Datasets:

NakanoMiku0-0

/

patent-brf-summary

like 0

11506879

This application claims priority to Chinese Patent Application Ser. No. CN2019214702154 and CN2019108371017 filed 5 Sep. 2019. TECHNICAL FIELD The present invention relates to the field of biomedical microscopic imaging, and more particularly, to an optical super-resolution microscopic imaging system. BACKGROUND At present, there are mainly three optical super-resolution microscopic imaging technologies, comprising Stimulated Emission Depletion Microscopy (STED), Photoactivated Localization Microscopy (PALM)/Stochastic Optical Reconstruction Microscopy (STORM) and Structure Illumination Microscopy (SIM). STED needs two strictly coaxial lasers, wherein one is excited light and the other is lost light. A system of STED is complicated in structure and high in construction cost. In addition, a resolution of STED is related to an intensity of the lost light, and the higher the intensity is, the higher the resolution is. However, excessively high intensity of the lost light may bring extra light damage to a biological sample, thus limiting an applicability of STED. PALM/STORM uses a spectral characteristic to detect fluorescent molecules in a time-sharing manner and locate a central position, thus realizing super-resolution imaging of a sample densely marked with fluorescence. PALM/STORM needs lots of repetition of a process of activation-excitation-localization-bleaching, and needs imaging for thousands of times to reconstruct a super-resolution image. Therefore, the application of PALM/STORM is greatly limited. SIM uses illumination light of one carrier frequency fringe to form Moire fringes on a sample. Fluorescence information of the sample is received by a CCD through an imaging system, and then a spatial domain and a frequency domain are changed through Fourier transform, thus obtaining a super-resolution image. In practical application, SIM is mainly limited by the CCD, so that it is difficult to balance a field of view and a super-resolution. SUMMARY One objective of the present invention is to solve at least the above problems and/or defects, and to provide at least the advantages to be described hereinafter. Another objective of the present invention is to provide an optical super-resolution microscopic imaging system, which can remarkably improve a resolution of an image and obtain a super-resolution image. In order to achieve these objectives and other advantages of the present invention, an optical super-resolution microscopic imaging system is provided, which comprises: a dichroic beamsplitter used for annular parallel light to transmit through; a focusing lens used for converging the annular parallel light transmitted through the dichroic beamsplitter; a confocal pinhole used for the annular parallel light after being converged to pass through so as to filter the annular parallel light; a varifocal lens system used for collimating the annular parallel light passing through the confocal pinhole into excited annular parallel light, the excited annular parallel light sequentially passing through a scanning lens and a microscope, and then forming a single fluorescent excited light spot with a diameter smaller than a diffraction limit of an objective lens on a sample positioned on a focal plane of the objective lens of the microscope; and a detector used for receiving and processing fluorescence emitted by the excited sample, the fluorescence emitted by the excited sample being returned by the same way, and passing through the microscope, the scanning lens, the varifocal lens system, the confocal pinhole and the focusing lens in sequence, and then the dichroic beamsplitter separating the fluorescence emitted by the sample from an annular parallel light path and turning the fluorescence to the detector to obtain a super-resolution image of the sample, wherein a diameter of an airy disk converged by the emit fluorescence of the sample after passing through the varifocal lens system is less than or equal to a size of the confocal pinhole, an inner diameter of the excited annular parallel light outgoing from the varifocal lens system is smaller than a diameter of the fluorescent incident into the varifocal lens system. Preferably, the optical super-resolution microscopic imaging system further comprises: a light source used for emitting a laser; a collimating lens and an excitation filter lens, the laser emitted by the light source sequentially passing through the collimating lens and the excitation filter lens and then forming collimated and excited light; and a beam shaper, the excited light being shaped into the annular parallel light after passing through the beam shaper. Preferably, according to the optical super-resolution microscopic imaging system, the beam shaper comprises a beam deformer, a long-focus convex lens and a short-focus convex lens arranged in sequence, the beam deformer deforms the excited light into the annular parallel light, and a zoom lens composed of the long-focus convex lens and the short-focus convex lens simultaneously reduces a diameter and a thickness of the annular parallel light according to a set multiple, so as to obtain the desired annular parallel light. Preferably, according to the optical super-resolution microscopic imaging system, the beam deformer comprises a plano-concave cone lens and a plano-convex cone lens arranged in sequence. Preferably, according to the optical super-resolution microscopic imaging system, the beam deformer is a variable annular aperture. Preferably, the optical super-resolution microscopic imaging system further comprises XY galvanometer scanners arranged between the varifocal lens system and the scanning lens to scan the sample on the focal plane of the objective lens point by point. Preferably, the optical super-resolution microscopic imaging system further comprises a three-dimensional stage with the sample arranged thereon, wherein the three-dimensional stage moves to drive the sample to move, so that the sample is completely and uniformly scanned. Preferably, according to the optical super-resolution microscopic imaging system, a filter pinhole is arranged at a point where focuses of the long-focus convex lens and the short-focus convex lens coincide, and a diameter of the filter pinhole is larger than a diameter of a main light spot formed by the annular parallel light converged through the long-focus convex lens, and smaller than a first side lobe formed by the annular parallel light converged through the long-focus convex lens. Preferably, according to the optical super-resolution microscopic imaging system, the detector is a photoelectric detector, and the photoelectric detector receives the fluorescence emitted by the excited sample, converts the fluorescence into an electrical signal, and then sends the electrical signal to a computer, so as to obtain a super-resolution image of the sample. Preferably, according to the optical super-resolution microscopic imaging system, the detector is an area-array detector, and the area-array detector receives the fluorescence emitted by the excited sample and executes imaging, and then sends the image to a computer, so as to obtain a super-resolution image of the sample; and a specific imaging process of the area-array detector is as follows: 1) when the excited annular parallel light moves relative to the sample, a scanning step distance being equal to one nthof a half-peak width of a fluorescent excited light spot formed by the excited annular parallel light on the sample, and n being an even number greater than 1; scanning x×y points in total; 2) acquiring x×y 5×5 or 7×7 images in total, and reconstructing an image with a pixel of x×y according to the images; 3) the reconstructed image being composed of a plurality of Gaussian circular spots with a normalized intensity, and a half-peak width thereof being n/2 pixels; 4) when the excited annular parallel light moves to a position (a, b), when an intensity of a central pixel of the 5×5 or 7×7 image is highest, and an intensity of each pixel is continuously distributed, the reconstructed image only having one Gaussian circular spot with a central position at (a, b), and an intensity thereof being equal to the intensity of the central pixel of the 5×5 or 7×7 image; and 5) if the reconstructed image has one Gaussian circular spot with a central position at (c, d), both sides thereof having a Gaussian circular spot at a distance less than or equal to n/2 pixels, and an intensity of the Gaussian circular spot being equal to or greater than an intensity of the Gaussian circular spot with the central position at (c, d), then the reconstructed image subtracting the Gaussian circular spot with the central position at (c, d). Preferably, the optical super-resolution microscopic imaging system further comprises an emission filter lens arranged between the dichroic beamsplitter and the detector, filtering out stray light in other wave bands and only enabling the fluorescence emitted by the sample to transmit through. Preferably, according to the optical super-resolution microscopic imaging system, the varifocal lens system is composed of a first lens and a second lens with variable positions and fixed focal lengths, or the varifocal lens system is composed of a continuous varifocal lens with variable positions. The present invention at least has the following beneficial effects: due to the arranged focusing lens, the annular parallel light transmitting through the dichroic beamsplitter is converged, the converged annular parallel light passes through the confocal pinhole, and the annular parallel light passing through the confocal pinhole transmits through the varifocal lens system to be collimated into the excited annular parallel light, so that the obtained excited annular parallel light can form the single fluorescent excited light spot with the diameter smaller than the diffraction limit of the objective lens on the sample positioned on the focal plane of the objective lens of the microscope after passing through the scanning lens and the microscope in sequence, and the super-resolution image with a resolution increased by at least 1.6 times may be obtained without calculation and reconstruction. Moreover, since the diameter of the confocal pinhole is greater than or equal to the diffraction limit of the objective lens, the present invention also keeps maximum light collection efficiency. Other advantages, objectives and features of the present invention will be partially reflected by the following description, and will be partially understood by those skilled in the art through study and practice of the present invention.

11353332

INCORPORATION BY REFERENCE The disclosure of Japanese Patent Application No. 2018-234151 filed on Dec. 14, 2018 including the specification, drawings and abstract is incorporated herein by reference in its entirety. BACKGROUND 1. Technical Field The present disclosure relates to an information processing system, a storage medium, and an information processing method. 2. Description of Related Art There is a technique that provides the information on a route from a departure place to a destination. For example, Japanese Patent Application Publication No. 2016-057284 (JP 2016-057284 A) discloses a technique that extracts a plurality of captured images, each corresponding to the capturing point identical or near to each of a plurality of passing points on a user's movement route, from the database and, before the user moves from the departure place to the destination, sequentially displays the plurality of extracted captured images. SUMMARY In recent years, a user may wish to confirm a desired route by video. However, according to the technique described above, the video of the route cannot be provided when there is no vehicle that has captured the video of the route while actually traveling the route. Therefore, it is desirable to improve the convenience of the technique for providing the information on a desired route. The present disclosure improves the convenience of the technique for providing the information on a desired route. An information processing system according to a first aspect of the present disclosure includes one or more vehicles; and a server configured to communicate with the one or more vehicles, wherein each of the one or more vehicles is configured to generate a first video of a traveling route by capturing an outside scene while traveling, and the server is configured to store a plurality of the first videos generated by the one or more vehicles, generate a second video of a specific route using two or more of the first videos, the specific route being different from the traveling route of each of the plurality of the first videos, and send the second video to a terminal device. A non-transitory storage medium according to a second aspect of the present disclosure stores a program that causes an information processing device configured to communicate with one or more vehicles to execute storing a plurality of first videos of traveling routes, each of the first videos being generated by capturing an outside scene while each of the one or more vehicles is traveling, generating a second video of a specific route using two or more of the first videos, the specific route being different from the traveling route of each of the plurality of the first videos, and sending the second video to a terminal device. An information processing method according to a third aspect of the present disclosure is performed by an information processing system including the one or more vehicles and a server configured to communicate with the one or more vehicles. The information processing method includes: generating, by each of the one or more vehicles, a first video of a traveling route by capturing an outside scene while traveling; storing, by the server, a plurality of the first videos generated by the one or more vehicles; generating, by the server, a second video of a specific route using two or more of the first videos, the specific route being different from the traveling route of each of the plurality of the first videos, and sending, by the server, the second video to a terminal device. According to the information processing system, the program, and the information processing method according to one embodiment of the present disclosure, the convenience of the technique for providing information on a desired route is improved.

11465958

BACKGROUND OF THE INVENTION Field of the Disclosure The invention relates to a new process for the manufacture or synthesis, respectively, of acylated or alkylated aryl compounds, for example, acylated or alkylated benzenes, by the so-called Friedel-Crafts reaction, and a new catalyst therefore. Description of Related Art Friedel-Crafts reactions, for example, are used in the industrial manufacture of PAEKs (polyaryletherketones), and especially of PEEK (polyetheretherketones). For example, PEEK is made out of condensation of hydroquinone with 4,4′-difluorobenzophenone, and this benzophenone is made out of fluorobenzene as key raw material like described in Victrex WO2018/055384 and also patents in Faming Zhuanli Shenqing (2018), CN 107573500. The 4,4′-difluorobenzophenone is either made out of 4,4′-difluorodiphenylmethane by oxidation (ChemCatChem (2018), 10(5), 1096-1106) or alternatively out of Friedel-Crafts alkylation reaction of fluorobenzene with CCl4(HuagongJinzhan (2015), 34(4), 1104-1108) or Friedel-Crafts acylation of fluorobenzene with 4-fluorobenzoylchloride like mentioned in Raychem's U.S. Pat. No. 4,814,508. The most common synthesis of difluorodiphenylmethane as of today is the synthesis out of 4,4′-methylenebis[benzenamine] by Balz-Schiemann reaction involving dirty NaNO2/HBF4chemistry like described by Faming ZhuanliShenging (2016), in CN 106008182, and by other authors. The synthesis of difluorodiphenylmethane out of fluorobenzene and formaldehyde is described in early days already in Bulletin de la SocieteChimique de France; (1951); p. 318,323 or out of 4-fluorobenzylchloride like in Journal of the Chemical Society, Chemical Communications (1989)(18), 1353-4. Another Friedel-Crafts acylation based synthesis of 4,4′-difluorobenzophenone is out of fluorobenzene, or alternatively starting from 4-fluorophenylboronic acid like described in Chemical Communications (Cambridge, United Kingdom) (2017), 53(93), 12584-12587 and a 4-fluorobenzoic acid derivative or 4-fluorotrichlorotoluene derivative like described in Faming ZhuanliShenging (2016), CN 106045828. All these processes involve at least in one of the steps a Balz-Schiemann reaction combined with a Friedel-Crafts reaction. Both reaction types are quite old technologies which might have to be replaced by newer environmentally friendly chemistries and reaction technologies. The synthesis of 4,4′-difluorobenzophenone out of 4,4′-dichlorobenzophenone by “dirty” Halex reaction is described in Mitsui's patent U.S. Pat. No. 4,453,009. The said Halex chemistry in general is considered “dirty” due to incomplete conversion, and isolation of product is challenging and often produces large amounts toxic waste water. The “dirty” KCl obtained as coupling product is often used for landfill. In general a Friedel-Crafts reaction of benzoylchloride with chlorobenzene in state of the art reactors (Lewis acid catalyzed in ionic liquids) is known as described in Chemistry Letters (2008), 37(8), 844-845 and Journal of the Chinese Chemical Society (Taipei) (2000), 47(6), 1243-1246, also the Friedel-Craft in microreactors with α-Fe2O3and CaCO3nanoparticles is already described like in Chemical Engineering Journal (Amsterdam, Netherlands) (2018)331, 443-449. The Friedel-Crafts reaction of chlorobenzene with chlorobenzoylchloride with AlCl3 as Lewis acid is described with 96% yield in HuagongXinxingCailiao (2012), 40(2), and 87-90% and in Journal of Fluorine Chemistry (2005), 126(8), 1191-1195 by using rare earth(III) perfluorooctane sulfonates in fluorous solvents with 86% yield. The reaction of chlorobenzene with terephtaloylchloride is known from KhimicheskayaTekhnologiya (Moscow, Russian Federation) (2001)(5), 3-5, at temperatures around 260° C. without Friedel-Crafts Catalyst and with 86% yield and also in Qingdao KejiDaxueXuebao, ZiranKexueban (2007), 28(1), 39-42 using AlCl3 and Jpn. KokaiTokkyoKoho (2014), JP 2014237738 using FeCl3 as Lewis acid. Friedel-Crafts reaction of chlorobenzylchloride and chlorobenzene is described in Journal of Organic Chemistry (1989), 54(5), 1201-3, and AngewandteChemie, International Edition (2011), 50(46), 10913-10916. For example, Friedel-Crafts reaction may be useful regarding the manufacture of benzophenone. The preferred IUPAC name of benzophenone is diphenylmethanone; other names include benzophenone, phenyl ketone, diphenyl ketone, benzoylbenzene, benzoylphenyl, benzoylphenyl, diphenylmethanone; the CAS Number is 119-61-9. In the prior art benzophenone is produced by the copper-catalyzed oxidation of diphenylmethane with air. A laboratory route involves the reaction of benzene with carbon tetrachloride followed by hydrolysis of the resulting diphenyldichloromethane. It can also be prepared by Friedel-Crafts acylation of benzene with benzoyl chloride in the presence of a Lewis acid (e.g., aluminium chloride) catalyst. Another route of synthesis is through a palladium(II)/oxometalate catalyst. This converts an alcohol to a ketone with two groups on each side. Another, less well-known reaction to produce benzophenone is the pyrolysis of anhydrous calcium benzoate. Regarding properties, diphenyldichloromethane is an organic compound with the formula (C6H5)2CCl2. It is a colorless solid that is used as a precursor to other organic compounds. Diphenyldichloromethaneis prepared, in the prior art, from carbon tetrachloride and anhydrous aluminium chloride as catalyst in a double Friedel-Crafts alkylation of benzene. Alternatively, benzophenone is treated with phosphorus pentachloride: (C6H5)2CO+PCl5→(C6H5)2CCl2+POCl3 Diphenyldichloromethaneundergoes hydrolysis to benzophenone: (C6H5)2CCl2+H2O→(C6H5)2CO+2HCl Diphenyldichloromethaneis used in the synthesis of tetraphenylethylene, diphenylmethane imine hydrochloride and benzoic anhydride. Regarding diphenylmethane, diphenylmethane is an organic compound with the formula (C6H5)2CH2. The compound consists of methane wherein two hydrogen atoms are replaced by two phenyl groups. Diphenylmethane forms a common skeleton in organic chemistry; the diphenylmethyl group is also known as benzhydryl. It is prepared by the Friedel-Crafts alkylation of benzyl chloride with benzene in the presence of a Lewis acid such as aluminium trichloride: C6H5CH2Cl+C6H6→(C6H5)2CH2+HCl All known above reactions either produce lots of waste and waste water, require expensive reagents or are not practicable in industrial scale. Object of the present invention is to overcome the disadvantages of the prior art processes, in particular to provide a more efficient and energy saving processes, also more environmentally friendly process, for the manufacture of compounds by Friedel-Crafts reaction, and to provide a beneficially catalyst therefore. Another object of the invention is to provide a Friedel-Crafts reaction, and to provide a beneficially catalyst therefore, which can easily be combined with a fluorination reaction, wherein the fluorination reaction may be prior to the Friedel-Crafts reaction, or may be after the Friedel-Crafts reaction. Herein it is still another object of the invention to provide a catalyst for the Friedel-Crafts reaction which catalyst may be used in both, the Friedel-Crafts reaction and the fluorination reaction. SUMMARY OF THE INVENTION The objects of the invention are solved as defined in the claims, and described herein after in detail. In particular, in one aspect, the present invention pertains to a novel environmentally friendly process for the manufacture or synthesis, respectively, of acylated or alkylated aryl compounds, for example, acylated or alkylated benzenes, by the so-called Friedel-Crafts reaction, and a new catalyst therefore. Accordingly, in another aspect, the invention pertains to a novel Friedel-Crafts catalyst or a novel use of a catalyst in a Friedel-Crafts reaction, respectively. In the context of organic molecules, aryl is any functional group or substituent derived from an aromatic ring, usually an aromatic hydrocarbon, such as phenyl and naphthyl. The term “aryl” is used for the sake of abbreviation or generalization, and “Ar” is used as a placeholder for the aryl group in chemical structure diagrams. A simple aryl group is phenyl (with the chemical formula C6H5), a group derived from benzene. The most basic aryl group is phenyl, which is made up of a benzene ring with one hydrogen atom substituted for some substituent, and has the molecular formula C6H5—. To name compounds containing phenyl groups, the phenyl group can be taken to be the parent hydrocarbon and being represented by the suffix “-benzene”. Alternatively, the phenyl group could be treated as the substituent, being described within the name as “phenyl”. This is usually done when the group attached to the phenyl group consists of six or more carbon atoms. The so-called Friedel-Crafts reactions are well known to the persons skilled in the art. For example, Friedel-Crafts reactions are known as a set of reactions developed by Charles Friedel and James Crafts in 1877 to attach substituents to an aromatic ring. Friedel-Crafts reactions are of two main types: alkylation reactions and acylation reactions. Both proceed by electrophilic aromatic substitution. The Friedel-Crafts alkylation involves the alkylation of an aromatic ring with an alkyl halide using a strong Lewis acid catalyst. With anhydrous ferric chloride as a catalyst, the alkyl group attaches at the former site of the chloride ion. This reaction suffers from the disadvantage that the product is more nucleophilic than the reactant. Consequently, overalkylation occurs. Furthermore, the reaction is only very useful for tertiary alkylating agents, some secondary alkylating agents, or ones that yield stabilized carbocations (e.g., benzylic ones). In the case of primary alkyl halides, the incipient carbocation (R(+)—X—Al(−)—Cl3) will undergo a carbocation rearrangement reaction. The Friedel-Crafts acylation involves the acylation of aromatic rings. Typical acylating agents are acyl chlorides. Typical Lewis acid catalysts are acids and aluminium trichloride. Friedel-Crafts acylation is also possible with acid anhydrides. Reaction conditions are similar to the Friedel-Crafts alkylation. This reaction has several advantages over the alkylation reaction. Due to the electron-withdrawing effect of the carbonyl group, the ketone product is always less reactive than the original molecule, so multiple acylations do not occur. Also, there are no carbocation rearrangements, as the acylium ion is stabilized by a resonance structure in which the positive charge is on the oxygen. The viability of the Friedel-Crafts acylation depends on the stability of the acyl chloride reagent. A compound of relevance in the context of the present invention is terephthaloyl chloride (TCL, 1,4-benzenedicarbonyl chloride), also known as terephthalic acid dichloride. The preferred IUPAC name is benzene-1,4-dicarbonyl dichloride. Other names are terephthaloyl dichloride, 1,4-benzenedicarbonyl chloride, benzene-1,4-dicarbonyl chloride, terephthalic acid dichloride, terephthaloyl dichloride, p-phthalyl chloride; and a common abbreviation is TCL. As stated before, all reactions known in the prior art either produce lots of waste and waste water, require expensive reagents or are not practicable in industrial scale. The disadvantages of the prior art are overcome by the present invention. Hence, this present invention provides a process without waste water, reasonable prices reagents and suitable for industrial scale. More particularly the object is solved by using very cheap clean and easy to make starting materials, and by using SbHal5based catalyst systems. The invention is also very advantageous even if fluorinated compounds are intended to be prepared, and furthermore, in one embodiment the Friedel-Crafts reaction of the invention optionally is performed in microreactor systems. The invention, in one aspect, is directed to a process of preparing a compound by Friedel-Crafts reaction, characterized in that the reaction is performed in the presence of an antimony pentahalide catalyst (SbHal5), preferably in the presence of an activated antimony pentahalide catalyst (SbHal5), optionally activated by hydrogen fluoride (HF). In another aspect, the invention is directed to a use of an antimony pentahalide catalyst (SbHal5), preferably of an activated antimony pentahalide catalyst (SbHal5), optionally activated by hydrogen fluoride (HF), as catalyst in Friedel-Crafts reaction. In a further aspect, the invention is directed to a use of an antimony pentahalide catalyst (SbHal5), preferably of an activated antimony pentahalide catalyst (SbHal5), optionally activated by hydrogen fluoride (HF), as catalyst in a process of preparing a compound by Friedel-Crafts reaction. In still a further aspect, the invention is directed to a process or use as defined here before, wherein the Friedel-Crafts reaction is combined with a fluorination reaction, which fluorination reaction may be prior to the Friedel-Crafts reaction, or which fluorination reaction may be after the Friedel-Crafts reaction. Accordingly, the invention also pertain in one embodiment to a process of preparing a compound by Friedel-Crafts reaction, characterized in that the reaction is performed in the presence of an antimony pentahalide catalyst (SbHal5), preferably in the presence of an activated antimony pentahalide catalyst (SbHal5), optionally activated by hydrogen fluoride (Hf), and wherein the compound prepared is a fluorinated compound. Surprisingly, it was found that a fluorination catalyst normally used with excess of HF in an industrially beneficial process for preparing fluorobenzenes from halobenzene precursors using HF to form hydrogen halide, in addition can also provide for a beneficial and surprisingly simple use as a Friedel-Crafts catalyst if HF is used in “low” concentration, or HF is absent, and thus provides new opportunities of providing acylated or alkylated compounds as industrially interesting starting materials for the manufacture of compounds by Friedel-Crafts reaction, in a manner that was not known in the prior art before the present invention. The term “low” concentration is defined more particularly herein below in the detailed description of the invention. Halogenation catalysts and/or fluorination catalysts are well known to those skilled in the field, and preferably in context of the invention, based on Sb, As, Bi, Al, Zn, Fe, Mg, Cr, Ru, Sn, Ti, Co, Ni, preferably on the basis of Sb. More preferably a fluorination catalyst, especially an Sb fluorination catalysts providing the active species H2F+SbF6−, if SbHal5is kept in an excess of HF for a fluorination step prior or subsequent to the Friedel-Crafts reaction, but wherein in the Friedel-Crafts reaction itself the HF is used in “low” concentration only, e.g. in the ppm-range. According to the invention, antimony (Sb) is the best and cheapest catalyst, but As and Bi are also possible to be used as fluorination catalyst, and if desired also for the Friedel-Crafts reaction, in the oxidation stage III of the metals, especially in the presence of SbHal5with a SbHal-III share, or with share of other metal compounds like MHalh compounds, e.g., AsHal3and BiHal3. The Friedel-Crafts reaction can be performed in reactors normally used in Friedel-Crafts reactions, but preferably the reactors are resistant to hydrogen fluoride (HF), at least to traces of HF, e.g., in the ppm-range. The Friedel-Crafts reaction may be performed batch-wise process or in a continuous process. Continuous Friedel-Crafts reaction processes may be preferred. In the present invention, in one embodiment of the Friedel-Crafts reaction it is particularly preferred to employ a microreactor.

11445591

FIELD OF THE INVENTIONS The inventions described below relate to the field of dimming controllers for lighting. BACKGROUND OF THE INVENTIONS Historically, 0-10V dimming signals for controlling light intensity have been transmitted over wires in cables that are part of and rated for a National Electrical Code (NEC) class 2 circuit. A class 2 circuit has sufficiently low voltage and current limitations such that the cables in the circuit do not have to be housed in raceway and conduit when they traverse the surface of a building. An NEC class 1 circuit can carry higher voltages and current, but the cables in such a circuit must be housed in raceway or conduit when they traverse the surface of a building. While different cables for different class 1 circuits can be routed together through common raceway and conduit, class 1 and class 2 circuits must be isolated from each other. Recently, electrical cable manufacturers have started offering cables for use in NEC class 1 circuits that include power wires for transmitting line power 110-120V AC as well as low-voltage wires for transmitting a 0-10V dimming signal. The overall cable is rated for use in class 1 circuits. Controllers for lighting control systems such as The Watt Stopper Inc.'s Digital Lighting Management system typically include inputs for line power and one or more sensors, such as occupancy and vacancy sensors. The line power is connected to one or more outputs for lighting loads within the controller through internal relays so that the lighting loads can be turned on or off based upon the status of the sensors. The controllers also typically include an output for a 0-10V dimming signal. The output is typically only suitable for a connection to a cable that is part of a class 2 circuit. SUMMARY The devices and methods described below provide for a hybrid dimming controller for a lighting control system providing isolated class 1 and class 2 dimming outputs. The controller has two NEC class 1 outputs for providing independent low-voltage dimming-control signals for two lighting loads and two NEC class 2 outputs for providing the same two independent dimming control-signals for the lighting loads. Thus, the controller has both a class 1 and a class 2 output for delivering the same dimming-control signal for each of the two lighting loads while maintaining within the controller the isolation that is required between class 1 and class 2 circuits. This provides an installer with greater flexibility when performing an installation of a lighting control system. The installer can choose to route the cable or wires transmitting the dimming signal through conduit or raceway for the class 1 circuits or could instead choose to route the cable or wires transmitting the dimming signal outside of such conduit or raceway. The low-voltage dimming control signal may be a 0-10V signal. A subset of the class 2 outputs may be in the form of a class 2 connector. Each of the class 1 outputs may be in the form of two low-voltage wires, each of which has sufficient insulation for a class 1 circuit.

11469464

CROSS-REFERENCE TO RELATED APPLICATIONS The present application is a National Stage Application of PCT International Application No. PCT/FR2018/051582 (filed on Jun. 28, 2018), under 35 U.S.C. § 371, which claims priority to French Patent Application Nos. 1756079 (filed on Jun. 29, 2017), 1756364 (filed on Jul. 6, 2017), and 1853930 (filed on May 7, 2019), which are each hereby incorporated by reference in their complete respective entireties. TECHNICAL FIELD The present invention relates to systems for encapsulating objects like of that microelectronic components and batteries. It relates more particularly to the field of batteries, and namely lithium-ion batteries, which can be encapsulated in this manner. The invention also relates to a novel method for manufacturing thin film lithium-ion batteries, having a novel architecture and encapsulation that confer on them a particularly low self-discharge, and an improved service life. BACKGROUND Microelectronic components and batteries, and in particular thin film batteries, must be encapsulated in order to be durable since oxygen and humidity degrade them. In particular, lithium-ion batteries are very sensitive to humidity, and need an encapsulation that provides them with a service life greater than 10 years. With the spread of portable electronic devices and networks of autonomous sensors, the need for rechargeable batteries with high energy density and high power density has grown considerably. Thin film lithium-ion batteries have a high energy density and a high power density, are rechargeable, and do not have a memory effect: they are capable of meeting this need, but their reliability and their service life remain critical factors. Thin film lithium-ion batteries comprise electrodes and an electrolyte that are entirely solid, that is to say devoid of liquid. The thickness of the various layers that form them normally does not exceed 10 μm, and is often comprised between 1 and 4 μm. It is observed that these thin film batteries, such as multilayer batteries, are sensitive to self-discharge. According to the positioning of the electrodes, namely the proximity of the edges of the electrodes for multilayer batteries and the cleanliness of the cuts, a leak current can appear on the ends, a creeping short circuit that reduces the performance of the battery. This phenomenon is exacerbated if the film of electrolyte is very thin. These all-solid thin film lithium-ion batteries most often use anodes comprising a layer of metallic lithium. It is observed that the anode materials have a high variation in their volume during the cycles of charge and discharge of the battery. Indeed, during a cycle of charge and discharge, a portion of the metallic lithium is transformed into lithium ions that insert themselves into the structure of the cathode materials, which is accompanied by a reduction in the volume of the anode. This cyclic variation of the volume can deteriorate the mechanical and electrical contacts between the layers of electrodes and of electrolyte. This reduces the performance of the battery over its life. The cyclic variation of the volume of the anode materials also induces a cyclic variation of the volume of the cells of the batteries. It thus engenders cyclic stresses on the encapsulation system, capable of initiating cracks that are responsible for the loss of sealing (or even of integrity) of the encapsulation system. This phenomenon is another cause of the reduction in the performance of the battery over its life Indeed, the active materials of lithium-ion batteries are very sensitive to air and in particular to humidity. The mobile lithium ions spontaneously react with traces of water to form LiOH, leading to calendar aging of the batteries. Not all the materials for insertion of and electrolytes conductive of the lithium ions are reactive upon contact with humidity. For example, Li4Ti5O12does not deteriorate upon contact with the atmosphere or with traces of water. On the contrary, as soon as it is charged with lithium in the form Li4,Ti5O12with x>0, then as for the surplus of lithium inserted (x), it is sensitive to the atmosphere and reacts spontaneously with the traces of water to form LiOH. The lithium that has reacted is therefore no longer available for the storage of electricity, inducing a loss of capacity of the battery. In order to avoid the exposure of the active materials of the lithium-ion battery to air and to water and prevent this type of aging, it is essential to protect it by an encapsulation system. Numerous encapsulation systems for thin film batteries are described in the literature. The document US 2002/0 071 989 describes a system for encapsulating an all-solid thin film battery comprising a stack of a first layer of a dielectric material chosen from alumina (Al2O3), silica (SiO2), silicon nitride (Si3N4), silicon carbide (SiC), tantalum oxide (Ta2O5) and amorphous carbon, of a second layer of a dielectric material and of a sealing layer disposed on the second layer and covering the totality of the battery. The document U.S. Pat. No. 5,561,004 describes a plurality of systems for protection of a thin film lithium-ion battery. A first proposed system comprises a layer of parylene covered with an aluminum film deposited on the active components of the battery. However, this system of protection against the diffusion of the air and of the water vapor is only effective for approximately one month. A second proposed system comprises alternating layers of parylene (500 nm thick) and of metal (approximately 50 nm thick). The document specifies that it is preferable to also coat these batteries with a layer of epoxy hardened with ultraviolet radiation (UV) in such a way as to reduce the speed of degradation of the battery by atmospheric elements. According to the prior art most lithium-ion batteries are encapsulated in metallized sheets of polymer (called “pouch”) closed around the battery cell and heat sealed at the connector tapes (called “tabs”). This packaging is relatively flexible and the positive and negative connections of the battery are thus embedded in the heat-sealed polymer that was used to close the packaging around the battery. However, this welding between the sheets of polymer is not totally impermeable to the gases of the atmosphere, the polymers used to heat seal the battery are rather permeable to the gases of the atmosphere. It is observed that the permeability increases with the temperature, which accelerates aging. However the surface of these welds exposed to the atmosphere remains very small, and the rest of the packaging consists of aluminum sheets sandwiched between these sheets of polymer. In general, two sheets of aluminum are associated in order to minimize the effects related to the presence of holes, of defects in each of these sheets of aluminum. The probability of two defects, on each of the foils being aligned is greatly reduced. These packaging technologies allow to guarantee approximately 10 to 15 years of calendar service life for a 10 Ah battery with a surface area of 10×20 cm2, under normal conditions of use. If the battery is exposed to a high temperature, this service life can be reduced to less than 5 years; this remains insufficient for numerous uses. Similar technologies can be used for other electronic components, such as capacitors, active components. Consequently, there is a need for systems and methods for encapsulating thin film batteries and other electronic components, which protects the component against air, humidity and the effects of temperature. More particularly there is a need for systems and methods for encapsulating thin film lithium-ion batteries, which protects them against air and humidity as well as against their deterioration when the battery is subjected to charge and discharge cycles. The encapsulation system must be impermeable and hermetic, must envelop and cover the component or the battery totally, must be sufficiently flexible to be able to accompany slight changes in dimensions (“breaths”) of the battery cell, and must also allow to galvanically separate the edges of electrodes having opposite signs in order to avoid any creeping short circuit. One goal of the present invention is to at least partially overcome the disadvantages of the prior art mentioned above. Another goal of the present invention is to propose lithium-ion batteries provided with a very long service life and having a low self-discharge. SUMMARY At least one of the goals above is achieved by means of at least one of the objects according to the invention as presented below. The present invention proposes as a first object a system30for encapsulating an object1000such as an electronic or electrochemical component such as a battery, characterized in that it is formed by three successive layers comprising: i. a first covering layer31,31′ composed of an electrically insulating material deposited by atomic layer deposition (hereinafter ALD, acronym for Atomic Layer Deposition), which at least partly covers said object, ii. a second covering layer32,32′ comprising parylene and/or polyimide, disposed on the first covering layer, iii. a third covering layer33,33′ deposited on the second covering layer in such a way as to protect the second encapsulation layer, namely, with respect to oxygen, and to increase the service life of the object. Advantageously, the system for encapsulating an object comprises a covering layer comprising parylene and/or polyimide, preferably parylene N and an encapsulation system30deposited on said covering layer comprising parylene and/or polyimide. Advantageously, the third covering layer33,33′ contains epoxy resin, polyethylene naphthalate (PEN), polyimide, polyamide, polyurethane or silicone. A second object of the invention is an electronic or electrochemical component such as a battery, preferably a thin film battery comprising an encapsulation system30. Another object of the invention is an electrochemical component, said component being a thin film battery, said battery comprising: a stack alternating between at least one anode10,10′ and at least one cathode20,20′, each consisting of a stack of thin films and wherein the anode10,10′ comprises at least one thin film of an active anode material12, and optionally a thin film of an electrolyte material13, and in which stack the cathode20,20′ comprises at least one thin film of an active cathode material22, and optionally a thin film of an electrolyte material23so that that the battery successively comprises at least one thin film of an active anode material12, at least one thin film of an electrolyte material13,23and at least one thin film of an active cathode material22, an encapsulation system30in which said first layer31,31′ at least partly covers the stack, said encapsulation system30partly covering said stack, a first anode10or cathode20comprising at least one accessible connection zone, while the adjacent cathode20or the anode10comprises a covering zone ZRT, which is covered by at least said first covering layer31,31′ and said second covering layer32,32′, said covering zone being located facing the connection zones ZC of the first anode or cathode, in a direction perpendicular to the plane of said stack. Another object of the invention is a method for manufacturing an encapsulated electronic or electrochemical component, comprising the formation of an encapsulation system30and wherein the following are successively deposited in such a way as to form said encapsulation system30: (i) a first covering layer31,31′ composed of an electrically insulating material by ALD, (ii) a second covering layer32,32′ comprising parylene and/or polyimide, deposited on said first covering layer, (iii) a third covering layer33,33′, deposited on the second covering layer, able to, and deposited in such a way as to, protect the second encapsulation layer namely from oxygen. Another object of the invention is a method for manufacturing an electronic component or an encapsulated battery, comprising the formation of an encapsulation system according to the invention and wherein the following are successively deposited in such a way as to form said encapsulation system: a pretreatment layer comprising parylene and/or polyimide on said electronic or electrochemical component, a first covering layer31,31′ composed of an electrically insulating material by ALD deposited on said covering layer comprising parylene and/or polyimide, a second covering layer32,32′ comprising parylene and/or polyimide, deposited on said first covering layer, a third covering layer33,33′, deposited on the second covering layer, able to, and deposited in such a way as to, protect the second encapsulation layer namely from oxygen. Yet another object of the invention is a method for manufacturing a thin film battery, said battery comprising a stack alternating between at least one anode10,10′ and at least one cathode20,20′, each consisting of a stack of thin films and wherein the anode10,10′ comprises: at least one thin film of an active anode material12, and optionally a thin film of an electrolyte material13, and wherein the cathode20,20′ comprises at least one thin film of an active cathode material22, and optionally a thin film of an electrolyte material23so that the battery successively comprises at least one thin film of an active anode material12, at least one thin film of an electrolyte material13,23and at least one thin film of an active cathode material22, said method comprising the following steps: (a) a primary superposition is formed, comprising an alternating succession of sheets of cathode and of sheets of anode, said primary superposition being intended to form at least one battery, two adjacent sheets defining at least one protruding region RS, intended to form said accessible connection zone ZC, as well as at least one set-back region RT, intended to form said covering zone RTC, (b) the encapsulation system according to the invention is deposited by the method described above. Advantageously, after step (b), the accessible connection zone ZC or each accessible connection zone ZC are revealed. In one embodiment, after step (b), a step (c) is carried out comprising at least one primary cut perpendicularly to the plane of said primary superposition in such a way as to make accessible a connection zone ZC at the anode hereinafter anode connection zone and at least one primary cut is carried out perpendicularly to the plane of said primary superposition in such a way as to make accessible a connection zone ZC at the cathode hereinafter cathode connection zone. Advantageously, the primary cuts are carried out at opposite edges of said primary superposition. In a first embodiment, the edges of two adjacent sheets of the primary superposition comprising an alternating succession of sheets of cathode and of sheets of anode are straight edges, the edge of a first sheet forming the protruding region RS while the edge of a second sheet forming the set-back region RR. In a second embodiment, first notches50,50′,50″,50′″ having a first or big cross-section are made in the edge of a first sheet of the primary superposition comprising an alternating succession of sheets of cathode and of sheets of anode, the wall of said first notches forming said set-back region RR, and second notches having a second or small cross-section, smaller than the first cross-section, are made in a second adjacent sheet, the wall of said second notches50,50′,50″,50′″ forming said protruding region RS. Advantageously, the sheets of cathode and the sheets of anode, have notches50,50′,50″,50′″ in the shape of a circle. Advantageously, first orifices having a first or big cross-section are made in a first sheet, the wall of said orifices forming said set-back region RR, second orifices having a second or small cross-section, smaller than the first cross-section, are made in a second adjacent sheet, the wall of said orifices forming said protruding region RS, the inner volume of said orifices is filled via the encapsulation system or one of these alternatives and at least one secondary cut, preferably each secondary cut, is made inside said first and second orifices, so that the connection zones ZC are formed near the walls having the small cross-section and the covering zones are formed near the walls having the big cross-section. Advantageously, in two adjacent sheets, first and second slots, mutually offset in the direction perpendicular to the plane of said sheets, are made, the inner volume of said slots is filled via the encapsulation system and at least one secondary cut, preferably each secondary cut, is made inside said slots, so that the connection zones are formed near the walls of a first slot and the covering zones are formed near the walls of a second slot. Advantageously, after step (c), the anode and cathode connection zones ZC are electrically connected to each other by thin-film deposition of an electronic conductor and wherein the deposition is carried out by ALD41,41′. Advantageously, anode and cathode interconnections40,40′ are made by metallization of the sections previously covered with a thin film of an electronic conductor. Advantageously, after step (c), the anode and cathode connection zones are electrically connected to each other by an interconnection system successively comprising: a first electronically conductive layer, preferably metallic, optional, preferably deposited by ALD41,41′, a second layer42,42′ containing epoxy resin loaded with silver, deposited on the first electronically conductive layer, and a third layer43,43′ containing tin, deposited on the second layer. In another embodiment, after step (c), the anode and cathode connection zones are electrically connected to each other by an interconnection system successively comprising: a first electronically conductive layer, preferably metallic, optional, preferably deposited by ALD41, a second layer42containing epoxy resin loaded with silver, deposited on the first electronically conductive layer, and a third layer43acontaining nickel, deposited on the second layer, a fourth layer43bcontaining tin or copper, deposited on the third layer. Advantageously, the sheets have dimensions clearly greater than those of the final battery, characterized in that at least one other cut called tertiary is made, in a median portion of said sheets. Advantageously, said electrically insulating material is chosen from non-conductive organic or inorganic polymer materials having barrier properties with regard to water. Advantageously, said electrically insulating material is chosen from Al2O3, SiO2, SiOyNx and the epoxy resins. Advantageously, the second covering layer comprises parylene N. Advantageously, the thickness of the first covering thin film is less than 200 nm, preferably between 5 nm and 200 nm, and even more preferably approximately 50 nm and the thickness of the second covering layer is between 1 μm and 50 μm, preferably approximately 10 μm. Advantageously, the thickness of the third covering thin film is between 1 μm and 50 μm, preferably less than 10 μm, preferably less than 5 μm and even more preferably approximately 2 μm. Advantageously, the layer of anode material is made from a material chosen from: (i) the oxynitrides of tin (having the typical formula SnOxNy); (ii) lithiated iron phosphate (having the typical formula LiFePO4); (iii) the mixed oxynitrides of silicon and tin (having the typical formula SiaSnbOyNz with a>0, b>0, a+b≤2, 0<y≤4, 0<z≤3) (also called SiTON), and in particular SiSn0.87O1.2N1.72; as well as the oxynitride-carbides having the typical formula SiaSnbCcOyNz with a>0, b>0, a+b≤2, 0<c<10, 0<y<24, 0<z<17; SiaSnbCcOyNzXn with X at least one of the elements out of F, Cl, Br, I, S, Se, Te, P, As, Sb, Bi, Ge, Pb and a>0, b>0, a+b>0, a+b≤2, 0<c<10, 0<y<24 and 0<z<17; and SiaSnbOyNzXn with Xn at least one of the elements out of F, Cl, Br, I, S, Se, Te, P, As, Sb, Bi, Ge, Pb and a>0, b>0, a+b≤2, 0<y≤4 and 0<z≤3; (iv) the nitrides of the type SixNy (in particular with x=3 and y=4), SnxNy (in particular with x=3 and y=4), ZnxNy (in particular with x=3 and y=4), Li3−xMxN (with M=Co and 0≤x≤0.5, with M=Ni and 0≤x≤0.6 or with M=Cu and 0≤x≤0.3); (v) the oxides SnO2, Li4Ti5O12, SnB0.6P0.4O2.9 and TiO2. Advantageously, the layer of cathode material can be made from a cathode material chosen from: the oxides LiMn2O4, LiCoO2, LiNiO2, LiMn1.5Ni0.5O4, LiMn1.5Ni0.5−xXxO4 where X is chosen from Al, Fe, Cr, Co, Rh, Nd, other rare earths such as Sc, Y, Lu, La, Ce, Pr, Pm, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, and where 0<x<0.1, LiMn2−xMxO4 with M=Er, Dy, Gd, Tb, Yb, Al, Y, Ni, Co, Ti, Sn, As, Mg or a mixture of these compounds and where 0<x<0.4, LiFeO2, LiMn1/3Ni1/3Co1/3O2, LiNi0.8Co0.15Al0.05O2, the phosphates LiFePO4, LiMnPO4, LiCoPO4, LiNiPO4, Li3V2(PO4)3; the phosphates having the formulae LiMM'PO4, with M and M′ (M≠M′) selected from Fe, Mn, Ni, Co, V; all the lithiated forms of the following chalcogenides: V2O5, V3O8, TiS2, the oxysulfides of titanium (TiOySz with z=2−y and 0.3≤y≤1), the oxysulfides of tungsten (WOySz with 0.6<y<3 and 0.1<z<2), CuS, CuS2, preferably LixV2O5 with 0<x≤2, LixV3O8 with 0<x≤1.7, LixTiS2 with 0<x≤1, the LixTiOySz oxysulfides of titanium and of lithium with z=2−y, 0.3≤y≤1, LixWOySz, LixCuS, LixCuS2. Advantageously, the layer of electrolyte material is made from electrolyte material chosen from: the garnets having the formula LidA1xA2y(TO4)z where A1 represents a cation having the degree of oxidation +II, preferably Ca, Mg, Sr, Ba, Fe, Mn, Zn, Y, Gd; and where A2 represents a cation having the degree of oxidation +III, preferably Al, Fe, Cr, Ga, Ti, La; and where (TO4) represents an anion in which T is an atom having the degree of oxidation +IV, located at the center of a tetrahedron formed by the atoms of oxygen, and in which TO4 advantageously represents the silicate or zirconate anion, knowing that all or a portion of the elements T having a degree of oxidation +IV can be replaced by atoms having a degree of oxidation +III or +V, such as Al, Fe, As, V, Nb, In, Ta; knowing that: d is between 2 and 10, preferably between 3 and 9, and even more preferably between 4 and 8; x is 3 but can be between 2.6 and 3.4 (preferably between 2.8 and 3.2); y is 2 but can be between 1.7 and 2.3 (preferably between 1.9 and 2.1) and z is 3 but can be between 2.9 and 3.1; the garnets, preferably chosen from: Li7La3Zr2O12; Li6La2BaTa2O12; Li5.5La3Nb1.75In0.25O12; Li5La3M2O12 with M=Nb or Ta or a mixture of the two compounds; Li7−xBaxLa3−xM2O12 with 0≤x≤1 and M=Nb or Ta or a mixture of the two compounds; Li7−xLa3Zr2−xMxO12 with 0≤x≤2 and M=Al, Ga or Ta or a mixture of two or three of these compounds; the lithiated phosphates, preferably chosen from: the lithiated phosphates of the NASICON type; Li3PO4; LiPO3; the Li3Al0.4Sc1.6(PO4)3 called “LASP”; Li3(Sc2−xMx)(PO4)3 with M=Al or Y and 0≤x≤1; Li1+xMx(Sc)2−x(PO4)3 with M=Al, Y, Ga or a mixture of the three compounds and 0≤x≤0.8; Li1+xMx(Ga1−yScy)2−x(PO4)3 with 0≤x≤0.8; 0≤y≤1 and M=Al or Y or a mixture of the two compounds; Li1+xMx(Ga)2−x(PO4)3 with M=Al, Y or a mixture of the two compounds and 0≤x≤0.8; the Li1+xAlxTi2−x(PO4)3 with 0≤x≤1 called “LATP”; or the Li1+xAlxGe2−x(PO4)3 with 0≤x≤1 called “LAGP”; or Li1+x+zMx(Ge1−yTiy)2−xSizP3−zO12 with 0≤x≤0.8 and 0≤y≤1.0 and 0≤z≤0.6 and M=Al, Ga or Y or a mixture of two or three of these compounds; Li3+y(Sc2−xMx)QyP3−yO12 with M=Al and/or Y and Q=Si and/or Se, 0≤x≤0.8 and 0≤y≤1; or Li1+x+yMxSc2−xQyP3−yO12 with M=Al, Y, Ga or a mixture of the three compounds and Q=Si and/or Se, 0≤x≤0.8 and 0≤y≤1; or Li1+x+y+zMx(Ga1−yScy)2−xQzP3−zO12 with 0≤x≤0.8, 0≤y≤1, 0≤z≤0.6 with M=Al or Y or a mixture of the two compounds and Q=Si and/or Se; or Li1+xM3xM2−xP3O12 with 0≤x≤1 and M3=Cr and/or V, M=Sc, Sn, Zr, Hf, Se or Si, or a mixture of these compounds; the lithiated sulfurated compounds, preferably chosen from: LixAlz−yGaySw(PO4)c with 4<w<20, 3<x<10, 0≤y<1, 1≤z<4 and 0<c<20; LixAlz−yGaySw(BO3)c with 4<w<20, 3<x<10, 0≤y<1, 1≤z<4 and 0<c<20; LixAlz−yScySw(PO4)c 4<w<20, 3<x<10, 0≤y<1, 1≤z<4 and 0<c<20; LixAlz−yScySw(BO3)c 4<w<20, 3<x<10, 0≤y<1, 1≤z<4 and 0<c<20; LixGez−ySiySw(PO4)c 4<w<20, 3<x<10, 0≤y<1, 1≤z<4 and 0<c<20; LixGe(z−y)SiySw(BO3)c with 4<w<20, 3<x<10, 0≤y<1, 1≤z<4 and 0<c<20; the lithiated borates, preferably chosen from: Li3(Sc2−xMx)(BO3)3 with M=Al or Y and 0≤x≤1; Li1+xMx(Sc)2−x(BO3)3 with M=Al, Y, Ga or a mixture of the three compounds and 0≤x≤0.8; Li1+xMx(Ga1−yScy)2−x(BO3)3 with 0≤x≤0.8, 0≤y≤1 and M=Al or Y; Li1+xMx(Ga)2−x(BO3)3 with M=Al, Y or a mixture of the two compounds and 0≤x≤0.8; Li3BO3, Li3BO3-Li2SO4, Li3BO3-Li2SiO4, Li3BO3-Li2SiO4-Li2SO4; the oxynitrides, preferably chosen from Li3PO4−xN2x/3, Li4SiO4−xN2x/3, Li4GeO4−xN2x/3 with 0<x<4 or Li3BO3−xN2x/3 with 0<x<3; the lithiated compounds containing oxynitride of lithium and of phosphorus, called “LiPON”, in the form of LixPOyNz with x ˜2.8 and 2y+3z ˜7.8 and 0.16≤z≤0.4, and in particular Li2.9PO3.3N0.46, but also the compounds LiwPOxNySz with 2x+3y+2z=5=w or the compounds LiwPOxNySz with 3.2≤x≤3.8, 0.13≤y≤0.4, 0≤z≤0.2, 2.9≤w≤3.3 or the compounds in the form of LitPxAlyOuNvSw with 5x+3y=5, 2u+3v+2w=5+t, 2.9≤t≤3.3, 0.84≤x≤0.94, 0.094≤y≤0.26, 3.2≤u≤3.8, 0.13≤v≤0.46, 0≤w≤0.2; the materials containing oxynitrides of lithium of phosphorus or of boron, respectively called “LiPON” and “LiBON” also capable of containing silicon, sulfur, zirconium, aluminum, or a combination of aluminum, boron, sulfur and/or silicon, and boron for the materials containing oxynitrides of lithium of phosphorus; the lithiated compounds containing oxynitride of lithium, of phosphorus and of silicon called “LiSiPON”, and in particular Li1.9Si0.28P1.0O1.1N1.0; the oxynitrides of lithium of the types LiBON, LiBSO, LiSiPON, LiSON, thio-LiSiCON, LiPONB (or B, P and S respectively represent boron, phosphorus and sulfur); the oxynitrides of lithium of the type LiBSO such as (1−x)LiBO2−xLi2SO4 with 0.4≤x≤0.8; the lithiated oxides, preferably chosen from Li7La3Zr2O12 or Li5+xLa3(Zrx,A2−x)O12 with A=Sc, Y, Al, Ga and 1.4≤x≤2 or Li0.35La0.55TiO3 or Li3xLa2/3−xTiO3 with 0≤x≤0.16 (LLTO); the silicates, preferably chosen from Li2Si2O5, Li2SiO3, Li2Si2O6, LiAlSiO4, Li4SiO4, LiAlSi2O6; the solid electrolytes of the antiperovskite type chosen from: Li3OA with A a halide or a mixture of halides, preferably at least one of the elements chosen from F, Cl, Br, I or a mixture of two or three or four of these elements; Li(3−x)Mx/2OA with 0<x≤3, M a divalent metal, preferably at least one of the elements chosen from Mg, Ca, Ba, Sr or a mixture of two or three or four of these elements, A a halide or a mixture of halides, preferably at least one of the elements chosen from F, Cl, Br, I or a mixture of two or three or four of these elements; Li(3−x)M3x/3OA with 0≤x≤3, M3 a trivalent metal, A a halide or a mixture of halides, preferably at least one of the elements chosen from F, Cl, Br, I or a mixture of two or three or four of these elements; or LiCOXzY(1−z) with X and Y halides as mentioned above in relation to A, and 0≤z≤1; the compounds La0.51Li0.34Ti2.94, Li3.4V0.4Ge0.6O4, Li2O—Nb2O5, LiAlGaSPO4; the formulations containing Li2CO3, B2O3, Li2O, Al(PO3)3LiF, P2S3, Li2S, Li3N, Li14Zn(GeO4)4, Li3.6Ge0.6V0.4O4, LiTi2(PO4)3, Li3.25Ge0.25P0.25S4, Li1.3Al0.3Ti1.7(PO4)3, Li1+xAlxM2−x(PO4)3 (where M=Ge, Ti, and/or Hf, and where 0<x<1), Li1+x+yAlxTi2−xSiyP3−yO12 (where 0≤x≤1 and 0≤y≤1); the electrolytes containing polymers that conduct lithium ions impregnated or not with lithium salts, the hybrid electrolytes comprising an inorganic matrix such as a ceramic matrix into which a phase carrying lithium ions is inserted, such as an organic electrolyte comprising at least one lithium salt, a solution formed by a lithium salt dissolved in an organic solvent or a mixture of organic solvents, and/or comprising a polymer containing at least one lithium salt possibly dissolved in an organic solvent or a mixture of organic solvents, and/or comprising at least one ionic liquid containing at least one lithium salt possibly dissolved in an organic solvent or a mixture of organic solvents. This phase carrying lithium ions can be a solution formed by a lithium salt dissolved in an organic solvent or a mixture of organic solvents, and/or it can comprise a polymer containing lithium salts, and/or it can comprise an ionic liquid (i.e. a melted lithium salt) containing a lithium salt. This phase can also be a solution formed from a mixture of these three components. The lithium salt can be for example LiPF6 or LiBF4 dissolved in an aprotic solvent, or an ionic liquid containing lithium salts. The ionic liquids and organic electrolytes can also be mixed. For example the LiPF6 dissolved in EC/DMC can be mixed at 50 mass % with an ionic liquid containing lithium salts of the type LiTFSI:PYR14TFSI 1:9 mol. Mixtures of ionic liquids that can operate at low temperature can also be made, for example such as the mixture LiTFSI:PYR13FSI:PYR14TFSI (2:9:9 mol ratio). EC is the usual abbreviation for ethylene carbonate (CAS n°: 96-49-1). DMC is the usual abbreviation for dimethyl carbonate (CAS n°: 616-38-6). LITFSI is the usual abbreviation for lithium bis-trifluoromethanesulfonimide (CAS n°: 90076-65-6). PYR13FSI is the usual abbreviation for N-Propyl-N-Methylpyrrolidinium bis(fluorosulfonyl)imide. PYR14TFSI is the usual abbreviation for 1-butyl-1-methylpyrrolidinium bis(trifluoromethanesulfonyl)imide. Yet another object of the invention is a thin film battery capable of being obtained by the method according to the invention. Yet another object of the invention is a thin film battery capable of being obtained by the method according to the invention characterized in that said encapsulation system totally coats four of the six faces of said battery and partly coats the two laterally opposite remaining faces, said two remaining faces being partly coated by at least said first covering layer31,31′ and at least said second layer32,32′ and said two remaining faces comprising an anode connection zone and a cathode connection zone. Another object of the invention is a battery comprising a stack alternating between at least one anode10′ and at least one cathode20′, each consisting of a stack of thin films and wherein the anode10′ comprises: at least one thin film of an active anode material12′, and optionally a thin film of an electrolyte material13′, and wherein the cathode20′ comprises at least one thin film of an active cathode material22′, and optionally a thin film of an electrolyte material23′ so that that the battery successively comprises at least one thin film of an active anode material, at least one thin film of an electrolyte material and at least one thin film of an active cathode material, with it being understood that the anode10′ has a first orifice50having a first cross-section, the wall of said first orifice forming at least one region that is set back RT (respectively protruding RS) and the adjacent cathode20′ has a second orifice having a second cross-section, smaller (respectively greater) than the first cross-section, the wall of said second orifice forming at least one region that is protruding RS (respectively set back RT); said at least one protruding region defining an accessible connection zone ZC and said at least one set-back region RT defining a non-accessible covering zone.

11286217

FIELD The field is the reaction of feed with fluid catalyst. The field may particularly relate to reacting a paraffin feed with a fluid dehydrogenation catalyst. BACKGROUND Light olefin production is vital to the production of sufficient plastics to meet worldwide demand. Paraffin dehydrogenation (PDH) is a process in which light paraffins such as ethane and propane can be dehydrogenated to make ethylene and propylene, respectively. Dehydrogenation is an endothermic reaction which requires external heat to drive the reaction to completion. Dehydrogenation catalyst may incorporate a dehydrogenation metal with a molecular sieve or an amorphous material. The catalyst must be sufficiently robust and appropriately sized to be able to resist the attrition expected in a fluidized system. In PDH reactions with fluidized catalyst, coke can deposit on the catalyst while catalyzing the reaction. The catalyst may be regenerated in a catalyst regenerator by combusting coke from the catalyst in the presence of oxygen. The hot regenerated catalyst may then be transferred back to the reactor to catalyze the reaction. If insufficient heat is provided to drive the endothermic reaction, olefin production can suffer. The catalytic reactions are more selective to the desired products such as propylene than the thermal cracking reactions. Care must be taken to maximize catalytic reactions over thermal cracking reactions to improve selectivity to propylene. There is a need, therefore, for improved methods of contacting feed with catalyst in a fluidized catalytic reaction process. BRIEF SUMMARY A dehydrogenation process and apparatus are used to contact a paraffinic stream with dehydrogenation catalyst to product olefinic product gases. The olefinic product gases are separated from spent dehydrogenation catalyst and contained in a confined space that has a smaller volume than the reactor particularly at the same elevation. The containment of the olefinic product gases facilitates quenching the olefinic product gases to terminate reaction and improve selectivity to propylene.

11235968

CROSS-REFERENCE TO RELATED APPLICATIONS This application is related to U.S. application Ser. No. 16/565,411, filed Sep. 9, 2019, entitled TOP RING RELIEF JOINT FOR A HORSE BRIDLE BIT AND METHOD OF USE and which application is hereby incorporated by reference herein in its entirety, including but not limited to those portions that specifically appear hereinafter, the incorporation by reference being made with the following exception: In the event that any portion of the above-referenced applications is inconsistent with this application, this application supersedes said portion of said above-referenced applications. SUMMARY OF THE INVENTION The disclosure of the present invention relates to a HORSE BRIDLE BIT or more specifically to a horse bridle bit having a headstall ring and curb chain ring featuring adjustable relief joints which allows the upper portion of the side shanks to conform to the cheek of the horse during aggressive rein commands, such as, turn or whoa. The relief joints allow for self-adjustment of the headstall ring and curb attachment ring to provide even contact and distribution of pressure against the side of the horses cheek and chin, depending on the position of the bit throughout the range of motion as the bit rotates and/or tips. A bit without the relief joints can cause undue pressure on different spots of the horse's face, depending on the bit position, and as the contoured shape of the horse's head changes from the chin and through the cheek area. Additionally, each horse may have differing facial characteristic or prominent contours which may be better accommodated using a bit having a relief joints at the headstall ring and curb chain ring. The bridle bit configured to convey clear commands to the horse without undue encroachment into the cheek or jaw, resulting in more controllable and compliant horse. A first embodiment of the present invention or horse bridle bit comprising a mouthpiece and side shanks connected with a moveable joint. The full side shanks having an overall length, with approximately two-thirds of the length being substantially linear with a rein loop formed in the free-end, the shank having an approximately 45 degree downturn bend where the remaining one-third of the shank forms a purchase portion; the free end of the purchase portion having an articulated headstall ring and articulated curb chain ring. The headstall ring configured as substantially a semi-circle wherein approximately one half of the central axis of the semi-circle base formed having a solid panel which extends toward the upper quadrant of the semi-circular ring opening. The base of the solid panel has an opening or pivot cut-out formed in the base, the cut-out leaving enough material at the base to constitute an axle or pivot pin, the pivot pin forming the base of semi-circular headstall ring. A post is formed at the inside edge of the pivot opening, and the post is attached to the axle or pivot pin proximate the mid-point of the headstall ring base. The axle or pivot pin extends across the headstall ring base from the panel side to the open side with the pivot opening post attached at the mid-point of the headstall ring base, at the mid-point of the pivot pin. The headstall ring is attached to the purchase portion of the side shank with pin cylinder formed in the free end of the purchase portion. The cylinder is aligned at approximately forty five degrees from purchase portion and perpendicular to, or substantially perpendicular to the linear rein loop end of the side shank. The cylinder having a central opening or hole formed to fit over the headstall ring pivot pin with enough clearance to allow the head stall ring to move freely. A limit slot is formed in the outside edge of the pin cylinder, the limit slot is formed wider than the thickness of the headstall ring and configured to engage a portion of the solid panel formed on the inside of the headstall ring. The width of the slot can be adjusted to change of the amount of rotation, or relief, the headstall ring has in relationship to the longitudinal axis of the side shank. In one embodiment, the limit slot will allow the headstall ring to pivot approximately 15 degrees to the outside of the side shank axis and approximately 15 degree to the inside of the side shank axis; this may also be described as the headstall ring having an overall relief rotation of 30 degrees. In other embodiments the cylinder limit slot will allow the headstall ring to having an overall relief rotation of more than 30 degrees or less than 30 degrees. In another embodiment the degrees of headstall relief or rotation to the inside of the side shank does not equal the degrees of rotation the headstall ring to the outside of the side shank. It is understood that in no case will the headstall ring be allowed to rotate more than 90 degree toward the inside of the side shank which may cause the edge of the side shank to be pulled or gouge into the horse's cheek or jaw. The overall rotation of the headstall ring will not reach 180 degrees, but, as for this disclosure, it is understood that be overall rotation or relief of the headstall ring may be any overall degree of rotation less than 180 degrees. The curb chain ring is configured having a pivot cylinder formed in one end and the free end having a curb chain opening or a curb chain hook. The pivot cylinder is configured to fit over the pivot pin formed in the base of the headstall ring on the open side, opposite the solid panel. The pivot cylinder having a central opening, or hole, formed to fit securely over the headstall ring pivot pin, the hole having enough clearance to allow the curb chain ring to pivot freely. A curb chain ring limit slot is formed on the inside edge of the curb chain cylinder with the limit slot formed to fit over the central post of the headstall ring. The width of the curb chain cylinder limit slot can be adjusted to change the amount of the relief provided by the curb chain ring. In one embodiment, the limit slot will allow the curb chain ring to pivot approximately 15 degrees to the outside of the alignment of the headstall ring and approximately 15 degree to the inside of the alignment of the headstall ring; this may also be described as the curb chain ring having an overall relief rotation of 30 degrees in relationship to the headstall ring. In other embodiments the cylinder limit slot will allow the curb chain ring to having an overall relief rotation of more than 30 degrees or less than 30 degrees and in no case may the curb chain ring rotate more than 90 degrees toward the inside of the side shank where may cause the horse discomfort. In one embodiment, the curb chain ring is formed as a ring requiring the curb chain to have attachment hardware to close or secure the bridle bit on the horse's head. In another embodiment, the curb chain ring is formed as a hook, or as a carabiner having a spring gate closure. This embodiment allows a full curb chain link or ring to be pushed through the spring gate and secured within the curb chain ring. The spring gate, in conjunction with the ability to pivot the curb chain ring away from the horse's head, allows a rider or user to readily adjust the curb chain length while the horse is wearing the bridle bit.

