important to point out that approximately one third of patients with DAH do not manifest hemoptysis, and BAL can be extremely helpful if this entity is suspected by showing the presence of siderophages or red blood cells within the alveoli. DAH can be observed in association with systemic findings or without evidence of associated diseases.In children, situations of DAH in the context of other disorders are reported in several forms of vasculitis discussed above. Other disorders that can also be accompanied by DAH include pulmonary hypertension and congenital heart diseases, pulmonary veino-occlusive disease, arteriovenous malformations and hereditary haemorrhagic telangiectasia, coagulation disorders, and celiac disease .In the absence of systemic findings, isolated pulmonary capillaritis should be discussed with the search for positivity of the antiglomerular basement membrane antibody with linear deposits in the lung tissue biopsy as well as suggestive serologic features such as p-ANCA antibodies .Idiopathic pulmonary hemosiderosis is a diagnosis of exclusion based on patient presentation with acute, subacute, or recurrent DAH, on the results of lung biopsy showing evidence of 'bland' pulmonary hemorrhage , and after exclusion of the conditions listed above . In thisIn the resolution phase of tissue injury, elimination of mesenchymal cells and recruited inflammatory cells is essential for restoration of normal cellular homeostasis. Dysregulated repair process in ILD is associated with accumulation and dysfunction of interstitial fibroblasts . In the In the context of ILD, pulmonary interstitial glycogenosis, neuroendocrine cell hyperplasia, and chronic pneumonitis in infancy have been reported to be exclusively observed in very young children .Pulmonary interstitial glycogenosis (PIG) is a non lethal disease, reported in neonates with respiratory distress syndrome developed shortly after birth ,194. VerNeuroendocrine cell hyperplasia of infancy (NCHI) is also a non lethal disease characterized by tachypnea without respiratory failure. The human airway epithelium contains highly specialized pulmonary neuroendocrine cells (PNEC) system. It's function remains unknown but is hypothysed to act in modulation of fetal lung growth and in post-natal stem cell condition . The PNEChronic pneumonitis in infancy was first described by Katzenstein et al. . The cliOther disorders associated with pulmonary development and growth abnormalities encompass a broader spectrum of respiratory manifestations and are more adequately integrated in the classification of diffuse lung diseases .Management of children with ILD includes administration of oxygen for chronic hypoxaemia, and maintenance of nutrition with an adequate energy intake, Immunization with influenza vaccine on an annual basis is recommended along with other routine immunizations against major respiratory pathogens . In addiA very few children do not require any treatment and recover spontaneously. In the majority of cases, treatment with immunosuppressive, anti-inflammatory, or anti-fibrotic drugs is required for weeks, months or even years ,9,61. VaAt the present time, the main therapeutic strategy is based on the concept that suppressing inflammation may most likely prevent progression to fibrosis. Among the anti-inflammatory agents used in pediatric ILD, steroids are the preferred choice, administered orally and/or intravenously. This has been well illustrated by the results of the ERS Task Force on pediatric ILD . Oral prAn alternative to steroids is hydroxychloroquine with a recommended dose of 6-10 mg/kg/day. Individual case reports have described a response to hydroxychloroquine even in the presence of steroid resistance ,206. SomPromising therapeutic options include macrolides. Indeed, these antibiotics have been shown to display a number of anti-inflammatory and immunomodulatory actions. Although the mechanisms and cellular targets specific to macrolide activity remain to be elucidated, beneficial effects in several chronic lung diseases including chronic obstructive pulmonary diseases (COPD) and cystic fibrosis have been reported ,208. Of Depending on the underlying diseases, several specific treatment strategies needs to be considered. These include whole lung lavage for pulmonary alveolar proteinosis, which has been reported to be effective by removing the material from the alveolar space . GM-CSF In recent years, lung transplantation has emerged as a viable option in children of all ages, even in young infants, and lung or heart-lung transplantation may be offered as an ultimate therapy for end-stage ILD . The outResponse to treatment and outcome can be evaluated in children based on several criteria such as decrease in cough and dyspnea, increase in oxygenation at rest and sleep, and changes in pulmonary function tests ,11. ImprPediatric ILD comprises a large spectrum of disorders, with compelling evidence that some of these disorders are observed more frequently in infants, while others are more specific to older children. Ongoing basic research will provide new insights into the molecular basis of ILD pathogenesis in children, and is expected to identify important preclinical markers of disease, pathways of disease regulation, and novel potential targets for therapeutic intervention. For the future, there is a strong need for international collaboration which will allow collecting sufficiently large cohorts of patients with specific entities in order to perform proper therapeutic trials. As a prerequisite, however, a clear and standardised classification of the histopathology of the underlying conditions is critical. Such multicenter trials will help to reduce the still considerable morbidity and mortality in children with ILD.SFTPB): Gene coding for SP-B; (SFTPC): Gene coding for SP-C; (GM-CSF): Granulocyte/macrophage colony-stimulating factor; (HSP): Henoch-Schönlein purpura; (HRCT): High-resolution computed tomography; (HIV): Human immunodeficiency virus; (HP): Hypersensitivity pneumonitis; (Ig): Immunoglobulin; (ILD): Interstitial lung disease; (KL-6): Kerbs von Lungren 6; (LIP): Lymphocytic interstitial pneumonia; (MMP): Metalloproteinases; (MPA): Microscopic polyangiitis; (MCTD): Mixed connective tissue disease; (NCHI): Neuroendocrine cell hyperplasia of infancy; (NSIP): Non-specific interstitial pneumonia; (p): Perinuclear-staining; (PAP): Pulmonary alveolar proteinosis; (PFT): Pulmonary function testing; (PIG): Pulmonary interstitial glycogenosis; (PNEC): Pulmonary neuroendocrine cells; (RV): Residual volume; (RSV): Respiratory syncitial virus; (RA): Rheumatoid arthritis; (RNP): Ribonucleoprotein; (SRP): Signal recognition particle; (SS): Sjögren syndrome; (Sm): Smith antigen; (SP): Surfactant proteins; (SLE): Systemic lupus erythematosus; (SSc): Systemic sclerosis; (TTF-1): Thyroid transcription factor 1; (TLC): Total lung capacity; (TLCO): Transfer factor of the lung for carbon monoxide; (TGF): Transforming Growth Factor; (UIP): Usual interstitial pneumonia; (WG): Wegener's granulomatosis;(ARDS): Acute respiratory distress syndrome; (AEC): Alveolar epithelial cells; (ATS): Amercican Thoracic Society; (AS): Ankylosing spondylitis; (Ab): Antibodie; (anti-CCP): Anticyclic citrullinated peptide; (anti-GBM): Anti-glomerular basement membrane;(Jo1): Anti-histidyl-t-RNA synthetase; (ANCA): Anti-neutrophil cytoplasmic antibody; (ANA): Antinuclear antibodies; (anti-U1-RNP): Anti-U1-ribonucleoprotein; (SaO2): Arterial oxygen saturation; (ABCA3): ATP-binding cassette, sub-family A, member 3; (BiP): Binding immunoglobulin protein; (BAL): Bronchoalveolar lavage; (CASR): Calcium-sensing receptor; (CGD): Chronic granulomatous disease; (COPD): Chronic obstructive pulmonary disease; (CSS): Churg-Strauss syndrome; (CTD): Connective tissue disorders; (CMV): Cytomegalovirus; (c): Cytoplasmic-staining; (DIP): Desquamative interstitial pneumonia; (DAD): Diffuse alveolar damage; (DAH): Diffuse alveolar hemorrhage; (DLCO): Diffusing capacity of the lung for carbon monoxide; (ER): Endoplasmic reticulum; (ET): Endothelin; (EMT): Epithelial-mesenchymal transition; (EBV): Epstein-Barrr virus; (ERS): European Respiratory Society; (FRC): Functional residual capacity; (The authors declare that they have no competing interests.AC and NN contributed equally to this work and should be considered as joint first authors. AC, NN and HC drafted the review. RE and BF have been involved in revising critically the review. All authors read and approved the final manuscript.

Many medical schools are establishing learning communities to foster cohesion among students and to strengthen relationships between students and faculty members. Emerging learning communities require nurturing and attention; this represents an opportunity wherein medical students can become involved as leaders. This study sought to understand issues related to active involvement among students who chose to become highly engaged in a newly developed learning community.Between April and June 2008, 36 students who assumed leadership roles within the Colleges Program were queried electronically with open-ended questions about their engagement. Qualitative analysis of the written responses was independently performed by two investigators; coding was compared for agreement. Content analysis identified major themes.35 students (97%) completed the questionnaire. Motives that emerged as reasons for getting involved included: endorsing the need for the program; excitement with the start-up; wanting to give back; commitment to institutional excellence; and collaboration with talented peers and faculty. Perceived benefits were grouped under the following domains: connecting with others; mentoring; learning new skills; and recognition. The most frequently identified drawbacks were the time commitment and the opportunity costs. Ideas for drawing medical students into new endeavors included: creating defined roles; offering a breadth of opportunities; empowering students with responsibility; and making them feel valued.Medical students were drawn to and took on leadership roles in a medical school curricular innovation. This example may prove helpful to others hoping to engage students as leaders in learning communities at their schools or those wishing to augment student involvement in other programs. In medical school, students encounter robust curricula that often leave little time for personal development and engagement within the academic community. The demanding nature of medical student training has forced educators to reconsider the impact of curriculum on student life . Social Learning communities contribute positively to stakeholders' perceptions of the educational environment, and in medicine they facilitate increased interaction among medical students as well as between students and faculty members . MedicalThis study used qualitative analytic methods to purposively examine student leaders enrolled at JHUSOM during the 2007-2008 academic year who volunteered to hold a defined leadership position in the Colleges Program. Leadership roles included planning Colleges-sponsored student programs, coordinating social gatherings, organizing educational events, and directing the peer advising program. These students actively participated in the programs and committed much effort trying to make them successful. To be eligible for inclusion, students had to have spent at least 10 hours working on Colleges related activities in the prior year. All medical students were invited to get involved with this program and those who stepped forward to volunteer were made aware the student leadership roles (described above). Four students had leadership roles but did not dedicate the minimum number of hours and were thus not included in the studied.Survey Monkey™ between April 30 and June 1, 2008 to the 36 medical student leader informants to understand their perspectives. In addition to the questions related to their engagement and leadership roles, the survey also collected demographic information . The study was approved by the institutional review board.The data collection instrument, comprised primarily of open ended questions Table , was senDemographic data and responses to quantitative questions are presented as means and proportions. The responses from all of the open-ended questions were moved to a master document for analysis. We analyzed written responses to all questions using an "editing analysis style," a qualitative analysis technique in which researchers search for "meaningful units or segments of text that both stand on their own and relate to the purpose of the study" . With thOf the 36 medical student leaders sent questionnaires, 35 responded. One female third-year student did not participate. Informant characteristics are summarized in Table tremendously' committed to making the Colleges program excellent.In describing their roles within the Colleges, fourteen students (40%) assumed leadership in both the peer advising and social/community building programs. The mean amount of time students devoted to leadership in the Colleges in the prior 12 months was 46 hours. Forty percent of students described being 'The comments and stories related by student leaders were categorized into themes that relate to their active involvement in the program. An overview of the themes is presented in Table From the responses of medical student leader informants, five subcategories emerged that explained why the students decided to become actively involved in the learning community. The reasons given can be thought of as the motivations and the expected or hoped advantages.Student leaders identified strongly with the goals of the Colleges program and were thrilled that it filled a previously unfulfilled void.A male first year student stated:"I think the Colleges program is a great idea. I personally benefited from the system--peer and faculty advising has been great. It is in its incipient stages, and I have enjoyed the opportunity to shape a future legacy at the school."A 30-year old male fourth year peer advising leader remarked:"The Colleges program provides an important link between faculty and students, which had been thus far missing, and a way to strengthen or establish inter-class relationships ..."Many student leaders discussed ideas related to their enthusiasm about being at the beginning of something special. They characterized the early years of the program as a time of potential, novelty, and growth in which they could take part.A different first year male student who had devoted 30 hours to the program in the last year explained:"I think that the Colleges program has a great potential of playing a very constructive, uniting, and functional role in students' lives. I felt that by participating, I could contribute towards that goal."A 29 year old fourth year female student who was 'tremendously' committed to the Colleges wrote:"I felt a need for better advising programs during my first year and was excited that the administration had plans to address the lack of faculty advising by implementing the Colleges program."Medical student leader informants described how a sense of giving back was also at the core of what motivated them to get involved. Specific facets within this domain included the desire to make a difference, to solve problems, and to be beneficent.A male second-year medical student leader who had devoted 60 hours to the program in the prior year emphasized the significance of giving back:"I saw peer advising as a way to give back to the med school community, a new program with an identity that we could help create as we participated..."A different second year medical student peer advising leader shared a sense of reciprocity:"I wanted to help underclassmen as I had been helped by upperclassmen before."The importance of making the program as successful as possible and of enhancing the school's reputation was referenced by the student leaders.A male third year medical student who had invested more than 100 hours in the program in the last year reflected on its effect on the institution:"The program is a great selling point for our school and for our potential students/applicants. When people look for medical schools, they like to compare advising opportunities (at least I did)."Another dedicated female first year medical student looked to the future impact of the Colleges on both students and the surrounding community:"I am excited about ... the impact the Colleges program holds in shaping students' Hopkins experience while making a tangible impact on the Baltimore community ... I have been amazed at the difference that a sense of group unity can make in enriching everyone's overall experience."Student leaders described being motivated to work in this environment and having the opportunity to collaborate with capable colleagues, both fellow students and faculty members.A male second year student who also estimated his time commitment at more than 100 hours in the prior year remarked:"I got involved primarily because I have a phenomenal advisor. In appreciating what the program had given me, I felt more devoted to it. From there, getting to work with certain classmates and peers reinforced that connection."A 25 year old female fourth year student with leadership roles in both peer advising and community building commented on how her involvement has impacted relationships with other students and faculty:"The main reason for me to take on a role in the Colleges program has been to meet students from different classes and to foster inter-class relationships. Another benefit is being able to work with faculty members whom I otherwise would never had met. I feel I am well taken care of and have several mentors..."curriculum vitae.Student leaders listed several actual benefits related to their active involvement in the learning community. Informants noted that their experience with the Colleges program assisted them through: (i) a better defined sense of community with a broader exposure to other students and faculty, (ii) deeper mentoring relationships (both as peer mentor and as mentee), (iii) the ability to learn or refine their own leadership skills, (iv) giving them additional insight about navigating within a large institution, and (v) recognition - both informally from others and in being able to add their contribution to their The most common drawback, identified by a majority of respondents, was the amount of time involved in taking on a committed leadership role within the program. Responses from student leaders also indicated that their involvement had 'opportunity costs' in terms of foregoing other activities - including studying and non-educational pursuits.A female medical student in her final year of medical school summarizes these ideas:"I think whenever you get involved with any activity; there are always pros and cons... I have sometimes sacrificed personal/academic time to work on colleges/peer advising initiatives - time that could have been spent with my spouse, studying for an exam, doing research. However, I feel that the opportunity to bring about a cultural change at an institution like Hopkins is worth the extra effort on my part and I don't believe I have suffered any long-term negative effects from my involvement...In fact, I think this experience will be useful to me in the future..."Medical student leader informants also generated several ideas for drawing more medical students into school or faculty-initiated endeavors. Their ideas were organized around the following ideas: (i) creating defined positions for students with specific responsibilities within a logical organizational structure, (ii) providing a diverse array of opportunities for students, (iii) empowering student leaders with specific and meaningful responsibilities, and (iv) implementing steps to make students feel appreciated, respected, and valued.About these matters, two different female students in the graduating class explained:"The most effective way to accomplish this to students would be to have them become invested in the process somehow. If students can take on ownership, and feel like they have a little piece of the pie, if you will, and that what they do as students will make a tangible difference then I feel like they will become engaged."If people feel that what they bring to the table is important and special, and will not otherwise be provided if they are absent, they are more likely to become actively engaged, keep to deadlines despite other work-pressures, and contribute productively to their colleges and the program in general.""wanting to give back, endorsing the need for the program), the school , and themselves . The last explanation for their assumption of a committed leadership role can be attributed to the entrepreneurial spirit of these students - excitement with the start-up.In this study, medical students describe motivations, benefits, and drawbacks associated with their voluntary assumption of leadership roles within a new learning community. The emergent themes that explain the reasons that they opted to roll up their sleeves and get involved may have been predicted based on motivational theory . Motivatlearning new skills), working with "winners" , the opportunity to solve problems (endorsing the need for the program), recognition of work (recognition), and appropriate compensation (recognition) [Reflecting upon learning communities in the context of organizational culture may provide insight as to why individuals seek out responsibility. Results from a study performed at successful organizations showed that dedicated employees gave answers that were comparable to the motivators and benefits listed by our committed medical students: opportunities for personal development (gnition) . The culgnition) . Thus, iThere is a fair amount of literature documenting the value of learning communities in higher education ,13. Boye'drawing in' medical students. Creating defined roles, offering a breath of opportunities, empowering students with real responsibility, and genuinely valuing the students and showing it may be instructive to others seeking student buy-in and leadership. Foregoing involvement in the learning community can represent a missed opportunity to leave a meaningful legacy at one's medical school, and disengagement may contribute to a student's social isolation [Students often come to medical school with robust resumes of leadership in their former collegiate and home communities . Howeversolation . Furthersolation .Several limitations of this study should be considered. First, this study relied exclusively on self-report. However, this is considered to be the most direct approach for understanding attitudes and beliefs. Second, this study is limited to a small number of medical students in one learning community at a single academic institution and thus our findings may not apply to other institutions. We sampled all possible informants so the issue of thematic saturation and ending data collection early was not necessary to consider. Students who might volunteer for leadership opportunities at other medical schools may be different and may have different perspectives about the benefits and drawbacks. Finally, one student leader declined participation and it is possible that her perspectives may have been different.The results of this study shed light onto medical student engagement and leadership within a learning community. The implementation and growth of learning communities in medical schools presents unique opportunities for many groups, particularly students. When medical students become engaged in leadership roles within the learning community, both the students and the learning community are to gain.The authors declare that they have no competing interests.All authors conceived the idea, chose the study design, and developed survey. MB and SW performed the qualitative analysis, but SM and RS were involved by reviewing and providing feedback on the coding template. All authors participated in writing paper and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6920/10/20/prepub

Laparoscopic approaches to gynecological surgery have been developed by an elite group of highly skilled surgeons. As these procedures become more prevalent in the general gynecological approach to disease and the general gynecologist's approach to treatment, the complication rate for these procedures is likely to increase. In an effort to assist in avoiding these complications, guidelines for the performance of laparoscopic gynecological procedures need to be established. This article presents approaches to the most common gynecological procedures that can assist in the prevention of complications.

Human respiratory syncytial virus (HRSV), and to a lesser extent human metapneumovirus (HMPV) and human parainfluenza virus type 3 (HPIV3), re-infect symptomatically throughout life without antigenic change, suggestive of incomplete immunity. One causative factor is thought to be viral interference with dendritic cell (DC)-mediated stimulation of CD4+ T cells.We infected human monocyte-derived DC with purified HRSV, HMPV, HPIV3, or influenza A virus (IAV) and compared their ability to induce activation and proliferation of autologous CD4+ T cells in vitro. IAV was included because symptomatic re-infection without antigenic change is less frequent, suggesting that immune protection is more complete and durable. We examined virus-specific memory responses and superantigen-induced responses by multiparameter flow cytometry. Live virus was more stimulatory than inactivated virus in inducing DC-mediated proliferation of virus-specific memory CD4+ T cells, suggesting a lack of strong suppression by live virus. There were trends of increasing proliferation in the order: HMPV<HRSV<HPIV3<IAV, and greater production of interferon-γ and tumor necrosis factor-α by proliferating cells in response to IAV, but differences were not significant. Exposure of DC to HRSV, HPIV3, or IAV reduced CD4+ T cell proliferation in response to secondary stimulus with superantigen, but the effect was transitory and greatest for IAV. T cell cytokine production was similar, with no evidence of Th2 or Th17 skewing.Understanding the basis for the ability of HRSV in particular to symptomatically re-infect without significant antigenic change is of considerable interest. The present results show that these common respiratory viruses are similar in their ability to induce DC to activate CD4+ T cells. Thus, the results do not support the common model in which viral suppression of CD4+ T cell activation and proliferation by HRSV, HMPV, and HPIV3 is a major factor in the difference in re-infectability compared to IAV. Human respiratory syncytial virus (HRSV) is the most important viral agent of serious pediatric respiratory tract disease worldwide These common human respiratory viral pathogens share a tropism for the superficial epithelial cells of the respiratory tract, although IAV appears to be much more cytopathic and also efficiently infects underlying cells in the epithelium Conventional or myeloid dendritic cells (DC) are pivotal in initiating the adaptive immune response. Immature DC reside in peripheral tissue to capture antigen, and serve as sentinels to detect local infection, and in lymphatic tissue, where they encounter microbial macromolecules from the draining lymph. In addition, during a lower respiratory tract infection, the number of DC in bronchi and lung increases by chemotactic influx of precursors that originate primarily from circulating monocytes After pathogen recognition, the immature DC up-regulate major histocompatibility (MHC) and co-stimulatory molecules, express cytokines, and shift expression of chemokine receptors to direct the DC to the T lymphocyte-rich areas of lymphoid tissue. This process of DC maturation may be affected by additional cues from the infected tissue, such as cytokines produced by infected cells, immune cells, or dying cells. A major role of mature DC is to present antigen and activate CD4+ and CD8+ T cells such that they proliferate and are polarized into memory and/or effector subsets FH) Naïve CD4+ T cells can differentiate into T helper (Th) subsets with distinct functions and effects on the adaptive immune response greater than that to HRSV and HMPV. In response to SEB secondary stimulation, T cell proliferation was transiently reduced in T cell cocultures with virus-matured MDDC, with the effect being greatest for IAV. Differences in the spectrum and quantity of cytokine production between the viruses were minimal. Thus, while these common respiratory viruses had an inhibitory effect on CD4+ T cell responses under certain conditions, the effect was not profound and unlikely to account for the ability of a virus to re-infect in nature since the effect was greatest for IAV.DDAO-labeled immature MDDC were mock-treated or treated for 4 to 6 h with rHMPV, rHRSV, rHPIV3, or IAV, an equivalent amount of each UV-inactivated virus, or, as a positive control, SEB. The MDDC were then washed extensively and co-cultured with autologous CFSE-labeled CD4 T lymphocytes at an MDDC-to-T cell ratio of 1∶10. After an incubation period of up to 7 days, the cells were stimulated with PMA and ionomycin and harvested, stained for discrimination between live and dead cells and immunostained for CD3 and several cytokines. CD4 T cells were analyzed by flow cytometry see , and ii.To determine the optimal time point for T cell analysis, we examined a time course of CD4+ T cell proliferation during co-culture with MDDC that had been exposed to mock-treatment, SEB, or a subset of the viruses, namely live or UV-inactivated rHRSV or IAV A and B,Using cells from one donor, we investigated whether the proliferating CD4+ T cells in the co-cultures with virus-stimulated MDDC were naïve or virus specific memory CD4+ T cells: this was determined on day 4, when proliferating cells were first evident, and also on day 7 . At day Next, using cells from eight donors, we compared the level of CD4+ T cell proliferation in response to MDDC exposed to each of the four live or UV-inactivated viruses , or SEB, or mock-treatment C. The cIn addition to measuring proliferation with CFSE, we also measured CD4 T cell cytokine expression by blocking protein export with brefeldin A and staining for IFN-γ (Th1 cytokine), IL-4 (Th2 cytokine), IL-17 (Th17 cytokine), IL10 (immunosuppressive cytokine) and TNF-α (pro-inflammatory cytokine). In experiments employing cells from six donors, there were only minimal numbers of IL-4 or IL-17 producing cells at any time point (not shown) and a pilot experiment with cells from one donor, we detected only minimal numbers of IL10 producing cells. Therefore, we focused on the production of two Th1 cytokines IFN-γ and TNF-α.From the same experiment shown in We then analyzed cytokine production on day 7 from five of the eight donors from the experiment shown in Interestingly, the IFN-γ MFI was approximately two to three-fold greater in T cells that produced both IFN-γ and TNF-α, compared to cells that produced only IFN-γ. Similarly, TNF-α production was also higher in double positive cells than in single positive cells. In particular, IAV and rHRSV treated MDDC induced more TNF-α in double positive T cells than SEB, rHPIV3, and rHMPV D. The fIt was previously reported that HRSV and HPIV3 suppress T cell responses to secondary stimuli As with the previous set of experiments, we first determined the best time point to measure proliferative and cytokine responses using cells from a single donor A and B.Next, using cells from six donors, we compared the level of CD4+ T cell proliferation in response to MDDC that had been mock-treated to those stimulated with each of the four live or UV-inactivated viruses followed by co-culture in the presence of SEB C. This We previously reported that types I and III (lambda) IFN play a role in the inhibition of CD4+ T cell proliferation in response to HRSV-exposed MDDC As part of the experiments described in the previous section, proliferating CD4+ T cells were analyzed by intracellular cytokine staining to quantify expression of IFN-γ, IL-4, IL-17 and TNF-α. Since there was minimal detection of cells producing IL-17 at any time point (data not shown), we focused on the production of IL-4, IFN-γ and TNF-α. However, IL-4+ cells that were detected were also IFN-γ+ and TNF-α+ . The proFrom the experiments shown in We then analyzed CD4+ T cell cytokine expression in the experiments shown in in vitro, with varied and inconsistent conclusions. The first such studies reported that exposure of adult human peripheral blood mononuclear cells (PBMC) to HRSV, IAV, and Sendai virus suppressed proliferation in response to the non-specific mitogen phytohemagglutinin (PHA), an effect that was attributed to the expression of CD54/CD11a/CD18 (ICAM-1/LFA-1) and the interaction between APC and T cells et al.The ability of HRSV, HMPV and HPIV3 to re-infect symptomatically throughout life without the need for significant antigenic change has led to the widely held speculation that these viruses, especially HRSV, can suppress or subvert the host adaptive immune response, resulting in incomplete and inefficient long-term immunity. A number of studies have addressed virus-specific effects on APC and T lymphocyte responses et al. (2003) in vitro from cord blood CD34+ stem cells and showed that in presence of the toxic shock syndrome toxin-1 superantigen, HRSV caused increased DC apoptosis and reduced expression of IFN-γ and increased expression of IL-4 without affecting proliferation. Rothoeft et al.et al.et al.et al.et al.More recent studies have used increasingly more defined conditions. Bartz To address the question of virus-specific suppression of CD4 T cell function, we examined four viruses side-by-side, whereas the majority of the studies noted above examined a single virus, usually HRSV. While logistically more difficult, comparing a greater number of viruses provided for discrimination between effects that were unique to a particular virus versus those that were common to all. Also, analyzing more viruses and thus obtaining more comparisons for each individual donor was useful, given the heterogeneity of responses from an outbred human population. The “down-side” of our approach is that these studies were time consuming and laborious, and the donor-to-donor variability in human populations, and the relatively large panel of viruses studied, would have necessitated a high number of studies to reach statistical significance for the more nuanced differences between viruses, and forced us to interpret trends in differences.We also used a more careful method of preparing virus. Viruses were grown in Vero cells, which do not produce type I IFN, and purified by sedimentation in sucrose gradients. We avoided the use of high input MOI of virus, especially with HRSV, which was used at an MOI of 10-20 or more in some studies With regard to antigen-specific responses, CD4+ T cell proliferation in response to MDDC exposed to rHRSV was less than that to rHPIV3 and IAV and greater than to rHMPV, but the differences were not significant. In addition, proliferation was greater in response to MDDC exposed to live versus UV-inactivated virus, indicating that, although we cannot rule out the possibility of viral interference with CD4+ T cell proliferation, the net effect of exposure to live virus was stimulatory rather than inhibitory. The increased percentage of proliferating cells found in IAV cultures might reflect the presence of more IAV-specific CD4+ T cells at the beginning of the culture compared to the frequency of T cells specific for the other viruses. However, the magnitude of T cell proliferation induced by the four viruses correlated well with the extent of MDDC maturation we observed previously By day 7, the IFN-γ and TNF-α cytokine expression profiles were similar among the four viruses, with approximately the same proportion of IFN-γ single-positive or IFN-γ/TNF-α double-positive CD4+ T cells. This shows that MDDC stimulated by all four viruses induced the same cytokines at similar levels with no signs of inhibition or Th2- or Th17-biased responses.The functionality of a protective T cell response depends on the quality of the cytokine producing cell. Several recent studies have shown that CD4+ T cells which are double-positive for IFN-γ and TNF-α produce these cytokines at a higher level compared to single-positive cells in vitro in the presence of GM-CSF and IL-4, with the potential to bias the T cell response, in particular by stimulating or inhibiting the Th2 pathway. While there have been many reports of plasticity among CD4 T cell subsets, the data still points to a fair level of rigidity among Th1 and Th2 subsets, compared, for example, to Th17 and Treg subsets. This suggests that our in vitro observations reflect the level of Th1 responses to each of these viruses in vivo.The CD4+ T cell recall response to all viruses was Th1-biased as characterized by the production of IFN-γ and the low IL-4 and IL-17 production by proliferating CD4+ T cells. This is offered with the caveat that the MDDC were generated We also investigated whether any of the virus stimulated MDDC inhibited T cell proliferation and cytokine production to SEB, as a model of secondary infection that is independent of virus-mediated differential effects on antigen uptake and presentation pathways. Indeed, compared to their UV-inactivated counterparts, rHRSV, rHPIV3 and IAV inhibited the CD4 T cell response to SEB. However, this effect was transient, most pronounced on day 4, and showed little or no difference between live and UV-inactivated HRSV by day 6. The inhibitory effect was relatively less for live rHRSV and rHMPV, whereas live IAV and rHPIV3 induced a markedly stronger inhibition of proliferation and IFN-γ and TNF-α production by day 4 of co-culture.The transient inhibition by live viruses in the SEB assay might be explained by the anti-proliferative effect of type I interferon on CD4+ T cells In summary, each of these common human respiratory pathogens can affect the ability of MDDC to activate CD4+ T cells. The more biologically relevant response, namely the proliferation of virus-specific memory T cells, was somewhat less for the paramyxoviruses compared to IAV. While this might make a contribution to a trend of increased ease of re-infection, the differences in proliferation did not rise to the level of statistical significance. The modestly reduced paramyxovirus-specific proliferative responses correlated with reduced levels of DC maturation observed in previous studies, an effect that appeared to reflect a lower level of stimulation rather than virus-mediated inhibition. There was no obvious virus-specific bias to T cell polarization, and cytokine production was not significantly different between viruses. The non-specific proliferation response to SEB was lower for IAV than for HRSV and the other viruses. These results suggest that rHRSV-infected MDDC do not strongly and specifically inhibit proliferation of CD4+ T cells. Thus, HRSV-specific effects on DC/T cell interactions are unlikely to account for the ability of HRSV to cause repeat infections during life.Elutriated monocytes and autologous CD4+ T lymphocytes were obtained from healthy donors at the Department of Transfusion Medicine of the National Institutes of Health, under a protocol (99-CC-0168) approved by the Institutional Review Board of the Clinical Center, NIH. Written informed consent was obtained from all donors.in vitroRecombinant (r) HMPV (strain CAN97-83), rHRSV (strain A2) and rHPIV3 (strain JS) were described previously 2, with inactivation monitored by plaque assay.Virus purification was described previously Elutriated monocytes and autologous CD4+ T lymphocytes were obtained from healthy donors at the Department of Transfusion Medicine of the National Institutes of Health, under a protocol (99-CC-0168) approved by the IRB of the Clinical Center, NIH. Written informed consent was obtained from all donors. As previously described 5 cells per well and were (i) keep mock-stimulated, (ii) infected for 4 to 6 h with live virus at an input MOI of 3 PFU/cell, (iii) with an equivalent amount of UV-inactivated virus, or (iv) incubated with 1 µg/ml of the superantigen SEB , a strong inducer of CD4+ T cell proliferation. All inoculations or stimulations were performed in complete medium at 37°C in 5% CO2.Immature MDDC were labeled with the far-red cell tracer 7-hydroxy-9H- . After 15 min incubation of MDDC in medium with 1.5 µM DDAO at room temperature, cells were quenched on ice using 5 volumes of aRPMI supplemented with 5% heat-inactivated human serum and extensively washed with aRPMI with 10% human serum. The DDAO labeled immature MDDC were then washed in aRPMI with 10% heat-inactivated fetal bovine serum (FBS), and seeded in 12-well plates at 6×102.After four to six h of stimulation, MDDC were extensively washed with complete medium and the absence of remaining infectious virus particles in the MDDC suspensions was confirmed by plaque assay as described above. To monitor CD4+ T cell proliferation by flow cytometry, autologous purified CD4+ T cells were labeled by incubation with the cell tracer carboxyfluorescein succinimidyl ester for 10 min at 37°C. Cells were quenched using medium with 5% human serum for 5 min on ice and extensively washed with complete medium. DDAO-labeled stimulated MDDC were co-cultured with CFSE-labeled CD4+ T lymphocytes at a ratio of one MDDC for ten CD4+ T lymphocytes for 1 to 7 days at 37°C in 5% COIn some experiments and 5, mCo-cultures were incubated for 6 h at 37°C with 20 ng/ml Phorbol myristate acetate (PMA), 1 µM ionomycin and 10 µg/ml brefeldin A to prepare for intracellular cytokine staining. Cells were then harvested and stained using live/dead fixable blue dead cell stain (Invitrogen) for 30 min at 4°C to discriminate between live and dead cells by flow cytometry. The cells were fixed and permeabilized according to the manufacturers instructions using the perm/wash buffer kit , blocked with milk saponin for 30 min and immunostained according to previously published protocols In addition, in some experiments, we determined if the proliferating CD4+ T cells arose from naïve versus virus specific memory cells. Virus stimulated MDDC were co-cultivated with CFSE stained autologous CD4+ cells. At day 4 and 7, cells were harvested and stained with live/dead fixable violet dead cell stain (Invitrogen) to discriminate between live and dead cells, and with an antibody specific to CD3 to identify T lymphocytes. To discriminate between naïve and memory CD4+ T cells, cells were stained with antibodies to CD45RA , and to CD45RO , respectively. To discriminate between central memory and effector memory CD4+ T cells, co-cultures were stained for CCR7 . CCR7 is expressed on central memory but not on effector memory CD4+ T cells Compensation was performed automatically using single color antibody capture beads (BD biosciences) for each antibody. Due to cell number limitations, settings and gating were adjusted using fluorescence minus one controls in five independent experiments with the same staining panel of antibodies and cell numbers as used in the present study. The gating was performed generously (i.e. far enough from the negative populations to not include negative events in the positive gates). The gating for cytokines was kept consistent between experiments as rainbow beads were used to adjust each photomultiplier tube voltage to the same median fluorescence for all experiments as previously described 10 transformation was applied to data sets when necessary to obtain equal standard deviation among groups, a necessary requirement of both tests. Statistics were performed using Prism, version 5 . Data were only considered significant at P≤0.05.Data sets were assessed for significance using parametric one-way repeated measures ANOVA with the Tukey post hoc tests for normally distributed data sets or the non-parametric Friedman test with Dunns post hoc test. A logFigure S1Memory phenotype of the proliferating CD4+ T cells. Proliferating CD4+ T cells (CFSE diluted T cells) were analyzed for naïve or memory markers. MDDC derived from one donor were stimulated with the indicated virus at an MOI of 3 and co-cultivated with autologous CD4+ T cells at the ratio of 1 MDDC for 10 CD4+ T cells. The phenotype of the proliferating CD4+ T cells was evaluated on day 4, corresponding to the time of detection of the first proliferating cells Click here for additional data file.

Metastasis to the bone is one clinically important features of prostate cancer (PCa). Current diagnostic methods cannot predict metastatic PCa at a curable stage of the disease. Identification of metabolic pathways involved in the growth of bone metastases therefore has the potential to improve PCa prognostication as well as therapy.de novo synthesis of cholesterol.Metabolomics was applied for the study of PCa bone metastases (n = 20) in comparison with corresponding normal bone (n = 14), and furthermore of malignant (n = 13) and benign (n = 17) prostate tissue and corresponding plasma samples obtained from patients with (n = 15) and without (n = 13) diagnosed metastases and from men with benign prostate disease (n = 30). This was done using gas chromatography-mass spectrometry for sample characterization, and chemometric bioinformatics for data analysis. Results were verified in a separate test set including metastatic and normal bone tissue from patients with other cancers (n = 7). Significant differences were found between PCa bone metastases, bone metastases of other cancers, and normal bone. Furthermore, we identified metabolites in primary tumor tissue and in plasma which were significantly associated with metastatic disease. Among the metabolites in PCa bone metastases especially cholesterol was noted. In a test set the mean cholesterol level in PCa bone metastases was 127.30 mg/g as compared to 81.06 and 35.85 mg/g in bone metastases of different origin and normal bone, respectively (P = 0.0002 and 0.001). Immunohistochemical staining of PCa bone metastases showed intense staining of the low density lipoprotein receptor and variable levels of the scavenger receptor class B type 1 and 3-hydroxy-3-methylglutaryl-coenzyme reductase in tumor epithelial cells, indicating possibilities for influx and We have identified metabolites associated with PCa metastasis and specifically identified high levels of cholesterol in PCa bone metastases. Based on our findings and the previous literature, this makes cholesterol a possible therapeutic target for advanced PCa. Aggressive prostate cancer (PCa), eventually spreading to the bone, is a common and fatal disease requiring early diagnosis and effective treatment. Current diagnostic methods; measuring levels of prostate specific antigen (PSA) in blood samples and examining needle biopsies from the prostate under light microscopy, are however not particularly effective in separating cases of aggressive PCa from the even more prevalent and indolent forms of PCa that often can be left without treatment, or in separating cancer from other non-malignant prostate disorders N-methyl derivative of glycine, as a potentially important marker for PCa cell invasion, migration, and aggressiveness. The Sreekumar study together with other recent studies Much effort has been put into the recognition of genetic and proteomic profiles for PCa between the normal bone and bone metastasis samples, independent of treatment, determined by ANOVA of the cross-validated model were found for 58.5% (71 of 123) of the putative metabolites (P<0.001) between the PCa bone metastases and corresponding normal bone samples in the test set and the metabolites significantly separating those sample groups (Gas chromatography-time of flight mass spectrometry (GC/TOFMS) was used to characterize PCa bone metastases from 14 patients (7 hormone-naive PCa patients and 7 patients with CRPC) and adjacent normally appearing bone pieces that were available from 10 of the patients . In totaed model . Signifiabolites . Of the abolites . Predictabolites . In addie groups overlappe groups . Furthere groups .Among the detected metabolites in PCa bone metastases we foundP = 3.12E-5, P = 0.001, We specifically noted the high levels of cholesterol in PCa bone metastases as cholesterol showed the highest VIP value when differentiating PCa bone metastases from normal bone tissue as well de novo synthesis from acetyl-CoA where the reduction of 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) into mevalonate is considered to be the rate-limiting step de novo via HMG-CoA reductase, but also that other cell types in the bone metastases micro-environment express this enzyme possibly allowing them to provide cholesterol that could be taken up by tumor epithelial cells through the LDL and SRB-1 receptors , the scavenger receptor class B type 1 (SR-B1) or by eceptors . There weceptors , possibleceptors .Primary PCa tissue obtained from patients with high-risk tumors with or without diagnosed bone metastases were profiled in comparison with benign prostate samples n = 17, . This reInvestigation of the plasma metabolome from PCa patients with and without diagnosed bone metastases and men with benign disease was based on 179 resolved putative metabolites, and of those 50 could be assigned an identity . DespiteSarcosine levels were measured separately in the samples using AccQ•Tag derivatization followed by LC/MS analysis. The analysis showed an increase of sarcosine in PCa bone metastases compared to normal bone, while no difference could be observed compared to bone metastases from other cancers . In addide novo synthesis of cholesterol in tumor epithelial cells as well as influx of this metabolite from the surroundings via LDL-R and SR-B1.We here, for the first time, report a comprehensive analysis of metabolic patterns in PCa bone metastases in comparison to primary PCa, benign prostate tissue, and normal bone tissue. We have found metabolites which differentiate PCa bone metastases from normal bone samples and, furthermore, from bone metastases of different origin. We also found metabolites which, in contrast to PSA, showed altered plasma and primary tumor levels in individuals with metastatic PCa in comparison with patients with high-risk tumors but without detectable metastases. One of our most notable findings is high levels of cholesterol in the PCa bone metastases, which is probably reached by in vitroin vitro and in model experimental systems in vivoIncreased bioavailability of cholesterol in tumor cells may have high biological relevance for bone metastases growth, as cholesterol supplementation has been shown to increase PCa tumor cell proliferation, migration, and invasion We found high levels of many amino acids within the PCa bone metastases, and amino acid metabolism was the most altered functional pathway associated with PCa bone metastases according to Ingenuity pathway analysis. Our results thus support the metabolomic-based study by Sreekumar and co-workers Neither cholesterol nor sarcosine were, however, prognostic for bone metastases in plasma. Instead high levels of glutamatic acid, phenylalanine, and taurine were found in PCa bone metastasis tissue and in plasma from men with diagnosed PCa bone metastases. Glutamic acid was recently shown in the study by Sreekumar and collegues to be increased in PCa tissue 1H NMR studies have revealed evident changes in levels of citrate and choline between benign prostate and tumor tissue In conclusion, we have identified metabolites associated with prostate cancer metastasis and specifically noted high levels of cholesterol in PCa bone metastases. Based on our findings and the previous literature, this makes cholesterol a possible therapeutic target for advanced PCa. Although this is the largest metabolomic study of PCa bone metastases performed it certainly has its limitations. Previous Studies were approved by the local ethic review board of Umeå University and participants gave written or verbal consent.Bone metastases and adjacent normally appearing bone tissue pieces were obtained from a series of fresh-frozen biopsies collected from patients with cancer diagnosis or suspicion of cancer, operated for metastatic spinal cord compression or pathologic fractures . PatientBlood plasma was available from a series of men who underwent transrectal ultrasound–guided needle biopsies of the prostate, due to increased serum PSA levels, and primary PCa and benign prostate biopsies were assessable in some cases . The pat2O/methanol/chloroform (1∶3∶1) mixture containing 11 internal standards A Prior to GC/TOFMS analysis the low molecular weight metabolites in plasma samples were extracted and derivatized as previously described Data pre-treatment including baseline correction, chromatogram alignment, time-window setting, hierarchical multivariate curve resolution (H-MCR) P<0.05). ANOVA of the cross-validated models were used to determine the significance of the extracted metabolite patterns. Comparisons of categorical data were made using the chi-square test. For more details see supporting information ormation .P<0.05 in Mann-Whitney U-test, were included in pathway analysis according to Ingenuity Systems, Inc. Top altered canonical pathways and cellular and molecular functions in bone metastases were listed.Differentiating metabolites between PCa bone metastases and normal bone (VIP>0.9 in OPLS-DA and/or http://csbdb.mpimp-golm.mpg.de/csbdb/gmd/gmd.html) or the NIST98 mass spectra library. For a more detailed description, see supporting text for 1 h in 2100 Retriever . Primary antibody incubations and secondary systems were as follows; Anti-LDL receptor and Anti-SRB-1 were visualized using the iVIEW™ DAB detection kit while Anti-HMG-CoA reductase were incubated over night and further detected using the ABC Vectastain kit with DAB as chromogen. The staining intensity was scored as weak (+) or intense (++) and for SR-B1 also as negative (-) in a few cases. Positive controls for the immunostaining assays (liver and ovarian tissues) showed strong staining and control sections that were incubated without primary antibodies showed no staining.Text S1(0.04 MB DOC)Click here for additional data file.Table S1(0.20 MB DOC)Click here for additional data file.Table S2(0.09 MB DOC)Click here for additional data file.Table S3(0.04 MB DOC)Click here for additional data file.Table S4(0.03 MB DOC)Click here for additional data file.Table S5(0.07 MB DOC)Click here for additional data file.Table S6(0.07 MB DOC)Click here for additional data file.Table S7(0.07 MB DOC)Click here for additional data file.Table S8(0.06 MB DOC)Click here for additional data file.Table S9(0.07 MB DOC)Click here for additional data file.Table S10(0.10 MB DOC)Click here for additional data file.Figure S1Multivariate modelling in the search for a unique metabolite pattern in prostate cancer (PCa) bone metastases. OPLS-DA score vector t showing (2.24 MB TIF)Click here for additional data file.Figure S2Metabolomic differences between primary prostate cancer tissues from high-risk patients with (M1) and without (M0) established bone metastases. OPLS-DA score plot t revealin(2.40 MB TIF)Click here for additional data file.Figure S3Sarcosine levels in bone metastases. A. Box plot for sarcosine concentration showing significantly higher levels in prostate cancer (PCa) bone metastases compared to normal bone. B. Box plot for sarcosine in test set showing higher levels in PCa bone metastases compared to normal bone but no difference in levels in PCa bone metastases compared to bone metastases from other cancers; breast, kidney, and squamous cancer .(4.93 MB TIF)Click here for additional data file.Data S1(0.38 MB XLS)Click here for additional data file.