11354833

FIELD This disclosure relates to magnetic resonance (MR) imaging generally, and more specifically to k-space trajectory infidelity correction in MR imaging. BACKGROUND In MR imaging, measurements are made in the frequency domain as k-space measurements. These measurements correspond to trajectories in the frequency domain, such as Cartesian, radial, or spiral trajectories, etc. K-space trajectory infidelity, where the actual acquired k-space location does not match the designed k-space trajectory, is a common issue in MR imaging. This trajectory infidelity causes various types of artifacts in reconstructed images. The type of artifact may depend on the actual application and include, among others, Nyquist ghosting in echo planar imaging (EPI) and off-resonance in non-Cartesian trajectories. The artifacts may be removed or reduced. Conventional model-based methods retrospectively correct the k-space trajectory by image processing. Trade-offs are usually made between model complexity and computation cost. Deep learning has been used to remove the artifacts caused by the trajectory infidelity in the image space, where artifact contaminated images are input, and the targets are the artifact-free images. Artifact removal may risk altering representation of actual structure of the patient. SUMMARY By way of introduction, the preferred embodiments described below include methods, systems, instructions, and computer readable media for k-space trajectory infidelity correction. Using machine training, a model is trained to correct k-space measurements in k-space for trajectory infidelity. In a first aspect, a method is provided for k-space trajectory infidelity correction in a MR imaging system. The MR imaging system scans a patient with an MR sequence. The scanning results in k-space measurements corresponding to k-space trajectories. The k-space measurements are corrected for errors in the k-space trajectories by input of the k-space measurements to a machine-learned model, which outputs corrected k-space measurements in response to the input. An MR image is reconstructed from the corrected k-space measurements. The MR image is displayed. Any of various types of scans may be used. For example, echo planar imaging is used. As another example, MR scans with non-Cartesian trajectories are used. A two- or three-dimensional distribution of pixels or voxels, respectively, representing an area or volume, respectively, of the patient is reconstructed. The MR image is rendered from the voxels or pixels to a two-dimensional display. In one embodiment, the correction is by a deep learned autoencoder network as the machine-learned model. In a further embodiment, the machine learned model performing the correction was trained using a loss for trajectory shift, a loss for k-space correction, and a loss for an estimate of corrupted data estimated from the trajectory shift and the k-space correction. Any of various architectures may be used for the machine-learned model. For example, the machine-learned model was trained as a first neural network trained in conjunction with a second neural network trained to estimate trajectory shifts. In this case, the second neural network as trained by be used to estimate trajectory shifts in response to input of the k-space data from the scanning. In a second aspect, a system is provided for trajectory correction in MR imaging. An MR scanner is configured to scan a patient. The scan provides first scan data in a scan domain. An image processor is configured to alter trajectories of the first scan data by application of a machine-learned model to the first scan data. The machine-learned model outputs second scan data in the scan domain where the second scan data has the altered trajectories. The image processor is configured to reconstruct a representation in an object domain from the second scan data in the scan domain. A display is configured to display an MR image from the reconstructed representation. In one embodiment, the MR scanner is configured to scan the patient with echo planar imaging or non-Cartesian trajectories. Two or three-dimensional imaging may be used, such as reconstructing a three-dimensional distribution of voxels representing a volume of the patient where the MR image is a rendering of the voxels to the display comprising a two-dimensional display. In another embodiment, the machine-learned model is a deep learned encoder-decoder network. In other embodiments, the machine-learned model was previously trained using a loss for trajectory shift, a loss for k-space correction, and a loss for an estimate of corrupted data estimated from the trajectory shift and the k-space correction. The machine-learned model may have been trained as a first neural network trained in conjunction with a second neural network trained to estimate trajectory shifts. The image processor may be configured to estimate trajectory shifts by application of another machine-learned model. The trajectory shifts are estimated in response to input of the first scan data in the scan domain to the other machine-learned model. In a third aspect, a method is provided for training a network for reducing artifacts from trajectory infidelity in MR imaging. A first neural network is defined to receive input k-space data. The first neural network is machine trained for correction of trajectory infidelity in the input k-space data. A machine-learned network resulting from the machine training is stored. In one embodiment, the first neural network is defined as an image-to-image network. In another embodiment, deep learning by the first neural network learns to output changes to trajectories of the input k-space data in response to input of the input k-space data. The trajectories of the input k-space data are altered according to the output changes. The machine training uses a loss based on a difference between the input k-space data with the altered trajectories and a ground truth. In other embodiments, a second neural network is defined to receive the input k-space data. The second neural network is defined to output a trajectory shift. The machine training includes joint training of the first and second neural networks. For example, the joint training uses first, second and third losses: the first loss being for corrected k-space data, the second loss being for the trajectory shift, and the third loss being for corrupted k-space data formed from the corrected k-space data and the trajectory shift. The present invention is defined by the following claims, and nothing in this section should be taken as a limitation on those claims. Aspects, embodiments, or features of one type of claims (e.g., method for application, method for learning, or system) may be used in other types. Further aspects and advantages of the invention are discussed below in conjunction with the preferred embodiments and may be later claimed independently or in combination.

11263150

TECHNICAL FIELD The present disclosure relates to quality assurance in general, and to verification of operation of processors while an address translation cache is full, in particular. BACKGROUND Computerized devices control almost every aspect of our life—from writing documents to controlling traffic lights. However, computerized devices are bug-prone, and thus require a testing phase in which the bugs should be discovered. The testing phase, also referred to as verification phase, is considered one of the most difficult tasks in designing a computerized device. The cost of a bug may be enormous, as its consequences may be disastrous. For example, a bug may cause the injury of a person relying on the designated functionality of the computerized device. Additionally, a bug in hardware or firmware may be expensive to fix, as patching it requires call-back of the computerized device. Hence, many developers of computerized devices invest a significant portion, such as 70%, of the development cycle to discover erroneous functionalities of the computerized device. BRIEF SUMMARY One exemplary embodiment of the disclosed subject matter is a method comprising: obtaining a first address translation structure, wherein the first address translation structure comprises multiple levels, each of which comprising one or more entries that point to a next level in the first address translation structure, wherein the multiple levels comprises a first top level which connects a sub-structure of the first address translation structure using pointers thereto, wherein the first address translation structure enables translation of virtual addresses to physical addresses; determining, based on the first address translation structure, a second address translation structure, wherein the second address translation structure comprises a second top level that is determined based on the first top level, wherein the second top level connects the sub-structure of the first address translation structure, wherein the second address translation structure enables translation of virtual addresses to physical addresses; executing a test by a target processor, wherein the test is configured to verify operation of an address translation cache of the target processor, wherein said executing comprises: adding a plurality of cache lines to the address translation cache, wherein said adding is based on the first address translation structure and the second address translation structure, wherein the plurality of cache lines, wherein at least one cache line of the plurality of cache lines is determined based on a translation by the first address translation structure, wherein at least one cache line of the plurality of cache lines is determined based on a translation by the second address translation structure; and verifying the operation of the address translation cache using one or more memory access operations. Another exemplary embodiment of the disclosed subject matter is a computerized apparatus having a processor and coupled memory, the processor being adapted to perform the steps of: obtaining a first address translation structure, wherein the first address translation structure comprises multiple levels, each of which comprising one or more entries that point to a next level in the first address translation structure, wherein the multiple levels comprises a first top level which connects a sub-structure of the first address translation structure using pointers thereto, wherein the first address translation structure enables translation of virtual addresses to physical addresses; determining, based on the first address translation structure, a second address translation structure, wherein the second address translation structure comprises a second top level that is determined based on the first top level, wherein the second top level connects the sub-structure of the first address translation structure, wherein the second address translation structure enables translation of virtual addresses to physical addresses; executing a test by a target processor, wherein the test is configured to verify operation of an address translation cache of the target processor, wherein said executing comprises: adding a plurality of cache lines to the address translation cache, wherein said adding is based on the first address translation structure and the second address translation structure, wherein the plurality of cache lines, wherein at least one cache line of the plurality of cache lines is determined based on a translation by the first address translation structure, wherein at least one cache line of the plurality of cache lines is determined based on a translation by the second address translation structure; and verifying the operation of the address translation cache using one or more memory access operations. Yet another exemplary embodiment of the disclosed subject matter is a non-transitory computer readable medium retaining program instructions, which program instructions when read by a processor, cause the processor to perform: obtaining a first address translation structure, wherein the first address translation structure comprises multiple levels, each of which comprising one or more entries that point to a next level in the first address translation structure, wherein the multiple levels comprises a first top level which connects a sub-structure of the first address translation structure using pointers thereto, wherein the first address translation structure enables translation of virtual addresses to physical addresses; determining, based on the first address translation structure, a second address translation structure, wherein the second address translation structure comprises a second top level that is determined based on the first top level, wherein the second top level connects the sub-structure of the first address translation structure, wherein the second address translation structure enables translation of virtual addresses to physical addresses; executing a test by a target processor, wherein the test is configured to verify operation of an address translation cache of the target processor, wherein said executing comprises: adding a plurality of cache lines to the address translation cache, wherein said adding is based on the first address translation structure and the second address translation structure, wherein the plurality of cache lines, wherein at least one cache line of the plurality of cache lines is determined based on a translation by the first address translation structure, wherein at least one cache line of the plurality of cache lines is determined based on a translation by the second address translation structure; and verifying the operation of the address translation cache using one or more memory access operations.

11450944

BACKGROUND 1. Field The present disclosure relates to antenna technology of transmitting and receiving extremely high frequencies. 2. Description of Related Art With a rapid increase in mobile traffic, fifth generation (5G) technologies based on an extremely high frequency band of 20 GHz or higher have been developed. Extremely high frequency signals may include millimeter waves having frequency bands from 30 GHz to 300 GHz. When extremely high frequencies are used, an antenna and device may become smaller and thinner due to their short wavelengths. Furthermore, a relatively larger number of antennas may be loaded into the same area due to their short wavelengths, so signals may be concentrated and transmitted in a specific direction. Moreover, since a large bandwidth is available, a larger amount of information may be transmitted. The above information is presented as background information only to assist with an understanding of the present disclosure. No determination has been made, and no assertion is made, as to whether any of the above might be applicable as prior art with regard to the present disclosure. SUMMARY An extremely high frequency may have strong straightness, resulting in high path loss. For example, a radio frequency integrated circuit (RFIC) for the extremely high frequency may be disposed close to an antenna. Moreover, beamforming technology for steering signals may be used to use the extremely high frequency having the strong straightness. Aspects of the present disclosure are to address at least the above-mentioned problems and/or disadvantages and to provide at least the advantages described below. Accordingly, an aspect of the present disclosure is to provide an electronic device including a plurality of mounted antennas which have directionality in the direction of at least one of a front plate, a back plate, or a side surface. In accordance with an aspect of the present disclosure, an electronic device is provided. The electronic device may comprise a housing comprising: a front plate facing a first direction, a back plate facing a second direction opposite to the first direction, and a side surface which surrounds the front plate and the back plate, wherein the front plate includes a screen area and a bezel area; a display exposed through the screen area of the front plate; a first circuit board disposed between the display and the back plate and including a first surface facing the display and a second surface facing the back plate; a first antenna array overlaid on the bezel area in the first surface; a second antenna array disposed on the second surface; and a wireless communication circuit disposed on the first circuit board and electrically connected with the first antenna array and the second antenna array, wherein the wireless communication circuit is configured to: form a beam which has directionality in the first direction using the first antenna array and form a beam which has directionality in the second direction using the second antenna array. In accordance with another aspect of the present disclosure, an electronic device is provided. The electronic device, comprises a housing comprising: a front plate, a back plate facing a direction opposite to the front plate, and a side member which surrounds a space between the front plate and the back plate and wherein the housing is integrated or attached with the back plate; a touch screen display located in the housing and exposed through a first portion of the front plate; an antenna array located in the housing when viewed from above the front plate and comprising a plurality of isolated antenna elements disposed in a gap between the touch screen display and the side member; and a wireless communication circuit located in the housing and electrically connected with the antenna array, wherein the wireless communication circuit is configured to form a beam using the antenna array. According to embodiments disclosed in the present disclosure, the electronic device may include a plurality of mounted antennas which have directionality in the direction of at least one of a front plate, a back plate, or a side surface of the electronic device. In addition, various effects directly or indirectly ascertained through the present disclosure may be provided. Other aspects, advantages, and salient features of the disclosure will become apparent to those skilled in the art from the following detailed description, which, taken in conjunction with the annexed drawings, discloses various embodiments of the present disclosure.

11505067

FIELD The present application relates to a display device and a method of installing the display device. BACKGROUND For example, a head-up display device (hereinafter, referred to as a “HUD device”) mounted on a vehicle has been known. A windshield of a vehicle is curved in a front-back direction and in a left-right direction. A ray path from a HUD device to a viewpoint of a driver in the HUD device installed for the driver in a vehicle with a right-hand steering wheel differs from that in a HUD device installed for a driver in a vehicle with a left-hand steering wheel. Therefore, the HUD device installed for the driver in the vehicle with the right-hand steering wheel and the HUD device installed for the driver in the vehicle with the left-hand steering wheel need to be designed so as to have the different ray paths, and it is necessary to arrange different components. An on-vehicle device in which some components can be shared between the vehicle with the right-hand steering wheel and the vehicle with the left-hand steering wheel has been known (for example, see Japanese Laid-open Patent Publication No. 2014-119718 A). SUMMARY In Japanese Laid-open Patent Publication No. 2014-119718 A, it is possible to share some components, but it is impossible to share some other components. Therefore, it is desired to share a large number of components. A display device and a method of installing the display device are disclosed. According to one aspect, there is provided a display device comprising: a display configured to display a video; a concave mirror configured to reflect a video display light of the video displayed on the display toward a reflection part that is formed in a curved shape and that faces a viewer; and a housing in which the display and the concave mirror are assembled, wherein an angle of the concave mirror with respect to the housing is adjustable by rotating the concave mirror on a reference plane of the housing in accordance with a relative positional relationship among the housing, the reflection part, and the viewer. According to one aspect, there is provided a method of installing a display device including: a display configured to display a video; a concave mirror configured to reflect a video display light of the video displayed on the display toward a reflection part that is formed in a curved shape and that faces a viewer; and a housing in which the display and the concave mirror are assembled, the method comprising: adjusting a mounting posture of the housing to a certain posture by rotating the housing by a first certain angle with respect to a mounted portion, the first certain angle being twice an angle between a first central ray of the video display light of the video displayed on the display and a second central ray that is reflected by the reflection part and reaches the viewer, both in a case in which the viewer is located at a first position in which the viewer faces the reflection part that is formed in the curved shape with a symmetric curvature with respect to a symmetric surface, and in a case in which the viewer is located at a second position that is symmetric to the first position with respect to the symmetric surface, and adjusting an angle of the concave mirror by rotating the concave mirror by a second certain angle with reference to the reference plane of the housing, the second certain angle being twice an angle between a normal line of the first central ray on the reference plane of the housing and a central line of the concave mirror on the reference plane. The above and other objects, features, advantages and technical and industrial significance of this application will be better understood by reading the following detailed description of presently preferred embodiments of the application, when considered in connection with the accompanying drawings.

11332716

FIELD The disclosure generally relates to cell differentiation and methods of inducing cell differentiation as well as uses of the differentiated cells in cell therapy and in screens for modulators of cell differentiation. INTRODUCTION Diabetes mellitus type 1 and 2 (T1D, T2D) are diseases characterized by autoimmune destruction or progressive dysfunction and subsequent loss of insulin-producing pancreatic beta cells, respectively. For example, Type-1 diabetes results from autoimmune destruction of the insulin-secreting beta cells within pancreatic islets. Typically it affects children and young adults. Current methods for management of type 1 diabetes generally require frequent glucose monitoring and life-long insulin administration. Current treatments for both types of patients with diabetes include regulating blood glucose levels through injections of exogenous insulin. While this approach provides reasonable management of the diseases, unwanted risks and long-term complications persist due to the inability of tightly maintaining glucose levels within a normal physiological range. Complications include life-threatening episodes of hypoglycemia, as well as long-term complications from hyperglycemia resulting in micro- and macro-angiopathy leading to cardiovascular pathologies and kidney failure, as well as neuropathy. In conjunction with new strategies to induce immune tolerance, the transplantation of healthy islet and beta cells to replace the lost cells may be a cure for the disease. However, a primary challenge remains—the scarcity of functional, glucose-responsive beta cells. One existing approach to treating diabetes is transplantation of human cadaveric islet preparations into patients. This procedure typically results in better glycemic control, can render patients insulin independent for prolonged periods of time, and improves overall quality of life (Shapiro et al, 2000; Barton et al, 2012; Posselt et al, 2010). However, the severe shortage of cadaveric organ donors, requirement for lifelong immunosuppression, and variability between islet preparations hampers the use of islet transplantation as a readily available treatment for people with diabetes. Consequently, numerous research efforts have focused on identifying abundant alternative sources of surrogate glucose-responsive insulin-producing cells (Hebrok, 2012; Efrat & Russ, 2012; Nostro & Keller, 2012; Tuduri & Kieffer, 2011; Bouwens et al, 2013; Zhou & Melton, 2008; Pagliuca & Melton, 2013). One of the most appealing approaches is the directed differentiation into insulin-producing cells from pluripotent human embryonic stem cells (hESC)(D'Amour et al, 2005; Nostro et al, 2011; Guo et al, 2013b; Van Hoof et al, 2011; Mfopou et al, 2010; Chen et al, 2009; Xu et al, 2011; Shim et al, 2014) and more recently, induced pluripotent stem cells (Maehr et al, 2009; Shang et al, 2014; Hua et al, 2013). Researchers have been hopeful that stem cells could provide an unlimited source of functional beta cells. Stepwise differentiation conditions have been proposed that recapitulate developmental signaling and that purportedly differentiate pluripotent stem cells through a definitive endoderm stage all the way into functional pancreatic beta cells (D'Amour, Agulnick et al. 2005; Yasunaga, Tada et al. 2005; Gouon-Evans, Boussemart et al. 2006; Jiang, Shi et al. 2007; Kroon, Martinson et al. 2008; Green, Chen et al. 2011). However, use of stem cells as the starting material for generating pancreatic cells has problems, including lack of availability, potential immunological rejection, and social concerns. Direct beta-cell reprogramming methods could be faster and more efficient than preparing induced pluripotent stem cells (iPSCs). However, a general approach to converting non-endoderm cells, such as fibroblast cells, across the germ-layer boundary towards an endoderm-beta cell lineage has not yet been developed. Cell types derived from the endoderm lineage, such as acinar cells or hepatocytes, might be easier to reprogram into a beta cell lineage owing to their similarity to beta cells. However, these methods have not been successfully applied to cell-based therapy or in vivo therapy because of the practicality of obtaining useful quantities of starting cells. In addition, beta-like cells generated by conventional direct reprogramming are post-mitotic and have very limited regenerative ability. Comprehensive knowledge of signaling events and temporal transcription factor (TF) expression patterns during rodent pancreas organogenesis (Pan & Wright, 2011; Seymour & Sander, 2011; Hebrok, 2003; Murtaugh & Melton, 2003) have accelerated the identification of culture conditions that allow the generation of pancreatic cell types from human pluripotent stem cells (hPSC). Early developmental stages, including definitive endoderm, gut tube-like cells and pancreatic progenitors can be efficiently induced in vitro. Subsequent transitions towards hormone-expressing cells in vitro are less efficient, however, and frequently lead to the formation of a mixed population of different pancreatic progenitors and polyhormonal endocrine cells (Guo et al, 2013a; Nostro et al, 2011; D'Amour et al, 2006). Such polyhormonal cells express insulin among other hormones, but lack expression of key pancreatic beta cell transcription factors and do not secrete insulin in vitro in response to a glucose challenge—the hallmark function of bona fide pancreatic beta cells (Guo et al, 2013a; Nostro et al, 2011; D'Amour et al, 2006). Nonetheless, transplantation of such heterogeneous cultures into surrogate mice results in the formation of glucose-responsive pancreatic beta cells after several months in vivo (Rezania et al, 2012; Kroon et al, 2008; Szot et al, 2014). Sophisticated sorting experiments identified progenitor cells expressing Pancreatic and Duodenal Homeobox 1 TF (PDX1, also known as IPF1) and homeobox protein NKX6.1 as the source for these functional pancreatic beta cells (Kelly et al, 2011). While polyhormonal cells have been identified in human fetal pancreas, suggesting that they may reflect aspects of the normal embryonic differentiation process (Riedel et al, 2011; De Krijger et al, 1992), increasing evidence indicates that hESC-derived polyhormonal cells preferentially give rise to single hormone-positive alpha-like cells (Rezania et al, 2011). Thus, to fully replicate human pancreatic beta cell development in vitro, it is important to better understand and accurately recapitulate the sequence of embryonic signals required for the proper specification of pancreatic beta cell precursors, rather than alpha cell precursors. During normal in vivo pancreatic organogenesis, functional pancreatic beta cells are generated through a step-wise specification process starting with pancreatic progenitors, identified by the expression of PDX1 (Herrera et al, 2002). While PDX1+cells can give rise to all pancreatic lineages (Herrera et al, 2002), the subsequent induction of NKX6.1 in these cells restricts their differentiation potential to only endocrine and ductal cells (Schaffer et al, 2010). Endocrine differentiation is then initiated in PDX1+/NKX6.1+progenitors by short-lived expression of the basic helix-loop-helix Transcription Factor Neurogenin 3 (NEUROG3, also known as NGN3) (Gu et al, 2002). Interestingly, the timing of NEUROG3 expression has been shown to be important in promoting the formation of diverse endocrine islet cell types (Johansson et al, 2007). For example, precocious induction of endocrine differentiation by forced expression of NEUROG3 in mice results predominantly in the generation of alpha cells (Johansson et al, 2007). Apparent from the preceding discussion, generation of functional insulin-producing pancreatic beta cells for the effective treatment of diabetes is a key area of translational research. Stepwise differentiation protocols have been devised to guide the differentiation of human embryonic stem cells (hESCs) and, more recently, induced pluripotent stem cells (iPSCs), into definitive endoderm, primitive gut tube endoderm, posterior foregut endoderm, and pancreatic endoderm (PE). These hESC-derived PE cells can mature into functional pancreatic beta cells in vivo after prolonged periods following transplantation into immunodeficient mice. More recently, improved differentiation protocols have been described that allow the formation of functional pancreatic beta cells from hESCs under cell culture conditions. While these findings are encouraging, several challenges remain and significant efforts have been directed towards further improvement of differentiation conditions, the expansion of cells at different progenitor stages, and the purification of target cell populations in order to obtain sufficient quantities of functional pancreatic beta cells. A reliable and reproducible source of human pancreatic beta cells is so far unavailable. Developing a source for greater numbers of human pancreatic beta cells would have wide application in basic research, drug and toxicology screens, and as a therapeutic product. There is a need for treatments that provide superior control of glucose metabolism to minimize (e.g., eliminate) long-term complications. There is a need for the directed differentiation of stem cells (e.g., pluripotent stem cells such as human pluripotent stem cells) into functional insulin-producing pancreatic beta cells for the treatment of diabetes. SUMMARY The problem of how to obtain or generate significant numbers of pancreatic beta-like cells has been solved by use of the compositions and methods described herein. The pancreatic beta-like cells express insulin protein and key transcription factors, but only rarely express other hormones. Compositions and methods are described herein for producing mammalian cell populations that include a high proportion of pancreatic beta-like cells and/or mature pancreatic cells. The pancreatic beta-like cells and mature pancreatic cells so produced may be particularly useful for treatment of diabetes. This disclosure describes the efficient generation of such cells in vitro. In addition, the disclosed technology offers an improved strategy for pancreatic beta cell survival upon transplantation by implementing the disclosed method for direct differentiation of pancreatic beta cells from embryonic stem cells, such as human embryonic stem cells, in the presence of physiological levels of oxygen. Cell therapies utilizing functional insulin-producing pancreatic beta cells produced from human stem cells hold great promise for the treatment of diabetes. Current pancreatic differentiation protocols induce precocious endocrine differentiation, leading to the formation of undesired polyhormonal endocrine cells. The disclosure provides a simplified suspension-culture-based differentiation protocol that allows for the correct temporal specification of pancreatic and endocrine progenitors into glucose-responsive pancreatic beta cells in vitro. This approach provides a fast and reproducible supply of functional pancreatic beta cells (e.g., human pancreatic beta cells) and enables detailed investigations into pancreas development and pancreatic beta cell biology. Features of the technology disclosed herein may include the exclusion of commonly used BMP inhibitors during embryonic stem cell-to-pancreatic progenitor cell differentiation, which prevents precocious endocrine induction. Sequential exposure of foregut cells to retinoic acid followed by combined EGF/KGF treatment of extended duration establishes highly pure PDX1+and PDX1+/NKX6.1+progenitor populations, respectively. Precise temporal induction of endocrine differentiation in PDX1+/NKX6.1+progenitors, but not in PDX1+/NKX6.1+progenitors, results in the generation of functional pancreatic beta cells in vitro. The pancreatic beta cells produced by the disclosed methods exhibit key features of bona fide human pancreatic beta cells, remain functional after short-term transplantation, and reduce blood glucose levels in diabetic mice. Elaborating on the preceding observations, current pancreatic progenitor differentiation protocols promote precocious endocrine commitment, ultimately resulting in the generation of non-functional polyhormonal cells. Omission of commonly used BMP inhibitors during pancreatic specification prevents precocious endocrine formation while treatment with retinoic acid followed by combined EGF/KGF efficiently generates both PDX1+and subsequent PDX1+/NKX6.1+pancreatic progenitor populations, respectively. Precise temporal activation of endocrine differentiation in PDX1+/NKX6.1+progenitors produces glucose responsive pancreatic beta cells in vitro that exhibit key features of bona fide human pancreatic beta cells, remain functional after short-term transplantation, and reduce blood glucose levels in diabetic mice. Thus, the disclosed system is a simplified and scalable system that accurately recapitulates key steps of human pancreas development, providing a fast and reproducible supply of functional human pancreatic beta cells. The methods disclosed herein result in pancreatic beta cells exhibiting improved function, as evidenced by a rapid and robust response to glucose. The experiments disclosed herein show that more insulin is produced with vitamin C and BayK-8644 in the culture system, as evidenced by GFP reporter gene expression levels and human C-peptide staining Thus, the improved functionality of the pancreatic beta cells produced using the methods disclosed herein is apparent from both qualitative and quantitative measures. In one aspect, the disclosure provides a method of generating a PDX1+/NKX6.1+progenitor cell by initially exposing a stem cell (e.g., an embryonic stem cell such as a human embryonic stem cell or hESC) to an effective amount of a retinoic acid compound, thereby inducing formation of a PDX1+progenitor cell. In some embodiments, the embryonic stem cell is a human embryonic stem cell. In some embodiments, the embryonic stem cell is contacted with a retinoic acid compound in vitro. Embodiments are also contemplated that further comprise not contacting the embryonic stem cell with a bone morphogenic protein (BMP) inhibitor prior to expression of NKX6.1 by the cell. Omitting BMP from the protocol for generating PDX1+progenitor cells prevents precocious endocrine differentiation that can lead to nonfunctional polyhormonal cells as schematically shown inFIG. 15. PDX1 progenitor cells can then be exposed to an effective amount of epidermal growth factor (EGF), keratinocyte growth factor (KGF), or a combination of EGF and KGF for extended time periods, thereby inducing formation of a PDX1+/NKX6.1+progenitor cell. In some of these embodiments, the cell expresses NKX6.1 prior to the cell contacting at least one of epidermal growth factor and keratinocyte growth factor. In some of these embodiments, the cell expresses NKX6.1 prior to contacting epidermal growth factor and keratinocyte growth factor. In some embodiments, cells are exposed to EGF and KGF simultaneously. In yet other embodiments, the method further comprises inducing the PDX1+/NKX6.1+progenitor cell to express NEUROG3, resulting in production of an INS+/NKX6.1+beta cell. In some embodiment, the NEUROG3 expression is induced by contacting the PDX1+/NKX6.1+progenitor cell with an effective amount of an inhibitor of bone morphogenetic protein, an inhibitor of TGFβ/ALK, or an inhibitor of sonic hedgehog. Embodiments are contemplated wherein the PDX1+/NKX6.1+progenitor cell is contacted by an effective amount of an inhibitor of bone morphogenetic protein and an effective amount of an inhibitor of TGFβ/ALK. In some embodiments, the PDX1+/NKX6.1+progenitor cell is contacted by an effective amount of an inhibitor of bone morphogenetic protein and an effective amount of an inhibitor of sonic hedgehog. In some embodiments, the inhibitor of bone morphogenetic protein is Noggin and/or the inhibitor of sonic hedgehog is Cyclopamine. This aspect of the disclosure further provides methods wherein the NEUROG3 expression is induced by exposure of the PDX1+/NKX6.1+progenitor cell to effective amounts of a TATA-Binding Protein, an Activin receptor-Like Kinase inhibitor, Noggin and Keratinocyte Growth Factor (KGF or K). In some embodiments, the NEUROG3 expression begins before expression of NKX2.2 is detected. In some embodiments, no more than 5% of the generated cells are polyhormonal cells. In some embodiments, the INS+/NKX6.1+beta cell is responsive to glucose levels. In some of these embodiments, the INS+/NKX6.1+beta cell secretes an increased level of insulin in response to an increased glucose level. Also provided by this aspect of the disclosure are methods that further comprise contacting the PDX1+/NKX6.1+progenitor cell with an effective amount of vitamin C and/or an effective amount of BayK-8644. As disclosed herein, the addition of vitamin C, BayK-8644 or both vitamin C and BayK-8644 improves the generation of functional pancreatic beta cells, also referred to herein as an INS+/NKX6.1+beta cells, from stem cells such as embryonic stem cells (e.g., hESCs). Some embodiments of the methods according to the disclosure are provided wherein the INS+/NKX6.1+beta cell does not express a detectable level of the Ki67 marker. Another aspect of the disclosure is a method for generating an INS+/NKX6.1+beta cell further compromising transplanting the INS+/NKX6.1+beta cell into a human. In some embodiments, the human is diabetic. Consistent with the foregoing descriptions, an aspect of the disclosure is drawn to a method of producing a pancreatic beta cell from a stem cell comprising: (a) exposing a stem cell to Epidermal Growth Factor (e.g., 10-300 ng/ml Epidermal Growth Factor) and/or Keratinocyte Growth Factor (e.g., 10-300 ng/ml Keratinocyte Growth Factor) for 12-72 hours[e.g., in DMEM comprising 0.1-5.0 mM glutamine (0.05-2.5X GLUTAMAX™; Invitrogen), 0.5-3.0X (e.g., IX) Invitrogen non-essential amino acids, and 0.5-3.0X (e.g., IX) B27 supplement (Invitrogen)] under conditions suitable for cell culture growth, thereby maintaining a progenitor cell; (b) incubating the progenitor cell in a culture medium (e.g., culture medium comprising DMEM) comprising nonessential amino acids (e.g., 0.1-5X non-essential amino acids, e.g., IX non-essential amino acids) (e.g., Invitrogen non-essential amino acids), glutamine (e.g., 0.1-5 mM glutamine) or GLUTAMAX™ (e.g., 0.05-2.5X GLUTAMAX™), heparin (e.g., 2-20 μg/ml heparin), cysteine (e.g., 0.2-5 mM cysteine), zinc (e.g., 2-20 μM zinc), ALK inhibitor (e.g., 2-20 μM ALK inhibitor), BMP inhibitor LDN-193189 (e.g., 0.2-2 μM BMP inhibitor LDN-193189), T3 thyroid hormone (e.g., 0.2-5 μT3 thyroid hormone) and secretase inhibitor XX (e.g.; 0.2-5 μM gamma secretase inhibitor XX, e.g., from Calbiochem) to yield a cell in culture; and (c) adding to the cell in culture vitamin C (e.g., 10-2000 μM vitamin C) and BayK-8644 (e.g., 0.2-5 μM BayK-8644), thereby producing a functional pancreatic beta cell. In some embodiments of the method, the stem cell is (a) exposed to 50 ng/ml Epidermal Growth Factor or 50 ng/ml of Keratinocyte Growth Factor for 12-72 hours in DMEM comprising 2 mM glutamine (IX GLUTAMAX™; Invitrogen), 0.1-5X (e.g., IX) Invitrogen non-essential amino acids, and 0.1-5X (e.g., IX) B27 supplement (Invitrogen); (b) Incubated in DMEM comprising 0.1-5X (e.g.; IX) Invitrogen non-essential amino acids, 2 mM glutamine (IX GLUTAMAX™), 10 μg/ml heparin, 1 mM cysteine, 10 μM zinc, 10 μM ALK inhibitor, 0.5 μM BMP inhibitor LDN-193189, 1 μM T3 thyroid hormone and 1 μM gamma secretase inhibitor XX(Calbiochem) to yield a cell in culture; and (c) Adding to the cell in culture 500 μM vitamin C and 2 μM BayK-8644, thereby producing a functional pancreatic beta cell. In some embodiments, the stem cell is exposed to Epidermal Growth Factor or Keratinocyte Growth Factor for 24 hours to 32 days, e.g., 24-48 hours, 48 hours to 3 days, 3 days to 5 days, 5 days to 10 days, 10 days to 20 days, or 20 days to 32 days. In some embodiments, the stem cell is an embryonic stem cell, such as a human stem cell. Embodiments are also envisioned wherein the stem cell is exposed to epidermal growth factor, or to keratinocyte growth factor, or to both epidermal growth factor and keratinocyte growth factor. The methods disclosed herein result in the efficient production of pancreatic beta cells of improved functionality in exhibiting improved response to glucose. With the addition of vitamin C and Bay K-8644, insulin production is increased, as evident by the strength of the fluorescent signal resulting from expression of GFP in the pancreatic beta cells produced by the disclosed methods. Thus, the disclosed methods lead to the production of pancreatic beta cells exhibiting a qualitative and quantitative improvement in functionality. In some embodiments, the functional pancreatic beta cell exhibits a several-fold, for example a 1-7-fold, increase in insulin secretion upon stimulation with glucose. Embodiments are also contemplated wherein the pancreatic beta cell is functional immediately upon transplantation, and embodiments are envisioned in which the pancreatic beta cell is functional within one week of transplantation. Embodiments are also contemplated wherein the pancreatic beta cell remains functional for at least four weeks, or longer. Yet other embodiments further comprise exposure of the stem cell to an oxygen level no greater than 10% O2, such as an oxygen level no greater than 5% O2, or no greater than 4% O2. In some embodiments, NGN3 and PDX1/NKX6.1 are expressed during the incubating step and the adding step. Embodiments are comprehended wherein at least 75% of the stem cells differentiate into functional pancreatic beta cells. The percentage yield of pancreatic beta cells (i.e., 75% pancreatic beta cells) was observed in experiments where cells are dissociated and allowed to reaggregate in smaller clusters using Aggrewells (StemCellTechnology) cell culture plates. Controls (undissociated clusters) reveal fewer pancreatic beta cells (about 65%). As shown in mice, Notch signaling is important in endocrine differentiation and indicates induction of endocrine differentiation upon disruption of cell-cell contact. It is expected that another influential factor is the better nutrition supplied to smaller cell clusters. Consistent with the data disclosed herein, an average of about 7,000 cells per cluster were generated in ambient oxygen and about 4.000 cells per cluster were generated at physiological oxygen levels. Other embodiments of the method are envisioned wherein the progenitor cell is maintained for up to 32 days in culture containing Epidermal Growth Factor and/or Keratinocyte Growth Factor. Another aspect of the disclosure provides a functional pancreatic beta cell produced according to the method described above. In some embodiments of this aspect of the disclosure, the functional pancreatic beta cell is a human cell. In some embodiments, the cell expresses at least three pancreatic cell markers selected from the group of human c-peptide (C-PEP), Chromagranin A (CHGA), transcription factor NKX6.1, transcription factor PDX1, transcription factor PAX6, transcription factor NKX2.2, transcription factor NEUROD1 and transcription factor ISL1, without inducing expression of other hormones, e.g., Glucagon (GCG) or Somatostatin (SST), that serve as markers for cells other than pancreatic beta cells. Yet another aspect of the disclosure is drawn to a method for treating diabetes comprising administering an effective amount of the cell disclosed herein to a diabetic subject, such as a human. One aspect of the invention is a method of converting pancreatic endodermal progenitor cells to pancreatic beta-like cells by (a) contacting the pancreatic endodermal progenitor cells with a first composition that includes heparin, zinc salts, a TGF-β inhibitor (e.g., Alk5 inhibitor), a BMP4 signaling inhibitor (e.g., LDN-193189), a T3 thyroid hormone, a Notch Signaling Inhibitor (e.g., Compound E), a Ca2+channel agonist (e.g. BayK-8644), vitamin C, and combinations thereof to generate a first population of partially differentiated pancreatic beta-like cells; (b) contacting the first population of cells with a second composition that includes heparin zinc salts, a TGF-β inhibitor (e.g., Alk5 inhibitor), a BMP4 signaling inhibitor (e.g., LDN-193189), a T3 thyroid hormone, cysteine, an anti-oxidant (e.g., vitamin E or a derivative thereof such as TROLOX®), an Axl kinase inhibitor (e.g., R428), a Ca2+channel agonist (e.g. BayK-8644), vitamin C, and combinations thereof to generate a second population of pancreatic beta-like cells. In a third step, the second population of cells can be cultured to generate 3D aggregates under low-attachment plates. The pancreatic beta cells that are generated can be administered to treat diabetes. The application also provides methods for converting adult cells (e.g., mammalian starting cells such as fibroblasts) into cells of the endodermal lineage. Once those cells have been converted into endodermal progenitor cells, they can be differentiated into pancreatic beta cells using the method described in the previous paragraph. Thus, another aspect of the invention is a method that involves: (a) contacting starting mammalian cells with a first composition comprising an effective amount of a TGFβ family member and a WNT activator, while the mammalian cells express pluripotency factors comprising OCT4, SOX2, and KLF4, wherein the effective amount is sufficient to generate a first cell population comprising definitive endoderm cells and wherein at least about 5% of the cells in the first population express Sox17 and/or Foxa2, but where the first cell population does not express detectable NANOG; and (b) contacting cells from the first cell population with a second composition comprising an effective amount of a TGFβ receptor inhibitor, a hedgehog pathway inhibitor, and a retinoic acid receptor agonist to generate a second cell population comprising pancreatic progenitor cells, wherein at least about 10% of the cells in the second population express Pdx1, Nkx6.1, Hnf6, or a combination thereof. Another aspect of the invention is a method that involves contacting an endodermal cell population with an expansion composition that includes growth factors, a WNT activator, and a TGFβ receptor inhibitor for a time sufficient to expand cell numbers by at least ten-fold and thereby generate an expanded population of posterior foregut-like progenitor cells. The methods can further include administering the second cell population, posterior foregut-like progenitor cells, pancreatic progenitor cells obtained from the second cell population, functional pancreatic beta-like cells obtained therefrom, or a combination thereof, to a mammal in need thereof. For example, such a mammal can have type I diabetes, type II diabetes, or type 1.5 diabetes.

11494741

BACKGROUND Applicant has identified many deficiencies and problems associated with existing methods, apparatus, and systems related to electronic calendar or scheduling services. For example, many calendar services fail to overcome technical challenges associated with event creation, modification, and sharing. BRIEF SUMMARY In accordance with various embodiments, an apparatus comprising at least one processor and at least one non-transitory memory comprising program code is provided. The at least one non-transitory memory and the program code configured to, with the at least one processor, cause the apparatus to at least receive, from a plurality of client devices, a plurality of electronic messages associated with a group-based communication channel identifier; generate, based upon an analysis of the plurality of electronic messages associated with the group-based communication channel identifier, an event generation request; transmit the event generation request to a calendar service, the event generation request comprising a request for an event object and an event object metadata set, wherein the event object metadata set comprises a time parameter, a location parameter, an attendee parameter, wherein at least one of the time parameter, the location parameter, and the attendee parameter is based on the analysis of the plurality of electronic messages; receive the event object from the calendar service; and transmit the event object renderable for display within an interface associated with the group-based communication channel identifier. In some embodiments, analyzing the plurality of electronic messages associated with the group-based communication channel identifier further causes the apparatus to: perform natural language processing on the plurality of electronic messages; and determine contextual information associated with the plurality of electronic messages. In some embodiments, the apparatus is further configured to: based on the contextual information associated with the plurality of electronic messages, generate an event generation prompt; and transmit the event generation prompt to a client device of the plurality of client devices. In some embodiments, the apparatus is further configured to: based on the contextual information associated with the plurality of electronic messages, identify a plurality of document objects associated with the event generation request; and connect the plurality of document objects to the event object. In some embodiments, the apparatus is further configured to: identify a workplace object associated with the plurality of client devices; and generate the location parameter based at least in part on the workplace object. In some embodiments, workplace object comprises workplace object metadata set, and the workplace object metadata set indicates location capacities. In some embodiments, the apparatus is further configured to: receive an event object sharing request from a first client device of the plurality of client devices; in response to receiving the event object sharing request, generate an event object sharing link; transmit an electronic message to the first client device, wherein the electronic message comprises the event object sharing link; receive an electronic selection on the event object sharing link from a second client device of the plurality of client devices; and in response to receiving the electronic selection on the event object sharing link, authenticate the second client device. In some embodiments, the calendar service is a third-party calendar service. In accordance with various embodiments, a computer-implemented method is provided. The computer-implemented method comprises receiving, from a plurality of client devices, a plurality of electronic messages associated with a group-based communication channel identifier; generating, based upon an analysis of the plurality of electronic messages associated with the group-based communication channel identifier, an event generation request; transmitting the event generation request to a third-party calendar service, the event generation request comprising a request for an event object and an event object metadata set, wherein the event object metadata set comprises a time parameter, a location parameter, an attendee parameter, wherein at least one of the time parameter, the location parameter, and the attendee parameter is based on the analysis of the plurality of electronic messages; receiving the event object from the third-party calendar service; and transmitting the event object renderable for display within an interface associated with the group-based communication channel identifier. In accordance with various embodiments of the present disclosure, a computer program product is provided. The computer program product comprises at least one non-transitory computer-readable storage medium having computer-readable program code portions stored therein. The computer-readable program code portions comprises an executable portion configured to: receive, from a plurality of client devices, a plurality of electronic messages associated with a group-based communication channel identifier; generate, based upon an analysis of the plurality of electronic messages associated with the group-based communication channel identifier, an event generation request; transmit the event generation request to a third-party calendar service, the event generation request comprising a request for an event object; and an event object metadata set, wherein the event object metadata set comprises a time parameter, a location parameter, an attendee parameter, wherein at least one of the time parameter, the location parameter, and the attendee parameter is based on the analysis of the plurality of electronic messages; receive the event object from the third-party calendar service; and transmit the event object renderable for display within an interface associated with the group-based communication channel identifier. In accordance with various embodiments of the present disclosure, a system is provided. The system comprises at least one repository and at least one server. The at least one server comprises at least one processor and at least one non-transitory memory comprising program code. The at least one non-transitory memory and the program code are configured to, with the at least one processor, cause the system to at least: receive, from a plurality of client devices, a plurality of electronic messages associated with a group-based communication channel identifier; generate, based upon an analysis of the plurality of electronic messages associated with the group-based communication channel identifier, an event generation request; transmit the event generation request to a calendar service, the event generation request comprising a request for an event object and an event object metadata set, wherein the event object metadata set comprises a time parameter, a location parameter, an attendee parameter, wherein at least one of the time parameter, the location parameter, and the attendee parameter is based on the analysis of the plurality of electronic messages; receive the event object from the calendar service; and transmit the event object renderable for display within an interface associated with the group-based communication channel identifier. The above summary is provided merely for the purpose of summarizing some example embodiments to provide a basic understanding of some aspects of the disclosure. Accordingly, it will be appreciated that the above-described embodiments are merely examples and should not be construed to narrow the scope or spirit of the disclosure. It will be appreciated that the scope of the disclosure encompasses many potential embodiments in addition to those here summarized, some of which will be further described below.

11418995

BACKGROUND Cloud computing platforms often provide on-demand, managed computing resources to customers. Such computing resources (e.g., compute and storage capacity) are often provisioned from large pools of capacity installed in data centers. Customers can request computing resources from the “cloud,” and the cloud can provision compute resources to those customers. Technologies such as virtual machines and containers are often used to allow customers to securely share capacity of computer systems.

11336477

BACKGROUND Home automation systems, which have become increasingly popular, may be used by homeowners to integrate and control multiple electrical and/or electronic devices in their house. For example, a homeowner may connect appliances, lights, window treatments, thermostats, audio systems, speakers, cable or satellite boxes, security systems, telecommunication systems, and the like to each other via a wireless network. The homeowner may control these devices using a controller or user interface provided via a smart phone, a tablet, a computer, and the like directly connected to the network or remotely connected via the Internet. These devices may communicate with each other and the controller to, for example, improve their efficiency, their convenience, and/or their usability. SUMMARY As described herein, a control system may comprise a plurality of audio output devices (e.g., controllable speakers), and a remote control device having at least one button for selecting a preset, where the preset defines different commands for at least two of the audio output devices. The at least two audio output devices may be configured to be controlled according to the different commands in response to an actuation of the button of the remote control device. The command of the preset may comprise commands for starting playback, pausing playback, stopping playback, muting playback, unmuting playback, adjusting volume, changing channels, changing equalizer settings, enabling audio output devices, and disabling audio output devices. The remote control device may be configured to wirelessly transmit a message in response to the actuation of the button. The control system may also comprise a system bridge configured to receive the message transmitted by the remote control device and to transmit commands according to the preset to the at least two of the audio output devices. The system bridge may be configured to dynamically group the at least two audio remote control devices together and subsequently transmit at least one command for controlling the grouped remote control devices. The system bridge may be configured to transmit a different command to each of the at least two of the audio output devices. The system bridge may be configured to cause at least one audio output device to play an alert sound, for example, when a limit of a streaming service has been reached or when the end of an album, a playlist, and/or a podcast has been reached. The control system may also comprise one or more load control devices, such as a dimmer configured to control an intensity of a lighting load. The dimmer may also be responsive to the preset selected in response to the actuation of the button of the remote control device. The dimmer may be configured to adjust the intensity of the lighting load to a predetermined intensity in response to the actuation of the button of the remote control device to select the preset. The system bridge may be configured to cause at least one audio output device to play a feedback signal indicating an operational characteristic of the dimmer.

11325028

FIELD The application relates to professional gaming augmented reality (AR) visors and methods for parsing context-specific heads up display (HUD) content from a video stream. BACKGROUND Many video streams, especially those from a video game, contain peripheral supplemental data, information or images on screen. As not to interrupt or block the primary images and content being displayed, this supplemental information is typically displayed on a television or computer screen around the edges or perimeter of the primary video being shown. However, for example, during the play of a video game, requiring the user to take his eyes off of the primary screen content to view and decipher HUD content along the outskirts of the screen can be distracting. Indeed, while scanning perimeter-located content typically takes only seconds, present principles appreciate that in game play activity even short durations of distraction can result in untimely miscalculations, missed opportunities or other game play mistakes. Indeed, to ensure they see important but peripheral information, professional video game players train themselves to constantly divert their gaze to the screen edges at opportune periodicities using training metronomes. SUMMARY As understood herein, content appropriate for HUD content can be strategically extracted and displayed or superimposed over the primary viewing area through the use of a visor or display worn or positioned in front of the user, relieving the user from diverting his attention to other areas of the screen and creating a gameplay advantage for the user. Present principles may also be used in applications other than competitive video game play. For example, dashboard displays of information, which otherwise divert the driver's attention from the road and operation of the vehicle, can be moved by a display apparatus that superimposes or otherwise displays the information from the dashboard to a safer HUD field of view. Accordingly, a system includes at least one primary display configured to present video demanded by a computer game program. The system also includes at least one interpose display locatable between a computer gamer and the primary display. The interpose display is translucent. At least one computer storage that is not a transitory signal includes instructions executable by at least one processor to present augmented reality (AR) information from the computer game program on the interpose display. In this way the computer gamer can see the AR information in his line of sight as the computer gamer looks through the interpose display and sees on the primary display the video demanded by the computer game program. In some examples, the interpose display is configured to be worn on the head of the computer gamer as, e.g., the visor of an AR headset. Or, wherein the interpose display may be configured like a pair of glasses. Yet again, the interpose display may be configured to be placed or mounted directly in an intended field of view of the computer gamer distanced from the computer gamer. In example implementations, the instructions are executable to present on the interpose display user content, data and/or updates from video game play including one or more of: health/lives, time, score, weapons/ammunition, capabilities, menus, game progression, mini-map, speedometer/tachometer, context-sensitive information, reticle/cursor/crosshair, stealthometer, compass. The instructions may be executable to present on the interpose display one or more of content, data and/or updates important to operation of a device or vehicle, battery life, vehicle speed, oil levels, speed/speed limit, lane departure warnings, driving directions, alerts/car status messages, cruise control information, proximity car detections, road and/or weather conditions. In some examples, the interpose display can include an inner surface and a touch sensitive outer surface facing the primary display, and the instructions are executable to move AR information presented on the interpose display in response to touches on the outer surface of the interpose display. In example embodiments, at least one camera may be presented on the interpose display and positioned to track an eye orientation of the computer gamer, with information from the camera being sent to a game console executing the computer game program for, e.g., establishing a computer game weapon aim line. If desired, wherein the instructions can be executable to access code in the computer game program identifying the AR information, and using the code, present the AR information on the interpose display. In examples, the instructions are executable to receive signals from the computer game program representing motion of AR information, and based at least in part on the signals, to change at least one of: a color, a size, of the AR information on the interpose display. In some implementations described in greater detail below, the instructions can be executable to, responsive to detecting communication between a communication component associated with the interpose display and at least one game console executing the computer game program, transfer AR information from the computer game program to the interpose display. In other implementations the instructions are executable to, responsive to at least one gamer-initiated voice or key press input command, send AR information from the computer game program to the interpose display. In another aspect, a method includes presenting computer game video on a primary display according to a game program. The method also includes presenting information from the game program as augment reality (AR) information on a translucent display located between the primary display and a computer gamer. In another aspect, a display assembly includes at least one translucent display and at least one computer storage with instructions executable by at least one processor to access code from a computer game program being executed to present video on a primary display separate from the translucent display. The instructions are executable to present on the translucent display information conveyed by the code. The details of the present application, both as to its structure and operation, can best be understood in reference to the accompanying drawings, in which like reference numerals refer to like parts, and in which:

11517408

BACKGROUND OF THE INVENTION Field of the Invention The invention pertains to the fields of dental and oral medicine, microbiology, and to the use of nanodiamonds to treat or prevent denture stomatitis associated withCandida albicansand other yeasts. Description of Related Art Edentulousness increases in old age and in such cases, a conventional complete denture is commonly the treatment of choice; Fouda S M, et al.,Missing teeth and prosthetic treatment in patients treated at College of Dentistry, University of Dammam. Int J Dent. 2017. Denture bases are constructed from metal and/or acrylic resin. Acrylic resin, however, is more frequently used due to its ease of construction and repair, aesthetics and low cost, despite the material's drawbacks of high surface roughness and low strength; Nandal S, et al.,New era in denture base resins: A review. Dental Journal of Advance Studies. 2013 December; 1(03):136-43. Denture stomatitis (DS) affects more than 70% of patients wearing complete dentures; Gendreau L, et al.,Epidemiology and etiology of denture stomatitis. J Prosthodont. 2011 June; 20(4):251-60. Many factors, such as poor oral hygiene; poor-fitting dentures; rough, porous denture surfaces and systemic diseases, are associated with DS, of whichCandida albicansis considered the main causative pathogen. The hydrophobicity and surface roughness of denture bases affect the primary attachment and colonization ofCandida albicans; Gendreau L, et al., id; Pereira T, et al.,In vitro Candida colonization on acrylic resins and denture liners: influence of surface free energy, roughness, saliva, and adhering bacteria. Int J Prosthodont. 2007 May 1; 20(3). Conventional ways to reduce the incidence of DS include mechanical cleansing, chemical disinfection, special coatings, and/or incorporating antimicrobial agents in the denture base material; Izumida F E, et al.In vitro evaluation of adherence of Candida albicans, Candida glabrata, and Streptococcus mutans to an acrylic resin modified by experimental coatings. Biofouling. 2014 May 28; 30(5):525-33; Ali A A, et al.,Effectiveness of coating acrylic resin dentures on preventing Candida adhesion. J Prosthodont. 2013 August; 22(6):445-50; Nawasrah A, et al.,Antifungal effect of henna against Candida albicans adhered to acrylic resin as a possible method for prevention of denture stomatitis. Int J Environ Res Public Health 2016 May 23; 13(5):520; Da Silva F C, et al.Effectiveness of six different disinfectants on removing five microbial species and effects on the topographic characteristics of acrylic resin. J Prosthodont. 2008 December; 17(8):627-33. Conventional cleaning methods are usually effective at eliminating plaque accumulation from dentures, Da Silva, R C, et al., id. However, performing them may be challenging for elderly patients, particularly those with physical disabilities or in need of nursing care. Oral antifungal agents are effective in the treatment of DS, but have toxic side effects and may lead to the development of resistant strains. In addition, DS recurrence commonly occurs with their use; Garcia-Cuesta C, et al.,Current treatment of oral candidiasis: A literature review. J Clin Exp Dent. 2014; 6:576-582. The antimicrobial effect of chemical disinfectants is related to their proper use according to the preparation guidelines and immersion time; Al-Thobity A M et al.,Impact of Denture Cleansing Solution Immersion on Some Properties of Different Denture Base Materials: An In Vitro Study. J Prosthodont. 2017; 1-7. Many studies have investigated the effect of adding antimicrobial or antifungal agents to a denture base resin in an attempt to reduce microbial and/or fungal adhesion and thereby prevent DS; Sawada T, et al.,Self-cleaning effects of acrylic resin containing fluoridated apatite-coated titanium dioxide. Gerodontology. 2014 March; 31(1): 68-75; Nam K Y, et al.,Antifungal and physical characteristics of modified denture base acrylic incorporated with silver nanoparticles. Gerodontology. 2012; 29(2):e413-19; Li Z, et al.,Effect of a denture base acrylic resin containing silver nanoparticles on Candida albicans adhesion and biofilm formation. Gerodontology. 2016 June; 33(2): 209-16. However, as explained above, the incorporation of antibacterial or antifungal agents can produce toxic side-effects, cause inflammation, disrupt the normal oral biota, or result in development of resistant microorganisms especially when used over an extended period of time, such over the lifetime of dentures. Moreover, the use of these cleaning or disinfection procedures can adversely affect the physical properties of a denture base resin leading to increased surface roughness, color changes and reduced flexural strength; Al Thobity, A M, et al., id; Eg-Porwal A, et al.,Effect of denture cleansers on color stability, surface roughness, and hardness of differentdenture base resins. J Indian Prosthodont Soc 2017; 17:61-67. Surface roughness (Ra) and hydrophobicity are important properties of the denture base material that influence plaque and microbial adhesion and, subsequently, DS; Yamauchi M, et al.In vitro adherence of microorganisms to denture base resin with different surface texture. Dent Mater J. 1990 Jun. 25; 9(1):19-24; Radford D R, et al.Adherence of Candida albicans to denture base materials with different surface finishes. J Dent. 1998 Sep. 1; 26(7):577-83. A rough denture surface provides more area for microbial adhesion. In addition, it protects entrapped microorganisms from shearing forces during denture cleaning, making their removal difficult even with the use of antimicrobial agents; Pereira-Cenci T, et al.Development of Candida-associated denture stomatitis: new insights. J Appl Oral Sci 2008; 16(2):86-94; Waltimo T, et al.Adherence of Candida species to newly polymerized and water-stored denture base polymers. Int J Prosthodont. 2001; 14, 457-460. Denture surfaces with high hydrophobicity have increased adhesion toCandida albicansdue to the hydrophobic interaction between the bacteria and the denture base resin; Waltimo, T. et al., id. Recent attempts to enhance the antimicrobial, mechanical and physical properties of polymethylmethacrylate (PMMA) involving the addition of silver, platinum or titanium nanoparticles; has attracted attention because these microparticles enhance the mechanical and physical properties of the resin as well as its antimicrobial resistance. Al Harbi et al.Effect of nanodiamond addition on flexural strength, impact strength, and surface roughness of PMMA denture base. J Prosthodont. 2019; 28:417-425 reported improvement in the mechanical properties of ND-reinforced PMMA. Several nanosized materials, such as silver, platinum, and titanium, have been added to PMMA, resulting in better resistance to bacterial and fungal colonization; Gad M M, et al.,A. PMMA denture base material enhancement: a review of fiber, filler, and nanofiller addition. Int J Nanomedicine 2017; 12:3801; Wang X, et al.,Shape-dependent antibacterial activities of Ag2O polyhedral particles. Langmuir. 2009 Oct. 9; 26(4):2774-8. Work has been performed using nanodiamonds in the fields of medicine and dentistry, including guided tissue regeneration, polymer reinforcement, and antibacterial dental implant coatings; Szunerits S, et al.Antibacterial applications of nanodiamonds. Int J Environ Res Public Health 2016 Apr. 12; 13(4):413; Najeeb S, et.al.Dental applications of nanodiamonds. Sci Adv Mater. 2016 Nov. 1; 8(11): 2064-70; Lee DK, et.al.Nanodiamond-gutta percha composite biomaterials for root canal therapy. ACS nano. 2015 Oct. 15; 9(11):11490-501. NDs possess multiple reactive groups (NH2, OH) that improve their interfacial bond with PMMA, and are thus considered a compatible filler material; Maitra U, et al.,Mechanical properties of nanodiamond-reinforced polymer-matrix composites. Solid State Commun. 2009 Oct. 1; 149(39-40):1693-7; Mochalin V N, et al.The properties and applications of nanodiamonds. Nat. Nanotechnol 2012 JaAn; 7(1):11. Although studies have reported on the antimicrobial effect of NDs, none have investigated their effect againstCandida albicansadhesion. As explained above, denture stomatitis is a significant problem for people wearing dentures.Candida albicansplays a significant role in the morbidity of DS. Accordingly, the inventors sought to develop a way to reduce the severity of DS by identifying materials that prevent the adhesion ofCandida albicansto dentures and other removable dental prostheses. BRIEF SUMMARY OF THE INVENTION As disclosed herein, the inventors have produced a dental composite material containing nanodiamonds that inhibits the attachment of yeasts such asCandida albicansto dentures and other dental prosthetics. Surprisingly, despite the high surface area of nanodiamond particles, the nanodiamonds increased the smoothness of the dental material while not substantially increasing its hydrophobicity as determined by scanning electron microscopy and by water contact angle. The incorporation of nanodiamonds, particularly at low concentrations, reducesCandidaadhesion and improves surface roughness. Aspects of the invention include a method for preventing or treating dental stomatitis by providing a dental composite material resistant to attachment of theCandida albicansyeast which provides resistance to dental stomatitis. The foregoing paragraphs have been provided by way of general introduction, and are not intended to limit the scope of the following claims. The described embodiments, together with further advantages, will be best understood by reference to the following detailed description taken in conjunction with the accompanying drawings.

11266668

BACKGROUND Field The present disclosure relates to a dietary supplement for controlling postprandial blood glucose, increasing insulin sensitivity and/or assisting in the glucose metabolism for individuals with impaired glucose tolerance (IGT), pre-diabetes and metabolic syndrome. Description of the Related Art With the rapid development of social economy and the aging of population, people's diet, nutrition and lifestyle have also undergone substantial changes. High-calorie, high-fat, high-sugar, high-salt diets and consumption of sweetened beverages, including diet soda, have significantly increased. On the other hand, physical activity levels have significantly decreased and sedentary lifestyle is very common. All these have contributed to the prevalence of chronic non-communicable diseases, such as overweight, obesity, pre-diabetes, diabetes and so on all over the world. The incidence of diabetes has increased significantly, becoming the third serious chronic disease after cancer and cardiovascular diseases. Although Acarbose, Metformin and 1-deoxynojirimycin have good clinical efficacy as hypoglycemic agents, their high cost and some serious side effects limit their clinical application. Thus, there is an urgent need for natural, botanical strategies to prevent the development of diabetes. Plants have always been a useful source of medicine, and many of the existing drugs are directly or indirectly derived from plants. It is of great significance to study the hypoglycemic effect of plants originally utilized in traditional medicine. The above information disclosed in this Background section is only for enhancement of understanding of the background of the invention, and therefore it may contain information that does not form the prior art that is already known to a person of ordinary skill in the art. SUMMARY An aspect of embodiments of the present invention is directed toward a dietary supplement that inhibits glucose absorption, controls postprandial blood glucose, increases insulin sensitivity and/or enhances glucose metabolism for patients with metabolic syndrome. Metabolic syndrome is a series of metabolic abnormalities, including abdominal obesity, insulin resistance, atherosclerotic dyslipidemia, increased blood pressure, and inflammation, which are related to type 2 diabetes, cardiovascular disease and/or increased mortality. The prevalence of these clustering abnormalities has been progressively growing over the past 20 years, and now it is estimated that more than a third of American adults, especially older adults, are affected. An aspect of embodiments of the present invention is directed toward a dietary supplement containing various herbal extracts, vitamins, 2-deoxy-D-glucose and trace element as a nutritional strategy for the prevention and treatment of insulin resistance and type 2 diabetes mellitus (T2DM). Another aspect of embodiments of the present invention is directed toward a method of preventing and treating insulin resistance and T2DM utilizing a botanical formula. According to some embodiments of the present disclosure, a formulation for a dietary supplement includes standardized extracts ofastragalusroot, phlorizin, root bark of white mulberry, olive leaf, and bitter melon. The standardized extracts ofastragalusroot, phlorizin, root bark of white mulberry, olive leaf, and bitter melon may be included at a ratio of 1:1.8:3.2:1.6:1.2. The formulation may further include chromium, 2-deoxy-D-glucose, biotin, vitamin D and vitamin C. The formulation may include 8% of standardized extract ofastragalusroot, 14.4% of phlorizin, 25.6% of standardized extract of root bark of white mulberry, 12.8% of standardized extract of olive leaf, 9.6% of standardized extract of bitter melon, 25.6% of 2-deoxy-D-glucose, 0.1% of biotin, 3.8% of vitamin C, and trace amount of chromium picolinate and vitamin D, based on a total weight of the formulation. The dietary supplement may be for oral consumption. The dietary supplement may be a tablet, a soft or hard capsule, liquid, or a suspension According to some embodiments of the present disclosure, a method of controlling postprandial blood glucose includes administering a formulation for a dietary supplement to a patient, the formulation containing standardized extracts ofastragalusroot, phlorizin, root bark of white mulberry, olive leaf, and bitter melon. The standardized extracts ofastragalusroot, phlorizin, root bark of white mulberry, olive leaf, and bitter melon may be included at a ratio of 1:1.8:3.2:1.6:1.2. The formulation may further include chromium, 2-deoxy-D-glucose, biotin, vitamin D and vitamin C. The formulation may include 8% of standardized extract ofastragalusroot, 14.4% of phlorizin, 25.6% of standardized extract of root bark of white mulberry, 12.8% of standardized extract of olive leaf, 9.6% of standardized extract of bitter melon, 25.6% of 2-deoxy-D-glucose, 0.1% of biotin, and 3.8% of vitamin C based on a total weight of the formulation. The administering may be through oral consumption. The administering may be repeated twice per day before meals, and a total weight of the formulation is about 780 mg. The patient may have one or more of obesity, impaired glucose tolerance, pre-diabetes and diabetes. According to some embodiments of the present disclosure, a formulation for a dietary supplement includes standardized extracts ofastragalusroot, phlorizin, root bark of white mulberry, olive leaf, bitter melon, and 2-deoxy-D-glucose. The standardized extracts ofastragalusroot, phlorizin, root bark of white mulberry, olive leaf, and bitter melon may be included at a ratio of 1:1.8:3.2:1.6:1.2. The formulation may further include biotin and vitamin C. The formulation may include 8% of standardized extract ofastragalusroot, 14.4% of phlorizin, 25.6% of standardized extract of root bark of white mulberry, 12.8% of standardized extract of olive leaf, 9.6% of standardized extract of bitter melon, 25.6% of 2-deoxy-D-glucose, 0.1% of biotin, and 3.8% of vitamin C. The dietary supplement may be for oral consumption. The dietary supplement may be a tablet, a soft or hard capsule, liquid, or a suspension. According to some embodiments of the present disclosure, alpha-lipoic acid is utilized in place of (i.e., to replace) 2-deoxy-D-glucose in the formulation for a dietary supplement at the same amount as the 2-deoxy-D-glucose. According to some embodiments of the present disclosure, a method of controlling postprandial blood glucose includes administering to a patient the formulation for the dietary supplement according to some embodiments of the present disclosure.

11457916

TECHNICAL FIELD The present disclosure pertains generally, but not by way of limitation, to medical devices, and methods for using medical devices. More particularly, the present disclosure pertains to devices for introducing and positioning implants within patients, and methods for using such devices. BACKGROUND With its complexity, range of motion and extensive use, a common soft tissue injury is damage to the rotator cuff or rotator cuff tendons. Damage to the rotator cuff is a potentially serious medical condition that may occur during hyperextension, from an acute traumatic tear or from overuse of the joint. Adequate procedures do not exist for repairing a partial thickness tear of less than 50% in the supraspinatus tendon. Current procedures attempt to alleviate impingement or make room for movement of the tendon to prevent further damage and relieve discomfort but do not repair or strengthen the tendon. Use of the still damaged tendon can lead to further damage or injury. There is an ongoing need to deliver and adequately position medical implants during an arthroscopic procedure in order to treat injuries to the rotator cuff, rotator cuff tendons, or other soft tissue or tendon injuries throughout a body. SUMMARY OF THE DISCLOSURE The disclosure describes various medical devices and methods for using medical devices to assist in delivering and positioning implants within a body. In a first example, a fastener delivery tool comprises a sheath assembly having at least one position retention member proximate a distal end of the sheath assembly, and a handle assembly coupled to a proximal end of the sheath assembly, the handle assembly comprising a housing, a trigger handle, and an insert connector, wherein an external force applied to the trigger handle in a proximal direction causes displacement of the trigger handle relative to a rest position, wherein displacement of the trigger handle from the rest position within a first displacement range imparts a first amount of force on the insert connector relative to the applied external force and displacement of the trigger handle from the rest position within a second displacement range imparts a second amount of force on the insert connector relative to the applied external force, and wherein the first amount of force is greater than the second amount of force. Alternatively or additionally, in another example, the fastener delivery further comprises a cam follower connected to the insert connector, and wherein the trigger handle imparts force on the insert connector through the cam follower when the trigger handle is displaced from the rest position. Alternatively or additionally, in another example, the cam follower comprises a flat portion and a protrusion. Alternatively or additionally, in another example, within the first displacement range, the cam follower protrusion contacts the trigger handle. Alternatively or additionally, in another example, within the second displacement range, the cam follower flat portion contacts the trigger handle. Alternatively or additionally, in another example, the first amount of force is between two times and six times the applied external force. Alternatively or additionally, in another example, the first amount of force is four times the applied external force. Alternatively or additionally, in another example, the second amount of force is between one and four times the applied external force. Alternatively or additionally, in another example, the first displacement range is greater than the second displacement range. Alternatively or additionally, in another example, the fastener delivery tool further comprises a spring connected to the housing and the trigger handle, wherein the spring biases the trigger handle to the rest position. In another example, a fastener delivery tool comprises a sheath assembly comprising a lumen and configured to receive one or more inserts at least partially within the lumen, and a handle assembly connected to the sheath assembly, the handle assembly comprising a trigger handle, wherein, when an insert is received within the sheath assembly, movement of the trigger handle relative to a rest position within a first movement range imparts a first amount of force on the received insert, and wherein movement of the trigger handle relative to the rest position within second movement range imparts a second amount of force on the received insert, wherein the first amount of force is greater than the second amount of force. Alternatively or additionally, in another example, the first movement range and the second movement range do not overlap. Alternatively or additionally, in another example, the first movement range is greater than the second movement range. Alternatively or additionally, in another example, the first amount of force is between two times and five times the second amount of force. Alternatively or additionally, in another example, the first amount of force is three times the second amount of force. In yet another example, a method for deploying a fastener into bone comprises positioning a position retention sleeve proximate the bone, the position retention sleeve having one or more position retention members proximate a distal end of the position retention sleeve, and wherein the position retention sleeve is coupled to a handle assembly, the handle assembly comprising a trigger handle, inserting a pilot hole forming assembly into a lumen of the position retention sleeve, the pilot hole forming assembly having one or more pilot hole forming members proximate a distal end of the pilot hole forming assembly, driving the one or more pilot hole forming members and the one or more position retention members into the bone, applying force to the trigger handle to remove the pilot hole forming assembly from the lumen of the position retention sleeve while retaining the one or more position retention members in the bone, wherein the trigger handle imparts the applied force to the pilot hole forming assembly with a first force multiplier in a first stage and with a second force multiplier in a second stage, wherein the first force multiplier is greater than the second force multiplier, inserting a staple delivery device into the lumen of the position retention of sleeve, and deploying a staple into the bone. Alternatively or additionally, in another example, the first stage comprises a first range of displacements of the trigger handle from a rest position, wherein the second stage comprises a second range of displacements of the trigger handle from the rest position, and wherein the first range of displacements is greater than the second range of displacements. Alternatively or additionally, in another example, when the pilot hole forming assembly is received within the position retention sleeve, the one or more pilot hole forming members extend distal of the one or more position retention members a first amount, wherein after the one or more pilot hole forming members have been driven into the bone, the one or more pilot hole forming members extend distal of the one or more position retention members a second amount, and wherein the second amount is greater than the first amount. Alternatively or additionally, in another example, the first amount is between 0.05 inches and 0.35 inches. Alternatively or additionally, in another example, the second amount is between 0.40 inches and 0.65 inches. The above summary of some examples is not intended to describe each disclosed example device, component, or method or every implementation of the present disclosure. The Brief Description of the Drawings, and Detailed Description, which follow, more particularly exemplify these examples, but are also intended as exemplary and not limiting.

11496296

CROSS REFERENCE The present application claims the benefit under 35 U.S.C. § 119 of German Patent Application No. DE 102020202594.0 filed on Feb. 28, 2020, which is expressly incorporated herein by reference in its entirety. FIELD The present invention relates to a method of authentication for delivery of a product in particular using an at least partially automated mobile platform. BACKGROUND INFORMATION When delivering products to a recipient, the deliverer must check, prior to handing over the product, whether a person is legitimate recipient for the product to be delivered. If the delivery is accompanied or performed by persons, a recipient is able to identify himself as legitimate for example by presenting identification papers. Due to increasing online commerce, an ever increasing quantity of products must be delivered. In order to reduce the personnel requirement for the delivery, automated delivery, in particular using drones, is currently being tested. SUMMARY In such an automated delivery, it is often necessary to check not only the delivery location or the delivery address, but also the right of a recipient to receive the product. In this context, a legitimate recipient may be a person as well as a mailbox in the broadest sense. If the delivery is performed by partially automated, fully automated or autonomous systems, there is the problem of authenticating the respective legitimate recipient in a secure, quick and simple manner. For this purpose, the greatest possible variety of different authentication tasks should be covered by a unified method, which allows for example for products to be received by persons or receiving stations that were in particular possibly not yet known at the time of the online order. According to the present invention, a method is provided for the authentication for a delivery of a product to a recipient as well as the use of this method. Advantageous developments and embodiments of the present invention are described herein. The present invention is based on the recognition that through a distributed exchange of messages and encrypted messages between an at least partially automated deliverer and a legitimate recipient, the recipient is able to authenticate himself by way of a text encrypted by data processing systems. In this entire description of the present invention, the sequence of method steps is presented in such a way that it is easy to follow the method. One skilled in the art will recognize, however, that many method step may also be run through in a different order and yield the same or a corresponding result. In this sense, it is possible to change the order of the method steps accordingly. Some features are provided with numerals in order to improve readability or to make the association more clear, but this does not imply an existence of specific features. In accordance with an example embodiment of the present invention, a method of authentication for delivery of a product to a recipient is provided having the following steps. In a first step, a customer generates a public and a private cryptographic key in accordance with an asymmetrical encryption. In a further step, the customer provides the public cryptographic key for the deliverer. In a further step, the deliverer generates an encrypted message using the public cryptographic key. In a further step, the encrypted message is transmitted to the recipient for authentication. In a further step, the recipient generates a plain text of the encrypted message by decrypting the encrypted message using the private key. In a further step, the plain text is transmitted to the deliverer. In a further step, the deliverer authenticates the recipient if the provided plain text matches the message. For this purpose, authentication means that it is verified that a recipient is authorized legitimately to receive products in a delivery. In an asymmetrical method for encrypting texts, a public and a private cryptographic key are generated, it being possible to make the public cryptographic key known without it thereby being possible to infer the private cryptographic key. Hence, no secrecy is required when distributing the public cryptographic key. In accordance with the example method, a recipient may be a person as well as an at least partially automated platform or an automated receiving station. Furthermore, the deliverer may be an at least partially automated platform, such as for example a robot or a drone, or a person, which performs for example with an automated receiving station an authentication of the automated receiving station. The message may be a plain text, which is any kind of text, such as for example an invoice or a product description, but the message may also contain in particular a hash value or a random number. The latter may render a corruption of the authentication more difficult. The product to be delivered may be a physical object or a non-physical object. The concept of generating the public and the private cryptographic key is to be understood broadly and comprises both a computing of a public and of a private cryptographic key as well as the case in which a previously generated public and private cryptographic key, which the customer has stored, is used for this method. The deliverer may also be vendor of a product, which is offered for sale via the Internet and was selected or purchased by the customer. The customer may be identical with the recipient or may be distinct from the recipient. The method may also be used, however, if the customer makes a purchase in a retail store, where the product is to be delivered later. This method makes it possible to perform an authentication between an automated deliverer and a person as well as between an automated deliverer and an automated receiving station in a simple and quick manner without requiring a material exchange of identification papers or tokens or similar items for authentication. Furthermore, using the asymmetrical encryption in the form of a public key cryptography also makes it possible, even after an order was placed, to authorize a recipient vis-a-vis the deliverer to receive the corresponding product in a delivery. It is furthermore advantageous that the required public and private keys may be generated simply using a stationary data processing system such as a computer, which is connected to the Internet, or by a mobile data processing device, such as a smart phone for example, and that these keys may be transmitted in a simple manner by wireless communication methods. Using the example method, access to the Internet is required only once in a typical ordering process since the authentication between deliverer and recipient is possible directly via any wireless communication method. It is furthermore advantageous that using this method the authentication does not depend on a predetermined delivery location, as the latter may be changed without having to change the authentication. According to one aspect, the present invention provides for the deliverer to be a first at least partially automated mobile platform. A mobile platform may be understood as an at least partially automated system, which is mobile, and/or a driver assistance system of a vehicle. One example may be an at least partially automated vehicle or a vehicle comprising a driver assistance system. That is to say that in this context, an at least partially automated system comprises a mobile platform with respect to an at least partially automated functionality, but the term mobile platform comprises also vehicles and other mobile machines including driver assistance systems. Further example of mobile platforms may be driver assistance systems having multiple sensors, mobile multi-sensor robots such as a drone for example, an automated transfer system or a self-driving system. Each of these systems may be a completely or partially automated system. In particular, the public key may be contained in a product shipment which is to deliver the product to a recipient. Before the product is handed over to the recipient, the first at least partially automated mobile platform, for example in the form of a robot, is able to authenticate the recipient on the basis of the public key. In other words, the authentication may be performed via the message that is encrypted by the public key and is transmitted to the recipient. This encrypted message is decrypted by the legitimate recipient using the private key and is returned to the at least partially automated mobile platform or to the robot. The fact that the encrypted message can only be decrypted using the private key ensures that the message was received by the person who ordered the product or by a person who has access to the private key. It is necessary that the private key is kept private and may only be seen by a trustworthy person who is permitted to receive the package, that is, by a legitimate recipient. Since only the public key is required for the purpose of ordering, it is possible to order products for third parties. As already mentioned, the entire process does not necessarily require a human interaction, and the actions of both parties of the delivery may be carried out entirely automatically, e.g., at an automated logistics hub. According to one aspect, the present invention provides for the recipient to be a person or an automated receiving station. An automated receiving station is a device in which products may be deposited and to which then only authorized persons have access in order either to deposit products or to retrieve products. This receiving station is automated in the sense that access to this receiving station is authorized in automated fashion in that the product is on the one hand mechanically protected against unauthorized access and in that on the other hand the authorization of an access is verified in automated fashion. The method may be used for example in an automated logistics center or a logistics hub. In such a case, the products delivered by an autonomous cargo truck could only be received by the hub designated for it, unless the cargo truck is forcibly opened or the cryptography is broken. This method may advantageously also be used for end customers in a supply chain, who are having the product delivered to such an automated receiving station. Such an automated receiving station may be used by a plurality of recipients or may be assigned to a specific recipient. According to one aspect, the present invention provides for the authentication to occur in fully automatic fashion between a first at least partially automated mobile platform as the deliverer and a second at least partially automated platform as the recipient. In this form, the method may be used to build up an automated logistics chain in that automated vehicles deliver products to one another and transport these further. According to one aspect, the present invention provides for the recipient to monitor the deliverer at a delivery location by remote transmission in order to perform the authentication. Such a remote transmission may be a transmission of images, for example via a video camera, whereby a recipient is able to monitor the delivery. For example, a delivery robot streams a video that shows that a package was placed at the front door. This allows for an authentication in a delivery over great distances. According to one aspect, the present invention provides for the transmission of the encrypted message and/or of the plain text to occur via a wireless communication method. Due to the fact that in this method the encrypted message may be transmitted using any wireless method, no Internet access is required for the authentication. Thus it is possible for the handover to occur even in places where there is no Internet access, and all information may be exchanged locally. Examples of such wireless communication methods are Bluetooth, NFC or optical transmission, for example via a QR code. According to one aspect, the present invention provides for the message to be a hash value and/or a random value. In this manner, the method for authenticating a receiver may be made more secure against an unauthorized attack on the delivery or the authentication. This is advantageous in particular if the delivery occurs between two automated systems. Decrypted, such a random value or hash value may look as follows: “e8c6a1801a92a72b2713482971f37f9d7b0a9efb4c92d05dfd9b20d27878895 0e1d37b3cfba03cbfbb0468ce27cf41c2bf0a657cbf4ab3cea5c282ccff5bae0 6” According to one aspect, the present invention provides for the transmission of the encrypted message to occur prior to a handover of the product to the recipient. This method for authentication in the delivery thus makes it possible to ensure that the product is handed over only if the recipient is actually entitled or was authorized to receive the product. According to one aspect, the present invention provides for the public key and the private key to be generated with the aid of a data processing system. Using a data processing system, such as a computer for example, makes it possible to ensure an appropriate security level when creating or generating the public and the private key. Alternatively, it is also possible to use a mobile data processing device, such as a smart phone for example, to generate the public and the private key. According to one aspect, the present invention provides for the plain text of the encrypted message to be generated with the aid of a mobile data processing device. This yields the advantage that the authorization of the delivery may be performed at any location in mobile fashion. According to one aspect, the present invention provides for a method for asymmetrical encryption to be negotiated between the customer and the deliverer. This makes it possible to adapt the utilized method to the possibilities of the utilized data processing systems or mobile data processing device or a security level of the utilized cryptographic method. Furthermore, it is also possible for the form of the transmissions of the encrypted message or the plain text to be negotiated between the customer and the deliverer. In this context, the term negotiating is to be understood in the sense that an exchange occurs between the customer and the deliverer regarding the respective method, for example in that the customer selects a method from a list provided by the deliverer. According to one aspect, the present invention provides that for authentication a plurality of different public keys is transmitted to the deliverer and that the authentication occurs by way of an encrypted message that was encrypted using one of this plurality of public keys. This makes it possible, during an ordering process, additionally to authorize multiple recipients, such as family members or neighbors of the customer for example, that the product will be delivered to them. Using this method, it is also possible to order products for third parties or accordingly to delegate the reception of a product by exchanging the private key. According to one aspect, the present invention provides for the asymmetrical encryption to be generated at an equivalent security level of a 128 bit symmetrical key length. A secure symmetrical method is subject to the requirement that there cannot be an attack that is quicker than trying out all keys. A secure key length for symmetrical methods is today considered to be at least 128 bits. It should be considered, however, that the assessment of such a “secure” key length may change sooner or later due to fundamentally better mathematical method or significantly faster computers possible in the future. In asymmetrical “public key methods,” the security level is not equal to the key length, but significantly less. Furthermore, there are conventional methods that are significantly faster than trying out all keys. These methods must be taken into consideration for assessing the equivalent security level. For example, the public or private key may be generated using the Ed25519 method, i.e., the Edwards curve Digital Signature Algorithm (EdDSA) in combination with SHA-512 (SHA-2) and the elliptical curve Curve25519. An example for a private key: b3B1bnNzaClrZXktdjEAAAAABG5vbmUAAAAEbm9uZQ BAAAAMwAAAAtz c2gtZW QyNTUxOQAAACDmTGPrG7dYi51v6aW1QgfubRD+0LgNyoxW+2dXLSUV1QAAAJjm/m WV5v51 1QAAAAtzc2gtZWQyNTUxOQAAACDmTGPrG7dYi51v6aW1QgfubRD+0LgNyoxW+2dX LSUV1Q AAAEC3zi8NpBNGo9vET/LwvdckXXAu964J2QjEH5ZENHZUCuZMY+sbtliLnW/ppb VCB+5t EP7QuA3KjFb7Z1ctJRWVAAAAEHJiajJhYnRAQUJUWjBGVEUBAgMEBQ== And this is an example of a public key: ssh-ed25519 AAAAC3NzaC11ZDI1NTE5AAAAIOZMY+sbtliLnW/ppbVCB+5tEP7QuA3KjFb7Z1ct JRWV A use of the method for authentication as described above is provided, which is performed prior to delivery of a product using an at least partially automated platform. This makes it possible to ensure that the product can only be handed over to an authorized recipient.

11312970

STATEMENT REGARDING ELECTRONIC FILING OF A SEQUENCE LISTING A Sequence Listing in ASCII text format, submitted under 37 C.F.R. § 1.821, entitled 80275-US-REG-ORG P-1 ST25.txt, 3,072 bytes in size, generated on Jul. 23, 2019 and filed via EFS-Web, is provided in lieu of a paper copy. This Sequence Listing is hereby incorporated herein by reference into the specification for its disclosures. FIELD OF THE INVENTION The invention relates to synthetic miRNA precursor molecules and methods for their use in modulating nucleic acid expression in plants. BACKGROUND MicroRNAs (miRNAs) are non-protein coding RNAs, generally of between about 17 to about 25 nucleotides (commonly about 20-24 nucleotides in plants). miRNAs direct cleavage in trans of target transcripts, regulating the expression of genes involved in various pathways (Bartel,Cell,116:281-297 (2004); Zhang et al.Dev. Biol.289:3-16 (2006)). miRNAs have been shown to be involved in different aspects of plant growth and development as well as in signal transduction and protein degradation. In addition, growing evidence indicates that small endogenous RNAs including miRNAs may also be involved in biotic stress responses such as parasite attack. Since the first miRNAs were discovered in plants (Reinhart et al.Genes Dev.16:1616-1626 (2002), Park et al.Curr. Biol.12:1484-1495 (2002)), many hundreds have been identified. Further, many plant miRNAs have been shown to be highly conserved across very divergent taxa. (Floyd et al.Nature428:485-486 (2004); Zhang et al.Plant J.46:243-259 (2006)). Many microRNA genes (MIR genes) have been identified and made publicly available in a database (“miRBase,” microrna.sangerac.uk/sequences). miRNAs are also described in U.S. Patent Publications 2005/0120415 and 2005/144669A1, the entire contents of which are incorporated by reference herein. Genes encoding miRNAs yield primary miRNAs (“pri-miRNA”) of 70 to 300 bp in length that can form imperfect stem-loop structures. A single pri-miRNA may contain from one to several miRNA precursors. In animals, pri-miRNAs are processed in the nucleus into shorter hairpin RNAs of about 65 nucleotides (referred to as precursor miRNAs (pre-miRNAs)) by the RNaseIII enzyme Drosha and its cofactor DGCR8/Pasha. The pre-miRNA is then exported to the cytoplasm, where it is further processed by another RNaseIII enzyme, Dicer, releasing a miRNA (guide strand)/miRNA* (passenger or carrier strand) duplex of about 22 nt in size. In contrast to animals, in plants, the processing of pri-miRNAs into mature miRNAs occurs entirely in the nucleus using a single RNaseIII enzyme, DCL1 (Dicer-like 1). (Zhu.Proc. Natl. Acad. Sci.105:9851-9852 (2008)). Many reviews on microRNA biogenesis and function are available, for example, see, Bartel.Cell116:281-297 (2004), Murchison et al.Curr. Opin. Cell Biol.16:223-229 (2004), Dugas et al.Curr. Opin. Plant Biol.7:512-520 (2004) and Kim.Nature Rev. Mol. Cell Biol.6:376-385 (2005). Since shortly after the discovery of miRNAs, researchers began to utilize natural endogenous precursor miRNAs (pre-MIR) for delivery of sequence-specific RNAi in which a sequence specific RNAi (miRNA) of interest is exchanged for the natural miRNA guide sequence in the endogenous precursor. However, this approach of using endogenous precursors for miRNA delivery has limitations. For instance, insertion into a genome of an artificial miRNA precursor sequence that is driven by a strong promoter may result in interference with the processing of the original endogenous precursor. As a consequence, unintended phenotypic outcomes can occur. Accordingly, new designs for delivering sequence specific RNAi are needed. SUMMARY OF THE INVENTION The present invention is based, in part, on the development of a synthetic miRNA precursor molecule that is processed in plants by Dicer-like1 (DCL-1) to produce a miRNA guide strand that targets nucleic acids of interest in planta. The precursor of this invention provides a scaffold into which any guide strand can be placed for expression. In one aspect, a synthetic miRNA precursor (nucleic acid) molecule is provided comprising the following structure 5′ to 3′: A-B-C-D-E-F, wherein A is a nucleotide sequence that is optionally present and when present comprises a first strand and a second strand each of which independently comprise 1 to 22 nucleotides; B is a nucleotide sequence comprising a first strand and a second strand, wherein the first strand comprises a miRNA passenger strand having a nucleotide sequence of GNGN15-22(SEQ ID NO:1) and the second strand comprises a miRNA guide strand having the nucleotide sequence of UN16-23C (SEQ ID NO:2) and the passenger strand and the guide strand form a double stranded sequence having three mismatches. C is a nucleotide sequence comprising a first strand and a second strand, wherein the first strand comprises a nucleotide sequence of GA[A/G][G/C]GGGCCUACGGACGGUGUUGU (SEQ ID NO:3), and the second strand comprises a nucleotide sequence of ACCACACCGUCCGGGCCC[G/C][C/A]UC (SEQ ID NO:4), and the first strand and second strand form a double stranded sequence comprising two to four mismatches or bulges, or any combination thereof; D is a nucleotide sequence comprising a first strand and a second strand, wherein the first strand comprises a nucleotide sequence of UCCGCUGC[U/C]CGUUCAUG (SEQ ID NO:5), and the second strand comprises a nucleotide sequence of CAUGACCG[A/G]GGAGCUGC (SEQ ID NO:6) and the first strand and second strand form a double stranded sequence comprising two to four mismatches; E is a nucleotide sequence comprising a first strand and a second strand, wherein the first strand comprises a nucleotide sequence of GUUCCC[C/A][A/C]UAUCUACUUCCA (SEQ ID NO:7), and the second strand comprises a nucleotide sequence of UGGAAGUAGCUU[U/G][G/U]GGUUUG (SEQ ID NO:8) and the first strand and second strand form a double stranded sequence comprising two mismatches; and F is a sequence comprising a length of 10 to 50 nucleotides and forming a loop. In some aspects the invention provides a synthetic miRNA precursor molecule comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:9. In another aspect, the present invention provides a synthetic miRNA precursor molecule comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:9 or a nucleotide sequence listed in Table 1. In some aspects, the miRNA guide strand of the synthetic miRNA precursor molecule can be about 60% to about 100% complementary to a target polynucleotide or target gene from a plant. In further aspects, a method of modulating the expression of a target polynucleotide in a plant of interest is provided, the method comprising: introducing into a plant or plant part a synthetic miRNA precursor molecule of the invention, optionally wherein the synthetic miRNA precursor molecule of the invention can be comprised in a recombinant nucleic acid, an expression cassette or a vector, thereby modulating the expression of a target polynucleotide or a target gene in said plant or plant part. In addition aspects, a method of modulating the expression of a target polynucleotide or a target gene in a plant or plant part is provided, the method comprising: introducing into a plant cell a synthetic miRNA precursor molecule of the invention, said miRNA precursor molecule comprising a guide sequence complementary to said target polynucleotide or target gene, optionally wherein the synthetic miRNA precursor molecule of the invention can be comprised in a recombinant nucleic acid, an expression cassette or a vector to produce a transgenic plant cell; and regenerating a plant or plant part from said plant cell, thereby modulating the expression of a target polynucleotide or a target gene in said plant or plant part. In other aspects, a method of producing a transgenic plant or plant part having modulated expression of a target polynucleotide or target gene is provided, the method comprising: introducing into a plant or plant part a synthetic miRNA precursor molecule of the invention, said miRNA precursor molecule comprising a guide sequence complementary to said target polynucleotide or target gene, optionally wherein the synthetic miRNA precursor molecule of the invention can be comprised in a recombinant nucleic acid, an expression cassette or a vector, thereby producing a transgenic plant or plant part having modulated expression of said target polynucleotide or target gene. In further aspects, a method of producing a transgenic plant or plant part having modulated expression of a target polynucleotide or target gene is provided, the method comprising: introducing into said plant or plant part a synthetic miRNA precursor molecule of the invention, said miRNA precursor molecule comprising a guide sequence complementary to said target polynucleotide or target gene, optionally wherein the synthetic miRNA precursor molecule of the invention can be comprised in a recombinant nucleic acid, an expression cassette or a vector; and regenerating a plant or plant part from said plant cell, thereby producing a transgenic plant or plant part having modulated expression of said target polynucleotide or target gene. In additional aspects, recombinant nucleic acids, expression cassettes and/or vectors are provided, which can comprise a nucleotide sequence encoding a synthetic miRNA precursor of the invention. The invention further provides plants, plant parts and cells comprising a synthetic miRNA precursor of the invention as well as seeds, crops, harvested products and post harvest products produced from the plants, plant parts, and/or crops of the invention. These and other aspects of the invention are set forth in more detail in the description of the invention below.

11360204

CROSS-REFERENCE TO RELATED APPLICATIONS The present application claims priority under 35 U.S.C. § 119 to DE 10 2018 221 085.3 filed in the Federal Republic of Germany on Dec. 6, 2018, the content of which is hereby incorporated by reference herein in its entirety. FIELD OF THE INVENTION The present invention relates to a method for operating a Multiple Input-Multiple Output (MIMO) radar system that includes multiple antennas. Moreover, the present invention relates to a MIMO radar system for estimating the speed of detected radar objects. BACKGROUND Radar systems are being increasingly used in motor vehicles for detecting the traffic surroundings, and they supply information concerning distances, relative speeds, and direction angles of located objects, such as vehicles or obstructions, to one or multiple safety or comfort function(s) that relieve the driver in driving the motor vehicle or completely or partially replace the human driver. MIMO systems in which multiple transmitting and receiving antennas are employed are finding increasing use. WO 2018/076005 A1 mentions various types of MIMO radar systems, in which transmitters and/or receivers can be situated at different positions. Virtual channels can be generated by use of mutually orthogonal codes. A time division multiple access (TDMA) method or a frequency division multiple access (FDMA) method can be used. A MIMO radar measuring method is known from DE 10 2014 212 284 A1, in which a transmitted signal is ramp-shaped frequency-modulated using a modulation pattern in which sequences of ramps are associated with different transmission switching states which differ in the selection of the antenna elements used for the transmission, and are temporally nested. In turn, multiple temporally nested sequences are associated with a transmission switching state. Based on a peak position in a two-dimensional spectrum of a signal that is obtained for a sequence, values of a relative speed of a radar target are determined which are periodic with a predetermined speed period. Phase relationships of spectral values in the spectra for the sequences of a transmission switching state are compared to phase relationships that are expected for particular periodic values of the relative speed, and an estimated value of the relative speed is selected based on the comparison result. US 2017/0160380 A1 describes a MIMO radar system in which multiple transmitting antennas transmit simultaneously. Using pseudo-random phase modulation (PRPM), the phase of a signal that is led to a particular transmitting antenna is randomly varied in order to achieve a degree of orthogonality between the simultaneously emitted and received signals. Digital modulation methods with multiple carrier frequencies are known as orthogonal frequency division multiplex (OFDM) methods. Use of OFDM methods for radar systems is being increasingly investigated. In an OFDM method, the frequency band is divided into multiple orthogonal subbands or subcarriers (frequency division multiplexing (FDM)), and OFDM symbols are sequentially transmitted. The transmitted signal of an OFDM symbol is made up of mutually orthogonal subcarrier signals that are modulated according to a modulation scheme of the symbol and which are simultaneously transmitted within the OFDM symbol period. SUMMARY An object of the present invention is to allow a relative speed of radar objects to be determined during a MIMO measurement, within a short measuring time and with high accuracy and a large uniqueness range. For a MIMO measurement, it is particularly desirable to determine the distance, relative speed, and a direction angle of radar objects within a short measuring time and with high accuracy and a large uniqueness range. This object is achieved, according to an example embodiment of the present invention, by a method for operating a MIMO radar system that includes multiple antennas, the method including the steps: encoding signals that are transmitted from different transmitting antennas, according to code blocks, a code block including different codes for encoding transmitted signals of different antennas, and each code including a sequence of code values according to which the phase and/or amplitude of a sequence of signals of the particular transmitting antenna are/is modulated; determining a Doppler estimation for a radar object based on phase changes between received signals at the same position in successive code blocks, the Doppler estimation for the radar object having a periodic ambiguity corresponding to multiple ambiguity hypotheses of a Doppler shift of the signals; and resolving the periodic ambiguity of the Doppler estimation for the radar object. The resolving includes, for each of multiple ambiguity hypotheses of the Doppler shift: compensating for the Doppler shift of the phases of the signals belonging to a code block according to the respective ambiguity hypothesis, decoding the Doppler shift-compensated signals of the code block for separating signal components associated with the transmitting antennas, and determining a quality criterion of the decoding. The resolving further includes selecting an ambiguity hypothesis that is applicable to the radar object based on the determined quality criteria for the particular ambiguity hypotheses, and determining an unambiguous speed estimation of the radar object corresponding to the Doppler estimation and the selected ambiguity hypothesis. The object, to determine during a MIMO measurement in particular a relative speed of a radar object within a short measuring time and with high accuracy and a large uniqueness range, is achieved by the present invention essentially in that an encoding of the transmission signals of different transmitting antennas takes place, and for multiple ambiguity hypotheses of the Doppler shift, a Doppler compensation and subsequent decoding take place, using a quality criterion for the decoding for selecting the applicable ambiguity hypothesis. For a non-applicable ambiguity hypothesis, the Doppler compensations based thereon are not adapted to the actual speed of the radar object and the actual Doppler shift, so that the decoding is disturbed; a signal component associated with a transmitting antenna then contains signal components of the other transmitting antennas. It is advantageous that a MIMO measurement with multiple transmitting antennas is made possible in which for the individual transmitting antennas, the unambiguously measurable distance and speed ranges as well as respective distances and speeds remain unchanged, even when multiple transmitting antennas are used at the same time. For multiple radar objects, in each case multiple ambiguity hypotheses are established and the steps based thereon are carried out. In an example embodiment, a phase modulation, or a phase modulation and an amplitude modulation, of the sequence of signals of the particular transmitting antenna take(s) place. The encoding preferably encompasses an encoding of signals that are simultaneously transmitted from different transmitting antennas, according to the code blocks, a code block including different codes for encoding simultaneously transmitted signals of different antennas, and each code including a sequence of code values according to which the phase and/or amplitude of a sequence of signals of the particular transmitting antenna are/is modulated. Thus, in each code instance (i.e., at each position within the code), the transmitting antennas simultaneously transmit their respective encoded signal, and are thus simultaneously active in each code instance. In another example embodiment, the modulation of the amplitude of the sequence of signals can include a sampling of the sequence of signals of the particular transmitting antenna according to the sequence of the code values, in particular a multiplication of a signal using zero for a code value in question. According to an example embodiment, the object is achieved by a method for operating a MIMO radar system that includes multiple antennas, including the steps of: encoding signals that are transmitted from different transmitting antennas, according to code blocks, a code block including different codes for encoding transmitted signals of different antennas, and each code including a sequence of code values according to which the phase and/or amplitude of sequence of signals of the particular transmitting antenna are/is modulated; determining a Doppler estimation for a radar object based on phase changes between received signals at the same position in successive code blocks, the Doppler estimation for the radar object having a periodic ambiguity corresponding to multiple ambiguity hypotheses of a Doppler shift of the signals; and resolving the periodic ambiguity of the Doppler estimation for the radar object. The resolving includes, for each of multiple ambiguity hypotheses of the Doppler shift: compensating for the Doppler shift of the phases of the signals belonging to a code block according to the respective ambiguity hypothesis, decoding the Doppler shift-compensated signals of the code block for separating signal components associated with the transmitting antennas, and determining an angle estimation for the radar object based on the signal components and their association with the transmitting antennas. The resolving also includes selecting an ambiguity hypothesis that is applicable to the radar object and the corresponding angle estimation based on the quality of the angle estimations, and determining an unambiguous speed estimation of the radar object corresponding to the Doppler estimation and the selected ambiguity hypothesis. The quality of the angle estimation is thus used as a quality criterion for the decoding, and the angle estimation for the selected ambiguity hypothesis is determined as the applicable angle estimation for the radar object. Thus, an encoding of the transmission signals of different transmitting antennas takes place, and, for multiple ambiguity hypotheses of the Doppler shift, a Doppler compensation and subsequent decoding and angle evaluation take place, the quality of the angle evaluation results being used for selecting the applicable ambiguity hypothesis. In particular, for multiple ambiguity hypotheses of the Doppler shift a Doppler compensation and subsequent decoding and angle evaluation can take place, the quality of the angle evaluation results being used for selecting the applicable ambiguity hypothesis. Use is thus made of the effect that the decoding is susceptible to Doppler shifts, in order to simultaneously find the correct hypothesis of the ambiguity of the Doppler shift, and also to determine the applicable result of the angular resolution after decoding. The sequence of signals whose phase and/or amplitude are/is modulated can also be referred to as a sequence of waveforms whose phase and/or amplitude are/is modulated according to the sequence of code values. The individual signal or the waveform can be, for example, an FMCW signal in the form of a frequency ramp, in particular a fast chirp, or an OFDM symbol. The signals that are (preferably simultaneously) transmitted from different antennas are encoded according to code blocks. In the step of encoding, an individual signal of a transmitting antenna is phase-modulated and/or amplitude-modulated according to a code value, the code value being associated with the signal via its position in the sequence of the code values. The sequence of code values of a code and the sequence of signals of the particular antenna in particular have the same length, i.e., contain the same number of elements. Based on the distance from a radar object, a signal that is delayed by the propagation time to the radar object and back is received at a particular antenna that is used for the reception. For simultaneously transmitted signals, the sum of the reflected, simultaneously transmitted signals of the particular transmitting antennas is received at a particular antenna. For an FMCW radar system, the propagation time is apparent due to a frequency shift with respect to the instantaneously transmitted frequency of a signal, and can be detected using a Fourier transform. A distance estimation can thus take place in the conventional manner. An encoding of the signals, in which the signals of the different transmitting antennas are phase-shifted relative to one another due to the codes used, has an effect similar to multiple simultaneously transmitted signals for virtual beam-forming with phase delay. The beams of the transmitting antennas can have pseudo-random directional characteristics, depending on the code matrix (code block). The different phases of the signals of the particular transmitting antennas have no effect on the propagation time. A distance estimation can thus take place based on the received signals which have not yet been decoded. Due to the Doppler effect, a radial relative speed of the radar object results in a frequency shift of the received signals. In addition, the ambiguous Doppler estimation can take place based on the received signals which have not yet been decoded. For an FMCW radar system, in which the signal has multiple fast frequency ramps within a code block whose phase and/or amplitude are/is modulated, and the signal is repeated for successive code blocks, for example a detection of radar objects can take place in a two-dimensional spectrum of the received signals. A Fourier transform takes place in a first dimension within a signal, and in a second dimension takes place from code block to code block, i.e., for the same position of a signal in successive code blocks. The uniqueness range of speed v has a width vuof: vu=c/(2f0TC2C), where c is the speed of light, f0is the carrier frequency or center frequency of the ramps, and TC2Cis the time period from code block to code block. If no Doppler shift is present due to the fact that the radar object has no relative speed in the radial direction, a decoding of the signals of a code block can be easily carried out in order to separate the signal components that originate from the different transmitting antennas. The separated signal components can then be used for an angle estimation in a manner known per se. For example, the pattern of the signal components is compared to patterns that are expected for particular angles in order to estimate the angle based on the degree of concordance. However, if a Doppler shift is present, it has the effect of a phase shift of the received signal, depending on the position of the signal relative to the first transmitted signal of a code block. Without a compensation for the Doppler shift of the phases, the separation of the signal components using decoding would be disturbed; a signal component associated with a transmitting antenna would then contain signal components of the other transmitting antennas. Conventional methods that include encoding of simultaneously transmitted signals are adversely affected by this effect of the Doppler shift. However, the present invention makes use of this effect. For this purpose, the ambiguity of the Doppler estimation is generated in a targeted manner, and for particular hypotheses of the Doppler shift an assumed Doppler shift of the signals is compensated for before the signals are decoded. For a non-applicable hypothesis of the Doppler shift, the compensation for the Doppler shift thus fails, and the decoding results in incorrectly or incompletely separated signal components of the transmitting antennas. Due to the fact that the signal components are preferably used as the basis for an angle estimation, the angle estimation takes place with only low quality. In contrast, for the applicable hypothesis of the Doppler shift, the Doppler shift is suitably compensated for, the decoding obtains the correctly compensated signals, and the angle estimation can be carried out with high quality. The quality of the angle estimation is thus utilized to recognize the correct ambiguity hypothesis. Thus, the ambiguity of the Doppler estimation, and thus of the speed estimation, can be resolved, and also the applicable angle estimation can be recognized, in one step. The method preferably also includes the step: determining a distance estimation for the radar object based on an evaluation of a propagation time of a received signal. Determining the distance estimation particularly preferably takes place based on the signals, prior to the step of decoding. The distance estimation can easily take place in addition to the Doppler estimation when, for the separation of radar objects, a separation, i.e., a detection as separate radar objects, is carried out based on different (peak) signal positions in a distance-speed spectrum. Determining a distance estimation for a radar object thus takes place based on an evaluation of a propagation time of a received signal. The individual signal of the sequence of signals of a code block is selected in such a way that the bandwidth of the signal allows the distance estimation. For example, in the case of an FMCW radar system, the individual signal can be a fast ramp of a ramp-shaped frequency modulation of the transmission signal. This corresponds to a chirp sequence method in which, however, in the present case a sequence of successive code blocks is provided for which the individual code block in turn contains a sequence of chirps (fast ramps). However, an OFDM symbol can also be used as an individual signal of the sequence of signals of a transmitting antenna. The modulation of the phases and/or amplitudes of the sequence of OFDM symbols then takes place within a code block. This means that OFDM symbols, whose phase and/or amplitude are/is modulated, are sequentially transmitted. Identical signals, which are phase-modulated and/or amplitude-modulated with the different sequences of code values, are preferably simultaneously used for the different antennas. A sequence of signals is preferably used for an antenna, the signals having the same carrier frequency. As a result, for different positions within a code block there are no different dependencies of the phases of the signals on the distance of the radar object. For FMCW ramps, for example the same ramp center frequency is used. For OFDM symbols, the same (main) carrier frequency is used. For an antenna, a sequence of identical signals is preferably used, the signals being phase-modulated and/or amplitude-modulated with the code values of the particular sequence of code values. The decoding of the Doppler shift-compensated signals of the code block preferably takes place by multiplying a vector of the complex signal amplitudes by a decoding matrix to obtain a vector of the signal components associated with the antennas. For example, orthogonal codes or pseudo-noise sequences can be used as codes in a code block. Codes for binary phase encoding using code values from the set of phase rotations by 0° and by 180° are particularly efficient to implement in terms of circuitry. In an example embodiment, codes can be provided in which in each code instance, only one of the transmitting antennas is active, in that for the remaining transmitting antennas a code value is provided that corresponds to a suppression of the signal via a modulation with an amplitude equal to zero, different transmitting antennas being active in different code instances. The decoding then corresponds to an association of the received and Doppler-compensated signals with the particular transmitting antennas corresponding to the transmission sequence that is defined by the code block. Moreover, the object is achieved by a MIMO radar system preferably configured for carrying out the described method. The MIMO radar system is preferably a MIMO radar system for estimating the speed and angle of detected radar objects, and the control and evaluation device is configured in such a way that during the resolution of the periodic ambiguity of the Doppler estimation for the radar object for multiple ambiguity hypotheses of the Doppler shift, in each case a determination of an angle estimation for the radar object takes place based on the signal components and their association with the transmitting antennas, the resolution of the periodic ambiguity of the Doppler estimation for the radar object further encompassing: selecting an ambiguity hypothesis that is applicable to the radar object, and the corresponding angle estimation, based on the quality of the angle estimations. The quality of the angle estimation is thus determined as a quality criterion for the decoding. The control and evaluation device is preferably further configured for determining a distance estimation for a radar object, based on an evaluation of a propagation time of a received signal. For the estimation of a distance based on an evaluation of a propagation time, a signal is preferably used which is not a continuous wave (CW) signal having a single fixed frequency. Rather, the signal should have a certain bandwidth greater than zero, since the bandwidth is essential for the distance resolution. In the step of encoding, an individual signal of a transmitting antenna, which is phase-modulated and/or amplitude-modulated according to the particular code value, preferably has a bandwidth that limits or in particular determines a distance resolution of the distance estimation (i.e., the smallest resolvable distance) in the step of determining the distance estimation. For the step of determining a distance estimation, bandwidth B can, for example, limit or define a distance resolution Δd corresponding to the relationship Δd=c/(2B), where c is the speed of light. In the case of a signal in the form of an FMCW frequency ramp, such as a fast chirp, bandwidth B corresponds to the frequency deviation of the ramp. In an example embodiment, in the step of encoding, an individual signal of a transmitting antenna is a signal which is frequency-modulated in the form of a ramp, and which is phase-modulated and/or amplitude-modulated according to the code value, the code value being associated with the signal based on its position in the sequence of the code values. This means that each code of a code block includes a sequence of code values according to which the phase and/or amplitude of a sequence of signals of the particular antenna are/is modulated, the signals being frequency ramps. The frequency ramps are also referred to as chirps. In an example embodiment, in the step of encoding, an individual signal of a transmitting antenna is an OFDM symbol that is phase-modulated and/or amplitude-modulated according to the code value, the code value being associated with the signal based on its position in the sequence of the code values. This means that each code of a code block includes a sequence of code values according to which the phase and/or amplitude of a sequence of signals of the particular antenna are/is modulated, the signals being OFDM symbols. The OFDM symbol is made up of mutually orthogonal subcarrier signals which are modulated according to a modulation scheme of the symbol and which are simultaneously transmitted within the period of the OFDM symbol. The number of code instances, i.e., the length of a code, is preferably greater than or equal to the number of transmitting antennas that transmit in a code block. With the same number, the signal components of the transmitting antennas can be unambiguously separated on the reception side by decoding. For a longer code length, an overdetermined equation system can be implemented. This can contribute to the robustness of the ambiguity resolution. Example embodiments are explained in greater detail below based on the drawings.

11412217

BACKGROUND The present disclosure relates to graphical digital images. Graphical images can be represented electronically in several types of formats. One type of format is a bitmap image, which is also known as a raster image. A bitmap, or raster, image is typically structured as a grid or array of pixels. For each pixel, a bitmap image includes data to indicate one or more visual properties of that pixel such as color, brightness, hue, transparency, etc. There are various file formats for electronically storing a bitmap image, namely, Graphics Interchange Format (GIF), Portable Network Graphics (PNG), Tagged Image File Format (TIFF), and Joint Photographic Experts Group (JPEG), among others. Image quality of a bitmap image can correspond to a total number of pixels stored within a given image file, or to a degree of lost data from image compression. As pixel count and quality increases, however, so does a file storage size. Individual bitmap files, and collections of bitmap files, can require large amounts of computer storage. SUMMARY File sizes of large and/or high-quality graphical digital images can consume large amounts of computer resources for storage, and large amounts of bandwidth for transmission. Transmitting a collection of such images can be even more challenging. One technique to address large file sizes is file compression or archiving. For example, one conventional archive format known as the ZIP file format, can compress one or more files of various formats by compressing each file separately. In addition to general data archiving formats, conventional image compression algorithms operate on individual files of a specific type. For example, the JPEG algorithm refers to several standards for image compression. These conventional standards were developed by the Joint Photographic Experts Group. JPEG compression uses a lossy compression that operates by replacing a range of values with a single average value. This means that some image data are lost. Compressing an image using a high-level of JPEG compression yields a smaller file size, but also yields a corresponding loss in image quality, that is, image degradation. Compressing an image using a low-level JPEG compression maintains a higher level of image quality, but with little reduction in file size. Techniques disclosed herein include systems and methods for providing image compression by rearranging an order of blocks from one or more images and then sorting and writing those blocks into one or more new or different images. This technique enables using a high level of image compression to reduce a relatively large amount of pixels to a common subset of values than would ordinarily be possible with the original image(s). In one embodiment, an advantage of using techniques disclosed herein is providing image compression that is about 0.1 to 4 times better than conventional compression methods, or that provides a higher compression ratio at a same image quality. In other words, for a given set of images, certain techniques disclosed herein can yield an image archive having a file size that is about two to four times smaller than conventional archiving techniques applied to the same given set of images. Alternatively, for the given set of images, certain techniques disclosed herein can yield an image archive of a same given file size of a conventional archive, but with archived images having four times better image quality than with images archived using conventional methods. In one embodiment, an image manager extracts a plurality of blocks from a graphical digital image file. The graphical digital image file defines an array of pixels for representing a graphical image. Each block from the graphical digital image file comprises a group of pixels. In other words, the array or grid of pixels can be divided or sectioned into groups of pixels. The image manager analyzes each block from the plurality of blocks to produce a corresponding variation value for each of the blocks. Each corresponding variation value indicates a level of variation of pixel data within a respective block. For example, a given block of pixels can have pixels with many different colors or with just a few colors. Blocks having many colors or much contrast have larger amounts of variation of pixel data, while blocks having just a few colors or little contrast have smaller amounts of variation among pixel data. The image manager sorts the plurality of blocks according to the variation values produced for the blocks. For example, the image manager can sort the plurality of blocks from blocks having low variation values to blocks having high variation values. The image manager then identifies a level of image compression applied to each respective block based on the variation value of each respective block. The level of image compression affects image quality. For example, a high level of image compression means that more data is lost during compression, resulting in a smaller image file size. Thus, high compression typically corresponds to high degradation. Likewise, a low level of image compression means that less data is lost during compression, resulting in a larger image file size. Low image compression typically corresponds to low image degradation by essentially keeping raw data. There can be any number of selectable levels of image compression ranging from no loss of data to extensive loss of data. The image manager compresses each respective block using the level of image compression identified to apply to each respective block. In addition to sorting the blocks based on variation values, the image manager can also sort the blocks according to color values produced or identified for the blocks. This can be, for example, an average color value of pixels within a given block. In another embodiment, the image manager extracts the plurality of blocks from graphical digital image files from a first plurality of graphical digital image files. Each graphical digital image file defines an array of pixels for representing the graphical image. Each block is extracted from the first plurality of graphical digital image files. Each block can be a contiguous group of pixels, such as a rectangular group of pixels. The image manager analyzes each block from the plurality of blocks to produce a corresponding variation value for each of the blocks. Each corresponding variation value indicates a level of variation of pixel data within a respective block. The image manager sorts the plurality of blocks according to the variation values produced for the blocks. The image manager can then organize the plurality of blocks into a second plurality of graphical digital image files. Each respective graphical digital image file, from the second plurality of graphical digital image files, is created from blocks having similar variation values. Optionally, the image manager can organize the plurality of blocks into a second plurality of graphical digital image files based on average color values in addition to the variation values. In other words, each image within a collection of images is divided into blocks and then the image manager extracts, sorts, and reorganizes these blocks into new images to create a second collection of images using the extracted blocks. The image manager compresses each respective graphical digital image file, from the second plurality of graphical digital image files, using a predetermined image compression algorithm. For example, after creating the collection of new images, image manager can use a JPEG algorithm or a TIFF algorithm to compress each of the new images. With each new image composed of blocks having similar variation values, the predetermined image compression algorithm can compress pixel data more efficiently. The image manager maintains a map of each block that identifies a location of each respective block with the first plurality of graphical digital image files and within the second plurality of graphical digital image files, so that after decompressing each respective graphical digital image file from the second plurality of graphical digital image files, the image manager can then reorganize the decompressed blocks into the graphical digital image files from the first plurality of graphical digital image files. Yet other embodiments herein include software programs to perform the steps and operations summarized above and disclosed in detail below. One such embodiment comprises a computer program product that has a computer-storage medium (e.g., a tangible computer readable storage media, disparately located or commonly located storage media, computer storage media or medium, etc.) including computer program logic encoded thereon that, when performed in a computerized device having a processor and corresponding memory, programs the processor to perform the operations disclosed herein. Such arrangements are typically provided as software, firmware, microcode, code data (e.g., data structures), etc., arranged or encoded on a computer readable storage medium such as an optical medium (e.g., CD-ROM), floppy disk, hard disk, one or more ROM or RAM or PROM chips, an Application Specific Integrated Circuit (ASIC), and so on. The software or firmware or other such configurations can be installed onto a computerized device to cause the computerized device to perform the techniques explained herein. Accordingly, one particular embodiment of the present disclosure is directed to a computer program product that includes one or more computer storage media having instructions stored thereon for supporting operations such as: extracting a plurality of blocks from a graphical digital image file, the graphical digital image file defining an array of pixels for representing a graphical image, each block from the graphical digital image file being a group of pixels; analyzing each block from the plurality of blocks to produce a corresponding variation value for each of the blocks, each corresponding variation value indicating a level of variation of pixel data within a respective block; sorting the plurality of blocks according to the variation values produced for the blocks; identifying a level of image compression to apply to each respective block based on the variation value of each respective block, the level of image compression affecting image quality; and compressing each respective block using the level of image compression identified to apply to each respective block. The instructions, and method as described herein, when carried out by a processor of a respective computer device, cause the processor to perform the methods disclosed herein. Other embodiments of the present disclosure include software programs to perform any of the method embodiment steps and operations summarized above and disclosed in detail below. Of course, the order of discussion of the different steps as described herein has been presented for clarity sake. In general, these steps can be performed in any suitable order. Also, it is to be understood that each of the systems, methods, apparatuses, etc. herein can be embodied strictly as a software program, as a hybrid of software and hardware, or as hardware alone such as within a processor, or within an operating system or within a software application, or via a non-software application such a person performing all or part of the operations. Example embodiments as described herein may be implemented in products and/or software applications such as those manufactured by Adobe Systems Incorporated of San Jose, Calif., USA. As discussed above, techniques herein are well suited for use in software applications supporting electronic image management, storage, and compression. It should be noted, however, that embodiments herein are not limited to use in such applications and that the techniques discussed herein are well suited for other applications as well. Additionally, although each of the different features, techniques, configurations, etc. herein may be discussed in different places of this disclosure, it is intended that each of the concepts can be executed independently of each other or in combination with each other. Accordingly, the present invention can be embodied and viewed in many different ways. Note that this summary section herein does not specify every embodiment and/or incrementally novel aspect of the present disclosure or claimed invention. Instead, this summary only provides a preliminary discussion of different embodiments and corresponding points of novelty over conventional techniques. For additional details and/or possible perspectives of the invention and embodiments, the reader is directed to the Detailed Description section and corresponding figures of the present disclosure as further discussed below.

11379539

BACKGROUND A Web crawler is a typical part of a search engine that procures information subsequently served by the search service to its users. As the Web is becoming increasingly more dynamic, in addition to discovering new web pages, a crawler needs to keep revisiting those already in the search engine's index, in order to keep the index fresh by picking up the pages' changed content. This refresh process is resource intensive. SUMMARY This summary is provided to introduce a selection of concepts in a simplified form that are further described below in the Detailed Description. This summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used as an aid in determining the scope of the claimed subject matter. The technology described herein provides a more efficient crawl schedule for content trackers, such as search engines, to use when refreshing a content index. As the Web becomes more dynamic, services that rely on Web data face the increasingly challenging problem of keeping up with content changes. Whether it be a continuous-query system, a virtual assistant, or an Internet search engine, such a service tracks many remote sources of content—web pages or data streams. Users expect trackers to surface the latest content that appears at the sources. For all content sources a tracker monitors, the tracker decides when to re-request (crawl) the content source in order to refresh the content in view of changes made since the last time the content was crawled. A policy that makes these crawl decisions well solves a freshness crawl scheduling problem. The technology described herein is a holistic approach to freshness crawl scheduling that is computationally efficient and generates optimal freshness results using a type of reinforcement learning. In the ideal world, the search engine would revisit the content source as soon as the content changes. As a practical matter, this is often not technologically possible: most content sources, e.g., web pages, don't notify search engines when their content changes Even if they did, network bandwidth constraints would prevent the search engine's crawler from updating content upon every change notification. The goal is to find the optimal times to revisit these content sources while taking the overall available bandwidth into consideration, along with an estimated change rate for the content sources, the importance of the content sources, and the change notifications received. At a high level, the technology described herein builds an optimal refresh schedule by minimizing a cost function that characterizes penalties a search engine incurs for staleness, i.e., the lack of freshness of its index, constrained by an available refresh bandwidth. The cost function takes into account a search-engine-defined importance score for a content item and a change rate of the content item as input in order to optimize the schedule. The optimization problem is solved when a refresh schedule is found that minimizes the cost while using the available bandwidth and no more. The optimal refresh schedule, sometimes described herein as a refresh policy, allocates an amount of available bandwidth to each content item in a set to be refreshed. In sum, the bandwidth allocated to each item within the set is less than or equal to the available bandwidth. The optimal schedule created using the technology described herein will maximize overall item freshness. Both the change rate of a content item and an importance score for the content item are used to allocate bandwidth. It is also a feature of the technology described herein that all of the content items in a set to be refreshed will be allocated at least some bandwidth during a time horizon covered by the schedule. The technology described herein can be optimized to build a refresh schedule for content items with different associated amounts of change data. The technology can build an optimized schedule to refresh content items with incomplete change data (when the search engine gets to observe an item from time to time and thereby detect changes, but doesn't know how many times the item changed in between observations), content items with complete change data (when the search engine gets notified every time when the content item changes), or a mixture of content items with and without complete change data. An optimized schedule is built by selecting differently parameterized cost functions for the different scenarios. In particular, the cost function used for sites with complete change data may depend on a probability of crawling in response to a change notification for the content site. In other words, the system may not crawl every content item every time a change notification is received. Instead, a probability is used to determine whether to visit the site, with different probability values translating to different values of the cost function. Conceptually, this can be imagined as flipping a coin to determine whether to visit the site when a change notification is received. Instead of the 50% probability associated with flipping a coin, the probability calculated for the item would be used to make the crawl or no crawl decision.

11238996

BACKGROUND 1. Field This invention relates in general to light water nuclear reactors and in particular to an instrumentation system for monitoring in real time the boron concentration within the reactor coolant. 2. Related Art The primary side of nuclear reactor power generating systems which are cooled with water under pressure comprises a closed circuit which is isolated and in heat exchange relationship with the secondary side for the production of useful energy. The primary side comprises the reactor vessel enclosing a core internal structure that supports a plurality of fuel assemblies containing fissile material, the primary circuit within heat exchange steam generators, the inner volume of a pressurizer, pumps and pipes for circulating pressurized water; the pipes connecting each of the steam generators and pumps to the reactor vessel independently. Each of the parts of the primary side comprising a steam generator, a pump and a system of pipes which are connected to the vessel form a loop of the primary side. For the purpose of illustration,FIG. 1shows a simplified nuclear reactor primary system, including a generally cylindrical reactor pressure vessel10having a closure head12(also shown inFIG. 2), enclosing a nuclear core14. A liquid reactor coolant, such as water is pumped into the vessel10by pump16through the core14where heat energy is absorbed and is discharged to a heat exchanger18, typically referred to as a steam generator in which heat is transferred to a utilization circuit (not shown), such as a steam driven turbine generator. The reactor coolant is then returned to the pump16, completing the primary loop. Typically, a plurality of the above described loops are connected to a single reactor vessel10by reactor coolant piping20. At least one of those loops normally includes a pressurizer19connected to the reactor coolant loop piping20through a charging line21. An exemplary reactor design is shown in more detail inFIG. 2. In addition to the core14comprised of a plurality of parallel, vertical, co-extending fuel assemblies22, for purposes of this description, the other vessel internal structure can be divided into the lower internals24and the upper internals26. In conventional designs, the lower internals' function is to support, align and guide core components and instrumentation as well as direct flow within the vessel. The upper internals restrain or provide a secondary restraint for the fuel assemblies22(only two of which are shown for simplicity in this figure), and support and guide instrumentation and components, such as control rods28. In the exemplary reactor shown inFIG. 2, coolant enters the reactor vessel10through one or more inlet nozzles30, flows down through an annulus between the vessel and the core barrel32, is turned 180 degrees in a lower plenum34, passes upwardly through a lower support plate37and a lower core plate36upon which the fuel assemblies22are seated and through and about the assemblies. In some designs, the lower support plate37and the lower core plate36are replaced by a single structure, the lower core support plate, at the same elevation as the lower support plate37. The coolant flowing through the core14and surrounding area38is typically large on the order of 400,000 gallons per minute at a velocity of approximately 20 feet per second. The resulting pressure drop and frictional forces tend to cause the fuel assemblies to rise, which movement is restrained by the upper internals26, including a circular upper core plate40. Coolant exiting core14flows along the underside of the upper core plate40and upwardly through a plurality of perforations42. The coolant then flows upwardly and radially to one or more outlet nozzles44. The upper internals26can be supported from the vessel10or the vessel head12and include an upper support assembly46. Loads are transmitted between the upper support assembly46and the upper core plate40, primarily by a plurality of support columns48. A support column is aligned above a selected fuel assembly22and perforations42in the upper core plates40. The rectilinearly movable control rods28typically include a drive rod50and a spider assembly52of neutron poison rods28that are guided through the upper internals26and into aligned fuel assemblies22by control rod guide tubes54. The guide tubes are fixedly joined to the upper support assembly46and connected to the top of the upper core plate40. By inserting and withdrawing the neutron poison rods into and out of guide thimbles within the fuel assemblies within the core the control rods regulate the extent of the nuclear reactions within the core. Boron, dissolved within the reactor coolant water, also functions to control the nuclear reactions and manages more gradual changes in reactivity than the control rods. There is currently no direct method employed to continuously measure the boron concentration in the reactor coolant system. Current measurements rely on samples drawn from taps in the reactor coolant system that have piping running from inside the Reactor Containment Building to Chemistry Analysis Offices located in the Auxiliary Building. This methodology results in a significant time lag between the boron concentration measured in the sample drawn and the current reactor coolant system boron concentration during reactor coolant system boron concentration dilution and boration transient conditions. This necessitates monitoring for uncontrolled changes in reactor coolant system boron via changes in reactor reactivity using changes in reactor neutron flux levels. This approach is not typically capable of detecting core reactivity changes until significant reactivity changes have already occurred. This situation has resulted in many adverse “Reactivity Management” Operating Event incidents associated with inadvertent changes in reactor coolant system boron concentration resulting in uncontrolled core reactivity changes. It is also necessary to monitor the reactor coolant system boron concentration to ensure that reactor Shutdown Margin is maintained when the reactor is shutdown. Boron concentration values are required during operation to ensure that the reactor is behaving in agreement with design expectations. Managing reactor coolant system boron concentration changes to compensate for fuel depletion during operation also requires detailed information on the value and changes in reactor coolant system boron concentration. Reactor coolant system boron dilution is required daily to compensate for fuel depletion. Ensuring that the desired reactor coolant system boron concentration change is occurring or has occurred is affected by the time lag caused by the current reactor coolant system boron concentration measurement process. Mistakes in the required amount of dilution required are only detected after they have already occurred. The approach described in this specification is difficult to employ in the locations described above using conventionally available technology because of the radiation fields generated by the decay of N-16 produced from the oxygen in the water when it flows through or near the reactor core. The radiation field degrades the reliability of the electronics required to digitize and wirelessly transmit the sensor readings. The difficulty is also increased by the fact that temperature of the water flowing through the pipes exceeds the Curie point of typical piezoelectric materials used to produce and measure the ultrasonic radiation. SUMMARY This invention eliminates the foregoing concerns by using electronics, transmitters, and signal measurement devices that utilize vacuum micro-electronic device technology, allowing the critical features of these devices to be replaced by micro-scale vacuum tube technology having performance characteristics shown to be essentially impervious to radiation damage and very high temperatures. An application of the vacuum micro-electronic devices wireless transmitter technology is disclosed in U.S. Pat. No. 8,767,903, entitled “Wireless In-Core Neutron Monitor.” Thus, in accordance with a broad concept of this invention, a boron concentration monitor is provided for measuring, in real time, the boron concentration of coolant within the piping servicing a primary loop of a nuclear reactor. The boron concentration monitoring system comprises an acoustic transmitter acoustically coupled to or through the piping that is operable to transmit an acoustic signal substantially through an interior of the piping. An acoustic receiver is supported at a location around a circumference of the piping that is spaced from the acoustic transmitter, for receiving the acoustic signal from the transmitter. A communication mechanism is in electrical communication with the acoustic transmitter and the acoustic receiver and is configured to convey the transmitted acoustic signal and the received acoustic signal to a remote location. An analyzer is in communication with the remote location and is configured to receive the received acoustic signal and the transmitted acoustic signal from the communication mechanism and compare the received acoustic signal and the transmitted acoustic signal and from the comparison determine the boron concentration within the piping. In one embodiment of the boron concentration monitor, the analyzer compares the signal comparison to a standard to determine the boron concentration in the piping. Preferably, the acoustic transmitter and acoustic receiver are at a known linear distance from each other and the standard is established from an experimental determination of the attenuation of an acoustic signal in a borated water solution over the known distance at a plurality of known boron concentrations. In another embodiment, the communication mechanism comprises a wireless transmitter coupled to the acoustic transmitter and the acoustic receiver. The wireless transmitter is configured to wirelessly transmit both the transmitted acoustic signal and the received acoustic signal to the remote location. In the latter embodiment, the communications mechanism also comprises a wireless receiver configured to receive the wirelessly transmitted, transmitted acoustic signal and received acoustic signal at the remote location and communicate the transmitted acoustic signal and the received acoustic signal to the analyzer. In one configuration of the latter embodiment the acoustic transmitter, the acoustic receiver and the wireless transmitter are powered from a thermoelectric generator having a hot junction in thermal communication with the piping and a cold junction in thermal communication with a surrounding environment. In one arrangement of the latter embodiment the hot junction is in thermal communication with the piping through a heat pipe. Preferably, the wireless transmitter comprises two separate wireless transmitters respectively connected to the acoustic transmitter and the acoustic receiver. In still another embodiment, the acoustic transmitter and the acoustic receiver are supported at substantially diametrically opposite positions around the circumference of the piping. Preferably, the acoustic transmitter and the acoustic receiver employ one or more vacuum micro-electronic devices and desirably those vacuum micro-electronic devices are vacuum micro-electronic devices. In such an arrangement, desirably, the transmitter employs one or more vacuum micro-electronic devices. In another embodiment, the acoustic receiver is an ultrasonic energy measurement sensor. In each of the foregoing embodiments, the piping may be a charging line in fluid communication with the primary loop or a hot leg or a cold leg of the primary loop of the nuclear reactor. Each of the foregoing embodiments may further include a temperature sensor for determining the temperature of water flowing in the piping at the location of the acoustic transmitter and acoustic receiver that transmits a signal representative of the temperature through the communication mechanism to the analyzer which determines the boron concentration as a function of temperature. The boron concentration monitor may also include a pressure sensor for determining a pressure of the water flowing in the piping at the location of the acoustic transmitter and acoustic receiver that transmits a signal representative of the pressure of the coolant through the communication mechanism to the analyzer which determines the boron concentration as a function of temperature and pressure.