Many hypotheses attempting to explain the speed and sensitivity with which a T-cell discriminates the antigens it encounters include a notion of relative spatial and temporal control of particular biochemical steps involved in the process. An essential step in T-cell receptor (TCR) mediated signalling is the activation of the protein tyrosine kinase ZAP-70. ZAP-70 is recruited to the TCR upon receptor engagement and, once activated, is responsible for the phosphorylation of the protein adaptor, Linker for Activation of T-cells, or LAT. LAT phosphorylation results in the recruitment of a signalosome including PLCγ1, Grb2/SOS, GADS and SLP-76. In order to examine the real time spatial and temporal evolution of ZAP-70 activity following TCR engagement in the immune synapse, we have developed ROZA, a novel FRET-based biosensor whose function is dependent upon ZAP-70 activity. This new probe not only provides a measurement of the kinetics of ZAP-70 activity, but also reveals the subcellular localization of the activity as well. Unexpectedly, ZAP-70 dependent FRET was observed not only at the T-cell -APC interface, but also at the opposite pole of the cell or “antisynapse”. The question of how the signalling machinery downstream of the T-cell Receptor (TCR) rapidly integrates the binding information resulting from the encounter of a T-lymphocyte with an antigen presenting cell (APC) is central to our understanding of the adaptive immune response. Many hypotheses attempting to explain the speed and sensitivity with which a T-cell discriminates the antigens it encounters, include a notion of relative spatial and temporal control of particular biochemical steps involved in the process which is comprised of elements of mouse Grb2, mouse LAT and the CFP-YFP pair of fluorescent donor and acceptor. Here we report the use of ROZA expressing cells to directly visualize ZAP-70 dependent phosphorylation in T-cell lines and primary human lymphocytes with subcellular resolution during the formation of an immunological synapse. Furthermore, we observe that ZAP-70 dependent activity revealed by ROZA displays a bipolar distribution, appearing at times at the pole opposite that of the lymphocyte-APC contact. To our knowledge, ROZA is the first biosensor engineered for a TCR dependent tyrosine kinase activity and as such represents a key step forward towards bringing the wealth of biochemical information available about TCR mediated signal transduction into the realm of live cell microscopy.Numerous studies employing ZAP-70 GFP fusion proteins have demonstrated that ZAP-70 is rapidly recruited to the cell membrane upon TCR engagement N-terminal residues of mouse Lck. As shown in N-terminal 35 residues of LAT, encompassing the transmembrane domain and palmitoylation sites, however this anchor led to a largely vesicular probe expression (data not shown).As previously described Stimulation of ROZA-expressing Jurkat T-cells with pervanadate (PV), a phosphatase inhibitor that unveils constitutive tyrosine kinase activity, triggered a simultaneous increase of the 436→470 nm signal and a decrease of the 436→535 nm signal . The stiIn order to establish that the observed FRET changes were due to a ZAP-70-dependent phosphorylation of the probe, Jurkat T-cells transiently expressing ROZA were stimulated, lysed, and subsequently subjected to anti-phosphotyrosine immunoprecipitation and anti-GFP immunoblotting . The resYVNV tyrosine phosphorylation motif present in the probe cannot be phosphorylated by Src kinases in the absence of ZAP-70.Additional specificity tests were performed by imaging. As expected, the FRET changes triggered by anti-CD3 stimulation were strongly inhibited in cells pretreated with PP2 for 30 minutes before stimulation (data not shown). The strong fluorescence of piceatannol precluded its use in FRET experiments. Cells expressing the YF175 ROZA mutant also displayed no significant change in the FRET signal upon PV stimulation confirming that phosphorylation of the LAT sequence found within ROZA was necessary for the FRET ratio change. Finally, in ZAP-70-deficient Jurkat T-cells, P116, transfected with ROZA, no significant change in the FRET ratio was observed upon stimulation . This clIn order to validate the utility of ROZA for examining the evolution and subcellular distribution of ZAP-70 dependent phosphorylation during a cell-cell activation event, we followed the formation of conjugates between Jurkat clones stably expressing ROZA and Raji B cells loaded with superantigen under 40X magnification. Rapidly after conjugate formation, a synaptic clustering of the probe was observed. Such a recruitment could be due to the fact that the probe is anchored to the membrane through a palmitoylated and myristylated N-terminal sequence derived from the Src kinase Lck, that presumably targets ROZA into lipid rafts The appearance of a double signalosome could be considered as a simple case of biological pattern formation. In the theory of biological pattern formation initially proposed by Turing and later revisited by others, a pattern-forming reaction uses a combination of self-enhancing local activator and a long-range inhibitor triggered by the activator, and may create a dead zone for activator accumulation around the initial accumulation JTAG, J77 clone 20 and Raji B cells were kinds gifts of Georges Bismuth ; ZAP-70 deficient Jurkat T-cells P116 were a kind gift of Claire Hivroz . Human T lymphocytes (PBT) were isolated from blood donors by Ficoll density gradient centrifugation, followed by negative depletion on magnetic beads . Cells were cultivated in RPMI 1640 supplemented with 10% FCS. Superantigen was a mix of recombinant staphylococcal enterotoxin E, staphylococcal enterotoxin A, staphylococcal enterotoxin B, and staphylococcal enterotoxin C3 (Toxin Technology). Raji B cells were loaded for 30 min at 37°C in RPMI with superantigen at a final concentration of 200 ng/ml. All PCR amplifications were performed using Taq polymerase (Invitrogen). Sequencing was performed by MWG-Biotech AG . DNA modifying enzymes were obtained from Invitrogen. Synthetic nucleotides were obtained from Sigma-Genosys, Ltd. . Plasmids encoding mCFP and mYFP were kindly provided by R.Y Tsien . Kinase inhibitors PP2 and piceatannol were from Calbiochem. Mouse anti-human anti-CD3 (UCHT1) was from BD Pharmingen. HRP coupled goat anti-mouse antibody was from Immunotech SA (Marseille France). Anti-phospho-tyrosine antibody 4G10 ascites was a kind gift of Hai-Tao He, . Anti-GFP antibody was from Abgene (U.K.) Anti phospho-ZAP70 319 and anti-phospho LAT171 were from Cell Signalling (USA).HindIII site, a kozak sequence, and the 13 N-terminal residues of mouse Lck and a non-coding primer incorporating a SphI restriction site. Mouse Grb2 (residues 56-152) cDNA was amplified using a coding primer incorporating a SphI site and a non-coding primer which incorporated the linker sequence, mouse LAT residues 171-178 and a SacI site. The specific amino acids created were as shown in SacI site and a non-coding primer incorporating a stop codon and an EcoRI site. The three fragments were ligated simultaneously into the HindIII/EcoRI sites of pCDNA3.1. The Tyr to Phe mutation of the LAT tyrosine 175 present in central fragment of the ROZA sequence was created using nested amplifications of the Grb2-linker LAT sequence. The complete nucleotide sequence encoding this structure has been deposited in Genebank (accession number EU035753).The sequence encoding ROZA was constructed from three fragments. A CFP fragment was created by PCR amplification of mCFP residues 1-228 using a coding primer incorporating a 6 cells were transfected with 5 µgs plasmid DNA. Cells were used 24–48 hours after nucleofection. Stable clones of the Jurkat J77 cl20 expressing ROZA were established first sorting the YFP positive cells with a Becton Dickenson FACSAria cell sorter followed by cloning by limiting dilution in the presence of 1.5 mg/ml G418 (Invitrogen).Jurkat T-cells and PBT were transfected by Amaxa nucleofection with solution V/ Program G-10 or S-18 and human T solution / Program U-14, respectively. Typically 5×10Fluorescence acquisition was performed with a Nikon TE2000 equipped with cooled CCD camera . Three images were acquired every 10s: visible, excitation at 435 nm and emission successively at 530 nm (FRET) and 470 nm (CFP). The ratio R = FRET/CFP that gives an estimation of the inverse of ZAP-70 activity, was calculated with MetaFluor (Roper Scientific) after background subtraction. The following filters were used, all from Chroma , except when otherwise mentioned. For CFP excitation and emission: 436±5 nm→470±15 nm. For YFP: 500±10 nm→535±20 nm.6 cells per ml, recovered, rinsed once in serum-free medium and suspended at 5×106 cells per point in RPMI supplemented with 10 mM HEPES with or without kinase inhibitors. Cells were stimulated with the pervanadate or antibody for the indicated time, briefly spun, and resuspended in ice cold NP-40 lysis buffer as per manufacturers instructions) at 4°C for 20 minutes. In the indicated experiment, post nuclear supernatants were subjected to immunoprecipitation with an anti-GFP antibody to pull down the probe. Immunoprecipitates were subjected to SDS-PAGE transferred to PVDF membrane. Membranes were probed with indicated antibodies as per manufacturers recommandations for each specific antibody followed by HRP conjugated secondary antibody . Images were revealed using ECL plus (Amersham).ROZA expressing cells were cultured at densities less than 0.5×10

Toxoplasma gondii is a leading cause of congenital birth defects, as well as a cause for ocular and neurological diseases in humans. Its cytoskeleton is essential for parasite replication and invasion and contains many unique structures that are potential drug targets. Therefore, the biogenesis of the cytoskeletal structure of T. gondii is not only important for its pathogenesis, but also of interest to cell biology in general. Previously, we and others identified a new T. gondii cytoskeletal protein, TgMORN1, which is recruited to the basal complex at the very beginning of daughter formation. However, its function remained largely unknown. In this study, we generated a knock-out mutant of TgMORN1 (ΔTgMORN1) using a Cre-LoxP based approach. We found that the structure of the basal complex was grossly affected in ΔTgMORN1 parasites, which also displayed defects in cytokinesis. Moreover, ΔTgMORN1 parasites showed significant growth impairment in vitro, and this translated into greatly attenuated virulence in mice. Therefore, our results demonstrate that TgMORN1 is required for maintaining the structural integrity of the parasite posterior end, and provide direct evidence that cytoskeleton integrity is essential for parasite virulence and pathogenesis. Toxoplasma gondii, which is pathogenic for most warm-blooded animals. If growth of the parasite is blocked, then it does not cause disease, even though it may persist in the host as a chronic infection. Proper assembly of the cytoskeleton of T. gondii is known to be essential for its growth, and consequently required for virulence. In this study, we investigated the function of a novel cytoskeletal protein, TgMORN1, in T. gondii. TgMORN1 is a major component of the basal complex, a novel cytoskeletal assembly located at the posterior end of the parasite. We found that TgMORN1 is required for maintaining the structural integrity of the parasite posterior end and is important for ensuring successful separation of daughters at late stage of parasite replication. In addition, infection with parasites deficient in TgMORN1 not only failed to kill mice but also provided protective immunity against a lethal challenge infection, indicating the importance of TgMORN1 in T. gondii growth both in vitro and in vivo.The disease toxoplasmosis is the result of uncontrolled growth and proliferation of the intracellular parasite Toxoplasma gondii is one of the most successful human parasites, infecting ∼30% of the total world population. It is the most common cause of congenital neurological defects in humans, and an agent for devastating opportunistic infections in immunocompromised patients. T. gondii is also a member of the phylum Apicomplexa, which contains thousands of species of obligate intracellular parasites T. gondii, many of these parasites pose serious health threats to human beings. The damage caused by these parasites absolutely depends on their ability to replicate. For instance, T. gondii causes severe lytic cerebral and ocular lesions when the immune system fails to control its proliferation. Massive proliferation of Plasmodium parasites often results in hemolytic anemia, parasite-mediated destruction of red blood cell; and cerebral malaria, caused by parasite-engorged erythrocytes clogging blood vessels in the brain T. gondii cytoskeleton provides the framework for organellar partitioning, maintains cell shape and drives invasion, thus is essential for parasite survival and proliferation. Furthermore, it is rich in structural features that are unique to the parasites, thus highly attractive potential drug targets for designing parasite specific drugs.T. gondii is complicated but highly ordered. Each parasite contains one cytoskeletal apical complex (made of 3 ring structures and 14 filaments of a novel tubulin polymer), and 22 cortical microtubules The cytoskeleton of Membrane Occupation and Recognition Nexus 1), TgCentrin2, and TgDLC- a member of the dynein light chain family, to a novel cytoskeletal structure at the extreme basal end of the parasite Previously, we located a number of new cytoskeletal proteins, including TgMORN1 and discovered that the structure of the parasite posterior end was grossly altered upon the loss of TgMORN1. Interestingly, ΔTgMORN1 parasites displayed cytokinesis defects, apicoplast segregation defects and growth defects in vitro. In mice, these parasites not only were avirulent but also provided protective immunity against a lethal challenge infection.To address the role of the basal complex in E. coli, 6XHIS-mCherryFP-TgMORN1 was assembled into rings and fibers in the absence of other T. gondii proteins .The MORN-domain is a structural module conserved from bacteria to human. MORN-domain containing proteins have been found in large protein complexes and are thought to mediate protein-protein or protein-lipid interactions proteins , suggestproteins . 6XHIS-TTgMORN1 locus and the complete loss of TgMORN1 protein expression in the TgMORN1 knockout parasite (ΔTgMORN1) parasites failed (unpublished results). These failures were not due to low homologous recombination frequency, as a parasite line in which endogenous TgMORN1 gene was replaced by homologous recombination with “LoxP-TgMORN1-HXGPRT-LoxP” was obtained fairly easily in the same set of experiments (one out of nine clones screened was positive) , suggestTgMORN1) .ΔTgMORN1 parasites were highly irregular and heterogeneous and that the distribution of the width of IMC1 basal gap among these parasites was much more wide-spread than those of the parental strain (LoxP-TgMORN1-HXGPRT-LoxP) and the complement (ΔTgMORN1/eGFP-TgMORN1) . The morarasites . These dRN1 line . The arre normal .ΔTgMORN1 parasites, eGFP-TgCentrin2 basal complex localization was undetectable, although the localization of eGFP-TgCentrin2 to the apical complex, the centrioles and the peripheral annuli was not affected . We also did not observe qualitative differences among the trails deposited by the parental, ΔTgMORN1 and the complemented parasites in gliding motility assays (data not shown).To assess the defects in parasite invasion in arasites . P valueΔTgMORN1 parasites, we examined their intracellular growth , an apicoplast protein To examine if ΔTgMORN1 parasites, where ∼15% of vacuoles at 24–40 hours post-infection, contained “odd” number (≠ 2n and <16) of parasites, comparing with less than 0.4% for the parental strain and ΔTgMORN1/eGFP-TgMORN1 parasites at day 5 post-infection (pi), and died between day 7 and day 9 pi, as expected. In contrast, mice that were challenged with 103 or 104ΔTgMORN1 parasites showed no signs of disease and remained alive. Mice that received 2×104 or 105ΔTgMORN1 tachyzoites showed a slightly swollen abdomen as sole sign of disease and remained alive. EGFP-TgMORN1 complementation restored parasite virulence, as mice that were infected with complemented parasites followed the same pattern as mice that were infected with the parental strain . Compared to naïve mice, which died between day 7 and day 10 pi, mice that were pre-infected with ΔTgMORN1 parasites were protected from lethal challenge, where all mice immunized with 104ΔTgMORN1 parasites and 75% of mice immunized with 103ΔTgMORN1 parasites remained alive and healthy more than 60 days after the challenge , the percentage of the knockout parasite in the population will drop to less than ∼0.03% was added to the 3′ end of the first LoxP site in PTKO, and 3′ portion of MCS1 in PTKO was modified to (GGTACCCTCGAGGATATCTACGAATTC). To construct PTKO2_II, a 521bp DNA fragment . PTKO contains total two LoxP sites and two multiple cloning sites (MCS), with one MCS (MCS1) placed at the 5′ end of the first LoxP site and the second MCS (MCS2) placed at the 3′ end of the second LoxP site. In PTKO2_II, an additional MCS (MCS3) using primers HK223 and HK224 . The PCRTo construct pQE30-6xHIS-TgMORN1, TgMORN1/BglII-AflII from pmin-eGFP-TgMORN1 was ligated into pQE30-DIP13_AflII E. coli varied among cultures when grown in suspension and in a given experiment usually about 1 in 3 cultures expressed 6XHIS-mCherryFP-TgMORN1 well, forming rings and fibers in ∼100% of the bacteria. The expression of 6XHIS-mCherryFP-TgMORN1 in bacteria grown on LB agar plate was more consistent. Samples were processed as described in Frozen stocks of BL21(DE3)pLysS bacteria transformed with pQE30-6XHIS-mCherryFP-TgMORN1 were made from cultures of single colonies. The frozen stock were then streaked on LB agar plates containing 100µg/ml of ampicillin, 50µg/ml chloramphenicol and grown at 37°C for 24 hours, then at 4°C for ∼24–48 hours. Alternatively, liquid cultures were grown from frozen stocks at 37°C in 100 ml LB containing 100µg/ml of ampicillin, 50µg/ml chloramphenicol (LB-amp-cap) for ∼24 hours. For unknown reasons, 6XHIS-mCherryFP-TgMORN1 expression in T. gondii tachyzoites were used in all experiments, and the maintenance of parasites by continuous passage in human foreskin fibroblasts (HFFs) and parasite transfections were performed as previously described c.f.7 RHΔHXGPRT (RHΔHX) parasites ΔTgMORN1) parasites were first selected by immunofluorescence using a rat anti-TgMORN1 antibody and subsequently confirmed by genomic PCR and western blotting.33 µg LoxP-TgMORN1-HXGPRT-LoxP plasmid was linearized with ApaI c.f. and tranΔTgMORN1/eGFP-TgMORN1 parasites, 7×106ΔTgMORN1 parasites were transfected with 25µg pmin-eGFP-TgMORN1 plasmid T. gondii selectable marker. Therefore like ΔTgMORN1 parasites, ΔTgMORN1/eGFP-TgMORN1 parasites were also HXGPRT deficient.To generate 600 reached ∼0.6–0.8 before the addition of isopropyl β-D-1-thiogalactopyranoside (IPTG) to 1 mM. Cultures were then grown for additional 4 hours at 37°C. Cells were then pelleted at 6,000 rpm for 25 minutes, resuspended in 40 ml of cold lysis buffer containing 9.6g of cell lytic express , 1 µM TAME and 1 µM PMSF , and incubated at 4°C for ∼60 minutes. Cells were sonicated∼five times for 30 seconds each with 1 minute cooling between each cycle, then centrifuged at 15,000 rpm for 15 minutes at 4°C. 1.9 ml packed Talon resin equilibrated with lysis buffer was then added to the supernatant and gently mixed at 4°C for 1 hour. The resin was then washed with lysis buffer with 10mM imidazole 4 times and eluted with ∼1.5 ml 1XLDS sample buffer and reducing reagents buffer .Single BL21(DE3)pLysS bacterial colonies containing pQE30-6xHIS-TgMORN1 plasmid were grown overnight in LB-amp-cap at 37°C. Cultures were then diluted 1∶20 in 2 liter LB-amp-cap and grown till OD3 was then added to the solution to 10mM. The purified antibody was stored at 4°C.Eluted 6XHIS-TgMORN1 proteins (see above) were loaded on 4–12% Bis-Tris gel and gel slices containing 6XHIS-TgMORN1 were then used to inject rats for antibody production . The affinity purification of TgMORN1 antibody was carried out as described in 6 extracellular parasites were lysed by incubating in 1× SDS sample buffer sodium deodeoyl sulfate, 10% (v/v) glycerol and ∼0.5 mg of bromophenol blue) containing 50 mM DTT at 100°C for 10 minutes. Western blot was performed as described in For each sample, 5×10Intracellular parasites were fixed with 3.7% formaldehyde in 1×PBS for 15 minutes, permeabilized with 0.25 or 0.5% TX-100 in 1×PBS for 15 minutes, then blocked with 1 or 3% BSA in 1×PBS (blocking buffer) for 30 minutes at room temperature. The cells were then incubated in primary and subsequently secondary antibody solutions (diluted in blocking buffer) for 60 minutes each. Primary antibody dilutions were as follows: mouse anti-IMC1, 1∶1000 ; rabbit anti-ACP (Kind gifts from Dr. Manami Nishi at McGill University and Dr. Dhanasekaran Shanmugam at University of Pennsylvania) 1∶500 or 1∶10; affinity purified rat anti-TgMORN1, 1∶10. Secondary antibody dilutions were as follows: goat anti-mouse Alexa 488, 1∶2000; goat anti-mouse Alexa 568 , 1∶2000; goat-anti-rat Cy3 , 1∶500; goat-anti-rat Alexa 488 , 1∶2000; goat anti-mouse Cy3 , 1∶500; goat anti-rabbit Alexa488 , 1∶1000; goat anti-rabbit Cy3 , 1∶500; donkey anti-rabbit Alexa 488 , 1∶1000; donkey anti-mouse Alexa 594 , 1∶1000.3D image stacks were collected at room temperature at z-increments of 0.3 µm on an Applied Precision Delta Vision imaging station constructed on an Olympus IX-70 inverted microscope base. A 100× oil immersion lens (NA = 1.4) and immersion oil at refractive index 1.518 were used for all the imaging. Deconvolved images were computed using the point-spread functions and software supplied by the manufacturer. All fluorescent images were maximum intensity projections of deconvolved 3D stacks unless otherwise stated. The brightness and contrast of images used in the final figures were optimized for color prints.Measurement was performed on parasites in vacuoles containing one or two parasites. Specifically, parasites were labeled with IMC1 antibody as described above. 3-D stacks were acquired as described above, and images focused at the mid-section of the parasite were used for measuring the width of basal IMC1 gap in the parasites using Softworx .7 extracellular parental, ΔTgMORN1 or ΔTgMORN1/eGFP-TgMORN1 parasites were added to confluent HFF monolayers and incubated at 37°C for 1 hour. Cells were fixed in 3.1% formaldehyde and 0.06% glutaraldehyde (diluted in PBS) for 15 minutes at room temperature. Extracellular parasites were labeled with mouse anti-SAG1 antibody and visualized with goat anti-mouse Alexa 568 . Cells were then permeabilized with 0.25% TX-100 diluted in PBS for 15 minutes at room temperature and intracellular and extracellular parasites were labeled with mouse anti-SAG1 and visualized with goat anti-mouse Alexa 488 (1∶1000). All antibody incubations were performed for 30 minutes. The number of invaded (green only) parasites was calculated by subtracting the number of extracelluar parasites from the total number of parasites on the coverslip. Images were taken from 6 randomly chosen fields at 10× magnification and counting was performed using MetaMorph® software. Results were from three independent experiments. Motility assays were performed as previously described Invasion assays were performed as previously described ΔTgMORN1 or ΔTgMORN1/eGFP-TgMORN1 parasites were added to confluent HFF monolayers and grown for 12, 18, and 24 hours. Immunofluoresence assay with rat anti-TgDIP13 diluted 1∶400 , mouse anti-IMC1 diluted 1∶500, and DAPI diluted to 1µg/ml was performed as described above. To assess the effect of TgMORN1 deficiency on cytokinesis, the number of vacuoles containing at least one parasite displaying cytokinesis defects was counted for a total of 200 vacuoles per time point in each of 3 independent experiments. The counting was restricted to the vacuoles with fewer than 16 parasites, because in larger parasitophorous vacuoles ΔTgMORN1 parasites were too disorganized for assessing the level of cytokinesis defect accurately.Equal numbers of parental, Replication assays were performed as previously described ΔTgMORN1 and ΔTgMORN1/eGFP-TgMORN1 parasites were grown for 20–24 hours and immunofluoresence was performed using an anti-ACP antibody as described above. For parental and ΔTgMORN1/eGFP-TgMORN1 parasites, total 50 vacuoles were counted. For ΔTgMORN1 parasites, total 250 vacuoles were counted and vacuoles were scored as apicoplast positive , apicoplast negative (i.e. none of the parasites in the vacuole contains apicoplast) or mixed (i.e. vacuoles contains both apicoplast positive and negative parasites).To analyze apicoplast segregation, parental, ΔTgMORN1, and ΔTgMORN1/eGFP-TgMORN1 parasites were allowed to infect and grow in fully confluent HFF for 11 days. The cultures were then fixed and permeablized in cold methanol (−20°C) for 15 minutes and stained with Coomassie® Brilliant Blue G-250 dye at room temperature for 2–3 hours, then 4°C overnight before scanning.Equal numbers of parental, 3 or 104), ΔTgMORN1 or ΔTgMORN1/eGFP-TgMORN1 (103 or 104) tachyzoites (in 0.1 ml of PBS) were injected intraperitoneally (IP) into 6–8 week old CD1 outbred female mice . After 21 days, surviving mice “immunized” with 103 or 104ΔTgMORN1 parasites were challenged IP with 10,000 wild type RH tachyzoites.Freshly lysed out tachyzoites were filtered (3 µm), spun down and parasite pellet was resuspended in PBS. Parental ; T. gondii α1 –tubulin ; T. gondii dynein light chain .TgMORN1 (583.m05359); TgCentrin2 (50.m03356); TgIMC1 (44.m00004); Figure S1The arrangement of cortical microtubules in the parental and the TgMORN1 knock-out parasites. Surface optical sections of the parental and the TgMORN1 knock-out parasites expressing eGFP-TgTubA1, which indicate that the arrangement of cortical microtubules around the TgMORN1 knock-out parasite cortex appears to be normal. Arrows: cortical microtubules. Arrowheads: conoid.(0.13 MB TIF)Click here for additional data file.Table S1Sequences of the 521 bp DNA fragment and primers used for PCR amplification for constructing the plasmids listed in the left column. For primers, restriction sites are shown in lower case.(0.05 MB PDF)Click here for additional data file.

The Italian Protective Maternity Legislation allows a woman to apply for early maternity leave from work during pregnancy if she is affected by health problems (option A) or if her working conditions are incompatible with pregnancy (option B). A community based health education program, implemented between 1995 to 1998 in North Eastern Italy, provided counseling , and an information leaflet detailing the risks during pregnancy and the governmental benefits available to expectant mothers. This leaflet was distributed to women who were under occupational medical surveillance and to women attending any healthcare office and outpatient department and was also mailed to women working at home as shoemakers.The effectiveness of this intervention has been evaluated in this investigation using an evidence based approach.A quasi-experimental design was adopted, applying several outcome measurements before (1989 to 1994) and after (1999 to 2005) the intervention. The outcome (ratio B/A) is the number of women receiving approval for B to those receiving approval for A . A linear regression coefficient (for B/A against years) was obtained separately for time periods "before" (1989-94) and "after" (1999-2005) the intervention program. The two regression coefficients were compared using a t-test.The trend over-time for the ratio B/A was steady before the initial intervention then increased considerably in coincidence with the start of the education campaign. There was a significant difference between the two regression coefficients .From a bureaucratic perspective Option B is far more complicated than A. In fact it implies an active approach involving an arrangement between the claimant and the employer, who has to certify to the relevant Authority that the woman's working conditions are incompatible with pregnancy. The increasing number of women availing of option B, as recommended, therefore suggests the suitability of such educational campaign(s). In Italy, women have the right to paid leave from work for five months, two before and three after the delivery. By Italian law (151/2001), these five months can be extended to begin earlier in pregnancy (even immediately after pregnancy diagnosis) if the woman has recognized health problems or if her working conditions are incompatible with pregnancy. An employer must perform an assessment of the risks in the work environment for pregnant women. If the work environment is considered to be hazardous, the particular exposure in question should be reduced or work tasks changed. If neither is possible, women have a right to take an early leave from work during pregnancy. To obtain this benefit, women have to make an application to the Provincial Directorate for Work specifying whether there is:• risks during pregnancy due to personal medical conditions (Letter a), Art. 17, Law 151/2001);• a circumstance whereby the pregnant woman is employed to undertake activities forbidden under Article 7 of the same law, and it is impossible to change these duties (Letter b) and c), Art. 17, Law 151/2001).The forbidden activities are those involving exposure to:• chemicals: glues (in leather and shoe industry), paints, painting, glaze containing silica , metals , anesthetic gas , solvents ;• biological risk factors: contact with infectious material , contact with sick patients , contact with children ;• physical risk factors: lifting heavy objects, obligatory standing position for more than four hours per day, work on stairs, noise (textile industries), transport work, excessive fatigue or tension (daily or night shifts), exposure to ionizing radiations.Domestic work is ignored: housewives do not qualify for this sort of employment protection.Woman's Wellbeing" launched by the Veneto Region , a comprehensive health education campaign was implemented in the same Region from 1995 to 1998, consisting of:Using the opportunities offered by the project "• face-to-face counseling provided by a team of gynecologists, pediatricians, geneticists, psychologists and occupational physicians throughout the pregnancy - that included information on the adverse effects of environmental, occupational and behavioral exposures on the health of mother and fetus;• an information leaflet illustrating health risks for pregnancy (as above) and the benefits assured by law distributed to workers during medical surveillance at workplaces, and to persons attending any surgery and outpatient department of the Primary Care Trust (PCT) 13 of the Veneto Region;• another leaflet, informing on the health risks for pregnancy related to solvent containing products, was mailed to females working at home as shoemakers.The intervention was carried out in an area , where numerous females of childbearing age were exposed to organic solvents in nearly 700 shoe factories. Some data collected in those years evidenced in many cases a failure to comply with certain hygiene requirements , and that there was little or no recourse to benefits granted by law 151/2001, in particular there were no or few cases of abstention from work during pregnancy when the problem was the unhealthy workplace [In an earlier study, a before-and-after design was adopted to assess the intervention effectiveness . The aimWoman's Wellbeing", approved, funded and launched by the Veneto Region. Ethical approval was therefore not required.This study was carried out within the context of the project "A quasi-experimental design (time series design), which yields more sound information, was adopted by taking several outcome measurements before (baseline time trend) and after (second time trend) implementing the intervention program. To establish a trend, six measurements were performed before 1995 and six after 1998, as the heath education campaign was carried out during the time period 1995 to 1998.The outcome in this study was leave from work during pregnancy. Relevant information was collected from the DPL records, local office of Venice. These records had name, address, and the type of action: Letter a), Letter b) or Letter c). These data were stored in a database where they were broken down by action taken: Letters a), b) or c), calendar year, and location of residence. The folder for year 2002 was not available, thus the observation time was extended until 2005. Letters b) and c) were pooled into a group named "B", with this quantity divided by group "A" (Letter a), and the B/A ratio plotted against calendar years. Using STATA 10, a median-band plot was obtained where the cross medians were graphed as a line plot. Furthermore, a linear regression coefficient (for B/A against years) was obtained separately for the period "before" (1989-94) and "after" (1999-2005).1989-94 and b1999-2005) were compared using a method previously described [0: b1989-94 = b1999-2005. A significant t value indicates that b1989-94 is different from b1999-2005.The two regression coefficients for the period "before" (1989-94), and 0.0426x - 84.89 for the period "after" (1999-2005).For B/A against years, the linear regression equation was 0.0081x - 16.087 , Art. 17, Law 151/2001). Women were normally opting for Letter a). This option is rather simple in nature, while the second option (Letters b) or c)) involves much more paperwork. In fact opting for "Letters b) or c)" involves more complex arrangements between the claimant and the employer, who has to certify to the relevant Authority that the woman's working conditions are incompatible with pregnancy. It is also necessary for women to provide more information and documents to enable the DPL to conclude that the claimant fulfils the conditions required by law. In the present study while option A saw some increase in use over the time period, there was a greater increase with option B. The increasing number of women availing of Letter b) of Art. 17, as recommended during the educational campaign, suggests the suitability of such educational intervention.The Protective Maternity Legislation (PML) in Italy can be considered valuable , as it oIt is possible to strengthen the before-and- after design further by combining two approaches: taking more measurements and adding a non-randomized control group . This muThe lack of a control group prevents us being in a position to attribute the findings of the present study to the health awareness campaign alone.Another limitation is that only regularly employed women generally benefit from PML. Despite a lack of relevant data, it could be presumed that there are inequalities among eligible workers: women with less qualified jobs and those employed in the private sector were less likely to benefit from these protective measures . FurtherThe authors declare that they have no competing interests.Woman's Wellbeing".Not required. This study is an assessment of efficacy of a health education program approved and funded by the Veneto Region, called "GM and RA conceived the idea and developed the paper, LC contributing to the drafting of the paper and the statistical analysis, JHL and EF contributing to the drafting of the paper, OA and AB collected the data and contributed to the literature search. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2458/10/694/prepub

Patients suffering from sepsis are currently classified on a clinical basis ; however, this clinical classification may not accurately reflect the overall immune status of an individual patient. Our objective was to describe a cohort of patients with sepsis in terms of their measured immune status.Fifty-two patients with sepsis (n = 13), severe sepsis (n = 21), or septic shock (n = 18) were studied. The immune status was determined by measuring the CD4+ lymphocyte adenosine triphosphate (ATP) content after mitogen stimulation in whole blood.P = 0.44). Furthermore, survivors of sepsis had a significantly higher CD4+ lymphocyte ATP content at the time of ICU admission than did nonsurvivors of sepsis .The measured CD4+ lymphocyte ATP content at the time of ICU admission did not differ among the various groups defined by the sepsis classification system (sepsis = 454 ± 79 ng/ml; severe sepsis = 359 ± 54 ng/ml; septic shock = 371 ± 53 ng/ml; The sepsis classification system that is currently used is not representative of the individual immune status as determined by measuring the CD4+ lymphocyte ATP content. Moreover, a lower CD4+ ATP content at the time of ICU admission is associated with a worse clinical outcome in those suffering from sepsis. Sepsis, the systemic inflammatory response syndrome that results from infection, is associated with considerable mortality. Besides controlling the inciting infectious insult and providing good supportive care, few therapies are available to treat this syndrome. Although it seems conceptually appealing that suppressing the generalized inflammatory response in sepsis would improve outcomes, the evaluation of numerous adjuvant therapies has led to conflicting, yet disappointing results -3.Currently, patients suffering from sepsis are classified based on the presence of organ dysfunction and/or shock . Although this classification system is widely used, it may not accurately reflect the overall immune status of an individual patient . This isWe hypothesized that the evaluation of a biomarker used to determine the cell-mediated immune status would be informative in a cohort of patients with sepsis. Furthermore, we hypothesized that their measured immune status might not be reflective of their sepsis classification. Finally, we hypothesized that their immune status might be associated with mortality.This study was approved by the Institutional Review Board at Washington University School of Medicine Human Studies Committee. Patients were enrolled in the study within 24 hours of admission to the medical ICUs at Barnes-Jewish Hospital in St. Louis, Missouri. In addition, patients met the criteria for sepsis (n = 13), severe sepsis (n = 21), or septic shock (n = 18) as defined according to the American College of Chest Physicians/Society of Critical Care Medicine Consensus Conference . All patPatients deemed likely to have a poor outcome, for a reason known at admission other than sepsis, severe sepsis, or septic shock were not enrolled in the study. Patients were followed until hospital discharge, and their routine clinical and laboratory data were recorded. All patients received early goal-directed therapy according to a standard protocol emphasizing adequate volume administration, appropriate antibiotic administration, and optimal oxygen delivery.1 = ICU day 1 (admission), T2 = ICU day 2 to 5, and T3 = ICU day 8 through existing venous catheters in all patients. This collection was performed at serial time points during the course of each patient's ICU stay. Specifically, blood was collected at T® assay was used to determine the ATP content of CD4+ lymphocytes and was performed according to the manufacturer's instructions and previous descriptions [The Immuknowriptions ,12. BrieP-value of less than 0.05 was considered significant.All data are presented as the mean ± the standard error of the mean unless otherwise indicated. All comparisons were unpaired and all tests of significance were two-tailed. SPSS version 11.0 for Windows was used for statistical analysis. Continuous variables were compared using the Mann-Whitney U test or the Kruskal-Wallis test, where appropriate, for non-normally distributed variables. The Pearson chi-squared was used to compare categorical variables. A The study sponsor, Cylex, Inc., had no role in the design of the study. They also had no role in the collection or interpretation of data, and they had no role in the preparation of the manuscript or the decision to submit it for publication.We evaluated 52 patients in our investigation. Overall, these patients appear representative of typical patients with sepsis encountered in an ICU setting. Table P = 0.44). In addition, there was no significant difference in the total white blood cell count among the different groups , and the absolute lymphocyte count was also not significantly different among the groups . Not surprisingly, the Acute Physiology and Chronic Health Evaluation (APACHE) II score did differ among the groups ; however, the mortality difference among the groups did not reach statistical significance .Figure P = 0.01). However, the total white blood cell count was not significantly different between these groups, and the absolute lymphocyte count was also not significantly different . Furthermore, the APACHE II score did not differ between the groups , and the mortality also did not differ significantly .The mean CD4+ lymphocyte ATP content differed significantly between the immunocompetent group of patients and the immunocompromised group of patients . The total white blood cell count was also not significantly different between survivors and nonsurvivors . In addition, the absolute lymphocyte count was not significantly different between the survivors and nonsurvivors . Not surprisingly, the APACHE II score did differ between survivors and nonsurvivors .Table 1, between survivors and nonsurvivors . Although differences were noted in CD4+ lymphocyte ATP content at other time points, statistical significance was not demonstrated other than at admission (T1); however, fewer patients were evaluated at subsequent time points.Figure We have demonstrated that there is a wide range of CD4+ lymphocyte ATP content in a typical ICU population suffering from sepsis. Furthermore, we have demonstrated that the current sepsis classification does not accurately reflect the CD4+ lymphocyte ATP content, and arguably, the immune status of an individual patient. We have also demonstrated that a lower CD4+ lymphocyte ATP content is associated with a higher mortality, and most surprisingly, this finding is present at the time of ICU admission.Measuring CD4+ lymphocyte ATP content after exposure to a stimulus is one method of determining the global cell-mediated immune response, and this approach has primarily been used as an aid to guide immunosuppressive therapy in transplant recipients ,13. In tOur data are consistent with previously published results suggesting that decreased cell-mediated immune function is associated with a worse prognosis in the setting of sepsis. For example, Heidecke and colleagues demonstrated that decreased T cell proliferation correlated with mortality in patients with post-operative sepsis due to intraabdominal infections . FurtherInterestingly, data are beginning to accumulate supporting the notion that viruses may reactivate in immunocompetent patients during times of critical illness, and this reactivation seems to be associated with worse clinical outcomes, including mortality ,7. In faThe reason for why lower CD4+ lymphocyte ATP content is associated with a worse prognosis is strictly speculation, yet interesting. First, this decrease may be due to mitochondrial dysfunction -19. SecoOur study has several limitations that should be mentioned. First, the CD4+ lymphocyte counts were not determined, so the measured CD4+ lymphocyte ATP content could be an indirect measure of cell number. However, previous experience using this assay in solid-organ transplant recipients indicates that this is unlikely to be the case, and we have reported the total lymphocyte counts, which also support this notion. Also, our small sample size limits our ability to draw definitive conclusions regarding the use of this assay in staging the host response to sepsis.On the other hand, our study also has several strengths. To our knowledge, this is the first investigation to use this method in an attempt to stage the host immune response in sepsis; therefore, our findings are important when viewed as thought provoking and hypothesis generating. Furthermore, patients in our study classified as immunocompromised based on clinical criteria had significantly different assay results than those who were immunocompetent, which is similar to prior published data . This obIn summary, we have demonstrated that the sepsis classification system that is currently used does not accurately reflect the immune status of an individual when measured by determining the CD4+ lymphocyte ATP content. This finding raises the question, 'Is the current sepsis classification system reliable at determining the immune status, specifically cell-mediated immune status, and should this classification system be used to direct adjuvant immunomodulatory therapy in the setting of sepsis?'. Furthermore, we have demonstrated that a lower CD4+ ATP content is associated with a worse clinical outcome in those suffering from sepsis, and importantly, this finding is present at the time of ICU admission.The sepsis classification system that is currently used is not representative of the individual immune status as determined by measuring the CD4+ lymphocyte ATP content. Moreover, a lower CD4+ ATP content at the time of ICU admission is associated with a worse clinical outcome in those suffering from sepsis.• Sepsis is the systemic inflammatory response that results from an infectious insult.• Patients with sepsis are currently classified based on the presence of organ dysfunction and/or shock .• The immune status of an individual patient may not correlate with the current classification system that is used to categorize these patients.• Our data shows no significant difference in the measured immune status of patients based on the current classification system.• Patients with sepsis who have lower measures of immune function at the time of ICU admission appear to have an increased mortality.APACHE II: acute physiology and chronic health II.This study was supported in part by Cylex Inc. through donations of laboratory equipment and supplies. The study sponsor, Cylex, Inc., had no role in the design of the study. They also had no role in the collection or interpretation of data, and they had no role in the preparation of the manuscript or the decision to submit it for publication.KLL, PHW, GPM, JJ, DLP, RSH, and MHK all contributed to the conception and design of the study or the acquisition of data or analysis and interpretation of the data. All were involved in drafting the manuscript or revising it for intellectual content. All gave final approval to the version of the manuscript to be published.

At the NPC, the FG motifs of nucleoporins may exert this cohesive effect intermolecularly as well as intramolecularly to form a malleable yet cohesive quaternary structure composed of highly flexible polypeptide chains. Dynamic shifts in the equilibrium or competition between intra- and intermolecular FG motif interactions could facilitate the rapid and reversible structural transitions at the NPC conduit needed to accommodate passing karyopherin–cargo complexes of various shapes and sizes while simultaneously maintaining a size-selective gate against protein diffusion.The nuclear pore complex (NPC) provides the sole aqueous conduit for macromolecular exchange between the nucleus and the cytoplasm of cells. Its diffusion conduit contains a size-selective gate formed by a family of NPC proteins that feature large, natively unfolded domains with phenylalanine–glycine repeats (FG domains). These domains of nucleoporins play key roles in establishing the NPC permeability barrier, but little is known about their dynamic structure. Here we used molecular modeling and biophysical techniques to characterize the dynamic ensemble of structures of a representative FG domain from the yeast nucleoporin Nup116. The results showed that its FG motifs function as The nuclear pore complex is a molecular filter that gates macromolecular exchange between the cytoplasm and the nucleoplasm of cells. It contains a size-selective diffusion barrier at its center composed of proteins named FG nucleoporins. These nucleoporins feature large, structurally disordered domains that are highly decorated with phenylalanine–glycine (FG) sequence motifs. The dynamic structure of these disordered FG domains excludes them from classical structural biology analyses such as X-ray crystallography; thus, new approaches are needed to characterize their shape. Here computational and biophysical approaches were used to elucidate the ensemble of structures adopted by the FG domain of a nucleoporin. The analyses showed that the FG motifs function as intramolecular cohesion elements that compact the shape of the FG domain, forcing it to adopt loosely knit globular configurations that are constantly reconfiguring. Within the nuclear pore complex, dozens of these nucleoporin FG domains may stack as loosely knit globules forming a porous sieve that gates molecular diffusion by size exclusion. The nuclear pore complex is a supramolecular protein structure in the nuclear envelope that controls nucleo-cytoplasmic traffic and communication [1]. A kS. cerevisiae FG nups is unusual because their 150–700 amino acid (AA) FG domains are natively unfolded S. cerevisiae indicated that some FG domains (the GLFG-rich domains) bind to each other weakly via hydrophobic attractions between their FG motifs, whereas other FG domains (the FxFG-rich domains) do not form such cohesions The three dimensional structure of It is generally assumed that natively unfolded proteins have some preferred 3-D structures dictated by intra-molecular cohesion Since traditional experimental methods for elucidating protein structure cannot be used with natively-unfolded proteins, new approaches are needed to study and describe their dynamic ensemble of structures. In this emerging area of research, Jha et al intramolecular cohesion elements that impart structure. Apart from its cell biological significance, we chose this protein as a model system to investigate how a combination of molecular dynamics simulations and biophysical measurements can be used to characterize the ensemble of structures adopted by a natively unfolded protein, such as the FG domain of a nucleoporin.Here we conducted molecular dynamics simulations and biophysical measurements on a small FG domain from the yeast nucleoporin Nup116 (Q02630) to test the hypothesis that phenylalanines in its FG motifs function as intramolecular cohesion of coils in the dynamic ensemble of nup structures. The simulated FG domains were then expressed in bacteria, purified to homogeneity, and analyzed by NMR spectroscopy and sizing columns to quantify their average shape through measurements of diffusion coefficient and Stokes radii. Finally, mathematical and biophysical analyses were combined to estimate the tertiary structure that best describes the natively unfolded domain of the representative FG nucleoporin.In the analysis that follows we first used MD simulations to generate a statistical ensemble of coil conformations for a 111 AA region of the Nup116 FG domain containing ten FG motifs (wild-type), and of a mutant version thereof lacking the phenylalanines in the ten FG motifs (F>A mutant) . The MD Rg values during the last 3 ns (data not shown).Twenty independent MD simulations were performed at 300 K (25°C) on the wild-type (6 ns) and F>A mutant (5 ns) versions of a Nup116 FG domain (AA 348–458) starting from a fully-extended conformation. The goal of these simulations was to sample the conformational distribution of the proteins as close as possible to their native distribution in solution. As soon as the simulations started, within the first 100 ps, the extended FG domains collapsed into a more cohesive or compact ensemble of structures with small patches of unstable (see below) secondary structure. Since the wild-type and mutant FG domains are highly flexible and disordered, the resulting end-structures from each of the twenty simulations did not resemble one another as expected for natively unfolded proteins see and by sTo describe quantitatively the structural dynamics of the FG domains, we calculated the auto-correlation function of a vector of the 118 Φ and 118 Ψ angles along the peptide backbone of FG domain structures sampled every 1 ps from the MD trajectory. 10-helix). In general, no significant difference in overall helical content between wild-type and mutant FG domains was observed. The alpha- and 310- helical structures that did form ranged in size from 2–6 AA residues and did not persist for more than 35 ps on average (data not shown). The maximum duration of an α-helix and a 310-helix was 97 and 699 ps, respectively (data not shown).The ensemble of structures for each of the twenty MD trajectories generated for the wild-type and mutant FG domains were sampled at 1 ps intervals during the final 3 ns of the simulations, yielding a total of 60,000 structures for each protein. The secondary structure content was then analyzed in detail to determine the fraction of time during the simulations that each AA residue spent as part of a “helical” structure (either an α-helix or a 3Rg) and the end-to-end distance between terminal residues. The average (±1 standard deviation) end-to-end distance for the wild-type FG domain simulated at 300 K was 20.42 Å (±9.51), and for the mutant was 20.69 Å (±7.78) (data not shown). The predicted radius of gyration was 14.52 Å (±1.18) for the wild-type and 14.41 Å (±1.24) for the mutant FG domain .Using the same set of 60,000 structures, two measures of protein compactness were calculated: the radius of gyration . The average Rg was 17.40 Å (±3.11) for the wild-type FG domain and 23.68 Å (±6.05) for the mutant domain . Consistently, the average end-to-end distance for the wild-type FG domain was 29.95 Å (±16.04) compared to 52.56 Å (±25.31) for the mutant for the ten sites that correspond to the phenylalanine or to the substitute alanine residues in the various FG motifs. The distances used were from the MD simulations at 350 K, which yielded structures that betTo permit comparisons of the average inter-residue distances, the probability distributions obtained for the Cβ-to-Cβ distances were fit to a single Gaussian distribution even though in some cases there were multiple distinct peaks . This waProbability distributions of all inter-residue distances obtained from the MD simulations were subjected to clustering using the Pearson squared correlation. This was done to determine how any two of the distributions sampled in regular intervals of the MD simulations are correlated with each other. The correlation coefficient does not depend on the specific measurement units used because other correlation coefficients, such as Euclidian distance metric, yielded similar clustering effects (data not shown). To obtain a broader view of the dynamical correlation between inter-residue distances in the FG domains, the Pearson correlation coefficient between all 990 distinct interresidue distances in all 20 simulation replicates of each FG domain were calculated, yielding 19,800 correlation coefficients. In this case, a value of 1.0 would indicate a perfect linear correlation between two inter-residue distances ; a value of 0.0 would indicate no correlation between a distance pair; and a value of −1.0 would indicate perfect anticorrelation. intramolecular distances between FG motifs in the wild-type and mutant FG domains are quantifiably different from each other. There was a tendency for FG motifs in the wild-type FG domain to be proximal to each other , which was absent in the mutant. This conclusion is consistent with the hypothesis that the FG motifs in the wild-type Nup116 FG domain interact intra-molecularly in a manner similar to what has been observed for intermolecular interactions between this Nup116 FG domain and other FG domains of nups To better describe the relationship between FG motifs in the FG domain, the distances between F–F pairs (or substitute A–A pairs) were also categorized into groups representing distances of 10–15, 15–20, or >20 Å. These are shown in intra-molecular interactions within the Nup116 FG domain. In principle, a change in the dynamic ensemble of FG domain structures resulting from the substitution of all Phe's to Ala's could be detected by NMR. A less-ordered mutant FG domain would exhibit a slower diffusion coefficient. The wild-type and F>A mutant versions of the Nup116 FG domain were purified to `homogeneity and subjected to NMR analysis. Plots of the one-dimensional 1H NMR spectra are shown in The structural predictions made by the in silico modeling prompted us to seek physical evidence that the phenylalanine residues in FG motifs function as structural cohesion elements that form putative Dsexpt) values of 13.17 (±0.26) and 12.18 (±0.12)×10−11 m2 s−1 for the wild-type and mutant FG domains, respectively. This indicated slower diffusion for the less-ordered mutant FG domain. Despite the mass of the F>A mutant domain being smaller (11.9 kDa) than wild-type (12.6 kDa) (due to the replacement of 10 Phe for Ala) the diffusion constant of the mutant was smaller on average, suggesting that its effective hydrodynamic volume is larger. As expected for unfolded proteins Experimental self-diffusion measurements (intensity vs. product of the area of gradient pulse strength and the diffusion length) of the FG domains and the corresponding exponential fits are also shown in Rs = 23.5Å), ovalbumin , and BSA . The Stokes radius for the wild-type FG domain was measured at 25.2 (±0.6) Å Å , which i(±0.6) Å . This ap(±0.6) Å and with(±0.6) Å . The obsThe hydrodynamic volume or Stokes radius of a protein in different structural configurations can be estimated from its mass using mathematical equations S. cerevisiae nucleoporin Nup116 (AA 348–458) and of a mutant version thereof (F>A) lacking the phenylalanines in its predominantly GLFG motifs , together with the scaling relations developed by Uversky's group across the NPC transport conduit from their tether sites within the NPC scaffold to native pre-molten globular configurations .Our finding that the FG motifs can function as c states . Alternac states . Accordiintramolecular or intermolecular, is indeed an important question whose answer may rely largely on four parameters: the distance between FG domain anchor sites at the NPC, the volume of space occupied by each FG domain, the space available at the NPC for each FG domain, and the steric hindrance effect between neighboring FG domains z-axis; see inter-molecular FG motif interactions. This structural assembly could take the form of a meshwork of intertwined polypeptide chains intra- and intermolecular FG motif interactions could facilitate the fast structural changes in the NPC permeability barrier, which are presumably coupled to the passage of karyopherin-cargo complexes of different shapes and sizes during transit across the NPC intramolecular interactions. This could cause the FG domains to fold back on themselves , effectively opening the permeability barrier by suddenly occupying less space.What type of FG motif interaction dominates at the NPC, either the NPC . As karyintermolecular cohesions with each other via FG motifs intramolecular cohesions of their own FG motifs to adopt compact configurations. According to the “virtual gate” Xenopus Nup153 FG domain It remains to be determined whether other types of nup FG domains, which do not display Secondary structure analysis: For the final 3 ns of each simulation, the structure was analyzed every 1 ps using a standard program for identifying secondary structure from atomic coordinates Radius of gyration and end-to-end distance analyses: For the final 3 ns of each simulation, radii of gyration and the end-to-end distances between terminal residues were calculated using the program CARNAL and ptraj, distributed with AMBER 7 High temperature molecular dynamics simulations: Molecular dynamics were performed at elevated temperatures for each of the 20 wild-type and mutant FG domain simulations. The GB/SA simulations were all restarted after 5 ns coupled to a heat bath at 325 or 350 K with all other parameters of the simulation kept the same. The simulations were run for 1 ns, and the final 500 ps were used for analysis.MD simulations of individual FG domains were started from a fully extended backbone structure . A different random number seed was chosen for each of the different simulations to randomize the initial atom velocities. Twenty separate simulations were run for either 6 ns (wild-type) or 5 ns (mutant) each using different initial atomic velocities and analyzed at 1 ps intervals. The wild-type fragment required an additional nanosecond of dynamics to have its radius of gyration converge. All MD simulations were performed with AMBER To determine the degree of dynamical change in the ensemble of FG domain structures, the autocorrelation function was derived for a vector composed of the 118 Φ and 118 Ψ angles to form a histogram of distance distributions. Probability distributions were calculated for each of the twenty simulations independently, and the values obtained were averaged at the end. A similar procedure was adopted for the mutant FG domain where the distance between the Cβ atoms of the Ala residue was used. Final probability distributions were used without any normalization.Clustering analysis: The correlation between different F–F probability distribution reflects the degree to which these variables (F–F distances) are related. The most common measure of correlation is the Pearson Product Moment Correlation (http://www.r-project.org/) and reflects the degree of linear relationship between the two variables. In order to determine whether probability profiles of the F–F interaction correlate, a similarity matrix with a Pearson square metric was calculated. The correlation was used to indicate the presence (or absence) of relationship between various F–F interactions.As a first approximation, the probability distributions were fit to a Gaussian distribution (probability versus distance). This is a conservative approach and is expected to be valid considering the number of structures generated during the molecular dynamics simulations and in the absence of any constraints. The center of the Gaussian is considered as the mean distance between the F–F (or A–A), while the width at half-maximum is used as the allowed variation in the constraint. S. cerevisiae DNA using PCR and was cloned into the vector pGEX-2TK in frame with the coding sequence for glutathione S-transferase (GST) at the 5′ end, and in frame with the coding sequence for six contiguous histidines at the 3′ end. Site directed mutagenesis was then used to alter the coding sequence for the mutant F>A FG domain. The correct coding sequences were confirmed by DNA sequence analysis. The FG domains were expressed in a E. coli BL21+ strain as fusion proteins with GST (glutathione S transferase) at the N-terminus and a HIS tag (six contiguous histidine residues) at the C-terminus. Glutathione coated Sepharose beads were then used to isolate each GST-FG domain fusion from crude bacterial cell extracts. The isolated FG domains were eluted from the beads by specific thrombin proteolysis of the GST tag. Nickel-coated beads were then used to capture and isolate the FG domain through its C-terminal His-tag, and the captured proteins were eluted from the beads using imidazole. Finally, the eluates were concentrated in a Centricon 3 unit and were size fractionated in an FPLC Superdex 200 sizing column that was equilibrated in 50 mM NaH2PO4, pH of 6.5 for the NMR analysis, or in an FPLC Superdex 75 column equilibrated in 20 mM Hepes, pH 6.8, 150 mM KOAc, 2 mM Mg(OA)2 for determination of Stokes radii.The coding sequence for the representative 111 AA Nup116 FG domain was amplified from genomic 2, and 0.5 ml fractions were collected. The FG domain elution profiles were monitored by UV absorbance at 280 nm and by SDS-PAGE analysis of the eluates. The nup elution profiles were compared to those of carbonic anhydrase , ovalbumin , and BSA , which served as molecular size standards. The elution volume of the standards was plotted in relation to their Stokes radii, allowing for estimation of the FG domain Stokes radii from the resulting linear regression formula.Tandem-affinity purified wild-type and F>A mutant Nup116 FG domains were subjected to size-fractionation through an analytical-scale FPLC Superdex 75 column. FG domains (100 µl of 7.5 mg/ml) were injected at a flow rate of 0.5 ml/min at 4°C into a column that was preequilibrated in 20 mM Hepes pH 6.8, 150 mM KOAc, 2 mM Mg(OAc)2PO4, pH 6.5. Final protein concentrations were ∼0.5 mM for both wild-type and mutant FG domains. NMR experiments were performed in a Varian INOVA 600 MHz spectrometer equipped with a 5 mm probe with a single-axis shielded magnetic field gradients. One dimensional 1H NMR experiments were obtained using the water suppression scheme 1-3-3-1 Water-gate dephasing) sequence NMR experiments were performed on tandem-affinity purified FG domains dissolved in 50 mM NaHTranslational diffusion tensor values were calculated based on the beads-model approximation of García de la Torre and Bloomfield Rh) for the wild-type and mutant Nup116 FG domains was calculated from the radius of gyration (Rg) values obtained from the simulations using the scaling relationship given in Rh = Rg/0.77, and for proteins in strong denaturing conditions, the scaling relationship is Rh = Rg/1.06. For the wild-type and mutant Nup116 FG domains simulated at 300 and 325 K, the hydrodynamics radius was obtained by Rh = Rg/0.77. In the 350 K simulations, some of the protein conformations were highly extended (as in denaturing conditions) and a single scaling value was not appropriate. In this case, if the Rg for a structure was less than 30.7 Å for wild-type and 29.6 Å for the mutant, it was scaled by 1/0.77; if the Rg was greater, the value was scaled by 1/1.06. The Rg cutoff values of 30.7 Å (wild-type) and 29.6 Å (mutant) were obtained by using Uversky's relationship: Rh (8 M urea) = (0.22)*M0.52, where M is the molecular mass Rh values were 22.5±4.0 for the wild-type FG domain and 28.6±5.2 for the mutant. To compare these Rh values to the Stokes radii values for the purified FG domains in sieving columns, the contribution of a C-terminal His-tag (6 histidine residues/841 Da), which was added (post simulations) to the FG domains to aid in the purification of only full-length FG domains, had to be factored in. This was done using Uversky's scaling relationship by calculating Rs for the FG domains with the additional tag assuming a native pre-molten globular configuration for the wild-type and a native coil configuration for the mutant (see Rs estimated from the molecular dynamics simulations for the wild-type and mutant FG domains were multiplied by the ratio (Rs (His-tag)/ Rs (no-tag)) to yield the final values of 23.1 (±4.1) Å for the wild-type FG domain and 29.6 (±5.4) Å for the mutant FG domain reported in The hydrodynamic radius Click here for additional data file.Table S2List of distance constraints obtained from the Gaussian fit to interresidue distance distribution.(0.11 MB DOC)Click here for additional data file.Table S3The dimensions and locations of GLFG-rich domains of nups at the NPC.(0.07 MB DOC)Click here for additional data file.Figure S1Rg) in units of Angstroms (Å) over the last 3 ns of the MD simulations for twenty replicate simulations at 300 K for the wild-type and F>A mutant FG domains. The plots show no systematic increase or decrease in the Rg values during this time window.Plots of radii of gyration versus time of the simulated Nup116 FG domains. Radii of gyration ((6.97 MB TIF)Click here for additional data file.Figure S2Structural dynamics of the simulated FG domains. Autocorrelation vector of all phi and psi angles calculated with a 1 ps time step averaging over all 2800 autocorrelation windows in the last 3 ns simulations time. A separate line is plotted for each of the twenty wild-type replicates (blue lines), F>A mutant replicates (red lines), and the fibroblast growth factor 1, as reference (green line).(2.24 MB TIF)Click here for additional data file.Figure S3Comparison of internal structural correlation between the simulated FG domains. Back-to-back histograms of the Pearson correlation coefficients calculated between all F–F (or A–A) distance pairs measured every 1 ps during the last 3 ns of simulation time at 300 K in all 20 replicates. Note that the wild-type FG domain shows a systematic bias towards higher correlation coefficients, indicating more internal structural correlation in comparison to the F>A mutant.(0.74 MB TIF)Click here for additional data file.Figure S4http://bioserv.impmc.jussieu.fr/hca-file.html. The AA sequences used are listed in A hydrophobic cluster analysis (HCA) of the Nup116 FG domain. (A) HCA analysis of the wild-type and F>A mutant FG domains (AA 348–458) was performed using the web server (3.51 MB TIF)Click here for additional data file.Figure S5intra- and intermolecular interactions. (B) Fluctuations in the dimensions of FG domains (which are intrinsic to natively unfolded structures) and steric hindrance effects between FG domains (due to their close anchoring) could cause the FG domains to extend further out into the transport conduit. The cohesive properties between FG domains within the conduit could transiently stabilize some of the extended conformations. In this panel, the FG motifs are shown in competition between intra- and intermolecular interactions. (C) During transit across the nuclear pore complex, karyopherin-cargo complexes likely separate and bridge FG domains by interacting with their FG motifs. In this panel, the FG motifs are shown in competition between intra- and intermolecular FG motif interactions as well as in competition with karyopherins. In all panels, the nuclear envelope is shown in gray, the nuclear pore complex in green, its cytoplasmic fibrils in light yellow, its nuclear basket in light red, the GLFG-rich domains of nucleoporins in blue, and their intra- and intermolecular FG motif interactions in bright red. For panel C, karyopherins are shown in black and their cargo in bright yellow.The dynamic behavior of GLFG-rich domains of nucleoporins within the transport conduit of the yeast nuclear pore complex. These FG domains are depicted as a dynamic ensemble of premolten globular structures that can fluctuate widely in dimensions. Other types of FG domains are excluded for simplicity. (A) In their “ground state” the GLFG-rich domains are too small to span across the NPC transport conduit from their tether sites within the NPC scaffold, but are large enough to contact each other locally within a single NPC spoke (see top panel) and between adjacent spokes (see bottom panel), based on their close anchoring at the NPC see . In this(1.58 MB TIF)Click here for additional data file.