11220353

BACKGROUND INFORMATION 1. Field The present disclosure relates generally to manufacturing composite structures and, more specifically, to manufacturing composite structures on layup mandrels. 2. Background Composite materials are tough, light-weight materials created by combining two or more functional components. For example, a composite material may include reinforcing fibers bound in polymer resin matrix. In manufacturing composite structures, layers of composite material are typically laid up on a tool, such as a layup mandrel. The layers may be laid up as fabric, tape, tows, or other suitable forms. For thermosetting resins, after laying up the composite material, the composite material is cured by exposure to at least one of temperature or pressure to form a composite part. For large composite structures such as composite fuselages, the manufacturing time, the manufacturing cost, the capital investment costs, and raw material costs are substantial. It is desirable to reduce at least one of the time and the cost, and to maximize raw material usage (e.g. minimize material waste or scrap) involved in manufacturing large composite structures, such as composite fuselages. Therefore, it would be desirable to have a method and apparatus that takes into account at least some of the issues discussed above, as well as other possible issues. For example, it would be desirable to have a method that reduces at least one of manufacturing cost or manufacturing time. SUMMARY An illustrative embodiment of the present disclosure provides a method of fabricating a composite structure. A plurality of composite plies is laid up over a layup mandrel. A first caul plate and a second caul plate are positioned over the plurality of composite plies, leaving composite material exposed. At least part of the composite material exposed between the first caul plate and the second caul plate is removed to separate a first composite section from a second composite section. The first composite section and the second composite section are cured to form a first composite part and a second composite part. The first composite part and the second composite part are removed from the layup mandrel immediately following curing. Another illustrative embodiment of the present disclosure provides a method of reducing flow time of a layup mandrel in composite fuselage manufacturing. A first half of a fuselage and a second half of the fuselage are cured on the layup mandrel. The first half of the fuselage and the second half of the fuselage are removed from the layup mandrel after curing and prior to performing post cure drilling or trimming on either the first half of the fuselage or the second half of the fuselage. Yet another illustrative embodiment of the present disclosure provides a method of fabricating a composite structure. A plurality of composite plies is laid up onto a layup mandrel. Composite material is removed from the layup mandrel to form a plurality of composite sections prior to curing. A respective bagging material is sealed over each composite section of the plurality of composite sections and to the layup mandrel to form a plurality of sealed regions, each sealed region of the plurality of sealed regions encompassing a respective composite section prior to curing. The plurality of composite sections is cured to form a plurality of composite parts. The plurality of composite parts is removed from the layup mandrel after curing and prior to performing a post cure machining operation. The features and functions can be achieved independently in various embodiments of the present disclosure or may be combined in yet other embodiments in which further details can be seen with reference to the following description and drawings.

11430649

CROSS-REFERENCE TO RELATED APPLICATIONS This application is a National Stage of International Application No. PCT/JP2018/020356 filed May 28, 2018. TECHNICAL FIELD The present invention relates to an analytical device. BACKGROUND ART In a time-of-flight mass spectrometry device (hereinafter, referred to as TOF-MS as appropriate), ions are accelerated by an electric field generated by a pulse voltage and a constant voltage, and m/z (mass-to-charge ratio) of each ion is measured based on flight time that elapses before accelerated ions are detected by a detector. If the pulse voltage or constant voltage changes unintentionally due to measurement conditions, measurement accuracy of the flight time will decrease. In order to perform accurate mass spectrometry, it is necessary to suppress the variation in flight time depending on the measurement conditions to about several ppm or less, so it is necessary to improve the variation due to various causes. As a method of suppressing such variation, for example, in Patent Literature 1 (PTL 1), variation in flight time due to voltage drop of the pulse voltage or the like, which occurs when the period between applying the pulse voltages (hereinafter referred to as a pulse period) changes, is reduced by changing the voltage applied to each electrode constituting the TOF-MS. CITATION LIST Patent Literature PTL 1: International publication No. 2017/068729 SUMMARY OF INVENTION Technical Problem Stray capacitance is generated between a plurality of electrodes to which a pulse voltage or a constant voltage is applied to accelerate ions. Due to this stray capacitance, there is a problem that the pulse voltage applied to the electrodes causes voltage fluctuations of other electrodes to which a constant voltage is applied. Although it is considered that this voltage fluctuation can be reduced by directly connecting the grounded capacitor and each electrode, even with this method, the voltage fluctuation cannot be completely eliminated. Solution to Problem According to the 1st aspect of the present invention, an analytical device comprises: a first acceleration unit including a first acceleration electrode to which a pulse voltage for accelerating ions is applied; a flight tube; a second acceleration unit that is arranged between the first acceleration unit and the flight tube, and includes a second acceleration electrode to which a voltage for accelerating the ions is applied; an ion detector that detects the ions; and a capacitance adjustment unit that causes adjustment of a capacitance between at least one set of electrodes among a plurality of electrodes arranged in the first acceleration unit, the second acceleration unit, and a flight tube. According to the 2nd aspect of the present invention, in the analytical device according to the 1st aspect, it is preferred that the first acceleration electrode includes a first electrode and a second electrode that is arranged at a position closer to the second acceleration unit in comparison with the first electrode; and the capacitance adjustment unit causes adjustment of at least one capacitance among one between the first electrode and the second acceleration electrode and one between the first electrode and the flight tube electrode arranged in the flight tube. According to the 3rd aspect of the present invention, in the analytical device according to the 2nd aspect, it is preferred that the capacitance adjustment unit generates a capacitance between the first electrode and the second acceleration electrode or the flight tube electrode based on stray capacitance between the second electrode and the second acceleration electrode or the flight tube electrode. According to the 4th aspect of the present invention, in the analytical device according to the 2nd or 3rd aspect, it is preferred that the capacitance adjustment unit causes adjustment of a capacitance between the first electrode and the second acceleration electrode that is arranged in the second acceleration unit at the closest position from the first acceleration unit. According to the 5th aspect of the present invention, in the analytical device according to any one of the 1st to 4th aspects, it is preferred that the capacitance adjustment unit causes adjustment of a capacitance between the second acceleration electrode and another second acceleration electrode or an electrode arranged in the flight tube. Advantageous Effects of Invention According to the present invention, capacitance between a plurality of electrodes to which a pulse voltage or a constant voltage is applied can be precisely adjusted.

11529627

BACKGROUND OF THE INVENTION The present invention relates generally to microfluidics, and more particularly to silicon-based techniques for separating or sorting macromolecules from a sample fluid. Separating and sorting biological entities, such as cells, proteins, and DNA, is critical to a vast number of biomedical applications, including diagnostics, therapeutics, cell biology, and proteomics. Gel electrophoresis is widely employed for separating macromolecules, such as DNA, RNA, proteins, and their fragments, and in the medical diagnostics field represents a multi-billion-dollar market. In gel electrophoresis separation of protein and DNA/RNA for analytical purposes, a protein mix is usually subjected to a strong electric field, typically about 30 V/cm. Proteins or DNA/RNA move through the gel at a rate depending upon their size and surface charge. However, there are several disadvantages to gel electrophoresis. The gels are prepared from agarose or acrylamide polymers that are known to be toxic, and the outcome of electrophoresis is revealed optically by staining the proteins with dye or the DNA/RNA with ethydium bromide, which is extremely cancerogenic. Gels require sufficient quantities of material for the outcome of the electrophoresis to be detectable, but poor cross-linking in the gel matrix often leads to inconclusive results and a complete loss of the samples. If the gel matrix size is not adapted to the sample molecule size or if the electrophoresis runs too long, then samples may be lost. Syringe-based filters also provide another option to filter material down to a size of tens of nanometers. However, such filters rapidly clog and are very unreliable for separating macromolecules at such scale. In comparison to traditional techniques, silicon (Si) nano-fabrication technology can offer precise and accurate control in the dimensioning and positioning of nano-structures, which can lead to reliable sorting of particles based upon their size. To date, silicon-based lab-on-a-chip approaches using Si and pillar arrays have shown promise in sorting material down to the range of DNA, exosomes, and viruses. However, the volumes that such chips can process are relatively small due to the in-plane arrangement of their structures, and consequently their applications are usually limited to analytic solutions. BRIEF SUMMARY Principles of the invention, in accordance with one or more embodiments thereof, provide apparatus and methods for layered stacking of silicon-based microfluidic chips. In accordance with one embodiment of the invention, an apparatus for sorting macromolecules in a sample fluid includes a first chip having a front side and a backside. The first chip includes at least first, second and third reservoirs formed in the front side of the first chip, the first reservoir being configured to hold the sample fluid. The apparatus further includes a second chip supported on the first chip. The second chip includes a channel having at least one monolithic sorting structure configured to sort macromolecules from the sample fluid. A first set of vias formed in the second chip is configured to couple the channel to the first reservoir, the first set of vias providing the sample fluid from the first reservoir to the monolithic sorting structure for sorting. A second set of vias formed in the second chip is configured to couple the channel to the second reservoir. A third set of vias formed in the second chip is configured to couple the channel to the third reservoir. A fourth set of vias formed in the first chip has respective openings in the backside of the first chip and is configured as an inlet to the first reservoir. A fifth set of vias formed in the first chip has respective openings in the backside of the first chip and is configured as an outlet for the second reservoir. A sixth set of vias formed in the first chip has respective openings in the backside of the first chip and is configured as an outlet for the third reservoir. In accordance with another embodiment of the invention, an apparatus for sorting macromolecules in a sample fluid includes a first chip comprising a channel formed in a first side of the first chip and having at least one monolithic sorting structure configured to sort macromolecules from the sample fluid. A first set of vias formed in the first chip has respective openings in a second side of the first chip opposite the first side, the sample fluid being provided to the monolithic sorting structure through the first set of vias. A second set of vias formed in the first chip has respective openings in the second side of the first chip and is configured for receiving macromolecules in the sample fluid greater than or equal to a prescribed dimension sorted by the monolithic sorting structure. A third set of vias formed in the first chip has respective openings in the second side of the first chip and is configured for receiving macromolecules in the sample fluid less than the prescribed dimension sorted by the monolithic sorting structure. The apparatus further includes first and second seals covering the first and second sides, respectively, of the first chip. In accordance with yet another embodiment of the invention, a method includes: forming at least first, second and third reservoirs in a front side of a first chip, the first reservoir being configured to hold a sample fluid containing macromolecules; forming a channel in a second chip, the channel having at least one monolithic sorting structure configured to sort macromolecules from the sample fluid; forming a first set of vias in the second chip configured to couple the channel to the first reservoir, the first set of vias providing the sample fluid from the first reservoir to the monolithic sorting structure for sorting; forming a second set of vias in the second chip configured to couple the channel to the second reservoir; forming a third set of vias in the second chip configured to couple the channel to the third reservoir; forming a fourth set of vias in the first chip, the fourth set of vias having respective openings in a backside of the first chip and being configured as an inlet to the first reservoir; forming a fifth set of vias in the first chip, the fifth set of vias having respective openings in the backside of the first chip and being configured as an outlet for the second reservoir; and forming a sixth set of vias in the first chip, the sixth set of vias having respective openings in the backside of the first chip and being configured as an outlet for the third reservoir. As used herein, “facilitating” an action includes performing the action, making the action easier, helping to carry the action out, or causing the action to be performed. Thus, by way of example and not limitation, instructions executing on one processor might facilitate an action carried out by instructions executing on a remote processor, by sending appropriate data or commands to cause or aid the action to be performed. For the avoidance of doubt, where an actor facilitates an action by other than performing the action, the action is nevertheless performed by some entity or combination of entities. One or more embodiments of the invention or elements thereof can be implemented in the form of a computer program product including a computer readable storage medium with computer usable program code for performing the method steps indicated. Furthermore, one or more embodiments of the invention or elements thereof can be implemented in the form of a system (or apparatus) including a memory, and at least one processor that is coupled to the memory and operative to perform exemplary method steps. Yet further, in another aspect, one or more embodiments of the invention or elements thereof can be implemented in the form of means for carrying out one or more of the method steps described herein; the means can include (i) hardware module(s), (ii) software module(s) stored in a computer readable storage medium (or multiple such media) and implemented on a hardware processor, or (iii) a combination of (i) and (ii); any of (i)-(iii) implement the specific techniques set forth herein. Techniques of the present invention can provide substantial beneficial technical effects. By way of example only and without limitation, one or more embodiments may provide one or more of the following advantages:reliable separation and sorting of macromolecules, suitable for relatively high volume processing;reduced silicon area requirements through multi-tier stacked chip layers to drive down costs;compatibility with advanced semiconductor processing;sealing of microfluidic channels and reservoirs for improved manufacturability to provide air-tight, fluid-tight seals for the fluidic channels until needed for use;access to fluidic through-silicon vias (TSVs) on the backside of the chip to facilitate the input and extraction of fluid; andintegration of electronics and fluidics. These and other features and advantages of the present invention will become apparent from the following detailed description of illustrative embodiments thereof, which is to be read in connection with the accompanying drawings.

PP34209

Botanical classification:Prunus persica. Variety Denomination: ‘CANDYSWEET XVI’. BACKGROUND OF THE VARIETY In a continuing effort to improve the quality of shipping fruits, we, the inventors, typically hybridize a large number of peach, nectarine, plum, apricot, and cherry seedlings each year. We also grow a smaller number of open pollinated seeds of each of these fruits, usually to capture recessive traits. The present invention relates to a new and distinct variety of nectarine tree, which has been denominated varietally as ‘Candysweet XVI’. The present variety was hybridized by us in 2005 as a first generation cross using ‘Candy Pearl’ (U.S. Plant Pat. No. 14,249) nectarine as the selected seed parent and ‘August Bright’ (U.S. Plant Pat. No. 15,143) nectarine as the selected pollen parent. Upon reaching maturity the fruit of this hybridization was gathered, and the seeds were removed, cracked, stratified, germinated, and grown as seedlings on their own root in our greenhouse facility. Upon reaching dormancy we transplanted them to a cultivated area of our experimental orchard located near Le Grand, Calif., in Merced County (San Joaquin Valley). During the fruit evaluation season of 2010 we selected the present variety as a single tree from the group of seedlings described above. Subsequent to origination of the present variety of nectarine tree, we asexually reproduced it by budding and grafting in the experimental orchard described above, and such reproduction of plant and fruit characteristics were true to the original tree in all respects. The reproduction of the variety included the use of ‘Nemaguard’ (unpatented) rootstock upon which the present variety was compatible and true to type. The present variety is similar to its seed parent, ‘Candy Pearl’ (U.S. Plant Pat. No. 14,249) nectarine by being vigorous, by being self-fertile, by having a large blossom, by having reniform leaf glands, and by producing nectarines that are mostly red in skin color, that are clingstone in type, and that are sub-acidic in flavor, but is quite distinguished from it by producing fruit that is yellow instead of white in flesh color, by being much sweeter in flavor, by having a bitter instead of sweet tasting kernel, and that ripen about forty-eight days later. The present variety is most similar to its pollen parent, ‘August Bright’ (U.S. Plant Pat. No. 15,143) nectarine, by having a medium size tree, by being self-fertile, by having reniform leaf glands, and by producing nectarines that are mostly red in skin color, that are yellow in flesh color, that are clingstone in type, and that mature in mid August, but is distinguished therefrom by having a bitter instead of sweet kernel, by having a genetically large instead of small flower, and by producing fruit that is somewhat larger in size, sub-acidic instead of acidic in flavor, and much sweeter. SUMMARY OF VARIETY In summary, the present nectarine variety is characterized by a medium size, vigorous, hardy, self-fertile, productive and regular bearing tree. The variety has a large showy blossom and blooms during the mid season, with a chilling requirement of about 550 hours. The fruit matures under the ecological conditions described in mid to late Mid to late August, with first picking on Aug. 18, 2021. The fruit is uniform, large in size, sub-acidic and very sweet in flavor, mostly globose in shape, clingstone in type, firm in texture, yellow in flesh color, mostly red in skin color, and has a bitter tasting kernel.

11302292

TECHNICAL FIELD The present application relates to the field of computer technology, and more particularly to graphical user interfaces and a solution for generating display contents based on compositing in the display subsystem. BACKGROUND Graphical user interfaces of modern operating systems have a windowing support. An application typically renders its contents in a dedicated, rectangular, two-dimensional area that is commonly referred to as a window or window surface. To combine rendered views from all running applications, the operating system needs to composite the window surfaces into a final, combined view that is then sent to a device display. The final compositing may be based on the windows' positions, sizes, transparences, and other features. Further, the final compositing for window surfaces may be done in different ways, depending on available hardware resources and capabilities of the hardware resources. However, performance and power consumption of compositing differ between the different hardware resources. It would be beneficial to be able to effectively utilize hardware resources for window surface compositing procedures. SUMMARY This summary is provided to introduce a selection of concepts in a simplified form that are further described below in the detailed description. This summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used to limit the scope of the claimed subject matter. It is an objective of this disclosure to provide a solution for compositing a final display frame. A solution is provided for display contents generation in a case where several application window surfaces are visible at the same time and the number of application window surfaces exceeds the number of available hardware layers in a display subsystem (DSS). In a solution according to an embodiment, the display subsystem is sequentially used to composite the final display frame. This objective is achieved by the features of the independent claims. Further embodiments and examples are apparent from the dependent claims, the description and the drawings. According to a first aspect, a method for display contents generation is provided. The method comprises selecting data of multiple application window surfaces stored in a memory, wherein an initial number of the application window surfaces exceeds the number of available hardware layers of a display subsystem; feeding data of the selected multiple window surfaces to the available hardware layers; compositing an intermediate frame by a compositor of the display subsystem based on the contents of the fed hardware layers; selecting data of at least one previously non-selected application window surface stored in the memory; feeding the intermediate frame and data of the selected at least one previously non-selected application window surface to the available hardware layers; and compositing a subsequent frame by the compositor based on the contents of the fed hardware layers. This enables display contents generation by performing a composition procedure using only the display subsystem sequentially even when the number of application window surfaces to be composited exceeds the number of available hardware layers in the display subsystem. Thus, by using only the display subsystem this also decreases the load of other hardware resources. Further, a solution is provided in which a graphical processing unit (GPU) will be available for applications to render their content for the next frame while a previous frame composition is still ongoing, thus enabling asynchronous composition and GPU offloading. This may also improve overall system performance. In an implementation of the first aspect, an initial number of the selected application window surfaces corresponds to the number of the available hardware layers. This enables utilizing the hardware capabilities optimally for the composition of the application window surfaces. In a further implementation of the first aspect, the method further comprises storing the intermediate frame in the memory. This enables feeding the intermediate frame with the next application window surfaces from the memory to the available hardware layers for composition. Further, the intermediate frame may be at disposal for other purposes. In a further implementation of the first aspect, the method further comprises storing the subsequent frame in the memory by replacing the previously stored intermediate frame. This enables feeding the subsequent frame with the next application window surfaces from the memory to the available hardware layers for composition. Further, the latest composited frame may be at disposal for other purposes. In a further implementation of the first aspect, feeding the intermediate frame and data of the selected at least one previously non-selected application window surface to the available hardware layers comprises, when the number of the remaining non-selected application window surfaces is equal or exceeds the number of the hardware layers, feeding each of the available hardware layers with one of the previously non-selected application window surfaces or the intermediate frame. This enables utilizing the display subsystem hardware capabilities optimally in the composition procedure by using each available hardware layer also when aggregating the resulted intermediate frame with the next application window surfaces not yet used in the composition procedure. In a further implementation of the first aspect, when the number of the remaining non-selected application window surfaces is equal or exceeds the number of the hardware layers, the subsequent frame is used as the intermediate frame and the method further comprises the following sequence at least once: selecting data of at least one previously non-selected application window surface stored in the memory; feeding the intermediate frame and data of the selected at least one previously non-selected application window surface to the available hardware layers; and compositing a subsequent frame by the compositor based on the contents of the fed hardware layers. This enables display content generation by sequentially compositing the previously non-selected application window surfaces with the resulted frame of the previous composition. In a further implementation of the first aspect, selecting data of the at least one previously non-selected application window surface comprises selecting all of the remaining non-selected application window surfaces when the number of the remaining non-selected application window surfaces is smaller than the number of available hardware layers. This enables using an optimal amount of composition rounds for compositing the application window surfaces. In a further implementation of the first aspect, the subsequent frame comprises a final frame, and the method further comprises causing transmission of the final frame to at least one of at least one display connector, at least one external connector and a virtual display. This enables sending the resulted combined view of all running applications to, for example, a primary display and other peripherals. According to a second aspect, there is provided an apparatus for display contents generation. The apparatus comprises a memory configured to store data of multiple application window surfaces; a display subsystem comprising hardware layers and a compositor; wherein the apparatus is configured to select data of multiple application window surfaces stored in the memory, wherein an initial number of the application window surfaces exceeds the number of available hardware layers of a display subsystem; feed data of the selected multiple window surfaces to the available hardware layers; composite an intermediate frame by the compositor based on the contents of the fed hardware layers; select data of at least one previously non-selected application window surface stored in the memory; feed the intermediate frame and data of the selected at least one previously non-selected application window surface to the available hardware layers; and composite a subsequent frame by the compositor based on the contents of the fed hardware layers. This enables display contents generation by performing a composition procedure using only the display subsystem sequentially even when the number of application window surfaces to be composited exceeds the number of available hardware layers in the display subsystem. Thus, by using only the display subsystem this also decreases the load of other hardware resources. Further, a solution is provided in which a graphical processing unit (GPU) will be available for applications to render their content for the next frame while a previous frame composition is still ongoing, thus enabling asynchronous composition and GPU offloading. This may also improve overall system performance. In an implementation of the second aspect, an initial number of the selected application window surfaces corresponds to the number of the available hardware layers. This enables utilizing the hardware capabilities optimally for composition. In a further implementation of the second aspect, the apparatus is configured to store the intermediate frame in the memory. This enables feeding the intermediate frame with the next application window surfaces from the memory to the available hardware layers for composition. Further, the intermediate frame may be at disposal for other purposes. In a further implementation of the second aspect, the apparatus is configured to store the subsequent frame in the memory by replacing the previously stored intermediate frame. This enables feeding the intermediate frame with the next application window surfaces from the memory to the available hardware layers for composition. Further, the latest composited frame may be at disposal for other purposes. In a further implementation of the second aspect, when feeding the intermediate frame and data of the selected at least one previously non-selected application window surface to the available hardware layers, the apparatus is configured to, when the number of the remaining non-selected application window surfaces is equal or exceeds the number of the hardware layers, feed each of the available hardware layers with one of the previously non-selected application window surfaces or the intermediate frame. This enables utilizing the display subsystem hardware capabilities optimally in the composition procedure by using each available hardware layer also when aggregating the resulted intermediate frame with the next application window surfaces not yet used in the composition procedure. In a further implementation of the second aspect, when the number of the remaining non-selected application window surfaces is equal or exceeds the number of the hardware layers, the subsequent frame is used as the intermediate frame and the wherein the apparatus is further configured to perform the following sequence at least once: select data of at least one previously non-selected application window surface stored in the memory; feed the intermediate frame and data of the selected at least one previously non-selected application window surface to the available hardware layers; and composite a subsequent frame by the compositor based on the contents of the fed hardware layers. This enables display content generation by sequentially compositing the previously non-selected application window surfaces with the resulted frame of the previous composition. In a further implementation of the second aspect, when selecting data of the at least one previously non-selected application window surface, the apparatus is configured to select all of the remaining non-selected application window surfaces when the number of the remaining non-selected application window surfaces is smaller than the number of available hardware layers. This enables using an optimal amount of composition rounds for compositing the application window surfaces. In a further implementation of the second aspect, the subsequent frame comprises a final frame, and the apparatus is configured to cause transmission of the final frame to at least one of at least one display connector, at least one external connector and a virtual display. This enables sending the resulted combined view of all running applications to, for example, a primary display and other peripherals. According to a third aspect, there is provided a computer program comprising program code which when executed by a processor, causes the processor to perform the method according to the first aspect. This enables display contents generation by performing a composition procedure using only the display subsystem sequentially even when the number of application window surfaces to be composited exceeds the number of available hardware layers in the display subsystem. Thus, by using only the display subsystem this also decreases load of other hardware resources. Further, a solution is provided in which a graphical processing unit (GPU) will be available for applications to render their content for the next frame while a previous frame composition is still ongoing, thus enabling asynchronous composition and GPU offloading. This may also improve overall system performance. According to a fourth aspect, there is provided a computing device comprising the apparatus according to the second aspect. This enables display contents generation by performing a composition procedure using only the display subsystem sequentially even when the number of application window surfaces to be composited exceeds the number of available hardware layers in the display subsystem. Thus, by using only the display subsystem this also decreases load of other hardware resources. Further, a solution is provided in which a graphical processing unit (GPU) will be available for applications to render their content for the next frame while a previous frame composition is still ongoing, thus enabling asynchronous composition and GPU offloading. This may also improve overall system performance.

11410126

TECHNICAL FIELD Aspects of the present disclosure relate to an electronic platform for distribution and inventory management of wearable items and, more particularly, to dynamically managing electronic data associated with dynamic allocations of articles, such as wearable items. BACKGROUND Services for providing articles, including electronically-presented services, typically adhere to an established, conventional structure. In these services, entities such as retailers design and manufacture, or otherwise obtain, a series of products that are offered for purchase. In the example of wearable articles including garments, a group of products can be offered for a period of time, such as a season, after which the articles are offered at a reduced price. Entities offering articles via one or more electronic destinations, such as a website, employ conventional allocation strategies, allotting each individual article to a particular purpose. For example, articles are allocated for purchase so that when stock of a particular article is exhausted, the website can be updated appropriately. When a large number of articles are present (e.g., unsold) after a period of time, the website or other electronic destination can be updated with a reduced price to encourage selection of these articles. Each article, and often the electronic destination itself, is typically dedicated to a specific purpose, such as one-time purchases, auction-style purchases, rentals, etc. While article subscriptions have recently experienced increased visibility and market importance, there are circumstances where a one-time rental system is desirable. However, implementing new systems to enable a new service, presents numerous technical challenges that involve significant design efforts and infrastructure to support new inventory systems, user experience design, cost structure, and others. Thus, conventional systems lack the capabilities to flexibly and dynamically link a plurality of service types (e.g., one-time purchases, one-time rentals, and/or subscription services), identify different users across these services, and facilitate interactions between different types of entities involved in management of these services. Additionally, while operating one of these services involves the generation and tracking of vast amounts of information that may be useful for monitoring storefront performance, service-type performance, article performance, etc., this information is generated and stored by individual entities and/or for an individual service. Thus, the ability to dynamically monitor, update, and analyze this information is limited. The background description provided herein is for the purpose of generally presenting the context of the disclosure. Unless otherwise indicated herein, the materials described in this section are not prior art to the claims in this application and are not admitted to be prior art, or suggestions of the prior art, by inclusion in this section. SUMMARY OF THE DISCLOSURE According to certain aspects of the disclosure, systems and methods are disclosed for dynamically managing electronic data associated with a plurality of services, such as services associated with wearable items or other articles offered by a plurality of entities, including entities having different roles (e.g., hosting entities, fulfiller entities, and others). In one aspect, a computer-implemented method for managing data associated with electronic inventory management of wearable articles may include receiving, by one or more processors, wearable article data from one or more electronic interfaces, the wearable article data describing wearable articles made available for physical shipment to users via electronic interactions, wherein the one or more electronic interfaces are accessible over one or more networks. The method may include assigning, by the one or more processors, a category to one or more wearable articles described in the wearable article data, the category being selected from a plurality of categories including a first category for selection by a first plurality of users and a second category for selection by a second plurality of users, the category being stored as categorization assignment data. The method may also include monitoring, by the one or more processors, availability data included in the wearable article data for one or more wearable articles, the availability data indicating an availability of one or more wearable articles for selection by one or more users interacting with a first electronic storefront, an availability of the one or more articles for selection by one or more users interacting with a second electronic storefront, or both, and in response to receiving one or more user selections via the first electronic storefront, the second electronic storefront, or both, initiating one or more services to facilitate physical shipment of a first wearable article. In another aspect, a computer system for managing data associated with electronic inventory management of wearable articles may include a memory having processor-readable instructions stored therein and one or more processors configured to access the memory and execute the processor-readable instructions. The processor-readable instructions, when executed by the one or more processors may configure the one or more processors to perform a plurality of functions. The functions may include functions for receiving, by the one or more processors, wearable article data from one or more electronic interfaces, the wearable article data describing wearable articles made available for physical shipment to users via electronic interactions, wherein the one or more electronic interfaces are accessible over one or more networks, and assigning, by the one or more processors, a category to one or more wearable articles described in the wearable article data, the category being selected from a plurality of categories including a first category for selection by a first plurality of users and a second category for selection by a second plurality of users. The functions may further include functions for monitoring, by the one or more processors, availability data included in the wearable article data for one or more wearable articles, the availability data indicating an availability of one or more wearable articles for selection by one or more users interacting with a first electronic storefront, an availability of the one or more articles for selection by one or more users interacting with a second electronic storefront, or both, and in response to receiving one or more user selections via the first electronic storefront, the second electronic storefront, or both, initiating one or more services to facilitate physical shipment of a first wearable article. In yet another aspect, a non-transitory computer-readable medium may contain instructions for performing functions for managing data associated with electronic inventory management of wearable articles. The functions may include receiving wearable article data from one or more electronic interfaces, the wearable article data describing wearable articles made available for physical shipment to users via electronic interactions, wherein the one or more electronic interfaces are accessible over one or more networks, and assigning a category to one or more wearable articles described in the wearable article data, the category being selected from a plurality of categories including a first category for selection by a first plurality of users and a second category for selection by a second plurality of users, the category being stored as categorization assignment data. The functions may further include monitoring availability data included in the wearable article data for one or more wearable articles, the availability data indicating an availability of one or more wearable articles for selection by one or more users interacting with a first electronic storefront, an availability of the one or more articles for selection by one or more users interacting with a second electronic storefront, or both, and in response to receiving one or more user selections via the first electronic storefront, the second electronic storefront, or both, initiating one or more services to facilitate physical shipment of a first wearable article.

11530940

BACKGROUND Various types of vehicles have body components that perform operations not directly associated with the operations of the engine, drive components, or other components that enable the translational movement of the vehicle from one location to another. For example, a moveable crane includes body components that operate to grasp, lift, lower, and otherwise move objects, a cement truck includes body components that operate to mix and pour cement, and a refuse vehicle (e.g., garbage truck) includes body components that may operate to collect and transport refuse. Such vehicles consume fuel to perform the operations of the body components, as well as to move the vehicle between locations. SUMMARY Implementations of the present disclosure are generally directed to determining vehicle fuel consumption that is due to operations of body components of the vehicle. More particularly, implementations of the present disclosure are directed to collecting sensor data that measures the state and/or activity of body components of a vehicle, and/or sensor data that describes the location, velocity, and/or acceleration of the vehicle, and using the sensor data to identify a portion of the vehicle's fuel consumption that is due the operations of body components and that is not directly the result of moving the vehicle between locations. In general, innovative aspects of the subject matter described in this specification can be embodied in methods that include actions of: receiving sensor data describing at least one operation that is performed during a time period by at least one body component of a vehicle, wherein the at least one body component does not provide translational movement of the vehicle between locations; analyzing the sensor data to determine a first amount of fuel that is consumed by the vehicle, during the time period, to perform the at least one operation of the at least one body component; calculating a second amount of fuel as a difference between the first amount and a total amount of fuel consumed by the vehicle during the time period; and providing fuel consumption information that at least describes the second amount of fuel that is consumed by the vehicle during the time period. These and other implementations can each optionally include one or more of the following innovative features: the vehicle is a garbage collection vehicle; the at least one body component performs the at least one operation to collect garbage; the at least one operation includes a power take off (PTO) operation to provide power, from an engine of the vehicle, to operate the at least one body component; the actions further include receiving location data describing at least one location of the vehicle during the time period; the actions further include correlating the location data with map information indicating that the at least one location is private; the actions further include modifying the second amount of fuel to subtract fuel consumed by the vehicle while at the at least one private location; determining the first amount of fuel further includes determining, based on the sensor data, an amount of time that each of the at least one body component is operated during the time period, determining an amount of power expended to operate each of the at least one body component based at least partly on the respective amount of time, and determining the first amount of fuel based on the amount of power expended to operate each of the at least one body component; the amount of power expended to operate each of the at least one body component is further based on at least one environmental condition at a location of the vehicle; the at least one environment condition includes one or more of an air temperature, an air pressure, an altitude, a wind condition, and a precipitation condition; and/or determining the amount of power expended to operate each of the at least one body component is further based on previously determined power expenditure information that describes the power to operate the respective body component. Other implementations of any of the above aspects include corresponding systems, apparatus, and computer programs that are configured to perform the actions of the methods, encoded on computer storage devices. The present disclosure also provides a computer-readable storage medium coupled to one or more processors and having instructions stored thereon which, when executed by the one or more processors, cause the one or more processors to perform operations in accordance with implementations of the methods provided herein. The present disclosure further provides a system for implementing the methods provided herein. The system includes one or more processors, and a computer-readable storage medium coupled to the one or more processors having instructions stored thereon which, when executed by the one or more processors, cause the one or more processors to perform operations in accordance with implementations of the methods provided herein. It is appreciated that aspects and features in accordance with the present disclosure can include any combination of the aspects and features described herein. That is, aspects and features in accordance with the present disclosure are not limited to the combinations of aspects and features specifically described herein, but also include any combination of the aspects and features provided. The details of one or more implementations of the present disclosure are set forth in the accompanying drawings and the description below. Other features and advantages of the present disclosure will be apparent from the description and drawings, and from the claims.

11430484

FIELD This disclosure relates to an interface for indicating video editing decisions. BACKGROUND A video application may automatically generate a video edit from video clips. It may be desirable to provide to users with information on how the video edit was generated. SUMMARY This disclosure relates to an interface for indicating video editing decisions. Video edit information and/or other information may be obtained. The video edit information may define a video edit of a video. The video may have a progress length. The video edit of the video may include one or more segments of the video that have been selected for inclusion in the video edit. A graphical user interface may be presented on a display. The graphical user interface may include interface elements that convey information relating to the video edit. The interface elements may include a timeline element that represents the progress length of the video. The interface elements may include one or more inclusion elements that visually indicate the segment(s) of the video that have been selected for inclusion in the video edit. A system that presents an interface for indicating video editing decisions may include one or more electronic storage, processor, and/or other components. The electronic storage may store video edit information, information relating to one or more video edits, information relating to one or more graphical user interfaces, information relating to one or more interface elements, and/or other information. The processor(s) may be configured by machine-readable instructions. Executing the machine-readable instructions may cause the processor(s) to facilitate presenting an interface for indicating video editing decisions. The machine-readable instructions may include one or more computer program components. The computer program components may include one or more of a video edit information component, a graphical user interface component, and/or other computer program components. The video edit information component may be configured to obtain video edit information and/or other information. The video edit information may define a video edit of a video. The video may have a progress length. The video edit of the video may include one or more segments of the video that have been selected for inclusion in the video edit. In some implementations, the segment(s) of the video that have been selected for inclusion in the video edit may include an automatically selected segment of the video. In some implementations, the segment(s) of the video that have been selected for inclusion in the video edit may include a manually selected segment of the video. The graphical user interface component may be configured to present a graphical user interface on a display. The graphical user interface may include interface elements that convey information relating to the video edit. The interface elements may include a timeline element that represents the progress length of the video. The interface elements may include one or more inclusion elements that visually indicate the segment(s) of the video that have been selected for inclusion in the video edit. In some implementations, the inclusion element(s) may include an automatic inclusion element that visually indicates an automatically selected segment of the video. In some implementations, the inclusion element(s) may include a manual inclusion element that visually indicates a manually selected segment of the video. In some implementations, the graphical user interface may further include an automatic selection element. The automatic selection element may enable a user to turn on or turn off automatic selection of video segments for inclusion in the video edit. One or more automatic inclusion elements may disappear responsive to the user turning off the automatic selection of video segments for inclusion in the video edit via user interaction with the automatic selection element. In some implementations, a manual inclusion element may include one or more shoulder elements. Individual shoulder element may visually represent a portion of the video that has not been manually selected for inclusion in the video edit. Individual shoulder element may visually represent a portion of the video that have been automatically selected for inclusion in the video edit to maintain synchronization between the manually selected segment of the video with a music of the video edit. In some implementations, the graphical user interface may further include a music-synchronization element. The music-synchronization element may enable a user to turn on or turn off synchronization between the music of the video edit and the segment(s) of the video that have been selected for inclusion in the video edit. In some implementations, a manual inclusion element may include shoulder element(s) based on the synchronization between the music of the video edit and the segment(s) of the video that have been selected for inclusion in the video edit being turned on. The shoulder element(s) may disappear responsive to the user turning off the synchronization between the music of the video edit and the segment(s) of the video that have been selected for inclusion in the video edit via user interaction with the music-synchronization element. In some implementations, an automatic inclusion element may not include any shoulder elements regardless of whether the synchronization between the music of the video edit and the segment(s) of the video that have been selected for inclusion in the video edit is turned on or turned off. In some implementations, the graphical user interface may enable user interaction with an automatic inclusion element to change an automatically selected segment of the video. Responsive to the user interaction with the automatic inclusion element to change the automatically selected segment of the video: the automatically selected segment of the video may change into a manually selected segment of the video, and the automatic inclusion element may change into a manual inclusion element that visually indicates the manually selected segment of the video. These and other objects, features, and characteristics of the system and/or method disclosed herein, as well as the methods of operation and functions of the related elements of structure and the combination of parts and economies of manufacture, will become more apparent upon consideration of the following description and the appended claims with reference to the accompanying drawings, all of which form a part of this specification, wherein like reference numerals designate corresponding parts in the various figures. It is to be expressly understood, however, that the drawings are for the purpose of illustration and description only and are not intended as a definition of the limits of the invention. As used in the specification and in the claims, the singular form of “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise.

11521207

BACKGROUND With the increasing ubiquity of online merchants and other types of electronic transactions, the need for secure, efficient tokenization has grown substantially. Tokenization provides merchants or other parties to transactions with tokens that can be used to initiate a transaction with a customer's account without exposing the customer's vulnerable account information to identity theft or other types of fraud. Major merchants that perform substantial quantities of electronic transactions may request the generation millions of tokens from token generation entities, such as payment networks, placing a significant processing load on the payment networks and other parties, such as issuers associated with the account information being tokenized. While it is not ideal, payment networks may be forced to substantially limit the number of tokenization requests that they accept from such merchants at a time, which introduces additional complexity into the systems of the merchants and the payment network and negatively affects the rate at which the tokenization requests can be processed. Further limitations in the rate of handling the requests may also be necessary based on the capabilities or limitations of the issuers associated with the tokenization requests. SUMMARY This Summary is provided to introduce a selection of concepts in a simplified form that are further described below in the Detailed Description. This Summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used as an aid in determining the scope of the claimed subject matter. A computerized method for handling tokenization requests associated with electronic transactions at a payment network at a throttled processing rate is described. Tokenization requests are received by one or more tokenization stream brokers in a request stream layer via tokenization request input interfaces from one or more request sources. The tokenization requests include primary account numbers (PANs) to be tokenized. The tokenization requests are then consumed by a request handler from the one or more tokenization stream brokers via request consumer interfaces, at a request storage rate, for storage in a request data store. Tokenization operations are then performed by a request processing service, at a request processing rate, based on the tokenization requests stored in the request data store. The tokenization operations include providing at least the PANs to be tokenized to one or more issuers associated with the tokenization requests at issuer tokenization rates associated with the one or more issuers, whereby the request processing rate is throttled for compatibility with capabilities of the system and the one or more issuers.

11397508

BACKGROUND The market for virtual experiences has vastly increased in recent years. Virtual experience systems allow users to explore virtual spaces. Some virtual experience systems rely on a head-mounted display (HMD) worn by participants and through which the participants visually experience a virtual experience environment.

11493655

BACKGROUND 143 million Americans live in areas of significant seismic risk across 39 states, especially California and the U.S. Pacific Northwest (PNW). In the next 30 years, California has a 99.7% chance of a magnitude 6.7+ earthquake, and the PNW has a 10% chance of a potentially devastating magnitude 8 to 9 megathrust quake in the Cascadia Subduction Zone. Potential quakes in the Seattle, Tacoma, and South Whidbey Island Faults, for example, hold additional risk to approximately 4.3 million people. FEMA estimates the average annualized loss from earthquakes to be $5.3 billion. However, depending on the type and location, the immediate, localized impact of any large seismic event may be much, much more. For example, the earthquake-caused economic cost just from water loss in Seattle, Tacoma, and Everett systems is estimated to be $1.4 billion (from a quake in the shallow Tacoma Fault) to $2.1 billion (Seattle Fault). Oregon estimates up to $32 billion in potential economic damage from a Cascadia quake.

11305116

BACKGROUND Embodiments of the inventive concept described herein relate to a current monitoring apparatus that monitors the amount of current actually flowing to a user's skin for each partitioned area while electrical stimulation is performed, when applying electrical stimulation to a user using an electrical stimulation apparatus, and an electrical stimulation apparatus including the same. The technology of brain electrical stimulation using transcranial electrical stimulation may be known to be effective in improving cognitive ability and treating mental illnesses such as depression and Attention Deficit Hyperactivity Disorder (ADHD). When the technology of brain electrical stimulation is available in everyday life, the technology may improve the brain function of a user and may treat continuous mental illness by activating or suppressing the connection between neurons. SUMMARY However, according to the conventional electrical stimulation apparatus, the electrical stimulation may be applied to a user based on a preset current value. However, information about how much the current amount is actually transmitted to the user may not be obtained while the electrical stimulation is applied to the user. Accordingly, in the case where the conventional electrical stimulation apparatus is used, even though the large amount of current is instantaneously transmitted to the user due to the unexpected problem of an electrical stimulation apparatus, the user may not recognize and respond to the situation. In some cases, the problem of the safety accident may occur, for example, the case where the user's skin is burnt. Embodiments of the inventive concept provide a current monitoring apparatus that is capable of preventing the safety accident of a user by monitoring the amount of current actually flowing to the user's skin for each partitioned area to determine whether there is a problem in electrical stimulation when the electrical stimulation is applied to the user by using an electrical stimulation apparatus, and an electrical stimulation apparatus including the same. Embodiments of the inventive concept provide a current monitoring apparatus that is capable of adjusting the amount of current flowing to the user's skin when the amount of current actually flowing to the user's skin differs from a predetermined reference value, and an electrical stimulation apparatus including the same. The technical problems to be solved by the present inventive concept are not limited to the aforementioned problems, and any other technical problems not mentioned herein will be clearly understood from the following description by those skilled in the art to which the inventive concept pertains. According to an exemplary embodiment, an electrical stimulation apparatus includes an electrode module receiving current for applying electrical stimulation to a skin of a user from a current providing part, a plurality of monitoring electrodes positioned spaced apart from each other on the electrode module, and a current monitoring part monitoring the current flowing to each of the plurality of monitoring electrodes. The current flows from the electrode module to the plurality of monitoring electrodes. According to another exemplary embodiment, an electrical stimulation apparatus includes an electrode module receiving current for applying electrical stimulation to a skin of a user from a current providing part, a patch formed on the electrode module, and a current monitoring part monitoring the current transmitted the skin of the user through each area with respect to a plurality of areas on the patch. The patch contacts the skin of the user when the user wears the electrical stimulation apparatus. According to another exemplary embodiment, a current monitoring apparatus mounted on an electrode module of an electrical stimulation apparatus and monitoring current flowing to a skin of a user by the electrical stimulation apparatus includes a plurality of monitoring electrodes positioned spaced apart from each other on the electrode module and a current monitoring part monitoring the current flowing to each of the plurality of monitoring electrodes. The current is transmitted to the user from the electrode module to the plurality of monitoring electrodes.

11264834

TECHNICAL FIELD The present disclosure relates to a coil apparatus. BACKGROUND ART Conventionally, a coil apparatus including a base included in an installation surface, a coil portion disposed on a front surface side of the base, and a cover attached to the base to cover the coil portion has been known as a coil apparatus (for example, Patent Document 1). Each of both ends of the coil portion is connected to a conductive wire. CITATION LIST Patent Literature Patent Document 1: International Publication No. 2012/039077 SUMMARY Technical Problem In the coil apparatus described above, a conductive wire drawn out from the coil apparatus on the front surface side of the base is led to the outside of the coil apparatus. Therefore, electromagnetic field radiation is generated around the conductive wire on the front surface side of the base. However, considering an influence of electromagnetic field radiation on the surrounding environment, it is desirable to reduce electromagnetic field radiation on the front surface side of the base. In this regard, the disclosure describes a coil apparatus capable of reducing electromagnetic field radiation on a front surface side of a base. Solution to Problem A coil apparatus according to an aspect of the disclosure includes a base having a front surface and a rear surface, a magnetic portion provided on a side of the front surface of the base, and a coil portion provided on an opposite side from the base with respect to the magnetic portion, the coil portion including a conductive wire, wherein the magnetic portion includes a first passing region, the base includes a second passing region, and the conductive wire is drawn out from the rear surface of the base through the first passing region and the second passing region. Effects According to an aspect of the disclosure, it is possible to provide a coil apparatus capable of reducing electromagnetic field radiation on a front surface side of a base.

11329178

CROSS-REFERENCE TO PRIOR APPLICATION Priority is claimed to European Patent Application No. EP 19154003.8, filed on Jan. 28, 2019, the entire disclosure of which is hereby incorporated by reference herein. FIELD The invention relates to a solar panel with a double-glass photovoltaic module and to a photovoltaic power station. BACKGROUND Single-glass photovoltaic modules are widely known in the art. In this kind of photovoltaic module, the solar cells are encapsulated between protective films, such as ethylene vinyl acetate (EVA) films, and further protected by a highly transparent front glass sheet of several millimeter thickness, and an electrically insulating flexible foil on the rear side. The laminate is typically mounted to a metal frame. The frame provides mechanical stabilization and edge protection for the laminate. Thus, with this type of photovoltaic module, the laminate or stack comprising the front glass sheet, the solar cells, and the protective backside film are together mounted in the frame to form a solar panel. In recent years, manufacturers have increasingly pushed the use of double-glass photovoltaic modules. In this type of photovoltaic modules, the solar cells are embedded between two glass sheets, namely, a front glass sheet and a rear glass sheet. An encapsulation of the solar cells by encapsulating films is typically also used. For so-called “bifacial solar cells” double-glass photovoltaic modules allow increasing the active surface area for generating electrical power by additionally using the rear side of the solar cells for electrical power generation. Furthermore, due to the increased mechanical stability of this design in comparison to single-glass modules, mechanical stabilization by a frame is per se not a requirement for double-glass photovoltaic modules. However, a double-glass photovoltaic module is sensitive to receiving damage on the edges of the glass sheets due to improper mechanical handling during transport, installation and maintenance, possibly even resulting in breakage and therefore complete failure of the photovoltaic module. SUMMARY In an embodiment, the present invention provides a solar panel comprising a double-glass photovoltaic module mounted in a frame. The double-glass photovoltaic module comprises a plurality of solar cells embedded between a front glass sheet, which is to be arranged facing towards the sun in operation of the solar panel, and a rear glass sheet. The rear glass sheet exhibits a larger extension than the front glass sheet, in at least two spatial directions, as measured in a plane of the rear glass sheet plane. The frame comprises a clamping element clamping only the rear glass sheet and not the front glass sheet of the double-glass photovoltaic module. The front glass sheet is either flush with a reference plane defined by inner edges of a front face of the frame or protrudes beyond the front face of the frame.

11429273

RIGHTS OF THE GOVERNMENT The invention described herein may be manufactured and used by or for the Government of the United States for all governmental purposes without the payment of any royalty. FIELD OF THE INVENTION The present invention relates generally to tracking systems and, more particularly, to tracking systems which utilize a variety of inputs and Bayesian probability algorithm. BACKGROUND OF THE INVENTION Target tracking in an unobstructed area such as air, sea and open landscape is well understood and is a relatively well established art. Hard data input from information sources such as cameras or other sensors are used and are frequently sufficient and reliable. Target determination and tracking in a complex environment having multiple obstructions, features, or obstacles, e.g. an urban environment, poses a different set of challenges. Currently, tracking in an urban environment includes communication of human observations via radios, and requires the ability to “see” and understand the entire target area. Urban, “busy”, or other complex areas present issues such as buildings of various sizes, moving people, moving vehicles, and a mixture of materials that may or may not allow the penetration of radio signals. Line of sight is frequently obstructed and can lead to the inability to obtain and analyze the whole target scenario. Human observation and input is absolutely necessary in these environments but the fusion and integration of hard data and soft data is a difficult issue. The output of the combined data in a readable usable format is also an issue. SUMMARY OF THE INVENTION The present invention overcomes the foregoing problems and other shortcomings, drawbacks, and challenges of tracking targets in busy or complex environments. While the invention will be described in connection with certain embodiments, it will be understood that the invention is not limited to these embodiments. To the contrary, this invention includes all alternatives, modifications, and equivalents as may be included within the spirit and scope of the present invention. The system fuses information from human sources (soft data) with information from automated sensors or machines (hard data) in a manner that autonomous agents or other humans can easily comprehend, and that is flexible as to a wide variety of target types, environments, and human variability. According to one embodiment of the present invention, a touch-based tracking method comprises: starting a GUI which displays an environment; observing at least one of the presence or absence of one or more targets in relation to features in the environment; when an observation is made, reporting the observation through the GUI to form an input; reporting the observation in the GUI with a hand gesture; applying an algorithm to convert the input into a probability distribution; and updating a target state estimate and alters the environment display. According to a first variation of the invention, the environment is an area or a map. According to another variation of the invention, the map includes a plurality of features. According to a further variation of the invention, the plurality of features of the map includes at least one of roads, building structures, forest, and water. According to another variation of the invention, the observation indicates the presence or non-presence of the one or more targets. According to a further variation of the invention, the method further comprises selecting the type of report to be made. According to another variation of the invention, the type of report is selected from detection reports and or non-detection reports. According to a further variation of the invention, the hand gesture is made on the map. According to another variation of the invention, the hand gesture is made by a swiping motion with one or more fingers on the GUI. According to a further variation of the invention, the hand gesture indicates the strength of the observation. According to another variation of the invention, the GUI is sensitive to the pressure of the swiping motion. According to a further variation of the invention, the algorithm determines a probability of a location of the one or more targets using Bayes' Rule. According to another variation of the invention, the step of updating a target state estimate includes observing the at least one of the presence or absence of the one or more targets in the environment and adjusting a particle distribution. According to another embodiment of the invention, a predictive tracking method comprises: populating a filter with information regarding the likely location of a target with a plurality of particles, wherein each particle corresponds to a position estimate for the target; selecting a few particles in the filter that correspond to a best estimate of the target's location; and running a time-update equation of a Bayesian filter recursively forward in time N steps for each selected particle to derive path predictions of where these particles will evolve in the N time steps. According to a further variation of the invention, the predictive tracking method further comprises combining two or more of the path predictions into average predicted trajectories. According to another variation of the invention, the predictive tracking method further comprises: when there are a finite set of goal states corresponding to one of M locations, counting how many of the path predictions terminate in each of the M locations; dividing the number of path predictions terminating in the ithlocation by the total number of path predictions to yield an estimate of a current probability that the target's goal is the ithlocation. Additional objects, advantages, and novel features of the invention will be set forth in part in the description which follows, and in part will become apparent to those skilled in the art upon examination of the following or may be learned by practice of the invention. The objects and advantages of the invention may be realized and attained by means of the instrumentalities and combinations particularly pointed out in the appended claims.

11524783

FIELD OF THE INVENTION The present invention concerns a method for disinfecting a vehicle cabin using a lighting assembly. The present invention also provides a lighting assembly for disinfecting a vehicle cabin. The vehicle cabin may be an aircraft cabin, a train cabin, a boat cabin, or the like. DESCRIPTION OF THE BACKGROUND AND RELATED ART As should be apparent to those skilled in the art, the interior of a vehicle, such as an aircraft, experiences continuous use during its operational lifetime. This means that the vehicle receives thousands of passengers during its operational lifetime. To keep the vehicle cabin clean, vehicle operators typically employ teams of workers to clean and sanitize the surfaces in the vehicle cabin. In recent years, a desire has developed for improved methods and devices to assist with sanitizing and cleaning vehicle cabins. This includes an increased desire to disinfect the surfaces in the vehicle cabin to reduce the potential for the spread of germs. SUMMARY OF THE INVENTION The present invention addresses one or more of the deficiencies with respect to the prior art. In particular, the present invention provides a lighting assembly for an aircraft that includes a visible light source generating visible light and an ultraviolet light source generating ultraviolet light. The visible light source is disposed adjacent to the ultraviolet light source. The visible light source illuminates a first illumination area with the visible light when the lighting assembly operates in a first operation mode. The ultraviolet light source illuminates a second illumination area with the ultraviolet light when the lighting assembly operates in a second mode of operation. The first illumination area substantially overlaps the second illumination area. It is contemplated that, in at least one embodiment, the visible light source and the ultraviolet light source are disposed on a single substrate. The visible light source may encompass a plurality of visible light generators. A further embodiment contemplates that the plurality of visible light generators are LEDs. Still further, in one embodiment, the ultraviolet light source may include a plurality of ultraviolet light generators. The plurality of ultraviolet light generators may be LEDs. A first number of the plurality of visible light generators is contemplated to be greater than or equal to a second number of the plurality of ultraviolet light generators. The lighting assembly also may include a controller connected to the lighting assembly to control operation of the visible light source and the ultraviolet light source. In addition, it is contemplated that the lighting assembly may have a first sensor connected to the controller to detect when a door to the aircraft is closed and generate a first input signal for the controller. A second sensor may be provided to detect the absence of a person in the aircraft and generate a second input for the controller. The second sensor may be a motion sensor. In another contemplated embodiment, the controller may be operatively connected to a management system and receive a third input from the management system indicating that the aircraft is parked. It is also contemplated that the controller may be connected to a plurality of window shades and close the window shades when the ultraviolet light source operates in the second mode of operation. In addition, the controller may be connected to a plurality of seats and position the seats in a configuration so that the seats are bathed in the ultraviolet light when the ultraviolet light source operates in the second mode of operation. The present invention also encompasses a method of operating a lighting assembly that includes a visible light source generating visible light, an ultraviolet light source generating ultraviolet light, a controller connected to the lighting assembly to control operation of the visible light source and the ultraviolet light source, a first sensor connected to the controller to detect when a door to the aircraft is closed and generate a first input, and a second sensor to detect the absence of a person in the aircraft and generate a second input, wherein the visible light source is disposed adjacent to the ultraviolet light source, wherein the visible light source illuminates a first illumination area with the visible light when the lighting assembly operates in a first operation mode, and wherein the ultraviolet light source illuminates a second illumination area with the ultraviolet light when the lighting assembly operates in a second mode of operation, and wherein the controller is operatively connected to a management system and receives a third input from the management system indicating that the aircraft is parked. The method includes receiving, by the controller, the first input, receiving, by the controller, the second input, receiving, by the controller, the third input, and initiating the second operation mode after receipt of the first input, the second input, and the third input. It is contemplated that the controller also may be connected to a plurality of window shades. If so, the method also includes closing, by the controller, the window shades when the ultraviolet light source operates in the second mode of operation. Still further, the controller may be connected to a plurality of seats. If so, the method may position the seats in a configuration so that the seats are bathed in the ultraviolet light when the ultraviolet light source operates in the second mode of operation. In addition, the method may include positioning the seats in a configuration so that the seats are bathed in the ultraviolet light when the ultraviolet light source operates in the second mode of operation. The method is contemplated to include an operation for checking periodically, by the controller, the first input, the second input, and the third input. Upon failure of receipt of at least one of the first input, the second input, or the third input the controller may stop the second operation mode. Further aspects of the present invention will be made apparent from the paragraphs that follow.

11314794

TECHNICAL FIELD The disclosure relates in general to a system and a method for adaptively adjusting related search words. BACKGROUND When providing the search result of a search word to the user, the advanced search system normally provides other search words related to the search word for the user to quickly clarify his/her inquiry target due to the following reasons. Firstly, the user is rarely able to accurately describe his/her search intent using limited search words. Secondly, the search word or the search target given by the user may have veracious descriptions or meanings, such that the vocabularies used by the user do not match that used in the text. Thirdly, the user may have insufficient or incorrect understanding of the search target and therefore may use incorrect search words. Lastly, the user may have typos due to homonyms or different words with similar pronunciation. Generally, methods for retrieving related search words can be classified as content-based and log-based according to the difference of data sources. Content-based approaches focus on the content of indexed text, while log-based ones exploit historical search logs. At the initial stage when the search system is on line, the method based on the content of indexed text can immediately provide a recommendation list of related search words according to the correlation analysis of the words in the content of indexed text. However, the method based on the content of indexed text can only provide recommendation according to the fixed content of the text but cannot analyze and predict the user's search intent according to the historical search logs accumulated in the late stage. Conversely, the method based on historical search logs can predict the user's search intent according to the accumulated user data to obtain a better recommendation list of related search words, but cannot immediately provide recommendation at the initial stage. The method based on historical search logs needs to be used over a long period of time to accumulate a sufficient number of historical user data which can be used as a basis for the analysis and prediction of the user's search intent. A weight combination method can be obtained by integrating the above two methods through the use of weights, and can provide suitable recommendation of related search words no matter the search system is at the initial stage when historical search logs are unavailable or the search system has accumulated a sufficient number of historical user data at the late stage. However, the weight combination method also has the data source problem of weight combination, and manual setting can hardly achieve the best effect. Normally, a sufficient number of search logs need to be accumulated before the first set of optimum weight combination can be obtained by using statistical models or machine learning approaches. However, the weight combination method still has the learning problem regarding vertical domain conversion. Therefore, the above retrieving technologies are adaptable to the search system at different on-line stages respectively. Since the number of search logs varies at different stages, the search system may not be able to immediately provide suitable recommendation of related search words to the user. Therefore, it has become a prominent task for the industries to resolve the above problems. SUMMARY The disclosure is directed to a system and a method for adaptively adjusting related search words according to the number of search logs accumulated in the system to provide suitable recommendation of related search words to the user. According to one embodiment, a system for adaptively adjusting related search words is provided. The system includes an input device, a search log collection module, a threshold setting module and a process evolution module. The input device receives a user input and generates a search word. The search log collection module determines whether the cumulative search count of the search word is greater than a first threshold or less than a second threshold. The threshold setting module sets the first threshold and the second threshold in terms of the number of search logs. The process evolution module adjusts a search process according to the number of search logs. When the cumulative search count of the search word is greater than the first threshold, the process evolution module finds out at least one historical search word related to the attributes or content of the search word according to a historical search log. When the cumulative search count of the search word is less than the second threshold, the process evolution module performs an initial search process to find out at least one related word related to the attributes or content of the search word from a text. When the cumulative search count of the search word is between the first threshold and the second threshold, the process evolution module optimizes a middle search process to find out at least one related word and/or at least one historical search word that are most related to the attributes or content of the search word from the text and the historical search log. According to another embodiment, a method for adaptively adjusting related search words is provided. The method includes an input process, a search log collection process, a threshold setting process, and a process evolution process. The input process is performed to receive a user input and generate a search word. The search log collection process is performed to determine whether the cumulative search count of the search word is greater than a first threshold or less than a second threshold. The threshold setting process is performed to set the first threshold and the second threshold in terms of the number of search logs. The process evolution process is performed to adjust a search process according to the number of search logs. When the cumulative search count of the search word is greater than the first threshold, at least one historical search word related to the attributes or content of the search word is found out from a historical search log. When the cumulative search count of the search word is less than the second threshold, an initial search process is performed to find out at least one related word related to the attributes or content of the search word from a text. When the cumulative search count of the search word is between the first threshold and the second threshold, a middle search process is optimized and performed to find out at least one related word and/or at least one historical search word that are most related to the attributes or content of the search word from the text and the historical search log. The above and other aspects of the disclosure will become better understood with regard to the following detailed description of the preferred but non-limiting embodiment(s). The following description is made with reference to the accompanying drawings.