The aim of this study was to investigate the effects of a massed compared to a distributed practice upon visuomotor learning as well as upon the regional oscillatory activity in the sensorimotor cortex.A continuous visuomotor tracking task was used to assess visuomotor learning; the underlying neuronal correlates were measured by means of EEG. The massed practice group completed a continuous training of 60 minutes, while the distributed practice group completed four 15 minutes practice blocks separated by rest intervals.While the massed and the distributed practice group did not differ in performance, effects of practice distribution were evident in the regional oscillatory activity. In the course of practice, the massed training group showed a higher task-related theta power and a strong task-related power decrease in the upper alpha frequency over the sensorimotor cortex compared to the distributed practice group.These differences in the regional oscillatory activity indicate a higher cognitive effort and higher attention demands in the massed practice group. The results of this study support the hypothesis, that a distributed practice is superior to a massed practice in visuomotor learning. Motor skill learning is the process by which movements or sequences of movements come to be performed with strongly reduced effort through repeated intended practice . Hence, While meanwhile it is common knowledge that motor learning induces functional and anatomical changes within neural motor circuits ,5, the iEver since the description of the alpha blockade by Hans Berger in 1924, it is known that neural activity influences the spectral composition of the EEG signal. In cortical motor areas, the power of frequency bands in the range of 10 to 20 Hz declines before and during the execution of movements as compared to a non-movement baseline condition - an effect referred to as task-related power decrease (TRPD) ,7 or eveIn the present study, participants were asked to perform a bimanual visuomotor task either following a massed or a distributed practice schedule. Based on the broad foundation provided by previous studies, we analysed task-related power changes to dissociate between the effects of the two practice schedules upon neural activity in the sensorimotor cortex. We hypothesise that over the course of practice both groups will show improvements in performance; but that the distributed practice group will perform better than the massed training group in later training stages. At the neural level, we assume that practicing the visuomotor task will lead to a diminished TRPD in the alpha and beta frequency bands, reflecting a reduction of motor-related activation due to increased task automaticity in both groups. We further hypothesise that TRPD changes in all three mentioned frequency bands observed across the practice period will differ between the two training groups, hence, reflecting the influence of practice distribution. Based on previous research, we particularly expect between-group differences in the theta frequency range. We hypothesise that the massed practice group will show a higher task-related theta power than the distributed practice group towards the end of the practice, reflecting a higher cognitive load and increased effort to maintain attention and perform accurately ,21-27.Thirty healthy right-handed female participants volunteered to participate in the present study . Handedness was assessed with the Annett-Handedness Questionnaire . A standParticipants were asked to practice a bimanual visuomotor tracking paradigm, which has been used in previous studies of our group . In ordeThe participants completed a total of 60 trials. For the statistical analysis, practice was split into groups of 15 trials corresponding to blocks 1 to 4. Each trial was initiated by the start signals "Achtung" (ready), "Fertig" (steady), "Los" (go) displayed in the middle of the screen. Subsequently the tracking commenced. Directly after each trial, participants were given feedback about their performance in form of a number displayed on the monitor indicating the mean deviation from the target track. Then a resting period of 16 seconds followed, during which a fixation cross was presented on screen. Thereafter, the next trial started automatically.Participants were randomly assigned to one of two experimental groups in counterbalanced order. One group practiced according to a massed schedule. Here, the 60 trials were conducted at one stretch without rest. In contrast, the second group practiced according to a distributed schedule that allowed three breaks of 7.5 minutes between the four practice blocks . During the resting intervals, participants of the distributed training group were presented with a commercial radio play via standard headphones (Technics Stereo Headphones RP-F550). Participants were instructed to pay attention to the radio play and press a button each time a particular character was speaking. This task was applied to prevent intentional rehearsal of the tracking movements during the rest intervals.Continuous EEG was recorded from 30 surface silver-silver chloride electrodes, positioned in accordance with the international 10-20 system and mounted with the "Easy Cap System" . The recording was referenced to FCz and impedances were kept below 5 kΩ. The BrainVision amplifier system and the BrainVision Recorder software were used to record the data. The electrooculogram was registered by two additional electrodes located below the outer canthi of each eye. The signal was sampled at 500 Hz and bandpass-filtered from 0.5 - 70 Hz. Prior to the first and subsequent to the last practice block, five minutes of spontaneous EEG with the alternating conditions "eyes open" and "eyes closed" were recorded.The steering-wheel position at each of the 2000 data points forming the sequence was compared with the required target position. The mean absolute deviation per trial was then calculated by averaging over the registered deviation values from the 2000 data points of each trial using Matlab 6.5 . The further analysis of the behavioural data was performed using statistical analysis software SPSS . Outliers were defined as trials in which the performance differed more than two standard deviations from the mean performance of the practice block and excluded from further analysis. We then recalculated the mean performance per practice block by averaging over the remaining trials of each block. Participants that showed a significant higher performance in block 4 compared to block 1 were classified as learners (one-tailed independent samples t-test p < 0.05), while participants that did not improve significantly were classified as non-learners and excluded from further analysis .Finally, a repeated-measures ANOVA with 'block' (practice blocks 1 - 4) as within-subject factor and 'group' (massed training vs. distributed training) as between-subject factor was conducted. Greenhouse-Geisser corrections were used to prevent effects of heteroscedasticity. To further investigate the emerging main effects, subsequent t-tests were performed.P-values strongly depend on sample size we furthermore calculated effect size measures to obtain information on how strong an effect is. ETA2 (η2) is reported in multivariate ANOVA statistics and describes the variance attributed to the independent variable of interest. For the t-tests, Cohen's d , we hypothesized that participants following a distributed practice would show a stronger improvement in performance in later practice sessions as compared to the massed practice group. The behavioural data of the present study, however, do not support this hypothesis. The massed and the distributed practice group performed equally well and showed an equal amount of improvement over the course of practice. The complexity of the task used in this study may provide an explanation for this inconsistency with the findings of most previous studies. The superiority of distributed over massed practice has predominately been shown in simple motor tasks in which the temporal distribution of training sessions led to better task performance and/or longer retention -38. A meIt can also be argued that the distributed practice group did not show a superior performance compared to the massed one due to the design of the practice schedules. The length of the rest interval between practice blocks in the previous literature varies between minutes and days and an ideal rest interval has not yet been found . The metAnother possible explanation for the contrast between the finding of this study and some previous studies consists in the time point of measurement. Some of the previous studies have assessed the final skill level in a delayed retention test rather than at the end of the practice session. Dail and Christina analysedFinally, it is conceivable that the practice of the distributed group would have to be spread over several days in order to be more effective than massed practice. Although Mackay et al. found thIn accordance with previous ERD studies of motor behaviour ,34,40, tContrary to our expectations, a slight TRPI was found in the lower alpha band. The lower alpha band is thought to reflect general task demands and attention processes ,34. ThisIn the theta band, no systematic changes were observed over the course of practice when all learners regardless of the practice group were analyzed. Interestingly, however, we found a number of differences between the two groups with respect to practice-induced changes of the regional oscillatory theta activity. While the TRPI in theta decreased over the course of practice in the distributed practice group, the TRPI raised over the course in the massed practice group. In other words, the massed practice group showed a higher TRPI in theta than the distributed practice group in later training block, in accordance with our hypothesis. The finding of a higher task-related theta power in later training sessions in the massed practice group is in line with the previous literature linking increased theta power with increased cognition demand, increased attentional demands and increased effort ,21-24,26Furthermore, the distributed group displayed a weaker task-related power decrease in upper alpha in both clusters of electrodes in the second practice block. While lower alpha is thought to reflect general cognitive demands and attention processes, previous studies indicate that upper alpha desynchronization is related to task-specific aspects, such as for example certain aspects of motor processing . ManganoSome limitations of the present study should be noted. Firstly, all participants were female and right-handed. Future research should replicate the main findings in independent samples. Secondly, our study was focused specifically on the effects of different practice distributions upon the local activity of the sensorimotor cortex. It is conceivable that a prolonged training of a visuomotor task might additionally lead to functional changes in brain areas outside the sensorimotor cortex. This hypothesis should be tested in forthcoming studies.This study examined the effects of a massed compared to a distributed training in visuomotor learning. In the behavioural data no differences between the two groups were evident and therefore the superiority of a distributed practice could not be confirmed by the behavioural data. However, the results of this study confirm distribution of practice-effects in motor learning on the neurophysiologic level. The analysis of regional oscillatory activity indicates a higher cognitive load and increased attentional demands in the massed training group compared to the distributed training group towards the end of the practice session. It is conceivable that an elongation of the practice session would lead to exhaustion in the massed practice group resulting in a weaker learning compared to the distributed practice group. Therefore, the results of this study generally support the hypothesis, that a distributed practice is superior to a massed practice when trying to acquire a motor skill.The authors declare that they have no competing interests.BS contributed to conception and design of the study, took care of the data acquisition, performed the data analyses and interpretation and drafted the manuscript. SK contributed to the design of the study, participated in data interpretation and helped drafting the manuscript. BJ participated in the design and helped with data processing and statistical analyses. LJ contributed to the design of the study and critically revised the results. All authors read and approved the final manuscript.

Better communication is often suggested as fundamental to increasing the use of research evidence in policy, but little is known about how researchers and policy makers work together or about barriers to exchange. This study explored the views and practice of policy makers and researchers regarding the use of evidence in policy, including: (i) current use of research to inform policy; (ii) dissemination of and access to research findings for policy; (iii) communication and exchange between researchers and policy makers; and (iv) incentives for increasing the use of research in policy.Separate but similar interview schedules were developed for policy makers and researchers. Senior policy makers from NSW Health and senior researchers from public health and health service research groups in NSW were invited to participate. Consenting participants were interviewed by an independent research company.Thirty eight policy makers (79% response rate) and 41 researchers (82% response rate) completed interviews. Policy makers reported rarely using research to inform policy agendas or to evaluate the impact of policy; research was used more commonly to inform policy content. Most researchers reported that their research had informed local policy, mainly by increasing awareness of an issue. Policy makers reported difficulty in accessing useful research syntheses, and only a third of researchers reported developing targeted strategies to inform policy makers of their findings. Both policy makers and researchers wanted more exchange and saw this as important for increasing the use of research evidence in policy; however, both groups reported a high level of involvement by policy makers in research.Policy makers and researchers recognise the potential of research to contribute to policy and are making significant attempts to integrate research into the policy process. These findings suggest four strategies to assist in increasing the use of research in policy: making research findings more accessible to policy makers; increasing opportunities for interaction between policy makers and researchers; addressing structural barriers such as research receptivity in policy agencies and a lack of incentives for academics to link with policy; and increasing the relevance of research to policy. Evidence from research can enhance policy development by identifying new issues for the policy agenda, informing decisions about policy content and direction, or by evaluating the impact of policy -5. Althoone of the most consistent findings in research of health services is the gap between evidence and practice" (p. 1225) [However, it is evident that many opportunities to use evidence from research in policy are currently missed -10, withp. 1225) .efforts by researchers and by decision makers seem to proceed largely independently. Both have their own (often misplaced) ideas about the other's environment. Opportunities for ongoing exchange and communication are few. ...It is like two people trying to assemble a jigsaw puzzle, each with half the pieces - but each working in a separate room" (p. 439) [A lack of communication, exchange and understanding between researchers and policy makers is often regarded as a major contributor to the failure to consider the relevant evidence. This has been well described by Lomas who noted that "(p. 439) .Relatively little is known about the ways in which researchers and policy makers work together or about barriers to increasing exchange. A systematic review of 24 studies of health policy makers' perceptions indicated that the most important facilitator of research use was personal two-way communication between researchers and policy makers . ResearcEven less is known about the views of researchers about factors that might increase their participation in policy relevant research and engagement with policy makers. Only one study exploring the views of health researchers was located; it reported that researchers were concerned about the risks posed to an academic career by spending time on engagement with policy agencies . In AustThere are very few studies of engagement between researchers and policy makers in Australia. In 1995, Ross examined the use of economic evaluations by senior policy makers (n = 34) from the New South Wales (NSW) Health Department and the Commonwealth Health Department and found that only 38% of the policy makers had ever used economic evaluations to inform policy development ; relativA recent study of reports from completed projects funded through National Health and Medical Research Council (NHMRC) grants found that only 14% of principal investigators felt their research had influenced public health practice, and only nine percent believed their work had made any impact on health policy . An earlThis study aimed to explore the views and current practice of both policy makers and researchers about the use of evidence in policy. Specifically, the study aimed to:i. Describe the extent to which policy makers and researchers believed that research is currently used to inform policyii. Investigate current practice in relation to the dissemination of and access to research findings for policyiii. Explore the extent of communication and exchange between researchers and policy makers andiv. Examine incentives for increasing the use of research in policy.The Sax Institute was established in 2002 with core funding from the NSW Department of Health. The Institute is a unique organisation in Australia that aims to build excellent policy- and practice-focused health research and increase the impact of this research on health policy, programs and services. The Institute is an independent, not-for-profit organisation structured as a coalition of member organisations. Membership is open to Universities, Schools and research groups with programs in public health and health services research. At the time of the study the Institute's members included 34 research groups (six Universities and 28 Schools/research centres) of national and international standing, representing most of the Universities and research groups that undertake public health and health services research in NSW. A full list of members and details about membership are available on the Sax Institute's website The study was designed as a quality assurance exercise to assess, and inform the further development of, the Sax Institute's programs for improving links between research and policy. The study complied with the definition of a quality assurance activity as set out in the relevant National Health and Medical Research Council guidelines . SpecifiSeparate interview schedules were prepared for researchers and policy makers and samples identified as described below. The procedure for administering both sets of interviews was the same. Structured telephone interviews were conducted by trained interviewers from an independent research company. Potential participants were initially contacted by telephone and asked to identify a suitable interview time; a minimum of six follow-up call attempts were made to establish contact. Participants were informed that their responses would be fully de-identified. Interviews took an average of 30 minutes to complete. The interviews were not recorded, but responses to open-ended questions were handwritten verbatim and subsequently coded using thematic analysis to identify common categories.All members of the NSW Department of Health Policy Development Committee and all directors of Health Service Development and of Population Health from each of the Area Health Services were sent a letter of invitation from the NSW Chief Health Officer (n = 54).The interview schedule included both closed and open-ended questions and asked about respondents' involvement in policy development, access to and use of research findings, and involvement in research activities and networks. Participants were asked to think broadly about policy and to include in their answers policy in the form of small-scale local plans or operational issues through to large-scale programs or system-wide directions, and relating to a variety of issues including resource allocation, service patterns, or the delivery of health care or public health programs. In responding to questions about research, participants were asked to include any kind of formal or systematic process of collecting and analysing data, including stand-alone studies, studies that form part of a broad thematic program of research, and research reviews.Sixty senior population health and health services researchers were invited to participate through a letter sent from the Chief Executive Officer of the Sax Institute. Invitees included nominated representatives from the Institute's member Universities (n = 6), nominated members from the Institute's member Schools and research centres (n = 28), and one additional nominee from each member School and research centre currently employing two or more senior researchers (n = 26).The structured interview schedule included both closed and open-ended questions and asked about respondents' involvement in policy development, dissemination of their research and its impact on policy, and degree of involvement of policy makers in their research. The descriptions of the terms 'policy' and 'research' were the same as those provided in the interviews with policy makers.Of the 54 people approached, six people were on extended leave or had transferred from their area. Of the remaining 48 potential participants, 10 did not respond to the letter of invitation. The final sample consisted of 38 interviewees (79% response rate).The 38 policy makers interviewed were employed at senior levels of the NSW Department of Health (n = 14) and the Area Health Services (n = 24). Over half (58%) had worked in their current position for more than two years. All participants had been involved in policy development in the last 12 months, with 71% having developed more than five policies and 84% having approved policies developed by other staff. Respondents were involved in developing a range of policies relating to population health , health service provision (eg cancer services plan), governance and administration (eg patient information privacy), and clinical care (eg collection of urine samples for testing).Of the 60 researchers approached, six were unavailable during the study period and four no longer held a substantive research position. Of the remaining 50 potential participants, five opted out of the study and four could not be contacted. Forty-one researchers completed an interview (82% response rate). The 41 researchers interviewed were drawn from 29 of the Sax Institute's member organisations across NSW. All but one respondent (98%) had worked in an academic research environment for eight or more years . Interviewees identified their primary research areas as public health (56%), health services (51%), clinical and medical sciences (27%), and equity (12%).Respondents were asked to indicate how much of a need there is to increase the use of research in policy making using a five point scale. Sixty three percent of respondents felt that there was a high need to increase the use of research (rated 4 or 5) and a further 24% believed that there was a medium need (rated 3).Figure Respondents were asked to estimate, for those policies that they had developed or approved, whether research was used to inform: (a) none of these policies; (b) less than a quarter; (c) between a quarter and a half; (d) between half and three quarters; or (e) more than three quarters. The majority of respondents used research only infrequently to inform policy agendas. Sixty six percent of respondents used research in agenda setting on less than a quarter of occasions in the previous year; this included two participants who had never used research to inform policy agendas. Most participants also used research infrequently to evaluate the implementation or impact of policies: 60% had used research to evaluate policies on less than a quarter of occasions in the previous year. This included three participants who had never used research to evaluate policies.Use of research to inform policy content or direction was more common. All respondents had used research to inform policy content at some time in the previous year, and only 11% reported using research on less than a quarter of policies. Nevertheless, only a minority of participants (29%) used research to inform content on more than three-quarters of policies.Eighty five percent of respondents perceived a high need to increase research use by policy makers (rated 4 or 5) and the remainder believed that there was a moderate need (rated 3).how their research had influenced health policy or practice, respondents most often felt that their research or reviews had increased policy makers' awareness of an issue.Table Respondents were asked whether the health research undertaken by researchers in NSW was relevant to policy and program development. Over one third of respondents (39%) felt that local research was relevant, but most of these (87%) believed that the research was not presented in a useful way. In total, only 5% of the interviewees felt that local research was both relevant and presented in a useful way.Figure Respondents were asked how often they had used various strategies to communicate their research findings in the previous two years. Twenty three (56%) reported that they often identified the policy or practice implications of their research findings, but only 14 (34%) regularly developed explicit policy recommendations or summaries from their research for policy makers. Sixteen (39%) respondents had frequently developed targeted strategies for communicating their research to non-academic audiences, and 18 (44%) often wrote reports or papers about their research for non-academics.Table Most policy makers had wanted to contact a researcher during the past 12 months to sound out an issue. Of those who had wanted to discuss ideas with a researcher in the previous year, 57% were easily able to contact a relevant researcher when needed.Table More than two-thirds of the policy makers had acted in an advisory role in research, participated in the development of research questions, or assisted with the dissemination of research results. Half of the interviewees reported active participation in a research team. However, fewer had been involved in the sorts of activities that are likely to facilitate communication and application of research, such as participating in the analysis, writing up and publication of the research results. Eighteen percent of the sample had collaborated on a successful competitive research grant.Table Eighty percent of interviewees had wanted to involve a policy maker in their research at some time in the previous two years. Of these, 58% were easily able to find a policy maker to contribute when needed, but 27% found it difficult to contact a policy maker and 15% could not find an appropriate person. For those interviewees who did find a policy maker to contribute to their research, this was almost always (79%) based on an existing relationship.Table building bridging systems between researchers and policy makers" and "standing arrangement with key research groups and key research people who can readily assist in policy making".In response to an open question, the most common reasons for not using research in policy were: the absence of appropriate and/or relevant research (29%); a lack of skills or capacity to access or acquire relevant research (24%); the need to consider local agendas and other policy drivers (24%); and time pressures (21%). The most frequently nominated strategy for improving the use of research in respondents' organisations was improved access to research and researchers (32%). Participants' suggestions included: "Fifty five percent of the respondents were not aware of a NSW Health guideline that required evidence to be checked during policy development. Forty two percent of the sample perceived that NSW Health placed a high value on policy being supported by research.Of the 27 researchers who reported that their research had been used in policy, the most commonly cited facilitators identified in response to an open question were: existing relationships and networks with policy makers (33%); the quality and credibility of the research (33%); a receptive policy environment - the 'right research at the right time' (33%); and research that was designed specifically to address policy priorities (19%). The 16 researchers who felt that their research should have been but was not used to inform policy reported that the use of their research was impeded by: research findings that were politically sensitive or inconsistent with policy directions (38%); the importance of other policy drivers, such as politics or media (31%); and practical constraints to the implementation of findings, such as financial implications (25%). Respondents' suggestions for improving the impact of their research on policy and practice included: encouraging a better understanding of the importance of research among policy makers and politicians (31%); more opportunities for dialogue and interaction with policy makers (25%); and more research and funding (19%).Respondents indicated that none of the policy making, research funding or academic sectors provided significant incentives to increase research uptake Table . Thirty This paper reports findings from interviews with both senior policy makers and researchers in NSW. While the samples were small, this reflects the size of the relevant research and policy communities in NSW, and the response rates were good.Policy makers and researchers recognise the potential of research to contribute to policy and are making significant attempts to integrate research into the policy process. Most policy makers reported having needed data and reviews in the past 12 months, having commissioned research or reviews during this period, and having used evidence to contribute to the content of policy. The rates of use of evidence by policy makers appear to be somewhat higher than those reported in previous Australian surveys (eg ). SimilaHowever, policy makers and researchers agreed that much more could be done to increase the use of research in policy. Reports of current practice indicated that only around half of the researchers thought their research had been used to get issues on the policy agenda or select preferred policy options in the past two years. Although policy makers drew on research findings to contribute to the content of policy, it was not often used to set agendas or to evaluate policy.This paper identifies four potential strategies for increasing the use of research in policy.First, making research findings more accessible is likely to be helpful. Policy makers reported that they often found it difficult to access brief summaries and systematic reviews. Many respondents also indicated that research conducted in NSW was often not presented in a useful way to inform policy and program issues. Similar results have been reported by others ,25,26. TResearchers reported a high level of effort in disseminating their research to policy makers. Thirty nine percent of respondents had regularly developed targeted strategies for communicating their findings to non-academic audiences. While peer review papers and conference papers remain the standard methods of dissemination, there is certainly evidence of a second tier dissemination strategy aimed at policy makers, primarily through research reports and presentations.However, despite these efforts by researchers, policy makers still found it difficult to access research findings. It seems likely that new approaches are required that more closely target the specific needs of policy users . There iSecond, increasing the opportunities for interaction and exchange between policy makers and researchers is key to promoting the use of research evidence in policy. This was identified by both policy makers and researchers in our samples, consistent with the findings of two systematic reviews ,30. Our Opportunities for researchers and policy makers to meet informally and mechanisms to help policy makers and researchers to identify individuals relevant to their work are likely to be important in promoting exchange. Policy makers in our sample reported that they often wanted to seek advice from researchers, but sometimes could not find the expertise that they needed, and that they tended to use existing contacts. Researchers perceived that input from policy makers into their research would be of value but were often not sure how best to identify appropriate individuals.A greater intensity of interaction and exchange is achieved by actively involving policy makers in conceptualising, designing, and implementing research . ExperieThird, there are clearly some structural barriers to increasing the use of research in policy that could be addressed. Both policy makers and researchers felt that enhancing policy makers' understanding of research is important; likewise, the need to improve research infrastructure and funding was regarded as important in generating relevant evidence. Policy makers felt that organisational reinforcement for evidence-informed policy could be improved. Although researchers agreed that there was a high need to increase the use of research by policy makers, more than one-third of the respondents in the current sample did not regard these activities as being a high personal priority. This is in part the result of a perception among researchers that their efforts to impact on policy were not valued by Universities or by funding agencies. This view is probably well founded; for example, in Canada, Phaneuf et al. surveyedThere seems little doubt that it will be necessary to address these structural barriers to increase the use of evidence in policy. In terms of increasing the receptivity of policy makers to research, the two main approaches that have been described are the use of tools to assess organisational capacity to acquire and apply research evidence (for example a self-assessment tool developed by the CHRSF ) and conWith regard to incentives for researchers to engage in research transfer activities, there is a need to develop a measure of the impact of research on policy. A reliable measurement tool would enable these activities to be included in consideration of applications for promotion or in assessment of research track record for funding applications. For example, the Netherlands Council for Medical Sciences has developed a methodology and indicators for evaluating the societal impact of applied health research ; this isFinally, there was a view among policy makers that there is a lack of relevant research that could inform policy. Almost half the sample believed that the health research being conducted in NSW was not relevant, or had variable relevance, to health policy. To increase the relevance of research, policy makers need be able to clearly identify and communicate gaps in knowledge and policy priorities for research to researchers. A greater understanding of the policy context by researchers could increase relevance by focusing the research on more useful questions, collecting information critical for policy decisions (for example on costs) and improving the description of the research results and their implications. Research partnerships may improve the relevance of research and therefore its translation to policy .The development of a national system for health data linkage through the National Collaborative Research Infrastructure Strategy (NCRIS) Population Health Research Network presents particular opportunities for new policy-relevant health research in Australia. Linked person-based data for entire populations provides powerful information about the outcomes of health systems, and how these are shaped both by environmental factors, patient factors and service configuration. However, to provide the information health policy makers need, this enhanced capacity to describe and monitor system outcomes must be accompanied by new multidisciplinary research to develop health service interventions and test these in real-life service settings.We intend to repeat our policy maker and researcher interviews in 2010. The 2010 sample of policy makers is likely to be almost entirely new, given the rapidity of change within the policy environment. Nonetheless, we would hope to demonstrate increased use of research evidence in health policy in NSW, as a result of the activities of the Sax Institute and initiatives such as the NHMRC Partnerships Program and the NCRIS Population Health Research Network, and reflecting a general, worldwide interest in promoting the efficient transfer of research evidence into policy.The authors declare that they have no competing interests.DC oversaw the design and conduct of the researcher interviews, undertook data analysis, and drafted the manuscript. SR contributed to the conception and design of the study, and to the development, drafting and editing of the manuscript. LJ and AZB contributed to the conception and design of the study, and helped to draft the manuscript. MC oversaw the design and conduct of the policy maker interviews, undertook data analysis, and helped to draft the manuscript. LR contributed to the design of the study and helped to draft the manuscript. All authors read and approved the final manuscript.

The applicability of pValac was demonstrated by invasiveness assays of Lactococcus lactis inlA+ strains harbouring pValac:gfp into Caco-2 cells.The use of food-grade lactococci as bacterial carriers to DNA delivery into epithelial cells is a new strategy to develop live oral DNA vaccine. Our goal was to develop a new plasmid, named pValac, for antigen delivery for use in lactococci. The pValac plasmid was constructed by the fusion of: i) a eukaryotic region, allowing the cloning of an antigen of interest under the control of the pCMV eukaryotic promoter to be expressed by a host cell and ii) a prokaryotic region allowing replication and selection of bacteria. In order to evaluate pValac functionality, the gfp, we observed GFP expression in PK15 cells. L. lactis inlA+ were able to invade Caco-2 cells and delivered a functional expression cassette (pCMV:gfp) into epithelial cells.After transfection with pValac:L. lactis harbouring pValac to DNA delivery and subsequent triggering DNA expression by epithelial cells. Further work will be to examine whether these strains are able to deliver DNA in intestinal cells in vivo.We showed the potential of an invasive Shigella flexneri, Yersinia enterocolitica, Listeria monocytogenesis, Salmonella thiphymurium or Mycobaterium [Numerous infectious agents invade the host through the mucosa to cause disease. The use of bacterial carriers to deliver DNA vaccine by oral route constitutes a promising vaccination strategy -3. Most baterium . Such babaterium ,4,8. Desbaterium .The use of food-grade lactic acid bacteria (LAB) as DNA delivery vehicles represents an attractive alternative to the use of such attenuated pathogens and other mucosal delivery systems such as liposomes or microparticles . LAB is Lactococcus lactis, the model LAB, has been intensively investigated [Antigen and cytokine delivery at the mucosal level by food-grade stigated -16 (for stigated ). In constigated .L. lactis expressing Listeria monocytogenes Internalin A (inlA) gene (LL-inlA+) was internalized by human epithelial cells in vitro and enterocytes in vivo after oral administration of guinea pigs [green fluorescent protein (gfp) open reading frame (ORF) under the control of a eukaryotic promoter carried by such LL-inlA+ strains could be delivered into and expressed by epithelial cells [E. coli and a L. lactis replicons. During further attempts to insert antigens in this plasmid, we verified that its structure and size made difficulty not only cloning strategies but also transformation steps in lactococci.We previously developed a strategy using recombinant invasive lactococci to deliver a plasmid containing a eukaryotic expression cassette gene into epithelial cells. We demonstrated that nea pigs . We alsoal cells . These rVaccination using lactic acid bacteria). The pValac plasmid was constructed by the fusion of: i) a eukaryotic region, containing the CytoMegaloVirus promoter (pCMV), a multiple cloning site, and the polyadenylation signal of Bovine Growth Hormone (BGH polyA) and ii) a prokaryotic region, containing the RepA/RepC replication origin for both E. coli and L. lactis and a chloramphenicol resistance gene for bacteria selection.To improve our delivery DNA strategy, we constructed a new smaller plasmid, named pValac (Escherichia coli DH5α was grown on Luria-Bertani medium and incubated at 37°C with vigorous shaking. L. lactis MG1363 was grown in M17 medium containing 0.5% glucose (GM17). Bacteria were selected by addition of antibiotics as follows (concentrations in micrograms per milliliter): for E. coli, erythromycin (100) and chloramphenicol (10); for L. lactis, erythromycin (5) and chloramphenicol (10).The bacterial strains and plasmids used in this work are listed in Table L. lactis, TES containing lysozyme (10 mg/ml) was added for 10 min at 37°C to prepare protoplasts. Enzymes were used as recommended by suppliers. Electroporation of L. lactis was performed as described [L. lactis transformants were plated on GM17 agar plates containing the required antibiotic and were counted after 2-day incubation at 30°C.DNA manipulations were performed as described with theescribed . L. lactpfx high fidelity polymerase, Invitrogen, Sao Paulo, Brazil) and the oligonucleotides CMVBglFwd (5' GGAGATCTGCGTTACATAACTTACGG 3') and BGHClaRev (5' GGATCGATTAGAAGCCATAGAGCCC 3') introducing respectively a BglII and a ClaI (underlined) sites in the fragment. The amplified PCR product was cloned into TOPO vector . The prokaryotic region of pValac was obtained from the pXylT:CYT . BglII/ClaI-digested and purified TOPO:VAX1 and pXylT:CYT fragments were ligated using T4 DNA ligase (Invitrogen) to obtain pValac vector (3742 pb) and then inserted into the pValac MCS using the same restriction enzymes resulting in pValac:gfp (4468 bp). The integrity of the gfp ORF was confirmed by sequencing as described above.The gfp plasmid was assayed for GFP expression by transfection into Porcine Kidney cell line (PK15 cells). Fifty to 80% confluent PK15 cells were cultured in Dulbecco modified Eagle medium, 10% fetal calf serum, 2 mM L-glutamine , 100 U penicillin and 100 g streptomycin. PK15 cells were transfected with 1.6 μg of pValac:gfp, pEGFP-N1 (positive control) or pIL253 (negative control) previously complexed with Lipofectamine 2000 (Invitrogen). pIL253 was used as a negative control due to the fate that it is an empty lactococcal plasmid; being more suitable for our next step (see below). The GFP-producing cells were visualized 48 hours after transfection with an epifluorescent microscope . Transfection assays were performed in triplicate.The pValac:LL-inlA+ strains were transformed with pValac:gfp (negative control) to kill extracellular bacteria. Fluorescent cell quantification was evaluated at 24 and 48 hours after gentamicin treatment by flow cytometry on Fluorescent Activated Cell Sorter . The GFP-producing cells were visualized with an epifluorescent microscope . Internalization and FACS assays were performed in triplicate.To demonstrate the efficacy of pValac as a delivery vector, +) Table . In vitrescribed with somescribed . BrieflyLactococcus lactis as DNA delivery vehicle [In this work, which is part of an ongoing project geared to implement safer strategies for DNA deliver and expression into eukaryotic cells, we reinforce the use of vehicle ,26. To iE. coli and L. lactis and a chloramphenicol resistance gene (Cm) for bacteria selection. The MCS , we observed comparable GFP expression in these epithelial cells for L. lactis, a suitable multiplicity required for an efficient internalization for these bacteria [LL-inlA+ pValac:gfp+ were able to invade Caco-2 cells and to deliver a functional expression cassette (pCMV:gfp) into epithelial cells.Internalization of ytogenes . Here webacteria . We thusgfp or pVE3890 [It is worth to note that concerning expression data, it is not surprisingly that we had comparable levels of approximately 1% using pValac: pVE3890 since bo pVE3890 -31 than L. lactis is probably taken up in the vacuoles and target for degradation, thereby releasing pValac:gfp. Then, by an unknown mechanism, the plasmid escapes the vacuoles and reaches the nucleus where the gene (gfp ORF in our case) could be translated by the host cell [L. lactis inlA+ survival rate was measured and showed a decrease from 4,5 log CFU/ml for 24 hours after internalisation to 2 log CFU/ml after 60 hours (data not shown). In fact, it was already suggested that L. lactis vaccine vectors engineered to access the cytoplasmic antigen presenting pathway are incapable of further growth in this environment [in vitro, these bacteria could still be regarded as safe when engineered to be invasive.The hypothesis for DNA delivery and expression is based on the infection of host cells by bacterial carriers: following internalization, invasive ost cell -34. Quesironment ,36. ThisLactococcus lactis, as DNA delivery vehicle at the mucosal level.Mucosal epithelium constitutes the first barrier to be overcome by pathogens during infection. The use of non-invasive bacteria for oral DNA vaccine delivery to induce intestinal mucosal immunity is a promising vaccination strategy used during the last decade. An attractive DNA vaccine strategy is based on the use of the food-grade LAB, gfp ORF in pValac we could show that: i) invasive L. lactis strains (inlA+) carrying pValac:gfp were able to enter epithelial cells and ii) after internalization, the host cells expressed the GFP protein. Therefore we could demonstrate the potential application of both plasmid and strain, to implement safer strategies for oral DNA deliver and expression into eukaryotic cells using LAB.In this sense, we constructed the pValac, a new plasmid for DNA delivery. pValac contains eukaryotic genetic elements, allowing cloning and further expression of an antigen of interest by an eukaryotic host cell as well as a prokaryotic region allowing replication and selection of bacteria. After cloning the in vivo. In long term, an alternative strategy for DNA vaccine delivery could be achieved based on these recombinant L. lactis carriers.Further experiments have been performed to examine whether these strains are able to release enough DNA to ensure an efficient intestinal cell expression The authors declare that they have no competing interests.VG and SI performed the experiments of the work. VG drafted the manuscript and AM contributed to improve it. JMC and FL coordinated it. PL, VA and AM conceived the study as project leaders. All authors read and approved the final manuscript.

The method was applied to data on 116 SNPs and 189 genes on chromosome 11, for which Morley et al. had previously reported linkage. We were able to confirm the association of the expression of HSD17B12 with a SNP in the same region reported by Morley et al., and also detected a SNP that appeared to affect the expression of many genes on this chromosome. The approach appears to be a promising way to address the huge multiple comparisons problem for relating genome-wide genotype × expression data.We describe a hierarchical Bayes model for the influence of constitutional genotypes from a linkage scan on the expression of a large number of genes. The model comprises linear regression models for the means in relation to genotypes and for the covariances between pairs of related individuals in relation to their identity-by-descent estimates. The matrices of regression coefficients for all possible pairs of single-nucleotide polymorphisms (SNPs) by all possible expressed genes are in turn modeled as a mixture of null values and a normal distribution of non-null values, with probabilities and means given by a third-level model of SNP and trait random effects and a spatial regression on the distance between the SNP and the expressed gene. The latter provides a way of testing for Recent advances in genomic technology now allow genotyping of hundreds of thousands of single-nucleotide polymorphisms (SNPs) and measurement of the expression of tens of thousands of genes on single microarrays or chips at a manageable cost. Extensive literature on the analysis of gene expression data has evolved over the last five years, and since the advent of ultra-high-volume genotyping platforms, genome-wide association and linkage scans using SNPs have also become feasible. The multiple comparisons problem is central to the analysis of either type of high-volume data. In 2001, Jansen and Nap , , , etc. The updates of the X values are based on a Metropolis-Hastings procedure with a random walk proposal. The sequence was started ten times from several initial points chosen from an overdispersed prior around rough estimates. Half of the initial samples are discarded and the second half is kept. The number of kept samples, L = 4000, is chosen to be large enough so that for all parameters of interest the variance between sequences VB is comparable to that within sequence VW, R < 1.10:We fitted the model using a Markov-chain Monte Carlo (MCMC) approach, implemented in Matlab. Updates of all parameters except the location parameters The rationale behind this convergence monitoring procedure is described and justified by Gelman et al. .cis and trans linkages at this chromosome. The final data set thus had 116 SNPs and 189 expressed genes. IBD status was estimated from the complete two-generation pedigrees (excluding grandparents) by a program written by JM based on the Lander-Green algorithm results are summarized in the right panel of Figure ] resultsWe have introduced a novel hierarchical Bayes model for genetic control of gene expression. Our approach to dealing with the multiple comparisons problem is to represent the matrices of all possible SNP × expressed gene association or linkage coefficients in terms of row and column random effects, along with a spatial regression on the distance between the two. Although this allows inference on specific pairs, we have greater interest in the variances of the row and column effects, which reflect systematic tendencies for SNPs to affect variable numbers of phenotypes and for phenotypes to be differentially expressed. Our mixture model also supports the possibility that the vast majority of such associations or linkages would be truly null, and allows separate estimation of both the probability and magnitude of non-null tests. So far we have not imposed any relationship between the parameters of the association (means) and linkage (covariance) models, but one might contemplate using the broad regions where linkage is seen for a particular phenotype as a prior for testing single-SNP associations with that phenotype.The strongest gene-expression × SNP association reported by Cheung et al. on chromm, n, sample size, and number of MCMC samples. Generating 4000 MCMC samples required 6 hours on a 2.2 GHz single-processor machine. However, one outstanding methodological challenge that would have to be addressed before the approach could be applied to dense SNP associations would be how to deal with the multicollinearity problem; for this reason, we chose to restrict this analysis to only a subset of SNPs that were not in strong LD with each other.We chose to restrict these analyses to a subset of genes and SNPs on a single chromosome to test the feasibility of the method. In principle the approach could be applied on a genome-wide scale, since the computation time increases linearly with The author(s) declare that they have no competing interests.

Sprague-Dawley rats aged 50 days were given single oral doses of the carcinogen, DMBA.Rats receiving the carcinogen at the same stage of the oestrous cycle were grouped together and mammary tumour production was compared between these groups.When the carcinogen was given during di-oestrus the mean number of tumours per animal was significantly greater than when it was given at other stages in the oestrous cycle. There was considerable variation in total tumour yield from one batch of animals to another.