11299655

CROSS-REFERENCE TO RELATED APPLICATIONS This application claims, under 35 U.S.C. § 119, the priority of Korean Patent Application No. 10-2018-0162364 filed on Dec. 14, 2018 in the Korean Intellectual Property Office, the disclosure of which is incorporated herein by reference in its entirety. TECHNICAL FIELD The present disclosure relates to a highly dielectric elastic structure and a method for manufacturing the same, more particularly, to a highly dielectric elastic structure which contains a stretchable conductive adhesive as an electrode on a highly dielectric elastic body so as to stably exhibit high dielectric properties of the elastic body, and a method for preparing the same. BACKGROUND In general, polymer materials have superior mechanical stability and processability as compared to other materials. Therefore, they are used as important materials in the modern high-tech industries. In addition, they are used as dielectric materials because various physical properties can be obtained through various molecular design and composition. However, there are limitations in application because their dielectric properties, thermal properties and mechanical properties are weak as compared to ceramic materials. Nevertheless, the polymers are suitable to be applied as elastic electronic materials and are used in touch sensors, highly dielectric (high-k) thin-film gates, elastomer actuators, etc. through composition. Among these, touch sensors are being applied in various fields such as touch screens, wearable devices, robots, smart devices, etc. For a sensor, durability and reliability are important. Also, the function of detecting various force and position at the same time is important. In addition, the touch sensors are drawing a lot of interests in the industry because they can be manufactured at low cost through simple processes. The sensing method by a touch sensor can be classified into resistance type, capacitive type, piezoelectric type, or the like. A capacitive-type touch sensor has the advantage of being able to detect different signals depending on the contact position and contact force, but there is much limitation due to the limitations of the dielectric material. Recently, research and development are made on structural control of the dielectric material and composite structures with the highly dielectric filler in order to solve these problems. However, because of unsatisfactory durability of the electrode and poor adhesion between the elastic dielectric and the electrode, the mechanical stability is unsatisfactory. Therefore, there is a problem that the dielectric properties are not exerted as desired and the reliability is not secured properly. REFERENCES OF RELATED ART Patent Documents Korean Patent Registration No. 10-1819272. SUMMARY The present disclosure is directed to providing a highly dielectric elastic structure, which exhibits stable dielectric properties and improved mechanical stability, by increasing dielectric constant through composition of a polymer dielectric material and a conductive filler such as a carbonaceous material and forming a stretchable conductive adhesive as an electrode on the composited material, and a method for preparing the same. The present disclosure is also directed to solving the problems of electrode destruction that may occur in a touch sensor and decreased dielectric properties caused by poor adhesion between the highly dielectric elastic structure and the electrode, by increasing dielectric constant through composition of a polymer dielectric material and a conductive filler such as a carbonaceous material and forming a stretchable conductive adhesive as an electrode on the composited material, thereby providing a touch sensor capable of exhibiting stable dielectric properties. In an aspect, the present disclosure provides a highly dielectric elastic structure, which contains: a highly dielectric elastic body containing a polymer matrix and a dielectric material dispersed in the polymer matrix; and a stretchable adhesive electrode disposed on the highly dielectric elastic body; wherein the stretchable adhesive electrode contains: a polymer adhesive containing a curable polymer and a curing agent; and a conductive filler containing a metal and a carbonaceous material dispersed in the polymer adhesive. The polymer matrix may be one or more selected from a group consisting of a silicone-based resin, a urethane-based resin, an acrylic resin, an isoprene-based resin, a chloroprene-based resin, a fluorine-based resin, butadiene rubber, styrene-butadiene rubber and a vinylidene fluoride polymer. Specifically, the polymer matrix may be a silicon-based resin. The silicone-based resin may be polydimethylsiloxane (PDMS). The polymer matrix may have a tensile strength of 0.1 to 10 MPa. The polymer matrix may have a dielectric constant of 1-10. The dielectric material may contain at least one selected from a conductive filler, a ceramic filler and an organometallic compound, and the at least one selected from the conductive filler, the ceramic filler and the organometallic compound may be surface-treated with a silane-based compound or an amine-based compound. The conductive filler may be at least one selected from metal particles, carbon black, carbon fiber, graphene, graphite, fullerene, single-walled carbon nanotube and multi-walled carbon nanotube. The ceramic filler may be at least one selected from metal oxide, silicate, boride, carbide, nitride and perovskite. The metal oxide may be one or more selected from ZrO2, Ta2O5, SnO2, Nb2O5, TiO2, S2O3, V2O5, FeO, FeO4, Fe2O3, SrO, Cu2O, Cu2O3, ZnO, Y2O3, CaTiO3, MgZrSrTiO6, MgTiO3, MgAl2O4, BaZrO3, BaTiO3, BaSnO3, BaNb2O6, BaTa2O6, BaSrTiO3, W03, MnO2, SrZrO3, SnTiO4, ZrTiO4, CaZrO3, CaSnO3, CaWO4, MgTa2O6, MrZrO3, La2O3, CaZrO3, MgSnO3, MgNb2O6, SrNb2O6, MgTa2O6and Ta2O3. The silicate may be at least one selected from Na2SiO3, Li4SiO4, BaTiSi3O9, ZrSiO4, CaMgSi2O6and Zn2SiO4. The organometallic compound may be a compound wherein at least one metal selected from copper, zinc and nickel is bound to one or more organic substance selected from phthalocyanine, uranine and rhodamine. The silane-based compound or the amine-based compound may be at least one selected from octadecyltrimethoxysilane (ODTMS), hexadecyltrimethoxy silane, dodecyltrimethoxysilane (DDTMS), octyltrimethoxysilane (OTMS), octadecylamine and dodecylamine. Specifically, the silane-based compound may be octadecyltrimethoxysilane (ODTMS). The highly dielectric elastic body may contain from 0.1 to 100 parts by weight of the dielectric material based on 100 parts by weight of the polymer matrix. The polymer matrix may contain 5-20 parts by weight of the curing agent based on 100 parts by weight of the polymer. The polymer adhesive may have a mixture viscosity 3000 mPa·s to 5000 mPa·s before curing. The polymer adhesive may have a bulk tensile strength of 0.1 to 10 MPa after curing. The polymer adhesive may have a volume shrinkage ratio of 1 to 10% after curing. The stretchable adhesive electrode may contain 100 to 500 parts by weight of the conductive filler based on 100 parts by weight of the polymeric adhesive. The curable polymer may include at least one member selected from a silicone-based resin, a urethane-based resin, an acrylic resin, an isoprene-based resin, a chloroprene-based resin, a fluorine-based resin, butadiene rubber and styrene-butadiene rubber. The curable polymer may include a silicone-based resin. The polymer adhesive may contain 10 to 120 parts by weight of the curing agent based on 100 parts by weight of the curable polymer. The metal may be at least one selected from gold (Au), silver (Ag), copper (Cu), nickel (Ni), aluminum (Al), platinum (Pt), ruthenium (Ru), rhodium (Rh), tungsten (W), cobalt (Co), palladium (Pd), titanium (Ti), tantalum (Ta), iron (Fe), molybdenum (Mo), hafnium (Hf), lanthanum (La) and iridium (Ir). Specifically, the metal may be at least one selected from gold (Au), silver (Ag) and copper (Cu). The metal may be a mixture of metal particles having a diameter of 100 to 200 nm, 1 to 4 μm, or 5 to 10 μm. The carbonaceous material may be at least one selected from single-walled carbon nanotube, multi-walled carbon nanotube, graphene, graphite, carbon black, carbon fiber and fullerene. The carbonaceous material may be multi-walled carbon nanotube having a diameter of 15 to 40 nm and a length of 10 to 50 μm. The conductive filler may contain 0.1 to 2 parts by weight of the carbonaceous material based on 100 parts by weight of the metal. The dielectric elastic body and the stretchable adhesive electrode may be connected to each other to form a single structure. In another aspect, the present disclosure provides a method for preparing a highly dielectric elastic structure, which includes: (a) a step of preparing a dielectric material dispersion by dispersing a dielectric material in an organic solvent; (b) a step of preparing a dielectric material/polymer mixture wherein a dielectric material is mixed with a polymer by mixing the polymer with the dielectric material dispersion; (c) a step of preparing a highly dielectric elastic body by mixing the dielectric material/polymer mixture with a curing agent and then performing curing; and (d) a step of preparing a highly dielectric elastic structure by forming a stretchable adhesive electrode on the dielectric elastic body. The organic solvent in the step (a) may be at least one selected from chloroform, toluene, ethanol, methanol, dichloromethane and tetrahydrofuran. The dielectric material/polymer mixture in the step (b) may contain from 0.1 to 100 parts by weight of the dielectric material based on 100 parts by weight of the polymer. In the step (b), a step of removing the solvent may be carried out additionally after the mixing of the polymer with the dielectric material dispersion. In the step (c), 5 parts to 20 parts by weight of the curing agent may be mixed with 100 parts by weight of the polymer. The step (d) may include: (d-1) a step of preparing a conductive filler dispersion by dispersing a metal and a carbonaceous material in an organic solvent; (d-2) a step of preparing a mixture of a conductive filler and a polymer adhesive by mixing a curable polymer and a curing agent with the conductive filler dispersion and then removing the solvent; and (d-3) a step of forming a stretchable adhesive electrode by coating the mixture of the conductive filler and the polymer adhesive on the highly dielectric elastic body to form an additive mixture coating layer, and then carrying out curing. In the step (d-1), the conductive filler dispersion may be prepared by dispersing 0.1 to 2 parts by weight of the carbonaceous material based on 100 parts by weight of the metal in the organic solvent. Most specifically, in the step (a), the dielectric material may be carbon black, the carbon black may be surface-treated with octadecyltrimethoxysilane (ODTMS), and the organic solvent used to disperse the carbonaceous material may be chloroform, in the step (b), the polymer may be polydimethylsiloxane (PDMS), and the dielectric material/polymer mixture may be a mixture of 1-3 parts of the surface-treated carbon black based on 100 parts by weight of polydimethylsiloxane (PDMS), in the step (c), a coating film with a thickness of 100-500 μm may be formed by using 5-20 parts by weight of the curing agent based on 100 parts by weight of the polydimethylsiloxane (PDMS) and performing curing at a curing temperature of 120-180° C. for a curing time of 60-120 minutes, and in the step (d), the stretchable adhesive electrode may contain, in addition to the polymeric adhesive containing a silicon polymer and a curing agent, multi-walled carbon nanotubes and silver (Ag) particles as a conductive filler, the silver (Ag) particles may be a mixture of particles having a diameter of 100-200 nm, 1-4 μm, or 5-10 μm, the multi-walled carbon nanotube may have a diameter of 15-40 nm and a length of 10-50 μm, the silver (Ag) particles may contain 0.1-2 parts by weight of carbonaceous material based on 100 parts by weight, and 100-500 parts by weight of the conductive filler may be mixed based on 100 parts by weight of the polymer adhesive. In a further another aspect, the present disclosure provides a touch sensor containing the highly dielectric elastic structure. The touch sensor may be a capacitance-type force sensor. In a further another aspect, the present disclosure provides a method for preparing a touch sensor, which includes a method for preparing the highly dielectric elastic structure prepared according to the method described above. A highly dielectric elastic structure of the present disclosure provides the effects of increasing dielectric constant through composition of a polymer dielectric and a dielectric material, improving dielectric properties by forming a stretchable conductive adhesive on the composite material as an electrode and exhibiting stable dielectric properties by improving mechanical stability. Further, a touch sensor containing the highly dielectric elastic structure of the present disclosure provides the effect of minimizing reduction in dielectric properties, etc. that occurs due to electrode breakdown and poor adhesion of the highly dielectric elastic structure to the electrode.

11378505

TECHNICAL FIELD The present disclosure relates to a method of measuring rheological characteristics and a capillary injection system, and more particularly, to a method and capillary injection system of measuring an extensional viscosity. DISCUSSION OF THE BACKGROUND A viscosity is an important characteristic in rheology. The viscosity includes a shear viscosity and an extensional viscosity. Conventionally, it is difficult to obtain an accurate measurement of the extensional viscosity. However, an inaccurate measurement of the extensional viscosity would affect a quality of a rheological analysis. Therefore, it is critical to obtain the accurate extensional viscosity measurement. This Discussion of the Background section is provided for background information only. The statements in this Discussion of the Background are not an admission that the subject matter disclosed in this section constitutes prior art to the present disclosure, and no part of this Discussion of the Background section may be used as an admission that any part of this application, including this Discussion of the Background section, constitutes prior art to the present disclosure. SUMMARY One aspect of the present disclosure provides a method of measuring an extensional viscosity of a polymer melt. The method includes operations of: based on a weighted generalized Newtonian fluid (GNF) viscosity model, obtaining a viscosity profile of the polymer melt according to a transport equation, a Navier Stokes equation, and a Trouton function; measuring a pressure drop of the polymer melt; obtaining a general viscosity of the polymer melt from the viscosity profile according to the pressure drop, wherein the general viscosity comprises a shear viscosity of the polymer melt and the extensional viscosity of the polymer melt; and extracting the extensional viscosity from the general viscosity. In some embodiments, the polymer melt flows through a capillary, and a difference between a pressure at an outlet of the capillary and a pressure at an inlet of the capillary is the pressure drop. In some embodiments, based on the weighted GNF viscosity model, obtaining the viscosity profile of the polymer melt according to the transport equation, the Navier Stokes equation, and the Trouton function includes operations of: determining a plurality of conditional parameters of the transport equation and the Navier Stokes equation; determining a plurality of computational parameters of the Trouton function; obtaining a Trouton ratio of the Trouton function according to the plurality of computational parameters; based on the weighted GNF viscosity model, obtaining an estimated pressure drop of the polymer melt according to the Trouton ratio, the transport equation, and the Navier Stokes equation; determining whether an error of the estimated pressure drop is within a threshold; and when the error of the estimated pressure drop is within the threshold, obtaining the viscosity profile according to the plurality of conditional parameters and the plurality of computational parameters. In some embodiments, when the error of the estimated pressure drop is not within the threshold, updating the plurality of computational parameters of the Trouton ratio function. In some embodiments, when the error is a positive value, an initial temperature of the plurality of conditional parameters is increased 1 degree so as to update the predetermined temperature. In some embodiments, when the error is a negative value, an initial temperature of the plurality of conditional parameters is decreased 1 degree so as to update the predetermined temperature. In some embodiments, the plurality of conditional parameters comprises a predetermined velocity vector of the polymer melt, a predetermined temperature of the polymer melt, and a predetermined pressure drop of the polymer melt. In some embodiments, based on the GNF viscosity model, obtaining the estimated pressure drop of the polymer melt according to the Trouton ratio, the transport equation, and the Navier Stokes equation includes operations of: obtaining an estimated velocity vector of the polymer melt according to the transport equation; obtaining an estimated strain rate of the polymer melt according to the weighted GNF viscosity model; obtaining an estimated temperature of the polymer melt and an estimated pressure of the polymer melt according to the Navier Stokes equation, the estimated velocity vector, and the estimated strain rate; and obtaining the estimated pressure drop according to the estimated pressure. The estimated velocity vector, the estimated temperature, and the estimated pressure drop converge to the predetermined velocity vector, the predetermined temperature, and the predetermined pressure drop, respectively. In some embodiments, the error of the estimated pressure drop is equal to a difference between the estimated pressure drop and the predetermined pressure drop divided by the predetermined pressure drop. In some embodiments, the threshold is about ±10%. In some embodiments, the Tronton function is represented using an expression: Tr⁡(γ.)=ηEηSTr⁡(γ.)=3+T0[1+(λT⁢γ.)-2]nT wherein Tr({dot over (γ)}) represents a Trouton ration with respect to a shear rate {dot over (γ)}, ηErepresents the extensional viscosity, ηSrepresents a shear viscosity, T0represents an initial temperature, λTrepresents a relaxation time, and nTrepresents a power index. Another aspect of the present disclosure provides a capillary injection system for measuring an extensional viscosity of a polymer melt, including a barrel, a capillary, a piston, a first pressure transducer, a second pressure transducer, and a rheometer. The barrel has a cavity configured to contain a polymer melt. The capillary is coupled to the barrel. The piston is coupled to the barrel, and configured to provide a force to the polymer melt to make the polymer melt flow through the capillary. The first pressure transducer is configured to measure a first pressure of the polymer melt at an inlet of the capillary. The second pressure transducer is configured to measure a second pressure of the polymer melt at an outlet of the capillary. The rheometer is configured to perform operations of: based on a weighted GNF viscosity model, obtain a viscosity profile of the polymer melt according to a transport equation, a Navier Stokes equation, and a Trouton function; obtain a general viscosity of the polymer melt from the viscosity profile according to the first pressure and the second pressure, wherein the general viscosity comprises a shear viscosity of the polymer melt and the extensional viscosity of the polymer melt; and extract the extensional viscosity from the general viscosity. The foregoing has outlined rather broadly the features and technical advantages of the present disclosure in order that the detailed description of the disclosure that follows may be better understood. Additional features and advantages of the disclosure will be described hereinafter, and form the subject of the claims of the disclosure. It should be appreciated by those skilled in the art that the conception and specific embodiment disclosed may be readily utilized as a basis for modifying or designing other structures or processes for carrying out the same purposes of the present disclosure. It should also be realized by those skilled in the art that such equivalent constructions do not depart from the spirit and scope of the disclosure as set forth in the appended claims.

11460719

FIELD This disclosure relates to dynamic contact lenses having a dynamic portion that when placed on a cornea have a conforming configuration and at least one non-conforming configuration, or can have at least two non-conforming configurations. When worn on an eye the dynamic portion forms a tear lens for correcting vision. The dynamic portion can also be configured to provide a dynamic tear lens that changes optical power in response to forces applied to the dynamic contact lens by eyelids and/or gaze movement. The contact lenses can be used for correcting vision such as for correcting presbyopia, delaying the progression of myopia progression, or for correcting vision caused by an irregularly-shaped cornea. BACKGROUND Typical vision problems such as myopia (nearsightedness), hyperopia (farsightedness) and presbyopia (loss of accommodation and subsequent loss of near and intermediate vision) are readily correctable using eyeglasses. However, some individuals prefer contact lenses for vision correction for reasons such as to accommodate an active life style or for aesthetic reasons. Contact lens wearers who become presbyopic with age require additional corrective lenses to allow both near, intermediate, and distance vision. To address presbyopia, contact lens manufacturers have developed multifocal lenses that simultaneously focus light from a range of distances via several focal regions and bifocal lenses that include two focusing regions, e.g., a central region for correcting myopia and a surrounding region for correcting hyperopia. The latter lenses translate with respect to the optical axis of the eye to provide both near and far vision correction depending on the eye gaze angle. Translating contact lenses are configured for moving (translating) anywhere from 1 mm to 6 mm over the surface of the cornea and as such are significantly less stable than standard contact lenses, which typically have a movement over the cornea from 0 mm to 1 mm. Because translating lenses are designed to move, during upper eyelid blinking, translating lenses shift downward over the cornea such that the lower edge of the lens impinges upon the lower lid margin with every blinking motion. Such repeated movement and lid contact causes significant user discomfort due to the heightened foreign object sensitivity of the cornea and lower lid margin. In addition, due to the presence of the meibomian gland opening on the lower lid margin, lower lid impingement can lead to repeated trauma and inflammation of these openings which can lead to hyperkeratosis and possibly meibomian gland dysfunction. SUMMARY According to the present invention, dynamic contact lenses comprise: a dynamic portion comprising a dynamic posterior surface and a dynamic anterior surface opposite the dynamic posterior surface; a peripheral portion comprising a peripheral posterior surface, a peripheral anterior surface opposite the peripheral posterior surface, and a transition zone coupling the peripheral portion and the dynamic portion; wherein the dynamic portion comprises: a material having a Young's modulus within a range from 0.05 MPa to 10 MPa; and an as-fabricated center SAG height from 10 μm to 300 μm. According to the present invention, dynamic contact lenses comprise: a peripheral portion, a dynamic portion coupled to the peripheral portion, wherein the dynamic portion comprises: a conforming configuration configured to provide a first optical power to an eye having a cornea; and at least one non-conforming configuration configured to provide a second optical power to the eye, wherein the second optical power is different than the first optical power. According to the present invention, dynamic contact lenses, comprise: a peripheral portion comprising a peripheral posterior surface and a peripheral anterior surface, wherein the peripheral posterior surface comprises a peripheral base curvature; and a dynamic portion comprising a dynamic posterior surface and a dynamic anterior surface, wherein at least the dynamic posterior surface bulges away from the peripheral base curvature toward the dynamic anterior surface. According to the present invention, dynamic contact lenses comprise: a dynamic portion comprising a dynamic posterior surface, wherein the dynamic posterior surface comprises a dynamic base curvature; a peripheral portion coupled to the dynamic portion, wherein the peripheral portion comprises a peripheral posterior surface; and the peripheral posterior surface comprises a peripheral base curvature; wherein, in a first configuration the dynamic base curvature is substantially the same as the peripheral base curvature; and in a second configuration the dynamic base curvature deviates from the peripheral base curvature. According to the present invention, dynamic contact lenses comprise a dynamic portion, wherein, the dynamic portion comprises a dynamic posterior surface; the dynamic posterior surface comprises a dynamic base curvature; in a first configuration the dynamic base curvature is substantially the same as a corneal curvature; and in a second configuration the dynamic base curvature deviates from the corneal curvature. According to the present invention, dynamic contact lenses comprise: a peripheral portion, wherein the peripheral portion comprises a peripheral posterior surface, wherein the peripheral posterior surface comprises a peripheral base curvature; and a dynamic portion coupled to the peripheral portion, wherein the dynamic portion comprises a center thickness, and a center SAG height with respect to the peripheral base curvature; wherein, the dynamic portion is configured to assume a first configuration characterized by a first center gap height with respect to the peripheral base curvature and assume a second configuration characterized by a second center gap height with respect to the peripheral base curvature, wherein, the first center gap height and the second center gap height are different; and the first configuration and the second configuration are quasi-stable. According to the present invention, dynamic contact lenses comprise a dynamic portion comprising a posterior surface, wherein, the posterior surface comprises a dynamic base curvature; in a first configuration the posterior surface comprises a first base curvature; and in a second configuration the posterior surface comprises a second base curvature. According to the present invention, dynamic contact lenses comprise: a dynamic portion, wherein the dynamic portion comprises: at least one first non-conforming configuration configured to provide a first optical power to an eye having a cornea; and at least one second non-conforming configuration configured to provide a second optical power to the eye, wherein the second optical power is different than the first optical power; at least one first mechanism configured to induce a change between the first non-conforming configuration and the at least one second non-conforming configuration; and at least one second mechanism configured to induce a change between the at least one second non-conforming configuration and the at least one first non-conforming configuration. According to the present invention, dynamic contact lenses comprise: a first portion comprising a first posterior surface, a first anterior surface opposite the first posterior surface, and a first material, wherein, the first posterior surface comprises a first radius of curvature; and the first material comprises a first Young's modulus; and a second portion coupled to the first portion, wherein the second portion comprises a second posterior surface and a second anterior surface opposite the second posterior surface, and a second material, wherein, The second posterior surface comprises a second radius of curvature; and the second material comprises a second Young's modulus; and wherein the first radius of curvature is less than the second radius of curvature; and wherein each of the first Young's modulus and the second Young's modulus is independently within a range from 0.05 MPa to 10 MPa. According to the present invention, dynamic contact lenses comprise: a first portion comprising a first posterior surface, a first anterior surface opposite the first posterior surface, and a first material, wherein the first material comprises a first Young's modulus; and a peripheral portion coupled to the first portion, wherein the peripheral portion comprises: a peripheral posterior surface having a base curvature, and the second material comprises a second Young's modulus; and wherein the first posterior surface bulges anteriorly from the base curvature of the posterior surface of the peripheral portion; and wherein each of the first Young's modulus and the second Young's modulus is independently within a range from 0.05 MPa to 10 MPa. According to the present invention, methods of correcting vision of a patient comprise applying a dynamic contact lens according to the present invention to an eye of a patient in need of corrected vision. According to the present invention, methods of treating presbyopia comprise applying a dynamic contact lens according to the present invention to a presbyopic eye of a patient. According to the present invention, methods of correcting vision of a patient comprise applying a dynamic contact lens according to the present invention to an eye of a patent in need of such treatment. According to the present invention, methods of treating an eye of a patient following ocular therapy comprise applying a dynamic contact lens according to the present invention to an eye of a patent in need of such treatment. According to the present invention, methods of healing a trauma wound to a cornea of an eye of a patient comprise applying a dynamic contact lens according to the present invention to an eye of a patent in need of such healing. According to the present invention, methods of protecting an eye of a patient from a potential injury comprise applying a dynamic contact lens according to the present invention to an eye of a patent in need of such protection. According to the present invention, methods of fabricating a dynamic contact lens comprise molding a material to provide a dynamic contact lens comprising: a peripheral portion comprising a peripheral posterior surface and a peripheral anterior surface, wherein the peripheral posterior surface comprises a peripheral base curvature; and a dynamic portion comprising a dynamic posterior surface and a dynamic anterior surface, wherein at least the dynamic posterior surface bulges away from the peripheral base curvature toward the dynamic anterior surface. According to the present invention, methods of fabricating a dynamic contact lens comprise molding a material to provide a dynamic contact lens comprising: a dynamic portion characterized by a dynamic base curvature; and a peripheral portion coupled to the dynamic portion, wherein the peripheral portion comprises a peripheral base curvature, wherein the dynamic base curvature is different than the peripheral base curvature. According to the present invention, dynamic contact lenses according to the present invention are applied to a cornea.

11256815

TECHNICAL FIELD The present disclosure generally relates to data storage, and in a more particular example, to distributed data storage. BACKGROUND Often, distributed storage systems are used to store large amounts (e.g., terabytes, petabytes, exabytes, etc.) of data, such as objects or files in a distributed and fault tolerant manner with a predetermined level of redundancy. Some existing object storage systems store data objects referenced by an object identifier versus file systems. This can generally allow object storage systems to surpass the maximum limits for storage capacity of file systems in a flexible way such that, for example, storage capacity can be added or removed as a function of the applications, systems, and/or enterprise needs, while reducing degradation in performance as the system grows. As a result, object storage systems are often selected for large-scale storage systems. Such large-scale storage systems generally distribute the stored data objects in the object storage system over multiple storage elements, such as for example hard disks, or multiple components such as storage nodes comprising a plurality of such storage elements. However, as the number of storage elements in such a distributed object storage system increase, equally the probability of failure of one or more of these storage elements increases. To cope with this issue, distributed object storage system generally use some level of redundancy, which allows the system to cope with a failure of one or more storage elements without data loss. In its simplest form, redundancy at the object store level is achieved by replication, which means storing multiple copies of a data object on multiple storage elements of the distributed object storage system. When one of the storage elements storing a copy of the data object fails, this data object can still be recovered from another storage element holding a copy. In some storage systems, replication of data objects for redundancy is supervised by an administrator or as an automated system task and may be largely invisible to application programmers and other users supported by the storage system. For example, in hosted storage models, replication processes may be designed to comply with a defined quality of service, but otherwise require little input from application users and data owners. In object storage systems that comply with Simple Storage Services (S3) protocols, data objects are generally put into the storage system by an application user using a PUT command. It may then be a system task to replicate the stored objects to another site, which can include another storage site of the same object storage provider or another S3 compliant provider. The replication solution is usually comprised of multiple GET-PUT processes run in parallel. In some integrated solutions, user credentials are used to secure data at rest (in storage elements) and during inter-region or inter-site transfer. More specifically, there may be multiple users (bucket owners) with their own access and related encryption keys. They may store data objects in the buckets to which they have access and the data may be secured at rest in a variety of ways (server side encryption (SSE), server side encryption with customer encryption (SSE-C), client side encryption, etc.). However, using the actual bucket owner user credentials during replication may lead to degraded performance. Lower network libraries, such as those responsible for replication, create connections with a certain source storage node and a certain destination storage node that may be reused for multiple transfers. If a replication agent is replicating objects from different bucket owners, it would have to close connections, switch user credentials, and establish a new connection for each transfer because the owner-specific connections cannot be reused. These changes have performance costs. Further, when replicating data objects to a different bucket on a different site, a replication agent may not have access to the user credentials of both bucket owners. The replication agent needs access credentials to read from the source storage node and write to the destination storage node, which may be challenging to manage across multiple deployments and/or sites. In many solutions, this involves creating an administrative or support credential that has access to all buckets, which may represent a significant security risk. Even if the communication channels are secure, such as using hypertext transport protocol secure (HTTPS), user data is at risk of getting exposed by the transporting applications, such as replication agents, during processing. Some of these transporting applications may be hosted applications maintained by a third party, reducing the level of trust in those applications from a data owner's perspective. An all-access credential may be misused purposefully or unknowingly by transporting applications or agents to expose user data. Even though the storage nodes ensure data security at rest and secure communication channels ensure data security during routing, intermediate processing may enable security holes that allow user data access without the user's knowledge. Even in on-premise solutions, multiple departments and/or user groups may maintain their own controls, access credentials, and security standards. Multiple deployments may make it difficult for data security to be maintained between the storage nodes in compliance with the secure data movement standards of each department and/or deployment using individual owner user credentials or enabling an all-access user, even if the all-access user credentials can be hidden. A need exists for at least improved secure replication of data objects to prevent unauthorized access to user data. For example, when replicating data among S3 compliant solutions or providers, a need exists to prevent user data from being exposed during replication. SUMMARY Various aspects for data object replication, particularly, secure data object replication, in distributed object storage systems are described. In an innovative aspect, a system comprises at least one processor, at least one memory coupled to the at least one processor, and a plurality of storage nodes configured to receive data objects. A controller node is stored in the at least one memory and executable by the at least one processor to communicate with the plurality of storage nodes for reading and writing data objects. An authenticator is stored in the at least one memory and executable by the at least one processor to identify a user credential for reading an identified data object requested in an object storage operation, the user credential having a user type. The user type selected from an owner user type and a replication user type. An encrypt engine is stored in the at least one memory and selectively executable by the at least one processor based on the user type to encrypt the identified data object while reading the identified data object from at least one of the plurality of storage nodes responsive to the user type being the replication user type. The controller node is executable to read the identified data object to execute the object storage operation. In various embodiments, the authenticator is further executable by the at least one processor to identify the user credential for writing the identified data object to at least one of the plurality of storage nodes. The storage system may further comprise a decrypt engine stored in the at least one memory and selectively executable by the at least one processor based on the user type to decrypt the identified data object while writing the identified data object to at least one of the plurality of storage nodes responsive to the user type being the replication user type. The controller node is executable to write the identified data object to execute the object storage operation. The controller node is executable to receive the identified data object from a different storage system and the identified data object is encrypted when the identified data object is received. The encrypt engine, the decrypt engine, and the different storage system may each include a common encryption key. The authenticator, the encrypt engine, and the decrypt engine may be included in a proxy application in communication with the controller node. The object storage operation may be processed by the proxy application prior to reading or writing the identified data object. In some embodiments, the user type is a flag associated with the object storage operation processed by the authenticator. The storage system may further comprise a cache memory for storing the identified data objects in the controller node during object storage operations. The identified data object may be encrypted by the encrypt engine before being stored in the cache memory. In various embodiments, the controller node is executable to set the user type for an object storage operation to the replication user type for system tasks not initiated by an application user and further comprises an object storage agent. The object storage agent may be configured for sending hypertext transfer protocol (HTTP) calls conforming to a simple storage services application protocol interface and using a GET operation to read the identified data object from the first storage node and a PUT operation to write the identified data object to the second storage node. The identified data object may be selectively routed through the encrypt engine during the GET operation and the decrypt engine during the PUT operation when the user type is the replication user type. The HTTP calls may be encrypted for routing among the plurality of storage nodes independent of the encrypt engine encrypting the identified data object. In another innovative aspect, a computer-implemented method provides secure data object replication. An object storage operation is initiated for reading and writing an identified data object. The identified data object is read from a first storage node. Read operations are encrypted to create an encrypted data object corresponding to the identified data object when reading the identified data object from the first storage node. The encrypted data object is moved from the first storage node to a second storage node. The write operations are decrypted from the encrypted data object when writing the identified data object to the second storage node. The identified data object is written to the second storage node. In various embodiments, initiating the object storage operation includes using a user credential for reading and writing the identified data object, the user credential has a user type, and the user type is selected from an owner user type and a replication user type. The method further comprises identifying the user type from the user credential for the object storage operation. Encrypting read operations is selectively executed based on the user type being the replication user type and decrypting read operations is selectively executed based on the user type being the replication user type. In some embodiments, reading the identified data object and writing the identified data object are executed by a controller node configured to communicate with a plurality of storage nodes. The plurality of storage nodes includes the first storage node and the second storage node. Identifying the user type from the user credential may be executed by an authenticator in communication with the controller node. Encrypting read operations may be executed by an encrypt engine in communication with the controller node and decrypting read operations may be executed by a decrypt engine in communication with the controller node. The first storage node and the second storage node may be in different storage systems. Encrypting read operations and decrypting write operations may use a common encryption key. The user type may be a flag associated with the object storage operation, wherein a first value of the flag is the owner user type and a second value of the flag is the replication user type. In various embodiments, reading the identified data object includes sending a first HTTP call conforming to a simple storage services application protocol interface GET operation to the first storage node and writing the identified data object includes sending a second HTTP call conforming to a simple storage services application protocol interface PUT operation to the second storage node. Identifying the user type from the user credential, encrypting read operations, and decrypting write operations may be executed by a proxy application. The object storage operation may be processed by the proxy application prior to reading and writing the identified data object. The method may further comprise setting the user type for the object storage operation to the replication user type for system tasks not initiated by an application user. The method may further comprise storing the identified data object in a cache memory after reading the identified data object from the first storage node and before writing the identified data object to the second storage node. In yet another innovative aspect, a system provides secure data object replication. Means are provided for initiating an object storage operation using a user credential for reading and writing an identified data object. The user credential has a user type and the user type selected from an owner user type and a replication user type. Means are provided for identifying the user type from the user credential for the object storage operation. Means are provided for selectively encrypting read operations based on the user type to encrypt the identified data object when reading the identified data object from a first storage node if the user type is the replication user type. Means are provided for reading the identified data object from the first storage node. Means are provided for selectively decrypting write operations based on the user type to decrypt the identified data object when writing the identified data object to a second storage node if the user type is the replication user type. Means are provided for writing the identified data object to the second storage node. The various embodiments advantageously apply the teachings of distributed object storage networks and/or systems to improve the functionality of such computer systems. The various embodiments include operations to overcome or at least reduce the issues in the previous storage networks and/or systems discussed above and, accordingly, are more secure than other computing networks. That is, the various embodiments disclosed herein include hardware and/or software with functionality to improve the security of data object replication, based on selectively encrypting and decrypting data objects to avoid exposing application data content to administrative users. Accordingly, the embodiments disclosed herein provide various improvements to storage networks and/or storage systems. It should be understood that language used in the present disclosure has been principally selected for readability and instructional purposes, and not to limit the scope of the subject matter disclosed herein.

11540191

CROSS-REFERENCE TO RELATED APPLICATIONS This application is the National Stage filing under 35 U.S.C. 371 of International Application No. PCT/KR2018/014133, filed on Nov. 16, 2018, which claims the benefit of U.S. Provisional Application Nos. 62/587,495, filed on Nov. 17, 2017, and 62/739,007, filed on Sep. 28, 2018, the contents of which are all hereby incorporated by reference herein in their entirety. TECHNICAL FIELD The present disclosure relates to a method of transmitting and receiving a reference signal and an apparatus therefor and, more particularly, to a method and apparatus for obtaining time information of a neighbor cell based on a sequence of a reference signal upon receiving a synchronization signal block and the reference signal from a serving cell and the neighbor cell, respectively. BACKGROUND ART As more and more communication devices demand larger communication traffic along with the current trends, a future-generation 5thgeneration (5G) system is required to provide an enhanced wireless broadband communication, compared to the legacy LTE system. In the future-generation 5G system, communication scenarios are divided into enhanced mobile broadband (eMBB), ultra-reliability and low-latency communication (URLLC), massive machine-type communication (mMTC), and so on. Herein, eMBB is a future-generation mobile communication scenario characterized by high spectral efficiency, high user experienced data rate, and high peak data rate, URLLC is a future-generation mobile communication scenario characterized by ultra-high reliability, ultra-low latency, and ultra-high availability (e.g., vehicle to everything (V2X), emergency service, and remote control), and mMTC is a future-generation mobile communication scenario characterized by low cost, low energy, short packet, and massive connectivity (e.g., Internet of things (IoT)). DETAILED DESCRIPTION OF THE DISCLOSURE Technical Problems The present disclosure provides a method of transmitting and receiving a reference signal and an apparatus therefor. It will be appreciated by persons skilled in the art that the objects that could be achieved with the present disclosure are not limited to what has been particularly described hereinabove and the above and other objects that the present disclosure could achieve will be more clearly understood from the following detailed description. Technical Solutions According to an aspect of the present disclosure, provided herein is a method of receiving a reference signal by a user equipment (UE) in a wireless communication system, including receiving first information related to a reference signal configuration from a serving cell, receiving the reference signal from a neighbor cell based on the first information, and obtaining second information about a timing of the reference signal based on a sequence of the reference signal, wherein the reference signal differs in type from a synchronization signal/physical broadcast channel (SS/PBCH) block. The second information may be information about a half-frame in which the reference signal is transmitted. The second information may be information about at least one of a slot or an orthogonal frequency division multiplexing (OFDM) symbol in which the reference signal is transmitted. The second information may be information related to an index of an SS/PBCH block received from the neighbor cell. The second information may include 3 most significant bits for the index of the SS/PBCH block received from the neighbor cell. The reference signal may be mapped to resources positioned within a predetermined range from resources to which an SS/PBCH block received from the neighbor cell is mapped. The reference signal may correspond to a channel state information-reference signal (CSI-RS). The reference signal may correspond to a demodulation reference signal (DMRS) and the DMRS may be mapped to a region for which mapping of the SS/PBCH block is skipped. The method may further include performing handover from the serving cell to the neighbor cell based on the second information. The method may further include performing measurement for the neighbor cell based on the second information. In another aspect of the present disclosure, provided herein is a communication apparatus for receiving a reference signal in a wireless communication system, including a memory; and a processor connected to the memory, wherein the processor performs control to receive first information related to a reference signal configuration from a serving cell, receive the reference signal from a neighbor cell based on the first information, and obtain second information about a timing of the reference signal based on a sequence of the reference signal, and wherein the reference signal differs in type from a synchronization signal/physical broadcast channel (SS/PBCH) block. In another aspect of the present disclosure, provided herein is a method of transmitting a reference signal by a neighbor cell in a wireless communication system, including generating a sequence of the reference signal based on first information about a timing of the reference signal, mapping the sequence of the reference signal to resource elements based on first information related to a reference signal configuration transmitted to a user equipment (UE) by a serving cell, and transmitting the reference signal to the UE, wherein the reference signal differs in type from a synchronization signal/physical broadcast channel (SS/PBCH) block. Advantageous Effects According to the present disclosure, since an index of a synchronization signal block received from a neighbor cell may be obtained although the synchronization signal block received from the neighbor cell is not decoded, decoding complexity may be reduced. The effects that can be achieved with the present disclosure are not limited to what has been particularly described hereinabove and other advantages not described herein will be more clearly understood by persons skilled in the art from the following detailed description of the present disclosure.

11427301

BACKGROUND INFORMATION Field This disclosure relates generally to the field of aircraft flap systems and, more particularly to a flap deployment system having a flap carrier beam with a hollow channel to receive a coupler link upon fracture of a fuse pin. Background Aircraft employ flaps which deploy to increase camber and chord of the wings for enhanced aerodynamic efficiency in take-off and landing. Various mechanical arrangements have been developed to deploy the flaps from retracted to extended positions. Flap supports typically extend below the lower surface of the wing and deployment of the flaps extend portions of the flap and flap support elements below the wing. Consequently, conditions may exist outside normal operations where the flap supports may contact the ground. The wing structure includes fuel tanks and other complex systems elements. Flap supports are therefore fusible or frangible, to allow flap system components to react to such ground contact in a controlled manner which does not compromise the surrounding primary wing structure and integrity of the integral wing fuel tanks. In many cases providing the frangible elements of the flap support require complex structures or multiple attachment points. It is therefore desirable to provide a simplified force relief system. SUMMARY Exemplary implementations of a flap support mechanism include a carrier beam on which a flap is mounted. The carrier beam is rotatably mounted at a fixed rotational axis and has a pair of flanges, each flange having an aperture, and a channel extending aft from the pair of flanges. A fuse pin is received through the aperture in each flange. A coupler link is attached to an actuator at a first end and pivotally engaged to the carrier beam by the fuse pin. Extension of the coupler link by the actuator rotates the carrier beam from a stowed position to a deployed position. Responsive to a moment induced on the flap and carrier beam by a ground contact load, the fuse pin is frangible to shear releasing the coupler link to translate into the channel. The exemplary implementations provide a method for relieving load on a flap carrier beam. A flap is mounted on a carrier beam and the carrier beam is rotatably mounted at a fixed rotational axis, the carrier beam having a pair of flanges each flange having an aperture, and a channel extending aft from the pair of flanges. A coupler link is attached to an actuator at a first end. The coupler link is pivotally engaged to the carrier beam with a fuse pin. The coupler link is extended with the actuator to rotate the carrier beam from a stowed position to a deployed position. The fuse pin is sheared responsive to a moment induced on the flap and carrier beam by a ground contact load. The coupler link is released and translates into the channel.

11350303

BACKGROUND Edge computing may involve a cloud-based Information Technology (IT) service environment located at an edge of a network. One of the purposes of edge computing is to enable high-bandwidth, low-latency access to latency-sensitive applications distributed at the edge of the network closest to the user. A primary goal of edge computing is to reduce network congestion and improve application performance by executing task processing closer to end users thereby improving the delivery of content and applications to the end users and reducing transport costs for high bandwidth services. Applications where edge computing is highly desirable may include on-line gaming, augmented reality (AR), virtual reality (VR), wirelessly connected vehicles, and Internet of Things (IoT) applications (e.g., industry 4.0 applications). Additionally, edge computing can be beneficial in large public venues and enterprise organizations where services are delivered to onsite consumers from an edge server located at or near the venue or organization. In such large-scale use cases, data content may be locally produced, stored, processed, and/or delivered from an edge server, thus, ensuring reduced backhaul, low latency, or even ultra-low latency. Multi-Access Edge Computing (MEC) is one type of edge computing. MEC moves the processing, storing, and/or delivery of traffic and services from a centralized network to a data center(s) at the edge of the network, closer to the end user.

11410047

BACKGROUND Technical Field The present disclosure generally relates to machine learning and artificial intelligence technology, and more particularly to transaction anomaly detection, according to various embodiments. Related Art In large sets of data, particularly relating to real-world events, a small sub-set of the data may indicate one or more unusual conditions or underlying real-world problems that may require remediation. However, such data may be relatively noisy—that is, it can be difficult to distinguish data for an ordinary (e.g. non-problematic) real-world event versus data for a problematic real-world event that may require that one or more additional actions be taken. Applicant recognizes that an improved system for detecting data anomalies in transactional data sets, particularly as they relate to real-world events, would be desirable, as such a detection system can improve computer system security and efficiency.

11487724

TECHNICAL FIELD The present disclosure generally relates to data, and specifically to data management and storage. BACKGROUND In moving data from one repository to another, data is often loaded in an incremental fashion so that newer periods of data build on top of older periods. After identifying a historical defect, the data in a storage system may be manually backed out, or deleted, starting with the latest period and moving backwards in time until a time period before the defect occurred. Once the data defect has been corrected, the data is then reloaded into the data storage system in an incremental manner, starting with the oldest missing period and moving forwards in time until the latest period of data is loaded in. This process may result in significant downtime for a system in which users cannot access data that is being removed and reloaded. Depending on the size of the system, the downtime can last weeks or even months. There is a need in the art for a system and method that addresses the shortcomings discussed above. SUMMARY In one aspect, a method of updating data in a target repository using data from a source repository includes a step of establishing a connection with a source repository, where the source repository includes data for a latest period, data for a first historical period, and data for a second historical period, and where the second historical period is an older period than the first historical period. The method further includes retrieving a latest data portion from the source repository, wherein the latest data portion includes data from the latest period. The method further includes retrieving a historical data portion from the source repository, where the historical data portion includes data from the first historical period and from the second historical period. The method further includes transforming the latest data portion into a transformed latest data portion, transforming the historical data portion into a transformed historical data portion, storing the transformed latest data portion and the transformed historical data portion in a first staging repository, retrieving a target data portion from a target repository and storing the target data portion in a second staging repository, and comparing the transformed historical data portion with the target data portion to determine if there is a defect in the target data portion. The method further includes updating the target repository to include the transformed latest data portion and the transformed historical data portion when there is a defect in the target data portion and updating the target repository with only the transformed latest data portion when there is no defect in the target data portion. In another aspect, a method of updating data in a target repository using data from a source repository includes a step of establishing a connection with a source repository, where the source repository includes data for a latest period, data for a first historical period, and data for a second historical period, and where the second historical period is an older period than the first historical period. The method further includes retrieving a first historical data portion from the source repository, where the first historical data portion includes data from the first historical period and from the second historical period. The method further includes transforming the first historical data portion into a first transformed historical data portion, comparing the first transformed historical data portion with a corresponding first target data portion from the target repository, and replacing the first target data portion with the first transformed historical data portion if there are differences between the first transformed historical data portion and the first target data portion. The method further includes retrieving a second historical data portion from the source repository, where the second historical data portion includes data from the first historical period and from the second historical period. The method further includes transforming the second historical data portion into a second transformed historical data portion, comparing the second transformed historical data portion with a corresponding second target data portion from the target repository, and replacing the second target data portion with the second transformed historical data portion if there are differences between the second transformed historical data portion and the second target data portion. In another aspect, a continuous data quality system for moving data from a source repository to a target repository includes a data manager, a first staging repository, and a second staging repository. The data manager is configured to retrieve data from the source repository, transform the retrieved data into transformed data, store the transformed data in the first staging repository, retrieve target data from the target repository, store the target data in the second staging repository, compare the transformed data with the target data, and update the target repository. Other systems, methods, features, and advantages of the disclosure will be, or will become, apparent to one of ordinary skill in the art upon examination of the following figures and detailed description. It is intended that all such additional systems, methods, features, and advantages be included within this description and this summary, be within the scope of the disclosure, and be protected by the following claims.

11251878

FIELD OF THE DISCLOSURE The disclosure generally relates to methods and apparatuses for the generation and use of subcarriers in optical communication systems. More particularly the disclosure relates to such methods and apparatuses that route or direct individual subcarriers to a different destination, wherein the modulation format, data rate, and/or baud rate, as well as the spectral width and frequency spacing between subcarriers, may be tailored for each subcarrier based on receiver characteristics and/or in accordance with the path or route over which a corresponding subcarrier is transmitted. BACKGROUND Communication systems are known in which optical signals, each being modulated to carry data and having a different wavelength, are transmitted from a first location to a second location. The optical signals may be combined on a single fiber and transmitted to a receiving node that includes circuitry to optically separate or demultiplex each signal. Alternatively, coherent detection techniques may be employed to extract the data carried by each optical signal. In such systems, a plurality of transmitters may be provided, such that each transmitter supplies a respective one of the optical signals. Typically, each transmitter includes a laser, modulator, and associated circuitry for controlling the modulator and the laser. As network capacity requirements increase, however, additional transmitters may be provided to supply additional optical signals, but at significantly increased cost. Moreover, communications systems may include multiple nodes, such that selected optical signals may be intended to transmission to certain nodes, and other signals may be intended for reception by one or more other nodes. Accordingly, optical add-drop multiplexers (“OADMs”) may be provided to drop one or more signals at an intended local receiver, for example, while other optical signals are passed by the OADM to one or more downstream nodes. Further, optical signals may be added by the OADM for transmission to one or more nodes in the communication system. Thus, the optical signals may be transmitted over varying distances and through varying numbers of OADMs. In addition, the data and/or baud rate, and or modulation format is preferably tailored to a particular route, as well as the capacity of the intended receiver. Thus, not only may multiple transmitters be required to provide a required number of optical signals to satisfy network capacity needs, but each transmitter may be required to be customized to generate each optical signal with a desired modulation format, data rate, and/or baud rate. SUMMARY Optical communication network systems and methods are disclosed. The problem of requiring multiple transmitters to provide a required number of optical signals to satisfy network capacity needs, and requiring each transmitter to be customized to generate each optical signal with a desired modulation format, data rate, and/or baud rate is addressed through systems and methods for providing subcarriers that may be routed through a network independently of one another. In addition, each subcarrier may have characteristics, such as baud rate, data rate and modulation format, spectral width, and frequency spacings that may be tailored based on the intended receiver for such subcarrier and the particular optical path or route over which the subcarrier is transmitted. Consistent with an aspect of the present disclosure, a transmitter may comprise a digital signal processor receiving a plurality of independent data streams, the digital signal processor supplying outputs based on the plurality of independent data streams, the digital signal processor comprising a plurality of pulse shape filters corresponding to the plurality of independent data streams, the plurality of pulse shape filters configured to filter the independent data streams to produce a first subcarrier having a first frequency bandwidth and a second subcarrier having a second frequency bandwidth different than the first frequency bandwidth for the outputs; one or more digital-to-analog converter configured to convert the outputs of the digital signal processor to voltage signal outputs; a laser configured to output an optical light beam; and a modulator configured to modulate the optical light beam, based on the voltage signal outputs, to output a modulated optical signal including a plurality of optical subcarriers based on the outputs of the digital signal processor, wherein a first one of the plurality of optical subcarriers carries data indicative of a first one of the plurality of independent data streams, and a second one of the plurality of optical subcarriers carries data indicative of a second one of the plurality of independent data streams, and wherein the first one of the plurality of optical subcarriers has a first bandwidth and the second one of the plurality of optical subcarriers has a second bandwidth different than the first bandwidth. In one implementation, the plurality of optical subcarriers are Nyquist optical subcarriers. In one implementation, the number of the plurality of optical subcarriers may be greater than the number of the plurality of independent data streams and two or more of the plurality of optical subcarriers may carry a single one of the plurality of independent data streams. In some implementations, the optical subcarriers may carry data with a different symbol rates, may have different data capacity, may have variable spacing between the optical subcarriers, may have different bandwidths, may carry clock recovery information in one optical subcarrier for multiple subcarriers, and/or may be modulated in accordance with the same or different modulation formats Consistent with an aspect of the present disclosure, a receiver may comprise circuitry configured to receive a plurality of optical subcarriers, each of which carrying data indicative of a respective one of a plurality of independent data streams, the plurality of optical subcarriers comprising a first subcarrier having a first bandwidth and a second subcarrier having a second bandwidth larger than the first bandwidth, and to convert the plurality of optical subcarriers into digital signals. Optionally, the receiver may further comprise a digital signal processor configured to receive the digital signals from the circuitry and recover clock information for the plurality of optical subcarriers from the second one of the optical subcarriers. The plurality of optical subcarriers may be Nyquist optical subcarriers. Consistent with an aspect of the present disclosure, an optical network may comprise a transmitter, comprising a digital signal processor receiving a plurality of independent data streams, the digital signal processor supplying outputs based on the plurality of independent data streams, the digital signal processor comprising a plurality of pulse shape filters corresponding to the plurality of independent data streams, the plurality of pulse shape filters configured to filter the independent data streams to produce a first subcarrier having a first frequency bandwidth and a second subcarrier having a second frequency bandwidth different than the first frequency bandwidth for the outputs; one or more digital-to-analog converter configured to convert the outputs of the digital signal processor to voltage signal outputs; a laser configured to output an optical light beam; and a modulator configured to modulate the optical light beam, based on the voltage signal outputs, to output a modulated optical signal including a plurality of optical subcarriers based on the outputs of the digital signal processor, wherein a first one of the plurality of optical subcarriers carries data indicative of a first one of the plurality of independent data streams, and a second one of the plurality of optical subcarriers carries data indicative of a second one of the plurality of independent data streams, and wherein the first one of the plurality of optical subcarriers has a first bandwidth and the second one of the plurality of optical subcarriers has a second bandwidth different than the first bandwidth. The optical network may further comprise a receiver, comprising circuitry configured to receive the plurality of optical subcarriers; and a digital signal processor configured to convert one or more of the plurality of optical subcarriers to output one or more of the plurality of independent data streams. The optical network of claim18may further comprise one or more optical add-drop multiplexer (OADM) configured to do one or more of: drop one or more of the optical subcarriers from the modulated optical signal from the transmitter and add one or more optical subcarrier to the modulated optical signal from the transmitter. Consistent with an aspect of the present disclosure, a transmitter may comprise a digital signal processor receiving a plurality of independent data streams, the digital signal processor supplying outputs based on the plurality of independent data streams; one or more digital-to-analog converter configured to convert the outputs of the digital signal processor to voltage signal outputs; a laser configured to output an optical light beam; and a modulator configured to modulate the optical light beam, based on the voltage signal outputs, to output a modulated optical signal including a plurality of optical subcarriers based on the outputs of the digital signal processor, wherein a first one of the plurality of optical subcarriers carries data indicative of a first one of the plurality of independent data streams, and a second one and a third one of the plurality of optical subcarriers carries data indicative of a second one of the plurality of independent data streams, such that a number of the plurality of optical subcarriers is greater than the number of the plurality of independent data streams. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.

11246658

BACKGROUND OF THE DISCLOSURE a. Field The present disclosure relates to low thermal mass ablation catheter tips (also known as high-thermal-sensitivity catheter tips) and to systems for controlling the delivery of RF energy to such catheters during ablation procedures. b. Background RF generators used during catheter ablation procedures are often set in a “temperature control” mode, and the power is initially set to a value that is sufficiently high (for example, 35 Watts) to create lesions in tissue and the tip temperature is set to, for example, 40° C. As soon as the tip reaches 40° C., the power is titrated down to a lower power setting such as, for example, 15 Watts to maintain the 40° C. target temperature. This can, however, create problems in that such lower power settings (e.g., 15 Watts) may be too low to create lesions that are deep enough to be effective for treating abnormal heart rhythms. The foregoing discussion is intended only to illustrate the present field and should not be taken as a disavowal of claim scope. BRIEF SUMMARY OF THE DISCLOSURE It is desirable to be able to control the delivery of RF energy to a catheter to enable the creation of lesions in tissue by keeping the generator power setting sufficiently high to form adequate lesions while mitigating against overheating of tissue. Various embodiments of the present disclosure are directed to a high-thermal-sensitivity ablation catheter tip. The ablation catheter tip including an electrically-conductive housing, a thermally-insulative tip insert, a plurality of thermal sensors, and a wired or wireless communication pathway. The electrically-conductive housing includes a conductive shell that surrounds at least a portion of the tip insert, and the thermally-insulative tip insert includes a plurality of longitudinally-extending sensor channels and a radially-extending sensor channel. The plurality of thermal sensors are in thermal communication with the conductive shell and provide directional temperature feedback. Each of the thermal sensors are circumferentially distributed around the tip insert in the plurality of longitudinally extending sensor channels and the radially-extending sensor channel. The wired or wireless communication pathway is communicatively connected to the plurality of thermal sensors and reports the directional temperature feedback to an ablation control system. In further more specific embodiments, the thermal sensors that are circumferentially distributed around the tip insert in the plurality of longitudinally extending sensor channels are radially offset relative to the thermal sensors that are circumferentially distributed around the tip insert in the radially-extending sensor channel. Some embodiments of the present disclosure are directed to ablation tips for an ablation catheter. The ablation tip includes a thermally and electrically conductive housing, a thermally-insulative tip insert, and a plurality of thermal sensors. The thermally and electrically conductive housing includes a conductive shell that comprises an inner surface, and surrounds at least a portion of the tip insert. The thermally-insulative tip insert includes a plurality of longitudinally-extending sensor channels and a plurality of longitudinally-extending lead wire channels positioned between the plurality of longitudinally-extending sensor channels. The plurality of thermal sensors are circumferentially distributed around the tip insert in the plurality of longitudinally extending sensor channels and in thermally-transmissive contact with the inner surface of the conductive shell. Each of the plurality of thermal sensors receive and report temperature feedback received through the conductive shell via the wired or wireless communication pathway which is communicatively connected to the plurality of thermal sensors and an ablation control system. Yet other embodiments of the present disclosure are directed to an ablation catheter tip having high-thermal-sensitivity. The ablation catheter tip includes a thermally-insulative ablation tip insert, a conductive shell, and a shank. The thermally-insulative ablation tip insert includes a first portion and a second portion, where the first portion of the tip insert includes a plurality of longitudinally-extending sensor channels and a radially-extending sensor channel. The insert supports a plurality of temperature sensors circumferentially distributed around the tip insert in the plurality of longitudinally extending sensor channels and the radially-extending sensor channel. The temperature sensors form proximal and distal circumferential rings. The conductive shell includes a shell distal end portion and a shell proximal end portion, where the conductive shell is adapted to fit around the first portion of the insert in thermally-conductive contact with the plurality of temperature sensors in the proximal and distal circumferential rings. The shank is adapted to cover the second portion of the insert, whereby the conductive shell and the shank are conductively connected and together effectively encase the ablation tip insert. The foregoing and other aspects, features, details, utilities, and advantages of the present disclosure will be apparent from reading the following description and claims, and from reviewing the accompanying drawings.

11390116

This is a National Phase application filed under 35 U.S.C. § 371, of International Application No. PCT/JP2018/014215, filed Apr. 3, 2018, the contents of which are incorporated by reference TECHNICAL FIELD The present invention relates to a front axle beam and a production method thereof. BACKGROUND ART Usually, front wheels of a vehicle body (for example, front wheels of a motor truck, a bus or the like, excluding motor cycles) are attached to a front axle beam (which will be hereinafter referred to as a “front axle” in some cases), and the front axle beam with the front wheels attached thereto is used to support the vehicle body. The front axle is important as a part for transmitting the load of the vehicle body to the right and left front wheels and as a structure maintaining part. The front axle keeps the wheels in fixed positions and ensures steerability of the front wheels, thereby ensuring driving stability. Also, at a time of braking, the front axle functions as a braking force transmission route. Thus, the front axle is a part which strongly affects traveling performance, steering performance and braking performance. The front axle is required to have high rigidity and therefore is heavy. From the viewpoint of fuel efficiency, on the other hand, weight reduction of the front axle is demanded. For driving stability, generally, heavy parts are arranged at low levels with respect to the vehicle height direction. Therefore, it is preferred that an engine, which is to be mounted on the front axle, is positioned at a low level with respect to the vehicle height direction. On both ends of the front axle, king-pin attachment parts are provided. An underbody is connected to the front wheels. Kingpins pass through the respective king-pin attachment parts along the body height direction from above and are inserted into the underbody attached to the front wheels. Thus, the kingpins connect the front axle and the wheels together. In this structure, when the vehicle body is steered, the front wheels turn about the respective kingpins. To form this structure of the vehicle body, the front axle is, for example, shaped like a bow of which center portion with respect to the vehicle width direction is at a low level and of which end portions with respect to the vehicle width direction are at a high level as shown inFIG. 2. The front axle has an H-shaped cross section, but unlike an H-steel, the front axle is not produced by a universal rolling machine. This is because it is impossible to form the bow-like shape by using a universal rolling machine. A front axle is usually produced by die forging. In a case of producing a front axle by die forging, it is necessary to make draft angles Q and Q′ as shown inFIG. 14, for example, for release of the product from the dies. This creates limitations on the shape of the front axle and eventually constrains improvement of the front axle in rigidity. Japanese Patent Application Publication No. 2003-285771 (Patent Literature 1) provides a front axle that decreases aerodynamic drag while the vehicle is running. The object of the invention disclosed in Patent Literature 1 is to decrease aerodynamic drag and thereby to improve fuel efficiency. Methods for producing a front axle have been provided up to now. Japanese Patent Application Publication No. 2009-106955 (Patent Literature 2) discloses a method for producing an axle beam with a right and a left spring attachment seat. In this production method, one of the spring attachment seats is press formed at a first pressing step, and the other spring attachment seat is press formed at a second pressing step. One of the measures to reduce the weight of a front axle is increasing the rigidity of the front axle. An increase in the rigidity of a front axle will permit the front axle to have rigidity comparable to the rigidity of a conventional front axle while having a lighter weight and/or a smaller size. An increase in the rigidity of the front axle also will permit the front axle to improve various properties associated with rigidity while keeping the cross-sectional size and/or the weight same as those of a conventional front axle. Therefore, a new technique for increasing the rigidity of a front axle is demanded. Meanwhile, around such a front axle, an engine and movable parts for steering are densely arranged. Accordingly, the front axle is required to be fitted in a small space without interfering with these surrounding parts. Therefore, a technique for increasing the rigidity of a front axle without increasing the cross-sectional size of the front axle is especially demanded. CITATION LIST Patent Literatures Patent Literature 1: Japanese Patent Application Publication No. 2003-285771 Patent Literature 2: Japanese Patent Application Publication No. 2009-106955 SUMMARY OF INVENTION Technical Problem In the circumstances, an object of the present invention is to provide a front axle beam with increased rigidity, and a production method of the front axle beam. Solution to Problem A production method according to an embodiment of the present invention is a method for producing a front axle beam including a beam part, the beam part including a web part and flange parts joined on both sides of the web part and having an H-shaped cross section. In the production method, a material is forged by dies which are paired with each other at a central axis of the web part in the cross section of the beam part. Further, at least one specified flange part, which is at least one of the flange parts, is bent toward another one of the flange parts that is opposed to the specified flange part. A front axle beam according to an embodiment of the present invention is a front axle beam including a beam part including a web part and flange parts joined on both sides of the web part and having an H-shaped cross section. In the cross section of the beam part, a space between an edge of at least one specified flange part, which is one of the flange parts, and an edge of another one of the flange parts that is opposed to the specified flange part is narrower than a length of the web part. Advantageous Effects of Invention The present invention provides a front axle beam with high rigidity. The production method according to the present invention facilitates production of the front axle beam.

11303229

BACKGROUND Generation of electrical energy is a fundamental technique for our society's energy needs. Conversion of the thermal energy contained in a plasma flame, such as a cylinder in an internal combustion engine, is an example of the utilization of thermal energy to provide for its conversion into mechanical energy. If thermal energy is available, a complicated and expensive device, such as a Carnot engine or Stirling cycle engine, is used to convert the heat energy from a hot sink and a cold sink into mechanical energy. The limitations to such devices are the temperature differentials between the two heat sources must be substantial. Efficiencies in the range of 15 to 30% are typical for the larger engines. Small temperature differences, such as a few degrees Celsius, are of little practical value. Other methods such as direct thermoelectric conversion using devices, such as a thermocouple, suffer the same lack of practical utility when the temperature differences are small. A convenient and direct method for the conversion of thermal energy to electrical energy is a much needed and desirable method for generating electrical power.

11332792

TECHNICAL FIELD The disclosure relates to methods, algorithms and compositions for determining disease risk based upon mitochondrial heteroplasmy. BACKGROUND The mammalian mitochondrial genome (mtDNA) is a double-stranded DNA molecule that is transmitted through the maternal line. The human mitochondrial DNA is a ringed two-chain molecule consisting of 16,569 nucleotide pairs that encode 37 genes. Twenty-two genes encode transport RNAs (tRNAs), 2 genes encode ribosomal RNAs (rRNAs), and 13 genes encode subunits of the respiration chain complex such as cytochrome B, ATPase, cytochrome-C-oxidase, and NADH-dehydrogenase. A mitochondrion usually contains multiple copies of its genome. The maternally inherited mitochondrial genome is characteristically unstable; thus, the occurrence of somatic mutations during the life of an individual is common. The penetrance and expressivity of such mutations vary widely between families, and between relatives (in the maternal line) within a family. Although many factors influence penetrance and expressivity, two main factors are genotype and the level of heteroplasmy (mixture of mutant and normal DNA molecules). Heteroplasmy is defined as the presence of a mixture of more than one type of an organellar genome within a cell or individual. Pathogenic mtDNA mutations are usually heteroplasmic, with a mixture of mutant and wild-type mtDNA within the same organism. A woman harboring one of these mutations transmits a variable amount of mutant mtDNA to each offspring. SUMMARY Inheritance and penetrance of mtDNA mutations is not Mendelian, but rather depends on the relative amount (%) of wild-type and mutant mtDNA molecules per cell. The normal state is 100% wild-type mtDNA or wild-type homoplasmy. A mutation in mtDNA can also be homoplasmic (present in all mtDNA molecules of a cell) in which case it is likely to have a functional and possibly pathogenic effect. The presence of a mixture of mutant and wild-type mtDNA molecules in an individual cell is referred to as heteroplasmy. Because normal cells have an excess capacity of mtDNA and mtDNA-encoded proteins, heteroplasmic mutant mtDNA are believed to cause an altered functional (or pathogenic) phenotype if the mutant mtDNAs are present at levels exceeding some threshold value, usually 70-90%. An additional consequence of heteroplasmy is the development of altered functions of mitochondria within a single cell, between cells and between tissues. Heteroplasmy has been associated with aging and disease in humans. The vast majority of deleterious mtDNA point mutations are heteroplasmic and their mutant load can vary significantly among different tissues, even in the same subject. Heteroplasmic mtDNA defects are considered an important cause of human disease with clinical features that primarily involve nondividing (postmitotic) tissues. The proportion of mutant out of total mtDNA in a cell, called the heteroplasmy level, is an important factor in determining the amount of mitochondrial dysfunction and therefore the disease severity. The disclosure provides a panel of mtDNA mutations that are useful in predicting human health conditions and disease risk, and can be used for monitoring treatments. The disclosure describes strong associations between numerous mtDNA mutations and human health conditions and disease risk. The mtDNA health panel will include both known mtDNA mutations that have been demonstrated to cause inherited diseases and novel mtDNA discoveries made in the course of the studies described herein. The disclosure provides a method of determining a risk of a clinically relevant cognitive decline comprising: (a) isolating mtDNA; (b) measuring a heteroplasmy at 10158 of the mtDNA; (c) determining the frequency of 10158T compared to 10158C; wherein when the frequency of 10158C is greater than 10% of the total number of alleles (10158C+10158T) then the subject is at risk for clinically significant cognitive decline as measured by the Modified Mini-Mental State Examination. The disclosure also provides a method of determining a risk of a clinically relevant vision loss comprising: (a) isolating mtDNA; (b) measuring a heteroplasmy at 11778 of the mtDNA; (c) determining the frequency of 11778A compared to 11778G; wherein when the frequency of 11778A is greater than 9.5% of the total number of alleles (11778A+11778G) then the subject is at risk for clinically significant vision loss as measured by contrast sensitivity testing. The disclosure also provides a method of determining a risk of a clinically relevant mobility decline comprising: (a) isolating mtDNA; (b) measuring a heteroplasmy at 5703 of the mtDNA; (c) determining the frequency of 5703A compared to 5703G; wherein when the frequency of 5703A is greater than 11% of the total number of alleles (5703A+5703G) then the subject is at risk for clinically significant mobility decline as measured by 400 m walking speed. The disclosure provides a method of determining a risk of a clinically relevant hearing loss comprising: (a) isolating mtDNA; (b) measuring a heteroplasmy at 7445 of the mtDNA; (c) determining the frequency of 7445A compared to 7445G; wherein when the frequency of 7445A is greater than 25% of the total number of alleles (7445A+7445G) then the subject is at risk for clinically significant high frequency hearing loss as measured by high frequency hearing testing. The disclosure provides a method of determining a risk of a clinically relevant cognitive decline that includes a) isolating mtDNA from a tissue sample; (b) determining the presence and frequency of at least one mutation in a nucleic acid sequence encoding at least one subunit of mitochondrial complex I, wherein the presence of at least one mutation correlates with risk of clinically relevant cognitive decline; (c) quantitiating the degree of heteroplasmy at the site of the at least one mutation; and (d) correlating the presence of the at least one mutation and the degree of heteroplasmy with the risk of having clinically relevant cognitive decline. The disclosure further provides a method of predicting a human subjects predisposition for developing a mitochondrial-associated disease, the method including (a) determining the presence and frequency of at least one mutation in a nucleic acid sequence encoding at least one subunit of mitochondrial complex I; (b) determining the degree of heteroplasmy at the site of the at least one mutation; (c) correlating the presence of the at least one mutation and the degree of heteroplasmy with at least one additional risk factor indicative of a mitochondrial-associated disease. In general the presence of increased heteroplasmy at the site of the at least one mutation, and the presence of at least one risk factor associated with a mitochondrial-associated disease correlates with an increased likelihood of the human subject developing the mitochondrial-associated disease. In some aspects the disclosure provides mitochondrial mutations in a nucleic acid sequence encoding at least one subunit of mitochondrial complex I. Such mutations include, but are not limited to, m.10158T>C, m.10191T>C, m.10197G>A, m.13091T>C, m.13513G>A, m.13514A>G, m.14487T>C, m.15244A>G, m.5046G>A, m.1703C>T, m.2850C>T, m.2639C>T, m.3915G>A, m.10589G>A, m.15758A>G, m.6776T>C, m.3918G>A, m.6152T>C, m.11899T>C, m.11778G>A, and m.15244A>G. The disclosure further provides a method of determining a treatment plan for a subject predisposed for developing a mitochondrial-associated disease. The method includes (a) determining the presence and frequency of at least one mutation in a nucleic acid sequence encoding at least one subunit of mitochondrial complex I; (b) determining the degree of heteroplasmy at the site of the at least one mutation; (c) correlating the presence of the at least one mutation and the degree of heteroplasmy with at least one additional risk factor indicative of a mitochondrial-associated disease. In general the presence of increased heteroplasmy at the site of the at least one mutation, and the presence of at least one risk factor associated with a mitochondrial-associated disease correlates with an increased likelihood of the human subject developing the mitochondrial-associated disease. Such methods further include generating a risk assessment based on the correlation and devising a treatment plan based on the risk assessment. The treatment plan can be generated from a treatment protocol database that is populated with one or more treatment protocols that provide guidelines for treating patients with the correlation. The disclosure provides a system for generating a treatment protocol for a subject having, or predisposed for developing, a mitochondrial-associated disease. The system includes: (a) a processor; (b) a patient database that receives patient data from a treating provider. The patient data includes: (i) identification of the presence and frequency of at least one mutation in a nucleic acid sequence encoding at least one subunit of mitochondrial complex in a biological sample comprising mitochondria obtained from the patient; (ii) identification of the degree of heteroplasmy at the site of the at least one mutation in a biological sample comprising mitochondria obtained from the patient; (iii) a correlation of the presence of the at least one mutation and the degree of heteroplasmy with at least one risk factor indicative of a mitochondrial-associated disease, wherein the correlation is indicative of increased likelihood of a negative clinical outcome. The system further includes (c) a treatment protocol database that is populated with one or more treatment protocols that provide guidelines for treating patients with the correlation of b), iii) above. The system includes a means for determining a treatment protocol. The disclosure further discloses a computer system for generating a personalized health plan that includes: (a) a database comprising a mitochondrial genomic profile of a subject; (b) a processor for: (i) determining the degree of heteroplasmy for at least one nucleotide position of the mitochondrial genome of the subject based on the database of (a); (ii) correlating the degree of heteroplasmy of (b) (i) with the risk of having a clinically relevant mitochondrial-associated disease or condition; (iii) optionally correlating the degree of heteroplasmy determined in (b) (i), and the risk of having a clinically relevant mitochondrial-associated disease or condition in (b) (ii), with at least one additional phenotypic characteristic of the subject; and (iv) generating a personalized health plan based on (b) (i), (ii), and (iii). The computer system includes (c) a means for outputting the personalized health plan to the subject or health care manager of the subject. The personalized health plan optionally includes a recommendation(s) for alleviating the symptoms associated with clinically relevant mitochondrial-associated disease or condition. In any of the foregoing, the mtDNA is isolated from a mitotic or postmitotic cell population. In a further embodiment, the postmitotic cell population comprises platelet cells. In another embodiment, the mtDNA is obtain from blood. In yet another embodiment, the mtDNA is obtain from a tissue selected from the group consisting of muscle, brain, skin, liver, kidney, urogenital and intestine.