We set out to estimate historical trends in HIV incidence in Australian men who have sex with men with respect to age at infection and birth cohort.newly diagnosed HIV infections", "newly acquired HIV infections" and "AIDS diagnoses", to estimate trends in HIV incidence over both calendar time and age at infection.A modified back-projection technique is applied to data from the HIV/AIDS Surveillance System in Australia, including "Our results demonstrate that since 2000, there has been an increase in new HIV infections in Australian men who have sex with men across all age groups. The estimated mean age at infection increased from ~35 years in 2000 to ~37 years in 2007. When the epidemic peaked in the mid 1980s, the majority of the infections (56%) occurred among men aged 30 years and younger; 30% occurred in ages 31 to 40 years; and only ~14% of them were attributed to the group who were older than 40 years of age. In 2007, the proportion of infections occurring in persons 40 years or older doubled to 31% compared to the mid 1980s, while the proportion of infections attributed to the group younger than 30 years of age decreased to 36%.The distribution of HIV incidence for birth cohorts by infection year suggests that the HIV epidemic continues to affect older homosexual men as much as, if not more than, younger men. The results are useful for evaluating the impact of the epidemic across successive birth cohorts and study trends among the age groups most at risk. After a steady decline since the mid 1980s, there is now growing evidence that HIV infection has been increasing in parts of the developed world indicateIncreases over time in the epidemic could potentially reflect the risk profile of new generations of MSM as they become sexually active. Therefore, describing the trends in HIV incidence by year of infection for successive birth cohorts can potentially provide a comprehensive picture of the epidemic. Comparing incidence estimates obtained from these sub-populations can be fundamental in providing indications of the epidemic trends in terms of demography for informing public health responses.Australia established an HIV surveillance system in the early 1980s, whereby all new HIV diagnoses are reported. Since 1991, further surveillance has been supplemented by national notification of HIV diagnoses with evidence of newly acquired HIV infection, defined as new HIV diagnoses with either a previous negative HIV test within 12 months, or with evidence of a recent seroconversion illness. Although these data are indicative of trends in the HIV epidemic, they cannot be used directly to estimate HIV incidence (number of new infections per year). Accurate estimates of HIV incidence by population subgroup are required to determine trends in the epidemic and to evaluate the groups most at risk for acquiring HIV.Methods based on back projection have hisnewly diagnosed HIV infections", "newly acquired HIV infections" and "AIDS diagnoses", to estimate trends in HIV incidence.This method allows us to obtain estimates of the past and current incidence trends in a population over each calendar year and with respect to age at infection. Similar approaches have been used to estimate age-specific historical trends in the past -7, but tSince there is no established statistical model to link HIV incidence to HIV diagnosis with respect to HIV testing patterns, the current methodology assumed that if an individual was infected before, or in, a certain year, it was more likely that this individual sought an HIV diagnostic test at the onset of clinical symptoms. However, as HIV testing became more available and promoted, individuals infected in later years tended to be more likely to seek testing independent of the onset of clinical symptoms. Unlike the similar models used in the literature where boThis methodology is applied to Australia's HIV/AIDS National Surveillance data to estimate the number of HIV infections among MSM and to evaluate the impact of the year of birth and age at infection. It is also used to assess whether incremental increases in age at diagnoses in recenIn Australia, HIV transmission is monitored through the notification of cases of newly diagnosed HIV infection, including cases with evidence of newly acquired HIV infection . There are potentially three data sources of HIV surveillance data available in each calendar year: new HIV-positive diagnoses by year of diagnosis; newly acquired HIV infection (recent infections among new HIV diagnoses); and new AIDS cases [The back-projection method was originally proposed by Brookmeyer and Gail and used in western countries in the late 1980s and early 1990s to estimate trends in HIV infections based on reported AIDS diagnoses . Later sThe method used here differs from similar approaches in the literature in that it does not require data linkage between the HIV and AIDS diagnostic registries. It is based on a parametric formulation of the duration of time between the time of acquisition of HIV infection and the time of earliest diagnosis of HIV infection from enhanced HIV surveillance systems or from laboratory confirmed testing. Many factors may influence this distribution , but in this study we consider two testing "forces" as described below.λ. This leads to a Pareto distribution with decreasing hazard function for the duration X between HIV infection and HIV diagnosis, which essentially steps down over time. The survivor and hazard functions areA proportion of people infected with HIV will be diagnosed with HIV prior to clinical symptoms or AIDS. A heterogeneous mixed exponential model was used to model the rate at which people in this group are diagnosed with HIV, assuming a constant testing rate We definex = 0, 1, 2,... years after infection.for the probability of testing 3 without any treatment. A Weibull distribution was adopted, with median time to HIV diagnosis of 6.5 years and shape parameter 2.08 [A proportion of HIV diagnoses are assumed to be made at a late stage of HIV infection or at AIDS diagnosis. We assumed that the progression from HIV infection to the earliest HIV diagnosis follows a distribution similar to the progression to CD4 counts of <200 cells/mmter 2.08 with theWe defineThe Weibull distribution has the property that the hazard increases with time from infection, which intuitively would mirror the risk of progression to HIV-related symptoms in untreated HIV infection.f was formulated by combining the two sub-models and fb(x)) described above using a mixture distribution model, i.e.,The overall rate of progression to HIV diagnosis x|t; φ) is the survival function:where S; π represents the proportion of infected individuals who were not tested because of clinical symptoms; δ determines the overall shape of the curves; and γ denotes the rate of increase in infection at time t.where t = t0, mt(φ) increases with time t at rate γ to a saturation level π = limt → ∞ mt(φ) We assume that there will be a proportion 1 - π of infected individuals who are driven by clinical symptoms to be tested (as specified by Sub-model 2).When HIV testing just became available at f results in an overall "bath-tub" shaped hazard and HIV diagnostic data using the combined progression rate distribution.This model uses three key parameters: the proportion of infected individuals who are "late testers" (from Sub-model 2); the rate of increase in incidence over time; and a shape parameter. The final estimates for HIV incidence were produced using an optimization method based on Nelder-Mead, quasi-Newton and conjugate-gradient algorithms written in R-language.x|t; φ) as defined by mt(φ) at the values of 0.2, 0.4, 0.6 and 0.8 for the shape parameter.Sensitivity analyses were performed to assess the robustness of the hypothetical HIV incidence curve for a variety of shape parameters. Figure The properties of the parameters used in this approach were also studied with a series of simulation studies. We predicted the mean numbers of HIV diagnoses over time using a variety of parameter estimates. We used the log-logistic distribution with mean = 10 years and a shape parameter 3.08 for the HIV to AIDS incubation period to predict the mean numbers of new AIDS diagnoses up to the time of the availability of effective antiretroviral therapies in 1997. We set the testing behaviour parameter to 0.5 per year before we predicted the proportions of recent infections.3 sets of simulated data from all parameter combinations contained: (i) the primary data for HIV diagnoses; (ii) the AIDS diagnostics data to adjust for the ramp-up period; and (iii) the auxiliary data for proportions of recent infections among newly diagnosed cases. Results are presented in Figure For each year, we generated 200 random numbers for each time point from a mixed-Poisson distribution around the predicted mean values with an over-dispersion factor to account for the extra-Poisson variation. The resulting 200To explore the possible effects of birth cohorts on annual HIV incidence over time, birth years were grouped in 10 five-year birth cohorts; in addition, men born after 1980 or men born before 1940 were grouped together. Changes in the age distribution of HIV infections over time were examined by considering "age at diagnosis" and "age at infection". Age at diagnosis was obtained directly from available data on the date of person's new HIV diagnosis and year of birth.20-24 years". Finally, "mean age at infection" was estimated from the mid-point of each birth cohort and plotted as a smooth function against "year at infection" to investigate possible non-linear associations years in 1990, to ~35 (se = 0.29) years in 2000, and ~38 (se = 0.27) years in 2007. Such a trend is suggestive of an increase over time in HIV incidence among older individuals relative to younger individuals. This is reflected by a continual increase in the average age of HIV diagnosis . The difference between the average infection and diagnosis ages is a surrogate indicator for the average time between infection and diagnosis. The difference in average ages of infection and diagnosis has decreased significantly over time, consistent with increases in HIV testing rates . CurrentHIV incidence was also estimated for each birth cohort and plotted as a smoothed function over calendar years in Figure However, this younger group subsequently contributed to a rising HIV infection trend after 1985. It is clear that the younger age groups experienced delays in the onset of HIV infections . But younger age groups also experience longer incidence levels; that is, as age decreases, progressively the duration of the peak is longer and, in fact, the first peak in incidence has now been reached for MSM born after 1970. Figures also indicate that the annual HIV incidence of new infections appears to have reached a plateau between 1995 and 2000 in all birth cohorts, but since 2000, HIV incidence has been steadily increasing in all birth cohorts.In Figure Estimates of past and current incidence of HIV are important for assessing the impact of public health prevention strategies and need to be updated regularly to describe the changing face of the epidemic. Particularly, monitoring new HIV infections among various age groups may provide one of the sources of information on the spread of HIV that can contribute to a better understanding of the HIV epidemic at the national level. Results based on age at infection are useful to assess if the average age of infection is increasing over time, whereas results based on birth cohort are important for understanding demographic trends in HIV infections. Together, they provide considerable insight into the epidemic to inform HIV prevention programmes.To our knowledge, this is the first study to investigate the impact of age and birth cohorts on an HIV epidemic by using advanced back-projection methodology.As the epidemic has matured, the primary route of HIV transmission in Australia has remained unprotected homosexual contact. Annual HIV diagnoses and the incidence of HIV infection in Australia during the 1990s fell to levels below the peak of the mid 1980s. Although this decline was seen in all age groups, it was more pronounced in homosexual men older than 30 years, with more modest reductions in age groups younger than 30 years .Using a novel adaptation of a back-projection method, we estimated that the annual incidence of HIV infections among men who have sex with men in Australia has been gradually increasing since the late 1990s, from ~500 new infections per year to 874 new infections in 2007. An increase occurred among all age groups.ping_yan@phac-aspc.gc.ca.These analyses may help in providing greater understanding of the dynamics of the HIV epidemic, based on high-quality surveillance data, and provide reasonably reliable estimates of HIV infection. Our improved methodology has allowed quantitative assessments of the HIV epidemic by birth cohorts, thus providing a sound basis for informing targeted public health policy. This method could also be easily applied to other settings by using the publicly available software written in R-language. Further technical and methodological documents are available upon request The authors declare that they have no competing interests.HW, PY and DW were responsible for the study concept and design. They also undertook the analysis and interpretation of data. HW and AM extracted the data, and HW drafted the manuscript. All authors undertook critical revision of the manuscript for important intellectual content. All authors read and approved the final manuscript.

Length of hospital stay (LOS) is a surrogate marker for patients' well-being during hospital treatment and is associated with health care costs. Identifying pretreatment factors associated with LOS in surgical patients may enable early intervention in order to reduce postoperative LOS.This cohort study enrolled 157 patients with suspected or proven gynecological cancer at a tertiary cancer centre (2004-2006). Before commencing treatment, the scored Patient Generated - Subjective Global Assessment (PG-SGA) measuring nutritional status and the Functional Assessment of Cancer Therapy-General (FACT-G) scale measuring quality of life (QOL) were completed. Clinical and demographic patient characteristics were prospectively obtained. Patients were grouped into those with prolonged LOS if their hospital stay was greater than the median LOS and those with average or below average LOS.Patients' mean age was 58 years (SD 14 years). Preoperatively, 81 (52%) patients presented with suspected benign disease/pelvic mass, 23 (15%) with suspected advanced ovarian cancer, 36 (23%) patients with suspected endometrial and 17 (11%) with cervical cancer, respectively. In univariate models prolonged LOS was associated with low serum albumin or hemoglobin, malnutrition (PG-SGA score and PG-SGA group B or C), low pretreatment FACT-G score, and suspected diagnosis of cancer. In multivariable models, PG-SGA group B or C, FACT-G score and suspected diagnosis of advanced ovarian cancer independently predicted LOS.Malnutrition, low quality of life scores and being diagnosed with advanced ovarian cancer are the major determinants of prolonged LOS amongst gynecological cancer patients. Interventions addressing malnutrition and poor QOL may decrease LOS in gynecological cancer patients. Despite significant advances in cancer therapy, in-patient hospital care remains a major expense in the treatment of patients with gynecological cancer. Reducing length of hospital stay (LOS) has the potential to decrease health care cost, risk of infections and other hospital acquired diseases, and to improve patients' quality of life (QOL). Previous studies have observed differential LOS by cancer type and stage, however, these characteristics commonly are not available before surgery, and thus are not amenable to pre-treatment interventions. Identifying modifiable risk factors at admission predicting (LOS) could lead to appropriately targeted interventions to improve the delivery of care for women with gynecological cancer. Previous research has shown that preoperative serum albumin , hemoglobin and lymphocyte status are associated with LOS and mortality in the gynecological oncology setting -4. PreopAcute malnutrition may be a further potentially amenable risk factor for LOS. Malnutrition has been found to be associated with increased risk of morbidity and mortality, complication rates such as wound infections, costs of hospitalisation, and decreased QOL in various cancer populations ,4,6-16. Gynecological cancer and/or malnutrition can have a profound impact on patients' physical function and psychosocial well-being - both important components of QOL. One common definition of QOL is that it is a subjective, multidimensional construct representing functional status, mental and social well-being as well as general health . Health-Thus, the purpose of this study was to evaluate factors available prior to initial treatment to predict LOS in patients with suspected or proven gynecological cancer.The study was conducted at the Queensland Centre for Gynecological Cancer at the Royal Brisbane and Women's Hospital, Brisbane, Australia. Patients with presumed or proven primary gynecological cancer were screened for eligibility at their preoperative visit between March 2004 and December 2006. Patients were excluded from the study if they presented with recurrent cancer, had received treatment for other cancers within the past five years, had psychological or cognitive impairments or were non-English speaking. A total of 194 patients gave informed written consent. Thirty-two study participants declined to complete the Functional Assessment of Cancer Therapy-General (FACT-G) questionnaire and five participants had to be excluded from analyses due to incomplete data. Overall, 157 women completed both the scored PG-SGA and the FACT-G questionnaire before commencing treatment. Patients' clinical and demographic characteristics including age at study entry, body mass index, serum albumin, hemoglobin, lymphocytes, co-morbidities, adverse events, surgical approach, LOS, and histopathological diagnosis and staging according to the International Federation of Gynecology and Obstetrics (FIGO) were recorded prospectively. Six women did not undergo surgery, because a surgical approach was contraindicated or chemotherapy and/or radiotherapy was initiated as the primary treatment. Pre-treatment serum albumin levels were recorded in 146 patients; hemoglobin and lymphocyte count in 153 patients and actual body weight and height for all but one patient. All pre-treatment predictive factors were collected either at the outpatient or preadmission clinic, typically one to five weeks before primary treatment was initiated. The median waiting time for surgery was two weeks for women with suspected ovarian and cervical cancers and five weeks for women with suspected benign diseases or endometrial cancer, respectively. Women were categorised according to their clinical diagnosis before surgery: pelvic mass/benign disease, suspected advanced ovarian cancer, cervical cancer or endometrial cancer. This study has been approved by The Royal Brisbane and Women's Hospital Human Research Ethics Committee (Protocol Number 2004/007) and the University of Queensland Medical Research Ethics Committee .The scored PG-SGA is a validated nutritional assessment tool for cancer patients ,16 that QOL was measured by the FACT-G questionnaire, which is a widely utilized and validated instrument . VersionDescriptive statistics were used to summarize patient characteristics and to group patients by the main outcome variable (average versus prolonged LOS). Prolonged LOS was defined as LOS of greater than five days for patients who underwent open abdominal surgery and greater than two days for patients who underwent vaginal of laparoscopic surgery. Univariate logistic regression analyses were conducted to calculate odds ratios adjusted for age and surgical approach for patients who had prolonged compared to average LOS.Variables significantly associated with LOS were then entered into a multivariable model Table .All models were adjusted for age and surgical approach . Hosmer-Lemeshow goodness-of-fit statistic assessed fit of the models. SPSS software version 16.0 Graduate Student was used for the statistical analyses.Patients' mean age was 58 years (SD 14 years). Preoperatively, 81 (52%) patients presented with suspected benign disease/pelvic mass, 23 (15%) were suspected to have advanced ovarian cancer, 36 (23%) patients to have endometrial cancer, and 17 (11%) patients to have cervical cancer. Ninety-four patients were operated using an open-abdominal, 40 patients with a laparoscopic and 17 patients with a vaginal surgical approach. Data on patients' weight, body mass index, albumin and PG-SGA have been reported in previous publications .The median LOS for all patients in the study was 5 days (range 0-43 days). In total, 75 48.1%) of the patients had prolonged LOS . Patients with PG-SGA B or C and patients with suspected advanced stage ovarian cancer were significantly more likely to have prolonger LOS compared to other patients among gynecological cancer patients. Malnutrition and low QOL were found to predict prolonged LOS independent of patients' age at diagnosis, surgical approach (laparoscopy or laparotomy), albumin and hemoglobin and suspected clinical diagnosis. Patients suspected to have stage III or IV ovarian cancer were also independently at greater risk for prolonged LOS compared to other patients.Previous studies have shown that malnutrition was associated with prolonged LOS in hospitalized patients requiring treatment for various types of cancer ,16,26-28Our findings show that LOS was not equally distributed between tumor types. Even after adjustment for age and surgical approach, 96% of all suspected advanced stage ovarian cancer patients had prolonged hospital stay, compared with only 50% of patients with endometrial cancer and 42% of patients with a pelvic mass. In our previous work we described in detail that malnutrition was almost exclusively present in ovarian cancer patients compared to other gynecologic oncology diagnoses .A previous study by Dean and colleagues found that gynecological cancer patients with two or more pre-existing co-morbidities had significantly longer LOS than those with one or no co-morbidities . In contIn this study, we found low preoperative hemoglobin and lymphocyte counts in a small number of patients and these patients were more likely to experience prolonged LOS, but this difference was no longer statistically significant in adjusted modelling. Previous studies suggested that low hemoglobin levels were related to poor survival in patients with ovarian cancer ,30, and A third biochemical marker assessed in the present study was serum albumin, generally believed to indicate the presence of chronic malnutrition. Previous studies have demonstrated an association between low serum albumin and increased postoperative complications ,34,35, aResearch conducted on QOL and nutritional status in cancer patients indicates that nutritional support may lead to better QOL ,37,38. TIn conclusion, prolonged LOS was found to be associated with low presurgical QOL and malnutrition. Strategies to reduce LOS and improve patients' well-being during hospital stay will need to address these potentially modifiable factors, particularly among women with suspected advanced ovarian cancer.The authors declare that they have no competing interests.The authors' responsibilities were as follows - AO: initiated the study; BL, SK: collected data; AO, BL, and MJ: data analysis; AO and GC: project supervision; AO, BL, SK and MJ: writing the manuscript; and all authors: revision of the manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/10/232/prepub

To assess current attitudes towards the national patient survey programme in England, establish the extent to which survey results are used and identify barriers and incentives for using them.Qualitative interviews with hospital staff responsible for implementing the patient surveys (survey leads).National Health Service (NHS) hospital organisations (trusts) in England.Twenty-four patient survey leads for NHS trusts.Perceptions of the patient surveys were mainly positive and were reported to be improving. Interviewees welcomed the surveys’ regular repetition and thought the questionnaires, survey methods and reporting of results, particularly inter-organisational benchmark charts, were of a good standard. The survey results were widely used in action planning and were thought to support organisational patient-centredness. There was variation in the extent to which trusts disseminated survey findings to patients, the public, staff and their board members. The most common barrier to using results was difficulty engaging clinicians because survey findings were not sufficiently specific to specialties, departments or wards. Limited statistical expertise and concerns that the surveys only covered a short time frame also contributed to some scepticism. Other perceived barriers included a lack of knowledge of effective interventions, and limited time and resources. Actual and potential incentives for using survey findings included giving the results higher weightings in the performance management system, financial targets, Payment by Results (PbR), Patient Choice, a patient-centred culture, leadership by senior members of the organisation, and boosting staff morale by disseminating positive survey findings.The national patient surveys are viewed positively, their repetition being an important factor in their success. The results could be used more effectively if they were more specific to smaller units. The stated aims of patient feedback programmes are normally twofold: to monitor performance and to stimulate improvements in the quality of care. These goals are not contradictory, but neither are they entirely complementary. Patient experience surveys are now widely accepted as valid indicators of healthcare performance, but their usefulness in improving the quality of care at the organisational level has not yet been systematically researched.NHS Plan.In England, the Healthcare Commission is now responsible for the National Health Service (NHS) patient experience survey programme, as set out in the –Benchmarks of trusts’ performance on each of the survey questions have been published and the results used to calculate the Healthcare Commission’s “patient focus” performance indicators. Most surveys have been repeated, so longitudinal data are available. National results published in key findings reports2–6In a number of countries, healthcare workers’ attitudes towards patient experience surveys and patient feedback reports in general have been found to be broadly positive.6There is also evidence that some healthcare workers are sceptical about the value of surveys. Criticisms include concerns that questionnaires are too lengthy, and that the surveys are not cost-effective.10The evidence that patient surveys can stimulate local quality improvements is equivocal. UK healthcare leaders claimed their NHS trust had made positive changes following from patient surveys,14The perceived barriers to using patient survey results include a lack sufficiently specific information at the level of smaller units within healthcare facilities;9Suggested ways of improving the use of survey findings include “a systematic approach to quality improvement;” giving survey results higher weightings in the performance management system;The aim of this research is to document current attitudes towards the national patient survey programme, to establish the extent to which patient survey results are currently used in NHS hospitals and to identify the drivers and barriers experienced by NHS staff in using survey results.Twenty-seven hospital organisations (NHS trusts) were selected from the 169 NHS trusts providing adult acute services that were in existence in England in spring 2006. Trusts were selected purposively, with the aim of covering a broad range of performance scores, size and geographical spread within England. The proportions of selected trusts was approximately representative of four subgroups (divided by trust size and location in London or outside London) within the total population: two of the 13 large London trusts were selected, nine of the 55 large outside London trusts, three of the 19 medium/small London trusts and 13 of the 82 medium/small outside London trusts. The selected trusts were also broadly representative of the range of performance ratings across the population. Of the 69 trusts with the highest three-star rating in the Healthcare Commission’s 2005 performance ratings, 14 were selected for inclusion; seven of the 53 two-star trusts, five of the 38 one-star trusts and one of the nine zero-star trusts were also selected.In the first quarter of 2006, in the 27 selected trusts, telephone calls were made to the person listed in Healthcare Commission records as the lead for patient surveys. Before the interview started, the interviewer checked that the contacted person had primary responsibility for responding to patient survey results and if someone else had this responsibility instead, the researcher contacted that alternative person. Semistructured interviews were conducted by one interviewer using an interview guide which was based on the reviewed literature and discussions with opinion leaders in the uses patient survey results. Interviewees were asked about their uses of the patient surveys; their views on the quality of the questionnaires, survey methods and reporting of results; and factors that facilitated or hindered their using survey results. Participants had an opportunity to review and correct the interview notes.The verified interview notes were manually coded and categorised, and initial themes were identified by the interviewer. After discussion between both researchers, the themes were modified and reduced by merging them.Interviews were successfully completed at 24 of the 27 trusts. The three non-participating trusts were all medium/small outside London; two of them had two stars, and one had one star. Efforts to arrange interviews with people from the non-responding trusts were stopped after at least five attempts had been made to identify an appropriate staff member, but none of those trusts actively refused to participate in the research, or gave a reason for not wanting to participate.Job titles of interviewees varied, but the most common were Director of Nursing, Director of Patient and Public Involvement, Quality Development Manager and Head of Clinical Governance. Most interviewees had been involved with the surveys since 2001.About half of the respondents noted that the national patient surveys provided reliable, credible and fair benchmarks against other NHS trusts, and that survey results strengthened the validity and usefulness of other information on patient experience: “The results do reinforce where we suspect there are problems.”The fact that the surveys were repeated regularly was welcomed because it facilitated longitudinal comparisons and meant they were well-established as performance measures: “People have taken notice since it’s clear that it’s a rolling programme and we will be able to measure whether we’ve made changes.”Almost all interviewees said that the surveys were more widely accepted now than when they first started, and some said that their own attitudes had become more positive: “It would be awful if the surveys were stopped now. It takes 2–5 years for a new initiative to be accepted. The surveys are really starting to get accepted now.”There were concerns that the surveys were not good value for money. Six interviewees said that they did not provide new information, but just confirmed what was already known: “There are rarely any surprises with the patient survey.”Almost all interviewees said they used patient survey results as a basis for action plans aimed at improving the quality of care and for measuring the success of those plans. About a quarter of them also said that the implementation of action plans was now part of some individuals’ performance assessment.However, four interviewees said that they had learned that they needed to take a more directive approach to implementing action plans: “Just giving people the results doesn’t mean they will take action. They need direction to make them do things and the frameworks to help them.”The generally positive surveys findings were mentioned by five interviewees as being helpful in boosting staff morale.Although particular quality improvements made by trusts were not explored in depth in this research, some mentioned innovative ways in which they had used patient experience information. For example, one interviewee said that the patient survey highlighted a problem with noise at night, so they had asked patients to keep records of the source of disturbing noises. As a result, floor coverings were changed, quieter waste bins were installed, and, where possible, patients admitted overnight were put into a separate area. Another trust’s patient survey results had prompted them to recognise that their provision of discharge information was patchy, so they produced comprehensive discharge information packs, which were given to patients on admission.Fifteen respondents said they found the patients’ comments written on questionnaires particularly interesting and useful for getting clinicians’ attention: “Reading through the comments, even though our percentage scores are OK, you think, ‘That shouldn’t have happened.’”There was also support for the more qualitative feedback methods, although it was recognised that these were more labour-intensive and could be impractical for gathering systematic feedback. The most popular sources were complaints, prioritised by nine respondents, “Complaints really tell you how it is,” and PALS by six, followed by the national patient surveys, which were given the greatest weight by five interviewees.Comments cards and suggestion boxes were thought useful because they offered immediate feedback. The robust nature of the patient surveys was cited as an important factor: “Without a doubt, the national patient surveys are given the most weight. We have nothing else that is so sophisticated and would give us such useful data.”Six respondents commented on the importance of looking at different sources of patient experience information concurrently. The surveys were seen as adding harder evidence to “soft” information, such as comments or complaints, while they also added patient experience information to “hard” clinical or routine data.Fourteen respondents said the quality of the questionnaires was good, and three also mentioned that they used the national surveys as models for constructing their own local questionnaires, rather than designing their own surveys: “Everyone thinks they can design a questionnaire, so it’s cut down on badly prepared surveys.”The most common concern about questionnaires, mentioned by five respondents, was that they were too long.Almost all respondents were confident in the rigour of the survey methods. Some were concerned that the sample size was too small, but most of those concerns seemed to be based on a misunderstanding that sample size should necessarily be proportionate to population size: “I often find that clinicians will say that it isn’t representative, as the numbers are very small in comparison to the numbers of patients we treat.”Results were communicated to patients and the public through posters and leaflets in public areas, press releases, annual reports, presentations to patient and public involvement groups and articles in the trust’s magazines. The most common way of disseminating survey results to staff were the organisation’s intranet, newsletters, meetings at which approved contractors presented results, teaching sessions and special events designed to engage staff in forward planning.In most organisations, results were sent to senior staff, who were expected to cascade results down to junior staff. It was recognised that some groups of staff, such as doctors or more junior staff, were less likely to receive survey results: “If I could change anything … I would be better at sharing results and information about what we’re doing in response to them.”Some interviewees said their boards did not receive patient survey results, some sent a summary report to the board, and in others the trust board received detailed information about the survey results in the form of both written materials and presentations.Interviewees noted a number of factors which affected their use of the patient surveys in positive or negative ways, and several had tried to implement local solutions or suggested improvements to the national programme.The most commonly cited barrier to using survey results was that the feedback was not specific enough to be salient to those who needed to act on it. That is, clinicians, particularly doctors, were interested mainly in their own sphere of influence: “The main criticism we have from doctors is ‘Make it specific to the area I work in and I will take notice of it.’”For the 2006 inpatient survey, trusts were required to include information on patient’s specialties in the data they submitted to the Healthcare Commission, so we asked whether they planned to analyse their results by specialty. Some interviewees had already done this, or planned to do it, while others liked the idea but had not yet thought of it.A few respondents mentioned that clinical staff questioned the validity of the surveys. One comment underlined this view: “Sometimes doctors and nurses question their validity but some people would rather look at anything but the issues raised by the questions.”Several respondents said that there was variation among clinicians in their receptiveness to survey results. Some found that nurses were easier to engage than doctors. Several had tried ways of improving clinician engagement, including seeking opportunities to present the results to clinicians. Training and induction programmes were used as opportunities to share survey results.The importance of taking account of patients’ views was a common theme, and there was a sense that this was still a fairly new approach to planning services, and that a culture change was under way. One of the most commonly cited reasons for using patient survey results was that the culture of the organisation, and their Chief Executive, supported it.Delivering the NHS Plan.National Health Service so that’s exactly what we should be doing: sharing best practice.”Some interviewees said they found it difficult to identify the reasons behind their successes or failures, or in knowing what to do to make improvements. The importance of spreading best practice in service improvement is noted in However, despite complaints that they did not know what to do to make improvements, several interviewees were not particularly enthusiastic about proposed strategies for identifying best practice. On the other hand, a surprising number of others, who said they had not thought of looking at other organisations’ performance, or did not know how to do it, said it would be a good idea.Lack of time and resources, and competing demands on their time were mentioned by seven interviewees as inhibiting factors in implementing quality improvements.A number of respondents thought external incentives, particularly the annual published performance ratings, could be important stimuli to increasing the focus on patient surveys: “If [the surveys] were heavily weighted in the annual performance ratings, they would get more attention.”Six said financial incentives, including PbR, were important drivers for change. Targets evoked mixed feelings, often within the same individuals, who tended to say they did not like targets, and were concerned that they diverted resources away from important services, but conceded that they were strong drivers for change.The Patient Choice AgendaOpinions on the Healthcare Commission’s presentation of published results were almost universally positive, particularly regarding the benchmark “traffic light” charts, which show in three-colour bands whether their trust’s score on each question falls within the best 20% of trusts, the worst 20% or the middle 60%: “With the simple traffic lights, you can see quite clearly where you are and where you should be.”Most respondents were interested both in comparing their own trust’s performance with previous years, and in comparing their current performance with other trusts, but there was slightly more interest in their own organisation’s change over time. Many commented that the surveys have become more useful now that year-on-year comparisons are possible: “We are interested to see if our actions have been effective, and if any areas have gone up or down.”One person commented that the prompt reporting of the patient survey results was unlike most other centrally managed audits, but another said the time between the survey being carried out and the results being published was too long: “If the benchmarks came out earlier, it would help us to act on them more immediately.”Related to this issue were concerns that the surveys covered only a short and very specific time frame, and that fluctuations in the quality of care might not therefore be adequately reflected in the results: “It’s a pretty blunt instrument; it only captures a moment in time: a small number of people’s experiences.”Data were not specific enough to wards, departments or specialtiesLack of time and resourcesNot knowing what to do about the survey resultsLack of statistical expertiseSurvey results made an important contribution to the organisation’s performance ratingsA patient-centred organisational cultureDetailed and clear benchmark informationRepetition of the same surveys, facilitating longitudinal comparisonsRepeat the same surveys at regular intervalsRun regular workshops to facilitate networking and educate survey leadsDisseminate information about the basic statistics relevant to patient surveysGather data on smaller units and/or encourage organisations to analyse their existing results by smaller unitsGive patient surveys prominence in performance-management systemsContinue to publish benchmark charts in a “traffic light” formatEnsure that results are published quickly after completion of surveysEnsure that a section for patient comments is included in questionnairesConsider collecting patient survey data at more regular intervalsPatient survey results were judged to be accurate and robust indicators of patient experiences. Almost all respondents said attitudes had become more positive since the survey programme began. Interviewees were complimentary about the standard of the questionnaires and the survey methods, and particularly liked the patients’ written comments. Consistent with previous UK research,Consistent with previous research, the most common barrier to using survey findings was that results were not specific enough to smaller units within the organisation. There were also suggestions that more continuous feedback, rather than an annual “snapshot,” would be useful. A lack of knowledge of effective interventions and lack of time were also important barriers. There was some scepticism, particularly among clinicians, about the validity of the survey results. Sample sizes were a concern, but there were some statistical misunderstandings. The low priority given to using survey results within the NHS was thought to be a barrier to their use.Many of the findings on incentives for using the results also concurred with previous research. Several respondents said that targets, the surveys’ weightings in performance ratings and financial incentives were, or would be, important in strengthening their impact, but they also said that they did not like targets. On the other hand, many mentioned internal drivers, such as a desire to deliver high-quality patient-centred care, as important in stimulating work with patient surveys. The patient surveys, along with leadership by senior managers, were thought to be important promoters of a patient-centred culture. Almost all respondents were positive about the reporting by the Healthcare Commission of inter-organisational benchmarks for each NHS trust on each survey question. This detailed information was of particular interest for making longitudinal within-trust comparisons.We did not replicate a previous finding that the time lag between survey administration and reporting is a barrier to their use.It was interesting that most of those who had not thought of analysing their own survey results by smaller units were positive about the idea. Similarly, identifying high scorers so that lessons could be learned from them was a new idea for many, some of whom thought it was a good idea. This suggests that disseminating knowledge about the survey methods and better networking arrangements for survey leads would be beneficial.The non-probablility sampling method used in this study, and its relatively small scale, meant that it was not possible to ensure that every subgroup of trust type was included in the sample. However, the sampled trusts were broadly representative of the population in their size, performance ratings and location within or outside London. Furthermore, it would have been impractical to employ a probability sampling method, given the large number of potential confounding organisational variables, the lack of information about the influence of organisational variables on attitudes towards patient surveys and the qualitative nature of the study.It is possible that employees in trusts with more positive attitudes towards the surveys were more willing to participate, and this could have introduced a self-selection bias. This is perhaps why all of the selected three-star trusts participated. However, to minimise bias, once a trust had been selected, considerable efforts were made to obtain an interview, and the resulting response rate was high.Many of the attitudes and beliefs about the current national patient survey programme in England are positive, one of its key strengths being the surveys’ regular repetition. This research highlighted a number of issues that are important for the success of patient survey programmes, including the need to make results specific to smaller units, strengthening the survey results’ profile in performance assessments and facilitating networking for those involved with the surveys.

The dihedral angles between the central benzene ring and the three pendant phenoxy rings are 76.71 (14), 67.81 (13) and 70.67 (16)°. In the crystal structure, one bmph is disordered over two sites in a 0.611 (5):0.389 (5) ratio. Some of the methyl H atoms are equally disordered over two sets of sites. Inter­molecular C—H⋯N hydrogen bonding is present in the crystal structure.In the title compound, C Å b = 13.524 (3) Å c = 13.550 (3) Å α = 83.913 (4)°β = 80.629 (4)°γ = 84.766 (4)°V = 2141.4 (9) Å3 Z = 2 Kα radiationMo −1 μ = 0.08 mmT = 295 (2) K 0.23 × 0.19 × 0.18 mm Bruker SMART APEXII CCD area-detector diffractometerAbsorption correction: none16527 measured reflections7926 independent reflectionsI > 2σ(I)3519 reflections with R int = 0.035 R[F 2 > 2σ(F 2)] = 0.057 wR(F 2) = 0.186 S = 1.01 7926 reflections552 parameters60 restraintsH-atom parameters constrainedmax = 0.15 e Å−3 Δρmin = −0.28 e Å−3 Δρ APEX2 used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008ORTEP-3 for Windows (Farrugia, 1997WinGX (Farrugia, 1999Data collection: 10.1107/S1600536808028845/xu2438sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536808028845/xu2438Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

The length of the Csp 2—S bond is significantly shorter than that of the Csp 3—S bond. The crystal structure is stabilized by inter­molecular N—H⋯O, C—H⋯O and C—H⋯N hydrogen bonding, and C—H⋯π inter­actions.In the title compound, C Å b = 4.6736 (9) Å c = 11.931 (2) Å V = 1477.3 (5) Å3 Z = 4 Kα radiationMo −1 μ = 0.40 mmT = 113 K 0.30 × 0.26 × 0.20 mm Rigaku Saturn diffractometerSADABS; Sheldrick, 1996T min = 0.890, T max = 0.925Absorption correction: multi-scan (8870 measured reflections2573 independent reflectionsI > 2σ(I)2445 reflections with R int = 0.031 R[F 2 > 2σ(F 2)] = 0.024 wR(F 2) = 0.061 S = 1.07 2573 reflections187 parameters2 restraintsH atoms treated by a mixture of independent and constrained refinementmax = 0.17 e Å−3 Δρmin = −0.20 e Å−3 ΔρAbsolute structure: Flack 1983, 1199 FrFlack parameter: 0.00 (5) CrystalClear used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536809011520/at2755sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809011520/at2755Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

The number of newborn boys was higher than that of girls in the Czech Republic each month from 1950 to 2005. The only exception was November 1986, when the number of newborn boys was significantly reduced. This has been explained by a selective negative impact of the Chernobyl accident in April 1986 on male fetuses during the third month of their prenatal development.The first and most radioactive cloud passed over the Czech Republic during 30 April–1 May 1986. Concurrent rainfall multiplied the radioactivity by up to > 10,000-fold in specific regions. We verified a hypothesis that the decrease in the male birth fraction in November 1986 correlated with the level of radiation in eight Czech regions after the Chernobyl disaster.We found a relationship between the level of radiation and the decrease in the number of newborn boys. The number of newborn boys was decreased in the six eastern regions where the radiation was strongly increased due to rain that accompanied the radioactive cloud. In contrast, the number of newborn boys was not reduced in the two western regions where the radioactivity was markedly lower.131I probably played the most important role because of its up-take during primary saturation of fetal thyroid by iodine, which accompanies the onset of the gland function in 3-month-old fetuses.A negative impact of radiation on the prenatal population was manifested as a selective loss of newborn boys in November 1986. This loss correlated with level of radioactivity. The However, these authors did not exclude that the observed excess could be a random or temporary phenomenon. Increased incidence of thyroid diseases have been found in children in Hungary (The effect of relatively low doses of radiation from Chernobyl on pregnancy outcome is still under discussion in Europe. After the Chernobyl accident (26 April 1986), an increase in spontaneous abortions was reported not only in the adjacent area but also Hungary . In the Hungary .We have shown that the impact of the Chernobyl disaster might also be manifested by a decrease in the male birth fraction in the Czech Republic in November 1986. There was a greater number of newborn boys (51.42%) than girls (48.58%) by 342.1 (2.83%), on average, in 599 of 600 months during the last 50 years. The only exception was November 1986, when the sex ratio reversed: Significantly fewer boys were born (49.35%) than girls (50.65%). We have estimated the number of missing boys to be 467 .Male fetuses are more vulnerable to prenatal damage by environmental stress . Thus, tRainfall can strongly increase radiation on the ground . The mosWe used official national demographic data registered by the Czech Statistical Office in Prague during 1950–2006. We first analyzed the monthly birth fractions of boys and girls (during 1950–1999) and the numbers of spontaneous abortions (during 1970–1999) for the whole Czech Republic. We then evaluated the numbers of newborn boys and girls for each of the eight Czech regions in each month during 1986 .We calculated the mean numbers of newborn boys and girls and the mean difference in their numbers (number of boys minus number of girls) for 11 months of 1986 and then for November alone.To determine the number of missing newborn boys in November, we compared the difference between the numbers of newborn boys and girls in November 1986 with the mean difference between the numbers of newborn boys and girls during the rest of the year. The number of missing male births was then expressed as a percentage of the overall male birth rate in November 1986 in each of the individual regions. This method allowed the comparison of regions that have different birth rates .We assumed that the children born in November 1986 were at 8–12 weeks of gestation at the time of the highest radioactive fallout at the end of April and beginning of May 1986 . We compStatistical significance of the number of newborn boys and girls was tested using the chi-square test and confidence interval of the mean .We found two trends in the monthly birth rates during each year. First, in each year from 1950 to 1999, the birth rate gradually increased from December to reach its annual maximum in April. Then it gradually fell down to its annual minimum in November, with only one small increase in value in September (corresponding to fertilization in late December). Compared with the yearly mean birth rate and its confidence interval, we found a statistically significant baby boom in March, April, May, and June, and a significant decrease in October, November, and December.The second trend was that more boys than girls were born each month ; the onlThe number of spontaneous abortions showed regular changes each year from 1970 to 1999. For each year, the lowest numbers occurred in spring , and the highest numbers were recorded in winter and in autumn . We did not find a marked increase in spontaneous abortions during 1986 .The radioactivity resulted from passage of the first radioactive cloud and was dramatically increased at specific places due to rainfall. The first and most radioactive cloud crossed the eastern part of the Czech Republic on 30 April 1986 Figure . The mos137Cs reflected well the crossing passage of the radioactive cloud and rainfall intensity and 14% fewer boys were born, respectively , more boys were born than girls . The reaA higher male birth ratio is considered a sensitive indicator of health in human reproduction . In the A decrease in the male birth ratio can result either from a change in the primarily determined sex ratio during conception or from a decrease in survival of males during the prenatal period. A change in the newborn sex ratio has been reported after paternal exposure to a harmful environmental factor, which resulted in a change in the sex ratio during conception e.g., , 2002. HThe missing newborn boys in November 1986 were not born prematurely because the numbers of male births in September and October 1986 were not increased. Neither did the number of newborn girls increase in November 1986 . TherefoWe evaluated data from the official Czech statistical monitoring system. Compared with other years, we did not find a marked change in spontaneous abortions during 1986 . HoweverBirth represents a well-defined termination point in the overwhelming majority of pregnancies. The entire sample of prospective newborns follows a similar schedule, being born at a similar time. This is why the newborn data are robust and reliable. In contrast, there is no predictable fixed term for a spontaneous abortion, so we cannot expect that the population of fetuses damaged during the third month of prenatal development would suIn the regions affected by the passage of the radioactive cloud accompanied by rain, the male birth ratio was much lower than in the regions that did not experience rainfall. The most affected area was the eastern part of the Czech Republic (North and South Moravia). In the western Czech Republic, the number of missing boys gradually decreased. At places where the strong radioactive cloud passed and rain simultaneously fell, the radioactivity of all measured radionuclides increased suddenly Figure . A simila) the death of the embryo or fetus; b) malformations, changes in growth rate, or other functional changes; c) mental retardation; and d) the induction of malignancies including leukemia was similar for everyone in our country because of food distribution by companies.After the Chernobyl disaster, thyroid doses of ngestion . Rain dr0 kBq/m2 . At that131I in the Czech Republic after Chernobyl for adults (1.7 mGy) and for children 1 year of age (11.7 mGy). We can assume that the fetal doses were much higher. When the fetal thyroid is just becoming functional, its iodine intake is maximal. The critical period of structural maturation of the fetal thyroid gland and onset of its function is the third month of prenatal development. The gland starts to synthesize thyroid hormones, which requires the presence of iodine. Therefore, iodine is rapidly absorbed by the thyroid gland, including 131I . The Czech Republic has a mild deficiency of iodine; thus the population suffers from a mild iodine deficiency. This undoubtedly contributed to the fact that Czech citizens suffered the greatest contamination of their thyroid glands by 131I of all 22 European countries after the Chernobyl accident can substantially reduce thyroid uptake of and irradiation by internalized radioiodine. Potassium iodide administered up 48 hr before thyroid . In Pola thyroid .After the Chernobyl accident, the (former) Soviet Union and other countries adopted preventive programs aimed to overload the thyroid gland with stable iodine (potassium iodide) as soon as possible in case of another atomic power crash or a terrorist attack. Recently, the Israeli government decided to distribute potassium iodide tablets to citizens living near the two nuclear research centers in Israel . Special

High rates of esophageal cancer (EC) are found in people of the Henan Taihang Mountain, Fujian Minnan, and Chaoshan regions of China. Historical records describe great waves of populations migrating from north-central China (the Henan and Shanxi Hans) through coastal Fujian Province to the Chaoshan plain. Although these regions are geographically distant, we hypothesized that EC high-risk populations in these three areas could share a common ancestry. Accordingly, we used 16 East Asian-specific Y-chromosome biallelic markers and six Y-chromosome short tandem repeat (Y-STR) loci to infer the origin of the EC high-risk Chaoshan population (CSP) and the genetic relationship between the CSP and the EC high-risk Henan Taihang Mountain population (HTMP) and Fujian population (FJP). The predominant haplogroups in these three populations are O3*, O3e*, and O3e1, with no significant difference between the populations in the frequency of these genotypes. Frequency distribution and principal component analysis revealed that the CSP is closely related to the HTMP and FJP, even though the former is geographically nearer to other populations (Guangfu and Hakka clans). The FJP is between the CSP and HTMP in the principal component plot. The CSP, FJP and HTMP are more closely related to Chinese Hans than to minorities, except Manchu Chinese, and are descendants of Sino-Tibetans, not Baiyues. Correlation analysis, hierarchical clustering analysis, and phylogenetic analysis (neighbor-joining tree) all support close genetic relatedness among the CSP, FJP and HTMP. The network for haplogroup O3 showed that the HTMP have highest STR haplotype diversity, suggesting that the HTMP may be a progenitor population for the CSP and FJP. These findings support the potentially important role of shared ancestry in understanding more about the genetic susceptibility in EC etiology in high-risk populations and have implications for determining the molecular basis of this disease. The non-recombining portion of the Y chromosome (NRY) has unique characteristics, including paternal inheritance, absence of recombination at meiosis, and a relatively low probability of recurrent mutations, thus endowing it with population- and area-specific polymorphisms. Thus, NRY is particularly useful for the study of human evolution and population genetics. Two types of polymorphisms exist on the NRY: single nucleotide polymorphisms (SNPs) and short tandem repeat (STR) loci, each with different mutation rates and mechanisms. Accordingly, combined analysis using these 2 types of polymorphic markers increases the power of the NRY for use in tracing human evolution as well as migration through different geographic locales and time scales, and therefore could also be effective in depicting the paternal structures of populations.Indeed, in 1999, Su et al. Esophageal cancer (EC) is one of the most common fatal cancers worldwide The geographies of south-littoral (Chaoshan and Fujian areas) and north-central China (Henan and Shanxi) are distinct, but populations within these regions share a high risk of EC Therefore, we hypothesized that these three EC high-risk populations may be genetically related. To test our hypothesis of common ancestry, we analyzed 16 East Asian-specific biallelic markers X2 = 4.213, p = 0.122). These results provide evidence for genetic affinity between these three EC high-risk populations. O*, O1*, O2a*, and O2a1, the four common haplogroups in the southern East Asians, were more frequent in the CSP and HTMP than in the FJP . The C*, D1, and F* haplogroups were more common in the northern than southern group, and their combined frequencies were significantly lower in the CSP than in the other two . These results support the hypothesis of gene flow between the HTMP, FJP, and CSP.The haplogroup frequencies of the three EC high-risk populations were based on Y-SNP typing. As shown in PC plots of Y-SNP and Y-STR frequencies are shown in To further elucidate the relationship between populations, we performed correlation analysis based on Y-SNP haplogroup and Y-STR haplotype frequencies . BecauseTo delineate the genetic relationship among the three EC high-risk populations and populations based on other language families, we performed a further principal component analysis using data, provided by the State Key Laboratory of Genetic Engineering and Center for Anthropological Studies , which include Y-SNP data for 64 Chinese populations belonging to the 5 language families: Sino-Tibetan, Hmong-Mien, Daic (Baiyue), Austronesian, and Austroasiatic.The Y-chromosome haplogroup profiles identified in these populations were treated as input vectors for PC analysis. The cumulative contribution of PC1 and PC2 accounted for 54.85% of the total variance. A PC dot plot was drawn with values for PC1 and PC2 as the X and Y axes, respectively. As shown in P<0.001). Analysis of PC1 showed that the number of negatively correlated haplogroups, despite their weak correlations, was larger than that of the positive groups. O3e* is the only haplogroup with a significantly positive correlation with PC1 . For PC2, the number of positively and negatively correlated haplogroups was similar. O2a* and O1 represent the southern aboriginal haplogroups in the East Asian population and O3e* is probably a northern haplogroup. As shown in Correlation analysis was carried out to seek the origin of each PC . PC1 shoTo further elucidate the affinity among the three EC high-risk populations and other Chinese populations, hierarchical cluster analysis was carried out with average linkage (between groups) based on Y-SNP data. To illustrate the cluster of the three high-risk populations and its relationship with other Hans, Baiyue, and Hmong-Mien groups, we included 20 Chinese Hans To further investigate the genetic relationships between the three EC high-risk populations, Rst distances between pairs of populations were calculated on the basis of seven Y-STRs by use of Alrequin 3.1 software. Six additional Chinese populations were included in this analysis: Zhejiang www.fluxus-engineering.com) based on all of haplogroup O3 individuals for analyzing the relationship among CSP, FJP and HTMP. As shown in The highest haplogroup frequency shared by the CSP, FJP and HTMP was haplogroup O3. The network for haplogroup O3 was further constructed using Network 4.516 software the Baiyue populations formed the earliest settlement in modern history. Before 2200 BC, one branch of the Baiyue population—the Minyue—was the main group living in the Chaoshan littoral areas. The north-to-south strategic expansion started by Emperor Qin Shi Huang initiated large southward migrations of central China Hans from 214 BC onward The incidence and mortality rate for EC is very high in the CSP, FJP, and HTMP areas. We propose that the Chaoshan littoral region is an EC high-risk area because of the genetic background of the CSP and FJP shared with those in north-central China. The ancestors of the EC high-risk CSP may have derived from the EC high-risk HTMP via the FJP. This study provides genetic evidence to support this hypothesisIn general, populations sharing similar patterns of haplogroup distribution are likely to have a relatively close genetic relationship. In this study, the three EC high-risk populations resemble one another in distribution of haplogroups O3*, O3e* and O3e1 , which sAs historically recorded 2 millennia ago, southern China was originally inhabited by the southern natives, including those speaking Daic (Baiyue), Austro-Asiatic, and Hmong-Mien languages Although we used two types of Y-chromosome polymorphic markers and demonstrated consistent results from multiple analyses, populations from other EC high-risk areas were not included in this study, so we cannot ascertain whether all the EC high-risk populations share a common genetic background. To further explore this aspect, a large-scale study of EC high-risk populations is necessary.In summary, the patrilineal genetic structure of the EC high-risk CSP, HTMP, and FJP suggests an origin in genetic background of the EC high-risk CSP. The three EC high-risk populations in this study appear to share a similar patrilineal genetic background that may explain, at least in part, the high incidence of EC in these areas in China. The extent to which other factors such as environment and customs may contribute to the high incidence of EC remains to be explored.Blood samples of 211 unrelated healthy males were collected from the the three EC high-risk areas in China during 2002 to 2004; 89 samples were from the Chaoshan area, 48 from the Henan Taihang mountain area and 74 from the Fujian area (Minnan area). All individuals gave their informed consent before being included in the study. The study was approved by the ethical review committees of the Medical College of Shantou University. Genomic DNA was extracted from whole blood by standard phenol/chloroform methods Three strategies were used to type Y-SNPs and Y-STRs. SNPs without length changes (base substitutions) were genotyped by a PCR-based restriction fragment length polymorphism (PCR-RFLP) method and southern East Asian populations (SEAPs) according to their geographic locations. The Yangtze River was used as the geographic border to separate the NEAPs and SEAPs; NEAPs were further divided into northern Hans (NHs) and northern minority nationalities (NMNs), and SEAPs were defined as southern Hans (SHs) and southern minority nationalities (SMNs). Additional Y-SNP data allowed for dividing the major Chinese Han populations into 2 groups with Y-STR data from individuals of the EC high risk CSP, FJP and HTMP based on Y-SNP information. In the network map, individuals with the same mutations of Y-STRs were present in the same node and one node can generate other nodes below due to gradual Y-STR mutations.STRs can infer minute genetic diversity within a haplogroup in different populations, so the network was constructed using Network 4.516 software (

The exploration of quantitative variation in complex traits such as gene expression and drug response in human populations has become one of the major priorities for medical genetics. The International HapMap Project provides a key resource of genotypic data on human lymphoblastoid cell lines derived from four major world populations of European, African, Chinese and Japanese ancestry for researchers to associate with various phenotypic data to find genes affecting health, disease and response to drugs. Recent progress in dissecting genetic contribution to natural variation in gene expression within and among human populations and variation in drug response are two examples in which researchers have utilized the HapMap resource. The HapMap Project provides new insights into the human genome and has applicability to pharmacogenomics studies leading to personalized medicine. Phenotypic variation provides the raw materials for evolution by natural selection. Genetic variation together with interaction with non-genetic factors is the underlying driving force of the phenotypic changes . In the The exploration of quantitative variation in human populations has become one of the major priorities for medical genetics. The successful identification of variants that contribute to complex traits such as gene expression and drug response is highly dependent on reliable assays and genetic maps. In this review, we briefly introduce the publicly available HapMap resource followed by a discussion of the recent progress in two areas significantly benefited from the HapMap resource: gene expression variation studies and pharmacogenomic studies. This resource is providing new insights into the human genome and cellular make-up and its impact on our understanding of the molecular basis of variable response to drugs and regulation of gene expression. We also discuss the advantages and limitations of the HapMap resource.Four populations were selected for inclusion in the International HapMap Project : 30 trioThe HapMap web site is the pcis eQTLs when summarizing gene expression (Gene expression data using different microarray platforms have been made public through Gene Expression Omnibus (GEO) for the four populations in the HapMap Project . Althougis eQTLs . A recenpression .Other phenotypic data such as cell growth inhibition and/or apoptosis after drug treatment and drug metabolizing enzyme activity are being generated by various laboratories that use the HapMap cell lines as experimental models . PublishGene expression as a complex trait or phenotype is believed to be a composite reflection of multiple genetic and non-genetic factors and the genetic contribution is consequently often difficult to characterize . Understcis-) to the genes of interest was found to be more abundant and more stable than those distal and (trans-) across statistical methodologies LCLs including some HapMap samples examined ~2500 expressed genes for natural variation in gene expression and identified genes whose transcript levels differed greatly among unrelated individuals . They aldologies . Impressdologies , Cheung dologies . Recentlariation .cis determinants, they found most of the variation is due to allele frequency differences at cis-linked regulators, suggesting that specific genetic variation among populations contributes appreciably to differences in gene expression phenotypes is also likely to play an important role in regulating gene expression and generating variation in mRNA and protein isoforms. It has been estimated that between one-third and two-thirds of all human genes undergo AS and the It has been especially difficult to dissect genetic contribution to common, polygenic diseases as well as other clinical phenotypes such as drug response in which multiple genetic and environmental factors may interact with each other. It is now widely accepted that association studies offer greater statistical power over linkage in detecting genetic effects underlying these complex traits when the causative variant is common in the population . Besides50 (the drug concentration resulting in 50% cell growth inhibition) values for the four drugs for both the YRI and CEU samples. They also reported drug response differences between the two populations for two of the drugs they tested as well as a significant difference between females and males in the YRI samples for the two platinating agents. Differences in sensitivity to drugs may be explained, to some extent, by differences in gene expression between males and females polymorphism could be identified as predicting TPMT phenotype . Howevera priori knowledge, as well as more directed studies using a candidate gene approach. The HapMap samples provide an in vitro model for studies of the major world populations, i.e. European, African and Asian (including Chinese and Japanese). Another advantage to using these samples in pharmacogenomic studies of drug targets is that a cellular approach avoids the complexities of in vivo pharmacokinetic variability. Thus, genetic variation important in variation in pharmacodynamic effects can be teased out. Furthermore, such in vitro studies are less expensive and require less time than similar studies in human subjects, which would also need to consider the potential risks of the drugs being tested. Chemotherapy, for example, is associated with severe toxicity and therefore cannot be given to unaffected family members for genetic studies. A number of tools and techniques are now available to increase the ease of utilizing the HapMap resource, including tools for viewing and analyzing haplotype and LD data, identification of optimal sets of haplotype tagging SNPs, drawing links between associated SNPs and putative causal alleles or simply viewing LD and haplotypes across a gene or region of interest that affect complex traits.Clearly, recent studies using the HapMap resource have shown its applicability to detect common genetic variants important for variation in complex traits or phenotypes such as development of common diseases and the

Chemical-in-plug assays are commonly used to study bacterial chemotaxis, sometimes in the absence of stringent controls.Shewanella oneidensis and Helicobacter pylori) show apparent zones of accumulation or clearing around test plugs containing potential attractants or repellents, respectively.We report that non-chemotactic and non-motile mutants in two distinct bacterial species (Our results suggest that the chemical-in-plug assay should be used with caution, that non-motile or non-chemotactic mutants should be employed as controls, and that results should be confirmed with other types of assays. Escherichia coli as the model organism, and the assay has since been used to study behavioral responses in an extensive range of bacteria including Bdellovibrio bacteriovorus . No cleH. pylori mutants defective for these processes in our assay. The non-motile H. pylori mutant used has the motB gene deleted. The MotB protein is a motor protein required for flagellar rotation; mutants lacking it are flagellated but the flagella cannot turn. This mutant has been well characterized . Some sy assays ,26, but The authors declare that they have no competing interests.JI, ACG, MJW and KMO designed the experiments and interpreted the data. JI and ACG performed the experiments. MJW and KMO wrote the manuscript. All authors read and approved the final manuscript.