11528784

CROSS-REFERENCES TO RELATED APPLICATIONS This application is the U.S. National Stage of International Application No. PCT/EP2018/076949, filed Oct. 4, 2018, which designated the United States and has been published as International Publication No. WO 2019/081171 A1 and which claims the priority of German Patent Application, Serial No. 10 2017 218 832.5, filed Oct. 23, 2017, pursuant to 35 U.S.C. 119(a)-(d). BACKGROUND OF THE INVENTION The invention relates to a door for a household microwave appliance, having at least one perforated, electrically conductive lattice, in particular metal lattice, which covers a viewing opening of the door and has a plurality of microholes arranged in a regular pattern. The invention also relates to a household microwave appliance with such a door. The invention is particularly advantageously able to be applied to standalone household microwave appliances and ovens with microwave functionality. For example, U.S. Pat. No. 3,679,855 A, DE 32 31 516 A1 and EP 0 042 616 B1 disclose a door for a microwave appliance, which has a standalone perforated metal lattice, which covers a viewing opening of the door and has a plurality of round holes arranged in a regular pattern. WO 2016/179317 A1, U.S. Pat. No. 4,010,343 A or EP 2 020 827 B1 disclose a shielding for a viewing opening of a door of a microwave appliance in the form of a metallic mesh. DE 39 23 734 C1, DE 103 072 17 A1 disclose glass windows for doors of microwave appliances, which are coated with a thin-film shielding e.g. made of aluminum, copper, tin, tin oxide, carbon nanotubes etc. DE 102 014 23 A1 discloses shielding in the form of an electrically conductive coating in the viewing area, wherein the coating is embodied in a strip-shaped or diamond-shaped manner. Shield lattices for airplane windows made of metal-coated polyester fibers are known from US 2014/0319276 A1. EP 0 503 899 B1 discloses a microwave shielding for a viewing opening of a door of a microwave appliance in the form of a layered lattice. The thickness of the lattice amounts to approx. 0.2 micrometers. Metal lattices mostly used in household microwave appliances have round holes arranged in a triangular pattern, which have a diameter of approx. 1.5 mm and are arranged with a pitch of approx. 2.5 mm. BRIEF SUMMARY OF THE INVENTION The object of the present invention is to at least partially overcome the disadvantages of the prior art and in particular to provide a microwave-sealed shielding for a viewing opening of a door of a microwave appliance, which combines a particularly advantageous combination of the properties: preventing an escape of microwave radiation from the viewing opening, keeping the microwave losses in the shielding low and having good optical visibility through the shielding. This object is achieved in accordance with the features of the independent claims. Advantageous embodiments are the subject matter of the dependent claims, the description and the drawings. The object is achieved by a door for a household microwave appliance, having at least one perforated electrically conductive lattice, which covers a viewing opening of the door and has a plurality of microholes arranged in a regular pattern, wherein the microholes have a rectangular basic shape with rounded corners. This door produces the advantage that microwave losses in the shielding are kept particularly low and it is possible to maintain a good level of optical transparency for an observer in a front view and a very good level of attenuation against microwaves being allowed to pass through. In this context, the rounded corners cause an electrical current density induced by the microwaves to be reduced at the corners compared to a pointed or sharp corner, which means that microwave losses are reduced. This also produces the advantage that a reliability of an electrical connection over various regions of the lattice is increased. This in turn prevents an aging-related reduction of the shielding effect. The rounded corners may also be referred to as defined radii, as the rounding-off is introduced or manufactured with at least one predefined radius. The perforation of the lattice is brought about by the microholes. Microholes may be understood to mean holes in general which have a width (e.g. represented by a diameter or an edge length) in the sub-millimeter range. In principle, the lattice may be present as a standalone, e.g. prefabricated lattice. In one development, the lattice is a metal lattice. The metal lattice may consist entirely of metal, such as steel, aluminum and/or copper etc., or may be metal-coated. For example, the metal may be or contain steel, aluminum and/or copper (e.g. in the form of a mixture or alloy). The use of a metal lattice produces the advantage that the microholes are able to be created with a low manufacturing outlay and in a particularly precise manner. Alternatively, the lattice may consist of carbon nanotubes or another electrically conductive material, e.g. carbon nanotubes, electrically conductive ceramic etc. The viewing opening of the door may be covered by exactly one lattice or by a plurality of lattices arranged one behind the other. The viewing opening of the door may in particular be covered by two lattices, which for example are arranged on a front side and on a rear side of a viewing pane. If a plurality of lattices are present, then their microholes are advantageously arranged such that they overlap one behind the other, in order to retain a good level of transparency. It is also advantageous if the microholes of a plurality of lattices have the same shape and/or size. It is particularly advantageous if the plurality of lattices have identically shaped and arranged microholes or patterns. A rectangular basic shape may be understood to mean a shape which is rectangular up until the rounded corners. In one development, the rectangular basic shape is a square basic shape, which enables a particularly even distribution of the current density in the lattice. In one embodiment, the at least one perforated lattice is a layer applied to a transparent door pane. This makes it possible to provide a particularly thin lattice, in particular metal lattice. A layered metal lattice advantageously consists of aluminum and/or copper or alloys thereof, in order to achieve a particularly low ohmic resistance, which in turn is advantageous for a good level of shielding power and low losses. In one development, the lattice is present in the form of a printed electrically conductive dye. In one development, the lattice is a microcontact-printed lattice or has been applied by means of a microcontact printing. The microcontact printing produces the advantage that micrometer-scale patterns are able to be applied to the door pane in a simple manner. This may advantageously be performed without using a cleanroom. It is possible to manufacture multiple identical stamps by means of a single “master” stamp. The stamps are able to be used to manufacture prints many times with very little wear. In addition, only little energy is consumed to manufacture the prints. In one development, the lattice is a vapor-deposited lattice. In this context, for example, CVD or PVD methods may be used for the application. In one development, the lattice is a sputtered-on lattice. A magnetron sputtering may be used for the application in this context, for example. The magnetron sputtering may use a guided beam or a mask, in order to apply the lattice. In the microcontact printing, in particular an electrically conductive pattern is first applied to a door pane, and if required the layer thickness thereof is subsequently increased, e.g. by galvanization without external current. In this context, the materials of the microcontact printing and of the galvanization may be different. In particular, the lattice may practically only consist of the material applied by galvanization. The door pane may be a glass pane or a plastic pane. In one embodiment, the predefined radius of the rounded corners lies between 7 micrometers and 15 micrometers. This has emerged as a value range which is particularly advantageous for reducing local current density peaks in the corners and simultaneously for keeping an area of the microholes large for good transparency. In one embodiment, a cumulative layer thickness of the at least one perforated lattice lies between 2 micrometers and 5 micrometers. This embodiment is based on the observation that a precision of the introduction of the microholes is significantly reduced for layer thicknesses of more than five micrometers. This in turn hinders a targeted, uniform reduction of the current density peaks and may lead to local fluctuations in the optical transparency. On the other hand, it has been shown that for cumulative layer thicknesses of less than two micrometers, the ohmic resistance drops so far that losses in the lattice and/or a leakage of microwaves through the lattice increase significantly. If exactly one microwave-shielded lattice is present, then a “cumulative” layer thickness is understood to mean its layer thickness. If a plurality of microwave-shielded lattices arranged one behind the other are present on the door in a front view, then the “cumulative” layer thickness is understood to mean the added or common layer thickness of all lattices. In one embodiment, the at least one perforated lattice is exactly one lattice, the layer thickness of which lies between 2.5 micrometers and 5 micrometers. This produces the advantages for exactly one lattice described above. For a single-layer lattice made of copper, for example, a layer thickness between 2.5 micrometers and 5 micrometers may be particularly advantageous. For a single-layer lattice made of aluminum, for example, a layer thickness of approx. three micrometers may be particularly advantageous. In one embodiment, the at least one perforated lattice has a plurality of lattices arranged one behind the other on the door in a front view, the cumulative layer thickness of which lies between 2 micrometers and 5 micrometers. This produces the advantages for a plurality of lattices described above. In particular, if two lattices are present, then these may have a layer thickness of one micrometer in each case. Nevertheless, the upper limit of five micrometers is retained, e.g. due to manufacturing tolerances when positioning the lattice on a viewing pane, which may lead to a lateral offset of the lattices in relation to one another, which in turn hinders an optical transparency. In one embodiment, the microholes are arranged in a rectangular matrix shape. This produces the advantage that particularly low current density peaks can be achieved. A rectangular matrix shape may, in particular, be understood to mean a shape of an arrangement in which the microholes are arranged uniformly along notional rows and columns running at right angles thereto. The microholes of adjacent rows or columns have no longitudinal offset in relation to one another—for example as opposed to a triangular pattern. The rectangular matrix shape may, in particular, be a square matrix shape, in which a distance between the rows and columns, or the microholes along the rows and columns, respectively, is equal. This advantageously causes a particularly even distribution of the current densities in the lattice. The particularly even distribution of the current densities in the lattice is also supported by the edges of the microholes in particular running parallel to the rows and columns, i.e. not arranged in the manner of a rhombus in the pattern. In one embodiment, a width of strip regions of the lattice which delimit the microholes is at least three times, in particular at least four times as great as a thickness of the lattice. This produces the advantage that it is possible to achieve a particularly even width of the strip region of the lattice, which reduces an inhomogeneous current density distribution in the strip regions further still and thus a danger of damage to the lattice. A “strip region” of the lattice may in particular be understood to mean a material strip of the lattice with parallel, straight longitudinal sides, the longitudinal sides of which adjoin the microholes. The width of the material strip corresponds in particular to a following distance between directly adjacent microholes of adjacent rows or columns of the matrix pattern. In a rectangular matrix pattern, the width of the material strips of the columns (“vertical” material strips) and the width of the material strips of the rows (“horizontal” material strips) may be different. In a square matrix pattern, their width is the same. This embodiment is particularly advantageous in connection with the cumulative layer thickness between 2 micrometers and 5 micrometers, as for greater layer thicknesses and correspondingly enlarged microholes the leakage of microwaves through the lattice increases once more. The reason for this may lie in that a higher conductivity of the lattice is not able to compensate for an increased permeability of the lattice for microwaves due to enlarged microholes. In one development, a width of the strip regions of the lattice is no more than five times, in particular no more than four times as great as a thickness of the lattice. This produces the advantage that a transparency is particularly high. In one embodiment, a pitch of adjacent microholes lies between 50 micrometers and 100 micrometers. This embodiment produces the advantage that a particularly advantageous compromise is made between good transparency, low losses and high shielding effect. A “pitch” of adjacent microholes may in particular be understood to mean a center-to-center distance between directly adjacent microholes (i.e. not arranged obliquely in relation to one another). In a rectangular matrix pattern, the pitch along the columns and the pitch along the rows may differ. In a square matrix pattern, their pitch is the same. In one embodiment, the microholes have an edge length between 30 micrometers and 100 micrometers, in particular between 40 micrometers and 75 micrometers. Such an edge length enables a good level of transparency, in particular across the entire optical spectrum. Lower edge lengths for example may lead to a significant refraction of the light at the edges of the microholes. Higher edge lengths may lead to a loss of the visible homogeneity. An edge length may in particular be understood to mean a full height or width of the microholes. In one embodiment, the household microwave appliance is a dedicated microwave appliance (“standalone appliance”). In another embodiment, the household microwave appliance is a microwave combination appliance. The microwave combination appliance may in particular be an oven with microwave functionality. The door is then a microwave-sealed oven door. The object is also achieved by household microwave appliance, which has such a door. The household microwave appliance may be embodied in the same way as the door and has the same advantages. The object is further achieved by a viewing pane as described above.

11261267

FIELD OF THE DISCLOSURE The present disclosure relates to a photocurable composition, particularly to a photo-curable composition for inkjet adaptive planarization adapted for forming photo-cured layers having a low thermal shrinkage during subsequent baking treatment. BACKGROUND Inkjet Adaptive Planarization (IAP) is a process which planarizes a surface of a substrate, e.g., a wafer containing an electric circuit, by jetting liquid drops of a photocurable composition on the surface of the substrate, and bringing a flat superstrate in direct contact with the added liquid to form a flat liquid layer. The flat liquid layer is typically solidified under UV light exposure, and after removal of the superstrate a planar polymeric surface is obtained, which can be subjected to subsequent processing steps, for example baking, etching, and/or further deposition steps. Subsequent baking of the formed photocured layer is often conducted at a temperature above its glass transition temperature. The baking typically causes forming of a denser packing of the polymeric layer, which leads to an undesired shrinking of the layer and can be a further challenge to the planarization efficiency. Typically, the thermal shrinking during baking is larger than the shrinking during the photo-curing of the photocurable composition. There exists a need for improved IAP materials leading to planar photo-cured layers with low shrinkage during subsequent processing. SUMMARY In one embodiment, a photocurable composition can comprise a photoinitiator and a polymerizable material, wherein the polymerizable material may comprise a mono-functional acrylate monomer having a structure of formula (1), with R1 being H or C1-C6alkyl, and R2 and R3 being one or more substitutions of C1-C10alkyl or alkyl-aryl, and R4, R5 being H or C1-C10alkyl, an amount of the acrylate monomer of formula (1) can be at least 10 wt % and not greater than 30 wt % based on the total weight of the polymerizable material; and a carbon content of a photo-cured layer of the photocurable composition can be at least 74%. In one aspect, the polymerizable material can further comprise at least one multi-functional acrylate monomer. In a particular aspect, the at least one multi-functional acrylate monomer can include a bi-functional acrylate monomer, a tri-functional acrylate monomer, a tetra-functional acrylate monomer, or any combination thereof. In a certain particular aspect, the at least one multi-functional acrylate monomer can include bisphenol A dimethacrylate (BPADMA). In another certain aspect of the photocurable composition, the amount of the multi-functional acrylate monomer can be at least 10 wt % and not greater than 30 wt % based on the total weight of the polymerizable material. In a particular embodiment of the photocurable composition, the mono-functional acrylate monomer can have a structure of formula (2), with R1 being H or CH3: In one aspect, the amount of the mono-functional acrylate monomer of formula (2) can be not greater than 25 wt % based on the total weight of the polymerizable material. In another aspect, the amount of the mono-functional acrylate monomer of formula (2) may be not greater than 15 wt % based on the total weight of the polymerizable material. In a further embodiment, the photocurable composition can be adapted that a photo-cured layer of the composition has a thermal shrinkage of not greater than 7.5 percent, the thermal shrinkage being a difference in thickness of the photo-cured layer before and after being subjected to a baking treatment at 250° C. for 2 minutes. In another aspect, the viscosity of the photocurable composition can be not greater than 15 mPa·s. In yet a further aspect, the photocurable composition can be adapted that a photo-cured layer of the composition has an Ohnishi number not greater than 2.9. In one embodiment, a laminate can comprise a substrate and a photo-cured layer overlying the substrate, wherein the photo-cured layer is formed from the above-described photocurable composition. In one aspect of the laminate, the photo-cured layer can have a thermal shrinkage of not greater than 7 percent, the thermal shrinkage being a difference in thickness of the photo-cured layer before and after being subjected to a baking treatment at 250° C. for 2 minutes. In another aspect of the laminate, the photo-cured layer can have an Ohnishi number of the greater than 2.9. In a further embodiment, a method of forming a photo-cured layer on a substrate, can comprise: applying a layer of a photocurable composition on the substrate, wherein the photocurable composition can comprise a photoinitiator and a polymerizable material. The polymerizable material may comprise 10 wt % to 30 wt % of a mono-functional acrylate monomer having a structure of formula (1), with R1 being H or C1-C6alkyl; R2 and R3 being one or more substitutions of C1-C10alkyl or alkyl-aryl; and R4, R5 being H or C1-C10alkyl, bringing the photocurable composition into contact with a superstrate; irradiating the photocurable composition with light to form a photo-cured layer; and removing the superstrate from the photo-cured layer. In one aspect of the method, the photo-cured layer can have a thermal shrinkage of not greater than 7.5 percent, the thermal shrinkage being a difference in thickness of the photo-cured layer before and after being subjected to a baking treatment at 250° C. for 2 minutes. In a further aspect of the method, the viscosity of the photocurable composition may be not greater than 15 mPa·s. In a certain aspect of the method, the photocurable composition can further comprise bisphenol A dimethacrylate (BPADMA) in an amount of 10 wt % to 30 wt % based on the total weight of the polymerizable composition. In another embodiment, a method of forming an article can comprise: applying a layer of a photocurable composition on a substrate, wherein the photocurable composition can comprise a photoinitiator and a polymerizable material, the polymerizable material comprising 10 wt % to 30 wt % of a mono-functional acrylate monomer having a structure of formula (1), with R1 being H or C1-C6alkyl; R2 and R3 being one or more substitutions of C1-C10alkyl or alkyl-aryl; and R4, R5 being H or C1-C10alkyl, bringing the photocurable composition into contact with a superstrate; irradiating the photocurable composition with light to form a photo-cured layer; removing the superstrate from the photo-cured layer; forming a pattern on the substrate; processing the substrate on which the pattern has been formed in the forming; and manufacturing an article from the substrate processed in the processing.

11539888

CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the priority of the Chinese Patent Application No. 202010187207.X, filed with China National Intellectual Property Administration on Mar. 17, 2020, the disclosure of which is herein incorporated by reference in its entirety. TECHNICAL FIELD The disclosure relates to the field of data processing, and in particular to a method for processing video data, apparatus, electronic equipment, and storage medium. BACKGROUND In the process of shooting video, an anti-shake shooting function that makes captured video pictures clearer and more stable has become one of indispensable functions of shooting video applications. However, the anti-shake shooting function provided by existing applications has a single processing method for video pictures. With the emergence of shooting devices with multiple cameras, focal lengths of different cameras are often different, and the video pictures captured are also different. The single processing method of application for the video pictures causes the stability and definition of the captured video pictures to be greatly reduced, and the anti-shake shooting performance is poor. SUMMARY According to a first aspect of the implementations of the disclosure, a method for processing video data is provided. The method for processing video data includes: switching to a target anti-shake shooting mode in response to acquiring a switching operation in a video shooting interface; acquiring a video editing operation corresponding to the target anti-shake shooting mode; obtaining target video data by processing the video data collected in real time based on the video editing operation; and outputting the target video data in the video shooting interface. According to a second aspect of the implementations of the disclosure, an apparatus for processing video data is provided. The apparatus for processing video data includes an operation response module configured to switch to a target anti-shake shooting mode in response to acquiring a switching operation in a video shooting interface; a video processing module configured to acquire a video editing operation corresponding to the target anti-shake shooting mode and obtain target video data by processing the video data collected in real time based on the video editing operation; and a video output module configured to output the target video data in the video shooting interface. According to a third aspect of the disclosure, there is provided electronic equipment. The electronic equipment includes a processor and a memory for storing instructions executable by the processor. The processor is configured to implement the method for processing video data as described in any one of the implementations of the first aspect. According to a fourth aspect of the disclosure, there is provided a storage medium having a computer instruction stored thereon, when the computer instruction being executed by a processor of an electronic device, enable the electronic device to implement the method for processing video data as described in any one of the implementations of the first aspect. According to a fifth aspect of the implementations of the disclosure, there is provided a computer program product including a computer program, the computer program is stored in a readable storage medium, and the computer program is read from the readable storage medium and executed by at least one processor of a device, so that the device executes the method for processing video data described in any one of the implementations of the first aspect. It should be understood that the above general description and the following detailed description are only example and explanatory, and cannot limit the disclosure.

11512769

BACKGROUND AND SUMMARY OF THE INVENTION The invention relates to a liquid-lubricated motor vehicle device having a ventilation installation. A motor vehicle device having a device interior space in which a water-containing lubricant is received for lubricating at least one component disposed in this device interior space is known from DE 10 2010 025980 A1. The invention is described hereunder in the context of a water-containing lubricant; this description is not to be understood as a limitation of the invention. Water-containing lubricants in comparison to conventional lubricants offer advantages in particular with a view to efficiency and in particular also in terms of thermal behavior. The lubricating properties of such a water-containing lubricant depend inter alia on the water content in this lubricant. In the operation of a motor vehicle device, temperatures in the lubricant can be reached such that water is converted to water vapor and escapes from the motor vehicle device. It is the object of the invention to provide a motor vehicle device having a water-containing lubricant, wherein the variability of the water content in this water-containing lubricant is improved in comparison to a conventional motor vehicle device, that is to say that the variability of the water content is kept almost constant during the operation of the motor vehicle device. This object is achieved by a motor vehicle device as claimed in the independent claim; preferred embodiments of the invention are the subject matter of the dependent claims. In the context of the invention, a motor vehicle device is to be understood to be a device in a motor vehicle, and preferably a transmission installation, and particularly preferably a transmission installation in the drivetrain for transmitting the drive forces for overcoming rolling resistances. This motor vehicle device has a device interior space in which at least one and preferably a multiplicity of components, which in the operation of the motor vehicle device is/are at least temporarily lubricated by a lubricant, is/are disposed. Such a component is preferably understood to be a gear wheel, a bearing, a shifting element, or a shaft, in particular a transmission shaft. This lubricant is furthermore received in this device interior space or for lubricating the at least one component is incorporated into this device interior space. This lubricant is furthermore configured as a water-containing lubricant. A water-containing lubricant in the context of the invention is to be understood to be a lubricant which comprises at least 5% or more by volume of water, the remaining components of this lubricant potentially being solids, preferably so-called nanoparticles, or water-soluble substances. Water-containing lubricants per se are known from the prior art and are in some instances also referred to as water-based lubricants. The operating properties of the motor vehicle device can in particular be improved by using water-containing lubricants. The motor vehicle device preferably has a ventilation installation for pressure equalization with the environment surrounding the motor vehicle device during the operation of the motor vehicle device; in other words, the device interior space, by means of the ventilation installation, is in particular fluidically connected to this environment. This ventilation installation furthermore has a semi-permeable membrane. A semi-permeable membrane in the context of the invention is to be understood to be a membrane which is impermeable to water and/or water vapor in a first direction, from a first surface toward a second surface, and this membrane is furthermore preferably permeable to water and/or water vapor in a second direction, from the second surface toward the first surface. Membranes of this type in a similar form are also known under various trade names from their use in breathable sportswear. The semi-permeable membrane by way of the first surface thereof faces the device interior space such that an imaginary fluid flow from the device interior space into the environment surrounding the motor vehicle device would have to flow through this membrane from the first surface to the second surface of the membrane; however, this direction of flow is specifically blocked by the installed position of the semi-permeable membrane and an escape, in particular of water vapor, from the device interior space into the environment is thus able to be prevented. The device interior space, in particular by a membrane disposed in such a manner, is closed off so as to be impermeable to water and water vapor in relation to the environment surrounding the motor vehicle device such that no moisture, or only minor quantities of moisture, can escape from the device interior space. By way of such a semi-permeable membrane it is thus furthermore possible for the exit of water or water vapor to at least be minimized, and the water content in the water-containing lubricant can thus be kept constant or almost constant. In one preferred embodiment of the invention, a further membrane is provided in the ventilation installation. This further membrane in terms of a flow direction from the device interior space into the environment surrounding the motor vehicle device is preferably disposed downstream of the semi-permeable membrane. This further membrane is preferably configured as a semi-permeable membrane and is thus to be understood as a further semi-permeable membrane. This further semi-permeable membrane is furthermore preferably disposed in such a manner that this further semi-permeable membrane closes off this device interior space so as to be impermeable to water and water vapor in an imaginary flow direction from the environment surrounding the motor vehicle device into the device interior space. Figuratively speaking, the further semi-permeable membrane in such a case is disposed counter to the semi-permeable membrane. On account of a disposal of this type, it is in particular possible for the uncontrolled ingress of water and/or water vapor into the device interior space to be prevented or at least to be minimized. In one preferred embodiment, the motor vehicle device is designed as a motor vehicle transmission, in particular as a motor vehicle transmission in the drivetrain of a motor vehicle that is designed for providing drive forces for overcoming rolling resistances (air drag, frictional resistance, incline resistance, etc.). The at least one component disposed in the device interior space is in particular configured as a gear wheel, or as a multiplicity of gear wheels, respectively. Individual features of the invention are explained in more detail hereunder by means of a FIGURE.

11393907

BACKGROUND Many types of power transistors such as power MOSFETs (metal-oxide-semiconductor field-effect transistors) utilize trenches that contain both gate electrodes and field electrodes below the gate electrodes. The field electrodes help to shape the electric field distribution within the device, thereby increasing the breakdown voltage characteristics of the device. However, as cell dimensions for power transistors continue to shrink, the corresponding interconnect dimensions also shrink which results in higher resistance. For field plate (electrode) trench power MOSFETs, this means the resistance of the field plate material which is typically polysilicon becomes higher. To counter this effect, more frequent connections from higher resistance polysilicon field electrodes to lower resistance source metal is needed. Each time a connection is made between source metal and field plate polysilicon, valuable active transistor area is consumed which results in an increase of RDSON*AA and therefore chip size where RDSONis on-state resistance and AA is active area. For example, some conventional approaches interrupt the overlying gate electrode to connect the underlying buried field electrode to source metal. Such approaches require an accompanying additional metal connection to gate metal (gate bus) and a source bus for connecting source metal to the buried field electrodes. Thus, there is a need for an improved buried field plate connection for transistor devices and corresponding methods of manufacture. SUMMARY According to an embodiment of a semiconductor device, the semiconductor device comprises: a semiconductor substrate; a plurality of trenches formed in the semiconductor substrate and extending lengthwise in parallel with one another, the plurality of trenches having connecting regions which interconnect adjacent ones of the trenches; semiconductor mesas separated from one another by the plurality of trenches in a first lateral direction and by the connecting regions in a second lateral direction transverse to the first lateral direction; a gate electrode and a field electrode below the gate electrode in at least some of the trenches, and dielectrically insulated from each other and from the semiconductor substrate; first contacts vertically extending into one or more transistor device regions in the semiconductor mesas; and second contacts vertically extending into the field electrodes in the connecting regions such that the gate electrodes are uninterrupted by the second contacts. According to an embodiment of a method of producing a semiconductor device, the method comprises: forming a plurality of trenches in a semiconductor substrate and which extend lengthwise in parallel with one another, wherein the plurality of trenches have connecting regions which interconnect adjacent ones of the trenches, wherein semiconductor mesas are separated from one another by the plurality of trenches in a first lateral direction and by the connecting regions in a second lateral direction transverse to the first lateral direction; forming a gate electrode and a field electrode below the gate electrode in at least some of the trenches, and dielectrically insulated from each other and from the semiconductor substrate; forming first contacts which vertically extend into one or more transistor device regions in the semiconductor mesas; and forming second contacts which vertically extend into the field electrodes in the connecting regions such that the gate electrodes are uninterrupted by the second contacts. Those skilled in the art will recognize additional features and advantages upon reading the following detailed description, and upon viewing the accompanying drawings.

11320776

CROSS-REFERENCE TO RELATED APPLICATION This application claims priority under 35 U.S.C. § 119 from Japanese Patent Applications No. 2019-215622 and No. 2019-215623 each filed on Nov. 28, 2019. The entire subject matter of the applications is incorporated herein by reference. BACKGROUND Technical Field Aspects of the present disclosure are related to an image forming apparatus. Related Art Heretofore, an image forming apparatus (hereinafter referred to as a “first image forming apparatus”) has been known that includes a discharge tray to support sheets discharged thereon via a discharge path, a re-conveyance path on which a sheet to be duplex-printed is switched back, and stack levers configured to contact a top surface of the sheets discharged on the discharge tray and press the sheets toward the discharge tray. In the first image forming apparatus, a sheet being conveyed along the re-conveyance path may come into contact with the top surface of the sheets stacked on the discharge tray and push out some of the stacked sheets, thereby disarranging the alignment of the stacked sheets. In particular, as the number of the sheets stacked on the discharge tray increases, a contact point, at which the sheet being conveyed along the re-conveyance path comes into contact with the sheets stacked on the discharge tray, becomes closer to the re-conveyance path. Thereby, since a distance over which the sheet being conveyed along the re-conveyance path pushes out some of the stacked sheets becomes longer, the alignment of the stacked sheets might be more disarranged. Accordingly, the first image forming apparatus is configured to guide the sheet being conveyed along the re-conveyance path, by upper surfaces of the stack levers positioned below the sheet. Thereby, the sheet, which is being conveyed along the re-conveyance path, is kept from contacting the sheets stacked on the discharge tray and is smoothly re-conveyed. Furthermore, another image forming apparatus (hereinafter referred to as a “second image forming apparatus”) has been known that includes two discharge rollers to discharge a sheet out of an apparatus main body, a discharge tray to support the sheet discharged by the discharge rollers, and a swingable stack lever to press the sheet discharged on the discharge tray. SUMMARY However, in the first image forming apparatus, since an upper side of the stack levers is open, the sheet being conveyed along the re-conveyance path might be conveyed in an unintended direction such as to be away upward from the stack levers, and might not smoothly be re-conveyed. Further, in the second image forming apparatus, the stack lever is exposed to the outside of the apparatus so as to be easily touched by a user. Therefore, the stack lever might be incorrectly operated by the user. If the stack lever is operated incorrectly, the stack lever may be damaged due to an excessive load applied thereto. Aspects of the present disclosure are advantageous to provide one or more improved techniques for an image forming apparatus that make it possible to stabilize a posture of a sheet being conveyed along a re-conveyance path and to prevent a stack lever from being operated incorrectly. According to aspects of the present disclosure, an image forming apparatus is provided, which includes an image forming engine configured to form an image on a sheet, a re-conveyance path configured to guide the sheet, on which the image is formed by the image forming engine, to be switched back and re-conveyed toward the image forming engine, a discharge tray, a discharge path configured to guide the sheet in a sheet discharge direction toward the discharge tray, a stack lever configured to contact a top surface of the sheet on the discharge tray and press the sheet toward the discharge tray, and a guide member configured to form a part of the re-conveyance path, extend up to a position downstream of the stack lever in the sheet discharge direction above the stack lever, and guide the sheet being conveyed along the re-conveyance path, between the guide member and the stack lever. According to aspects of the present disclosure, further provided is an image forming apparatus including an apparatus main body, a discharge roller configured to discharge a sheet in a sheet discharge direction from the apparatus main body, a discharge tray configured to support the sheet discharged by the discharge roller, a stack lever configured to contact a top surface of the sheet discharged on the discharge tray and press the sheet toward the discharge tray, and a cover removably attachable to the apparatus main body, the cover being configured to, when attached to the apparatus main body, form at least a part of an upper surface of the image forming apparatus and cover the stack lever from above, the cover having a downstream end portion that is positioned downstream of the stack lever in the sheet discharge direction when the cover is attached to the apparatus main body. According to aspects of the present disclosure, further provided is an image forming apparatus including an apparatus main body, an image forming engine configured to form an image on a sheet, a re-conveyance path configured to guide the sheet, on which the image is formed by the image forming engine, to be switched back and re-conveyed toward the image forming engine, a discharge roller configured to discharge the sheet in a sheet discharge direction from the apparatus main body, a discharge tray configured to support the sheet discharged by the discharge roller, a stack lever configured to contact a top surface of the sheet discharged on the discharge tray and press the sheet toward the discharge tray, and a cover removably attachable to the apparatus main body, the cover being configured to, when attached to the apparatus main body, form at least a part of an upper surface of the image forming apparatus and cover the stack lever from above, the cover including a guide configured to, when the cover is attached to the apparatus main body, serve as a part of the re-conveyance path, extend up to a position downstream of the stack lever in the sheet discharge direction above the stack lever, and guide the sheet being conveyed along the re-conveyance path, between the cover and the stack lever.

11515237

CROSS-REFERENCE TO RELATED APPLICATIONS This patent application is a U.S. National Phase Application under 35 U.S.C. § 371 of International Application No. PCT/SG2019/050368, filed 29 Jul. 2019, entitled SEMICONDUCTOR PACKAGE AND METHOD OF FORMING THE SAME, which claims the benefit of priority of Singapore application No. 10201806765V filed Aug. 8, 2018, the contents of which were incorporated by reference in the entirety for all purposes. TECHNICAL FIELD Various aspects of this disclosure relate to a semiconductor package. Various aspects of this disclosure relate to a method of forming a semiconductor package. BACKGROUND Power electronics devices are extensively used in the areas of aerospace, automotive, solar panels, wind generators, oil & gas and power grids for efficient electrical power delivery requirements. With the evolution of the power electronics devices in semiconductor industry, the demand for power modules with low power consumption and high efficiency has increased dramatically. In general, a power package, which includes several power semiconductor devices (e.g., chips and diodes) and assembled with different packaging technologies, provides mechanical supports, electrical interconnection, protection and thermal management to the power semiconductor devices. Correspondingly, the power package performance relies on the characteristics of the power semi-conductor devices, the packaging technology and the package configuration. As it well known, wide band gap (WBG) devices have excellent mechanical and thermal properties, as well higher critical breakdown field in comparison to silicon chips. Owning to superior properties of the WBG device based power package over the conventional silicon based power package, the WBG device based power package has attracted extensive interests. On the other side, WBG devices can be much smaller than similarly rated silicon devices. WBG based power packages may have higher power dissipation due to higher power output and greater packaging densities, which in turn pose very big challenges in terms of thermal management. Therefore, advanced package design/structure and effective thermal management may be critical in the development of WBG device based power modules. Conventional power modules packaging use conventional wire-bond interconnection scheme or using double-sided direct bonded coppers (DBCs) to form planar interconnection configurations on both sides of the power module.FIG. 1Ais a schematic of a conventional wire-bonded power module100a.FIG. 1Bis a schematic of a conventional double-sided cooled power module100b. The conventional structures of the power modules include series of power devices attached by different die attach material for a ground (power drain) contact on the direct bonded copper (DBC) substrate. The power source and gate pads on the power chips are interconnected to the DBC substrate by multiple bond wires. Although the conventional processes have been tried and tested for power module packaging, these conventional wire-bonded power modules have high package volume due to height of the bond wires and are also not compatible for double side cooling. Alternatively, advanced top-of-chip planar interconnection schemes, instead of bond wires, have been applied to power modules. Commonly, two DBC substrates are applied on both sides of the power devices for power drain, gate and source interconnections. Consequently, the assembled power modules have large form factor, heavy package weight and high costs due to the thick, heavy and costly DBC substrates. Moreover, the state-of-the-art power modules without additional health monitoring sensors run the risk of sudden failure, resulting in safety issues. SUMMARY Various embodiments may provide a semiconductor package. The semiconductor package may include a first package interconnection component. The semiconductor package may also include a second package interconnection component. The semiconductor package may further include a first electrical component between the first package interconnection component and the second package interconnection component, the first electrical component having a first side and a second side opposite the first side (of the first electrical component). The semiconductor package may also include a first bonding layer bonding the first side of the first electrical component and a first portion of the first package interconnection component. The semiconductor package may additionally include a second bonding layer bonding the second side of the first electrical component and a first portion of the second package interconnection component. The semiconductor package may further include a third bonding layer bonding a second portion of the first package interconnection component and a second portion of the second package interconnection component. The semiconductor package may also include a second electrical component having a first side and a second side opposite the first side (of the second electrical component). The semiconductor package may additionally include a fourth bonding layer bonding the first side of the second electrical component and the second portion of second package interconnection component. The semiconductor package may additionally include a first heat sink. The semiconductor package may also include a second heat sink. The semiconductor package may further include a first interface layer bonding or adhering the first heat sink and the first package interconnection component. The semiconductor package may also include a second interface layer bonding or adhering the second heat sink and the second package interconnection component. Various embodiments may relate to a method of forming a semiconductor package. The method may include bonding a first side of a first electrical component and a first portion of a first package interconnection component via a first bonding layer. The method may also include bonding a second side of the first electrical component, the second side of the first electrical component opposite the first side (of the electrical component), and a first portion of a second package interconnection component via a second bonding layer so that the first electrical component is between the first package interconnection component and the second package interconnection component. The method may further include bonding a second portion of the first package interconnection component and a second portion of the second package interconnection component via a third bonding layer. The method may additionally include bonding a first side of a second electrical component and the second portion of second package interconnection component via a fourth bonding layer, the second electrical component also including a second side opposite the first side (of the second electrical component). The method may also include bonding or adhering a first heat sink and the first package interconnection component via a first interface layer. The method may further include bonding or adhering a second heat sink and the second package interconnection component via a second interface layer.

11293860

FIELD The present application relates to the field of scanning imaging technology, in particular to terahertz spectral imaging data reconstruction methods, apparatuses, devices, and storage mediums. BACKGROUND Terahertz (THz) waves are electromagnetic waves having frequencies in the range of 0.1 THz to 10 THz, have advantages such as penetrating, low energy, non-destructiveness, high spectral resolution, and so on, and therefore have unique superiority and applications in the field of imaging. At present, terahertz time domain spectral imaging technology is the earliest and most mature technology in the terahertz imaging technology. In the terahertz time domain spectral imaging technology, an object to be detected can be spatially and time domain scanned to obtain terahertz time domain spectral imaging data which is subsequently analyzed and processed, to achieve terahertz spectral images and curves based on the processed terahertz time domain spectral imaging data. However, the terahertz time domain spectral imaging technology has problems such as long scanning time and huge data volume. SUMMARY In view of this, the present application discloses a terahertz spectral imaging data reconstruction method, an apparatus, a device, and a storage medium. A terahertz spectral imaging data reconstruction method includes: scanning a target object according to a first spatial interval and a first time domain sampling period to acquire first terahertz spectral data; scanning the target object according to a second spatial interval and a second time domain sampling period to acquire second terahertz spectral data, the first spatial interval is larger than the second spatial interval, and the first time domain sampling period is larger than the second time domain sampling period; and reconstructing the second terahertz spectral data on basis of the first terahertz spectral data by using a preset reconstruction method to obtain third terahertz spectral data. A terahertz spectral imaging data reconstruction apparatus includes a first acquisition module, a second acquisition module, and a reconstruction module. The first acquisition module is configured to scan a target object according to a first spatial interval and a first time domain sampling period to acquire first terahertz spectral data. The second acquisition module is configured to scan the target object according to a second spatial interval and a second time domain sampling period to acquire second terahertz spectral data. The first spatial interval is larger than the second spatial interval. The first time domain sampling period is larger than the second time domain sampling period. The reconstruction module is configured to reconstruct the second terahertz spectral data on basis of the first terahertz spectral data by using a preset reconstruction method to obtain third terahertz spectral data. A computer device includes a processor and a memory. The memory stores a computer program. When the computer program is executed by the processor, the following steps are implemented: scanning a target object according to a first spatial interval and a first time domain sampling period to acquire first terahertz spectral data; scanning the target object according to a second spatial interval and a second time domain sampling period to acquire second terahertz spectral data, the first spatial interval is larger than the second spatial interval, and the first time domain sampling period is larger than the second time domain sampling period; and reconstructing the second terahertz spectral data on basis of the first terahertz spectral data by using a preset reconstruction method to obtain third terahertz spectral data. A computer readable storage medium stores a computer program. When the computer program is executed by a processor, the following steps are implemented: scanning a target object according to a first spatial interval and a first time domain sampling period to acquire first terahertz spectral data; scanning the target object according to a second spatial interval and a second time domain sampling period to acquire second terahertz spectral data, the first spatial interval is larger than the second spatial interval, and the first time domain sampling period is larger than the second time domain sampling period; and reconstructing the second terahertz spectral data on basis of the first terahertz spectral data by using a preset reconstruction method to obtain third terahertz spectral data. The details of one or more embodiments of the present application are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the present application will be apparent from the description and drawings, and from the claims.

11454319

CROSS-REFERENCE TO RELATED APPLICATION This application claims priority to Japanese Patent Application No. 2020-124777 filed on Jul. 21, 2020, incorporated herein by reference in its entirety. BACKGROUND 1. Technical Field The present disclosure relates to a vehicle parking lock mechanism, and more particularly to a technique for suppressing a parking pawl from coming off a parking gear (hereinafter this phenomenon is referred to as P-removal) while the vehicle is in a parked state in which a P range is selected. 2. Description of Related Art There is known a vehicle parking lock mechanism including a parking gear, a parking pawl, a lock member, and a guide member as described below. The parking pawl is provided so as to be brought closer to and separated from the parking gear and hinders rotation of the parking gear by being engaged with the parking gear. The lock member is provided so as to be reciprocally movable between a lock position and an unlock position and brings, when the lock member is moved to the lock position, the parking pawl closer to the parking gear via a cam mechanism such that the lock member is moved to the lock position to establish a parking lock state in which the parking pawl hinders rotation of the parking gear. The guide member is provided on an opposite side of the parking pawl with respect to the lock member put between the guide member and the parking pawl and includes a guide surface that guides movement of the lock member between the lock position and the unlock position while restricting the lock member from displacing in a direction away from the parking pawl. Here, the cam mechanism includes a first roller and a second roller provided on the lock member so as to be rotatable around axes perpendicular to a moving direction of the lock member and parallel to each other such that outer peripheral surfaces are brought into rolling contact with each other. When the lock member is moved from the unlock position to the lock position, the first roller is engaged with a cam surface provided on the parking pawl to bring the parking pawl closer to the parking gear and engage the parking pawl with the parking gear, while the second roller is engaged with the guide surface to restrict the lock member from displacing to the side opposite to the parking pawl. A device described in Japanese Unexamined Patent Application Publication No. 2002-178891 (JP 2002-178891 A) is an example thereof, in which a sprag2corresponds to the parking pawl, a rod4provided with a pair of rollers7corresponds to the lock member, and a pressing member3corresponds to the guide member. In such a vehicle parking lock mechanism, when the P range for parking is selected by a shift lever or the like, the lock member is moved to the lock position and the parking pawl is engaged with the parking gear so that a wheel is locked so as not to be rotatable via the rotating shaft on which the parking gear is provided. In that case, if the road surface slope of the parked place is large, a pushing load that pushes the parking pawl out of the parking gear may be generated in accordance with rotational torque applied to the parking gear by the weight of the vehicle, and the pushing load may cause the lock member to be retracted to the unlock position side, causing the P-removal in which the parking pawl comes off the parking gear. For example, when an engaging surface of the parking pawl to be engaged with the first roller is inclined in the direction away from the guide member toward a parking release position side due to variations in the dimensions of the parts, the inclination may generate torque in the first roller causing the first roller to roll toward the unlock position side, and a force may be applied to the lock member in the retracting direction toward the unlock position side. In view of this, Japanese Unexamined Patent Application Publication No. 2018-141520 (JP 2018-141520 A) proposes a technique in which a stopper (wedge restricting means) is provided in the moving path of the lock member (wedge) so that the stopper can be advanced and retracted, and the stopper is advanced and retracted along with the shift lever, which hinders the retraction of the lock member to suppress the P-removal from occurring. SUMMARY However, in such a method described in JP 2018-141520 A, it is necessary to provide a stopper in the moving path of the lock member so that the stopper can be advanced and retracted, and to provide an interlocking mechanism in which the stopper is advanced and retracted along with the shift lever. With this method, there has been an issue that the complicated structure increased the size and the manufacturing cost. The present disclosure relates to a vehicle parking lock mechanism that suppresses the P-removal from occurring in the parking lock mechanism with a simple method when parking on a slope. A vehicle parking lock mechanism according to an aspect of the present disclosure includes a parking gear, a parking pawl, a lock member, and a guide member. The parking pawl is provided so as to be brought closer to and separated from the parking gear and is configured to hinder rotation of the parking gear by being engaged with the parking gear. The lock member is provided so as to be reciprocally movable between a lock position and an unlock position and is configured to, when the lock member is moved to the lock position, bring the parking pawl closer to the parking gear via a cam mechanism such that the lock member is moved to the lock position to establish a parking lock state in which the parking pawl hinders rotation of the parking gear. The guide member is provided on an opposite side of the parking pawl with respect to the lock member put between the guide member and the parking pawl and includes a guide surface configured to guide movement of the lock member between the lock position and the unlock position while restricting the lock member from displacing in a direction away from the parking pawl. The cam mechanism includes a pair of a first roller and a second roller provided on the lock member such that the first roller and the second roller are rotatable around axes perpendicular to a moving direction of the lock member and parallel to each other, and outer peripheral surfaces are brought into rolling contact with each other. When the lock member is moved from the unlock position to the lock position, the first roller is configured to be engaged with a cam surface provided on the parking pawl so as to bring the parking pawl closer to the parking gear to be engaged with the parking gear and the second roller is configured to be engaged with the guide surface so as to restrict the lock member from displacing in a direction away from the parking pawl. The outer peripheral surface of at least one of the first roller and the second roller includes a fixing portion that in the parking lock state protrudes toward the lock position and is brought into contact with the parking pawl or the guide surface over a predetermined engaging length. According to the vehicle parking lock mechanism of the above aspect, the outer peripheral surface of at least one of the first roller and the second roller includes the fixing portion, and the fixing portion is brought into contact with the parking pawl or the guide surface over a predetermined engaging length in the parking lock state. Therefore, when parking on a slope, the pushing load for pushing the parking pawl out of the parking gear is generated, and when the pushing load is applied from the parking pawl to the lock member, the fixing portion is pressed against the parking pawl or the guide surface, generating sliding friction. Thus, due to the sliding friction, the rotational resistance increases until the rollers start rolling. Therefore, the force applied to the lock member in the retracting direction toward the unlock position side due to rolling of the rollers is reduced, and the P-removal where the parking pawl comes off the parking gear due to the retraction of the lock member is suppressed from occurring. In this case, it is only necessary that the fixing portion is provided on the outer peripheral surface of at least one of the first roller and the second roller, enabling the structure to be made simpler, smaller, and cheaper. In the vehicle parking lock mechanism of the above aspect, the outer peripheral surface of the first roller may include, as the fixing portion, a first fixing portion that protrudes toward the lock position and is brought into contact with the parking pawl over a predetermined engaging length in the parking lock state. According to the vehicle parking lock mechanism of the above configuration, with the first fixing portion provided on the outer peripheral surface of the first roller and brought into contact with the parking pawl, in the case where the parking pawl is pressed against the first fixing portion of the first roller by the pushing load when parking on a slope, the sliding friction generated by the pressing increases the rotational resistance of the first roller, and the P-removal due to the retraction of the lock member is appropriately suppressed from occurring. In the vehicle parking lock mechanism of the above configuration, in the parking lock state a lock-side engaging surface of the parking pawl with which the first fixing portion is brought into contact may be inclined in a direction away from the guide member toward the lock position side with respect to a straight line parallel to the moving direction of the lock member. According to the vehicle parking lock mechanism of the above configuration, since in the parking lock state the lock-side engaging surface of the parking pawl with which the first fixing portion is brought into contact is inclined in a direction away from the guide member toward the lock position side, the lock-side engaging surface being pressed against the first roller by the pushing load generates torque in the first roller causing the first roller to roll in the direction toward the lock position side. When the lock member attempts to move to the unlock position side, the parking pawl needs to be pushed back to the parking gear side due to the inclination of the lock-side engaging surface, which hinders the movement of the lock member toward the unlock position side, and the P-removal is more appropriately suppressed. In the vehicle parking lock mechanism of the above configuration, the outer peripheral surface of the first roller may include a first adjusting portion that, in an unlock state in which the lock member is moved to the unlock position, protrudes toward the unlock position and that is brought into contact with the parking pawl over a predetermined engaging length. According to the vehicle parking lock mechanism of the above configuration, in the case where the outer peripheral surface of the first roller includes the first adjusting portion that is brought into contact with the parking pawl over a predetermined engaging length in the unlock state, the phase (rotational position) of the first roller is adjusted so that the first adjusting portion is brought into contact with the parking pawl when the lock member is moved to the unlock position. That is, if the first roller slips and falls out of phase when the lock member is moved, the first fixing portion may be unable to appropriately be brought into contact with the parking pawl in the parking lock state, which may hinder obtaining sufficient frictional force to suppress the P-removal from occurring. In the present disclosure, since the phase adjustment is performed so that the first adjusting portion is brought into contact with the parking pawl in the unlock state, the first fixing portion is appropriately brought into contact with the parking pawl in the parking lock state, and the effect of suppressing the P-removal with the first fixing portion can be appropriately obtained. In the vehicle parking lock mechanism of the above aspect, the outer peripheral surface of the second roller may include, as the fixing portion, a second fixing portion that in the parking lock state protrudes toward the lock position and is brought into contact with the guide surface over a predetermined engaging length. According to the vehicle parking lock mechanism of the above configuration, with the second fixing portion provided on the outer peripheral surface of the second roller and brought into contact with the guide surface, in the case where the second fixing portion of the second roller is pressed against the guide surface by the pushing load when parking on a slope, the sliding friction generated by the pressing increases the rotational resistance of the second roller, and the P-removal due to the retraction of the lock member is appropriately suppressed from occurring. In the vehicle parking lock mechanism of the above configuration, the guide surface with which the second fixing portion is brought into contact may be inclined in a direction away from the parking pawl toward the lock position side with respect to a straight line parallel to the moving direction of the lock member. According to the vehicle parking lock mechanism of the above configuration, since the guide surface with which the second fixing portion is brought into contact is inclined in a direction away from the parking pawl toward the lock position side, the second roller being pressed against the guide surface by the pushing load generates torque in the second roller causing the second roller to roll in the direction toward the lock position side. When the lock member attempts to move to the unlock position side, the parking pawl needs to be pushed back to the parking gear side due to the inclination of the guide surface, which hinders the movement of the lock member toward the unlock position side, and the P-removal is more appropriately suppressed. In the vehicle parking lock mechanism of the above configuration, the outer peripheral surface of the second roller may include a second adjusting portion that, in an unlock state in which the lock member is moved to the unlock position, protrudes toward the unlock position and that is brought into contact with the guide surface over a predetermined engaging length. According to the vehicle parking lock mechanism of the above configuration, in the case where the outer peripheral surface of the second roller includes the second adjusting portion that is brought into contact with the guide surface over a predetermined engaging length in the unlock state, the phase (rotational position) of the second roller is adjusted so that the second adjusting portion is brought into contact with the guide surface when the lock member is moved to the unlock position. That is, if the second roller slips and falls out of phase when the lock member is moved, the second fixing portion may be unable to appropriately be brought into contact with the guide surface in the parking lock state, which may hinder obtaining sufficient frictional force to suppress the P-removal from occurring. In the present disclosure, since the phase adjustment is performed so that the second adjusting portion is brought into contact with the guide surface in the unlock state, the second fixing portion is appropriately brought into contact with the guide surface in the parking lock state, and the effect of suppressing the P-removal with the second fixing portion can be appropriately obtained. In the vehicle parking lock mechanism of the above aspect, the outer peripheral surface of the first roller may include, as the fixing portion, a first fixing portion that in the parking lock state protrudes toward the lock position and is brought into contact with the parking pawl over a predetermined engaging length. In addition, the outer peripheral surface of the second roller may include, as the fixing portion, a second fixing portion that in the parking lock state protrudes toward the lock position and is brought into contact with the guide surface over a predetermined engaging length. According to the vehicle parking lock mechanism of the above configuration, with the first fixing portion provided on the outer peripheral surface of the first roller to be brought into contact with the parking pawl and the second fixing portion provided on the outer peripheral surface of the second roller to be brought into contact with the guide surface, in the case where the pushing load is generated on the parking pawl when parking on a slope, the parking pawl is pressed against the first fixing portion of the first roller and the second fixing portion of the second roller is pressed against the guide surface due to the pushing load. Since the sliding friction generated by this pressing increases the rotational resistance of both the first roller and the second roller, as compared with the case where the fixing portion is provided only on one of the rollers, it is possible to more appropriately suppress the P-removal due to the retraction of the lock member from occurring. In the vehicle parking lock mechanism of the above configuration, the outer peripheral surface of the first roller may include a first adjusting portion that, in an unlock state in which the lock member is moved to the unlock position, protrudes toward the unlock position and that is brought into contact with the parking pawl over a predetermined engaging length. In addition, the outer peripheral surface of the second roller may include a second adjusting portion that, in the unlock state, protrudes toward the unlock position and that is brought into contact with the guide surface over a predetermined engaging length. According to the vehicle parking lock mechanism of the above configuration, with the first adjusting portion provided on the outer peripheral surface of the first roller to be brought into contact with the parking pawl and the second adjusting portion provided on the outer peripheral surface of the second roller to be brought into contact with the guide surface, when the lock member is moved to the unlock position, the phase (rotational position) of the first roller is adjusted so that the first adjusting portion is brought into contact with the parking pawl, and the phase (rotational position) of the second roller is adjusted so that the second adjusting portion is brought into contact with the guide surface. That is, if the first roller and the second roller slip and fall out of phase when the lock member is moved, in the parking lock state the first fixing portion may be hindered from appropriately being brought into contact with the parking pawl and the second fixing portion may be hindered from appropriately being brought into contact with the guide surface, which may hinder obtaining sufficient frictional force to suppress the P-removal from occurring. In the present disclosure, since the phase adjustment of the first roller and the second roller is performed in the unlock state, in the parking lock state the first fixing portion is appropriately brought into contact with the parking pawl and the second fixing portion is appropriately brought into contact with the guide surface. Thus, the effect of suppressing the P-removal with the first fixing portion and the second fixing portion can be appropriately obtained. In the vehicle parking lock mechanism of the above configuration, the first roller and the second roller may be provided with a first gear and a second gear so as not to be rotatable with respect to the first gear and the second gear, respectively. The first gear and the second gear mesh with each other such that the first roller and the second roller are synchronously rotated in a predetermined phase. According to the vehicle parking lock mechanism of the above configuration, when the first roller and the second roller are provided with the first gear and the second gear so as not to be rotatable with respect to the first gear and the second gear, respectively, and the first gear and the second gear mesh with each other such that the first roller and the second roller are synchronously rotated in a predetermined phase, it is possible to suppress the first roller and the second roller from slipping and falling out of phase when the lock member is moved. That is, if the first roller and the second roller slip and fall out of phase when the lock member is moved, in the parking lock state the first fixing portion may be hindered from appropriately being brought into contact with the parking pawl and the second fixing portion may be hindered from appropriately being brought into contact with the guide surface, which may hinder obtaining sufficient frictional force to suppress the P-removal from occurring. In the present disclosure, since the synchronous rotation of the first gear and the second gear suppresses the first roller and the second roller from falling out of phase, the first fixing portion is appropriately brought into contact with the parking pawl and the second fixing portion is appropriately brought into contact with the guide surface in the parking lock state. Thus, the effect of suppressing the P-removal with the first fixing portion and the second fixing portion can be appropriately obtained.

11329986

BACKGROUND I. Field The present invention relates generally to the field of authentication and certification of communications, and more specifically to systems that authenticate or certify electronic communications transmitted between entities, such as emails. II. Background In the modern world, electronic communications, such as emails, are subject to hacking, wherein either the communication is intercepted and not delivered to the recipient, or an electronic communication is falsely transmitted as being from a different sender. Different authentication systems have been employed to combat such hacking. One system is the use of keys or tokens, including use of a “public” key, which can be given to anyone, and a “private” key, which is retained by the sender. The sender encrypts the transmission using the key, token, or other item, transmits the encrypted communication over the internet, and the recipient decrypts the transmission using decryption processing and the necessary keys, tokens, or items. Various versions or flavors of this type of operation exist, including but not limited to certificate distribution, PM (RSA algorithm) processing, PGP, and digital signatures. In these types of arrangements, the sender and recipient mail clients are configured to use encryption entities, such as encryption keys. The sender encrypts the message using, for example, the sender private key, and the recipient decrypts the message using the sender's public key and may use the recipient's private key to decrypt a second layer. A PGP client may be employed with PKI, where the sender and recipient exchange public keys, and the sender encrypts the message with the sender private key and the recipient public key, and the recipient uses the PGP application to decrypt both layers of encryption. An issue with this type of authentication is that both parties need to have the applicable software available and operational. In the current environment, where users are employing various electronic communication solutions on different platforms (online/cloud services such as Gmail, Yahoo Mail, etc., solutions or client products such as Microsoft Outlook, Apple Mail, etc.) on mobile devices, tablets, personal computers, and even televisions and other appliances, successfully deploying such authentication solutions (certificate verification, PKI software, etc.) is challenging. Most email applications have not adopted encryption technology, and a turnkey solution is in most cases unavailable. As a result, such technology must be added by the user, a complex task for many individuals that requires updating upon encountering new versions, different underlying email applications, and so forth. Certain cloud-based email services simply do not offer encryption or decryption capabilities for such communications. In such a transmission scenario, a user receiving a message on a device that does not have the proper setup, in terms of both hardware and current and properly implemented software, is placed in the unenviable position of having a message that may be highly important with no way to understand the communication. Such limitations are highly undesirable. It would therefore be beneficial to offer a system employable across multiple platforms that overcomes issues with previously available communication authentication designs. SUMMARY According to one embodiment, there is provided a system for processing communications, comprising a trusted receiver device configured to receive a communication directed to a known trusted receiver address, a message handler device configured to interface with the trusted receiver device and create a thumbprint of select portions of the communication, an analysis device configured to analyze the communication based on the communication and the thumbprint, and a metadata storage device connected to the trusted receiver device configured to receive and store metadata associated with each verified communication received. The communication comprises information identifiable to the system in a particular field of the communication to be invisible to unauthorized recipients, and the communication is verified and transmitted to the sender and intended recipient. In one aspect, any entity can verify a communication received by the system. Any communication transmission protocol, service, or platform may be employed to transmit the communication and the recipient does not require any specialized software to view the communication. According to another embodiment, there is provided a method for processing communications, comprising receiving at a system an electronic communication comprising a message and information identifying a sender in a predetermined field in the electronic communication, processing the electronic communication by selecting components of the electronic communication, thereby establishing a communication thumbprint, analyzing the communication based on the communication thumbprint, wherein said analyzing comprises determining authenticity of the communication, and transmitting the message to the sender and a recipient. The information identifying a sender in a predetermined field is invisible to unauthorized recipients, and the communication is verified and transmitted to the sender and intended recipient. According to a further embodiment, there is provided a system comprising a trusted receiver device configured to receive a communication directed to a known trusted receiver address, a message handler device configured to interface with the trusted receiver device and create a thumbprint of select portions of the communication, and an analysis device configured to analyze the communication based on the communication and the thumbprint. The communication comprises information identifiable to the system in a particular field of the communication intended to be invisible to unauthorized recipients, and the system is configured to verify and transmit the communication to the sender and intended recipient. Various aspects and features of the disclosure are described in further detail below.

11323353

TECHNICAL FIELD The disclosure relates to assessing the effectiveness of a service path, such as a service path of physical processes or a service path in a computing environment or networked computing environment. BACKGROUND A service path is a system for performing a series of tasks or an overall process. A service path may be implemented using a system of electronic, mechanical, or other devices, or service providers that operate on data, physical objects, or other items to perform a function, achieve a result, generate data, and/or generate or transform a physical object. A networked computing environment is an example of a service path that may include a number of interdependent computing devices, servers, and processes that transmit and receive data via a network. In some instances, and in a service path implemented using a networked computing environment, one or more network security tools may be deployed to monitor network data and identify data that that may be malicious. The network security tools may be deployed at a number of locations throughout the network and may be tasked with processing a relatively large amount of data. For example, an enterprise computing environment may include hundreds or thousands of computing devices, servers, and processes that transmit or receive network data via a large number of network routes. In certain instances, it may be difficult to determine whether the security tools are identifying and/or processing the data. SUMMARY In general, the techniques of this disclosure relate to assessing, measuring, and/or adjusting system effectiveness. For example, a service path implemented on a networked computing environment may have a plurality of network routes and one or more visibility points that monitor and/or process data traffic on those routes, e.g., such as one or more data security appliances. According to aspects of this disclosure, a computing device in such a service path may generate test data that is configured to be identified as data of interest at the visibility points of the network (or visibility points in the service path). The computing device may inject the test data into each network route at a location upstream from the one or more visibility points, and verify, for each network route through which the test data travels, that the test data is identified at the one or more visibility points. In examples of networks having more than one visibility point, the computing device may also verify that each of the visibility points identifies the data, e.g., by comparing data identified at the visibility points. The computing system may repeat the testing at regular intervals. In this way, the techniques may provide a comprehensive measurement of system effectiveness by testing each route and each visibility point. In other examples, a service path implemented on a networked computing environment might also do more than merely observe test data and verify that the test data is identified at a visibility point. For instance, in some examples, a visibility point or other component of such a network may block and/or shape the data to address, remediate, or control aspects of the data or the operation of the service path. In one such example, test data might be injected into a network route, and a first downstream visibility point might verify that the test data has traversed the network. That first visibility point may also, however, block the data. Where the data is blocked by the first visibility point, a second visibility point, further downstream, may then verify that the test data did not arrive at the second visibility point. In some examples, such as in a mechanical process being performed by a service path, one or more visibility points may cause the service path to be stopped if a test event or test data is not detected as expected, or if the data has not been appropriately blocked. In such an example, a repair and resume protocol might be initiated to address any service path problems arising from the failure to accurately detect the test event or test data. In another example, test data might be injected into a network route, and a first downstream visibility point might shape, reshape, and/or modify the test data (e.g., remove a malicious file, change an erroneous packet header, reroute traffic, control flow of traffic). A second visibility point, further downstream in such an example, may verify that the test data arrived at the second visibility point in the appropriate modified or shaped form. Multiple visibility points may each perform a reshaping and/or blocking operation, and later downstream visibility points may verify that the reshaping and/or blocking operations were performed successfully and in sequence. In another example, this disclosure describes a method comprising generating, by the computing system, test data that is configured to be identified as data of interest at one or more of a plurality of visibility points in a service path having a plurality of network routes; injecting, by the computing system, the test data into a first network route of the plurality of network routes at a location upstream from a first visibility point of the plurality of visibility points, wherein the first visibility point is located along the first network route; determining, by identifying the test data at the first visibility point, whether the test data has traveled along the first network route; modifying the test data by the first visibility point to generate modified test data; injecting, by the first visibility point, the modified test data into a second network route of the plurality of network routes at a location upstream from a second visibility point of the plurality of visibility points, wherein the second visibility point is located along the second network route; determining, by identifying the modified test data at the second visibility point, whether the modified test data has traveled along the second network route; receiving, by the computing system, assessment data indicating whether the test data traveled along the first network route and the modified test data traveled along the second network route; and assessing, by the computing system and based on the assessment data, the effectiveness of the network. In another example, this disclosure describes a method comprising generating, by a computing system, test data that is configured to be identified as data of interest at one or more visibility points in a service path having a plurality of network routes, each of the plurality of network routes including a proxy that maintains a proxy log identifying data processed by the proxy; injecting, by the computing system, the test data into each network route of the plurality of network routes at a location upstream from the one or more visibility points; receiving, by the computing system, data from the one or more visibility points; determining, for each network route through which the test data travels and based on the data received from the one or more visibility points, whether the test data is identified at the one or more visibility points; outputting, for each network route through which the test data travels, data that indicates whether the test data is identified at the one or more visibility points as data of interest; comparing, by the computing system, the data that indicates whether the test data is identified to data derived from the proxy log; and outputting, by the computing system, data representative of the comparison. The details of one or more examples of the disclosure are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the disclosure will be apparent from the description and drawings, and from the claims.

11467087

TECHNICAL FIELD The present invention relates to an optical sensor for detecting radiation light such as phosphorescence emitted from a detection target excited by excitation light, a light detection apparatus including the optical sensor, a sheet processing apparatus including the light detection apparatus, and a light detection method and a phosphorescence detection apparatus for detecting the radiation light. BACKGROUND ART Conventionally, security marks having predetermined optical characteristics have been used to recognize authenticity of sheets, such as banknotes and documents, products, and the like. For example, a security mark including a special material that does not emit radiation light, such as phosphorescence, under visible light but emits radiation light only when irradiated with excitation light of a predetermined wavelength such as ultraviolet light is provided on a sheet or product package by printing or the like so that the authenticity of sheets, products, and the like are determined from the radiation light state of radiation light. Fluorescence emitted at the time of excitation light irradiation and phosphorescence emitted after the excitation light irradiation are used as radiation light. PTL 1 discloses an apparatus that irradiates excitation light from a light source to an item marked with a luminescent material and moving on a manufacturing line, and detects the luminescent light with five photosensors. PTL 2 discloses an apparatus that irradiates the fluorescent substance in a banknote with ultraviolet light from a light-emitting diode disposed obliquely to the banknote, and detects the fluorescence emitted from the banknote by using a fluorescence detector through an optical system using a lens. PTL 3 discloses an apparatus that that irradiates a banknote with excitation light from a light source disposed obliquely to the banknote, and detects luminescent light excited in or on the banknote by using a detector unit through an optical system using a lens. PTL 4 discloses an apparatus that irradiates a banknote with excitation light and detects emitted fluorescence and phosphorescence to verify the authenticity of the banknote. In the apparatus disclosed in PTL 4, fluorescence or phosphorescence is detected using an array detector through an optical system provided with a cylindrical lens. PTL 1 further discloses an apparatus for discrimination between two luminescent materials that emit light within the same wavelength range and contain two dyes having different decay time constants at different ratio. This apparatus, which has a large number of photodetectors along a path, detects a luminescence intensity profile and compares the intensity value of a normalized intensity profile or the time required for decay with a reference value or compares the curve shape of the normalized intensity profile with the curve shape of a reference luminescence intensity profile. This allows the luminescent materials to be identified even when the normalized luminescence intensity profiles of the two luminescent materials are very similar, despite the different ratio of the two dyes. PTL 5 discloses an apparatus that irradiates a banknote with excitation light and detects emitted fluorescence to verify the authenticity of the banknote. This apparatus detects phosphorescence using two sensors and verifies the ratio between the phosphorescent intensities detected by the sensors. PTL 6 discloses an apparatus that irradiates a banknote with excitation light and detects emitted fluorescence to verify the authenticity of the banknote. This apparatus detects a peak of a phosphorescent spectrum obtained by irradiation with excitation light, and detects decay characteristics for the wavelength of each detected peak. PTL 1 further discloses an apparatus for distinction between two luminescent materials that emit light within the same wavelength range and contain two dyes having different decay times in different ratio. This apparatus detects the decay time characteristics of the luminescent material on the item conveyed at high speed to create a measured luminescence intensity profile and compares it with a reference intensity profile. The conveyance speed V is 6 m/s (6000 mm/s). The excitation time interval Δtex of the light source is 100 μs (0.1 ms). The time delay Δtd after the turning off of the light source is 40 μs (0.04 ms). The measurement time interval Δtm of the excited luminescent material is 4000 μs (4 ms). In addition, the drawing shows that there are five optical sensors. Therefore, when detection is performed five times during the measurement time interval Δtm at equal intervals, each detection is performed every 1000 μs (1 ms). The apparatus disclosed in PTL 1 creates a measured luminescence intensity profile through this five times of detection. PTL 6 further discloses an apparatus for irradiating a banknote with excitation light, detecting emitted phosphorescence, and verifying the authenticity of the banknote. This apparatus detects a peak of the phosphorescent spectrum obtained by irradiation with excitation light, detects a decay characteristics for the wavelength of each detected peak, and compares it with the registered feature. This apparatus performs the first measurement for 500 μs (0.5 ms) immediately after the light source is turned off (that is, without delay). After the light source is turned on again, the light source is turned off again, and the next measurement is performed during the period of 500 is (0.5 ms) after 100 μs (0.1 ms) has elapsed after the second turning off (that is, with a time delay of 100 μs). This apparatus repeats the measurement until the lapse of the emission decay time while increasing the time delay. PTL 5 further discloses a method of determining the authenticity of a document by determining the ratio between the intensity value detected in the first spectral region and the intensity value detected in the second spectral region. Detection of the emission intensity starts 50 μs (0.05 ms) after the end of excitation of a luminescent material and lasts 50 μs (0.05 ms). Detection of the emission intensity starts after a time interval of 100 μs (0.1 ms) and lasts 50 μs (0.05 ms). The decay time of the intensity value detected in the first spectral region is τ1=200 μs (0.2 ms), and the decay time of the intensity value detected in the second spectral region is τ2=400 μs (0.4 ms). CITATION LIST Patent Literature PTL 1 Japanese Unexamined Patent Application Publication (Translation of PCT Application) No. 2014-519130 PTL 2 U.S. Pat. No. 6,918,482 PTL 3 U.S. Pat. No. 6,777,704 PTL 4 Japanese Patent No. 3790931 PTL 5 U.S. Patent Application Publication No. 2015/348351 PTL 6 U.S. Pat. No. 7,262,420 SUMMARY OF INVENTION Technical Problem The apparatus disclosed in PTL 1, which has multiple detectors, is advantageous in that it provides a large radiation light reception area, but is disadvantageous in that the apparatus is complicated and large. The apparatus disclosed in PTL 2, PTL 3, or PTL 4 uses an optical system using a lens. It is therefore necessary to secure a distance corresponding to the lens focal length between the lens and the fluorescence detector, detector unit, or array detector. In other words, the apparatuses disclosed in these literatures have the problem that they can hardly be miniaturized. Besides, since the light reception area is restricted by the lens diameter in an optical system using a lens, the apparatuses disclosed in these literatures have the problem that they can hardly have a large light reception area. As described above, the conventional apparatus cannot simultaneously achieve the miniaturization of the sensor unit for detecting radiation light and the enlargement of the radiation light reception surface. An object of the present invention, which has been made in view of such a situation, is to enlarge the radiation light reception surface of the sensor while miniaturizing the sensor. Further, in the apparatus disclosed in PTL 1, for distinction between luminescent materials, regardless of whether it is a luminescent material of a single dye or a luminescent material of multiple dyes having different decay time constants, it is necessary to prepare in advance a reference value or a reference curve shape for each luminescent material. In other words, a luminescent material for which a reference is prepared can be identified, whereas a luminescent material for which a reference is not prepared, it is impossible to identify whether the luminescent material is a luminescent material of a single dye or a luminescent material of multiple dyes. Further, the apparatus disclosed in PTL 5 verifies the authenticity of a banknote by using the ratio between the phosphorescent intensities detected by the two sensors as a feature, and is not capable of determining whether each luminescent material that has emitted phosphorescence is a luminescent material of a single dye or a luminescent material of multiple dyes having different decay time constants. The apparatus disclosed in PTL 6 detects the decay characteristics for the wavelength of each detected peak, and may be capable of determining whether a luminescent material that has emitted phosphorescence is a luminescent material of a single dye or a luminescent material of multiple dyes having different phosphorescent colors, according to the number of peaks. However, whether the luminescent material that has emitted phosphorescence is a luminescent material of a single dye or a luminescent material that emits light within the same wavelength range and is composed of multiple dyes having different decay time constants cannot be determined. As described above, the apparatuses disclosed in PTLs 1, 5, and 6 are not capable of judging whether a phosphorescent material that has emitted phosphorescence is a phosphorescent material of a single dye or a phosphorescent material of multiple dyes that emit light in the same wavelength range and have different decay time constants. An object of the present invention, which has been made in view of such a current situation, is to determine whether or not detected phosphorescence results from multiple types of phosphorescence that are within the same wavelength range and have different decay time constants. In addition, as in the apparatus disclosed in PTL 1 or 6, when the feature of a phosphorescent decay is determined by repeating detection more than once and is compared with a registered phosphorescent feature, phosphorescence can be accurately detected but it takes time to detect it. It is therefore difficult to speed up the processing. The invention disclosed in PTL 5 detects phosphorescence only twice and only determines the ratio between two types of phosphorescence, and does not detect a phosphorescent feature, such as a decay time constant. Phosphorescent materials are materials that are excited upon reception of excitation light, such as visible light and ultraviolet light, and emit phosphorescence. The intensity (light amount) of the phosphorescence emitted from a phosphorescent material reaches a maximum at the end of the irradiation with excitation light and then gradually attenuates. The color and decay time constant of the phosphorescence emitted from a phosphorescent material depends on each phosphorescent material. Even different phosphorescent materials may have the same phosphorescent color or/and decay time constant. In addition, the number of types of phosphorescence emitted from a single phosphorescent material is not always one and may be more than one. The following description is based on the assumption that one type of phosphorescence is emitted from a phosphorescent material for the sake of simplicity. Moreover, even phosphorescence having different apparent phosphorescent colors can be treated as phosphorescence within the same wavelength range as long as it is within the wavelength range detectable by a photodetector. The relationship between the intensity of phosphorescence emitted from a single phosphorescent material α and time is represented by Expression 1. [Expression 1] Pα=Aαexp(−t/τα)  (1) In Expression 1, Pαis the intensity of phosphorescence emitted from a phosphorescent material α, Aαis a constant determined by the concentration and the emission efficiency of the phosphorescent material α, t is the time elapsed from the time of the turning-off of excitation light to the time of detection, and ταis the decay time constant of the phosphorescence emitted from the phosphorescent material α. Even when the phosphorescent material α is a mixture of a plurality of phosphorescent materials having the same decay time constant, the relationship between the intensity of phosphorescence emitted from the phosphorescent material α and time is similarly expressed by Expression 1. When the detected phosphorescence is phosphorescence emitted from a single phosphorescent material having a decay time constant or a plurality of phosphorescent materials having the same decay time constant, the decay time constant of the phosphorescent material can be determined by detecting the intensity twice changing the detection timing (detection time), and solving the simultaneous expression of Expression 1. The following description is based on the assumption that, regarding the time t in Expression 1, the detection timing of phosphorescence is time tn. The time tnis represented by the time elapsed from turning-off of excitation light to detection, and the time when the excitation light is turned off is to =0. To be specific, after the stop of irradiation of excitation light, the intensity P1and intensity P2of the phosphorescence emitted from the detection target are detected at the time t1 (first timing) and the second time t2 (second timing). With the intensity P1and intensity P2and the time t1and time t2 at which they are detected, the decay time constant Tec of the phosphorescence emitted from a detection target is calculated based on the following Expression 2. [Expression 2] τα=−(t2−t1)/ln(P2/P1)  (2) In this manner, the decay time constant of phosphorescence emitted from the detection target is calculated from a difference in detection timing t2−t1and the intensity ratio P2/P1so that the phosphorescence is recognized, whereby the authenticity of a sheet or the like having the detection target can be determined. When the phosphorescence emitted from the detection target results from multiple types of phosphorescence having different decay time constants, the intensity of the phosphorescent cannot be expressed by Expression 1, but the decay time constant obtained when it is approximated by phosphorescence that has a single decay time constant can be determined by the aforementioned calculation method. This can also be recognized as a phosphorescent feature. However, as the difference between the time t1and the time t2decreases, the amount of change in the intensity of phosphorescence decreases, which may make it susceptible to unevenness of the phosphorescent material c printed on the detection target, errors made by detectors, and the like, and make it difficult to accurately calculate the decay time constant T. It is therefore important to set an appropriate detection timing of phosphorescence according to the decay characteristics of a phosphorescent material to be detected. An object of the present invention, which has been made in view of such circumstances, is to provide an apparatus capable of recognizing recognition target phosphorescence in a short time. Solution to Problem An optical sensor according to the present invention includes: a light source that irradiates excitation light; a photodetector that detects radiation light emitted from a detection target excited by the excitation light; and a single light guide unit that guides the excitation light to the detection target and guides the radiation light to the photodetector. A light detection method according to the present invention includes: irradiating excitation light from a light source; and detecting, through a photodetector, radiation light that has been emitted from a detection target excited by the excitation light passing through a light guide unit and that has passed through the light guide unit. When the detected phosphorescence is phosphorescence emitted from a single phosphorescent material or a plurality of phosphorescent materials having the same decay time constant, the decay time constant of the phosphorescent material can be determined by detecting the intensity twice changing the detection time, and solving the simultaneous expression representing the relationship between the intensity of phosphorescence and time. However, when the detected phosphorescence is phosphorescence emitted from a plurality of phosphorescent materials having different decay time constants, it is necessary to solve a complex simultaneous expression of exponential functions, making it difficult to determine the decay time constants of the plurality of phosphorescent materials. Meanwhile, in the determination of the authenticity of security marks and the like, whether the phosphorescence results from multiple types of phosphorescence that emit light within the same wavelength range and have different decay time constants is one of the features, and success in judging it is useful. To be specific, when the detection time is changed and the intensity of phosphorescence is detected at least three times, it can be determined whether the detected phosphorescence results from phosphorescence having a single decay time constant. In other words, it can be determined whether or not the detected phosphorescence results from multiple types of phosphorescence having different decay time constants. In other words, a phosphorescence detection apparatus according to the present invention solves the aforementioned problem by including: a light source that irradiates a detection target with the excitation light, the detection target containing a phosphorescent material; a photodetector that detects the intensity of phosphorescence emitted from the detection target; and a detection unit that controls the light source and the photodetector, and detects the intensity at least three times after the stop of the irradiation with the excitation light, changing the detection time; and a determination unit that determines whether or not the phosphorescence results from multiple types of phosphorescence having different decay time constants, on the basis of the at least three intensities detected by the detection unit and their detection times. A phosphorescence detection method according to the present invention solves the aforementioned problem by including: irradiating a detection target with excitation light, the detection target containing a phosphorescent material; detecting the intensity of phosphorescence emitted from the detection target at least three times after the stop of the irradiation with the excitation light, changing the detection time; and determining whether or not the phosphorescence results from multiple types of phosphorescence having different decay time constants, on the basis of the at least three intensities and their detection times. A phosphorescence detection apparatus according to the present invention includes: a light source that irradiates a detection target with excitation light, the detection target emitting at least one of multiple types of phosphorescence to be recognized; a photodetector that detects the intensity of phosphorescence emitted from the detection target; and a control unit that controls the light source and the photodetector, in which the control unit performs the first detection of the intensity at a first timing after the stop of the irradiation with the excitation light, and performs the subsequent detection of the intensity at a second timing subsequent to the first detection. The second timing is a timing at which the absolute value of a difference in the ratio of the intensity detected in the first detection to the intensity detected in the subsequent detection is greater than or equal to a predetermined value, between at least two of the multiple types of phosphorescence to be recognized. A phosphorescence detection method according to the present invention includes: irradiating a detection target with excitation light, the detection target emitting at least one of multiple types of phosphorescence to be recognized; stopping the irradiation with the excitation light; performing a first detection of the intensity of phosphorescence emitted from the phosphorescent material contained in the detection target at a first timing after stopping the irradiation with the excitation light; and performing subsequent detection of the intensity at a second timing subsequent to the first detection. The second timing is a timing at which the absolute value of a difference in the ratio of the intensity detected in the first detection to the intensity detected in the subsequent detection is greater than or equal to a predetermined value, between at least two of the multiple types of phosphorescence to be recognized. Although there are various phosphorescent materials and phosphorescence has various emission colors and decay time constants, here, a phosphorescent material having a decay time constant in the range of 0.2 to 10 msec, which is thought to be a preferable security feature for sheets represented by value documents such as banknotes and securities is regarded a detection target. To be specific, for example, when phosphorescence having a decay time constant in the range of 0.2 to 10 msec is detected with a banknote processing apparatus that conveys a banknote at 4,000 mm/sec, the distance by which the detection target is conveyed and moved until the phosphorescence reaches about 37% of the initial value (1/e of the initial value) is 0.8 to 40 mm. For this reason, when the phosphorescence detectable range of the sensor is about 10 mm to 20 mm in the convey direction of the detection target, phosphorescent materials having the aforementioned decay time constant can be distinguished. Advantageous Effects of Invention According to the present invention, excitation light can be guided from the light source to the detection target by using a single light guide unit, and the radiation light can be guided from the detection target to the photodetector, whereby the sensor can be miniaturized and the radiation light reception surface of the sensor can be enlarged at the same time. According to the present invention, whether or not the detected phosphorescence results from multiple types of phosphorescence that emit light within the same wavelength range and have different decay time constants can be determined. According to the present invention, an apparatus can be provided which is capable of recognizing recognition target phosphorescence in a short time.

11381347

TECHNICAL FIELD The present invention relates to the field of communications technologies, and in particular, to a communication method and a communication device. BACKGROUND A Long Term Evolution (LTE) communications system aims to provide low-delay and highly-reliable data transmission. According to a current communication method, multiple retransmissions are usually performed to improve reliability of data transmission between a transmit end and a receive end. For example: When the receive end fails to decode a data packet, the receive end feeds back a negative acknowledgement to the transmit end; after receiving the negative acknowledgement fed back by the receive end, the transmit end re-sends the data packet that fails to be decoded to the receive end. The foregoing process may be executed for multiple times. However, although the reliability of data transmission is ensured to some extent in the foregoing multiple-retransmission manner, multiple transmissions inevitably increase a delay of data transmission. Therefore, according to the current communication method, data transmission cannot be both low-delay and highly-reliable, and it is imperative to provide a low-delay and highly-reliable data transmission method. SUMMARY Embodiments of the present invention provide a communication method and a communication device, so as to provide a low-delay and highly-reliable data transmission method. According to a first aspect, a communication device is provided, including: a determining unit, configured to determine a parallel hybrid automatic repeat request HARQ communication instruction, where the parallel HARQ communication instruction is used to instruct the communication device to send or receive data in a parallel HARQ manner; and a transceiver unit, configured to send or receive data in the parallel HARQ manner according to the parallel HARQ communication instruction determined by the determining unit; where the sending data in the parallel HARQ manner is sending at least one data packet with same content within a same transmission time interval; and the receiving data in the parallel HARQ manner is receiving at least one data packet with same content within a same transmission time interval, and performing combined decoding on the received at least one data packet with same content. With reference to the first aspect, in a first implementation, the communication device is a network device or user equipment. With reference to the first aspect or the first implementation of the first aspect, in a second implementation, the parallel HARQ communication instruction is a HARQ configuration parameter; and the HARQ configuration parameter is a configuration parameter used by the communication device to send or receive data in the parallel HARQ manner. With reference to the second implementation of the first aspect, in a third implementation, the HARQ configuration parameter includes a parallel HARQ quantity parameter used by the communication device to send or receive data in the parallel HARQ manner; and the parallel HARQ quantity parameter includes a largest quantity of parallel HARQs or a specific quantity of parallel HARQs. With reference to any one of the first aspect or the first implementation of the first aspect to the second implementation of the first aspect, in a fourth implementation, if the communication device is user equipment, the transceiver unit is further configured to receive at least one piece of downlink control signaling before sending or receiving data in the parallel HARQ manner, where the at least one piece of downlink control signaling includes a physical resource, a modulation and coding scheme, and a parallel HARQ quantity parameter that are used by the user equipment to send or receive the data in the parallel HARQ manner; and the transceiver unit is specifically configured to send or receive data in the parallel HARQ manner in the following way: sending or receiving data in the parallel HARQ manner based on the physical resource, the modulation and coding scheme, and the parallel HARQ quantity parameter that are indicated in the at least one piece of downlink control signaling. With reference to the fourth implementation of the first aspect, in a fifth implementation, each of the at least one piece of downlink control signaling includes at least one of all physical resources used by the user equipment to send or receive data in the HARQ manner; and the transceiver unit is specifically configured to send or receive data in the parallel HARQ manner based on the physical resource indicated in the at least one piece of downlink control signaling and in the following way: sending or receiving data in the parallel HARQ manner based on all physical resources indicated in the at least one piece of downlink control signaling. With reference to the fourth implementation of the first aspect or the fifth implementation of the first aspect, in a sixth implementation, the communication device further includes: a combined decoding unit, configured to: when the user equipment receives at least two pieces of downlink control signaling, and all the pieces of downlink control signaling include a same physical resource, perform combined decoding on the at least two pieces of downlink control signaling before the transceiver unit sends or receives data in the parallel HARQ manner based on the at least one piece of downlink control signaling. With reference to any one of the fourth implementation of the first aspect to the sixth implementation of the first aspect, in a seventh implementation, the transceiver unit is further configured to: receive a first carrier parameter before the user equipment receives the at least one piece of downlink control signaling, where the first carrier parameter is used to indicate a first carrier used by the user equipment to receive the at least one piece of downlink control signaling; and the transceiver unit is specifically configured to receive the at least one piece of downlink control signaling in the following way: receiving the at least one piece of downlink control signaling according to the first carrier indicated by the first carrier parameter. With reference to any one of the first aspect or the first implementation of the first aspect to the seventh implementation of the first aspect, in an eighth implementation, the determining unit is further configured to: determine a second carrier parameter before the transceiver unit sends or receives data in the parallel HARQ manner, where the second carrier parameter is used to indicate a second carrier used by the communication device to send or receive the data in the parallel HARQ manner; and the transceiver unit is specifically configured to send or receive data in the parallel HARQ manner in the following way: sending or receiving data in the parallel HARQ manner according to the second carrier indicated by the second carrier parameter. With reference to the eighth implementation of the first aspect, in a ninth implementation, the communication device further includes a configuration unit, configured to: when the second carrier includes at least two carriers, configure the at least two subcarriers included in the second carrier as one virtual carrier before the transceiver unit sends or receives the data in the parallel HARQ manner according to the second carrier indicated by the second carrier parameter; and the transceiver unit is specifically configured to send or receive data in the parallel HARQ manner according to the second carrier indicated by the second carrier parameter and in the following way: sending or receiving data in the parallel HARQ manner on the virtual carrier. With reference to any one of the first aspect or the first implementation of the first aspect to the ninth implementation of the first aspect, in a tenth implementation, the transceiver unit is further configured to: before receiving the parallel HARQ communication instruction, send capability information used to represent that the communication device supports sending or receiving data in the parallel HARQ manner. With reference to the tenth implementation of the first aspect, in an eleventh implementation, the capability information includes a quantity of parallel HARQs used by the communication device to support sending or receiving data in the parallel HARQ manner. With reference to the eleventh implementation of the first aspect, in a twelfth implementation, the quantity of parallel HARQs used by the communication device to support sending or receiving data in the parallel HARQ manner is a quantity that is of carriers for carrier aggregation and that can be supported by the communication device. With reference to any one of the first aspect or the first implementation of the first aspect to the twelfth implementation of the first aspect, in a thirteenth implementation, the transceiver unit is further configured to: after sending or receiving the data in the parallel HARQ manner, send or receive feedback information by using at least one feedback resource, where the feedback resource is an uplink transmission resource determined according to a physical resource used by the downlink control signaling, or a downlink transmission resource determined according to the physical resource used for sending data in the parallel HARQ manner. According to a second aspect, a network device is provided, including: a determining unit, configured to determine a parallel hybrid automatic repeat request HARQ communication instruction, where the parallel HARQ communication instruction is used to instruct user equipment to send or receive data in a parallel HARQ manner; and a sending unit, configured to send the parallel HARQ communication instruction to the user equipment; where the sending data in a parallel HARQ manner is sending at least one data packet with same content within a same transmission time interval; and the receiving data in a parallel HARQ manner is receiving at least one data packet with same content within a same transmission time interval, and performing combined decoding on the received at least one data packet with same content. With reference to the second aspect, in a first implementation, the sending unit is further configured to send data in the parallel HARQ manner, and the network device further includes: a receiving unit, configured to receive data in the parallel HARQ manner. With reference to the second aspect or the first implementation of the second aspect, in a second implementation, the parallel HARQ communication instruction is a HARQ configuration parameter; and the HARQ configuration parameter is a configuration parameter used by the user equipment to send or receive the data in the parallel HARQ manner. With reference to the second implementation of the second aspect, in a third implementation, the HARQ configuration parameter includes a parallel HARQ quantity parameter used by the user equipment to send or receive data in the parallel HARQ manner; and the parallel HARQ quantity parameter includes a largest quantity of parallel HARQs or a specific quantity of parallel HARQs. With reference to the second aspect, the first implementation of the second aspect, or the second implementation of the second aspect, in a fourth implementation, the network device further includes a configuration unit, configured to configure at least one piece of downlink control signaling, where the at least one piece of downlink control signaling includes a physical resource, a modulation and coding scheme, and a parallel HARQ quantity parameter that are used by the user equipment to send or receive data in the parallel HARQ manner; and the sending unit is further configured to send the at least one piece of downlink control signaling to the user equipment. With reference to the fourth implementation of the second aspect, in a fifth implementation, each of the at least one piece of downlink control signaling includes at least one of all physical resources used by the user equipment to send or receive data in the HARQ manner. With reference to the fifth implementation of the second aspect, in a sixth implementation, there are at least two pieces of downlink control signaling, and all the pieces of downlink control signaling include a same physical resource. With reference to any one of the fourth implementation of the second aspect to the sixth implementation of the second aspect, in a seventh implementation, the configuration unit is further configured to: configure a first carrier parameter, where the first carrier parameter is used to indicate a first carrier used by the user equipment to receive the at least one piece of downlink control signaling; and the sending unit is further configured to send the first carrier parameter to the user equipment. With reference to any one of the second aspect or the first implementation of the second aspect to the seventh implementation of the second aspect, in an eighth implementation, the network device includes the configuration unit, configured to: configure a second carrier parameter, where the second carrier parameter is used to indicate a second carrier used by the user equipment to send or receive the data in the parallel HARQ manner; and the sending unit is further configured to send the second carrier parameter to the user equipment. With reference to the eighth implementation of the second aspect, in a ninth implementation, the sending unit is further configured to: send instruction information to the user equipment when the second carrier includes at least two carriers, where the instruction information is used to instruct the user equipment to configure the at least two subcarriers included in the second carrier as one virtual carrier. With reference to any one of the second aspect or the first implementation of the second aspect to the ninth implementation of the second aspect, in a tenth implementation, the network device includes the receiving unit, and the receiving unit is configured to: before the determining unit determines the parallel hybrid automatic repeat request HARQ communication instruction, receive capability information sent by the user equipment and used to represent that the user equipment supports sending or receiving the data in the parallel HARQ manner. With reference to any one of the second aspect or the first implementation of the second aspect to the tenth implementation of the second aspect, in an eleventh implementation, the network device includes the receiving unit, and the receiving unit is configured to receive, by using at least one uplink feedback resource, feedback information sent by the user equipment, where the at least one uplink feedback resource is a transmission resource determined according to a physical resource used by the downlink control signaling; and the sending unit is further configured to: send feedback information to the user equipment by using at least one downlink feedback resource, where the at least one downlink feedback resource is a transmission resource determined according to the physical resource used for sending data in the parallel HARQ manner. According to a third aspect, a communication method is provided, including: determining, by a communication device, a parallel hybrid automatic repeat request HARQ communication instruction, where the parallel HARQ communication instruction is used to instruct the communication device to send or receive data in a parallel HARQ manner, where the sending data in a parallel HARQ manner by the communication device is sending, by the communication device, at least one data packet with same content within a same transmission time interval; and the receiving data in a parallel HARQ manner by the communication device is receiving, by the communication device, at least one data packet with same content within a same transmission time interval, and performing combined decoding on the received at least one data packet with same content; and sending or receiving, by the communication device, data in the parallel HARQ manner according to the parallel HARQ communication instruction. With reference to the third aspect, in a first implementation, the communication device is a network device or user equipment. With reference to the third aspect or the first implementation of the third aspect, in a second implementation, the parallel HARQ communication instruction is a HARQ configuration parameter; and the HARQ configuration parameter is a configuration parameter used by the communication device to send or receive data in the parallel HARQ manner. With reference to the second implementation of the third aspect, in a third implementation, the HARQ configuration parameter includes a parallel HARQ quantity parameter used by the communication device to send or receive data in the parallel HARQ manner; and the parallel HARQ quantity parameter includes a largest quantity of parallel HARQs or a specific quantity of parallel HARQs. With reference to any one of the third aspect or the first implementation of the third aspect to the third implementation of the third aspect, in a fourth implementation, before the sending or receiving, by the communication device, data in the parallel HARQ manner, the method further includes: if the communication device is user equipment, receiving, by the user equipment, at least one piece of downlink control signaling, where the at least one piece of downlink control signaling includes a physical resource, a modulation and coding scheme, and a parallel HARQ quantity parameter that are used by the user equipment to send or receive the data in the parallel HARQ manner; and the sending or receiving, by the user equipment, the data in the parallel HARQ manner specifically includes: sending or receiving, by the user equipment, data in the parallel HARQ manner based on the physical resource, the modulation and coding scheme, and the parallel HARQ quantity parameter that are indicated in the at least one piece of downlink control signaling. With reference to the fourth implementation of the third aspect, in a fifth implementation, each of the at least one piece of downlink control signaling includes at least one of all physical resources used by the user equipment to send or receive data in the HARQ manner; and the sending or receiving, by the user equipment, data in the parallel HARQ manner based on the physical resource indicated in the at least one piece of downlink control signaling includes: sending or receiving, by the user equipment, data in the parallel HARQ manner based on all physical resources indicated in the at least one piece of downlink control signaling. With reference to the fourth implementation of the third aspect or the fifth implementation of the third aspect, in a sixth implementation, before the sending or receiving, by the user equipment, data in the parallel HARQ manner based on the at least one piece of downlink control signaling, the method further includes: if the user equipment receives at least two pieces of downlink control signaling, and all the pieces of downlink control signaling include a same physical resource, performing, by the user equipment, combined decoding on the at least two pieces of downlink control signaling. With reference to any one of the fourth implementation of the third aspect to the sixth implementation of the third aspect, in a seventh implementation, before the receiving, by the user equipment, at least one piece of downlink control signaling, the method further includes: receiving, by the user equipment, a first carrier parameter, where the first carrier parameter is used to indicate a first carrier used by the user equipment to receive the at least one piece of downlink control signaling; and the receiving, by the user equipment, at least one piece of downlink control signaling specifically includes: receiving, by the user equipment, the at least one piece of downlink control signaling according to the first carrier indicated by the first carrier parameter. With reference to any one of the third aspect or the first implementation of the third aspect to the seventh implementation of the third aspect, in an eighth implementation, before the sending or receiving, by the communication device, data in the parallel HARQ manner, the method further includes: determining, by the communication device, a second carrier parameter, where the second carrier parameter is used to indicate a second carrier used by the communication device to send or receive the data in the parallel HARQ manner; and the sending or receiving, by the communication device, data in the parallel HARQ manner specifically includes: sending or receiving, by the communication device, data in the parallel HARQ manner according to the second carrier indicated by the second carrier parameter. With reference to the eighth implementation of the third aspect, in a ninth implementation, before the sending or receiving, by the communication device, the data in the parallel HARQ manner according to the second carrier indicated by the second carrier parameter, the method further includes: if the second carrier includes at least two carriers, configuring, by the communication device, the at least two subcarriers included in the second carrier as one virtual carrier; and the sending or receiving, by the communication device, data in the parallel HARQ manner according to the second carrier indicated by the second carrier parameter includes: sending or receiving, by the communication device, data in the parallel HARQ manner on the virtual carrier. With reference to any one of the third aspect or the first implementation of the third aspect to the ninth implementation of the third aspect, in a tenth implementation, before the communication device receives the parallel HARQ communication instruction, the method further includes: sending, by the communication device, capability information used to represent that the communication device supports sending or receiving data in the parallel HARQ manner. With reference to the tenth implementation of the third aspect, in an eleventh implementation, the capability information includes a quantity of parallel HARQs used by the communication device to support sending or receiving data in the parallel HARQ manner. With reference to the eleventh implementation of the third aspect, in a twelfth implementation, the quantity of parallel HARQs used by the communication device to support sending or receiving data in the parallel HARQ manner is a quantity that is of carriers for carrier aggregation and that can be supported by the communication device. With reference to any one of the third aspect or the first implementation of the third aspect to the twelfth implementation of the third aspect, in a thirteenth implementation, after the sending or receiving, by the communication device, the data in the parallel HARQ manner, the method further includes: sending or receiving, by the communication device, feedback information by using at least one feedback resource, where the feedback resource is an uplink transmission resource determined according to a physical resource used by the downlink control signaling, or a downlink transmission resource determined according to the physical resource used for sending data in the parallel HARQ manner. According to a fourth aspect, a communication method is provided, including: determining, by a network device, a parallel hybrid automatic repeat request HARQ communication instruction, where the parallel HARQ communication instruction is used to instruct user equipment to send or receive data in a parallel HARQ manner, where the sending data in a parallel HARQ manner is sending at least one data packet with same content within a same transmission time interval; and the receiving data in a parallel HARQ manner is receiving at least one data packet with same content within a same transmission time interval, and performing combined decoding on the received at least one data packet with same content; and sending, by the network device, the parallel HARQ communication instruction to the user equipment. With reference to the fourth aspect, in a first implementation, the method further includes: sending or receiving, by the network device, data in the parallel HARQ manner. With reference to the fourth aspect or the first implementation of the fourth aspect, in a second implementation, the parallel HARQ communication instruction is a HARQ configuration parameter; and the HARQ configuration parameter is a configuration parameter used by the user equipment to send or receive the data in the parallel HARQ manner. With reference to the second implementation of the fourth aspect, in a third implementation, the HARQ configuration parameter includes a parallel HARQ quantity parameter used by the user equipment to send or receive data in the parallel HARQ manner; and the parallel HARQ quantity parameter includes a largest quantity of parallel HARQs or a specific quantity of parallel HARQs. With reference to the fourth aspect, the first implementation of the fourth aspect, or the second implementation of the fourth aspect, in a fourth implementation, the method further includes: configuring, by the network device, at least one piece of downlink control signaling, where the at least one piece of downlink control signaling includes a physical resource, a modulation and coding scheme, and a parallel HARQ quantity parameter that are used by the user equipment to send or receive data in the parallel HARQ manner; and sending, by the network device, the at least one piece of downlink control signaling to the user equipment. With reference to the fourth implementation of the fourth aspect, in a fifth implementation, each of the at least one piece of downlink control signaling includes at least one of all physical resources used by the user equipment to send or receive data in the HARQ manner. With reference to the fifth implementation of the fourth aspect, in a sixth implementation, there are at least two pieces of downlink control signaling, and all the pieces of downlink control signaling include a same physical resource. With reference to any one of the fourth implementation of the fourth aspect to the sixth implementation of the fourth aspect, in a seventh implementation, the method further includes: configuring, by the network device, a first carrier parameter, where the first carrier parameter is used to indicate a first carrier used by the user equipment to receive the at least one piece of downlink control signaling; and sending, by the network device, the first carrier parameter to the user equipment. With reference to any one of the fourth aspect or the first implementation of the fourth aspect to the seventh implementation of the fourth aspect, in an eighth implementation, the method further includes: configuring, by the network device, a second carrier parameter, where the second carrier parameter is used to indicate a second carrier used by the user equipment to send or receive the data in the parallel HARQ manner; and sending, by the network device, the second carrier parameter to the user equipment. With reference to the eighth implementation of the fourth aspect, in a ninth implementation, the method further includes: sending, by the network device, instruction information to the user equipment if the second carrier includes at least two carriers, where the instruction information is used to instruct the user equipment to configure the at least two subcarriers included in the second carrier as one virtual carrier. With reference to any one of the fourth aspect or the first implementation of the fourth aspect to the ninth implementation of the fourth aspect, in a tenth implementation, before the determining, by the network device, a parallel hybrid automatic repeat request HARQ communication instruction, the method further includes: receiving, by the network device, capability information sent by the user equipment and used to represent that the user equipment supports sending or receiving the data in the parallel HARQ manner. With reference to any one of the fourth aspect or the first implementation of the fourth aspect to the tenth implementation of the fourth aspect, in an eleventh implementation, the method further includes: receiving, by the network device by using at least one uplink feedback resource, feedback information sent by the user equipment, or sending feedback information to the user equipment by using at least one downlink feedback resource, where the at least one uplink feedback resource is a transmission resource determined according to a physical resource used by the downlink control signaling, and the at least one downlink feedback resource is a transmission resource determined according to the physical resource used for sending data in the parallel HARQ manner. According to the communication method and the communication device provided in the embodiments of the present invention, data is sent or received in the parallel HARQ manner according to the parallel HARQ communication instruction. The at least one data packet with same content is sent or received within a same transmission time, so that the data packet is sent or received in parallel, and a delay can be reduced. In addition, multiple data packets are sent or received within a same transmission time, so that reliability of data transmission is also improved.

11394398

TECHNICAL FIELD In general, certain embodiments of the present disclosure relate to wireless communications. More particularly, certain embodiments relate to adaptive selection of information bit locations for polar codes. BACKGROUND Polar codes, proposed by Arikan, are the first class of constructive coding schemes that are provable to achieve the symmetric capacity of the binary-input discrete memoryless channels under a low-complexity successive cancellation (SC) decoder. See E. Arikan, “Channel Polarization: A Method for Constructing Capacity-Achieving Codes for Symmetric Binary-Input Memoryless Channels,” IEEE Transactions on Information Theory, vol. 55, pp. 3051-3073, July 2009 (hereinafter, “[1]”). However, the finite-length performance of polar codes under SC is not competitive compared to other modern channel coding schemes such as low-density parity-check (LDPC) codes and Turbo codes. Later, SC list (SCL) decoder is proposed by Tal et al., which can approach the performance of optimal maximum-likelihood (ML) decoder. See I. Tal and A. Vardy, “List Decoding of polar codes,” in Proceedings of IEEE Symp. Info. Theory, pp. 1-5, 2011 (hereinafter, “[2]”). By concatenating a simple cyclic redundancy check (CRC) coding, it was shown that the performance of concatenated polar code is competitive with that of well-optimized LDPC and Turbo codes. As a result, polar codes are being considered as a candidate for future 5G wireless communication systems. Additional background related to polar codes is described by Leroux. See Leroux, et. al., “A Semi-Parallel Successive-Cancellation Decoder for Polar Codes,” IEEE TRANSACTIONS ON SIGNAL PROCESSING, VOL. 61, NO. 2, Jan. 15, 2013 (hereinafter, “[3]”). The main idea of polar coding is to transform a pair of identical binary-input channels into two distinct channels of different qualities, one better and one worse than the original binary-input channel. By repeating such a pair-wise polarizing operation on a set of N=2nindependent uses of a binary-input channel, a set of 2n“bit-channels” of varying qualities can be obtained. Some of these bit channels are nearly perfect (i.e., error free) while the rest of them are nearly useless (i.e., totally noisy). The point is to use the nearly perfect channel to transmit data to the receiver while setting the input to the useless channels to have fixed or frozen values (e.g., 0) known to the receiver. For this reason, those input bits to the nearly useless and the nearly perfect channel are commonly referred to as frozen bits and non-frozen (or information) bits, respectively. Only the non-frozen bits are used to carry data in a polar code. Loading the data into the proper information bit locations have directly impact on the performance of a polar code. An illustration of the structure of a length-8 polar code is illustrated inFIG. 1(example of polar code structure with N=8). FIG. 2, polar code encoder with N=8, illustrates the labeling of the intermediate info bits sl,i, where l∈{0,1, . . . n} and i∈{0,1, . . . , N−1} during polar encoding with N=8. The intermediate info bits are related by the following equation: sl+1,i=sl,i⊕sl,i+2l,fori∈{j∈{0,1,…⁢,N-1}⁢:⁢⁢mod⁡(⌊j2l⌋,2)=0}⁢⁢and⁢l∈{0,1,…⁢,n-1}sl+1,i+2l=sl,i+2l,fori∈{j∈{0,1,…⁢,N-1}⁢:⁢⁢mod⁡(⌊j2l⌋,2)=0}⁢⁢and⁢l∈{0,1,…⁢,n-1} with s0,i≡uibe the info bits, and sn,i≡xibe the code bits, for i∈{0,1, . . . , N−1}. SUMMARY Certain embodiments of the present disclosure may provide solutions to one or more problems associated with using Polar codes. For example, a main design problem of Polar codes is to identify the set of locations of the information bits (or equivalently the frozen bits), which is commonly referred to as the information set (or correspondingly, frozen set). In conventional Polar code design, the information set is determined based on orthogonal frequency division multiplexing an assumption that the underlying binary-input channels (e.g., the channels denoted by W inFIG. 1) from which the polarized bit-channels are transformed are identically distributed. However, in many practical situations, (such as the use of higher modulation schemes, the use of rate-matching schemes to accommodate the amount of radio resources, different channel profiles, different deployment scenarios, etc.), the qualities of the underlying bit-channels are non-uniform. This affects the optimal locations of the information bits. In one of the embodiments of the present disclosure, an adaptive scheme of Polar coding is described, where the system utilizes multiple collections of information sets, each collection consisting of one information set for every possible number of information bits. For a given scenario, the collection to be used is adaptively determined based on various system parameters and link measurements. The system parameters include, but are not limited to, number of punctured or repeated code bits in rate-matching process, modulation scheme used for the target transmission, resource allocation methods, the direction of communication (uplink or downlink), waveform or multiplexing scheme (e.g., orthogonal frequency division multiplexing (OFDM) vs. discrete Fourier transform spread (DFT-S-OFDM)), multiple input multiple output (MIMO) technique, beamforming/beam-sweeping technique, number of data streams in a MIMO transmission, etc. The link measurements include signal-to-noise levels, amount of delay spread, long-term channel delay profile, Doppler-related measurement, etc. According to certain embodiments, a transmitter comprises an interface, processing circuitry, and logic. The logic, when executed by the processing circuitry, causes the transmitter to select an information set or sequence of information sets for polar encoding, perform polar encoding for a plurality of data bits to yield encoded data, and transmit the encoded data to a receiver. The information set or sequence of information sets are selected from a plurality of information sets based on one or more system parameters and/or one or more link measurements, and the polar encoding is performed according to the selected information set or sequence of information sets. According to certain embodiments, a method for use in a transmitter comprises selecting an information set or sequence of information sets for polar encoding. The information set or sequence of information sets are selected from a plurality of information sets based on one or more system parameters and/or one or more link measurements. The method further comprises performing polar encoding for a plurality of data bits to yield encoded data. The polar encoding is performed according to the selected information set or sequence of information sets. The method further comprises transmitting the encoded data to a receiver. According to certain embodiments, a computer program product comprises a non-transitory computer readable medium storing computer readable program code. The computer readable program code comprises program code for selecting an information set or sequence of information sets for polar encoding. The information set or sequence of information sets are selected from a plurality of information sets based on one or more system parameters and/or one or more link measurements. The computer readable program code further comprises program code for performing polar encoding for a plurality of data bits to yield encoded data. The program code performs the polar encoding according to the selected information set or sequence of information sets. The computer readable medium further comprises program code for transmitting the encoded data to a receiver. Each of the above-described transmitter, method for use in a transmitter, and/or computer program product may include various other features. Examples of such features include the following; In some embodiments, performing the polar encoding comprises inputting the data bits into a polar encoder according to an assigned bit location. The assigned bit location is defined by the selected information set or sequence of information sets. In some embodiments, the one or more system parameters include a rate matching configuration and the information set or sequence of information sets is selected based at least in part on the rate matching configuration. In some embodiments, the rate matching configuration comprises a repetition pattern indicating a subset of the bits of the encoded data to be repeated before transmitting the encoded data. In some embodiments, the rate matching configuration comprises a puncturing pattern that indicates a subset of the bits to be removed from the encoded data before transmitting the encoded data. As an example, in some embodiments, the encoded data comprises a first subset of encoded data bits and a second subset of encoded data bits, and the puncturing pattern indicates to remove the second subset of encoded data bits in response to a determination that another transmitter has been configured to transmit the second subset of encoded data bits to the receiver. In some embodiments, the one or more system parameters include a modulation scheme and the information set or sequence of information sets is selected based at least in part on the modulation scheme. For example, in some embodiments, the modulation scheme corresponds to an n-order Quadrature Amplitude Modulation (QAM) modulation scheme and the information set or sequence of information sets is selected based at least in part on the QAM modulation order. In some embodiments, the information set or sequence of information sets is selected based at least in part on one or more of the following system parameters: radio resource allocation with respect to frequency range or time duration, whether the encoded data is being transmitted via uplink or downlink, waveform or multiplexing scheme, number of redundancy versions being transmitted, MIMO technique, beamforming technique, beam-sweeping technique, number of data streams in a MIMO transmission, capabilities of the receiver, and/or cell size. In some embodiments, the one or more link measurements comprise a channel quality indicator and the information set or sequence of information sets is selected based at least in part on the channel quality indicator. In some embodiments, the information set or sequence of information sets is selected based at least in part on one or more of the following link measurements: channel delay spread, channel delay profile, and/or Doppler spread. In some embodiments, the transmitter sends a signal to the receiver indicating which information set or sequence of information sets have been selected for polar encoding. In some embodiments, the transmitter selects the information set or sequence of information sets based on a signal received from the receiver, wherein the signal indicates which information set or sequence of information sets to select for polar encoding. In some embodiments, in response to selecting the information set or sequence of information sets, the transmitter obtains the selected information set or sequence of information sets in compressed form, decompresses the compressed form of the selected information set or sequence of information sets, and uses the decompressed form of the selected information set or sequence of information sets when performing the polar encoding. In some embodiments, the transmitter is implemented in a radio node, such as a radio access node or a wireless device. Some embodiments of the present disclosure may have one or more technical advantages. As an example, an advantage of certain embodiments is that the code performance for different scenarios can be optimized since the optimal information set selection for polar code is often dependent on various system parameters and link measurements. Certain embodiments may have additional or different advantages which may be apparent to those of ordinary skill in the art.

11340403

BACKGROUND Field of the Invention The present disclosure generally relates to various novel embodiments of a photonic component with distributed Bragg reflectors and various novel methods of making such a device. Description of the Related Art There are many types of optical components in a typical fiber optics communications system, e.g., photodetectors, waveguides, light couplers, splitters, filters, etc. The function of the photodetector element in a fiber optics communication system is to convert optical power into electrical voltage or current. The most common photodetector used in fiber optics applications is the semiconductor photodetector. There are many other applications where a photodetector may be employed, e.g., radiation detection, smoke detection, flame detection and to switch on relays for street lighting, etc. When incident light from, for example, a laser or an optical fiber irradiates the photodetector, light photons in the incident light are absorbed by the photodetector. The absorption of the light photons results in the creation of electron-hole pairs in the depletion region of the photodetector. The present disclosure is generally directed to various novel embodiments of a photonic component with distributed Bragg reflectors and various novel methods of making such a device. SUMMARY The following presents a simplified summary of the invention in order to provide a basic understanding of some aspects of the invention. This summary is not an exhaustive overview of the invention. It is not intended to identify key or critical elements of the invention or to delineate the scope of the invention. Its sole purpose is to present some concepts in a simplified form as a prelude to the more detailed description that is discussed later. The present disclosure is directed to various novel embodiments of a photonic component with distributed Bragg reflectors and various novel methods of making such a device. One illustrative device disclosed herein includes a layer of semiconductor material and a first Bragg reflector structure positioned in the layer of semiconductor material, wherein the first Bragg reflector structure comprises a plurality of dielectric elements and a first internal area defined by an innermost of the first plurality of dielectric elements. In this example, the device also includes an optical component positioned above the layer of semiconductor material wherein at least a portion of the optical component is positioned within a vertical projection of the first internal area.

11282134

FIELD OF THE INVENTION The present disclosure relates generally to online auctions and more particularly to online auctions having multiple bidding options. The present also relates to online events used to match a seller and a buyer with an agreeable price that is different than a price first shown. BACKGROUND When consumers are in the market for purchasing a new or used vehicle, a major concern is that the purchase price is too high or that their negotiated purchase price could have been better or lower or their purchase could have been structured more advantageously. The feeling of buyer's remorse is commonplace post purchase when buying a vehicle from an auto dealer because buyers never know if they paid a fair price. Vehicle auctions are one avenue for consumers to purchase a vehicle without the need to enter into a direct face to face price negotiation and retain a sense of control and transparency in the vehicle buying process. A consumer must be savvy in order to bid smartly and would like to have flexibility and choice in the way they place bids. The current auctioning systems do not address these problems and often enhance these issues with respect to the buyer's experience. Further, buyers considering the purchase of expensive durable goods such as vehicles that operate on or in land, water or air, or expensive collectibles such as jewelry or artwork and other similar items, are often unable to consider a purchase through an auction, because the total cost is too financially prohibitive to settle at the end of an auction. Buyers of these types of products during typical, non-auction scenarios very regularly make use of lender financing to facilitate final transactions. The lack of opportunity to display and reconcile auction results based upon the costs of regular financing payments that the buyer can pay to acquire the product(s) or services, leaves buyers disinterested in many opportunities and sellers unable to complete potential transactions. On the other side, a vehicle dealership must manage vehicle inventory carefully in order to control costs and maximize profit. If, for example, a new or used car sits on a dealer lot for months prior to purchase, costs of capital, costs of lost opportunity, insurance costs and maintenance costs may force the dealership to reduce the sales price of the new or used car to a breakeven level or even to a level that causes the dealership to incur a loss. In order to reduce inventory, dealerships may sell vehicles at auction in order to realize profit or move inventory that is no longer profitable. The structures of existing auctioning systems are not configured to handle these deficiencies in the auction process. SUMMARY OF THE INVENTION What is desired is an online auction system for vehicles and other products or services that provides incentives to entice consumers to utilize the auction site at a benefit to both consumer and dealership. Further desired would be for this system to have the capability of adjusting pricing for or negotiating pricing with the buyer on behalf of the seller. Even greater benefit would be delivered by the system that would be able to adjust pricing and/or offer discounting to the buyer incrementally which would benefit the seller by only offering enough adjustment or discounting to entice the buyer into a transaction. This system would also benefit by the ability to enable the buyer and seller to view the costs of and complete any transaction with a mutual understanding of how the payment of a total price can be replaced by the payment of multiple scheduled payments by the buyer. This system would have to reconcile the different value of various payment offerings by multiple bidders or offerors so that the offer with the optimum value for the seller can be accepted. Thus, a new special purpose system is introduced to perform new functions in an auctioning process to address the technical weaknesses of prior action-related systems.

11355907

BACKGROUND OF THE INVENTION Technical Field The present embodiments relate to insertable fliptop units that provide access to a variety of cables, connectors, and power outlets and, more particularly, to fliptop units that can be inserted into an opening in a table or lectern an having a lid that can be opened to provide such access to a variety of cable, connector, and power outlet modules. Background Art In many applications, it is desirable to provide power and data connections to different electrical or electronic devices using cables which may be dispensed when needed and then withdrawn when no longer needed. For example, many business and academic environments include conference rooms in which meetings are held where the participants bring laptop or notebook computers, video projectors or other devices that require various data connections. It is desirable that the conference room or similar facility be configured to deliver these services by providing cables which are connectable to the various devices. It further desired that such cables can be stowed away out of sight when they are no longer needed after the meeting. Various apparatuses such cable connections. As an example, fliptop enclosures may be provided that are inserted in an cutout in a conference table, lectern, or other work surface. The fliptop unit typically includes a housing that extends below surface of the tabletop or work surface and a bezel and lid that are disposed on or above the surface. By operating the lid, access is provided to a variety of cables, connectors, and power outlets disposed within the enclosure. One or more cables and/or connectors may then be withdrawn from the enclosure for use during a meeting or presentation. Typically, a device, such as a cable retractor, is attached to the housing and stores the cable in a manner that permits the cable to be pulled out from the enclosure, and prevents the withdrawn cable from being pulled back into the enclosure until such time as the cable or connector is no longer needed. The lid of the fliptop unit may then be closed to cover the opening in the enclosure. It is desirable that the lid of the fliptop unit remain closed when not needed and not open accidentally. Therefore, a positive lock mechanism is desired that prevents accidental movement of the lid. At the same time, it is also desirable that such positive lock mechanisms be as small as possible so that the lid and bezel have a low profile with respect to the work surface. Additionally, it is often desirable to permit the lid of the flip top to close while the cable is in use. Therefore, a configuration of the lid and a lock mechanism is needed that will allow the lid to close while one or more cable are extended from from the enclosure and to remain closed. It is therefore desirable to provide a fliptop unit with an improved lock mechanism the reduces the likelihood of the accidental movement of the lid of the unit. It is further desirable to provide a fliptop unit that permits extended cables to exit from the unit while the lid of the unit remains closed. SUMMARY OF THE INVENTION It is to be understood that both the general and detailed descriptions that follow are exemplary and explanatory only and are not restrictive. DISCLOSURE OF INVENTION In accordance with an aspect, an integrated latching mechanism comprises: a slider button extending along a first direction; first and second curved elastic arms that extend from the slider button in a second direction and then curve back in a direction opposite to the second direction; a locking part contiguous with the slider button and extending away from the slider button and the first and second curved elastic arms in a third direction perpendicular to the first direction; wherein in response to an end of each of the first and second curved elastic arms being held at fixed positions and an external force urging the slider button in a direction opposite to the third direction, the locking part moves in the direction opposite to the third direction, and the urging of the slider button distorts the first and second curved elastic arms such that upon removal of the external force, the first and second curved elastic arms move the slider button and the locking part in the third direction, and the first and second curved elastic arms, the slider button, and the locking part form a single piece of elastic material. According to a further aspect, a fliptop unit comprises: a movable lid; a bezel configured to surround the movable lid; an insert configured to be coupled with the bezel; and an integrated latching mechanism that is disposed between the bezel and the insert and having a slider button that extends through an aperture formed in the bezel, and a locking part formed adjacent to the slider button and extending away from the slider button, wherein the integrated latching mechanism is configured such that an external force urging the slider button to move within the aperture moves the locking part in a same direction and releases the movable lid, and the urging of the slider button distorts the integrated latching mechanism such that upon removal of the external force, the integrated latching mechanism urges the slider button and the locking part in an opposite direction. According to another aspect, a fliptop unit comprises: a movable lid; a bezel configured to surround the movable lid; an insert configured to be coupled with the bezel; and an integrated latching mechanism that is disposed between the bezel and the insert, and comprising: a slider button extending along a first direction through an aperture formed in the bezel, first and second curved elastic arms that are each substantially U-shaped and which extend from the slider button in a second direction and then curve back in a direction opposite to the second direction, and at a base of the U-shape, each of the first and second curved elastic arms includes a portion configured to press against wall portions formed in a region of the bezel and hold the integrated latching mechanism in place, the ends of the first and second curved elastic arms each including a pad having a post that extends away from the pad and to couple with corresponding openings formed in the insert, a locking part contiguous with the slider button and extending away from the slider button and the first and second curved elastic arms in a third direction perpendicular to the first direction, the locking part including a flat surface that is parallel to the third direction, and an opposing surface that slants toward and intersects with the flat surface at one end, wherein in response to an external force urging the slider button in a direction opposite to the third direction, the locking part moves in the direction opposite to the third direction and releases the movable lid, and the urging of the slider button distorts the first and second curved elastic arms such that upon removal of the external force, the first and second curved elastic arms move the slider button and the locking part in the third direction, and the first and second curved elastic arms, the slider button, and the locking part form a single piece of elastic material.

11253404

CROSS REFERENCE TO RELATED APPLICATIONS This application is a national stage application pursuant to 35 U.S.C. § 371 of International Application No. PCT/JP2017/38094, filed on Oct. 12, 2017 which claims priority under 35 U.S.C. § 119 to Japanese Patent Application No. 2016-214678 filed on Oct. 14, 2016, the disclosures of which are hereby incorporated by reference in their entireties. TECHNICAL FIELD The present invention relates to a composite stretchable member that is flexible, has a pleasant feel, and is capable of forming gathers that are soft to the touch, and, as an apparatus for manufacturing this stretchable member, to an apparatus for applying an adhesive to stretchable members (rubber threads). BACKGROUND ART In absorbent products such as disposable diapers and sanitary napkins, it is common practice to join elastic members in a stretched state to a sheet material, and then allow the elastic members to contract to form gathers or pleats (stretchable portions having numerous folds) in the sheet material. In Patent Literature 1 (seeFIG. 16) describes a disposable diaper comprising an elastic stretchable component, which is an elastic stretchable component having a sheet material F made of nonwoven fabric and elastic members sandwiched between a two-layer portion formed by folding back this sheet material, wherein linear joining portions HM′ of the sheet material extending perpendicular to the stretch direction of these elastic members are formed, and the elastic members R are joined to the sheet material at these joining portions. Patent Literature 2 discloses an absorbent product having side flaps105on both sides (seeFIG. 17). The side flaps105are made up of a plurality of pleats112, and grooves115are formed between the pleats with flat surfaces presenting between the pleats112. Patent Documents Patent Literature 1: Japanese Utility Model Registration No. 2518953 Patent Literature 2: Japanese Patent Application Laid-Open (Kokai) No. H11-104173 Problems to be Solved by the Invention In the elastic stretchable component described in Patent Literature 1, the sheet bulges out between linear joining portions to form uniform pleats; however, because of these linear joining portions, flexibility is poor in the direction parallel to the joining portions; as a result, a problem is that the product is neither soft nor pleasant to the touch. In other words, an adhesive is applied to two sheets to form linear application areas, and one side of each of a plurality of elastic members (rubber threads) is bonded to the linear application areas, thereby fixing the sheets together, and the two sheets and the rubber threads are also fixed to each other; accordingly, the existence of these linear application areas causes problems when used in a product such as a pleated diaper. It is an object of the present invention to solve the above problems and to form non-pleated sections between pleated sections. It is another object of the present invention to make a plurality of pleats continuous by forming flat surfaces between the individual pleats, so that it makes easier to produce a product in which flat surfaces are formed between pleats and the plurality of pleats are continuous. Means for Solving the Problems The first aspect of the invention provides an apparatus for applying an adhesive to stretchable members, comprising a coating head that has slit grooves in which coating agent reservoirs are formed and that applies an adhesive over the entire peripheral surface of rubber threads passing through the coating agent reservoirs, and a rubber thread vertical drive device that moves the rubber threads passing through the coating agent reservoirs up and down between a coating position at which the rubber threads pass through the coating agent reservoirs and a non-coating position at which the rubber threads pass away from the coating agent reservoirs. The second aspect of the invention provides an apparatus for applying an adhesive to stretchable members, comprising a coating head that has slit grooves in which coating agent reservoirs are formed and that applies an adhesive over the entire peripheral surface of rubber threads passing through the coating agent reservoirs, and a rubber thread vertical drive device that moves the rubber threads passing through the coating agent reservoirs up and down between a coating position at which the rubber threads pass through the coating agent reservoirs and a non-coating position at which the rubber threads pass away from the coating agent reservoirs, wherein the rubber thread vertical drive device is a rotating cam body that has a plurality of protrusions around its peripheral surface and is driven synchronously with the feeding speed of the rubber threads. The third aspect of the invention provides the apparatus for applying an adhesive to stretchable members according to the second aspect of the invention, wherein the rotating cam body constituting the rubber thread vertical drive device has a plurality of protrusions on part of its peripheral surface, and at least one pleat is formed by one rotation of the rotating cam body. The fourth aspect of the invention provides the apparatus for applying an adhesive to stretchable members according to the second aspect of the invention, wherein the rotating cam body constituting the rubber thread vertical drive device has a plurality of continuous two protrusions on part of its peripheral surface, with protrusion sections and flat sections being formed alternately, and at least one pleat and at least one flat part are formed by one rotation of the rotating cam body. The fifth aspect of the invention provides a stretchable composite sheet in which a plurality of stretchable elastic members (rubber threads) are bonded and fixed between two nonwoven fabric sheets to form two-layer pleats (gathers) orthogonal to the plurality of stretchable elastic members (rubber threads), whereinthe pleats are formed such that both sides of the plurality of stretchable elastic members (rubber threads) are bonded and fixed to the nonwoven fabrics at contact points between the peaks of the two-layer pleats (gathers) and the plurality of stretchable elastic members (rubber threads) that are positioned orthogonally to the peaks of the pleats (gathers), and thus a plurality of pleat formation regions are formed, andbetween the plurality of pleat formation regions, pleat-free regions where no pleats are formed are formed. Effects of the Invention In the composite elastic sheet of the present invention, the joining portions between the rubber threads and the nonwoven fabric are point contacts; as a result, the product is more flexible and feels better than sheets having linear joints, the pleats (stretchable portions having numerous folds) are soft to the touch, and such pleats can be formed in absorbent products and the like, having the effect of reducing amount of adhesive used. Further, although the joining portions are point contacts, the rubber threads are bonded and fixed on its both sides (top and bottom) to the nonwoven fabrics, an effect to securely join the two sheets of nonwoven fabric and the rubber threads is provided. Furthermore, because pleat-free regions where there are no pleats are formed between a plurality of pleat formation regions, an effect thereof is that it is possible to provide a stretchable composite sheet that is suitable for various applications as an intermediate product for manufacturing products for absorption of bodily fluids, such as a disposable diapers.

11489045

BACKGROUND The present invention relates, generally, to the field of semiconductor manufacturing, and more particularly to fabricating a nanosheet field effect transistor with dynamic threshold voltage control. Complementary Metal-oxide-semiconductor (CMOS) technology is commonly used for field effect transistors (hereinafter “FET”) as part of advanced integrated circuits (hereinafter “IC”), such as central processing units (hereinafter “CPUs”), memory, storage devices, and the like. As demands to reduce the dimensions of transistor devices continue, nanosheet FETs help achieve a reduced FET device footprint while maintaining FET device performance. A nanosheet FET includes a plurality of nanosheets extending between a pair of source/drain epitaxial regions. The device may be a gate all around transistor in which a gate surrounds at least a portion of the nanosheet channel. The threshold voltage of an FET is typically determined by properties of a composition of a work function metal used in the FET, along with various other device/material properties including but not limited to channel doping, growth conditions of a high-k dielectric, charge distribution within the high-k dielectric, spacing of high-k/channel interface, presence and properties of interfacial oxide formed between the high-k and the channel. It would be advantageous to fabricate a nanosheet FET device with a dynamic threshold voltage control. SUMMARY According to an embodiment, a semiconductor nanosheet device is provided. The semiconductor nanosheet device including semiconductor channel layers vertically aligned and stacked one on top of another, the semiconductor channel layers separated from each other by a work function metal and a gate dielectric layer partially surrounding each of the semiconductor channel layers and physically separating the work function metal from each of the semiconductor channel layers, where a first portion of the work function metal directly contacts a vertical sidewall of each of the semiconductor channel layers. According to an embodiment, a semiconductor device is provided. The semiconductor device including a first set of semiconductor channel layers vertically aligned and stacked one on top of another separated by a work function metal, a second set of semiconductor channel layers adjacent to the first set of semiconductor channel layers, the second set of semiconductor channel layers are vertically aligned and stacked one on top of another separated by the work function metal, and a gate dielectric layer partially surrounding each of the semiconductor channel layers and physically separating the work function metal from each of the semiconductor channel layers, where a first portion of the work function metal between the first set of semiconductor channel layers and the second set of semiconductor channel layers directly contacts a sidewall of each of the semiconductor channel layers of both the first set and the second set of semiconductor channel layers. According to an embodiment, a method is provided. The method including forming an initial stack of nanosheet layers on a substrate, the stack of nanosheet layers including alternating layers of a sacrificial and a semiconductor channel vertically aligned and stacked one on top of another, and forming a vertical opening along a length of the initial stack of nanosheet layers creating a first stack of nanosheet layers and a second stack of nanosheet layers, the vertical opening exposing vertical side surfaces of the alternating sacrificial layers and the semiconductor channel layers of both the first stack and the second stack.