This can be achieved if protein phosphatase activity promoting CaMKII dephosphorylation activates at lower Ca2+ levels than kinase activity. Finally, it is shown that the CaMKII system can qualitatively reproduce results of plasticity outcomes in response to spike-timing dependent plasticity (STDP) and presynaptic stimulation protocols. This shows that the CaMKII protein network can account for both induction, through LTP/LTD-like transitions, and storage, due to its bistability, of synaptic changes.The calcium/calmodulin-dependent protein kinase II (CaMKII) plays a key role in the induction of long-term postsynaptic modifications following calcium entry. Experiments suggest that these long-term synaptic changes are all-or-none switch-like events between discrete states. The biochemical network involving CaMKII and its regulating protein signaling cascade has been hypothesized to durably maintain the evoked synaptic state in the form of a bistable switch. However, it is still unclear whether experimental LTP/LTD protocols lead to corresponding transitions between the two states in realistic models of such a network. We present a detailed biochemical model of the CaMKII autophosphorylation and the protein signaling cascade governing the CaMKII dephosphorylation. As previously shown, two stable states of the CaMKII phosphorylation level exist at resting intracellular calcium concentration, and high calcium transients can switch the system from the weakly phosphorylated (DOWN) to the highly phosphorylated (UP) state of the CaMKII (similar to a LTP event). We show here that increased CaMKII dephosphorylation activity at intermediate Ca ., a low state, or “switched off”, and a high state, or “switched on”. LTP would correspond to switching on the synapse and LTD to switching off. We propose a realistic biochemical model of protein–protein interactions which exhibits two stable states. We then investigate conditions under which the model exhibits transitions between the two stable states. We show that experimental stimulation protocols known to evoke LTP and LTD lead to corresponding transitions in the model. This work supports the idea that the investigated intracellular protein network has a role in both induction and storage of synaptic changes, and hence in learning and memory storage.Learning and memory have been hypothesized to occur thanks to synaptic modifications. The efficacy of synaptic transmission has been shown to change as a function of correlated activity between presynaptic and postsynaptic neurons. Long-lasting synaptic modifications can occur in both directions (long-term potentiation (LTP) and long-term depression (LTD)). Recent experiments suggest that these synaptic changes are all-or-none switch-like changes. This would mean that only two stable states of synaptic transmission efficacy exist, i.e Synaptic plasticity is thought to underlie learning and memory, but the mechanisms by which changes in synaptic efficacy are induced and maintained over time are still unclear. Numerous experiments have shown how synaptic efficacy can be increased or decreased by spike timing of presynaptic and postsynaptic neurons ,2, presy2+/calmodulin binding and is prolonged beyond fast-decaying calcium transients by its autophosphorylation . I. Iand int on LTD ,75,90,94t on LTD –97 is coCalcium binding to calmodulin. Calmodulin contains four calcium binding sites, two at the C- and two at the N-terminal domain. Calcium binding happens in a cooperative manner in each one of these pairs = 1.0 mM [sNMDA obeys the same types of equations as s and x of the AMPA current (τNMDA = 80 ms and ≈8 ms).The voltage dependence is controlled by the extracellular magnesium concentration [= 1.0 mM . The dim and ms and the NMDA-R mediated contribution (ΔCapre) is as measured by Sabatini et al. [βNMDA and βCaL, which account for fast calcium buffering and for the fractional calcium current through NMDA-Rs of ∼10 %. The calcium reversal potential, ECa, is used to describe the fractional calcium current through NMDAs in the calcium dynamics . In some cases, we used experimentally determined values . These parameters are adjusted in order to obtain the “LTD” and the “LTP window” at specific intervals of calcium concentration . The maximal calcineurin activity kCaN is used to adjust the PP1 level evoked during the STDP stimulation protocol .The calcium-dependent steady-state concentration of phosphorylated CaMKII subunits depends heavily on the choice of the parameters defining the PKA pathway (CaM0) is smaller than the value found in experimental studies, due to the reasons given above . KM is taken from the modeling study of [Dsteady-state = D0 / (1 + (I0k13vPKA) / (−k13vCaN)). Hence, Dsteady-state depends on I0, vPKA, and vCaN through the single variable I0, kCaN, kPKA, the steady-state PP1 concentration depends on three independent combinations of those parameters, e.g., I0 and kCaN, kPKA are obtained by constraints imposed on the model .The total calmodulin concentration (study of . Equatioodel see B. On theCapre) and a postsynaptic spike (ΔCapost), keeping their ratio constant, ΔCapost = 2 · ΔCapre (see the section “Effect of Kinetics of Autophosphorylation and Dephosphorylation on the Number of Spike-Pair Presentations Needed for Transitions”).The parameters describing postsynaptic calcium and postsynaptic membrane potential dynamics are taken from previous modeling studies . We systhttp://www.pitt.edu/~phase/) for the steady-state calculations of the CaMKII system.We solve the system of coupled, ordinary differential equations with a fourth-order Runge-Kutta method with adaptive stepsize control. This has been implemented in a C++ program. We used XPPAUT by G. Bard Ermentrout (

The Testisin gene (PRSS21) encodes a glycosylphosphatidylinositol (GPI)-linked serine protease that exhibits testis tissue-specific expression. Loss of Testisin has been implicated in testicular tumorigenesis, but its role in testis biology and tumorigenesis is not known. Here we have investigated the role of CpG methylation in Testisin gene inactivation and tested the hypothesis that Testisin may act as a tumour suppressor for testicular tumorigenesis. Using sequence analysis of bisulphite-treated genomic DNA, we find a strong relationship between hypermethylation of a 385 bp 5′ CpG rich island of the Testisin gene, and silencing of the Testisin gene in a range of human tumour cell lines and in 100% (eight/eight) of testicular germ cell tumours. We show that treatment of Testisin-negative cell lines with demethylating agents and/or a histone deacetylase inhibitor results in reactivation of Testisin gene expression, implicating hypermethylation in Testisin gene silencing. Stable expression of Testisin in the Testisin-negative Tera-2 testicular cancer line suppressed tumorigenicity as revealed by inhibition of both anchorage-dependent cell growth and tumour formation in an SCID mouse model of testicular tumorigenesis. Together, these data show that loss of Testisin is caused, at least in part, by DNA hypermethylation and histone deacetylation, and suggest a tumour suppressor role for Testisin in testicular tumorigenesis. Testicular cancer is the most common malignancy affecting males aged 14–40 , 2003. NTGCT commonly consist of two distinct histological subtypes, seminomas and nonseminomatous TGCT, with the latter including yolk sac, teratoma and mixed germ cell tumours. Somatic mutations leading to TGCT include chromosome duplication, loss of heterozygosity (LOH) and gene deletion . EpigeneTestisin was identified by virtue of its tissue-specific expression in testis and its absence in TGCTs, suggesting that Testisin may function as a tumour suppressor gene . Some meTEST1; PRSS21) is located within a cluster of serine protease genes on chromosome 16p13.3 and SiHa (ATCC No. HTB-35) and the colon carcinoma cell line SW620 (ATCC No. CCL-227) were cultured in RPMI 1640 supplemented with 10% foetal bovine serum, 50 μg ml−1 penicillin and 50 μg ml−1 streptomycin. All cell lines were cultured in 5% CO2 and 95% humidified air atmosphere at 37°C. Cell viability was determined by Trypan blue dye exclusion and mycoplasma-free status tested by Hoechst 33258 staining (staining .μg) was reverse transcribed using Superscript™ II reverse transcriptase . PCR was performed using 1–3 μl of cDNA in a 25 μl reaction containing 1 μl (25 ng) of Testisin forward (5′-CTGACTTCCATGCCATCCTT-3′) and reverse (5′-GCTCACGACTCCAATCTGAT-3′) primer, 1 μl (12.5 ng) of β-actin forward (5′-GACATGGAGAAGATCTGGCA-3′) and reverse (5′-ggtctttacggatgtcaacg-3′) primer, and 0.5 U of Red Hot DNA polymerase . The PCR program was as follows: 94°C for 5 min followed by 30 cycles of 94°C for 30 s, 56°C for 30 s and 72°C for 90 s with a final extension of 72°C for 10 min. PCR products were analysed by agarose gel analysis, purified using the Qiaex II gel extraction kit and sequenced using the Testisin reverse primer and ABI PRISM BigDye™ Terminator Cycle Sequencing Reagent . PCR amplification of Testisin mRNA (460 bp product) was unaffected by the amplification of β-actin mRNA (375 bp product) in the same reaction mixture (data not shown).Total RNA was extracted using TRIZOL® reagent as per the manufacturer's instructions. The RNA (2 β-actin (Hs 99999903_m1) were obtained from Assay-on-Demand Gene Expression Products (Applied Biosystems). cDNA was synthesised from RNA using the Taqman Reverse Transcription Reagents with random primers (Applied Biosystems) according to ABI optimised protocols . PCR was performed using the ABI PRISM 7900HT sequence detector system. The thermal cycling conditions comprised an initial denaturation step at 95°C for 10 min followed by 40 cycles at 95°C for 15 s, and then 60°C for 1 min. Expression levels of β-actin were determined as an internal RNA control. Threshold cycle (CT) was obtained from PCR reaction curves. Three replicates each sample were analysed on two separate occasions to verify the precision of the assay. The relative quantification of Testisin was calculated using the comparative CT method as recommended by Applied Biosystems with β-actin serving as the endogenous reference: ΔCT (Testisin CT–β-actin CT); ΔΔCT (ΔCT−ΔCT of untreated or control cell line), fold difference in target relative to untreated (2CT)−(ΔΔ).For quantitative real-time PCR, specific primers and fluorescent-labelled probes for Testisin (Hs 00199035_m1) and Genomic DNA from human tumour cell lines was extracted ). The amvice versa , allowed to adhere overnight, then treated with either 2–10 μM 5-azacytidine (5-aza), 10–100 nM trichostatin A (TSA), 1–10 μM 5-aza-2′-deoxycytidine (5-aza-2′) or combinations of these reagents for 3–4 days (2 days for TSA) with the media changed every 24 h. RT–PCR analysis as described above using Testisin and β-actin oligonucleotide primers was performed on cellular RNA.The human tumour cell lines Tera-2, SW620 and GCT27C-4 were seeded at low density (2.5 × 10μF). Clones resistant to G418 (0.1 mg ml−1) were isolated and screened for Testisin mRNA expression by RT–PCR as described above. Four independent clones expressing Testisin mRNA and a cell line containing the pcDNA3 vector alone (VOC2) were selected for subsequent experiments.Full-length Testisin cDNA in pcDNA3 (6 cells in 25 μl PBS). As an internal control, the contralateral (right) testis was either injected with an equal volume of PBS or not injected; no difference was detected between the two methods. After 4 weeks, or when the apparent tumour size approached 1 cm3, both testes were removed, weighed and half was fixed in formalin for histological analyses and the remaining half, frozen in liquid nitrogen for RT–PCR analyses. The lungs were inflated with Bouin's fixative and removed for histological analyses. Testes weights were represented as a percentage of total body weight in grams to correct for differences in size between individual mice. Tumour burden was calculated by dividing the value for the tumour-affected left testis by that of the contralateral testis. These studies were performed according to the Australian ‘Code of Practice for the Care and Use of Animals for Scientific Purposes’. During the 4-week period of tumour development, the mice exhibited no symptoms or signs of clinical illness apart from a visible or palpable lump in the lower abdomen or scrotum.This model was performed essentially as we have published previously (μm) of mouse tissues were affixed to adhesive slides and air-dried overnight at 37°C. For immunohistochemistry, sections were deparaffinised and immersed in methanol containing 0.3% H2O2 for 30 min to exhaust endogenous peroxidase activity. After thorough washing, the sections were preincubated with 10% horse serum, followed by anti-Testisin monoclonal antibody at 8 μg ml−1 for 1 h at room temperature. After washing in PBS, biotinylated anti-mouse IgG was applied for 30 min at room temperature. The sections were washed thoroughly in PBS before incubating in Vectastain ABC reagent for 30 min at room temperature. Sections were developed by incubation in 0.05% 3,3′-diaminobenzidine (DAB) in Tris-HCl, pH 7.4 buffer with H2O2 as substrate. After washing in water, the sections were lightly counterstained with Mayer's haematoxylin. Negative controls were stained as above but with PBS substituted for the primary antibody. Histology sections were stained with Mayer's haematoxylin and eosin.Paraffin sections (3–4 Tera-2 cells were seeded in 96-well tissue culture plates (Costar) in triplicate at low (1000 cells), medium (5000 cells) and high (10 000 cells) density and allowed to grow for 2, 3 or 4 days under normal culture conditions. Cell proliferation was assayed by 5-bromo-2′-deoxyuridine (BrdU) (colorimetric) ELISA (Roche) as per the manufacturer's instructions. The assay was replicated on four separate occasions.For monolayer assays, cells were plated in six-well plates (100 cells per well) in triplicate and cultured for 14 days with the media changed every 4 days. The cells were fixed, stained with 1% crystal violet and colonies of greater than 50 cells were counted. For assay of colony formation in soft agarose, cells were embedded in 0.33% agarose, which was sandwiched between a 0.6% agarose base and a 0.33% top layer with media, in triplicate in six-well plates. Plates were incubated for 4 weeks under normal culture conditions. The number and approximate colony sizes were recorded.P<0.05 was considered statistically significant.The nonparametric Mann–Whitney test was used to determine differences between two groups, and the nonparametric Kruskal–Wallis test was used for the analysis of differences among more than two groups. As reported previously , top. ToWe have demonstrated previously that while Testisin is present in testicular spermatocytes, TGCTs lack Testisin expression . To deteβ-actin mRNA confirmed the quality of the total RNA used in each reaction. The upregulation of Testisin mRNA expression following treatment was quantitated by real-time RT–PCR. Testisin mRNA was induced in SW620 cells after treatment with 10 μM 5-azacytidine .An expression plasmid containing Testisin cDNA or the control vector alone were transfected into Tera-2 cells and stable cell lines isolated on the basis of G418 resistance. Four independent clones, C1, C11, C29 and C33, expressing Testisin mRNA and a veMorphological analysis of tissue specimens showed that growth of the parental Tera-2 cells or the control tumour cells resulted in virtual replacement of the affected testis with the growing mass of tumour cells. Tumour growth blocked the blood supply to the seminiferous tubules causing widespread severe atrophic changes in residual seminiferous tubules . Each ofin vivo suggests that the Testisin gene may function as a tumour suppressor. Expression of Testisin mRNA did not affect Tera-2 in vitro cell proliferation as assessed by BrdU incorporation (data not shown). In addition, no alterations in cell viability or cell morphology under normal culture conditions in vitro were observed (data not shown). As in vitro growth of Tera-2 cells is anchorage-dependent, the effect of Testisin mRNA expression on Tera-2 malignant potential in vitro was examined by colony forming assay in monolayer. Tera-2 clones expressing Testisin mRNA formed fewer colonies than the parent line or pcDNA3 vector only clones (P<0.005) (in vivo. Testisin mRNA expression in Tera-2 cells did not confer anchorage-independent growth as measured by colony formation in agarose (data not shown).The suppression of Tera-2 tumour growth P<0.005) , consistin vivo testicular tumour growth and colony forming ability in vitro, supporting the hypothesis that Testisin inactivation confers a selectable advantage for testicular tumours.The Testisin gene is specifically expressed by meiotic germ cells in human testis and 2. FThat the Testisin gene is silenced by DNA hypermethylation was demonstrated by (i) the correlation of CpG island methylation status with gene expression in tumour cell lines and in primary testicular tumour tissues and 2 anHPRT, PGK1, which, like PRSS21, contain CpG-rich TATA-less promoters (Mechanisms of silencing of gene transcription by DNA methylation occur either through methylation of specific CpG dinucleotides contained within the binding sites for transcription factors or throuThe semimethylated CpG sites observed in the 5′ untranslated region of testicular tumour tissues may reflect some heterogeneity in these tissues. It is likely the tissues are comprised of mixed tumour cell types and also infiltrating cells, such as inflammatory cells and lymphocytes that may contribute to the heterogeneity (While hypermethylation of the Testisin 5′ CpG island is most likely responsible for the silencing of Testisin in testicular tumours, it is unclear whether this represents a cause or consequence of testicular tumorigenesis . KnudsonThe finding of gene silencing associated with hypermethylation has precedents with two other protease genes. The NES1 serine protease gene is downregulated in breast and prostate cancers, and its expression is associated with a tumour suppressor function and breain vivo allowing for the ‘tumour suppressor’ function of the gene to be restored (reviewed in in vivo re-activation is currently being used in the clinical setting to re-express foetal haemoglobin to treat sickle cell anaemia (The data presented here demonstrate that Testisin gene silencing is associated with hypermethylation of the Testisin CpG island in primary testicular cancers and support a role for Testisin as a tumour suppressor in testicular cancers. The inactivation of a tumour suppressor gene through epigenetic mechanisms leaves the gene structure intact and provides for the therapeutic possibility that the gene can be re-activated anaemia .

Family members diagnosed with TB or showing clinical signs of extra-pulmonary TB (EPTB) were reported in 86 households (19%). None of the assessed potential risk factors of disease transmission between cattle and human were statistically significant.This study shows a representative stratified cluster sample survey of the prevalence of comparative intradermal tuberculin test in cattle from four regions in Ethiopia. Using a cut-off for positivity of 2 mm, it assesses possible risk factors for tuberculin-positive reaction in cattle. Seventy-three villages in 24 kebeles (administrative units) were randomly selected, from which 2216 cattle from 780 owners were tested. In addition, 450 of these cattle owners were interviewed for risk factor assessment. Ninety-nine percent of the tested cattle in this rural livestock production system were traditional zebus. The individual overall prevalence of cattle bovine tuberculosis (BTB)e was 3%, with the highest found in Meskan Mareko, in Central Ethiopia (7.9%) and the lowest in Woldia, in the North East edge of the Rift Valley (1.2%). Generalised Linear Mixed Models (GLMM) with random effect on kebeles was used to analyse risk factors of cattle reactors and human tuberculosis (TB) infection. Purchase of cattle and presence of other livestock in the herd were statistically significant, with OR: 1.7, Mycobacterium bovis, a member of the Mycobacterium tuberculosis complex (MTC), which also comprises the closely related M. tuberculosis, the major causative agent of human tuberculosis (TB) cases) is an infectious disease caused by sis (TB) . Around sis (TB) , with susis (TB) . It has ) cases) . Howeverfeatures . In addirculosis .M. bovis was described by numerous authors in extensive detailed reviews; however, they tend to focus mainly on experiences from industrialised countries, where control and/or eradication programmes have been implemented since a long time . M. bovis in milk and faeces from milking buffaloes and cattle in Nepal. This indicates that transmission to young animals by milk should not be neglected. Recent publications from Africa also suggest that ingestion of M. bovis might be an important mode of disease transmission in cattle, since mesenteric lymph nodes were shown to be more affected than mediastinal lymph nodes ) between the latitudes of 5.1°N and 11.5°N and the longitudes of 36.1°E and 40.1°E. Within these regions, six woredas (districts) (Woldia (Northern highlands), Meskanena Mareko , Bako Gazer (Southern middle lands), Dinsho, Robe and Goro) were selected according to the requirements of the study as a whole . The latter three woredas were combined into one study area, the Bale Mountains, which is a highland area adjacent to a national park. Altitude of the study sites varied between 1300 and 4200 m above sea level. Although belonging to different ethnic groups with different culture and religion, all farmers were sedentary small holders with similar mixed livestock-crop farming system.22.1Cattle herds were selected by a stratified cluster sampling proportional to the size of the cattle population, in which the unit village was considered as a cluster. Sample size was calculated using the formula described by s.e.x which measures the precision of our estimate is given by Roh (ρ) describes the rate of homogeneity, thus the variability is given by The standard error roh (ρ) as 0.2, and using the formula we obtain a design effect D of 6.8 We take n = b × c, thus 510 animals, which gives us a total number of required animals of 2040 for all four woredas. A complete list of kebeles and villages within the kebeles was obtained from each woreda agricultural office. Kebeles within the woreda were selected randomly using random numbers generated in Microsoft Excel®; villages were selected randomly and proportionally to their number within a particular kebele. Since cattle of all villagers are kept together during the day, at least on grazing areas and for drinking, each village was considered as one big cattle herd for assessment of tuberculin reactivity status. Thirty animals were selected from a minimum of five and a maximum of 15 owners per village. In general, not all animals per owner were tested since as many owners as possible per village were included in the study, either randomly from a list of all owners (where owners numbered higher than 15) or including the total number of owners gathered at the place where the tuberculin testing was performed (where owner number was less than 15). Animals younger than 6 months, cows at a late stage of pregnancy and clinically sick animals were excluded from the testing. Possible sampling bias was introduced when the owner himself decided which animals fulfilling the inclusion criteria were tested.Choosing 30 animals per cluster with a disease prevalence of 5% and 17 clusters gives us an estimate of the standard error (1) or precision of 0.025. The total sample size per woreda is given by Farmers were asked to gather their animals at a certain point in or in the proximity of the village for testing and reading. If animals were not at the meeting point during the reading day, a house-to-house visit was conducted. As compensation and incentive for farmer's participation, all tested cattle were de-wormed on the reading day with Albendazol boli .2.2−1) bovine PPD and 0.1 ml (2500 IU ml−1) avian PPD were administered in two shaved sites, 12 cm apart from each other in the middle neck region, after having recorded skin thickness with a caliper. Skin thickness was measured again at both injection sites after 72 h. The reaction at each site was derived by measuring the difference of the skin thickness before and 72 h after the injection. An animal was considered positive if the bovine minus the avian reaction was greater than 2 mm supplied by the Veterinary Laboratories Agency, Weybridge, UK. Intradermal injections of 0.1 ml . In addition, focus group discussions were conducted in the villages.Geographic coordinates and altitude were registered at the central point of each village by global positioning system (GPS).2.4Data were double entered in Access, validated with EpiInfo (version 3.3.2) and analysed with the software package STATA/IC 10.1 . Analysis of potential risk factors for the cattle being positive for BTB and estimation of variance component were performed using generalised linear mixed models with binary outcome and logit link function (GLLAMM add-on). The exploration of the different variance components of each stage of the multistage cluster sampling indicated that the random effect variances were mainly associated with each woreda and kebele. In contrast, the variance components of owner and village level were <0.0001. Therefore, we included in all models the kebele as random and woreda as fixed effects.33.1Seventy-three villages in 24 kebeles in the four woredas were selected, of which a total of 2216 cattle from 780 cattle owners were tested for BTB. Ninety-nine percent of the tested animals were traditional zebus, 1% accounted for exotic Holstein breed and cross-breeds (Holstein and zebu). The overall apparent individual animal prevalence of tuberculin reactors was 3.1% but varied significantly between the woredas in Meskan Mareko with the highest prevalence and the lowest in Woldia . Of the 3.2In this survey, 450 farmers were interviewed. Fifty-six owners (12.4%) had PPD-positive cattle, and among these farmers, 24% reported TB cases in their household. Cattle fodder consisted of 90% pasturing and crop residues after harvest. Fifty-four percent and 31% of the farmers vaccinated their cattle against blackleg and/or pasteurellosis and de-wormed on a regular basis.Livestock other than cattle were kept in mixed herding systems in 70% of the farms interviewed . Sixty-two percent of the cattle herds grazed on communal pasture either full-time or part-time, 81% were watered at the river and 99% of the herds had close contact with other cattle herds the year round during communal grazing and/or watering, veterinary campaigns, communal harvesting–ploughing and/or threshing. Overall, nearly half of the farmers (46%) kept cattle inside the living housing at night. Natural service for cow fertilisation was used in 92% of the farms with 54% of the farmers using a bull from a neighbouring farm for reproduction. Encounters between wildlife and cattle were overall rare or children and men combined (50%). Twelve percent of the herds were looked after by adult men, whereas women were rarely involved in herding (0.4%). Herds were not looked after at all in 0.7% of the interviewed households. In contrast, milking of cows was mainly carried out by women (45.5%) or adult men and women combined (44.5%). In 9.5% of the interviewed households, adult men were milking cows. Children were rarely involved in milking tasks (0.5%). Eighty-one percent of the farmers did not boil the drinking milk and 74% ate raw meat. The farmers’ knowledge of the clinical signs of TB, either in humans or in cattle, was generally high (70%). However, we noticed during focus group discussions that farmers often did not know that the disease could be transmitted from cattle to humans.3.3p = 0.04) and the presence of other stock .We excluded the variable ‘presence of sheep’ for the multivariable model due to co-linearity with the variable ‘presence of other stock’. We included following variables in the multivariable analysis according to the criteria mentioned earlier: presence of other stock, purchase of cattle, cattle that were not de-wormed and communal grazing. All these variables showed a higher risk for having positive cattle reactor, although none of them were statistically significant .3.4TB was reported in 86 households (19%). At least 20% of the reported cases were EPTB . None of the assessed eight variables were statistically significant in the univariable model for having a TB case in a household .4Our study reports a representative estimate of BTB prevalence in rural Ethiopia. The overall prevalence found in our study is consistent with the results found in some African countries. In Tanzania, Although the situation in the sampled villages is favourable for BTB transmission among animals , only a few animals per herd were found positive, with an overall individual prevalence of 3%. This indicates a low transmission in the investigated livestock systems which are characterised by small herd size; mostly communal grazing with some crop residue supplementation; if housing, then only at night but not during the day and cattle that are often kept together with small ruminants.In contrast to p = 0.1). However, this result suggests that high parasitic loads may decrease the animal resistance and make it more susceptible to BTB.There seems to be very little transmission during extensive communal grazing, even on crowded pasture. Similarly, p = 0.2), despite prevailing poor ventilation and very close animal contact. This could be explained by the low number of animals kept indoors. We did not investigate any direct environmental risk factors. However, recent studies in Tanzania . This might have been due to the low number of old animals in our study . These findings suggest, nevertheless, that removing old animals from a herd and avoiding purchasing old animals from markets might help decreasing-within-herd prevalence and risk of introduction of infectious animals, respectively. Purchase of animals was significantly associated with BTB positivity , suggesting that the disease is likely to be spread regionally by animal movements.Animals older than 10 years were at higher risk of infection (OR: 1.9), which is in line with findings by p = 0.05). Although not statistically proven, keeping sheep in the farm increased the risk of finding positive PPD cattle . Nearly half the farmers having stock other than cattle, owned sheep, which are kept in mixed herding with cattle. Bovine TB in sheep is rare but has been nevertheless described in Europe , it is plausible that M. bovis might play a role. Farmer consumption habits did not show any statistical significance, as against previous findings in Ethiopia .The reported human TB in our study comprised all forms of the disease and no differentiation was made between Ethiopia . In contM. bovis infection. ‘Classical’ risk factors have been investigated to a certain extent in small studies in the Ethiopian Highlands, sometimes showing divergent results. However, in order to embark in a national BTB control programme, thorough knowledge of possible risk factors is an essential prerequisite and should, therefore, also include risk factors associated with environment and milk as well as the role of co-infection in cattle with diseases highly prevalent in some areas , nutritional challenges and the genetic role of different cattle breeds to BTB susceptibility.Such high household interviews (450), as conducted in our study, have rarely been conducted in the past. However, considering the very low prevalence of the disease in the country, the power of the study should be further increased in future research. Because of the clustered distribution of livestock, random effects models are more appropriate and risk factor assessments more conservative. Further studies on risk factors of BTB in humans require case–control studies with confirmed It appears that the epidemiology of BTB varies not only between different African countries but also between different regions in Ethiopia depending on livestock systems , breeds but also ecological and geographic factors. Further research is needed to better understand BTB transmission in extensive livestock systems of Ethiopia as well as the true potential of zoonotic risk of transmission and finally to address the potential of control options.

Danio rerio and Poecilia reticulata. Both zebra fish and guppies were exposed to progressive concentrations of silver nitrate; a semi-static method according to OECD 203 was used. In each test series, 6 tests of acute toxicity were conducted, with 10 fish used for each separate concentration and for the control group. The results were subjected to probit analysis (EKO-TOX 5.1 software) to determine the 96hLC50 AgNO3 values. The 96hLC50 AgNO3 value for the zebra fish was (mean±SEM) 15±0.52 µg/l and for the guppies was (mean±SEM) 17.14±5.43 µg/l. We didn't find any statistically significant difference between the sensitivity of zebra fish and guppies. The results reported in this study are in agreement with LC50 values published in peer-reviewed literature, and conclude that AgNO3 is one of the most toxic compounds known to fishery.The aim of this study is to assess the acute toxicity of silver nitrate in adult zebra fish and adult guppies and to compare the sensitivity of these species to this compound. Silver is a naturally occurring element in our environment and it combines with other elements such as sulfide, chloride, and nitrate. Silver, in the form of silver nitrate, is one of the most toxic metals affecting freshwater fish. Industry, particularly photographical and electrotechnical, is the major contributor of silver that is released into the environment. Tests of acute toxicity were performed on the most common species of aquarium fish, They reach sexual maturity at about three months. Females lay hundreds of eggs approximately every other week, a feature that greatly facilitates genetic analysis. Eggs are fertilized externally and embryos are completely transparent, allowing one to follow the development of every individual cell are small tropical fish, native to the coastal streams of northeast South America. Female guppies are live-bearing. Males fertilize the eggs using a stick-like modified anal fin, the so-called gonopodium. Guppies are ovoviviparous, i.e. the eggs develop inside the mother.Guppies showed that higher water temperatures induce greater accumulation of Ag in the gills, plasma and the liver and bile. Regarding elimination, there was no significant difference between warm and cold fish and Poecilia reticulata .Acute toxicity tests were performed on aquarium fish Both zebra fish and guppies were exposed to a series of progressive concentrations of silver nitrate (2–50 µg/l); this procedure complied with OECD No. 203 Acute Toxicity Test according to the Fish-Semistatic Method guidelines. The fish were acclimatized for 96 hours. In each test series, 6 tests of acute toxicity were made, with 10 fish used for each concentration and for the control group. Every 48 hours the solution in each concentration was changed. Every 24 hours water temperature, pH, and the oxygen saturation of water were recorded, as well as the fish mortality rate.4.5 1.15 mmol/l; CODMn 1.9mg/l; total ammonia bellow limit of determination; NO3– 24.5–31.4mg/l; NO2– below limit of determination; Cl– 19.1mg/l; sum of Ca+Mg 14mg/l. Water temperatures in the test was 23±1°C, the oxygen saturation of water was above 60% (ranging from 85 to 96%), and pH ranged from 8.04 to 8.66.The basic physical and chemical indices of the diluted water used in the acute toxicity test were as follows: ANC50 AgNO3 values. The statistical significance of the difference between LC50 values for the guppies and the zebra fish was evaluated by using a non-parametric Mann-Whitney test and Unistat 5.1 programme.The results were subjected to a probit analysis (EKO-TOX 5.1 software) to determine the 96hLC50 AgNO3 value for Danio rerio was (mean±SEM) 15±0.52 µg/l and for Poecilia reticulata was 17.14±5.43 µg/l. We didn't find any statistical significant difference between the sensitivity of zebra fish and guppies.The 96hLC50 values suggest that the AgNO3 is one of the most toxic metal salts in freshwater.Our (and other author's) reported measurements of 96hLC50 ranged 330–2,700 µg/l) than in freshwater fish (96hLC50 ranged 5–70 µg/l).Hogstrand and Wood observedet al., , it was higher 60 µg/l and the 96hLC50 values were 6.7 µg/l it was determined that the 96hLC50 value was 17.3 µg/l (Holcombe et al., 50 values obtained by this study are mostly comparable with previous results.Davies et al., recorded et al., and Hogs(et al., . In blueet al., (In this study the acute toxicity of silver nitrate in guppies and zebra fish has been assessed separately with 96h toxicity tests, and there was no significant difference in the sensitivity of zebra fish and guppies to this compound. However, Gallo et al., compared50 and 48hLC5 were almost the same in both species. Statistically significant higher values of 48hLC50 and 48hLC5 for zinc sulfate were recorded in the zebra fish. In contrast, acute toxicity tests for potassium dichromate found that zebra fish proved to be more sensitive.Other authors that have compared acute toxicity between zebra fish and guppy are Svobodova and Vykusova . Their sThese results may indicate species-specific toxicity, with the conclusion that ecotoxicological tests performed only on one fish species may lead to an erroneous classification of chemical compounds.

Women have been able to delay childbearing since effective contraception became available in the 1960s. However, fertility decreases with increasing maternal age. A slow but steady decrease in fertility is observed in women aged between 30 and 35 years, which is followed by an accelerated decline among women aged over 35 years. A combination of delayed childbearing and reduced fecundity with increasing age has resulted in an increased number and proportion of women of greater than or equal to 35 years of age seeking assisted reproductive technology (ART) treatment.Literature searches supplemented with the authors' knowledge.Despite major advances in medical technology, there is currently no ART treatment strategy that can fully compensate for the natural decline in fertility with increasing female age. Although chronological age is the most important predictor of ovarian response to follicle-stimulating hormone, the rate of reproductive ageing and ovarian sensitivity to gonadotrophins varies considerably among individuals. Both environmental and genetic factors contribute to depletion of the ovarian oocyte pool and reduction in oocyte quality. Thus, biological and chronological ovarian age are not always equivalent. Furthermore, biological age is more important than chronological age in predicting the outcome of ART. As older patients present increasingly for ART treatment, it will become more important to critically assess prognosis, counsel appropriately and optimize treatment strategies. Several genetic markers and biomarkers are emerging that can identify women with accelerated biological ovarian ageing. Potential strategies for improving ovarian response include the use of luteinizing hormone (LH) and growth hormone (GH). When endogenous LH levels are heavily suppressed by gonadotrophin-releasing hormone analogues, LH supplementation may help to optimize treatment outcomes for women with biologically older ovaries. Exogenous GH may improve oocyte development and counteract the age-related decline of oocyte quality. The effects of GH may be mediated by insulin-like growth factor-I, which works synergistically with follicle-stimulating hormone on granulosa and theca cells.Patients with biologically older ovaries may benefit from a tailored approach based on individual patient characteristics. Among the most promising adjuvant therapies for improving ART outcomes in women of advanced reproductive age are the administration of exogenous LH or GH. Over recent years, the average age of patients seeking infertility treatment has increased . Since tth to the early 19th century show that women who married late were more likely to die childless; women who married when more than 35 years of age had twice the chance of dying childless compared with those who married when aged 30-34 years [After approximately 30 years of age, fertility decreases with increasing age, with a slow but steady decline in fertility in women aged between 30 and 35 years, which is followed by an accelerated decline ,7. Data 34 years . Thus, d34 years .A combination of delayed childbearing and reduced natural fecundity with increasing age has resulted in a steady increase in the number and proportion of women aged ≥35 years who are seeking ART treatment . UnfortuAlthough chronological age is the most important predictor of ovarian response to follicle-stimulating hormone (FSH), the rate of reproductive ageing varies considerably among individuals. Both environmental and genetic factors contribute to biological ovarian ageing. Thus, chronological and biological age are not always equivalent. We review here the principal developmental and endocrine mechanisms of ovarian ageing that underlie the variability between chronological and biological age. We will also discuss the effect of biological ovarian ageing on ART treatment outcomes and consider potential treatment strategies for those of advanced biological reproductive age.Electronic literature searches were performed via PubMed using combinations of the following keywords to identify relevant articles: 'AFC', 'age', 'AMH', 'ART', 'assisted reproduction', 'environmental', 'folliculogenesis', 'FSH', 'genetic', gonadotrophin', 'GH', 'infertility', 'LH', 'oogenesis' and 'ovarian'. All types of articles published in the English language were permitted and were unlimited by date of publication. The resulting publications were examined for relevance to the scope of the review and supplemented with other key publications that were known to the authors.The different stages of folliculogenesis are illustrated in Fig. The life-cycle of preovulatory follicles can be broken down into three successive phases: initiation, which occurs from birth to old age and is independent of gonadotrophic support; FSH-dependent progression, which requires tonic stimulation by FSH; and LH-responsive maturation, which occurs when FSH-induced genes fall under LH control, leading to oestrogen secretion and ovulation ,15. ThesEarly stages of follicular growth are characterized by oocyte enlargement, granulosa cell proliferation (forming multiple layers around the oocyte) and development of the theca interna. From early infancy onwards, the proportion of the total number of healthy primordial follicles that proceeds to further development remains constant throughout a woman's reproductive life. Therefore, as the number of oocytes present in the ovaries decreases, the absolute number of developing follicles progressively declines with age .The mechanisms responsible for initiating follicular growth are independent of gonadotrophins and may originate in the oocyte itself . When a When approximately three layers of granulosa cells have formed in preantral follicles, fluid-filled spaces appear between the granulosa cells and gradually become confluent to form a single large antrum. Antrum formation is gonadotrophin-dependent. In humans, this growth stage lasts until follicles are approximately 2-4 mm in diameter. Healthy antral follicles are on the brink of entering the terminal stages of preovulatory development. However, to do so, they require appropriate, cyclical gonadotrophin stimulation. Thus, all antral follicles that develop before puberty will become atretic.Usually one preovulatory follicle develops during each menstrual cycle, increasing in diameter from approximately 5 mm at the beginning of the cycle to more than 20 mm at ovulation 2 weeks later. During its last 6 days or so of development, a follicle increasingly secretes oestrogen and inhibin (INH), the classic biomarkers of preovulatory follicular development. These hormones lead to discharge of the mid-cycle LH surge from the pituitary gland, which in turn triggers resumption of oocyte meiotic maturation and ovulation.As a woman ages, her fecundity declines because of the loss of follicles from the ovary and an aIt has been suggested that a threshold number of follicles is required to maintain a regular menstrual cycle . The perSeveral years before menstrual cycles cease, initiation of follicular growth begins to accelerate, speeding up the loss of the residual follicular stock ; this ocFSH orchestrates the termination of folliculogenesis in human ovaries. The increase in circulating plasma FSH levels appears to be due mainly to reduced secretion of follicular growth and differentiation factors related to transforming growth factor-b that negatively affect the release of FSH from the pituitary gland.INH and anti-Müllerian hormone (AMH) are produced by immature ovarian follicles and help to regulate secretion of FSH by the pituitary gland ,27. As tThe size of the initial oocyte stock, the proportion that undergoes atresia and the rate of initiation of growth of follicles are genetically determined variables ,29. ThusThe peri-menopausal period, from the onset of cycle irregularity to menopause, is reported to be approximately 6 years, regardless of the age at menopause . SimilarEpidemiological studies show that 10% of women in the general population are menopausal by the age of 45 years ,36. AssuFSH levels begin to increase long before the onset of menstrual cycle irregularity, and continue to rise thereafter ,38. LeveFerrell et al. conducted a 5-year prospective study in order to investigate age-related changes in LH and FSH, in a group of 156 women within an age range of 25-58 years at the beginning of the study . The parThe study confirmed that both FSH and LH levels increase with age, but the timing and magnitude of these changes were different for each hormone and varied among individuals. Both FSH and LH increased dramatically during the later peri-menopausal stages. FSH levels increased from normal to high within a relatively short time frame in the peri-menopausal years (<5 years). Although the most rapid increase in aggregate and individual FSH levels occurred after the age of 45, an increasing level of FSH was observed even in young women. However, any aggregate estimates of FSH or LH levels may be misleading as they represent a mixture of different trends seen in individuals, who have widely varying levels at different ages, and the rate of increase also differs among individuals. Figure Both genetic and environmental factors influence the rate of ovarian ageing and ovarian sensitivity to gonadotrophins.FMR1 gene [It is well established that genetic variations may affect ovarian response to gonadotrophins and ovarian ageing and even premature menopause. For instance, fragile X-associated primary ovarian insufficiency affects a proportion of female carriers of a mutated version of the MR1 gene . It has MR1 gene .An extreme example of the relevance of a genetic cause of reduced ovarian gonadotrophin sensitivity to accelerated biological ageing is provided by the FSH-receptor haplo-insufficient knock-out mouse (FSH-R+/-); these animals consequently have ovarian insensitivity due to a reduced number of FSH receptors . FSH-R+/Additionally, it has been demonstrated that oocytes obtained from older women may have inadequate reserves of energy due to age-related accumulated effects on their mitochondrial DNA . Such a 680/Ser680 genotype, comprising approximately 20% of the female population, showed a significant increase in total menstrual cycle length and time from luteolysis to ovulation compared with control subjects (Asn680/Asn680 wild-type receptor). In addition, despite being normo-ovulatory, women with the Ser680 polymorphism displayed a significantly higher serum FSH level compared with the control population [680 polymorphism have been reported to have a lower ovarian response to FSH stimulation during ART [The importance of genetic characteristics in determining ovarian cycle and ovarian morphology with respect to the FSH receptor has also been described . Women wpulation . Consequring ART .8Arg and Ile15Thr of the beta subunit) encodes a protein with altered in vitro and in vivo activity [Although much research into ovarian resistance to gonadotrophins and ovarian ageing has focused on the gonadotrophin receptors, it is also important to consider the gonadotrophins themselves and other systems. A common variant of the LH gene gene is considered to be primarily associated with bone metabolism via Wnt signalling, gene polymorphisms have been associated with a marked variation in circulating FSH levels in normal post-menopausal women [A possible link between ovarian age and the tumour suppressor gene, phosphatase and tensin homologue (PTEN) has been suggested. In a PTEN knock-out mouse model, all primordial ovarian follicles were activated prematurely . In addial women .Data from three epidemiological studies on the effect of biological and behavioural determinants of fertility in Bangladesh during 1975-1989 , 1981-19Environmental factors may shorten the functional lifespan of a woman's ovaries. Diet may play a role in the occurrence of early menopause . CigaretThere is an association between endometriosis and infertility (30-50% of patients with endometriosis are infertile) but the visible endometriotic lesions contribute only a small proportion of the reduced fecundity of these women . Data suThere is also evidence of reduced responsiveness to gonadotrophins following laparoscopic ovarian cystectomy , suggestin vitro fertilization (IVF) also declines progressively in women over the age of 35 years [Although ART treatments are now available for patients experiencing fertility problems, the likelihood of successful outcomes decreases with increasing female age. Poor ovarian response to stimulation is more common in women aged ≥35 years as the ovaries become less sensitive to FSH with increasing age . The pro35 years ,80 genotype, and Ser680/Ser680 genotypes demonstrate ovarian resistance to FSH [The AFC represents a better marker than either chronological age or basal FSH for assessing the ovarian biological age, and may be used to select older patients who have a good prognosis for IVF . Older pe to FSH .Because of their production by immature ovarian follicles, AMH and INH are also promising biomarkers of ovarian ageing ,94. EarlBaseline AMH levels have been used successfully to individualize ovarian stimulation . A recenThe 'two cell - two gonadotrophin' model highlighted the role of LH in androgen production and release throughout folliculogenesis, and founded the concept that granulosa and theca cells are distinct follicular compartments regulated by FSH and LH, respectively ,102. ThiFSH and LH cooperate to induce the local production of growth factors, which are required for the paracrine regulation of follicular maturation ,107. It This hypothesis explains why a low LH concentration or activity may lead to impaired granulosa paracrine signalling and a correspondingly higher requirement for FSH. Furthermore, this theory gave rise to a suggestion that women with ovarian resistance to exogenous FSH, such as those with biologically older ovaries, may benefit from LH supplementation. Although some studies have failed to show an effect of LH supplementation in older women ; however, no age-related differences were found in women who received supplementation with r-hLH [P < 0.05) [In a prospective randomized study using a long GnRH down-regulation protocol, significantly lower implantation and pregnancy rates were observed in women aged ≥35 years than in those aged <35 years when only recombinant human (r-h)FSH was used for ovarian stimulation (th r-hLH . Moreove < 0.05) . Similar < 0.05) .P = 0.03), but this effect was not observed in younger patients [In a randomized controlled trial (using a GnRH antagonist), LH supplementation was associated with a significant improvement in implantation rates in women aged 36-39 years than stimulation with only FSH to follicular development [The use of hGH in the management of female subfertility was first reported in the early 1990s ,132 and elopment ,134, subelopment -141.P = 0.04).Interestingly, recent studies have shown more promising results. In a randomized trial of 100 women aged >40 years, co-stimulation with hGH (8 IU daily) led to significantly higher plasma and intrafollicular oestradiol levels, and clinical pregnancy and live birth rates, than did a standard ovarian stimulation protocol . These dBiological ovarian age is more important than chronological age in predicting the outcome of ART. An increasing number of older patients are now presenting for ART treatment, and efforts should be made to critically assess each patient's biological ovarian age in order to counsel them appropriately regarding prognosis, and optimize individual treatment. When endogenous LH levels are heavily suppressed by GnRH analogues, LH supplementation may help to optimize treatment outcomes for women with biologically older ovaries. The potential genetic influences on ovarian gonadotrophin sensitivity discussed here are intriguing, and have encouraged an approach based on systems biology to further improve our understanding of gonadal function and ageing. Such translational medical research could refine the use of current therapies, producing valuable predictive models to guide use of current treatments, and may ultimately lead to a range of new therapies.CA, SH and PH have declared no conflicts of interest. CMH is an employee of Merck Serono S.A. - Geneva, Switzerland . DT was an employee of EMD Serono, Inc., Rockland, MA, USA when the manuscript was in development.All authors were involved with the design, writing and reviewing of this manuscript and have approved the final version for submission.

Caenorhabditis elegans with cellular biochemical experiments in mammalian cells, we showed that: i) loss of CeTOCA proteins reduced the efficiency of Clathrin-mediated endocytosis (CME) in oocytes. Genetic interference with CeTOCAs interacting proteins WSP-1 and WVE-1, and other components of the WVE-1 complex, produced a similar effect. Oocyte endocytosis defects correlated well with reduced egg production in these mutants. ii) CeTOCA proteins localize to cell–cell junctions and are required for proper embryonic morphogenesis, to position hypodermal cells and to organize junctional actin and the junction-associated protein AJM-1. iii) Double mutant analysis indicated that the toca genes act in the same pathway as the nematode homologue of N-WASP/WASP, wsp-1. Furthermore, mammalian TOCA-1 and C. elegans CeTOCAs physically associated with N-WASP and WSP-1 directly, or WAVE2 indirectly via ABI-1. Thus, we propose that TOCA proteins control tissues morphogenesis by coordinating Clathrin-dependent membrane trafficking with WAVE and N-WASP–dependent actin-dynamics.The TOCA family of F-BAR–containing proteins bind to and remodel lipid bilayers via their conserved F-BAR domains, and regulate actin dynamics via their N-Wasp binding SH3 domains. Thus, these proteins are predicted to play a pivotal role in coordinating membrane traffic with actin dynamics during cell migration and tissue morphogenesis. By combining genetic analysis in Caenorhabditis elegans. We established that toca genes regulate Clathrin-mediated membrane trafficking during oocyte growth. We further discovered that these proteins play an important role in epithelial morphogenesis in developing embryos, and in egg production in adult nematodes. Moreover, the TOCA interacting proteins WASP/WSP-1 and WAVE/WVE-1, as well as other components of the WVE-1 complex, appear to be involved in TOCA-dependent processes. Thus, we propose that TOCA proteins control tissue morphogenesis by coordinating Clathrin-dependent membrane trafficking with WAVE and N-WASP–dependent actin-dynamics.Cells continuously remodel their shape especially during cell migration, differentiation, and tissues morphogenesis. This occurs through the dynamic reorganization of their plasma membrane and actin cytoskeleton: two processes that must therefore be intimately linked and coordinated. Molecules that sit at the crossroads of membrane remodeling and actin dynamics are predicted to play a pivotal role in coordinating these processes. The TOCA family of proteins represents a case in point. These proteins bind to and deform membranes during processes such as membrane trafficking. They also control actin dynamics through their interactions with actin remodeling factors, such as WASP and WAVEs. Here, we characterize the functional role of TOCA proteins in a model organism, the nematode The coordination and functional cooperation between endocytic trafficking of membranes and membrane proteins with actin-based motility is required for the correct execution of many cellular phenotypes. These include directional cell migration, tissue morphogenesis, cell-fate determination, and the establishment of cell polarity in epithelial and in neuronal cells. Consistently, endocytic trafficking and actin-based motility and dynamics are intimately linked. Results obtained in several species have established that endocytosis and trafficking events rely on propelling forces generated by actin treadmilling in vitro biochemical studies, showing that members of the family are elongated dimers formed by the antiparallel association of α-helical coiled coils which can deform liposome into tubules of different diameters However our understanding of the molecular circuitry involved in these processes is still in its early stages. Proteins that sit at the crossroads of membrane remodeling and actin dynamics are predicted to play a prominent role in these processes, simultaneously binding regulators of actin dynamics and sensing or inducing membrane curvature. A prototypical example of this kind of protein is the BAR domain superfamily of proteins—including “classical” BAR domains, F-BAR (FCH-BAR or EFC Extended-FCH) and I-BAR (Inverse-BAR) domains, which have emerged as important players in membrane-remodeling processes A defining feature of a subfamily of F-BAR-containing proteins that includes three mammalian members, TOCA-1 (Transducer of Cdc42 dependent actin assembly), CIP4 (Cdc42 interacting protein 4) and FBP17 (Formin binding protein 17) (hereafter referred to as the TOCA family), is to possess additional protein:protein interaction domains that enables them to function as signal transducers, physically bridging membrane trafficking with signalling that controls actin dynamics. TOCA-1 and CIP4, through their imperfect HR1/CRIB-like (Cdc42 and Rac interacting binding motif) domain act as direct downstream effectors of the small GTPase Cdc42 Drosophila TOCA-family was demonstrated to mediate E-cadherin endocytosis in conjunction with the Cdc42/Par6/aPKC polarity complex Despite this wealth of structural and biochemical observations, the functional and cellular roles of the TOCA family proteins have remained largely elusive. Consistent with their biochemical properties, concomitant downregulation of TOCA-1 and FBP17 in vivo resulted in a relative slight inhibition of Transferrin receptor internalization C. elegans with cellular biochemical analysis in mammalian cells we have identified a requirement of the TOCA subfamily of proteins in WASP and WAVE-dependent pathways controlling actin dynamics and membrane trafficking. Specifically we find that CeTOCA-1 and CeTOCA-2 are important for the regulation of Clathrin-mediated endocytic processes during oocyte growth, and in the control of epithelial morphogenesis in developing embryos. Remarkably, mammalian TOCA-1, like C. elegans CeTOCA-2, associates with ABI-1, a key member of the WAVE complex. Furthermore mammalian TOCA-1 localizes at tight junction in epithelial cells, suggesting that this function may be conserved.Here, by combining genetic approaches in the nematode C. elegans two distinct genes display a significant level of overall similarity to the three mammalian members of the TOCA family: CeTOCA-1 and CeTOCA-2. CeTOCA-1 and CeTOCA-2 contain, like their mammalian counterparts, a predicted N-terminal extended FCH or F-BAR domain, a central Cdc42-binding HR1 region, and a C-terminal SH3 domain , the model predicted this domain to fold into a nearly flat zeppelin shape. This analysis also showed full conservation of all key cationic residues required for membrane lipid bending , from which they are taken up into growing oocytes via receptor-mediated endocytosis Lipids and proteins derived from yolk are thought to provide essential nutrients required for rapid embryo development. Accordingly, adult toca-1(tm2056), toca-1(tm3334), and toca-2(ng11), single mutants, as well as toca-1(tm2056);toca-2(ng11) double mutant animals. The aberrant distribution of YP170 was most prominent in the toca-1(tm2056);toca-2(ng11) double mutant, where nearly 100% of the worms accumulated YP170::GFP in the pseudocoelomatic space ;toca-2(ng11) strain displays a significant reduction in the number of oocytes positive for YP170, with YP170::GFP only detectable in the single most proximal oocyte, in more than 50% of mutant worms (toca-1(tm2056);toca-2(ng11) worms had only the most proximal of the oocyte positive for YP170 (>85% of cases), with striking accumulation of YP170 in the pseudocoelomatic cavity ;toca-2(ng11) double mutant strain is associated also in nematode with GEX-2, and GEX-3 abi-1(ok640), in 20% of abi-1(RNAi) animals, and in 20% of wsp-1(gm324) mutant animals cdc-42(RNAi), while ablation of chc-1/Clathrin completely blocked YP170 accumulation by oocytes (The putative role of CeTOCA oocytes [35].The oocytes .abi-1(ok640) carries a deletion of the exons coding for the C-terminal SH3 domain, which mediates activation of N-WASP in mammals ok640 mutant, suggesting that WVE-1 function might not be disrupted. Consistent with this idea, the level of WVE-1 protein in abi-1(ok640) mutant was similar to Wt controls (gex-3(RNAi) (abi-1(RNAi) which is known to destabilize the WAVE2 complex wve-1, gex-2, or gex-3, indicating that the WVE-1 complex contributes to endocytosis.Notably, the mutant controls . WVE-1 l-3(RNAi) , anotherC. elegans oocytes. In keeping with this notion, RNAi mediated interference of wve-1 or gex-3 (wsp-1(gm324) strain, indicating that the two NPFs act redundantly in this process and toca-2(tm2088) mutant animals laid only 50–60% of the eggs laid by Wt strains and egg production in toca-1(tm2056);toca-2(ng11) double mutants was about 20% of Wt (toca-2(ng11) mutant rescued the defect in egg production , but detectable reduction in the number of eggs laid ;toca-2(ng11) double mutant worms (from around 70/worm to ∼30) . Thus, Ctoca-1 and toca-2 single mutants, and toca-1;toca-2 double mutant, are defective in YP170 oocytes endocytosis and display reduced eggs production, but are capable of moving, mating and appear morphologically normal. Additionally, toca-1 and toca-2 single mutants displayed a weakly penetrant, but significant, embryonic lethality (toca-1(tm2056);toca-2(ng11) was entirely recapitulated by the single toca-2(ng11), suggesting that loss of CeTOCA-2 is primarily responsible for this phenotype. Identical results were obtained with toca-1(tm3334);toca-2(ng11) double mutant (toca-2(ng11) strains rescued the embryonic lethal phenotype ;toca-2(ng11) double mutant. Time-lapse analysis of developing toca double mutant revealed that virtually all dying embryos are defective in morphogenesis (wve-1 mutant and the toca-1(tm3334);toca-2(ng11) double mutant display a similar increase in the width of the intestinal lumen (toca double mutant show an expanded MH33 region (toca-1(tm2056);toca-2(ng11) double or toca-2(ng11) mutants is due to a Gex epithelial morphogenesis phenotype In ogenesis . In all ogenesis . Using togenesis , just asal lumen . This Geal lumen , which r3 region . Togethetoca mutations on apical junctions, focusing on the key junctional protein AJM-1 toca-1;toca-2 double mutant, AJM-1::GFP was localized at cell-cell junctions, as in the Wt strain, but hypodermal cells failed to intercalate dorsally and to correctly migrate ventrally, similar to gex-2 and gex-3 mutants strains toca-1;toca-2 double mutants, similar to defects previously reported for gex mutants toca-1;toca-2 mutant than in Wt strain toca-1(tm2056);toca-2(ng11) with the triple wsp-1(gm324);toca-1(tm2056);toca-2(ng11) mutant strain. No enhancement of lethality was observed in strains where both wsp-1 and tocas were mutated, compared to the individual wsp-1 mutant (wve-1 expression by RNAi interference toca-2(ng11) strain (not shown). More experiments will be needed to assess whether toca-2 is a germline morphogenesis gene and its precise role in the process.The concomitant genetic disruption of the two s may modulate the function of WSP-1 and ABI-1/WVE-1, but are not obligatory partners of either protein complexes.In YP170 internalization, CeTOCA-1 and CeTOCA-2 act in a redundant fashion. However, in this process, as in embryo development and oocyte growth, CeTOCA-2 display a more prominent role than CeTOCA-1, likely reflecting a differential intracellular localization and/or different binding affinity for their common partners, namely ABI-1 or N-WASP. In these latter cases, the relative low affinities of the interactions observed suggest that CeTOCAtoca-1 and toca-2 reduced or delayed, but did not abrogate, YP170 entry into oocytes, indicating that these proteins are critical, but not essential for endocytosis of YP170. This is not unexpected given the complexity of CME, where >50 accessory proteins C. elegans genome contains additional F-BAR, N-BAR and SH3-containing proteins. These proteins may, thus, potentially function in a partially redundant fashion with the tocas and sequence verified. pEGFP-CIP4 and pEGFP-FBP17 were a gift from P. De Camilli. pEGFP-TOCA1 and TOCA1-HA vectors were generated by PCR amplification, subcloned in pcDNA-1-HA or pEFGP vectors and sequence verified. ABI-1HA, WAVE-myc, ABI-1-GFP, Cdc42QL-myc were generated as described before The monoclonal anti-WAVE2 antibody was generated against the C-terminal portion of human protein produced as a GST fusion protein.C.elegans proteins. A monoclonal anti-mammalian TOCA-1 was raised against amino acids 416–470 fused to GST. Secondary Abs conjugated to Cy3 (Amersham), FITC (Amersham) or Alexa 488 (Molecular Probes) were used. HeLa cells were grown in DMEM supplemented with 10% fetal bovine calf serum (FCS), 100 µg/ml streptomycin, 100 µg/ml penicillin, and 2 mM glutamine. Phoenix and NIH cells were grown in DMEM supplemented with 10% bovine North American serum, 100 µg/ml streptomycin, 100 µg/ml penicillin, and 2 mM glutamine. Transfections were performed using calcium phosphate, FUGENE (Invitrogen), or LipofectAMINE2000 (Invitrogen) reagents, according to manufacturer's instructions.An anti-CeTOCA-1 rabbit serum and an anti-CeTOCA-2 mouse were generated against a GST-fusion protein containing the CC-SH3 domains (CeTOCA-1 362–592 aa and CeTOCA-2 325–608 aa) of C. elegans and cell biochemistry in mammalians are described in All genetic experiments and phenotypic analysis in Figure S1Homo sapiens, Hs; Mus musculus, Mm; Xenopus tropicalis, Xt; Caenorhabditis elegans, Ce). Protein sequences were aligned using the ClustalW program. Manual adjustments were introduced on the basis of secondary structure information, and the picture was produced using Jalview. The secondary structure of the F-BAR domain of the human FBP17 (black) and the predicted one of the C. elegans TOCA-1 . The locus position of the putative F-BAR, HR1, and SH3 domains is indicated on top. Bar, 1 Kb. The deletion of the various tocas mutant worms utilized is also indicated. The toca-1(tm2056) is a deletion encompassing the exon that precedes the one coding for the SH3 domain; toca-1(tm3334), harbours a deletion extending from exon 3 to 4 over the F-BAR domain. Both these deletions result in an out-of-frame shift of the remaining gene products, which cannot be detected by immunoblotting (toca-2(tm2088) is a short deletion of exons 1–4, also causing an out-of-frame shift; finally toca-2(ng11), which was generated by TMP/UV mutagenesis, is a large deletion encompassing almost the entire locus (from exon 4 to 9). To obtain double toca mutants, we crossed either one of the two strains carrying the toca-1 mutated alleles with toca-2(ng11). (C) TOCA-1 and TOCA-2 localization in developing embryos. C. elegans embryos were fixed and immuno-stained with anti-CeTOCA-1 or CeTOCA-2 antibodies as indicated (right) or processed for differential interference contrast microscopy (DIC)(left). Bar, 10 µm. (D) TOCA-2 displays a specific localization in rachis. Fluorescent image of pie-1::TOCA-2::GFP showing localization of CeTOCA-2 in Rachis. Arrow points to the plasma membrane. (E) Expression levels of CeTOCA-1 and CeTOCA-2 in Wt and in mutant worms. Total cellular lysates of the indicated Wt and toca-2 (left panel) or WT and toca-1 (right panel) mutant adult worms were immunoblotted with antibodies against actin and either CeTOCA-1 or CeTOCA-2, respectively. Arrows point to CeTOCAs proteins. These data indicate the specificity of the anti-CeTOCAs ab. (F) The SH3 domains of CeTOCA-1 and CeTOCA-2 bind mammalian N-WASP. Total cellular lysates (1 mg) of HeLa cells were incubated with different amounts of the SH3 domain of CeTOCA-1 or CeTOCA-2-fused to GST or GST, as a control. Bound proteins and an aliquot of total cell lysates (100 µg) were immunoblotted with the antibodies indicated on the right.TOCA genes and proteins. (A) Multiple sequence alignment of TOCA family members from various species Click here for additional data file.Figure S2Toca localization at junction and in germline. (A) CeTOCA1 and AJM-1 partially colocalize at cell-cell junction. Confocal lateral view of Wt embryos expressing AJM-1::GFP at 1.5 fold stage. Embryos were fixed and stained with anti-CeTOCA-1 or processed for epifluorescence. Bar, 10 µm. (B) Germline and oocytes expression of CeTOCA-1. Germline and oocytes (surface and middle view) from Wt animal showing CeTOCA-1 expression. Gonads were dissected, fixed, and stained with anti-CeTOCA-1. Bar, 20 µm. Images were acquired with Axiovert 200 M microscope using MetaMorph and deconvoluted by AutoDeblur.(5.08 MB TIF)Click here for additional data file.Figure S3toca-1(tm2056) and toca-2(ng11) mutants. Localization of YP170::tdimer2 in synchronized young adult single toca-1 and toca-2 mutant worms and in pie-1::TOCA-1::GFP and pie-1::TOCA-2::GFP lines in their respective mutant background. Arrows indicate examples of YP-170::tdimer2 accumulation into the body cavity. Bar, 100 µm. (B) Double mutant toca-1;toca-2 display reduced YP-170::GFP endocytosis in the oocytes. Examples of the most represented categories of GFP-positive oocytes in Wt and toca-1;toca-2 mutant when comparing animals with the same number of oocytes in the gonad (see DIC images). The numbers −1, −2, −3, and −4 indicate the GFP positive oocytes from the more proximal to the more distal. (C) Double toca-1;toca-2 mutant has reduced YP-170::GFP in the oocytes. Left, quantification of YP-170::GFP into oocytes comparing Wt and toca-1;toca-2 with the same gonad category (3 GFP-positive oocytes). The numbers −1, −2, and −3 indicate the GFP positive oocytes from the more proximal to the more distal. YP-170::GFP fluorescent intensities along selected area were quantified by ImageJ software or the overall GFP intensity (right) in Wt and toca-1;toca-2 mutant. Asterisks indicate P<0.0001 by two-tailed t-test.OCA proteins in yolk endocytosis. (A) pie-1::TOCA-1::GFP and pie-1::TOCA-2::GFP rescue the YP-170::tdimer2 accumulation in the body cavity of ware see . Differe(2.93 MB TIF)Click here for additional data file.Figure S4toca-1;toca-2 oocytes. RME-2, the yolk receptor, is correctly localized and enriched at the plasma membrane. RME-2::GFP fluorescent intensities along selected areas and lines were quantified by ImageJ software to equalize and remove background staining and evidence pixel intensities values above threshold, which correspond to surface RME-2 signals. This procedure permits us to appreciate that the levels of cortical RME-2 are higher in toca-1;toca-2 animals with respect to Wt. Graph, the GFP intensity along the junctions (upper) and the average intensity of cytoplasmic RME-2 per area (bottom) is plotted for Wt and toca-1;toca-2.RME-2 levels in ware see . Differe(1.68 MB TIF)Click here for additional data file.Figure S5toca-1;toca-2. toca-1 and toca-2 mutants display a Gex phenotype. (A) toca-1;toca-2 double mutant worm displays altered intestinal morphology during embryo development. Wt and the indicated mutant worms were fixed and stained with anti-MH33 antibody or DAPI to detect the intestinal cells and cell nuclei, respectively. Embryos die at 1.5 fold stage, just before elongation starts; DAPI shows that Wt and mutants have a similar number of nuclei, indicating a similar developmental stage. Bar, 10 µm. The percentage of gut-defective embryos of the various genotypes, quantified as described in gex-3(zu196) we used a balanced heterozygous strain OX169 gex-3(zu196)/DnT1 in which only 25% of the progeny is homozygous for gex-3(zu196) according to Mendelian distribution. Nearly 100% of these homozygous gex-3(zu196) embryos display the morphogenetic intestinal defect as previously reported . Data are the mean±s.e.m. (n = 100) of at least three independent experiments. P<0.0001, two-tailed t-test is indicated by an asterisk. (B) Intestinal morphology of Wt and mutant embryo at different stages of development. Wt and toca-1;toca-2 mutant worms were fixed and stained with anti-MH33 antibody. All dying ; A significant fraction of toca-1;toca-2 embryos display altered intestinal morphology with enlargement of the intestinal lumen at the 2 fold stage with respect to Wt. Of note, at this stage it is easy to appreciate that MH33 display an apical distribution as previously reported (right). Bar, 10 µm. (C) toca-1;toca-2 Gex (Gut on the exterior) embryos display an altered epidermal cell morphology typical of gex mutants. Left, lateral and ventral view of Wt and toca-1;toca-2 expressing AJM-1::GFP. Right, a scheme of the morphogenetic defects caused by loss of toca-1 and toca-2. Loss of tocas leads to the distinctive Gex (Gut on the exterior) phenotype due to failures in cell movement and cell shape changes. Lateral view: gex embryos fail to initiate epidermal ventral movements. By 400 min after first cleavage, Wt embryos initiate circumferential constrictions to squeeze the embryo into a worm. gex embryos undergo constriction that leads the epidermis to collapse inwardly. The internal organs (pharynx and intestine) end morphogenesis exposed on the ventral surface. Ventral view: in gex embryos epidermal cells fails to correctly migrate to the ventral side as in the Wt. Arrows indicate epidermal cells. Bar, 10 µm.Intestinal morphology defects of (2.88 MB TIF)Click here for additional data file.Figure S6toca-1;toca-2 mutant embryos are slightly higher than wt embryos. Quantification of AJM-1 along the cell perimeter of hypodermal cells in WT and toca-1;toca2 mutant embryos. Embryos at the two-cell stage were kept at 22° for 5 hours before fixation between 360 and 400 min, as indicated, when the “bean shape stage” was reached. Embryos were stained with anti-actin (not shown). The second and third raw images were used to determine the levels of F-actin at junctions as described in C. elegans, but rather associates with apical junctional molecules and thus presumably reflects the cell surface levels of such transmembrane proteins. P<0.0002, two-tailed t-test is indicated by asterisks.The surface levels of AJM-1 of (1.75 MB TIF)Click here for additional data file.Figure S7Biochemical interactions of Toca-1 protein in mammalian cells. The SH3 domain of mammalian TOCA-1 binds to N-WASP and WIP. (A) Purified N-WASP was incubated with the indicated SH3-GST fusion proteins (10 µg). Input and bound N-WASP and GST fusion proteins were detected with the antibodies indicated on the right. (B) Lysates (1 mg) from HeLa cells were incubated with the indicated SH3-GST fusion proteins (10 µg). Lysates (50 µg), bound material, and GST proteins were detected by immunoblotting with the indicated antibodies. (C) The SH3 domain of mammalian TOCA-1 binds to ABI1 and WAVE2. Lysates (2 mg) of HeLa cells were incubated with the SH3 domain indicated (SH3-GST) or GST alone as control (GST). Lysates (100 µg) and bound proteins were immunoblotted with the indicated antibodies. (D) CIP4 and FBP17 interact with ABI1. Lysates of HeLa cells expressing ABI1-HA alone or in combination with CIP4-GFP or FBP17-GFP were immunoprecipitated (IP) with anti-ABI1 antibody. Lysate and IP were immunoblotted with antibodies indicated on the right.(1.31 MB TIF)Click here for additional data file.Figure S8toca-1/2; iii) the biochemical link between TOCA-1/2 and ABI1, which is conserved also in mammals. The WAVE (WVE-1) complex may function in later endocytic steps of CME since, at least, in mammals it does not localize to Clathrin-coats at the plasma Membrane . The precise relation of the WAVE (WVE-1) complex with CDC42/TOCA-1/2 is unclear at present. However, TOCA-2 appears dominant with respect to TOCA-1. TOCA1/2 may also directly associate to Dynamin , whose pinching activity is critical to promote vesicle scission. Dynamin- and actin-dependent activities may work in concert with TOCA-1/2 to promote tubule scission. Other F-BAR containing proteins, such as Nostrin may add further layers of complexity to this network, which may coordinate membrane tubulation and curvature sensing with the activity (WASP/WSP-1) . Green lines indicate potential genetic interactions; black line indicates genetic and/or biochemical interactions.Working model of TOCA proteins signalling network in the regulation of membrane trafficking. Working model of TOCA proteins signalling network in the regulation of membrane trafficking. TOCA-1 and TOCA-2 may link nucleating promoting factors to the plasma membrane (not shown) via their F-BAR domain and integrate signalling pathways controlled by the small GTPases Cdc42. A Cdc42/WASP(WSP-1)/TOCA-1/2, in analogy to that demonstrated in mammalian , may directly promote localized actin dynamics during early steps of Clathrin-mediated endocytosis (CME). The polarity complex PAR-3/PAR-6 whose activity is required for endocytic and recycling events downstream of Cdc42 may define an alternative branch of the pathway that may also converge in controlling the TOCA-1/2/WASP(WSP-1) axis. An unexpected contribution of the WAVE(WVE-1) axis in this process is evidenced by; i) the increased accumulation of YP170 after interference with WAVE (WVE-1) complex components; ii) the genetic interactions of these latter genes with (0.16 MB TIF)Click here for additional data file.Text S1Supplementary Materials and Methods.(0.04 MB DOC)Click here for additional data file.Video S1toca-1;toca-2 double mutants show a Gex phenotype. Time-lapse observation of embryogenesis with Nomarski microscopy of Wt and toca-1;toca-2 double mutant worms. Movie recording started approximately 300 min after first cleavage. Frames (451) were taken every 1 min for a total of 7 1/2 hours.(1.78 MB AVI)Click here for additional data file.

We performed these studies using a highly relevant in vivo model of mucosal HIV-1 transmission, humanized Bone marrow/Liver/Thymus mice (BLT). BLT mice are susceptible to HIV-1 infection via three major physiological routes of viral transmission: vaginal, rectal and intravenous. Our results show that BLT mice given systemic antiretroviral PrEP are efficiently protected from HIV-1 infection regardless of the route of exposure. Specifically, systemic antiretroviral PrEP with emtricitabine and tenofovir disoproxil fumarate prevented both rectal and intravenous HIV-1 transmission. Our results indicate that antiretroviral PrEP has the potential to be broadly effective at preventing new rectal or intravenous HIV transmissions in targeted high risk individuals. These in vivo preclinical findings provide strong experimental evidence supporting the potential clinical implementation of antiretroviral based pre-exposure prophylactic measures to prevent the spread of HIV/AIDS.Successful antiretroviral pre-exposure prophylaxis (PrEP) for mucosal and intravenous HIV-1 transmission could reduce new infections among targeted high-risk populations including discordant couples, injection drug users, high-risk women and men who have sex with men. Targeted antiretroviral PrEP could be particularly effective at slowing the spread of HIV-1 if a single antiretroviral combination were found to be broadly protective across multiple routes of transmission. Therefore, we designed our Preventing the spread of HIV to new individuals is critical to stopping the HIV/AIDS pandemic. However, few successful strategies to prevent HIV transmissions currently exist de novo generated human immune cells and HIV being transmitted via physiological routes in the context of highly active antiretroviral drugs. In addition, such a model should be affordable, available to many investigators and capable of providing relatively rapid feedback on the efficacy of any intervention being evaluated. To this end, we chose the humanized Bone marrow/Liver/Thymus (BLT) mouse as our experimental system We performed comprehensive efficacy studies to determine whether a single antiretroviral PrEP approach can protect from multiple routes of HIV transmission using a uniform and highly relevant experimental platform. When choosing a model system to perform PrEP efficacy studies, it was important to identify critical characteristics that the system would have to exhibit in order to study HIV prevention modalities. Such a model would permit studying the interplay between + T cells, macrophages and dendritic cells) that encompasses the peripheral blood and the rectal and vaginal mucosa rendering BLT mice susceptible to intravenous and mucosal HIV-1 infection in vivo preclinical evaluation of HIV prevention modalities Humanized BLT mice are individually bioengineered to exhibit a complete, systemic, self-renewing reconstitution of all major human hematopoietic lineages including T, B, monocyte/macrophage, dendritic and natural killer cells that facilitates the generation of functional human immune responses in vivo preclinical efficacy data shows that systemic antiretroviral PrEP provides strong protection against HIV-1 infection regardless of the route of transmission.To date, the majority of HIV prevention research has focused on the assessment of the safety and effectiveness of products capable of preventing HIV transmission via the vaginal compartment. Receptive anal intercourse is common among men who have sex with men and rectal transmission is a major driving force of the AIDS pandemic + cells and monitored for human reconstitution in peripheral blood by flow cytometry BLT mice were prepared essentially as previously described JR-CSFStocks of HIV-1In this study, the primary endpoint was determining whether a given intervention protected BLT mice from HIV-1 transmission. To ensure that the most stringent criteria were met by the intervention, we designed a high threshold defining “protection”. We defined “protection” in treated groups as the complete absence of any evidence of infection, such that protected mice had no positive results for the presence of HIV by any method of analysis at any time point tested. A positive result for the presence of HIV-1 from any treated animal by any method indicated a lack of protection referred to as “breakthrough” infection.Infection of BLT mice with HIV-1 was monitored in peripheral blood by determining plasma levels of viral antigenemia , levels of viral RNA in plasma and levels of viral DNA in peripheral blood cells as previously described All statistical analyses were performed in Prism version 5 . Kaplan-Meyer plots indicate the percentage of animals that are HIV-1 positive in the peripheral blood by each time point. Tick marks on the curves represent the time point at which HIV-1 negative animals were censored from the analysis.+) cells in their peripheral blood . In addial blood .+ T cells (flow cytometry). In contrast, 12 of 19 non-treated control mice became HIV-1 positive ; Table 1We confirmed the lack of rectal HIV-1 transmission in BLT mice treated systemically with FTC/TDF using a comprehensive set of highly sensitive analytical techniques aimed at detecting the presence of HIV-1 in tissues. Specifically, we analyzed several tissues from these mice for evidence of viral RNA expression (in situ hybridization), replication competent virus or viral DNA . All tissues analyzed by each method for each mouse are detailed in JR-CSF 3 hours after the administration of the third of 7 consecutive daily doses of FTC/TDF ; Table 2+ T cells or plasma viral RNA ; Table 2in vivo preclinical evidence supporting the hypothesis that systemic antiretroviral PrEP can provide broad protection from HIV transmission. Our results obtained using a highly relevant in vivo model of HIV transmission show that systemic antiretroviral PrEP can effectively prevent rectal and intravenous HIV-1 infection. It is important to note that systemic antiretroviral PrEP with a single drug combination prevents infection of BLT mice by the three most common routes of human HIV-1 transmission. The highly encouraging results from this comprehensive evaluation of antiretroviral PrEP efficacy serve as strong proof of principle for this approach and have major implications for the continued planning and implementation of future and current PrEP studies.In this manuscript, we provide Approaches aimed at obtaining protection from all potential modes of transmission are highly significant. Individually, unprotected vaginal intercourse accounts for the vast majority of new HIV transmissions globally in vivo preclinical data substantiating a broad prevention approach using a single drug combination to prevent three routes of transmission had been lacking. In vivo data on the efficacy of PrEP with FTC/TDF had been limited to two reports relating to mucosal transmission. In one study, we showed that systemic PrEP with FTC/TDF can effectively prevent vaginal HIV-1 transmission in BLT mice Until this study, When considering such broad use of antiretrovirals as prophylaxis, there is an issue of major importance that must be addressed. In humans, lack of strict compliance to PrEP regimens could increase the likelihood of drug resistance being developed in the event of breakthrough infection. Therefore broad antiretroviral use can result in increased emergence of resistance to the drug(s) when infections do occur mne in long-tailed macaques mac251/32H or SHIVSF162P3 have also been reported with this compound Results obtained using humanized BLT mice must be considered in the context of previous studies of antiretrovirals for HIV prevention performed in other models such as non-human primates. Experiments performed using non-human primates have provided evidence for the use of tenofovir (PMPA) to prevent intravenous infection by SIVWhile our findings and those from non-human primate research suggest that antiretroviral PrEP can prevent HIV transmission, neither model has been shown to predict efficacy or safety in humans. This limitation exists because there is still no evidence of efficacy for antiretrovirals in preventing vaginal, rectal or intravenous transmission in humans In conclusion, we provide preclinical evidence regarding the potential efficacy of an antiretroviral pre-exposure prophylactic approach to prevent vaginal, rectal and intravenous HIV-1 transmission. Our results provide strong support for the continued implementation of clinical trials using targeted antiretroviral pre-exposure prophylaxis for all the major routes of HIV transmission contributing to the HIV/AIDS pandemic.

Sophisticated diagnostic modalities such as a large number of biomarkers and advanced imaging tools have become common nowadays and pose challenges in analysis, modelling and interpretation of the high-dimensional data these modalities yield. These challenges motivate researchers to develop complex mathematical and statistical models using innovative and efficient analytic methods. To complicate the issue, omitted variables and missing data are frequently encountered and need to be dealt with carefully. In various therapeutic areas, the high-dimensional data require new visualization and analytic tools. The overall purpose of this Theme Issue is to present newly developed innovative mathematical and statistical modelling and analytic approaches for complex diagnostic and therapeutic data. The social impact of this body of work is to improve therapeutic outcomes by evaluating the accuracy, reliability in medical diagnoses and treatments by analysing complex biomarkers and multivariate data.There have been a number of recent developments in the mathematical and statistical modelling of the processes generating clinical data, as well as improved methods of assessing whether deviations from the ‘ideal’ assumptions, which often arise in practice, could seriously affect the scientific conclusions. For example, clinical data pertaining to biomarkers and assays, missing data and high-dimensional medical image analyses are at the forefront of current medical treatments. Traditionally, almost all statistical methods assume that the data satisfy a few important assumptions and contain information about the variables related to the response under investigation. In practice, however, most datasets are imperfect, i.e. some may not be possible to obtain complete measurements for all potentially relevant variables. Inevitably, critics of a study point out these deviations from a ‘perfect’ study to cast doubt about the main findings. Sensitivity analysis has become an established method for assessing whether a ‘flaw’ in an otherwise competent study could ‘explain’ or ‘mask’ a scientifically valid association. The article by Concerning the policies on a national level, the US National Institutes of Health reported on medical errors , while the UK Department of Health report ‘An organisation with a memory’ emphasized the need for a structured response to the previously less-recognized problem of medical errors in healthcare and statistics . To name a few more, By developing these new methods in this Theme Issue, the authors and the editors hope that they will ultimately benefit clinical and scientific readers.

This paper reviews some of our recent applications of computational fluid dynamics (CFD) to model heat and mass transfer problems in neonatology and investigates the major heat and mass-transfer mechanisms taking place in medical devices, such as incubators, radiant warmers and oxygen hoods. It is shown that CFD simulations are very flexible tools that can take into account all modes of heat transfer in assisting neonatal care and improving the design of medical devices. While full-term and healthy neonates are able to regulate their body temperature, premature and sick infants may often have difficulties keeping their body temperature at a constant level without external assistance. Owing to this immaturity of their thermoregulation system, they can suffer from cold stress and hypothermia, increasing the morbidity and mortality of premature and sick newborns . For thiMedical devices to assist the thermoregulation of neonates include incubators, radiant warmers and heated mattresses, the first two being of common use in hospitals. Incubators were invented first, and provide an enclosed environment with warm air circulating inside the device. Radiant warmers are open devices, consisting of a radiant heater placed above a neonate lying on a crib. The main advantage of these devices over incubators is the ease of access to the neonate, which enables various medical interventions. The main drawback is that they increase evaporative heat losses, which may result in dehydration in the case of very premature babies.Oxygen hoods are commonly used devices to deliver supplemental oxygen to neonates. An air–oxygen blender is often used with oxygen hoods to administer gas when a precise dose of oxygen is required. Hoods are a versatile method of oxygen delivery that can be used on neonates in an incubator or under a radiant warmer has been greatly developed over the last decade, mostly due to the rapid advance of computer technology. It is now possible to simulate complex scientific problems including several combined processes taking place simultaneously. CFD techniques have been successfully used to describe the thermal interaction between the human body and its surrounding environment e.g. . Howeveret al. et al. This paper reviews some of our recent applications of CFD to problems in neonatology, and discusses the mechanisms of metabolic heat generation and sensible and latent heat losses, including heat conduction, convection, radiation and evaporation. The paper follows previous studies by the authors , was then developed and fully integrated into the main solver via user-defined functions tudio MAX et al. 2 h)−1. Such a high evaporation rate would result in 3.6 W of latent heat loss caused by the evaporation process for the 900 g infant analysed in the previous validation case. At the same time, the metabolic heat generated by the infant, based on the equation proposed by  Water loss from the infant’s skin is only part of the total water losses due to evaporation. A similar process occurs within the lungs during respiration. The IHBM module possesses the capability of calculating both the respiratory and transepidermal water losses from the infant’s body.4.A series of validation tests has been performed based on extensive studies of The validation of results has been performed with respect to experimental measurements available in The experiments of °C and 36.8°C, respectively, while the corresponding data obtained by °C and 36.3±0.1°C.The mean skin temperature for the infant was calculated in the CFD simulations as a weighted average of each computational face representing the infant’s skin. The body core temperature was calculated as the maximum temperature within the infant’s body. The CFD results for the mean skin temperature and the body core temperature were 35.4CFD simulations were then performed for nine different ambient conditions, in which the air humidity ranged from 20 to 60 per cent. Air temperature and velocity are kept constant in all simulations. The results from the CFD simulations are compared with the experimental data in The next validation test case concerns respiration heat losses. To validate this last remaining component of the infant heat balance, four different cases were investigated by making use of the full capabilities of the IHBM module. The validation tests were performed on the basis of experimental data for respiratory heat losses obtained by °C, while the maximum difference for the average skin temperature was less than 0.8°C. These results indicate good accuracy of the CFD calculations, in line with the previous cases. The difference between the experimental and numerical results can be justified by the lack of some of the data necessary to fully describe the model in In the first stage, deep body and skin temperatures have been compared with the corresponding experimental data a, the radiant warmer contains the neonate’s crib and a radiant lamp placed above it. The lamp is better visible in figure 2b, while the geometry of the lamp built for the purpose of numerical simulations is shown in figure 2c. The radiant lamp consists of a cylindrical heat source surrounded by parabolic reflecting surfaces. The endings of the lamp are ‘cold endings’, as no heat generation occurs there. Baffles are placed perpendicular to the tube and the parabolic reflector to shield the rear of the lamp from the radiant heat. The importance of the presence of these baffles will be investigated in future research.The initial data for this series of simulations were based on the information found in figure 2c.Temperature measurements on a CosyCot infant warmer, both with and without a neonate, were taken at Hammersmith Hospital using a Flir thermal camera. Fisher & Paykel has also provided some data on the emissivity of the radiant warmer surfaces, as well as the temperatures of the radiating element inside the lamp. In addition, they have provided the dimensions of the radiant lamp, making it possible to create a realistic model as shown in figure 2Contrary to incubators, radiant warmers are open devices with no external walls. Because the modelling of the whole room with the radiant warmer inside would be too computationally expensive, the domain for the numerical simulation had to be limited by artificial boundaries, with boundary conditions of pressure inlet and pressure outlet. Several tests were performed to find the optimum dimensions of the computational domain for which the artificial boundaries would not significantly interfere in the air flow and heat transfer between the radiant warmer and the newborn. A domain with dimensions of 2×2×2.17 m (length×width×height) was found to provide a good compromise between numerical accuracy and computer efficiency. Moreover, according to the dimensions of the CosyCot warmer, the mattress is square with side length of 61 cm, placed at a height of 90 cm. The lamp is situated 71 cm above the top surface of the mattress. The modelling of the lamp is crucial in this model. Namely, the parabolic reflector surrounding the heat source tube reflects the radiation in a mirror-like manner. Together with locating the tube in the focal position of the parabola, the mirror-like reflection of the radiator enables the heat radiation to be directed towards the infant rather than being scattered in all directions.The calculations have to be performed in a particular manner to improve the convergence of the CFD solver during the iterative process. Initially, only natural convection from the baby is considered, with the radiator off and no radiation modelled. In the next step, radiation is included in the model, while in the final step the radiant warmer is switched on. Transient calculations are performed to improve convergence, leading to a steady-state solution.d shows the convective plume created over the neonate (in the symmetry plane of the domain) due to natural convection. The temperature scale in this figure has been lowered to 42°C in order to visibly present the convective plume. However, the maximum temperatures occurring at the bottom of the radiant lamp are much higher, where the air is in contact with the surface of the lamp. The natural convection phenomenon is difficult to model because of the instability of this physical setup. For this reason, at this stage of research, many simplifications have been made to the model. The research on radiant warmers is still on-going and only preliminary results have been obtained so far. More details of some of the different models created at this stage can be found in The temperature field presented in figure 2The results presented in (b)The ability to model respiration as a transient process is very important in some situations, e.g. those including oxygen concentration studies and drug delivery. For this reason, a series of simulations has been performed in order to investigate the distribution of oxygen concentration under an oxygen hood. The relatively small dimensions of this device enhanced the importance of the respiration process on the overall air flow pattern surrounding the infant. The computational domain for the calculations included only the head of the infant placed under the oxygen hood. The hood geometry was created based on information from the manufacturer. However, it must be stressed that the numerical simulations have not been validated and the manufacturer only provided a brief description of the model.The quality of the mesh was, once again, verified by mesh-independence tests, which focused on node distribution, cell shape and smoothness. As usual, the mesh was more refined near the salient features of the flow . Rapid changes in the cell volume between adjacent cells were avoided to minimize truncation errors. The aspect ratio of the cells was kept at less than 5 : 1, and their skewness was also controlled to avoid the appearance of degenerated cells. The final computational domain is presented in k–ε turbulence model was used in the calculations due to the high Reynolds numbers at the exhaled stage of breathing. All calculations were performed for the same infant characteristics as in the previous validation case regarding respiration heat losses. In order to limit the number of cells in the simulation, the centre plane was considered as a plane of symmetry. Air was considered to be a multispecies mixture of oxygen, nitrogen, carbon dioxide and water vapour. An incompressible ideal gas law was employed to take into account density variations caused by temperature differences.The Velocity boundary conditions were set at the inlets to the computational domain and at the infant nostrils, using the information provided by The numerical simulation was performed for a time interval of 25 min of regular breathing, and aimed at demonstrating the potential capabilities of CFD techniques for transient modelling of the respiration process. Hence, the results obtained at this point have not been validated. However, several important conclusions can be obtained. For example, the oxygen concentrations in the air provided to the oxygen hood and in the air inhaled by the infant are considerably different. The respiration pattern and other related parameters will also influence the oxygen concentration in the inhaled air. CFD techniques can help in determining the level of oxygen concentration and the optimum position of the infant’s head under the hood. 5.Our current research aims at developing an advanced thermoregulation model for neonates, which will include the modelling of the temperature distributions inside the neonate’s head. The model will allow numerical simulations of brain cooling as a contribution to the investigation on the use of hypothermia for the treatment of perinatal asphyxial encephalopathy.°C have been reported in infants with encephalopathy, with the aim of determining whether the use of body cooling following perinatal asphyxia is a safe treatment that will improve survival and reduce neurological and neurodevelopmental impairments (Perinatal asphyxia causing moderate or severe encephalopathy occurs in approximately two of 1000 births. Causes include damage to the umbilical cord, detachment of the placenta or rupture of the uterus during labour. There is an increasing risk of death or neurodevelopmental abnormalities with more severe encephalopathy. In full-term newborns, perinatal asphyxia may account for up to 30 per cent of cases of cerebral palsy. At present there is no specific treatment for asphyxia other than stabilization with treatment to reduce seizures. Pilot studies of head cooling combined with mild whole-body hypothermia and of moderate whole-body cooling to 33–34airments .°C temperature within 30 mins’ criterion.Previous theoretical research suggests that it is uncertain whether head cooling alone is effective in lowering deep brain temperature. According to Results of studies by An alternative technique involves whole-body cooling. This technique would allow the use of much simpler and cheaper devices such as cooling mattress to achieve the same brain cooling results. Substantial theoretical extensions to our current model are required for brain cooling studies, with the development and implementation of suitable techniques to predict detailed temperature distributions in the deep brain via the combination of a simplified whole-body thermoregulatory technique with an advanced head cooling model.The regulatory processes that control the cerebral blood flow depend on the mean arterial blood pressure and on physiological parameters, including the partial pressure of oxygen, the partial pressure of carbon dioxide and the cerebral metabolic rate of oxygen consumption, which is also affected by the tissue temperature. The effect of these regulatory mechanisms on cerebral blood flow has been confirmed by the experimental findings of The new thermoregulation model for neonates will incorporate the effect of cerebral blood flow on metabolic heat rate via the Pennes bioheat equation. The consideration of temperature-dependent metabolic heat generation is also important in this case since it is known that the assumption of constant metabolic heat generation is only valid for healthy conditions (The above developments have been initiated, and it is predicted that the resulting thermoregulation model for neonates will then be coupled with the CFD model for heat exchange with the ambient environment. The complete model will be validated with clinical data from the TOBY trial, which enrolled 325 infants (6.This paper presented an overview of CFD studies of the heat balance in neonates. The CFD simulations have been validated against experimental measurements from the medical literature, and proved to be reasonably accurate in estimating the core and skin temperatures of infants nursed within incubators. The study also demonstrated the CFD capabilities of simulating the transient processes occurring within oxygen hoods. These studies aim at optimizing the design of medical devices used in neonatology, in order to improve their performance.A recently started research investigates design improvements to radiant warmers, which are used to nurse unstable neonates requiring continuous interventions. As the infants are nursed in an open environment, a large amount of radiant heat is lost to the surroundings. Furthermore, as the neonates may be observed under a radiant warmer for several hours, water losses may be up to 50 per cent higher than in incubators, increasing the risk of dehydration . The usuA further new study aims at helping to determine whether the use of body cooling following perinatal asphyxia is a safe treatment that will improve survival and reduce neurological and neurodevelopmental impairments. These computer trials will test the feasibility of brain cooling using different types of cooling mattresses and body wrappers, and have the potential to reduce the number of clinical trials normally required for this type of study.

BRCA1 and BRCA2, as well as by the joint multiplicative effects of many genes (polygenic component). We have now updated BOADICEA using additional family data from two UK population-based studies of breast cancer and family data from BRCA1 and BRCA2 carriers identified by 22 population-based studies of breast or ovarian cancer. The combined data set includes 2785 families (301 BRCA1 positive and 236 BRCA2 positive). Incidences were smoothed using locally weighted regression techniques to avoid large variations between adjacent intervals. A birth cohort effect on the cancer risks was implemented, whereby each individual was assumed to develop cancer according to calendar period-specific incidences. The fitted model predicts that the average breast cancer risks in carriers increase in more recent birth cohorts. For example, the average cumulative breast cancer risk to age 70 years among BRCA1 carriers is 50% for women born in 1920–1929 and 58% among women born after 1950. The model was further extended to take into account the risks of male breast, prostate and pancreatic cancer, and to allow for the risk of multiple cancers. BOADICEA can be used to predict carrier probabilities and cancer risks to individuals with any family history, and has been implemented in a user-friendly Web-based program (http://www.srl.cam.ac.uk/genepi/boadicea/boadicea_home.html).Multiple genetic loci confer susceptibility to breast and ovarian cancers. We have previously developed a model (BOADICEA) under which susceptibility to breast cancer is explained by mutations in BRCA1 and BRCA2 account for approximately 15% of this excess familial risk . Direct evidence for the polygenic basis of the residual familial clustering not due to BRCA1 and BRCA2 mutations has more recently been provided by the identification of further loci that confer moderate risks, including mutations in CHEK2, ATM, PALB2, BRIP1 BRCA2 carriers are at an increased risk of developing breast cancer The Anglian Breast Cancer Study . The families were identified through 1484 women with breast cancer diagnosed before the age of 55 years and registered in the East Anglian Cancer Registry between 1991 and 1996. These index cases were invited to provide blood samples and complete an epidemiological questionnaire, including family history of cancer in all first-degree relatives. The blood samples were tested for germline mutations in BRCA1 and BRCA2 using conformation-sensitive gel electrophoresis (CSGE). Mutations were confirmed by sequencing. These data were used in the initial model development and the study is described in more detail elsewhere ((b) UK National Case–Control Study (UK). Women with breast cancer were identified through two UK population-based case–control studies. The first study involved 755 patients diagnosed under the age of 36 years and registered between 1982 and 1985. The second study included 644 patients diagnosed from age 36 to 45 years and registered between 1988 and 1989. These index cases provided family history information of breast and ovarian cancer and were later contacted to provide blood samples. DNA was screened for germline mutations in BRCA1 and BRCA2 by heteroduplex analysis. Again, mutations were confirmed by sequencing. In all, 617 samples were tested for BRCA1 and BRCA2 mutations and were included in our analysis. This data set is described in detail elsewhere ((c) The Manchester Study. Women diagnosed with breast cancer at or before the age of 30 years were recruited via the North West Regional Cancer Registry (UK) between 1980 and 1997. A total of 99 index cases provided blood samples, which were screened for mutations in BRCA1 and BRCA2 using a combination of the Protein truncation test, single-strand conformation polymorphism/heteroduplex analysis and fluorescent chemical cleavage of mismatch analysis. Three-generational pedigrees were constructed through interviews and were augmented with data from hospital notes. The study is described in (d) Multiple case families: ‘British’ (B) families. In all, 156 families were ascertained in response to national publicity in the United Kingdom and by referral by oncologists or general practitioners. Eligibility was restricted to families with at least two breast cancer cases, one or more diagnosed before the age of 50 years. Occurrence of cancer and follow-up was recorded on all family members. One or more individuals from each family provided blood samples, which were analysed for BRCA1 and BRCA2 mutations using CSGE ((e) Meta-analysis families (BRCA families). This data set included pedigree data from BRCA1 and BRCA2 mutation carriers identified in 22 population-based studies of breast or ovarian cancer patients reported by BRCA1 and/or BRCA2 mutations by systematic screening, and family history information had to be available on all first-degree relatives of identified mutation carriers. To avoid replication, the families of mutation carriers identified through the ABC, UK and Manchester studies were not considered to be part of the BRCA families for the present analysis. A total of 429 families of BRCA1 and BRCA2 mutation carriers were included in the present analysis.BRCA1 and BRCA2 mutations were considered to be disease causing if they were classified pathogenic according to the generally accepted criteria (http://research.nhgri.nih.gov/projects/bic/). For consistency across the population-based studies , family history information was restricted to the first-degree relatives of the index cases.Model fitting was performed using complex segregation analysis of breast and ovarian cancer occurrences in the combined set of families described above. Individuals were followed from birth and were censored at the age of cancer occurrence, age at death or at the age of 70 years whichever occurred first. Female patients with no age information or no year of birth were censored at age 0 .BRCA1, BRCA2 and a polygenic component representing the combined multiplicative effect of multiple loci of small effect. This model is consistent with the recent discovery of multiple low-risk susceptibility genes (and the failure to identify any further ‘high-risk’ loci by linkage) =λ0(t)exp(Gi(t)+Pi(t)), where λ0(t) is the baseline incidence for the cohort, Gi(t) represents the major gene effect at age t and Pi(t) is the polygenic effect assumed to be normally distributed with mean zero and variance σ2(t). The polygenic component was approximated by the hypergeometric polygenic model acts on BRCA1 and BRCA2 background, the polygenic component is referred to as the ‘modifying’ component. In this analysis, we generalised the model to allow for different polygenic and modifying variances in mutation carriers and noncarriers. We also fitted models in which the polygenic and modifying variance was age dependent.The breast cancer incidence for individual ic model . More deGi(t), Pi(t)) were assumed not to vary by birth cohort. Owing to this constraint, the estimated incidences for BRCA1 and BRCA2 carriers and noncarriers were themselves cohort specific.The breast and ovarian cancer incidences were assumed to be calendar period and cohort specific, based on the incidences for England and Wales used in the regression specifies the degree of smoothness. Various degrees of smoothness were investigated and the resulting set of incidences was compared with the original set of incidences for adherence. As a smoothness criterion, we used the sum of the absolute values of the third-order finite differences of the smoothed incidences: Published incidences are reported in 5-year intervals, which can result in large variations in the incidences between adjacent age intervals. This is particularly an issue for chniques . This meχ2 test statistic, treating the smoothed incidences as expected values. However, formal tests of significance were not performed because of the difficulty in determining the correct number of degrees of freedom for the test.Smaller values of the sum (*) correspond to smoother incidence curves. Consistency of the model with the data was assessed using a BRCA1 and BRCA2 log-relative risks (Gi(t)) for both breast and ovarian cancer. Our primary analysis involved fitting models in which the relative risks are assumed to be constant within each decade of age . Once the most parsimonious model for the form of the polygenic and modifying variance was chosen, we fitted additional models in which the log-relative hazards were piecewise linear functions of age . Variants of uncertain significance (VUSs) were assumed to be equivalent to a BRCA1- and BRCA2-negative test, since this is how they are treated in clinical genetics and in analyses testing the goodness of fit of the model. Although some such variants may be pathogenic, this effect is allowed for in the model by the mutation sensitivity parameter . For the relatives of index patients who were screened for family-specific mutations, we assumed that the test was 100% sensitive.To allow for the fact that not all mutations could be detected by the screening methods used, we allowed in our analysis for a sensitivity of mutation testing parameter, giving the probability of detecting a mutation if one exists. We assumed that 70 and 80%, respectively, of the disease-causing mutations in Nested models were compared against each other using the likelihood ratio test. The Akaike Information Criterion (AIC) was used to compare non-nested models .BRCA1 and BRCA2 allele frequencies in the population and the natural logarithm of the ratios of the breast and ovarian cancer incidences in BRCA1 and BRCA2 mutation carriers to the population incidences (relative hazards). Parameters were estimated by maximum likelihood, and their variances were obtained from the observed information matrix. To obtain confidence intervals for parameters with restricted ranges we used transformations to obtain parameters that are likely to be more normally distributed . The graduated calendar- and cohort-specific incidences included the age-specific features for all cohorts observed in the general population (data not shown) . On the BRCA1 and BRCA2 relative hazards were assumed to be constant within each 10-year interval: 20–29, 30–39, 40–49, 50–59 and 60–69 years. In the first model, the polygenic and modifying variances were constrained to be equal. In the second model, the polygenic variance was allowed to be different from the modifying variance, but the latter was constrained to be the same for BRCA1 and BRCA2 carriers. In the third model, the polygenic variance and the BRCA1 and BRCA2 modifying variances were all allowed to vary. In each of these models, the polygenic and modifying variance were assumed to be constant with age. We found no evidence that the BRCA1- and BRCA2-modifying variances were different from each other (P=0.76). The modifying variance was estimated to be somewhat lower than the polygenic variance (1.55 vs 2.02), but the difference was not significant (P=0.63). When a single polygenic/modifying variance was assumed, it was estimated to be 1.99 (95% CI: 1.54–2.57). This model had the lowest AIC value of the three models (7948.284). The BRCA1 and BRCA2 parameter estimates for this model are given in We first fitted three models, with different assumptions about the polygenic and modifying variances . For theP=0.30). The other two models assumed separate constant modifying variances, which were either constrained to be equal or different among BRCA1 and BRCA2 mutation carriers. These models also did not improve the fit significantly, compared with the model with a constant polygenic/modifying variance (P=0.53 and 0.65). The latter two models assumed constant modifying variances because models with varying modifying variances resulted in unbounded estimates.We then fitted three further models, for which the polygenic variance was allowed to vary by age group =σm2(t)=α+βt, where t represents the age in years, and estimated the parameters α and β . Compared with the model with a constant variance, there was some marginal evidence that this model fitted better (P=0.049).Despite the lack of a significant improvement in fit, the parameter estimates suggest that the polygenic variance may decrease with age. We explicitly allowed for this hypothesis by fitting a model in which the polygenic and modifying variances were the same linear function of age, that is, To investigate further the properties of these models, we computed the age-specific familial relative risks (FRRs) for an individual with an affected mother predicted by these two models as described elsewhere . The preBRCA1 and BRCA2 log-relative hazards to be piecewise linear functions of age and 0.10% (95% CI: 0.07–0.16%), respectively. These correspond to population carrier frequencies of 0.12% for BRCA1 and 0.20% for BRCA2. The average cumulative risks of breast and ovarian cancer in BRCA1 and BRCA2 mutation carriers based on this model are shown in BRCA1 carriers over all possible modifiers was estimated to be 46% by the age of 70 years for women born before 1920, rising to 59% for women born after 1950. On the basis of the 5th and 95th percentiles of the distribution of the polygenic/modifying component, the estimated cumulative breast cancer risks were 7.2 and 98%, respectively, for carriers born before 1920, rising to 12.0 and 99.9% for carriers born after 1950. The average cumulative risks of breast cancer in BRCA2 mutation carriers by the age of 70 years were estimated to be lower, 39% for women born before 1920 rising to 51% for those born after 1950 . The estimated ovarian cancer risks were highest for women born between 1930 and 1939, but the variation across the birth cohorts was smaller than for breast cancer. For BRCA1 mutation carriers, the ovarian cancer risk by the age of 70 years was estimated to be 33% for women born prior to 1920, rising to 36% for those born between 1920 and 1939, and then dropping to 34%. For BRCA2 mutation carriers, the corresponding risks were estimated to be 11, 12 and 11%, respectively. The predicted age-specific FRRs under this model are shown in The model with a linearly decreasing polygenic/modifying variance was extended to allow for the BRCA1 and BRCA2 mutation carriers were obtained by multiplying the cohort and calendar period age-specific incidence rates from the general population. Noncarriers were assumed to develop these cancers according to the population incidences.Since reliable data on these additional cancer types were not available in the main data set used to derive BOADICEA, we used instead estimated risks derived from the largest published studies see . We incoBRCA1 and BRCA2 alone cannot explain all the observed FRRs , was entirely due to the susceptibility as defined by the model . On the basis of this assumption, the contralateral breast cancer incidence after the first breast cancer, given the genotype, is half the breast incidence assumed in the standard model (since only one breast is at risk). Similarly, the incidence of a cancer at another site, after a first cancer diagnosis, was assumed to be the same as if the preceding cancer had not occurred, consistent with the assumption that the site-specific cancer risks are independent conditional on the genotype. The transition model for female patients in this extended BOADICEA model is depicted in BRCA1 and BRCA2 mutation carriers are now based on a much larger number of mutation-carrying families and are, therefore, more reliable; the variance of the polygenic component is now age dependent as opposed to constant; and the incidences vary gradually with age and are cohort and calendar period specific. In addition, the model has been extended to allow for the risks of male breast, prostate and pancreatic cancer, and the risks of other cancers after a first diagnosis.In this report, we have updated and extended our previously published model BOADICEA using additional data. There are several additional features in the updated model. The breast and ovarian cancer incidences in FGFR2 and TNRC9), the per allele odds ratio was higher below the age of 40 years, although not significantly so. Other studies have found that the relative risks associated with CHEK2 1100delC and ATM mutations are somewhat higher at young ages variances for carriers . HoweverBRCA1 and BRCA2 carriers. The majority of the current data came from families of unselected series of cases that had been previously used to estimate the BRCA1 and BRCA2 penetrance . In contrast, the estimates in BRCA1 and BRCA2 mutation carriers who have an affected first-degree relative (affected with breast cancer in most cases). Under the BOADICEA model, these women would be expected to have higher than average breast cancer risks, as demonstrated elsewhere . Users can either create a pedigree online, or can upload a pedigree file. The program allows for families of any size or structure; pedigrees built online are restricted to first- and second-degree relatives but uploaded files can be of arbitrary complexity. It has been shown that relatives more distant than second degree can provide important information for risk models of developing breast or ovarian cancer for unaffected individuals, or the risk of contralateral breast cancer or ovarian cancer for those who have already developed a first breast cancer. The code has also been modified to allow for the possibility that the individual is of Ashkenazi Jewish origin. This case requires separate consideration owing to the high prevalence of three founder mutations in this population reported in BRCA1 and BRCA2 mutation carriers, and the polygenic variance, were assumed to be the same in the Ashkenazi and non-Ashkenazi versions. Similar modification will be required for other populations where the frequencies of BRCA1 and BRCA2 mutations are different . These will be implemented at a later stage.The current version of BOADICEA has now been implemented as a user-friendly Web-based program ; tumour histological characteristics; and the inclusion of hormonal, reproductive and lifestyle risk factors.

Rarely, systemic lupus erythematosus (SLE) presents with bullous lesions due to severe edema and hydropic degeneration of the basal layer, or as a subepidermal blistering disease. Here, we describe two Mexican teenagers, one with SLE with blisters and another with bullous SLE. We also discuss the mechanisms and clinical implications of lesion formation in patients with SLE and bullae. Bullous lesions can occur in systemic lupus erythematosus (SLE) as a subepidermal blistering disease or when A 13-year-old female presented with a macular and vesicular eruption of 3 days duration. On examination, several 1 mm to 2 mm clear or hemorrhagic tense vesicles over erythematous macules were identified in the left supracilliary region and on the neck , C3 116 mg/dL (83-177)], proteinuria (2.3 g/day), and positive antinuclear antibodies . She also had positive anti-dsDNA antibodies, positive anti-Ro antibodies, positive low titer IgM (26 MPL) and IgG (21GPL) anticardiolipin antibodies. She was prescribed oral prednisone and received three methylprednisolone boluses. The current dermatosis coincided with a new episode of hemolytic anemia and resolved with slight depigmentation within 10 days, after a fourth methylprednisolone pulse.Histopathological study of a skin biopsy revealed a subepidermal blister with marked neutrophilic dermal infiltration Figure and a slThe patient did not experience another bullous eruption in the 3 years following that episode. Her SLE has predominantly been characterized by nephritis and hematologic disease, which have gradually resolved with cyclophosphamide, methylprednisolone boluses, and oral prednisone. During her most recent follow-up exam, cytotoxic treatment was suspended, oral prednisone was being tapered and hydroxychloroquine treatment had commenced.A 16-year-old female presented with a purpuric and bullous eruption of 7 days duration. On examination, several 3 cm to 6 cm nummular purpuric plaques were disseminated on her trunk and extremities. The surface of each plaque contained a clear-fluid blister that required aggressive antimicrobial treatment and the replacement of warfarin with low-dose aspirin.The patient had been diagnosed with SLE and secondary antiphospholipid syndrome (APS) 1 year prior to the onset of the dermatosis, based on hemolytic autoimmune anemia, lymphopenia, thrombocytopenia, proteinuria, serositis, cutaneous vasculitis, positive antinuclear antibodies, positive antiphospholipid antibodies, and a thrombus on the inferior cava vein. During the year prior to the onset of the bullous dermatosis, the patient had experienced several disease flares associated with persistent lymphopenia, with the main target organs being the central nervous system (vasculitis), kidney and liver. She was treated with methylprednisolone and cyclophosphamide boluses, as well as warfarin for APS, topiramate for seizures, and captopril for high blood pressure. During this period, the patient also developed warfarin skin necrosis and experienced three different septic events , the patient developed a pulmonary complication that was believed to be the result of sepsis. The patient later presented with pulmonary hemorrhage and death. Because all cultures were negative and aspirin had been inadvertently withdrawn several weeks before, it is not clear whether the final complication was due to a massive pulmonary thromboembolism or to septic shock.Blistering eruptions are rare cutaneous manifestations of SLE that can result from two distinct mechanisms, as illustrated by the two patients described here. In the first case, vesicles resulted from a subepidermal blistering disease with an acute neutrophil-predominant infiltrate in the upper dermis, known as bullous SLE ,13. In tBullous SLE is a rare, transient autoimmune bullous disease that occurs in established cases of SLE . It appeThe association of bullous SLE with lupus nephritis has been reported in adults -17. It ade novo expression of fibrillary collagens in the diseased renal extracellular matrix.The relationship between lupus nephritis and bullous SLE does not appear to be casual. Onetti Muda et. al demonstrSystemic lupus erythematosus is a multisystem heterogeneous autoimmune disease and auto-antibodies directed against several components of the cell have been described. It can be hypothesized that bullous SLE develops in patients with lupus nephritis once type VII collagen deposition has occurred in an abnormal location and antibody production towards this abnormally located protein has been initiated. Type VII collagen is the major component of anchoring fibrils at the dermal-epidermal junction, and is the target of autoimmunity in patients with bullous SLE . There hThe second patient described in this report developed SLE with blisters, which is also a rare manifestation of SLE both in adults and children. The actual incidence of this condition is difficult to ascertain, especially because some cases are reported under the term 'bullous SLE', even when the patients do not have the typical autoimmune blistering disease with acute neutrophilic upper dermal infiltrate and subepidermal separation, as well as positive direct immunofluorescence tests. However, of the 148 pediatric SLE cases that have been examined in our lupus clinic over the last 8 years, this is our first incidence of SLE with blisters.As opposed to bullous SLE, SLE with blisters has not been associated with specific systemic lupus manifestations and therefore does not necessarily imply a worse prognosis. This LE-specific lesion represents a severe dermo-epidermal edema, which is not directed towards specific antigens.The differential diagnosis of blistering eruptions in patients with SLE includes dermatitis herpetiformis and bullous pemphigoid which are clinically similar but can be differentiated by direct immunofluorescence. Bullous lesions in SLE due to photosensitivity, acute lupus or drugs can be differentiated by both histopathology and immunopathology. Epidermolysis bullosa acquisita (EBA) is histopathologically and immunopathologically identical since both are mediated by circulating antibodies against type VII collagen. However, a dramatic therapeutic response to dapsone in bullous SLE differentiates it from EBA . When inIt seems contradictory that the patient with bullous SLE continued to thrive, whereas the patient with SLE with blisters, which are apparently not associated with any further risk, had a fatal clinical course. However, the cause of death in the latter case could be related to an APS relapse when the patient developed what has been called "catastrophic APS" after low-dose aspirin was inadvertently withdrawn. There were no other signs or symptoms of SLE disease activity, cyclophosphamide had been stopped, and the prednisone dose was low. Therefore, the patient had a low risk of developing a septic event due to the immunosuppressive effects of medical treatment.The recognition and correct diagnosis of two different mechanisms of blistering production in SLE is mandatory, as bullous SLE implies the risk of lupus nephritis and can sometimes be the first manifestation of the disease ,21, wherClinical photographs were taken with oral consent from the parents in both cases. The identity of the patients cannot be disclosed from the reports and the clinical photographs do not reveal any recognizable feature of either. Besides, the Ethical Committee at our Hospital has found no objection to the publication of both cases.The authors declare that they have no competing interests.MSO and FER contributed in taking care of the patients, preparing the manuscript and reviewing the final draft. ELC and BLB contributed in reading the skin biopsies, preparing the manuscript and reviewing the final draft.

The diethyl ether ligand adopts a nearly planar W-type conformation.In the title compound, [Li(C DOI: 10.1107/S1600536809011556/dn2437Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Increases in obesity and other chronic conditions continue to fuel efforts for lifestyle behavior changes. However, many strategies do not address the impact of environment on lifestyle behaviors, particularly healthy dietary intake. This study explored the perceptions of environment on intake of fruits and vegetables in a cohort of 2,479 people recruited from 22 family practices in North Carolina.Participants were administered a health and social demographic survey. Formative assessment was conducted on a subsample of 32 people by using focus groups, semistructured individual interviews, community mapping, and photographs. Interviews and discussions were transcribed and content was analyzed using ATLAS.ti version 5. Survey data were evaluated for means, frequencies, and group differences.The 2,479 participants had a mean age of 52.8 years, mean body mass index (BMI) of 29.4, and were predominantly female, white, married, and high school graduates. The 32 subsample participants were older, heavier, and less educated. Some prevalent perceptions about contextual factors related to dietary intake included taste-bud fatigue (boredom with commonly eaten foods), life stresses, lack of forethought in meal planning, current health status, economic status, the ability to garden, lifetime dietary exposure, concerns about food safety, contradictory nutrition messages from the media, and variable work schedules.Perceptions about intake of fruits and vegetables intake are influenced by individual (intrinsic) and community (extrinsic) environmental factors. We suggest approaches for influencing behavior and changing perceptions using available resources. Lifestyle practices of unhealthy diet and physical inactivity are noted determinants of chronic conditions, especially overweight and obesity . NationaIn North Carolina, approximately 77% of adults do not consume the recommended daily intake of 5 or more servings of fruits and vegetables and 26% do not engage in leisure time physical activity ,4. TheseHistorically, most assessments of dietary and other lifestyle behaviors and attitudes have been conducted using survey methods. However, because of their systematic structure, surveys have been less able to contextualize individuals' experiences and perceptions and do not facilitate easy assessment of motivational factors and contexts underpinning peoples' behaviors . Nonetheformative assessment is used. Formative research has been used primarily by intervention researchers in community-based studies and has guided the development of several interventions . The NC-2. It was categorized according to Centers for Disease Control and Prevention guidelines . Comorbidity was measured as reported diagnosis of 1 or more of 18 chronic conditions. Some of the conditions assessed were heart disease, hypertension, diabetes, and depression. Comorbidity scores were calculated by summing the number of reported diagnoses. Body mass index (BMI) was calculated from self-reported weight and height, and was reported as weight in kilograms/(height in meters), ≥30.0) . The surThinking of the store where you do most of your grocery shopping, how would you rate the quality of their fresh fruits and vegetables?How would you rate the variety of their fresh fruits and vegetables?How would you rate the affordability of their fresh fruits and vegetables?excellent to not applicable and for the third question, very affordable to not applicable.The response options for the first 2 questions ranged from Participants were eligible to participate in focus group discussions if they had completed the telephone survey. Six of the 22 NC-FM-RN practices were chosen as recruitment sites, and patients from these sites were invited to participate first by letter and then by telephone calls. A total of 84 people were recruited, and 21 (25%) attended the discussion sessions. Seven focus groups, averaging 3 participants and lasting 1.5 hours, were conducted in 6 locations. Participants received a gift of $20. Sessions were arranged, facilitated, and audiotaped with participants' consent by 2 trained moderators and subsequently transcribed, coded, and analyzed using ATLAS.ti version 5.0 software . Nutrition-specific thematic content and coding analyses were further conducted (J.E.A.B.). Portions of the transcripts that addressed participants' reported consumption patterns of fresh fruits and vegetables and their perceptions of environmental influences on their nutrition behaviors were reviewed for emergent themes and compared across groups. Participants responded to the question, "Do you think about getting fruit and vegetables in your diet?"To broaden the range of perspectives, semistructured individual interviews were conducted with community members not demographically represented in the focus groups. These individuals were recruited from the same list used for the focus group participants. A total of 11 participants who were African American men, African American women, or white men were intentionally recruited to participate in telephone-administered interviews. This addition increased the formative assessment sample to 32.Before each focus group session, a cursory geographic assessment of each of the 6 localities was conducted. Research team members drove through the downtown sections of localities on the day of the session and identified physical assets that could serve as resources for or constraints to lifestyle behavior change. Relevant assets included the availability, type, and proximity of grocery stores, farm stands, restaurants, and convenience stores. This endeavor helped moderators to contextualize the behaviors and perceptions reported by the participants during the sessions.Participants were asked to identify and photograph factors in their environment that they perceived demonstrated a relationship between their community and health. They were each given a disposable camera and a photo-diary with instructions on how to document their thoughts about their photographs. They were also instructed that the purpose of this activity was to facilitate discussion and that the activity was not a requirement for participation in the discussions. Submitted photographs were coded as representative of barriers or facilitators if participants showed them to the group in their responses to nutrition questions or if the photographs noticeably related to nutrition.2 test of differences at the α = .05 level. The poverty rate by census block group variable was created by using 2000 census data, which indicated that 12.3% of the North Carolina population lives below the poverty level. Focus group transcripts were content-analyzed for prevalent perceptions related to fruit and vegetable intake as determined by income and poverty rate by census block group, education, and chronic disease status using χe intake . Identife intake and external environments, respectively.The framework includes individual (intrinsic), lifestyle-enabling, and external (extrinsic) environmental factors. Pictorially , the frad values . Positionterest" . FinallyThe survey sample N = 2,479) had a mean (SD) age of 52.8 (15.3) years, was predominantly female (72%), non-Hispanic white (75%), married (63%), and had a high-school diploma (87%). More than 44% of the sample had a total annual household income of less than $30,000. The mean  (SD) BMI was 29.4 (7.1), and the mean (SD) number of comorbid conditions was 3 ,479 had . The mosParticipants responded to 3 survey questions assessing food quality, variety, and affordability . BMI andTranscripts revealed a rich dataset of perceptions related to factors perceived to affect intake of fruits and vegetables. Findings from the community mappings helped to contextualize participants' perceptions. Photographs shown and discussed by participants during the sessions included images of farms, restaurants, kitchen spaces, convenience stores, gardens, buffet foods, and condiments, and generally supported participant perceptions. We used the framework by Booth and colleagues to categorize perceptions on the basis of related environmental factors highlighted in the framework and by the influence (barrier or facilitator) of the perception on dietary behavior . Most peThe following intrinsic factors were identified as barriers: food preferences, fatigue of taste buds for certain foods, life stresses, lack of forethought in meal planning, current personal health status, aging, and perceived impact of food on current chronic disease status. Intrinsic factors perceived as facilitators were the presence of chronic disease, lifetime experience related to intake of fruits and vegetables, preferences for certain fruits and vegetables, and personal or spousal health status. At the extrinsic level, participants reported the following factors as facilitators: availability of home gardens, low cost of foods at farm stands, and childhood exposure to fruits and vegetables. Perceived barriers included contradictory media messages related to nutrition and health outcomes, worksite food options, food availability, and food cost at grocery stores. Finally, participants reported the following as factors perceived to have an interactive effect: concerns about food safety and perceptions about the interaction between chronic disease status and social and environmental influences on behavior and health. For example, participants highlighted the interactions between physical fatigue due to changing work schedules or shifts and stresses resulting from trying to manage fatigue, work schedule, and personal dietary intake at home. Some participants perceived chronic disease status as a facilitator, whereas to others it was a barrier.Intake of fruits and vegetables is a major factor in the prevention of chronic diseases. The continued increase in chronic disease and obesity and the corresponding increase in poor chronic disease outcomes require different approaches. Using survey methods, we found that this sample was significantly overweight and was affected by chronic diseases. The 2007 health profile of North Carolina residents indicates suboptimal nutritional practices. Reportedly, only 23% of residents consume the recommended daily intake of 5 or more fruits and vegetables, and 26% did not participate in leisure-time physical activity , with adequate representation, a sample of 30 individuals is enough to uncover the perceptions of the majority of a population ,27. Othewww.eatsmartmovemorenc.com). This program targets all North Carolinians and has offerings designed for a multitude of settings and audiences. These offerings can be individually tailored, and when executed properly, allow individuals to access resources that promote risk reduction by increasing healthy nutrition and physical activity practices.Participants' perceptions of intrinsic and extrinsic influences on intake of fruits and vegetables are consistent with those of other studies ,28-30 buThe findings of this study indicate that many unfavorable intrinsic and some extrinsic factors are perceived to affect the intake of fruits and vegetables of this sample of North Carolinians. The perceptions evidenced are of concern because they are associated with behaviors that increase chronic disease risk. Options that would facilitate increased fruit and vegetable intake are needed, and family practice settings and community-based programs may be useful places to begin.This study was funded by National Institute of Arthritis and Musculoskeletal and Skin Diseases grant no. 5P60-AR49465-01. Dr Boyington was supported by the National Institute of Arthritis and Musculoskeletal and Skin Diseases grant no. 5P60-AR49465-04S1, National Institutes of Health, the National Center on Minority Health and Health Disparities grant no. R24 MD000167, and the Department of Health and Human Services, Agency for Healthcare Research and Quality R24 HS013353. Ms Remmes Martin was supported by the Carolina Program on Health and Aging Research Predoctoral Fellowship , the Arthritis Foundation Doctoral Dissertation Award, and the ACR REF Health Professional Graduate Student Research Preceptorship Award.We thank the following participating family practices in the North Carolina Family Medicine Research Network for their assistance: Black River Health Services, Burgaw; Bladen Medical Associates, Elizabethtown; Blair Family Medicine, Wallace; Cabarrus Family Medicine, Concord; Cabarrus Family Medicine, Harrisburg; Cabarrus Family Medicine, Kannapolis; Cabarrus Family Medicine, Mt. Pleasant; Chatham Primary Care, Siler City; CMC-Biddle Point, Charlotte; CMC-North Park, Charlotte; Community Family Practice, Asheville; Cornerstone Medical Center, Burlington; Dayspring Family Medicine, Eden; Family Practice of Summerfield, Summerfield; Goldsboro Family Physicians, Goldsboro; Henderson Family Medicine Clinic, Henderson; Orange Family Medical Group, Hillsborough; Person Family Medical Center, Roxboro; Pittsboro Family Medicine, Pittsboro; Prospect Hill Community Health Center, Prospect Hill; Robbins Family Practice, Robbins; and Village Family Medicine, Chapel Hill.We also gratefully acknowledge Andrea Meier, PhD, for her technical and research assistance in developing study materials, training study investigators, and troubleshooting data analysis software problems; Thelma Mielenz, PhD, for her assistance with

It has been proposed that the use of gene expression microarrays in nonrecombinant parental or congenic strains can accelerate the process of isolating individual genes underlying quantitative trait loci (QTL). However, the effectiveness of this approach has not been assessed.QTL gene. To complement the literature results, a microarray experiment was performed using three mouse congenic strains isolating the effects of at least 25 biometric QTL. Results show that genes in the congenic donor regions were preferentially selected. However, within donor regions, the distribution of differentially expressed genes was homogeneous once gene density was accounted for. Genes within identical-by-descent (IBD) regions were less likely to be differentially expressed in chromosome 2, but not in chromosomes 11 and 17. Furthermore, expression of QTL regulated in cis (cis eQTL) showed higher expression in the background genotype, which was partially explained by the presence of single nucleotide polymorphisms (SNP).Thirty-seven studies that have implemented the QTL/microarray approach in rodents were reviewed. About 30% of studies showed enrichment for QTL candidates, mostly in comparisons between congenic and background strains. Three studies led to the identification of an underlying QTL genes. Our own results from microarray profiling of three congenic strains revealed a strong tendency to select cis-eQTL over trans-eQTL. IBD regions had little effect on rate of differential expression, and we provide several reasons why IBD should not be used to discard eQTL candidates. In addition, mismatch probes produced false cis-eQTL that could not be completely removed with the current strains genotypes and low probe density microarrays. The reviewed studies did not account for lack of coverage from the platforms used and therefore removed genes that were not tested. Together, our results explain the tendency to report QTL candidates as differentially expressed and indicate that the utility of the QTL/microarray as currently implemented is limited. Alternatives are proposed that make use of microarray data from multiple experiments to overcome the outlined limitations.The literature shows limited successes from the QTL/microarray approach to identify In practice, the validity of this distinction depends on the resolution of the QTL analysis, i.e., the density of the genetic map and the size of the segregating population , no further interpretation of this result is attempted. In contrast, the Congenic design was implemented in 11 studies with sufficient information for meta-analysis. Of these, five studies revealed enrichment for candidate genes. By design, only regions that are confirmed to harbor QTL have genetic divergence, and therefore enrichment of QTL candidates can be expected. However, multiple factors can potentially contribute to this trend. Polymorphic genomic regions are more likely to host pQTL for any trait and to generate allelic bias in probe binding for one strain versus the other. This situation can be expected in cases where the microarray has been designed for one of the strains that are being compared, or for a strain that is genetically more closely related to one of them. Allelic bias of probe binding will have a systematic effect on fluorescence intensity levels, which can be interpreted as differential gene expression. Since higher polymorphism rate is expected to increase both frequency of QTL as well as allelic bias of probe signals, the variables would be associated and the observed overrepresentation of pQTL candidates may result from such confounding effect. Both hypotheses are not mutually exclusive, since in reality QTL regions may be enriched for both polymorphisms that produce allelic bias as well as for functional polymorphisms that produce differential expression. However, it is important to assess the relative importance of these two factors in the apparent tendency for some QTL/microarray experiments to report pQTL candidates as differentially expressed.When divided by type of experiment, only one of eight instead . In both instead . Of two instead . BecauseMeta-analysis of results from the literature presents several limitations. Overrepresentation of pQTL candidates can be affected by a number of factors, such as publication bias for genes that are functional candidates or that are located near pQTL and inaccurate estimation of the gene coverage in microarrays. The number of candidate genes that were targeted by each microarray was largely unknown and the two reference sets used, i.e., total number of genes in the genome and number probes in the microarray, may not be optimum reference sets for overrepresentation tests. Furthermore, heterogeneity in quality of microarray annotation, definition of candidate region limits, and statistical procedures for data processing and differential expression testing limit our ability to investigate the specific causes of enrichment for pQTL candidates in their results. Therefore, an in-house microarray experiment was deemed necessary to specifically test for overrepresentation of candidate genes among differentially expressed genes. This gave us complete control over all these variables and allowed performing more specific tests that considered probe mismatches, IBD regions, and QTL location within congenic donor regions.-/- mouse congenic strains with their genotypic background controls C57.hg-/- was tested on the Illumina Mouse-6 microarray with samples from brain, liver, and gonadal white adipose tissue . This platform has coverage for 71.7% of 30,388 EntrezGenes in the mm9 genome assembly and for 75.5% of EntrezGenes in the donor region of the congenic strains. Differential expression analysis detected a total of 577, 110, and 109 genes genome-wide that were affected by allelic variants of genes in the congenic region of HG2D, HG11, and HG17, respectively. Of these, 124, 89, and 95 genes were located within the donor regions of those strains. Probes selected within the donor regions presented an allelic bias toward higher intensity of the C57 samples for chromosomes 2, 11, and 17, respectively. This high cis-eQTL enrichment was observed despite the fact that probes overlapping known SNP between CAST and C57 genomes were removed. Furthermore, some genes classified as trans regulated lay right at the ends of the congenic regions and are most likely cis regulated , 11 (P = 0.52), or 17 (P = 0.67). Inspection of Figure F2 offspring subcongenics from three congenic strains have been assayed for the same set of biometric measurements but not in chromosomes 11 (P = 0.35) or 17 (P = 0.54). Therefore, although cis eQTL candidates were preferentially located in non-IBD regions in agreement with Doss et al. [cis eQTLs in these two chromosomes was driven only by the overall higher rate of genes in those regions. This added to the limited number of genes that would be removed from the candidate list by the IBD criterion indicates that there would be no real gain in using this approach. Because we are inspecting only the chromosomes in one cross, we refrain from generalizing this conclusion to other cases. However, there are four main reason why using IBD to filter down lists of cis eQTL candidates should be done with care. In most cases, IBD is inferred from incomplete genotype data originated from resequencing [Prcp was identified as a candidate gene for obesity by subcongenic isolation and gene expression data from brain [PRCP demonstrated that it has enzymatic activity to inactivate α-melanocyte-stimulating hormone (α-MSH1-13) by removing the C-terminal amino acid to produce α-MSH1-12. α-MSH1-13, a critical anorexigenic neuromodulator in the hypothalamus. A mouse model with a gene trap in PRCP confirmed effects of PRCP on obesity. In addition, inhibiting PRCP activity in vivo decreased food intake, confirming the role of Prcp in weight maintenance via control of active α-MSH1-13 levels [ regions , and the regions . Therefondidates ,20,62. Ws et al. , this waquencing , genotypquencing , or micrquencing . Errors om brain ,67. ThisIn summary, differential expression testing in three congenic strains revealed expression signatures enriched for eQTL candidates, which resulted in hundreds of genes to be considered for further testing. Expression differences within the donor regions were distributed according to the overall distribution of genes in those regions and were affected by IBD blocks only on chromosome 2. High genetic divergence between C57 and CAST resulted in very limited number and size of IBD regions. Filtering by IBD would only discard 16 genes, which according to previous reports may well contain a causal variant. Intense phenotyping of F2 fine mapping populations revealed high genetic complexity, with multiple QTL, in each of these regions. The HG2D congenic includes multiple QTL for the same phenotype (body weight) with opposite genotype effects . Furtheret al. [et al. [The results from our literature review and the present experiment do not invalidate the use of microarrays for dissecting QTL. On the contrary, they stress the need for new approaches to make better use of these data. It has been shown that reanalyzing large repositories of microarray data can identify profiles of differential expression that are highly predictive of gene associations to human diseases ,69. By ret al. were abl [et al. . ResultsUsing meta-analysis of large collections of microarray data to prioritize QTL candidates in rodents can present several advantages over similar approaches in humans. Linkage disequilibrium (LD) in humans can extend large distances; it is affected by population structure and history and can even reach across multiple chromosomes AND (QTL OR complex trait)" in PubMed , resultiThe analysis examined the overrepresentation or underrepresentation of genes within the pQTL or target regions that were selected in the reviewed studies. The information relevant for the objective of this analysis was (1) the number of genes under pQTL peaks, i.e., confidence limits for the position of pQTL, (2) number of genes in the genome being represented in the microarrays platform used, (3) number of differentially expressed genes, and (4) fraction of selected genes that are located within the confidence interval for the pQTL. In cases where microarray profiling was performed on congenic versus background strains, every gene located in the donor region of the congenic strain was considered a positional candidate.Relevant information from all studies is shown in Tables Ho):Significance of over or under representation of pQTL candidate genes was assessed by a Fisher's exact test with the null hypothesis . The second test, using number of probes in the microarray, is intended to control for the effect of different levels of genome coverage by microarrays. An ideal reference would only consider genes that are included in the microarrays. However, because of nonexistent or obsolete annotations for some platforms, this information is not always known and we used the total number of probesets as an approximation.where "candidate genes" refers to genes located within pQTL confidence intervals or donor congenic regions , "genes in reference set" is the total number of genes considered, "selected candidate genes" is the number of genes differentially expressed in the candidate region, and "selected genes" is the total number of differentially expressed genes. In other words, under the null hypothesis, the detection of differentially expressed genes is assumed as a process of randomly sampling genes from a pool that includes genes within and outside the target region. Therefore, the fraction of target genes in the selected sample is expected to be equal to the fraction in the gene set that is used as a reference. The ratio of these two ratios is called the Ratio of Odds (OddsRatio). A Fisher's exact test for overrepresentation (OddsRatio > 1) or underrepresentation (OddsRatio < 1) of candidate genes in the list of differentially expressed genes was performed and browser ,82 by adhg/hg (C57) background and bare the hg deletion in the high growth locus on chromosome 10 [2 intercross between congenic males and C57BL/6J control females. Mice were weaned at 3 weeks old, housed in age- and sex-matching cages with five or fewer animals per cage. All animals were fed a standard Purina Formulab Chow 5008 diet and killed at 9 weeks old. Nonrecombinant animals for the congenic region that were homozygous for congenic or background alleles and hg/hg for the high growth locus were selected. Brain, liver, and gonadal white adipose tissues were collected from four biological replicates, snap frozen in liquid nitrogen, and stored at -80°C. All samples were obtained from males except for adipose tissue in HG2D. All mouse protocols followed the guidelines of the American Association for Accreditation of Laboratory Animal Care [Three congenic mouse strains were profiled with microarrays and were analyzed using a QTL/microarray approach to identify candidate genes that regulate obesity traits: HG2D (HG.CAST-(D2Mit329-D2Mit457)), HG11 , and HG17 (HG.CAST-(D17Mit196-D17Mit190); MGI reference: 3771215) . All theosome 10 ,84. Animmal Care .RNA was purified, prepared, and hybridized using manufacturers' protocols. Briefly, total RNA was extracted with TRIzol reagent , DNase treated , and cDNA was generated by reverse transcription using Total Prep RNA Amplification Kit . cDNA was labeled with Biotin-16-UTP and hybridized to Mouse-6 V1 Illumina BeadArrays at the Gene Expression Core facility of the University of California Davis Genome Center . BeadArrays were scanned and features were extracted using BeadStudio V. 1.5.1.3 . Local background correction was done at scanning using default values. Bead level data was summarized by removing outliers greater than 3 median absolute deviations (MADs) from the median and by calculating the mean and variance of the remaining beads. Summarized intensity values were imported into the R 2.9.2 language/environment for normalization and analysis .affy package from Bioconductor [P < 0.01) in four or more samples from any given tissue. A total of 72 samples (3 strains × 2 genotypes × 3 tissue × 4 replicates) were hybridized to 12 Mouse-6 chips. Differential expression was tested by fitting a cell-means linear model after background correction and normalization of single-sample intensity values,The probes in Mouse-6 array were gene-annotated in-house to ensure current coverage of the mouse genome. Probe sequences were aligned to the mm9 mouse genome (Genome Build 37) obtained from the UCSC Genome Browser . Sequenconductor . Probes yij is the base 2 log transformed gene expression, μ is the overall mean, μi is the effect of experimental group k , and εij is the residual effect . Experimental group was defined as the combination of strain, genotype within strain, and tissue. For each strain, there are six experimental groups: B.B, B.C, F.B, F.C, L.B, and L.C, where the first letter indicates tissue and the second letter is genotype (B = C57 and C = CAST). Differential expression by genotype was tested by the following contrasts: L.Geno = L.C-L.B, F.Geno = F.C-F.B, and B.Geno = B.C-B.B. Model fitting and contrasts testing was done with the R/Maanova software [F values were calculated with James-Stein shrinkage estimates of the error variance [P values were calculated by 1000 permutations of sample labels and by pooling permutation F values across probes. Multiple comparison error was controlled by a false discovery rate (FDR) transformation [where software . F valuevariance . P valueormation . Probe wP values were estimated by sampling 2 million Monte Carlo simulations of the possible contingency tables using the fisher.test R function. Probes targeting transcripts associated to the same EntrezGenes were grouped so that overrepresentation tests counted genes as selected if any of their transcripts were found differentially expressed. Probes within the congenic regions that overlapped at least one SNP from between C57 and CAST were not considered [Over- or underrepresentation of positional candidates in the set of differentially expressed genes was tested by Fisher's exact test as described above for meta-analysis of literature results. For the test of homogeneity or rations of differentially expressed genes along donor regions, nsidered . Signifinsidered and downnsidered . IBD regRV did the literature review, designed the microarray experiment with the HG17 congenic strain, analyzed the data and drafted the manuscript. CRF designed and performed the mouse crosses and microarray experiments with the HG2D and HG11 congenic strains. CHW oversaw the design of the study and helped to draft the manuscript. JFM conceived the study and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.Metadata from QTL/Microarray Studies in Rat and Mouse. Table with one row per each of 37 reviewed studies implementing the QTL/Microarray approach in rodents. Information about experimental design and results was collected. Additional sheets contain description of acronyms and the full list of references.Click here for fileList of phenotypes measured in three congenic strains HG2D, HG11, HG17. The file contains a list, symbol and units of measurement for 16 phenotypes measured in the mice.Click here for fileQTL located within the limits of the donor regions for the HG2D, HG11, and HG17 congenic strains. The file contains a table with interval limits representing a non-redundant set of QTL from the cited references at the highest resolution currently known.Click here for file

Recent commentaries by Verheijde et al, Evans and Potts suggesting that donation after cardiac death practices routinely violate the dead donor rule are based on flawed presumptions. Cell biology, cardiopulmonary resuscitation, critical care life support technologies, donation and transplantation continue to inform concepts of life and death. The impact of oxygen deprivation to cells, organs and the brain is discussed in relation to death as a biological transition. In the face of advancing organ support and replacement technologies, the reversibility of cardiac arrest is now purely related to the context in which it occurs, in association to the availability and application of support systems to maintain oxygenated circulation. The 'complete and irreversible' lexicon commonly used in death discussions and legal statutes are ambiguous, indefinable and should be replaced by accurate terms. Criticism of controlled DCD on the basis of violating the dead donor rule, where autoresuscitation has not been described beyond 2 minutes, in which life support is withdrawn and CPR is not provided, is not valid. However, any post mortem intervention that re-establishes brain blood flow should be prohibited. In comparison to traditional practice, organ donation has forced the clarification of the diagnostic criteria for death and improved the rigour of the determinations. Our ability to support organ failure with technology and transplantation raises important questions of when a disease is irreversible, when further treatment is no longer effective and when death has occurred. Continuing scientific advance forces our communities to reflect on the concept and definition of death, and we continue to thoughtfully struggle in this regard. The practice of organ donation galvanizes these issues. In particular, the immediacy of procurement in donation after cardiac death (DCD) has incited scrutiny and ominous concerns. Observations and criticisms of existing and evolving practices are indispensable, in order guard against erosions of ethical practice. This journal has contributed to the debate with recent provocative commentaries by Verheijde et al followedVerheijde et al contend that this rule should be abandoned but transformed to allow the removal of organs from dying rather than dead persons. Evans contends that because complex organs taken from unequivocally dead people are not suitable for transplantation, human death has been redefined so that it can be certified at an earlier stage in the dying process. Potts categorically contends that DCD should be banned from practice. Central to this discussion is the distinction of whether the DCD candidate is recently and legitimately dead, as opposed to dying but nearly and not quite dead. The authors make allegations of transgressions of ethical and moral practice by the transplant communities.Inherent to these contentions is the flawed presumption that there is and was a clear line between alive and dead and this was fully understood before and subsequent to organ donation practices. This line of 'unequivocal death', as implied by all 3 papers, was clearly delineated and is now clearly being violated. This erroneous presumption fuels much debate and misunderstanding about the complex biology of life and death. Death and our understanding of it as a biological event, with profound social, religious and psychological customs, is relative to the context of experience and the accumulation of scientific information available. This biological understanding has evolved and deepened as a direct result of technology, cell biology, organ donation and transplantation, but has been inadequately reconciled in law, health policy and bioethical discourse. Organ donation, as one of the immediate sequels to death, has forced the understanding, acceptance or persisting controversy of where that line is. For an instructive review, I refer readers to a superb historical, social and biological examination of death in a book entitled "The Way We Die" by Ivan and Melrose.Historically, there has been little need for diagnostic or conceptual precision in regard to death. Early humans associated living with breathing and cessation of life was marked by unresponsiveness and the absence of respiration. The discovery of blood circulation by William Harvey in 1628 and the stethoscope in 1816 allowed the absence of heartbeat to be included in the determination. In recent decades and disturbingly so, the professional determination of death after cardiac arrest has remained rudimentary and of low rigour. Death occurred upon a doctor or coroner's determination. The criteria used were not articulated and remained untaught in training, ranging from absence of movement, breathing, heart sounds, pulse or EKG activity, applied at discretion of the attending physician. Observation and confirmation was not required and the irreversibility of death was not a practical concern, although diagnostic errors were made. Organ donation in general, and DCD in particular, has by necessity enhanced the rigour of the determination of death.Life is fundamentally based on the maintenance of individual and collective cell function, dependent of the provision of nutrients and oxygen. Cell biology has demonstrated that a layer of human cells, separated from the human organism, may be grown in laboratory culture as long as they are bathed in a sterile supply of nutrients and oxygen. The human being, a complex arrangement of trillions of cells organized into organ systems, requires a cardiopulmonary delivery system for oxygen and nutrients to reach the cells. The development and evolution of modern cardiopulmonary resuscitation evolving into cardiopulmonary support technologies have been important advances informing our concepts of life and death.The most common mechanism of cell injury that leads to cell death is oxygen deprivation as seen with the arrest of blood flow. Oxygen deprivation causes the inability to produce energy and depletes energy stores required to maintain cell function. Within limits and differing according to which cell type is housed within which organ, the cell can compensate for energy loss and can return to normal function if the delivery of oxygen resumes. Permanent loss of oxygen delivery will cause cells to pass the threshold to irreversible injury and cell death, morphologically characterized by necrosis.It is important to emphasize that the time to death for each cell, and each organ, will vastly differ. This has been well demonstrated by cell biologists who can remove and grow human cells in laboratory culture hours or days after death has occurred. Skins cells can be grown in culture when removed over 24 hours post-mortem , and braAdvances in organ support and replacement technologies teach us about the mechanics of death. Survival of the individual organs and the human organism is related to adequacy of oxygenated blood flow and this is the principle goal of cardiopulmonary resuscitation and critical care support. There are 3 basic mechanisms : a) primThe reversibility of cardiac arrest is now purely related to the context in which it occurs. The ability to restore the circulation depends on the location of the arrest, a predetermined ethical decision regarding level of medical intervention, the types of interventions available , and the types of interventions actually used. Medicine has advanced to the point where all vital organs can be supported by machines, or replaced by transplantation. Complete and irreversible arrest of the heart is not death, as long as oxygenated circulation to the body can be provided mechanically. Circulation can be artificially maintained for days, weeks and months and the arrested heart can then be replaced by transplantation. The event may be the cardiac arrest, but death is only occurs if it leads to an accompanying loss of circulation.any functions of the brain. Breathing replacement machines merely interrupt the way brain failure leads to cardiac arrest. Contrary to previous perceptions that brain death invariably leads to cardiac arrest [The brain is the only organ that cannot be supported or replaced by technology. For all forms of severe brain injury, ICU care does not replace c arrest , any degc arrest .It is the arrest of brain blood flow that occurs after cardiac arrest that is of vital importance. The success of resuscitation is judged by the ability to reanimate the brain once spontaneous or mechanical circulation has been reestablished. The limits of brain resuscitation are commonly quoted as 4–10 minutes . This isBrain death is better understood as brain arrest, characterized by the complete and irreversible loss of clinical brain function. The most reliable ancillary test for brain death is the absence of brain blood flow ,14, relaAccepting the concept that the permanent absence of brain blood flow is death, I share Verheijde et al concerns about the reported practices of CPR or extracorporeal oxygenated circulation applied after death, expressly for the purposes of organ preservation in DCD ,22. ThisA major criticism of DCD protocols has been the concern regarding the time of observation to determine death and the possibility that death is not 'irreversible' within the time limits proposed. There have been case reports of spontaneous resumption of heart function after cardiac arrest (autoresuscitation), ranging from seconds to minutes and longer. The true incidence and conditions that increase the potential for such an event are unclear and many reports are hampered by inadequate monitoring ,25. SomeFrom a cellular, organ and whole body human-based perspectives, the commonly used terms in the lexicon of death, such as 'complete and irreversible' cessation ,33 of fuIn medical practice and law, the separation between being alive and dead should not be ambiguous. It marks the point in time after which consequences occur, including no legal or medical requirement to provide resuscitation or life support technologies, loss of personhood and most individual rights, the opportunity for organ donation and autopsy proceedings, execution of the decedent's legal will, estate and property transfer, payment of life insurance, final disposition of the body by burial or cremation, and religious or social ceremonies to mark the end of a life. Organ donation has not created this reality, but continues to force its reconciliation.

PARP activation is also relevant to the development of complications of diabetes. Hence, agents capable of inhibiting PARP may be useful in preventing the development of diabetes and in slowing down complications of diabetes.Poly(ADP-ribose) is a NADPARP inhibition was assessed with a colorimetric assay kit. Molecular docking studies on the active site of PARP were conducted using the crystalline structure of the enzyme available as Protein Data Bank Identification No. 1UK1. Type 2 diabetes was induced in male Sprague-Dawley rats with streptozotocin . The test compounds were given by the i.p. route 45 min before STZ at 2.4 mM/kg or 1.2 and 3.6 mM/kg (only NIC and TAU). Blood samples were collected at 24 hr after STZ and processed for their plasma. The plasma samples were used to measure glucose, insulin, cholesterol, triglycerides, malondialdehyde, nitric oxide, and glutathione levels using reported methods.+ and TAU to interact with the binding site for the adenine moiety of NAD+. While STZ-induced diabetes elevated all the experimental parameters examined and lowered the insulin output, a pretreatment with 3-AB, NIC or TAU reversed these trends to a significant extent. At a dose of 2.4 mm/kg, the protective effect decreased in the approximate order 3-AB>NIC≥TAU. The attenuating actions of both NIC and TAU were dose-related except for the plasma lipids since NIC was without a significant effect at all doses tested.3-AB, NIC and TAU were able to inhibit PARP, with the inhibitory potency order being 3-AB>NIC>>TAU. Molecular docking studies at the active site of PARP showed 3-AB and NIC to interact with the binding site for the nicotinamide moiety of NADAt equal molar doses, 3-AB was generally more potent than either TAU or NIC as an antidiabetogenic agent, but the differences were not as dramatic as would have been predicted from their differences in PARP inhibitory potencies. NIC and TAU demonstrated dose-related effects, which in the case of TAU were only evident at doses ≥2.4 mM/kg. The present results also suggest that in the case of NIC and TAU an increase in dose will enhance the magnitude of their attenuating actions on diabetes-related biochemical alterations to that achieved with a stronger PARP inhibitor such as 3-AB. Hence, dosing will play a critical role in clinical studies assessing the merits of NIC and TAU as diabetes-preventing agents. Contill death -8. Overaycolysis ,5,9. Wheycolysis ,10.+ consumption and decreases of the ATP pool, and to protect pancreatic β-cells from chemically induced necrosis but not from cytokine-mediated apoptosis, a major cause of autoimmune diabetes [+ and NADPH caused by diabetes [+, has been the subject of intensive clinical trials around the world as a means of preventing or delaying the clinical onset of diabetes in humans [3 possesses other properties that may be of benefit in diabetes such as antioxidant action, modulatory role on neuronal Ca++ influx, inhibitory action on apoptosis [PARP inhibitors have the ability to prevent intracellular NADdiabetes . Furtherdiabetes . Becausediabetes -13. Howediabetes , studiesdiabetes . In contn humans ,16-18. Ipoptosis , and abiAmong natural compounds, taurine (TAU) is among those most extensively investigated for its attenuating effects on diabetes-related alterations such as decreased insulin secretion ,20, hypeIn view of the similarity of protective actions manifested by TAU, 3-AB and NIC against diabetes it appeared of interest to determine whether or not TAU is endowed with PARP-inhibiting action and, if this is the case, to what extent differences in PARP-inhibiting potency among TAU, 3-AB and NIC impact on the extent of their antidiabetic effects. To attain these goals, TAU, 3-AB and NIC were tested both in vitro for PARP-1 inhibiting power and for mode of interaction with the active site of PARP-1 in rats and in vivo, using rats made diabetic with streptozotocin, (STZ), a known generator of oxygen and nitrogen reactive species, for their counteracting actions on hypoinsulinemia, hyperglycemia, hyperlipidemia and oxidative stress when administered in equimolar doses as a pretreatment to STZ. To our knowledge these comparisons have not been previously reported.All the experiments were carried on male Sprague-Dawley rats, 200-225 g in weight, purchased from Taconic Farms, Germantown, New York, USA, and housed in a temperature controlled room (21±1°C) with a 12 hr light-12 hr dark cycle. The animals were allowed free access to a standard rat chow and filtered tap water for at least 5 days. The solid food, but not the water, was removed 12 hr prior to an experiment. The experimental groups consisted of 6 animals each. The study received the approval of the Institutional Animal Care and Use Committee of St. John’s University, and the animals were cared in accordance with the guidelines established by the United States Department of Agriculture.Solutions of STZ, 3-AB, NIC and TAU were made in citrate buffer pH 4.6, and they were administered by the intraperitoneal (i.p.) route in a volume not exceeding 2 ml. The doses used were: STZ 60 mg/kg, 3-AB 2.4 mM/kg, TAU 1.2-3.6 mM/kg, NIC 1.2-3.6 mM/kg. 3-AB and NIC were administered 45 min before STZ. TAU was administered in divided doses, one-half at 75 min before STZ and one-half at 45 min before STZ. Control animals received only citrate buffer pH 4.6 in a volume equal to that of a treatment solution. All the animals were decapitated at 24 hr after a treatment with STZ, and their blood samples, collected into heparinized tubes, were processed for their plasma fractions.2HPO4, NaH2PO4, and NaCl) and 0.1% Triton X-100. Then, 50 µL of diluted Strep-HRP (blocking solution) was added to each well, and the strips were further incubated at room temperature for 60 min. After washing the wells 4 times each with PBS and with 0.1% Triton X-100, they were mixed with 50 µL of TACS-Sapphire™ colorimetric substrate, and allowed to stand in the dark for 10-15 min. The intensity of the blue color that developed in each well was read on a microplate reader set at 630 nm. After stopping the reaction by adding 50 µL of 5% phosphoric acid to each well, the absorbance of the yellow color was measured at 450 nm. Parallel experiments were conducted by substituting the test solution with an equivalent volume of dimethyl sulfoxide or distilled water to verify the effect of the vehicles on the enzyme activity. All the samples were tested in triplicate.The inhibitory action of the test compounds towards PARP-1 was determined using a commercially available microplate assay kit and in accordance with the instructions provided by the manufacturer. Stock solutions of the various test compounds were made in dimethyl sufoxide, which were then serially diluted to the required concentration (100 µM) with distilled water. For the assay, each strip well was filled with 10 µL of the inhibitor solution, 15 μL of diluted PARP-1 enzyme (providing 0.5 Unit/well), and 25 µL of PARP Cocktail . The strip wells were incubated at room temperature for 60 min, and then washed 4 times with phosphate buffered saline and the IC50 value for each plot was obtained using Regression Wizard from Sigma Plot version 10.0 . All the assays were conducted in two separate occasions, each time in triplicate. The results of these studies are presented as mean ± standard deviation (SD) and are reported in μM.To determine the ICMolecular docking computations were carried out on a Dell Precision 470n workstation with the RHEL 4.0 operating system using Glide 5.0. 3D Structures of the various test compounds were constructed using the fragment dictionary of Maestro 9.0. The geometry of the ligands was optimized by Macromodel program v9.5 using the Optimized Potentials for Liquid Simulations-all atom (OPLS-AA) force field with theortho-dianisidine, and the reaction is allowed to proceed at 37°C for 30 min. The absorbance of the colored solution is read on a spectrophotometer at 450 nm. The concentration of glucose in the sample was calculated by reference to a glucose standard solution provided by the manufacturer and treated in identical manner as the plasma sample. The result was expressed in mg/dl of plasma.The content of glucose in a plasma sample was measured using a commercially available colorimetric assay kit which is based on the method of Rabbo and Terkildsen . In the The quantity of insulin released into the plasma was measured using a commercially available solid phase two-site Insulin ELISA immunoassay kit and strips coated with insulin MAb . This assay is based on a direct sandwich technique in which two monoclonal antibodies (enzyme (HRP)-conjugated anti-insulin and anti-insulin antibody bound to a microtitration well) are directed against separate antigenic determinants on the insulin molecule. Following a washing step to remove any unbound enzyme labeled antibody, the bound HRP complex is detected by reaction with TMB to yield a colored product that can be read on an ELISA plate reader. The results were expressed as μIU/ml.® Cholesterol, Beacon Diagnostics Pvt. Ltd., Navsari, India). In the assay, 10 μl of plasma sample was mixed with 1.0 ml of enzyme-color reagent solution , incubated at 37°C for 5 min, and the absorbance of the solution was read on a spectrophotometer at 505 nm against a blank preparation (the enzyme-color solution). A standard preparation of cholesterol, treated in identical manner as the plasma sample, was analyzed alongside and used as a reference for calculating the plasma cholesterol content, in mg/dl.The concentration of total cholesterol in a plasma sample was measured using a commercially available enzymatic-colorimetric assay kit . In the assay, 10 μl of plasma sample was mixed with 1.0 ml of enzyme-color reagent solution , incubated at 37°C for 5 min, and the absorbance of the solution was read on a spectrophotometer at 500 nm against a blank preparation (the enzyme-color solution). A standard preparation of triglyceride, treated in identical manner as the plasma sample, was analyzed alongside and used as a reference for calculating the plasma triglyceride content, in mg/dl.The concentration of triglycerides in a plasma sample was measured using a commercially available enzymatic-colorimetric assay kit in the plasma was measured as TBARS by the method of Buege and Aust . In the The content of GSH in a plasma sample was measured using the method of Ellman and in wEvidence of the formation of NO in the plasma was obtained indirectly by measuring the content of nitrite by the method of Kauser et al. which isResults are expressed as the mean ± SEM for n = 6. Intergroup comparisons were carried out by Student’s t-test, one-way ANOVA, and Neuman-Keuls post hoc test. Differences were considered to be significant when p was <0.05.50 values, 3-AB (33 ± 1.8 μM) was about 6.4-fold more potent than NIC (210 ± 2.9 μM) and about 9.7-fold more potent than TAU (320 ± 3.4 μM).3-AB, NIC and TAU were tested for their ability to inhibit PARP-1 using a colorimetric assay kit. The results of this test indicated that a wide difference in inhibitory potency existed among these compounds. In terms of their mean ± SD IC+. In the donor site, three subsites are described: a NIC-ribose (NI) binding site, a phosphate (PH) binding site and an adenine-ribose (AD) site [904 and amino and carbonyl groups of the backbone of Gly863 at the NI binding site of PARP-1, the highly polar TAU entered into hydrogen bonding at the AD site with the carbonyl group on the backbone of Asp766 and the carboxyl group of Asp770 via its β-amino group and to the carbonyl and amino groups on the backbone of Arg878 via its sulfonic acid group. Assessment of ligand binding efficiency based on docking scores indicated a good correlation with the PARP-1 inhibitory actions of the test compounds .PARP-1 is a polypeptide whose activation requires binding as a homodimeric protein to a nicked DNA. This polypeptide possesses a highly conserved organization consisting of three main domains: a N-terminal DNA-binding domain which acts a DNA nick sensor, a central portion designated as the automodification domain (AMD) and which contain regions for dimerization and for modulating interactions with DNA and with proteins, and a C-terminal region, representing the most conserved part of the enzyme, and capable of catalyzing poly(ADP-ribose) synthesis and of binding to target proteins . In turnAD) site . To be aFrom the data presented in Figure While a 60 mg/kg i.p. dose of STZ induced type 2 diabetes in the rat and suppressed the insulin output by about 82% of the control value (p<0.001), a pretreatment with any of the test compounds was able to preserve the ability of pancreas to secrete insulin following a treatment with STZ Figure . In paraAs shown in Figure From the results shown in Figure The occurrence of oxidative and nitrosative stress as a result of STZ-induced diabetes was assessed on the basis of the plasma MDA Figure , NO Fig and GSH NO is one of the metabolic products of STZ responsible for DNA strand breakage in pancreatic cells and for the formation of the highly toxic peroxynitrite anion following interaction with reactive oxygen species (ROS) . In thisGSH is a biomolecule that functions as an antioxidant by participating in the detoxification of electrophilic/oxidizing xenobiotics, free radicals and peroxides . During + and ATP as a result of several possible mechanisms. First, metabolism of its nitrosoureido moiety can yield chemical species for alkylating DNA, inhibiting the incorporation of precursors into DNA, and causing DNA strand breaks [O-GlcNAc residues from modified nucleocytoplasmic proteins acting as a glucose sensor [In the present study, diabetes was induced by the intraperitoneal administration of STZ. This methylnitrosoureido derivative of D-glucose is well suited as pharmacological tool for studying the effects of compounds with PARP-1 inhibitory action and with potential for preventing the onset of type 1 diabetes in experimental animals. Following its entry into pancreatic β-cells, STZ will be toxic to cells because it depresses the levels of NADd breaks ,35. Therd breaks ,36-38. Hd breaks ,37. Addid breaks , and thee sensor ,42.The three compounds evaluated in the present study are endowed with biological properties that are of benefit in preventing or delaying the onset of type 1 diabetes and to minimize the development of complications of diabetes. In this context, while 3-AB and NIC have been extensively studied for their PARP-1 inhibitory actions, in the case of TAU such link appears lacking. Although both 3-AB and NIC are examples of PARP inhibitors that are presently considered to be of low potency when compared to compounds designated as second- and third-generation inhibitors, they are still used experimentally to explore the function of the PARP family of enzymes . Among P50 values for both 3-AB and NIC fall within the range of values reported for these compounds in the scientific literature [904 and Gly863 at the NI binding site of the active site, the much weaker inhibitor, TAU, was forming hydrogen bonds with Asp766, Asp770 and Arg878 at the AD site of the active site. Calculation of the corresponding docking scores for each compound, which are inversely related to the binding affinities, suggested 3-AB to be more tightly bound than NIC to the active site of the enzyme than NIC, and TAU to be weakly bound to PARP-1. In common with most PARP inhibitors, the three compounds under evaluation are inhibiting the enzyme in a competitive manner since they block the binding of NAD+ to the catalytic domain of PARP-1 [In vitro testing of 3-AB, NIC and TAU for their PARP-1 inhibitory activity indicated that 3-AB was about 6.4-fold more potent than NIC and about 9.7-fold more potent than TAU. The experimental ICterature ,44. WithIn addition to differences in inhibitory activity imposed by their structural features , the actA role of PARP activation in pancreatic islet cell damage by STZ can be ascertained from the circulating levels of both insulin and glucose, with the type of diabetes being a determined by the dose of STZ administered . In the In rodents, the induction of diabetes with a STZ is known to lead to a hyperlipidemia characterized by elevations in the circulating levels of total cholesterol, triglycerides, very low density lipoprotein and low density lipoprotein-cholesterol and by a decrease of high density lipoprotein-cholesterol ,39,47. IOxidative stress is a hallmark of STZ-induced diabetes since this diabetogen can promote the formation of ROS and NO in the pancreas ,38,48 anThe present study finds that all the test compounds were able to lower the plasma levels of NO and MDA, a secondary product of LPO, and to increase the plasma GSH content relative to plasma levels from animals on STZ alone. In all likelihood, these changes reflect the intracellular status of those organs and tissues, particularly erythrocytes, being affected by STZ-induced diabetes along with the activities of those intracellular systems responsible for their formation , Further2-induced LPO [+. In turn, NAD+ undergoes metabolic conversion to NADP, which in its reduced form is an obligatory cofactor for the redox cycling of GSH with its disulfide form GSSG under the mediation of glutathione reductase [++ influx, apoptosis and cell injury in a dose-related manner [The reduction in LPO by these compounds is not unexpected since they have all shown antioxidant properties in vivo, in vitro and ex vivo. Thus, 3-AB was found to ameliorate peroxynitrite-induced cytotoxicity , to effeuced LPO . NIC caneductase . Furthereductase ,57. In reductase . The samd manner .2O2 [In addition to its protective actions against STZ-induced hyperglycemia and hypoinsulinemia , TAU is 2O2 ,66, has 2O2 . In brie2O2 , and, moThe results of the present work indicate that TAU possesses PARP-1 inhibitory activity and that this activity is rather weak when compared to classical PARP-1 inhibitors such as 3-AB and NIC. Through molecular docking analysis, TAU is found to bind to subsite of the active site of PARP-1 that is different from that shared by 3-AB and NIC. When administered to rats at a 2.4 mM/kg dose 45 min before a 60 mg/kg dose of STZ, 3-AB, NIC and TAU demonstrated common attenuating actions on the hyperglycemia, hypoinsulinemia and oxidative stress induced by STZ, with 3-AB exhibiting the greatest potency and TAU the least. However, at a dose of 3.6 mM/kg the effects of TAU and NIC against STZ-related alterations became either equal or greater than those by a 2.4 mM/kg dose of 3-AB. Irrespective of the dose used, TAU was the most protective among the compounds tested against oxidative stress by STZ. On the other hand, the lack of effect of NIC, a more potent PARP-1 inhibitor than TAU on hyperlipidemia by STZ suggests that PARP-1 inhibitory potency is not a reliable predictor of the type and extent of the effect that a PARP inhibitor may have on the plasma lipids associated with diabetic hyperlipidemia.TMB: 3,3´,5,5´-tetramethylbenzidine; TBARS: thiobarbituric acid reactive substances; TCA: trichloroacetic acid; TBA: thiobarbituric acid; HCl: hydrochloric acid; TEP: 1,1,3,3-tetraethoxypropane; GSH: reduced glutathione; GSSG: oxidized glutathinoe; DTNB: 5,5’-dithiobis(2-nitrobenzoic acid); NED 2HCl: N-1-naphthylethylenediamine hydrochloride.The authors declare that they have no competing interests.KGP carried out all experimental work on live animals, performed all the biochemical assays and statistical analyses, helped with the collection of literature information, prepared the figures, and made editorial comments to the article. MRP performed the in vitro tests for PARP-1 inhibition, carried out the molecular modeling studies, prepared the figures for the molecular modeling results, and made editorial comments to the article. CLP conceived the project and guided its development, assembled, organized and interpreted the experimental data, and reviewed the pertinent scientific literature.

The entry of human immunodeficiency virus (HIV-1) into host cells involves the interaction of the viral exterior envelope glycoprotein, gp120, and receptors on the target cell. The HIV-1 receptors are CD4 and one of two chemokine receptors, CCR5 or CXCR4.a) of 269 kJ/mol and an inactivation temperature (Ti) of 56°C. Thermal inactivation of CD4 exhibited a reaction order of 1.3, an Ea of 278 kJ/mol , and a Ti of 52.2°C. The second-order denaturation kinetics of CXCR4 is unusual among G protein-coupled receptors, and may result from dimeric interactions between CXCR4 molecules.We created proteoliposomes that contain CD4, the primary HIV-1 receptor, and one of the coreceptors, CXCR4. Antibodies against CD4 and CXCR4 specifically bound the proteoliposomes. CXCL12, the natural ligand for CXCR4, and the small-molecule CXCR4 antagonist, AMD3100, bound the proteoliposomes with affinities close to those associated with the binding of these molecules to cells expressing CXCR4 and CD4. The HIV-1 gp120 exterior envelope glycoprotein bound tightly to proteoliposomes expressing only CD4 and, in the presence of soluble CD4, bound weakly to proteoliposomes expressing only CXCR4. The thermal stability of CD4 and CXCR4 inserted into liposomes was examined. Thermal denaturation of CXCR4 followed second-order kinetics, with an activation energy (EOur studies with proteoliposomes containing the native HIV-1 receptors allowed an examination of the binding of biologically important ligands and revealed the higher-order denaturation kinetics of these receptors. CD4/CXCR4-proteoliposomes may be useful for the study of virus-target cell interactions and for the identification of inhibitors. Human immunodeficiency virus type 1 (HIV-1) entry into target cells is mediated by the viral envelope glycoproteins, following interaction with the host cell receptors, CD4 and one of two coreceptors, CCR5 or CXCR4 For primary HIV-1 isolates, CD4 and either CCR5 or CXCR4 are required for entry into the host cell. Most transmitted and early HIV-1 isolates use CCR5 as a coreceptor. In some HIV-1-infected individuals, the viruses acquire the ability to use CXCR4 as a coreceptor. Besides the presence of CD4 and the chemokine receptors, the lipid composition of the target cell membrane has also been suggested to influence the efficiency of virus-cell membrane fusion.lckCD4 CXCR4 Proteoliposomes that contain the HIV-1 receptors could be useful tools in investigating the interaction of HIV-1 with target cells Here, we create proteoliposomes containing CD4 and CXCR4, demonstrate the ability of these HIV-1 receptors to interact with specific ligands, and investigate the thermal stability of these membrane proteins.To create proteoliposomes, we used CHAPSO detergent to solubilize human CD4 (expressed in 293T cells) and human CXCR4 (expressed in Cf2Th cells). Both proteins have a C-terminal C9 epitope tag, allowing capture and purification with the 1D4 antibody complexed with Protein A-Sepharose CL-4B beads. After washing, the CD4 and CXCR4 proteins were eluted from the beads with the C12 peptide, which competes with the C9 epitope tag for the 1D4 antibody In some experiments, the proteoliposomes were extruded through polycarbonate filters. The non-extruded and extruded CXCR4-proteoliposomes were studied by dynamic light scattering and electron microscopy. The mean diameter of the non-extruded proteoliposomes was found to be approximately 2,000 nm and that of the extruded proteoliposomes around 200 nm .The protein composition of the CD4-proteoliposomes and CXCR4-proteoliposomes was analyzed by separation on reducing and non-reducing SDS-polyacrylamide gels and silver staining. As a negative control, we prepared CD4-free and CXCR4-free liposomes from lysates of 293T cells and Cf2Th cells, respectively, and analyzed these in parallel. The 1D4 antibody could be detected in all of the liposomes . In addiTo assess the conformation of the CD4 and CXCR4 molecules incorporated into the proteoliposomes, we studied the binding of phycoerythrin (PE)-labeled antibodies to CD4/CXCR4-proteoliposomes using flow cytometry. Two anti-CD4 antibodies, Q4120 We also tested two antibodies, 12G5 Several of the variables associated with the preparation of CD4/CXCR4-proteoliposomes were optimized by assessing the final product with the Q4120 anti-CD4 antibody and the 12G5 anti-CXCR4 antibody. These studies revealed that the use of glycerol-free dialysis buffer resulted in a better yield of proteoliposomes with conformationally correct CD4 and CXCR4 (data not shown). The concentration of 1D4 antibody used to capture CD4 and CXCR4 (1.1 mg/ml) and the concentration of C12 peptide used to elute these proteins from the beads (200 µg/ml) were determined by optimizing 12G5 antibody recognition. In a similar manner, elution of CD4 and CXCR4 from the beads at room temperature proved to be slightly better than elution at 4°C for producing optimal levels of CD4 and CXCR4 recognized by the conformation-dependent antibodies (data not shown). Recognition by conformation-dependent anti-CD4 and anti-CXCR4 antibodies was maintained for CD4/CXCR4-proteoliposomes stored at 4°C for at least 3–4 weeks, with an affinity comparable to that seen for freshly prepared proteoliposomes (data not shown).50) of 270 nM of CXCL12 was 110 nM for CD4/CXCR4-proteoliposomes and 140 nM for CD4/CXCR4-expressing cells.We examined the binding of the natural CXCR4 ligand, CXCL12 CXCL12 also inhibited the binding of the 44717.111 anti-CXCR4 antibody to the CD4/CXCR4-proteoliposomes, but did not compete with the binding of the Q4120 and RPA-T4 anti-CD4 antibodies to the proteoliposomes (data not shown). These data suggested that the CXCR4 protein in the CD4/CXCR4-proteoliposomes binds CXCL12 with an affinity similar to that of CXCR4 expressed on the surface of cells.HXBc2 strain to CXCR4-proteoliposomes, in either the presence or the absence of sCD4. The bound gp120 molecules were detected with the human anti-gp120 antibody 2G12, followed by staining with a PE-labeled anti-human antibody. Only in the presence of sCD4 was weak binding of gp120 to the CXCR4-proteoliposomes detected above the background levels of fluorescence observed in untreated cells or cells incubated only with sCD4 . These 293T cells were incubated with either CD4-proteoliposomes or CD4/CXCR4-proteoliposomes. The ΔKS-transfected or HIV-1KB9 envelope-expressing 293T cells demonstrated a similar level of fluorescence following incubation with rhodamine-labeled CD4-proteoliposomes. Incubation of CD4/CXCR4-proteoliposomes with ΔKS-transfected cells resulted in a higher background level of fluorescence than was observed for the CD4-proteoliposomes; the basis for this background is unknown. The fluorescence increase associated with the incubation of CD4/CXCR4-proteoliposomes with 293T cells expressing the HIV-1KB9 envelope glycoproteins was slightly greater than that observed with the control ΔKS-transfected 293T cells HIV-13T cells . These rBecause proteoliposomes can withstand a wider range of temperatures than living cells, the availability of proteoliposomes containing the HIV-1 receptors provided an opportunity to examine the effects of temperature on the native conformation of these membrane proteins. The binding of a conformation-dependent ligand has been used to assess the degree of denaturation of some GPCRs following heat treatment 1−n at 55°C and 60°C (where sufficient denaturation occurred to make the measurements reliable) was fitted to equation (5) (See 2) and the ordinate intercept (b) were close to 1 when the reaction order, n, was 2 (app is the apparent reaction rate.Incubation at higher temperatures resulted in progressively greater denaturation of CXCR4 . When th (5) See . The corn, was 2 . Thus, t−1−1 versus time plots (app) at each temperature were derived from the slopes of these lines and decimal reduction time (D) (time required for 90% reduction in 12G5 antibody binding) were obtained for the second-order thermal denaturation of CXCR4 at each temperature from equations (7) and (9) See :1/2 and D values for CXCR4 at each temperature are shown in The calculated t10D versus temperature , which is defined as the temperature at which the t1/2 of thermal denaturation is 10 minutes, can be found from a plot of log10t1/2 versus temperature (The inactivation temperature (Tperature . The inaa) of the denaturation reaction can be determined from a plot of ln Kapp versus reciprocal temperature at 55°C and 60°C suggested that the order (n) of the CD4 thermal denaturation is close to 1.3 (app) at each temperature can be calculated, using the slopes of the plots in CD4 staining by the Q4120 antibody decreased faster than CXCR4 staining by the 12G5 antibody compare and 6A. e to 1.3 . The dete to 1.3 . For n =1/2 and D values at each temperature can be calculated:app, t1/2 and D are presented in Using equations (7) and (9) respectively, the t10D versus temperature , each with a different level of heat resistance, exist. These isoforms are converted to inactive forms (In) in parallel first-order reactions at rates governed by the constants kn:1 and F2 are the fractions of the native protein in each isoform at time t = 0. Note that, if F is normalized (F ≡ 1 at t = 0), then F1+F2 = 1.Various models have been proposed to explain second-order thermal denaturation reactions of proteins 2, …, Em are intermediate protein conformations, I is the inactivated conformation, and the first-order reactions E1→E2, …, Em→I proceed at rates described by the rate constants k1, …, km. In the simplest case involving two steps (E1→E2→I) where the protein proceeds to complete inactivation in the final conformation,According to a series-type model, protein inactivation proceeds in the following manner:1 and a2 are constants. To estimate k1 and k2, we fitted the experimental data on the normalized 12G5 reactivity with CD4/CXCR4-proteoliposomes at various times after 60°C incubation to this equation. (The 1-min incubation time point at 60°C was excluded because it is too short compared with the time required for the sample to reach 60°C). This yielded the following results: k1 = 0.046 min−1 and k2 = 0.376 min−1 (r2 = 0.9993), which correspond to respective half-lives of 15.0 and 0.26 minutes for each of the two reactions.The equations for both the two-isoform parallel reaction model and the two-step series-type model can be written Even in cell lysates, most or all of the CXCR4 molecules are dimeric a = 278 kJ/mol) was less thermostable than human and bovine immunoglobulin G (Ea = 315–393 kJ/mol) a = 567 kJ/mol), bovine milk IgM (Ea = 421 kJ/mol) K (Ea = 427 kJ/mol) per se.We also evaluated the thermal denaturation of CD4 in the CD4/CXCR4-proteoliposomes. The heat-induced denaturation of other immunoglobulin superfamily members has been previously studied. CD4 in the CD4/CXCR4-proteoliposomes , cholesterol, 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine (DOPE), sphingomyelin (from porcine brain), and 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine-N-(lissamine rhodamine B sulfonyl) (RhDOPE) were purchased from Avanti Polar Lipids, Inc. . Ammonium sulfate (NH4)2SO4, sodium chloride (NaCl) and glycerol were purchased from Fisher Scientific . UltraPure Tris, zeocin, Dulbecco's modified Eagle medium (DMEM), and fetal bovine serum (FBS) were purchased from Invitrogen . Protein A-Sepharose CL-4B beads were purchased from GE Healthcare . Hygromycin B in PBS, polyethylene glycol (PEG) 1500 (50% wt/vol solution in 75 mM HEPES) and complete mini EDTA-free protease inhibitor cocktail tablets were purchased from Roche . Glycine was purchased from ICN Biomedicals . Dulbecco's phosphate-buffered saline (D-PBS) without Ca+2 or Mg+2, penicillin-streptomycin solution, trypsin-EDTA solution and G418 sulfate were purchased from Mediatech, Inc. . Sodium butyrate, EDTA, EGTA, and R-phycoerythrin (PE)-labeled anti-human CD4, clone Q4120 were purchased from Sigma-Aldrich . CHAPSO [3-[(3-Cholamidopropyl) dimethylammonio]-2-hydroxy-1-propanesulfonate] was purchased from Anatrace, Inc. . PE-labeled anti-human CCR5, clone 2D7; PE-labeled anti-human CXCR4, clone 12G5; and PE-labeled anti-human CD4, clone RPA-T4 were purchased from BD Biosciences Pharmingen . PE-labeled anti-human CXCR4, clone 44717.111 was purchased from R&D Systems . CXCL12α was purchased from PeproTech, Inc. . C12 peptide (VSKTETSQVAPA) was purchased from American Peptide Company . HEPES was purchased from Boston BioProducts, Inc. . Human anti-gp120 monoclonal antibody 2G12 and small-molecule CXCR4 antagonist AMD3100 were obtained from the NIH AIDS Research and Reference Reagent Program . Soluble CD4 was produced in 293T cells after stable transfection or, in some cases, was purchased from ImmunoDiagnostics, Inc. . The 1D4 murine monoclonal antibody directed against the C9 peptide (TETSQVAPA) was obtained from the National Cell Culture Center . TAK779 was generously provided by Takeda Pharmaceuticals . Compound A was generously provided by Merck .1,2-dioleoyl-4)2SO4, 20 mM Tris (pH 7.5), 10 vol % glycerol, 1% (weight∶volume) CHAPSO, and protease inhibitor cocktail (1 mini tablet per 10 ml). Solubilization buffer S2 had the following composition: 100 mM (NH4)2SO4, 20 mM Tris (pH 7.5), 1% (weight∶volume) CHAPSO, and protease inhibitor cocktail (1 mini tablet per 10 ml). Glycerol-free dialysis buffer had the following composition: 100 mM (NH4)2SO4 and 20 mM Tris (pH 7.5). Glycerol-containing dialysis buffer had the following composition: 100 mM (NH4)2SO4, 20 mM Tris (pH 7.5) and 10 vol % glycerol.Solubilization buffer S1 had the following composition: 100 mM (NHLipids (in chloroform solutions) were pooled in cryovials and dried under vacuum until all of the solvent was removed. The lipid mixture from each cryovial was then resuspended in 1 ml D-PBS and sonicated using the Branson Sonifier 450 . Sonicated lipid mixture was stored under argon at −30°C. Except as indicated below, the lipid mixture had (if not stated otherwise) the following composition: 35% DOPC, 30% DOPE, 15% sphingomyelin, and 20% cholesterol Preparations of CXCR4-proteoliposomes used in the dynamic light scattering experiments, in electron microscopy, and in the studies of antibody and AMD3100 binding to extruded proteoliposomes were made with the following lipid composition: 40 mol % DOPC, 40 mol % sphingomyelin, and 20 mol % cholesterol.293T cells stably expressing human CD4 containing the C9 peptide (TETSQVAPA) at the C terminus were made by Christoph Grundner, using the pcDNA3.1+ plasmid .Cf2Th cells stably expressing human CXCR4 containing the C9 peptide (TETSQVAPA) at the C terminus are described elsewhere 2. CXCR4-free Cf2Th cells and CD4-free 293T cells were grown in DMEM supplemented with 10% fetal bovine serum (FBS), 100 IU/ml penicillin and 100 µg/ml streptomycin (complete DMEM). Cf2Th cells stably expressing human CXCR4 and CD4 were grown in complete DMEM containing 0.2 mg/ml zeocin and 0.2 mg/ml hygromycin B. Cf2Th cells stably expressing human CXCR4 containing C9 peptide at the C terminus and 293T cells stably expressing human CD4 containing C9 peptide at the C terminus were grown in complete DMEM containing 0.5 mg/ml G418.Cells were grown at 37°C with 5% CO7 cells in 1 ml of buffer) at 4°C for 45 minutes on a rocking platform. Cell debris were pelleted by centrifugation for 30 minutes at 16,000×g at 4°C, and the cleared lysate was stored at −30°C. For the preparation of the CXCR4-containing cell lysate, Cf2Th cells stably expressing human CXCR4 containing the C9 peptide at the C terminus were used. For the preparation of the CD4-containing cell lysate, 293T cells stably expressing human CD4 containing the C9 peptide at the C-terminus were used. For the preparation of CXCR4-free cell lysate, Cf2Th cells were used. For the preparation of CD4-free cell lysate, 293T cells were used.Cell lysates were prepared the following way. Cells grown to full confluency in a 150-mm dish were treated for 24 hours with complete DMEM containing 3 mM sodium butyrate prior to harvest, detached by treatment with D-PBS/5 mM EDTA, pelleted, washed in D-PBS, again pelleted, and stored at −30°C until needed. Frozen cells were solubilized with S1 solubilization buffer (∼5×10Approximately 1.5 g of Protein A-Sepharose CL-4B beads were washed 4 times with 45 ml of water and then resuspended in ∼7 ml of D-PBS/0.01% sodium azide and stored at 4°C.One volume of the solution of Protein A-Sepharose CL-4B beads was washed twice with solubilization buffer S1 and then resuspended in 0.4 volumes of the solution of the 1D4 antibody at a concentration of 1.1 mg/ml (a mixture of 0.08 volumes of the stock solution (5.5 mg/ml) of 1D4 and 0.32 volumes of solubilization buffer S1). Then beads were incubated overnight at 4°C on a rocking platform. The beads were then washed three times with solubilization buffer S1, and resuspended in 0.5 volumes of the same buffer. This bead suspension was aliquoted, 400 µl in each aliquot. To each aliquot, 1 ml of cell lysate was added. . The beads were incubated with the cell lysate for at least 2 hours at 4°C on a rocking platform.Next, the beads were washed 5 times with solubilization buffer S2 and then CXCR4 (and/or CD4) was eluted in the following manner. Beads in each aliquot were incubated for 1 hour at room temperature with 200 µl of a 200 µg/ml solution of peptide C12 (a mixture of 160 µl of the solubilization buffer S2 and 40 µl of the stock aqueous solution (1 mg/ml) of C12 peptide) on a rocking platform. The beads were pelleted, supernatants containing the eluted material were collected, and a second round of elution was carried out. The two eluted solutions were combined. After centrifugation to remove the beads, supernatants were collected.A suspension consisting of the eluted material and the lipid mixture in D-PBS was prepared . This suspension was dialyzed overnight at 4°C against glycerol-free dialysis buffer (unless stated otherwise), using a 10-kDa molecular weight cutoff to remove detergent and the C12 peptide and allow the formation of proteoliposomes. After five freeze-thaw cycles, proteoliposomes were stored at 4°C.The CXCR4-proteoliposomes used in the dynamic light scattering experiments, in electron microscopy, and in the studies of antibody and AMD3100 binding to extruded proteoliposomes were prepared using solubilization buffer S1 instead of S2 and dialysis against glycerol-containing buffer.Protein-free liposomes were prepared using dialysis of the mixture of 90 vol % solubilization buffer S1 and 10 vol % lipid mixture in D-PBS against glycerol-containing dialysis buffer.Proteoliposomes (prepared as described above) were extruded several times through two polycarbonate Nucleopore filters of 100-nm pore size in a pressure extruder to produce large unilamellar vesicles. All preparations were extruded at 37°C; the temperature during extrusion was maintained with a circulating water bath . Liposomes prepared by extrusion through 100-nm pore size filters were homogeneous and fusogenic and electron microscopy.Electron microscopy was carried out as follows. Five µl of each sample was absorbed to a formvar/carbon-coated grid for 1 minute and excess liquid was blotted off using Whatman #1 filter paper. The grid was stained with 1% uranyl acetate for 1 minute, blotted with a filter paper again and examined in a Tecnai Spirit BioTwin transmission electron microscope at the Electron Microscopy Core facility .The protein composition of proteoliposomes was analyzed by silver staining on an SDS-polyacrylamide gel as follows. Proteoliposomes suspensions were incubated at 37°C for 30 minutes in 1× SDS loading buffer containing 5% β-mercaptoethanol (β-ME) from Bio-Rad Laboratories, Inc. (reducing conditions) or in loading buffer without β-ME (non-reducing conditions). Samples were run on SDS-polyacrylamide gels and analyzed by silver staining using GelCode SilverSNAP kit, as described by the manufacturer.The binding of anti-CXCR4 and anti-CD4 antibodies to CD4/CXCR4-proteoliposomes was analyzed by fluorescence-activated cell sorting (FACS). Proteoliposomes were incubated for 45 minutes at room temperature in D-PBS/3% fetal bovine serum (FBS) containing varying concentrations of R-phycoerythrin (PE)-labeled monoclonal antibody, in a volume of 100 µl. After this incubation, 200 µl of D-PBS/3% FBS was added to each sample. All samples were analyzed with a FACScan flow cytometry using CellQuest software in the FL2 channel. Fluorescence of proteoliposomes incubated with varying concentrations of PE-labeled anti-CCR5 monoclonal antibody 2D7 was subtracted, as a baseline, from all fluorescence measurements obtained with specific antibodies.The binding of the CXCR4 ligand CXCL12 to CD4/CXCR4-proteoliposomes was analyzed by FACS using a competition assay The ability of CXCL12 to compete for the binding of the 12G5 antibody to Cf2Th-CD4/CXCR4 cells was studied as described above for proteoliposomes.In control experiments, the binding of 0.12 µg/ml of PE-labeled anti-CD4 monoclonal antibody Q4120, 0.125 µg/ml of PE-labeled anti-CD4 monoclonal antibody RPA-T4, and 0.25 µg/ml of PE-labeled anti-CXCR4 monoclonal antibody 44717.111 to CD4/CXCR4-proteoliposomes was studied in the absence of CXCL12 and in the presence of 500 nM of CXCL12.The binding of the small-molecule CXCR4 antagonist AMD3100 to CD4/CXCR4-proteoliposomes was analyzed by FACS using a competition assay The ability of AMD3100 to compete for the binding of the 12G5 antibody to Cf2Th-CD4/CXCR4 cells was studied as described above for proteoliposomes.In control experiments, the binding of 0.6 µg/ml of PE-labeled anti-CD4 monoclonal antibody Q4120 and 0.625 µg/ml of PE-labeled anti-CD4 monoclonal antibody RPA-T4 to CD4/CXCR4-proteoliposomes and Cf2Th-CD4/CXCR4 cells was studied in the absence of AMD3100 and in the presence of 0.241 µM of AMD3100.In other control experiments, the binding of 1.25 µg/ml of PE-labeled anti-CXCR4 monoclonal antibody 12G5 to CD4/CXCR4-proteoliposomes and Cf2Th-CD4/CXCR4 cells was studied in the absence of any ligand and in the presence of 2.4 µM TAK779 or Compound A, small-molecule CCR5 antagonists.The binding of anti-CXCR4 monoclonal antibodies 12G5 and 44717.111 and the small-molecule CXCR4 antagonist AMD3100 to extruded CXCR4-proteoliposomes was analyzed in the following manner.Liposomes were incubated with 25 µl of 4-µm-diameter aldehyde/sulfate latex beads in a final volume of 150 µl for 55 minutes at room temperature, followed by a 90-minute incubation in 1 ml D-PBS with gentle shaking. The reaction was stopped by incubation for 30 minutes in D-PBS supplemented with 100 mM glycine. Liposome-coated beads were washed three times with D-PBS/3% FBS and resuspended in 50 µl of D-PBS/3% FBS.For the study of the antibody binding to liposomes, the liposome-coated beads were incubated for 45 minutes at room temperature in D-PBS/3% FBS containing 0.625 µg/ml of PE-labeled anti-CXCR4 monoclonal antibody 12G5 or 1.25 µg/ml of PE-labeled anti-CXCR4 monoclonal antibody 44717.111, in a volume of 100 µl. For the study of AMD3100 binding to liposomes using the competition assay, the liposome-coated beads were incubated in D-PBS/3% FBS containing 0.241 µM AMD3100 in a final volume of 100 µl. Incubation for 20 minutes at room temperature, in the absence of antibody, was followed by incubation for 45 minutes at room temperature in the presence of 0.625 µg/ml of PE-labeled anti-CXCR4 monoclonal antibody 12G5.After incubation, 500 µl of D-PBS/3% FBS was added to each sample. All samples were analyzed with a FACScan flow cytometry as described above. Fluorescence of liposome-coated beads incubated with 0.625 µg/ml of PE-labeled anti-CCR5 monoclonal antibody 2D7, in the absence of AMD3100, was subtracted, as a baseline, from all fluorescence measurements obtained with CXCR4-specific antibodies.HXBc2 gp120 glycoprotein was prepared in the following manner. Approximately 3.5×106 293T cells were seeded in a T75 tissue culture flask one day before transfection. Cells were co-transfected with 9 µg of pSVIIIenv and 1 µg of pLTR-Tat plasmids using the Polyfect transfection reagent . The supernatant was harvested 48 hours later, cleared by centrifugation at 2,000 rpm for 5 minutes, and stored at 4°C. The amount of gp120 was quantified by Western blot analysis.Soluble HIV-1HXBc2 gp120 to CXCR4-proteoliposomes and CD4-proteoliposomes was analyzed by FACS. Proteoliposomes were incubated for 2 hours at 37°C in a total volume of 100 µl, containing HIV-1HXBc2 gp120. As a control, proteoliposomes were incubated for 2 hours at 37°C without gp120. Incubation of CXCR4-proteoliposomes was carried out in the presence of 80 µg/ml of soluble CD4 . Proteoliposomes were then centrifuged for 10 minutes at 20,800×g and resuspended in 100 µl of D-PBS/3% FBS containing 5 µg/ml of the human monoclonal antibody 2G12, which recognizes a carbohydrate epitope on the gp120 outer domain The binding of soluble HIV-1CXCR4-proteoliposomes , prepared using solubilization buffer S1 instead of S2 and glycerol-containing dialysis buffer, were used. Polyethylene glycol (PEG)-mediated lipid mixing between 293T cells and CXCR4-proteoliposomes was studied in the following manner. Cells were detached by treatment with D-PBS/5 mM EDTA, pelleted, washed in D-PBS, again pelleted, and resuspended in D-PBS/3% FBS. Samples containing D-PBS, 100 µl of cell suspension, 10 µl of the suspension of CXCR4-proteoliposomes and 120 µl of the PEG solution in HEPES buffer were incubated for 1 hour at 37°C. After this incubation, samples were analyzed with a FACScan flow cytometry as described above.KB9 envelope glycoprotein env gene were prepared using the Plasmid Maxi Kit .The plasmids that express the HIV-1KB9 envelope glycoproteins, 293T cells were co-transfected in T75 tissue culture flasks with the HIV-1KB9 Env-expressing plasmid and an HIV-1 Tat-expressing plasmid using the calcium phosphate precipitation method . Control cells were prepared in the same manner, except that the plasmid containing the deleted ΔKS env gene was used instead of the Env-expressing plasmid.To prepare cells expressing the HIV-1Surface expression of the HIV-1 envelope glycoproteins on Env-transfected 293T cells was analyzed by FACS in the following manner. Cells were detached by treatment with D-PBS/5 mM EDTA, pelleted, washed in D-PBS, pelleted again, and resuspended in 50 µl of D-PBS/3% FBS containing 5 µg/ml of human monoclonal antibody 2G12, which recognizes a carbohydrate epitope on the gp120 outer domain KB9 envelope glycoproteins or that contains the deleted ΔKS env gene with either CD4/CXCR4-proteoliposomes or CD4-proteoliposomes was studied.For the study of cell-proteoliposome interactions, transfected 293T cells and fluorescently labeled extruded proteoliposomes were used. Interaction of cells transfected with plasmids that express the functional HIV-1Extruded CD4/CXCR4-proteoliposomes and CD4-proteoliposomes were prepared using a lipid mixture of the following composition: 35 mol % DOPC, 25 mol % DOPE, 15 mol % sphingomyelin, 20 mol % cholesterol, and 5 mol % RhDOPE. Hence, these proteoliposomes contain a fluorescent rhodamine-labeled lipid probe in a self-quenching concentration.5 cells/ml, and 3×105 cells were seeded in each well of a 24-well plate. Cells were incubated at 37°C with 5% CO2 overnight.Transfected 293T cells were harvested 48 hours after transfection: cells were detached by treatment with D-PBS/5 mM EDTA, pelleted, washed in D-PBS, pelleted again, and resuspended in complete DMEM. The concentration of cells was adjusted to 3×102. The medium was then removed, and cells were harvested in 1 ml D-PBS, pelleted and washed in D-PBS twice, and then pelleted and resuspended in 500 µl of D-PBS. All samples were then analyzed with a FACScan flow cytometry as described above. Each of the experimental conditions was studied in parallel triplicate experiments and the results averaged.The following day, 80 µl of proteoliposome suspension was added to each well of cells. Proteoliposomes were incubated with cells for 8.5 hours at 37°C with 5% COAfter the incubation of CD4/CXCR4-proteoliposomes at different temperatures for various periods of time, the binding of anti-CXCR4 and anti-CD4 antibodies to these proteoliposomes was analyzed by FACS. Suspensions of proteoliposomes were incubated at different temperatures for different periods of time, and immediately placed on ice. Afterwards, proteoliposomes were incubated for 45 minutes at room temperature in D-PBS/3% FBS containing 1.25 µg/ml of the PE-labeled anti-CXCR4 monoclonal antibody 12G5, 0.6 µg/ml of the PE-labeled anti-CD4 monoclonal antibody Q4120, or 0.625 µg/ml of the PE-labeled anti-CCR5 monoclonal antibody 2D7 in a volume of 100 µl. After this incubation, 200 µl of D-PBS/3% FBS was added to each sample. All samples were analyzed with a FACScan flow cytometry as described above. The fluorescence of proteoliposomes incubated with the 2D7 antibody was subtracted, as a baseline, from all fluorescence measurements obtained with the 12G5 and Q4120 antibodies. Each experiment was performed in triplicate and employed proteoliposomes from three separate preparations.0 is the value of C at time t = 0 .The rate of the protein denaturation reaction at particular temperature can be generally described by the formula:app = kC0n−1; here, Kapp is the apparent denaturation rate constant, with k being the true rate constant.If n≠1, integration of (1) yields:0 is unknown and, hence, if the denaturation reaction does not follow first-order kinetics, we cannot find the true denaturation rate constant k. However, we assume that C/C0 is equal to F, which is defined as the specific fluorescence of proteoliposomes associated with the binding of a conformation-dependent antibody, normalized to the specific fluorescence observed for proteoliposomes that were not heated. Therefore, equation (2) can be rewritten as:In our experiments, the initial concentration of protein CThus, if thermal inactivation is a first-order reaction, the value of k can be obtained from the plot of ln F versus t.Likewise, equation (3) can be rewritten as1−n versus t should be a straight line , and the ordinate intercept b (at t = 0) of this line should be close to 1, if the process follows the estimated reaction order. Then, if (F1−n−1)/(n−1) is plotted versus t, the value of Kapp equals the slope of the plotted line.The function F1/2) of the thermal denaturation (time required for 50% denaturation at constant temperature) can be calculated using the formula:Half-lives and decimal reduction times of the thermal denaturation can be calculated for each temperature. The half-lives model), one can calculate the Z value, a measure of the temperature dependence of the denaturation reaction rate.Two models, the Arrhenius model and the Bigelow model, have been used to describe the thermal denaturation of proteins. The Arrhenius model is based on the assumption that the logarithm of the denaturation reaction rate constant k decreases linearly with an increase in reciprocal temperature. By contrast, in the Bigelow model, the logarithm of k increases linearly with an increase in temperature. By using the Arrhenius model, the activation energy EStrictly speaking, the assumptions underlying these two models contradict each other a is the activation energy of the denaturation reaction, A is the pre-exponential factor which is assumed to be temperature-independent, and R = 8.3145 J/(K·mol) = 1.987 cal/(K·mol) is the universal gas constant.According to the Arrhenius model, the absolute temperature T and the denaturation constant k are related according to the empirical Arrhenius equation Taking natural logarithms, equation (10) becomes:For non-first-order kinetics, equation (11) can be modified as:a can be obtained from the slope -Ea/R by regression analysis.When the natural logarithm of the denaturation rate constant is plotted against reciprocal temperature 1/T according to formulae (11) and (12), an Arrhenius plot is obtained. For a single rate-limited thermally activated process, an Arrhenius plot gives a straight line, and the value of E10D values versus temperature are plotted.According to the Bigelow model, by using D values, the Z value i) can be defined as the temperature when the half-life t1/2 of thermal denaturation is equal to 10 minutes i can be found by regression analysis of the line when the log10(t1/2) values versus temperature are plotted. This plot can be approximated as a straight linei can be calculated as Ti = (1−f)/g.The inactivation temperature and extruded (B) CXCR4-proteoliposomes were analyzed by dynamic light scattering (left) and by electron microscopy (right). The dynamic light scattering analysis reveals the diameters of the proteoliposomes in the non-extruded and extruded preparations; the average diameter of the proteoliposomes in each population is noted beneath the figures. The magnification of the electron micrographs differ, as indicated by the scale bars.(1.52 MB TIF)Click here for additional data file.Figure S2Protein composition of the proteoliposomes. CXCR4-proteoliposomes (CXCR4-PL), CD4-proteoliposomes (CD4-PL), or control proteoliposomes (PL) were lysed and analyzed under nonreducing (−β-ME) or reducing (+β-ME) conditions by SDS-PAGE. The gel was silver stained.(0.65 MB TIF)Click here for additional data file.Figure S3Polyethylene glycol (PEG)-mediated fusion of cells and proteoliposomes. The mean fluorescence intensity of 293T cells mixed with rhodamine-labeled non-extruded or extruded CXCR4-proteoliposomes is shown after treatment with PEG or, as a control, in the absence of PEG.(0.15 MB TIF)Click here for additional data file.Figure S4KB9 envelope glycoproteins (KB9) or transfected with a plasmid containing the deleted ΔKS env gene is shown, following incubation with D-PBS or rhodamine-labeled CD4-proteoliposomes or rhodamine-labeled CD4/CXCR4-proteoliposomes. The data shown represent the means and standard deviations derived from triplicate experiments.Association of CD4-proteoliposomes and CD4/CXCR4-proteoliposomes with cells expressing HIV-1 envelope glycoproteins. The median fluorescence intensity of 293T cells expressing the HIV-1(0.15 MB TIF)Click here for additional data file.Table S1Inhibition of antibody binding to CD4/CXCR4-proteoliposomes by ligands.(0.03 MB DOC)Click here for additional data file.