11511565

BACKGROUND Manual pool vacuums are known in the art. These apparatus typically include an operational head having a substantially planar bottom. Wheels on opposing sides of the head are installed to preserve the planar bottom just over the pool's surface. A hose typically installed centrally on the head connects to a pool filtration system. The pump of the filtration system draws water and debris toward the vacuum, under the vacuum head, through the hose and into the filter where debris is trapped. Since the bottom of the head is in close proximity to the pool surface, a Venturi effect is created, increasing suction at the vacuum head and making it more difficult to move along the pool's surface. To operate the vacuum, the head is moved along the pool's surface using a long extendable pole connected to the vacuum head. The wheels are normally oriented on the head for back-and-forth motion. This is because users can exert back-and-forth pressure on the pole more easily than other directions. Although the customary back-and-forth motion is more efficient than other directions due to posture and the user's orientation to the vacuum head, users occasionally desire to sweep the vacuum head side-to-side in the event a portion of the pool's surface or errant debris is missed during a first pass. This side-to-side action, already difficult due to viscosity and suction, is made even more difficult because the wheels travel only in two directions. Omni-directional wheels are also known in the art. Omni-directional wheels have small rollers around their circumference which are perpendicular to the axis of rotation, allowing them to be driven forward, backward, and side-to-side. State of the art omni-directional wheels are typically expensive to produce, having multiple different moving parts, and difficult to assemble, requiring fasteners or other mechanisms to hold them together. For these reasons they are disfavored for use in pool vacuums and other applications where cost and ease of use are at a premium. It is therefore an object of the invention is to provide an omni-directional wheel for a pool vacuum head that rolls from side-to-side and diagonally in addition to back and forth. Another object of the invention is to provide an omni-directional wheel for a pool vacuum head that is simple and inexpensive to mold, and easy to assemble and install. Another object of the invention is to provide an omni-directional wheel that can be readily used on an existing pool vacuum head without changing the head's basic structure or theory of operation. These and other objects are more fully discussed in the following summary, description and claims. SUMMARY An omni-directional wheel includes at least two substantially identical interlocking frames. Each frame has a hub which is rotatable around a common axis allowing the frames to rotate together. Lower supports extend radially around the hub, and upper supports are coupled to the hub. The upper supports extend radially around the common axis, and the upper supports and the lower supports are in a radially staggered relationship around the common axis. Rollers are retained by the lower supports and retained by the upper supports. To allow omni-directional movement, the rollers are oriented normal to the common axis and held in a staggered relationship around the wheel and present convex rolling faces. Optimally, the omni-directional wheel has two frames for holding the rollers, and the two frames are substantially identical. For mounting the omni-directional wheel on a pool vacuum head, the hubs each have a central hole. While the lower supports are staggered around the hub and the upper supports staggered around the common axis, the lower supports and the upper supports are also preferably staggered along the common axis. To allow such a configuration, a plurality of risers is employed, connecting the upper supports to the hub. When the omni-directional wheel is assembled, the risers of each frame are interlocked. Preferably the risers are interlocked in a way that the risers releasably lock into the hub. Additionally, the lower supports and the upper supports are configured to releasably lock together to hold the wheel together. In order to lock the rollers in position, each of the rollers comprises a spindle engaging channels formed in one of the plurality of lower supports and one of the plurality of upper supports. To hold the rollers on the lower supports and the upper supports, each lower support has a lower support head, and each upper support has an upper support head, with the lower support heads and the upper support heads distal from the hubs. The lower support heads and the upper support heads include the channels that hold the spindles extending from each of the rollers. To lock the frames together, the risers each have a first post, and the hubs each have a first bore. The first posts and the first bores releasably lock together. For added resiliency in holding the rollers on the omni-directional wheel, the upper support heads each comprises a second post and the lower support heads each comprise a second bore, wherein the second posts and the second bores are releasably locked together. With the spindles locked in the channels on the lower support heads and the upper support heads, the rollers preferably extend radially farther from the common axis than the lower supports and the upper supports. The frames may be characterized as a pair of essentially identical interlocking disc frames that form the omni-directional wheel and define its periphery or circumference. Each of the interlocking disc frames has a central hub defining a central axis for rotating the omni-directional wheel about the central axis, and rollers coupled or retained around the periphery or circumference of the wheel. Each of the rollers is oriented to roll about peripheral axes that are normal to the central axis. The rollers are preferably coupled to each of the interlocking disc frames in a staggered relationship around the periphery of the omni-directional wheel, allowing the wheel to move in multiple directions.

11359705

FIELD OF THE INVENTION The present invention relates to the functioning principle of machines generating mechanical energy from energy being the basis or ground of the accelerated expansion of our Universe, and more specifically from centrifugal forces, and more particularly for generating a rotating movement from oscillating rotating plates. BACKGROUND OF THE INVENTION As well explained in the background section of PCT patent application No. PCT/CA2015/000614 to Mr. Jamel Jebari, filed on Dec. 22, 2015, and published under Publication No. WO 2016/101062A1 on Jun. 30, 2016, which is incorporated herein by reference, there exist machines/generators functioning on the principle of exploiting centrifugal forces. More specifically, in that same publication, there is an embodiment represented in FIGS. 51 to 54 in which the centrifugal forces generated by the rotating masses are to be directly transmitted from the masses to the oscillating rotating plates (oscillating about a main shaft of the rotor) via direct contact there between along perimeters of bores receiving the masses therein. The centrifugal forces are not transmitted to the plate via the rotating shaft about which the masses rotate, since the masses are free to move (or slide) radially relative to the rotating shafts, which could be simpler to design and manufacture. Accordingly, there is a need for a generator of centrifugal forces from effective elliptic trajectory with simpler design, and the machine made therewith. SUMMARY OF THE INVENTION It is therefore a general object of the present invention to provide a generator of centrifugal forces from effective elliptic trajectory with simpler design, and the machine made therewith. It is noted that for the purpose of the present application, an effective elliptic trajectory refers to any closed trajectory having an effective varying radius relative to a moving center of rotation, as it may include, as an example, but not limited to, a circular trajectory about a center of rotation oscillating about a main axis. Furthermore, the trajectory, unless specifically mentioned otherwise, is intended to be the trajectory of the center of inertia (or gravity) of the mass of the body following the trajectory. Furthermore, the body following the trajectory could be any type of body, including a solid body (or a plurality of bodies), a fluid (liquid and/or gaseous), or any combination thereof, depending on the embodiment of the invention being considered. The present invention refers to a generator of centrifugal forces from effective elliptic trajectory (GCFEET) or a machine (MGCFEET) including at least one such GCFEET. An advantage of the present invention is that the generator (GCFEET) and/or machine (MGCFEET) uses the centrifugal forces (Fc) generated onto masses (M) to provide available output power (or torque), without the use of any drawback such as availability of the power source, weather condition or the like, since the centrifugal forces (Fc) are always available, wherever on the entire Universe. A further advantage of the present invention is that the generator (GCFEET) and/or machine (MGCFEET), with oscillating rotating movement, can generate electrical energy by having the power torque feeding an electric generator, and/or can be an engine for all types of ground vehicles and others. Yet a further advantage of the present invention is that the generator (GCFEET) and/or machine (MGCFEET) exploits a source of energy which: is endless; is everywhere in the Universe (therefore exploitable outside of the atmospheric environment, and no need of carrying it); is completely green (without any pollution while operating); is easy to access; is usable by everyone; and is free (of charge). According to an aspect of the present invention, there is provided a generator of centrifugal forces from an effective elliptic trajectory for mounting on a chassis having a main shaft freely rotatably mounted thereon and a mechanical energy transmission mechanism mounted thereon, said generator comprising:a rotating shaft for freely rotatably mounting on a rotating shaft plate of the mechanical energy transmission mechanism freely rotatably mounted on the main shaft, said rotating shaft fixedly connecting to and driving in rotation at least one mass there about, said rotating shaft plate and the mechanical energy transmission mechanism being adapted to be displaced in rotational oscillation by and carry at least a portion of a centrifugal force (Fc) generated by said at least one mass when said at least one mass is displaced in rotation about said rotating shaft to transmit said at least a portion of a centrifugal force (Fc) to a torque output mechanism; anda shaft driving system selectively driving the rotating shaft and the at least one mass connected thereto. According to another aspect of the present invention, there is provided a machine generating mechanical energy by exploiting the generation of centrifugal forces (MGCFEET) typically comprising:a chassis having a main shaft freely rotatably mounted thereon;a mechanical energy transmission mechanism mounted thereon; andat least one generator as defined hereinabove freely rotatably mounting on the rotating shaft plate of the mechanical energy transmission mechanism, said rotating shaft fixedly connecting to and driving in rotation at least one mass there about, said rotating shaft plate and the mechanical energy transmission mechanism being displaced in rotational oscillation by and carry at least a portion of a centrifugal force (Fc) generated by said at least one mass when said at least one mass is displaced in rotation about said rotating shaft to transmit said at least a portion of a centrifugal force (Fc) to a torque output mechanism, said at least one generator including a shaft driving system selectively driving the rotating shaft and the at least one mass connected thereto;wherein said at least a portion of the centrifugal force (Fc) being available at said torque output mechanism for transmission as an output energy from said machine generating mechanical energy by exploiting the generation of centrifugal forces. Conveniently, the machine includes a pair of rotating shaft plates freely rotatably mounted onto the main shaft and operatively connecting to the torque output mechanism via a sprocket/gear assembly including first and second sprocket shafts operatively connected to respective first and second wheel sprockets and respective first and second gears of the mechanical energy transmission mechanism, each one of said pair of rotating shaft plates operatively engaging said sprocket/gear assembly when rotating in opposite directions and being operatively disengaged therefrom when rotating in a respective reverse direction, each one of said first sprocket shafts operatively connecting on one said pair of rotating shaft plates including a respective rotational direction reversing member, each one of said at least one generator mounting onto a respective one said pair of rotating shaft plates being selectively angularly oriented relative to one another so as to allow said pair of rotating shaft plates to have a rotational oscillating movement about the main shaft. In one embodiment, the machine further includes a plate circumferential biasing mechanism hingeably connecting to the chassis and the rotating shaft plate and biasing the rotating shaft plate into a neutral rotational position of the rotational oscillating movement thereof relative to the chassis. Conveniently, the plate circumferential biasing mechanism is at least one tension coil spring laying within a plane substantially parallel to a plane of the rotating shaft plate. In one embodiment, each plate of said pair of rotating shaft plates including a pair of axially spaced apart united plates (or hollow disk) receiving respective ones of said at least one mass therebetween. In one embodiment, the shaft driving system includes at least one electric motor connecting to and selectively driving the at least one rotating shaft. Conveniently, the machine includes a plurality of generators with respective said rotating shaft, and wherein the shaft driving system includes a plurality of electric motors, each one of said plurality of electric motors connecting to and selectively driving a respective said rotating shaft. In one embodiment, the first and second sprocket shafts, with the respective first and second wheel sprockets and the respective first and second gears of the sprocket/gear assembly of the mechanical energy transmission mechanism being mounted into a circumferentially alternating fashion and/or substantially circumferentially equally spaced apart from one another around the lower plates. Other objects and advantages of the present invention will become apparent from a careful reading of the detailed description provided herein, with appropriate reference to the accompanying drawings.

11500806

TECHNICAL FIELD The present disclosure relates generally to network-attached devices, more particularly, to a system and method for supporting multi-path and/or multi-mode NVMe over fabrics (NVMeoF) devices. BACKGROUND Non-volatile memory express (NVMe) and NVMe over fabrics (NVMeoF) (or NVMf in short) are new emerging technologies. NVMe is a standard that defines a register-level interface for host software to communicate with a non-volatile memory subsystem (e.g., a solid-state drive (SSD)) over a peripheral component interconnect express (PCIe) bus. NVMeoF defines a common architecture that supports an NVMe block storage protocol over a wide range of storage networking fabrics such as Ethernet, Fibre Channel, InfiniBand, and other network fabrics. For an NVMeoF-based system, an X86-based central processing unit (CPU) on a motherboard is no longer required to move data between an initiator (e.g., host software) and a target device (i.e., an NVMeoF device) because the target device is capable of moving data by itself. The term, fabric, represents a network topology in which network nodes can pass data to each other through a variety of interconnecting protocols, ports, and switches. For example, Ethernet-attached SSDs may attach directly to a fabric, and in this case the fabric is the Ethernet. The physical connection of the NVMe is based on a PCIe bus. A typical Ethernet SSD has a U.2 connector to interface with a system via a mid-plane over the PCIe bus. In the case of the four-lane PCIe bus (PCIe x4), the two Ethernet ports consume only two lanes of the four-lane PCIe signals, and the remaining two lanes of the PCIe X4 signals remain unused. SUMMARY According to one embodiment, a system includes a fabric switch including a motherboard, a baseboard management controller (BMC), a network switch configured to transport network signals, and a PCIe switch configured to transport PCIe signals; a midplane; and a plurality of device ports. Each of the plurality of device ports is configured to connect a storage device to the motherboard of the fabric switch over the midplane and carry the network signals and the PCIe signals over the midplane. The storage device is configurable in multiple modes based on a protocol established over a fabric connection between the system and the storage device. According to another embodiment, an NVMeoF includes: a PCIe module; a network engine; and a connector configured to connect to a switch motherboard over a midplane and carry PCIe signals over the midplane. The PCIe module transports PCIe signals to the switch over the PCIe bus, and the network engine transport network signals to the switch over Serial Attached SCSI (SAS) pins of the connector. According to yet another embodiment, a system includes: a switch and a plurality of NVMeoF devices. Each NVMeoF device is configured to be coupled to the switch using a connector. The connector is configured to transport the PCIe signals to the switch over a PCIe bus and transport network signals to the switch over a network bus. The above and other preferred features, including various novel details of implementation and combination of events, will now be more particularly described with reference to the accompanying figures and pointed out in the claims. It will be understood that the particular systems and methods described herein are shown by way of illustration only and not as limitations. As will be understood by those skilled in the art, the principles and features described herein may be employed in various and numerous embodiments without departing from the scope of the present disclosure.

11260889

BACKGROUND OF THE INVENTION Field of Invention The disclosure relates to a cart and a wheel connecting structure, and more particularly to a cart having wheels that can be flattened and retracted, and a wheel connecting structure applied to a junction between a vehicle and a wheel thereof, and capable of flattening and retracting the wheel of the vehicle. Related Art When people are handling various kinds of goods, various sizes of carts for handling various kinds of goods are frequently used in order to achieve the timesaving and laborsaving effects. The cart mainly has tires disposed on a bottom of a vehicle body, and a handle disposed on the vehicle body and to be pulled or pushed by the user. Because the cart can carry a lot of goods at a time, it is unnecessary for two hands of the people to handle the goods slowly one by one. In addition, the movement caused by the tires of the cart provides the more laborsaving, timesaving and convenient ways than the manpower for handling the goods, so that the carts are widely used by people. Although the above-mentioned cart can achieve the effects of carrying and handling the objects, it only has one single function of handling objects, and the wheels cannot be retracted, so that the cart occupies too much space, and the overall structure design still needs to be improved. In summary, the inventor had thought of and designed a cart and a wheel connecting structure for improving the drawbacks of the prior art and thus enhancing the industrial implementation and utilization. SUMMARY OF THE INVENTION In view of the problems of the above-described known art, an objective of the disclosure is to provide a cart and a wheel connecting structure to solve the drawbacks of the known art. In view of the foregoing objectives, the disclosure provides a cart comprising a body structure and at least one wheel connecting structure. The body structure comprises a support shaft, a first frame member and a second frame member. The first frame member and the second frame member are disposed on the support shaft. Optionally, the second frame member is disposed adjacent to the first frame member and is fixed to the support shaft. The at least one wheel connecting structure is disposed on one end of the support shaft and comprises a driving assembly, a rotating assembly, a linking assembly, and an energy assembly. The driving assembly is fitted with the support shaft and connected to the first frame member. One end of the rotating assembly is disposed in correspondence with the one end of the support shaft, and the other end of the rotating assembly is mounted on a wheel member. The linking assembly is fitted with the support shaft, and disposed between the driving assembly and the one end of the rotating assembly. The linking assembly comprises a pushing unit, and one end of the pushing unit is pivotally connected to the rotating assembly. The energy assembly is disposed in the support shaft and connected to the linking assembly. Furthermore, the disclosure provides a cart comprising:a body structure comprising a support shaft, a first frame member and a second frame member, wherein the first frame member is disposed on the support shaft; andat least one wheel connecting structure, which comprises:a driving assembly;a rotating (pivoting) assembly, wherein one end of the rotating assembly is connected to the support shaft, and the other end of the rotating assembly is mounted on a wheel member, wherein the one end of the rotating assembly and the other end of the rotating assembly are pivotably connected to one another;a linking assembly fitted with the support shaft, and disposed between the driving assembly and the one end of the rotating assembly, wherein the linking assembly comprises a pushing unit, and one end of the pushing unit is connected to the rotating assembly; andan energy assembly disposed in the support shaft and connected to the linking assembly. Optionally, when the first frame member is driven and links with the driving assembly to move the linking assembly to approach the rotating assembly, the linking assembly moves the rotating assembly to be deployed through the pushing unit, so that the wheel member is deployed in a standing state, and pushes the energy assembly to make the energy assembly enter an energy storing state. Optionally, when the first frame member is driven to disengage the driving assembly from the linking assembly or link with the driving assembly away from the linking assembly, and the wheel member does not contact a ground, the energy assembly is in an energy releasing state to push the linking assembly toward the driving assembly, os that the linking assembly drives the rotating assembly to be retracted through the pushing unit to make the wheel member enter a flattened state. Optionally, the rotating assembly further comprises a fixing unit and a movable unit. The fixing unit disposed in correspondence with the one end of the support shaft, wherein the linking assembly is disposed between the driving assembly and the fixing unit; and one end of the movable unit is connected to the fixing unit, the other end of the movable unit is connected to the wheel member, wherein the one end of the pushing unit is pivotally connected to the movable unit. Optionally, when the wheel member is deployed in the standing state, a predetermined included angle is formed between the wheel member and the support shaft, and the predetermined included angle ranges from 85 to 95 degrees. Optionally, the linking assembly comprises a hollow structure, an inner wall of the linking assembly comprises at least one projecting portion, and the at least one projecting portion snaps in a sliding slot of the support shaft. Optionally, one end of the driving assembly comprises at least one pushing portion, one end of the linking assembly corresponding to the at least one pushing portion comprises a resisting portion, and when the driving assembly pushes the resisting portion by means of the at least one pushing portion to move the linking assembly toward the rotating assembly, the linking assembly moves in the sliding slot through the at least one projecting portion. Optionally, when the driving assembly is driven to move the linking assembly to approach the rotating assembly, the linking assembly moves the rotating assembly to be deployed through the pushing unit, so that the wheel member is in a deployed in the standing state, and links with the energy assembly to stretch. Optionally, when the energy assembly winds through a self-retraction force, the energy assembly moves the linking assembly toward the driving assembly, so that the linking assembly drives the rotating assembly to be retracted through the pushing unit to make the wheel member enter a flattened state. Optionally, the rotating assembly further comprises a fixing unit and a movable unit. The fixing unit disposed in correspondence with the one end of the support shaft, wherein the linking assembly is disposed between the driving assembly and the fixing unit; and one end of the movable unit is connected to the fixing unit, and the other end of the movable unit is connected to the wheel member, wherein the one end of the pushing unit is pivotally connected to the movable unit. Optionally, when the driving assembly is driven to move the linking assembly to approach the fixing unit, the linking assembly rotates the movable unit in a first direction through the pushing unit, so that the rotating assembly is deployed. Optionally, when the energy assembly moves the linking assembly toward the driving assembly, the linking assembly rotates the movable unit in a second direction through the pushing unit, so that the rotating assembly is retracted. Optionally, when the wheel member is in the deployed in the standing state, a predetermined angle is formed between the wheel member and the support shaft, and the predetermined angle ranges from 85 to 95 degrees. In view of the foregoing objectives, the disclosure further provides a wheel connecting structure. The wheel connecting structure comprises a driving assembly, a rotating assembly, a linking assembly and an energy assembly. The driving assembly is fitted with a support shaft of a vehicle. One end of the rotating assembly disposed in correspondence with one end of the support shaft, and the other end of the rotating assembly is mounted on a wheel member. The one end of the rotating assembly and the other end of the rotating assembly are pivotally connected to one another. The linking assembly is fitted with the support shaft, and disposed between the driving assembly and the one end of the rotating assembly. The linking assembly comprises a pushing unit, and one end of the pushing unit is pivotally connected to the rotating assembly. The energy assembly is disposed in the support shaft and connected to the linking assembly. As mentioned hereinabove, the provisions of the driving assembly, the rotating assembly, the linking assembly and the energy assembly on the shaft or axle in the cart and the wheel connecting structure of the disclosure can provide the user the functions of pushing and deploying the rotating assembly after enabling the driving assembly, and making the wheel member enter the standing state to achieve the effect of deploying the wheel by driving the linking assembly. While the linking assembly pushes the rotating assembly, the linking assembly also pushes the energy assembly, so that the energy assembly enters the energy storing state. Thus, when the linking assembly stops pushing the energy assembly, the energy assembly enters the energy releasing state, and pushes the linking assembly to move, so that the linking assembly drives the rotating assembly to retract, and the wheel member enters the flattened state to achieve the storage effect. Accordingly, the convenience in using and storing the cart can be enhanced. In another implementation aspect, while the linking assembly pushes the rotating assembly, the linking assembly may also link with the energy assembly to stretch the energy assembly. Thus, when the linking assembly stops linking with the energy assembly and is not restricted by the external force, the energy assembly winds through the self-retraction force, and links with the linking assembly to move together, so that the linking assembly drives the rotating assembly to retract, the wheel member enters the flattened state, and the storage effect can be similarly achieved.

11524834

FIELD The subject matter herein generally relates to a receiving structure and an automatic feeding system. BACKGROUND During production, manufacturing, and transportation of products, receiving structures are needed to package raw materials of the product or a finished product. The receiving structure may currently be a closed packaging box. The user needs to manually open the packaging box to take out the raw materials. The quantity and type of materials or products in the packaging box cannot be known until the box is opened, thus limiting the application of such packaging box in unmanned factories.

11330936

CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to French Application No. 1758062 filed on Aug. 31, 2017 and French Application No. 1852708 filed on Mar. 28, 2018, the contents of which are incorporated herein by reference in their entirety. FIELD This invention concerns a covering member for an opening of a cooking cavity of a mini-oven. BACKGROUND Ovens comprise a thermally insulated cavity or chamber and a door that can be manipulated between an open position, in which it is possible to access the cavity so that food products can be placed in it, and a closed position, in which the cavity is essentially insulated from the external environment and the oven can be implemented to cook the foods. There are many types of ovens, in particular large household ovens, toaster ovens or mini-ovens. Mini-ovens, in particular, are popular in homes with small kitchens where space is limited. Mini-ovens comprise an essentially metallic frame which defines a thermally insulated cooking cavity and a door allowing access to the cooking cavity so that foods can be transferred between the cooking cavity and the outside of the mini-oven. The cooking cavity comprises at least one electric heating element or a filament which generates heat energy during passage of electric current in order to cook foods in the cooking cavity. One or more racks may be included in the cooking cavity in order to support foods at various heights inside the cooking cavity, so that various cooking operations, such as roasting, broiling or general oven cooking, can be performed. Although the size of mini-ovens varies, they are generally designed to hold small foods such as bread slices, bagels, vegetables, pizza, cookies and cupcakes. However, for some larger mini-ovens, the cooking cavity can hold larger foods such as chickens and roasts. As with most ovens, the cooking process involves preheating the cooking cavity to a desired or target temperature at which the foods can be cooked optimally. Once the target temperature is reached, the oven door is opened and the foods are inserted into the cooking cavity and enclosed by the oven door. The oven keeps the cooking cavity at the target temperature for a predetermined period, so that the foods can be cooked in a precise and predictable manner. One problem associated with ovens is that, when the oven door is open, heat energy is lost by dissipation towards the outside of the oven through the opening of the cooking cavity. The oven must therefore do more work to return the cooking cavity to the target temperature and, as a result, the foods take longer to cook. When the foods to be cooked have a cross section much smaller than the opening of the cooking cavity, the heat energy loss during opening of the oven door is unnecessary, inefficient and a source of waste. SUMMARY One aspect of this invention is to propose a more energy-efficient mini-oven with reduced cooking times. A first aspect of this invention concerns a covering member intended to be connected to a mini-oven, the mini-oven comprising a cooking cavity accessible from the outside of the mini-oven through an opening, it being possible to close the opening with a door that can be moved between a first position, in which it is possible to access the cooking cavity from the outside of the oven through the opening, and a second position, in which the door restricts access to the cooking cavity from the outside of the oven through the opening, the covering member comprising one or more connectors constructed and arranged to connect the covering member to one or more complementary connectors of the mini-oven, andthe covering member being sized and designed to be able to be slidably connected to the mini-oven and to form at least a portion of the door when it is connected to the mini-oven, orthe covering member being sized and designed such that at least a portion of the covering member can be placed between the cooking cavity and the door when the door is in the second position, and the covering member also being sized and designed so as to limit access to the cooking cavity through the opening when it is connected to the mini-oven. Limiting access to the cooking cavity through the opening is beneficial in that this reduces the exposure of the cooking cavity to the outside of the mini-oven through the opening when the mini-oven door is in the first, open, position. Therefore, an unnecessary heat energy loss from the cooking cavity towards the outside of the mini-oven is reduced when the oven door is open but it is still possible to transfer certain small foods between the cooking cavity and the outside of the mini-oven. Reducing the heat energy loss from the cooking cavity during transfer of one or more foods between the outside of the oven and the cooking cavity makes it possible to maintain or quickly reestablish the desired cooking temperature of the cooking cavity, thereby reducing cooking times. The covering member also helps to further reduce heat energy loss from the cooking cavity to the outside of the mini-oven when it is positioned between the cooking cavity and the door in the second, closed, position such that the mini-oven cooking cavity can reach a desired temperature more quickly and efficiently than in the absence of the covering member. One or more connectors may be positioned for connecting the covering member to the mini-oven such that, during connection to the mini-oven, the covering member extends across an upper region of the opening. One or more connectors may be positioned for connecting the covering member to an upper part of the mini-oven. At least one connector may comprise a part of the covering member designed so as to cooperate with a part of the mini-oven having a complementary shape. At least one connector may comprise an edge of the covering member designed so as to cooperate with a throat, a slot or a groove of the mini-oven. At least one connector may comprise a keyhole-shaped opening intended to receive a projection having a complementary shape extending from the mini-oven. The opening may be positioned on the covering member so as to allow a part of the mini-oven to extend across the opening when the covering member is connected to the mini-oven and the door is in the second position. The covering member may also be sized and designed such that, when the covering member is connected to the mini-oven, it allows at least a portion of a rack or of a drip pan to be transferred between the cooking cavity and the outside of the oven through the opening. At least a portion of the covering member may comprise a sheet of material. The sheet of material may be thin enough to be lodged between the door and the cooking cavity when the door is in the second position. The covering member may also comprise a handle allowing the covering member to be gripped and manipulated. At least a portion of the handle may be positioned such that, when the covering member is connected to the mini-oven and arranged between the cooking cavity and the door, when the door is in the second position, at least a portion of the handle is outside of the mini-oven. The dimensions or the form of the covering member may be adjustable. A second aspect of this invention concerns a mini-oven comprising a cooking cavity accessible from the outside of the oven through an opening, a door that can be moved between a first position, in which it is possible to access the cooking cavity from the outside of the oven through the opening, and a second position, in which the door restricts access to the cooking cavity from the outside of the oven through the opening, and one or more connectors constructed and arranged to interact with complementary connectors of a covering member according to the first aspect of this invention. At least one connector of the mini-oven may comprise a projection extending from a part of the mini-oven and intended to receive a complementary keyhole-shaped opening of the projection and situated on the covering member. At least one connector of the mini-oven may comprise a groove, a slot or a throat intended to receive a complementary edge of the covering member. At least one connector of the mini-oven may be removable. A third aspect of this invention concerns an assembly forming a mini-oven comprising a mini-oven according to the second aspect of this invention, and a covering member according to the first aspect of this invention. One or more connectors of the covering member and one or more complementary connectors of the mini-oven may be positioned such that the covering member extends across an upper region of the opening of the mini-oven. One or more connectors of the covering member and one or more complementary connectors of the mini-oven may be positioned such that the covering member is connected to an upper part of the mini-oven. At least one connector may comprise a keyhole-shaped opening intended to receive a projection having a complementary shape extending from the mini-oven. The opening may be positioned on the covering member such that a part of the mini-oven extends across the opening when the covering member is connected to the mini-oven and the door is in the second position. At least one connector of the covering member may comprise an edge of the covering member and at least one connector of the mini-oven may comprise a complementary groove or throat in which the edge of the covering member is received. The covering member may also be sized and designed such that it allows at least a portion of a rack or of a drip pan to be transferred between the cooking cavity and the outside of the oven through the opening when the covering member is connected to the mini-oven. At least a portion of the covering member may comprise a sheet of material that is thin enough to be lodged between the door and the cooking cavity when the door is in the second position. At least a portion of the handle of the covering member may be positioned outside of the mini-oven when the covering member is connected to the mini-oven and arranged between the cooking cavity and the door is in the second position. A variant of the invention concerns a cover for an opening of a cooking cavity of a mini-oven, the cover comprising a body and a slot formed through the body, the body being sized and shaped to cover the opening and able to be arranged relative to the cooking cavity such that foods can be transferred between the cooking cavity and the outside of the mini-oven by means of the slot, and the slot being sized and configured such that, when the cover is arranged relative to the cooking cavity such that foods can be transferred between the cooking cavity and the outside of the mini-oven by means of the slot, the cooking cavity is then less exposed to the outside of the mini-oven by means of the slot than by means of the opening without the cover. Reducing the cooking cavity's exposure to the outside of the mini-oven while still permitting certain food products to be transferred between the cooking cavity and the outside of the mini-oven has the advantage of reducing superfluous heat energy loss from the cooking cavity to the outside of the mini-oven. Reducing the heat energy loss from the cooking cavity to the outside of the mini-oven allows the cooking cavity of the mini-oven to reach a desired temperature more quickly and with better performance. This also reduces a temperature drop in the cooking cavity from the desired temperature due to the heat energy loss during the insertion of one or more food products into the cooking cavity through the slot, thus reducing their cooking times. The cover may also comprise a sealing member constructed and arranged to seal the slot, the sealing member being able to be moved between a first position in which the slot is open and a second position in which the slot is closed. The sealing member may be fixed to the body by a hinge. The sealing member may be slidably attached to the body such that the sealing member can slide relative to the body between a first position and the second position. The sealing member may be biased towards the second position. The sealing member may be configured to extend inside the cooking cavity of the mini-oven in the second position when the cover is arranged to cover the opening. The sealing member may comprise a food support configured to hold one or more food products and a flange extending from the food support, at least a portion of the food support being sized and shaped for insertion through the slot and the flange being sized and shaped to cover the slot when at least a portion of the food support is inserted through the slot and the flange is against the body. There may be more than one sealing member. The cover may also comprise a gasket between the sealing member and the body to prevent the passage of air between the body and the sealing member when the sealing member is in the second position. The cover may also comprise a mounting system constructed and arranged to mount the cover on a mini-oven. The cover may also comprise a removable handle that can be connected to the body and/or to the sealing member to allow the cover and/or the sealing member to be maneuvered by means of the handle. The handle may also be capable of being connected to the sealing member to allow the sealing member to be maneuvered by means of the handle. The handle and the body or the sealing member may each comprise characteristics that cooperate with one another to allow the handle to be fixed to the body or to the food support. The cross-sectional area of the slot may be smaller than the cross-sectional area of the opening. The cross-sectional area of the slot may be at least 20% smaller than the cross-sectional area of the opening. The slot may be substantially rectangular in shape and the width of the slot may be greater than the height of the slot. The slot may be sized and shaped to allow a rack of the mini-oven to move between the cooking cavity and the outside of the mini-oven by means of the slot when the cover is arranged to extend across the opening. The slot may be positioned and oriented in the body such that, when the cover is arranged to cover the opening, one or more system intended to receive a rack of the mini-oven are aligned with the slot such that a rack can be inserted into a system intended to receive a rack from the outside of the mini-oven by means of the slot. The cover may also comprise one or more windows. The cover may also comprise a reflective surface. The cover may be sized and shaped to rest, during use, between the cooking cavity and a door of the mini-oven when the door is in the closed position. The cover may be an accessory of the mini-oven that can be separated from the mini-oven. The cover may be a door of a mini-oven. A second aspect of the variant of this invention concerns a mini-oven assembly comprising a mini-oven and a cover according to the first aspect. A third aspect of the variant of this invention concerns a mini-oven comprising a cover according to the first aspect.

11463770

FIELD OF THE DISCLOSURE This disclosure relates generally to media monitoring, and, more particularly, to methods and apparatus to identify media presentations by analyzing network traffic. BACKGROUND In recent years, methods of accessing media have evolved. For example, Internet media was primarily accessed via computer systems such as desktop and laptop computers. Recently, the advent of smart devices (e.g. televisions (TVs), smartphones, and streaming devices such as Roku®, Amazon Fire™ TV Stick, Google Chromecast™, Amazon Fire TV Cube, etc.) has allowed access to Internet media in ways that were previously unavailable. As used herein, the term “media” includes any type of content and/or advertisement delivered via any type of distribution medium. Thus, media includes television programming or advertisements, radio programming or advertisements, movies, web sites, streaming media, etc.

11438345

TECHNICAL FIELD The present disclosure relates generally to connected and autonomous vehicles, and more specifically to cyber security of connected and autonomous vehicles and fleets. BACKGROUND With advances in computer technology, computerized navigation and control systems in vehicles have been created to improve drivers' experiences and to allow for remotely controlled transportation of people and goods. These computerized car systems can provide guided or assisted driving, or autonomously control vehicles. To this end, computerized driving systems may have access to and control over critical vehicle functions such as, for example, unlocking the car, turning the engine on and off, controlling steering and braking, and the like. To aid in navigation and control, connected vehicles may be equipped with network access that allows the connected vehicles to communicate with each other and/or with remote control systems. These connected vehicles may be used for, e.g., tracking commercial cars (for example, buses, trucks, delivery/rental vehicles), navigating self-driving or assisted driving cars, car sharing services, and the like. Gartner, Inc., forecasts that, by 2020, there will be at least 220 million connected cars on the road. While connected vehicles offer great opportunities for owners of vehicles, these systems leave vehicles and the services that interact with those vehicles exposed to new dangers. Specifically, hackers can interfere with vehicle functions. Further, connected vehicles may be interfered with remotely. This opens the door to vehicle failure, theft, and other malicious activity, which can lead to death, injury, and financial damage due to, for example, loss of property, brand damage, recalls, law suits, etc. For example, a cyber attacker may be able to control driving systems, lock and unlock the car, turn the engine on or off, and the like. Additionally, due to the advent of controlled vehicle fleets, widespread cyber-attacks may be conducted on fleets including large numbers of cars simultaneously, enabling malicious actors to cause harm on a larger scale. Additionally, there is a concern regarding privacy for connected vehicles, as data leakage may also be harmful to vehicle owners. It would therefore be advantageous to provide a solution that would overcome the challenges noted above by securing vehicles and connected car service layers against cyber threats. It would be further advantageous to provide a solution for securing fleets of vehicles against cyber threats. SUMMARY A summary of several example embodiments of the disclosure follows. This summary is provided for the convenience of the reader to provide a basic understanding of such embodiments and does not wholly define the breadth of the disclosure. This summary is not an extensive overview of all contemplated embodiments, and is intended to neither identify key or critical elements of all embodiments nor to delineate the scope of any or all aspects. Its sole purpose is to present some concepts of one or more embodiments in a simplified form as a prelude to the more detailed description that is presented later. For convenience, the term “some embodiments” or “certain embodiments” may be used herein to refer to a single embodiment or multiple embodiments of the disclosure. Certain embodiments disclosed herein include a method for connected vehicle cybersecurity. The method comprises: creating a normal behavior model based on a first set of data, the first set of data including at least one first event with respect to at least one connected vehicle, wherein the first set of data is collected from a plurality of data sources; detecting an anomaly based on the normal behavior model and a second set of data, the second set of data including a second event with respect to the at least one connected vehicle, wherein each of the first set of data and the second set of data includes vehicle data related to operation of the at least one connected vehicle, wherein each event represents a communication with the at least one connected vehicle; determining, based on the detected anomaly, at least one mitigation action; and causing implementation of the at least one mitigation action. Certain embodiments disclosed herein also include a non-transitory computer readable medium having stored thereon causing a processing circuitry to execute a process for connected vehicle cybersecurity, the process comprising: creating a normal behavior model based on a first set of data, the first set of data including at least one first event with respect to at least one connected vehicle, wherein the first set of data is collected from a plurality of data sources; detecting an anomaly based on the normal behavior model and a second set of data, the second set of data including a second event with respect to the at least one connected vehicle, wherein each of the first set of data and the second set of data includes vehicle data related to operation of the at least one connected vehicle, wherein each event represents a communication with the at least one connected vehicle; determining, based on the detected anomaly, at least one mitigation action; and causing implementation of the at least one mitigation action. Certain embodiments disclosed herein also include a system for connected vehicle cybersecurity. The system comprises: a processing circuitry; and a memory, the memory containing instructions that, when executed by the processing circuitry, configure the system to: create a normal behavior model based on a first set of data, the first set of data including at least one first event with respect to at least one connected vehicle, wherein the first set of data is collected from a plurality of data sources; detect an anomaly based on the normal behavior model and a second set of data, the second set of data including a second event with respect to the at least one connected vehicle, wherein each of the first set of data and the second set of data includes vehicle data related to operation of the at least one connected vehicle, wherein each event represents a communication with the at least one connected vehicle; determine, based on the detected anomaly, at least one mitigation action; and cause implementation of the at least one mitigation action.

11354581

BACKGROUND There are a number of existing software programs for helping users manage their personal information. For instance, personal information management (“PIM”) programs can send, receive, and store electronic messages, and store address books, calendar events and tasks. Other applications also allow users to store and communicate files by the use of a network service, such as ONEDRIVE or other network storage services. Using these services, users can share and collaborate on virtually any type of document. Although the tools described above individually provide specific features for helping users manage individual types of data, such as electronic messages, contact lists, documents, spreadsheets, images, and videos, there are a number of drawbacks with some existing systems. For instance, there are a number of scenarios where a user's personalized data set becomes too large. In some instances, a user may have tens or even hundreds of thousands of emails, images, documents, tasks lists, etc. This large amount of data can make it very difficult for many users to process, locate, and utilize data files relating to a particular context, such as an activity, person, or event. There are a number of solutions that have been presented to help users organize and make use of large amounts of personal data. For instance, a number of companies have developed searching tools that enable users to query for relevant information. These tools are helpful for finding individual elements of content, such as a particular file or image. However, such tools may not provide the most accurate results given that the context of some queries may not be accurately represented. In addition, it can be difficult to use general search tools to find data having specialized formats such as tasks, contact information, images, videos, etc. In some situations, for example, users may have to interact with a large number of applications to find content relating to a particular context, such as an activity or event. Then, once the content is located, the user is challenged with the task of compiling the content into a useable format. These labor-intensive steps can be inconvenient for users and cause significant inefficiencies with respect to the utilization of computing resources. For example, opening and interacting with multiple applications to locate relevant information regarding a particular context can result in the inefficient utilization of processor cycles, memory, batter power, and network bandwidth. Moreover, some existing systems cause inefficient computer interactions that increase the frequency of inadvertent user inputs which, in turn, cause further inefficiencies with respect to the utilization of computing resources. Given these drawbacks and others, there still exists a need for tools that can efficiently identify and present salient information relating to a particular context. It is with respect to these and other technical challenges that the disclosure made herein is presented. SUMMARY The technologies described herein provide an artificial intelligence (“AI”) driven human-computer interface (“HCI”) for associating low-level content to high-level activities using topics as an abstraction. The associations can be generated by a computing system for use in organizing, retrieving and displaying data in a usable format that improves user interaction with the computing system. In one aspect, the present disclosure provides an AI-driven HCI for associating volumes of low-level content, such as email content and calendar events, with high-level activity descriptions. The associations enable a computing system to provide activity-specific views that present a specific selection of the low-level content in an arrangement that is contextually relevant to a user's current situation. In some configurations, an AI-based system presents activity-specific views of relevant activity-specific content. In particular, an AI engine can select activity-specific content relating to a multitude of activities. The selected activities can have associated relevance scores exceeding a predefined threshold value. The selected activity-specific content can be used to render user interface (“UI”) elements in a UI for the activities. The UI elements present an activity-specific view of the activity-specific content relating to each activity. In other configurations, an AI-based system utilizes a schema to auto-generate an application for a specific context. An AI engine selects an activity schema associated with an activity. The schema identifies data sources for obtaining activity-specific content for the activity and can be selected based upon topics associated with the activity. The AI engine also selects a view definition that defines an arrangement of an activity-specific UI for presenting relevant activity-specific content obtained from the data sources identified by the schema. An application is then generated using the schema and the view definition. The application can generate the activity-specific UI for presenting the relevant activity-specific content. In other configurations, an AI engine generates an activity graph that includes nodes corresponding to activities and that defines clusters of content associated with the activities. A natural language (“NL”) search engine can receive a NL query and parse the NL query to identify entities and intents specified by the NL query. Clusters of content defined by the activity graph can be identified based upon the identified entities and intents. A search can then be made of the identified clusters of content using the entities and intents. Search results identifying the content located by the search can then be returned in response to the NL query. In other configurations, an AI engine selects a schema that defines an activity-specific UI for presenting activity-specific content based upon one or more topics associated with an activity. A UI can then be presented for receiving edits to the selected schema and the edits can be published for utilization by other users. Data identifying the edits, selection of a different schema for the activity, modification of properties associated with the selected schema, and data describing usage of the schema can be provided to the AI engine for using in improving an AI model utilized to select the schema. Among many other technical benefits, the techniques disclosed herein can improve a user's interaction with one or more computing devices. For example, using the disclosed technologies a user can interact with only a single application to view and interact with various types of data such as, but not limited to, relevant email messages, images, calendar events, and tasks. This can reduce the utilization of computing resources like processor cycles, memory, network bandwidth, and power. Improved user interaction can also reduce the likelihood of inadvertent user inputs and thus save computing resources, such as memory resources, processing resources, and networking resources. The reduction of inadvertent inputs can reduce a user's time interacting with a computer, reduce the need for redundant queries for data, and also reduce the need for repeated data retrieval. By providing the right information to users at the right time, many other technical benefits can also result. Other technical benefits not specifically mentioned herein can also be realized through implementations of the disclosed subject matter. It is to be appreciated that while the technologies disclosed herein are primarily presented in the context of associating low-level content with activities, the disclosed technologies can additionally be utilized to associate low-level content with other types of contexts. It should also be appreciated that the subject matter disclosed herein can be implemented as a computer-controlled apparatus, a computer-implemented method, a computing device, or as an article of manufacture, such as a computer readable medium. These and various other features will be apparent from a reading of the following Detailed Description and a review of the associated drawings. This Summary is provided to introduce a brief description of some aspects of the disclosed technologies in a simplified form that are further described below in the Detailed Description. This Summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended that this Summary be used to limit the scope of the claimed subject matter. Furthermore, the claimed subject matter is not limited to implementations that solve any or all disadvantages of prior solutions noted in any part of this disclosure.

11374850

BACKGROUND As more networks move to the cloud, it is more common for one corporation or other entity to have networks spanning multiple sites. While logical networks that operate within a single site are well established, there are various challenges in having logical networks span multiple physical sites (e.g., datacenters). The sites should be self-contained, while also allowing for data to be sent from one site to another easily. Various solutions are required to solve these issues. BRIEF SUMMARY Some embodiments provide a system for implementing a logical network that spans across multiple datacenters (e.g., in multiple different geographic regions). In some embodiments, a user (or multiple users) defines the logical network as a set of logical network elements (e.g., logical switches, logical routers, logical middleboxes) and policies (e.g., forwarding policies, firewall policies, NAT rules, etc.). The logical forwarding elements (LFEs) may be implemented across some or all of the multiple datacenters, such that data traffic is transmitted (i) between logical network data compute nodes (DCNs) within a datacenter, (ii) between logical network DCNs in two different datacenters, and (iii) between logical network DCNs in a datacenter and endpoints external to the logical network (e.g., external to the datacenters). The logical network, in some embodiments, is a conceptual network structure that a network administrator (or multiple network administrators) define through a set of network managers. Specifically, some embodiments include a global manager as well as local managers for each datacenter. In some embodiments, any LFEs that span multiple datacenters are defined through the global manager while LFEs that are entirely implemented within a specific datacenter may be defined through either global manager or the local manager for that specific datacenter. The logical network may include both logical switches (to which logical network DCNs attach) and logical routers. Each LFE (e.g., logical switch or logical router) is implemented across one or more datacenters, depending on how the LFE is defined by the network administrator. In some embodiments, the LFEs are implemented within the datacenter by managed forwarding elements (MFEs) executing on host computers that also host DCNs of the logical network (e.g., in virtualization software of the host computers) and/or on edge devices within the datacenters. The edge devices, in some embodiments, are computing devices that may be bare metal machines executing a datapath and/or computers on which DCNs execute a datapath. These datapaths, in some embodiments, perform various gateway operations (e.g., gateways for stretching logical switches across datacenters, gateways for executing centralized features of logical routers such as performing stateful services and/or connecting to external networks). Logical routers, in some embodiments, may include tier-0 logical routers (which connect directly to external networks, such as the Internet) and tier-1 logical routers (which may be interposed between logical switches and tier-0 logical routers). Logical routers, in some embodiments, are defined by the network managers (e.g., the global manager, for logical routers spanning more than one datacenter) to have one or more routing components, depending on how the logical router has been configured by the network administrator. Tier-1 logical routers, in some embodiments, may have only a distributed routing component (DR), or may have both distributed routing components as well as centralized routing components (also referred to as service routers, or SRs). SRs, for tier-1 routers, allow for centralized (e.g., stateful) services to be performed on data messages sent to or from DCNs connected to logical switches that connect to the tier-1 logical router (i.e., from DCNs connected to other logical switches that do not connect to the tier-1 logical router, or from external network endpoints). Tier-1 logical routers may be connected to tier-0 logical routers in some embodiments which, as mentioned, handle data messages exchanged between the logical network DCNs and external network endpoints. These tier-0 logical routers may also have a DR as well as one or more SRs (e.g., SRs at each datacenter spanned by the T0 logical router). The details of the SR implementation for both tier-1 and tier-0 logical routers are discussed further below. As mentioned, the LFEs of a logical network may be implemented by MFEs executing on source host computers as well as by edge devices. When a logical network DCN sends a data message to another logical network DCN, the MFE (or set of MFEs) executing on the host computer at which the source DCN resides performs logical network processing. In some embodiments, the source host computer MFE set (collectively referred to herein as the source MFE) performs processing for as much of the logical network as possible (referred to as first-hop logical processing). That is, the source MFE processes the data message through the logical network until either (i) the destination logical port for the data message is determined or (ii) the data message is logically forwarded to an LFE for which the source MFE cannot perform processing (e.g., an SR of a logical router). For instance, if the source DCN sends a data message to another DCN on the same logical switch, then the source MFE will only need to perform logical processing for the logical switch to determine the destination of the data message. If a source DCN attached to a first logical switch sends a data message to a DCN on a second logical switch that is connected to the same tier-1 logical router as the first logical switch, then the source MFE performs logical processing for the first logical switch, the DR of the logical router, and the second logical switch to determine the destination of the data message. On the other hand, if a source DCN attached to a first logical switch sends a data message to a DCN on a second logical switch that is connected to a different tier-1 logical router than the first logical switch, then the source MFE may only perform logical processing for the first logical switch, the tier-1 DR (which routes the data message to the tier-1 SR), and a transit logical switch connecting the tier-1 DR to the tier-1 SR within the datacenter. Additional processing may be performed on one or more edge devices in one or more datacenters, depending on the configuration of the logical network (as described further below). Once the source MFE identifies the destination (e.g., a destination logical port on a particular logical switch), this source MFE transmits the data message to the destination. In some embodiments, the source MFE maps the combination of (i) the destination layer 2 (L2) address (e.g., MAC address) of the data message and (ii) the logical switch being processed to which that L2 address attaches to a tunnel endpoint or group of tunnel endpoints, allowing the source MFE to encapsulate the data message and transmit the data message to the destination tunnel endpoint. Specifically, if the destination DCN operates on a host computer located within the same datacenter, the source MFE can transmit the data message directly to that host computer by encapsulating the data message using a destination tunnel endpoint address corresponding to the host computer. On the other hand, if the source MFE executes on a first host computer in a first datacenter and the destination DCN operates on a second host computer in a second, different datacenter, in some embodiments the data message is transmitted (i) from the source MFE to a first logical network gateway in the first datacenter, (ii) from the first logical network gateway to a second logical network gateway in the second datacenter, and (iii) from the second logical network gateway to a destination MFE executing on the second host computer. The destination MFE can then deliver the data message to the destination DCN. Some embodiments implement logical network gateways on edge devices in the datacenters to handle logical switch forwarding between datacenters. As with the SRs, logical network gateways are implemented in the edge device datapaths in some embodiments. In some embodiments, separate logical network gateways are assigned for each logical switch. That is, for a given logical switch, one or more logical network gateways are assigned to edge devices in each datacenter within the span of the logical switch (e.g., by the local manager in the datacenter). The logical switches for which logical network gateways are implemented may include administrator-defined logical switches to which logical network DCNs connect as well as other types of logical switches (e.g., backplane logical switches that connect the SRs for one logical router). In some embodiments, for a given logical switch, the logical network gateways are implemented in active-standby configuration. That is, in each datacenter spanned by the logical switch, an active logical network gateway is assigned to one edge device and one or more standby logical network gateways are assigned to additional edge devices. The active logical network gateways handle all of the inter-site data traffic for the logical switch, except in the case of failover. In other embodiments, the logical network gateways for the logical switch are implemented in active-active configuration. In this configuration, all of the logical network gateways in a particular datacenter are capable of handling inter-site data traffic for the logical switch. For each logical switch, the logical network gateways form a mesh in some embodiments (i.e., the logical network gateways for the logical switch in each datacenter can directly transmit data messages to the logical network gateways for the logical switch in each other datacenter). In some embodiments, irrespective of whether the logical network gateways are implemented in active-standby or active-active mode, the logical network gateways for a logical switch in a first datacenter establish communication with all of the other logical network gateways in the other datacenters (both active and standby logical network gateways). In other embodiments, the logical network gateways use a hub-and-spoke model of communication, in which case traffic may be forwarded through a central (hub) logical network gateway in a particular datacenter, even if neither the source nor destination of a specific data message resides in that particular datacenter. Thus, for a data message between DCNs in two datacenters, the source MFE identifies the logical switch to which the destination DCN attaches (which may not be the same as the logical switch to which the source DCN attaches) and transmits the data message to the logical network gateway for that logical switch in its datacenter. That logical network gateway transmits the data message to the logical network gateway for the logical switch in the destination datacenter, which transmits the data message to the destination MFE. In some embodiments, each of these three transmitters (source MFE, first logical network gateway, second logical network gateway) encapsulates the data message with a different tunnel header (e.g., using VXLAN, Geneve, NGVRE, STT, etc.). Specifically, each tunnel header includes (i) a source tunnel endpoint address, (ii) a destination tunnel endpoint address, and (iii) a virtual network identifier (VNI). In some embodiments, the VNIs used in each of the tunnel headers maps to a logical switch to which the data message belongs. That is, when the source MFE performs processing for a particular logical switch and identifies that the destination for the data message connects to the particular logical switch, the source MFE uses the VNI for that particular logical switch in the encapsulation header. In some embodiments, the local manager at each datacenter manages a separate pool of VNIs for its datacenter, and the global manager manages a separate pool of VNIs for the network between logical network gateways. These pools may be exclusive or overlapping, as they are separately managed without any need for reconciliation. This enables a datacenter to be added to a federated group of datacenters without a need to modify the VNIs used within the newly added datacenter. Accordingly, the logical network gateways perform VNI translation in some embodiments. At the source host computer in a first datacenter, after determining the destination for a data message and the logical switch to which that destination connects, the source MFE encapsulates the data message using a first VNI corresponding to the logical switch within the first datacenter, and transmits the packet to the edge device at which the logical network gateway for the logical switch is implemented within the first datacenter. The edge device receives the data message and executes a datapath processing pipeline stage for the logical network gateway based on the receipt of the data message at a particular interface and the first VNI in the tunnel header of the encapsulated data message. The logical network gateway in the first datacenter uses the destination address of the data message (the underlying logical network data message, not the destination address in the tunnel header) to determine a second datacenter to which the data message should be sent, and re-encapsulates the data message with a new tunnel header that includes a second, different VNI. This second VNI is the VNI for the logical switch used within the inter-site network, as managed by the global network manager. This re-encapsulated data message is sent through the intervening network between the logical network gateways (e.g., a VPN, WAN, public network, etc.) to the logical network gateway for the logical switch within the second datacenter. The edge device implementing the logical network gateway for the logical switch in the second datacenter receives the encapsulated data message and executes a datapath processing pipeline stage (similar to that executed by the first edge device) for the logical network gateway based on the receipt of the data message at a particular interface and the second VNI in the tunnel header of the encapsulated data message). The logical network gateway in the second datacenter uses the destination address of the underlying logical network data message to determine the destination host computer for the data message within the second datacenter, and re-encapsulates the data message with a third tunnel header that includes a third VNI. This third VNI is the VNI for the logical switch used within the second datacenter, as managed by the local network manager for the second datacenter. This re-encapsulated data message is sent through the physical network of the second datacenter to the destination host computer, and the MFE at this destination host computer uses the VNI and destination address of the underlying data message to deliver the data message to the correct DCN. As noted, in addition to the VNI, the tunnel headers used to transmit logical network data messages also include source and destination tunnel endpoint addresses. In some embodiments, the host computers (e.g., the MFEs executing on the host computers) as well as the edge devices store records that map (for a given logical switch context) MAC addresses (or other L2 addresses) to tunnel endpoints used to reach those MAC addresses. This enables the source MFE or logical network gateway to determine the destination tunnel endpoint address with which to encapsulate a data message for a particular logical switch. For data messages sent within a single datacenter, the source MFE uses records that map a single tunnel endpoint (referred to as a virtual tunnel endpoint, or VTEP) network address to one or more MAC addresses (of logical network DCNs) that are reachable via that VTEP. Thus, if a VM or other DCN having a particular MAC address resides on a particular host computer, the record for the VTEP associated with that particular host computer maps to the particular MAC address. In addition, for each logical switch for which an MFE processes data messages and that is stretched to multiple datacenters, in some embodiments the MFE stores an additional VTEP group record for the logical switch that enables the MFE to encapsulate data messages to be sent to the logical network gateway(s) for the logical switch in the datacenter. The VTEP group record, in some embodiments, maps a set of two or more VTEPs (of the logical network gateways) to all MAC addresses connected to the logical switch that are located in any other datacenter. When a source MFE for a data message identifies the logical switch and destination MAC address for a data message, the source MFE identifies the VTEP record or VTEP group record to which the MAC address maps in the context of the identified logical switch (different logical networks within a datacenter may use overlapping MAC addresses, but these will be in the context of different, isolated logical switches). When the destination MAC address corresponds to a DCN in a different datacenter, the source MFE will identify the VTEP group record and use one of the VTEP network addresses in the VTEP group as the destination tunnel endpoint address for encapsulating the data message, such that the encapsulated data message is transmitted through the datacenter to one of the logical network gateways for the logical switch. When the logical network gateways are configured in active-standby mode, the VTEP group record identifies the current active VTEP, and the source MFE will always select this network address from the VTEP group record. On the other hand, when the logical network gateways are in active-active mode, the source MFE may use any one of the network addresses in the VTEP group record. Some embodiments use a load balancing operation (e.g., a round-robin algorithm, a deterministic hash-based algorithm, etc.) to select one of the network addresses from the VTEP group record. The use of logical network gateways and VTEP groups allows for many logical switches to be stretched across multiple datacenters without the number of tunnels (and therefore VTEP records stored at each MFE) exploding. Rather than needing to store a record for every host computer in every datacenter on which at least one DCN resides for a logical switch, all of the MAC addresses residing outside of the datacenter are aggregated into a single record that maps to a group of logical network gateway VTEPs. In addition, the use of VTEP groups allows for failover of the logical network gateways in a particular datacenter without the need for every host in the datacenter to relearn all of the MAC addresses in all of the other datacenters that map to the logical network gateway VTEP. In some embodiments, the MAC:VTEP mappings may be learned via Address Resolution Protocol (ARP) or via receipt of data messages from the VTEP. In addition, in some embodiments, many of the mappings are shared via network controller clusters that operate in each of the datacenters. In some such embodiments, the majority of the mappings are shared via the network controller clusters, while learning via ARP and data message receipt is used more occasionally. With the use of VTEP groups, when an active logical network gateway fails, one of the standby logical network gateways for the same logical switch becomes the new active logical network gateway. This newly active logical network gateway notifies the MFEs in its datacenter that require the information (i.e., the MFEs that process data messages for the logical switch) that it is the new active member for its VTEP group (e.g., via a specialized encapsulated data message). This allows these MFEs to simply modify the list of VTEPs in the VTEP group record, without the need to create a new record and relearn all of the MAC addresses for the record. In some embodiments, the edge devices hosting logical network gateways have both VTEPs that face the host computers of their datacenter as well as separate tunnel endpoints (e.g., corresponding to different interfaces) that face the inter-datacenter network, for communication with other edge devices. These tunnel endpoints are referred to herein as remote tunnel endpoints (RTEPs). In some embodiments, each logical network gateway implemented within a particular datacenter stores (i) VTEP records for determining destination tunnel endpoints within the particular datacenter when processing data messages received from other logical network gateways (i.e., via the RTEPs) as well as (ii) RTEP group records for determining destination tunnel endpoints for data messages received from within the particular datacenter. When the edge device receives a data message for a particular logical switch from another logical network gateway, in some embodiments the edge device executes a datapath pipeline processing stage for the logical network gateway, based on the inter-site VNI and the receipt of the data message via its RTEP. The logical network gateway for the logical switch maps the destination MAC address to one of its stored VTEP records for the logical switch context and uses this VTEP as the destination network address in the tunnel header when transmitting the data message to the datacenter. Conversely, when the edge device receives a data message for the particular logical switch from a host computer within the datacenter, in some embodiments the edge device executes the datapath pipeline processing stage for the logical network gateway based on the datacenter-specific VNI for the logical switch and the receipt of the data message via its VTEP. The logical network gateway stores RTEP group records for each other datacenter spanned by the logical switch and uses these to determine the destination network address for the tunnel header. Each RTEP group record, in some embodiments, maps a set of two or more RTEPs for a given datacenter (i.e., the RTEPs for the logical network gateways at that datacenter for the particular logical switch) to all MAC addresses connected to the particular logical switch that are located at that datacenter. The logical network gateway maps the destination MAC address of the underlying data message to one of the RTEP group records (using ARP on the inter-site network if no record can be found), and selects one of the RTEP network addresses in the identified RTEP group to use as the destination tunnel endpoint address for encapsulating the data message, such that the encapsulated data message is transmitted through the inter-site network to one of the logical network gateways for the particular logical switch at the datacenter where the destination DCN resides. When the logical network gateways are configured in active-standby mode, the RTEP group record identifies the current active RTEP, and the logical network gateway will always select this network address from the RTEP group record. On the other hand, when the logical network gateways are in active-active mode, the logical network gateway may use any one of the network addresses in the identified RTEP group record. Some embodiments use a load balancing operation (e.g., a round-robin algorithm, a deterministic hash-based algorithm, etc.) to select one of the network addresses from the RTEP group record. Similar to VTEP groups, the use of RTEP groups allows for failover of the logical network gateways in a particular datacenter without the need for every logical network gateway in the other datacenters to relearn all of the MAC addresses that map to the logical network in the particular datacenter. As with the MAC: VTEP mappings, the MAC:RTEP mappings are preferably learned via the network controller clusters, with learning via ARP and data message receipt also available. When an active logical network gateway in a particular datacenter fails, one of the standby logical network gateways for the same logical switch in the particular datacenter becomes the new active logical network gateway. This newly-active logical network gateway notifies the logical network gateways for the logical switch at the other datacenters that require the information (i.e., the other datacenters spanned by the logical switch) that it is the new active member for its VTEP group (e.g., via a routing protocol message). This allows these other logical network gateways to simply modify the list of RTEPs in their RTEP group record, without the need to create a new record and relearn all of the MAC addresses for the record. As noted above, the logical networks of some embodiments are defined to include tier-1 and/or tier-0 logical routers, in addition to the logical switches. In some embodiments, logical switches (i.e., the logical switches to which DCNs connect) connect directly to tier-1 (T1) logical routers, which can link different logical switches together as well as provide services to the logical switches connected to them. In some embodiments, the T1 logical routers may be entirely distributed (e.g., if just providing a connection between logical switches that avoids the use of a T0 logical router), or include centralized SR components implemented on edge devices (e.g., to perform stateful services for data messages sent to and from the logical switches connected to the T1 logical router. In addition, in some embodiments, T1 logical routers and the logical switches connected to them may be defined entirely within a single datacenter of a federated set of datacenters. In some embodiments, constructs of the logical network that span multiple datacenters (e.g., T0 logical routers, T1 logical routers, logical switches, security groups, etc.) are defined by a network administrator through the global manager. However, a network administrator (e.g., the same admin or a different, local admin) can also define networks that are local to a specific datacenter through the global manager. These T1 logical routers can be connected to a datacenter-specific T0 logical router for handling data traffic with external networks or can instead be connected to a T0 logical router of the datacenter-spanning logical network in some embodiments. As described below, when datacenter-specific T1 logical routers are connected to a T0 logical router that spans multiple datacenters, in some embodiments the SRs of the T0 logical router share routes advertised by the datacenter-specific T1 logical router. When a globally-defined T1 logical router is defined to provide stateful services at SRs, the network administrator can define the datacenters to which the T1 spans in some embodiments (a globally-defined T1 logical router without SRs will automatically span to all of the datacenters spanned by the T0 logical router to which it connects). For a T1 logical router with stateful services, the network administrator can define the T1 logical router to span to any of the datacenters spanned by the T0 logical router to which it connects; that is, the T1 logical router cannot be defined to span to datacenters not spanned by the T0 logical router. Some embodiments allow the T1 SRs to be deployed in active-active mode or active-standby mode, while other embodiments only allow active-standby mode (e.g., if the SR is providing stateful services such as a stateful firewall, stateful load balancing, etc.). The T1 SRs, in some embodiments, provide stateful services for traffic between (i) DCNs connected to logical switches that connect to the T1 logical router and (ii) endpoints outside of that T1 logical router, which could include endpoints external to the logical network and datacenter as well as logical network endpoints connected to other logical switches. In addition, for T1 logical routers that have SRs located in multiple datacenters, some embodiments allow (or require) the network administrator to select one of the datacenters as a primary site for the T1 logical router. In this case, all traffic requiring stateful services is routed to the primary site active SR. When a DCN that is located at a secondary datacenter sends a data message to an endpoint external to the T1 logical routers, the source MFE for the data message performs first-hop logical processing, such that the DR routes the data message to the active SR within that secondary datacenter, and transmits the data message through the datacenter according to the transit logical switch (e.g., using the transit logical switch VNI) for the datacenter between the T1 DR and T1 SR. As mentioned, in some embodiments the network managers define a transit logical switch within each datacenter to connect the DR for the logical router to the SRs within the datacenter for the logical router. As this transit logical switch only spans a single datacenter, there is no need to define logical network gateways for the transit logical switch. The active SR within the secondary datacenter routes the data message to the active SR in the primary datacenter according to its routing table which, as described below, is configured by a combination of the network managers and routing protocol synchronization between the SRs. The edge device implementing the active T1 SR in the secondary datacenter transmits the data message (according to the logical network gateway for the backplane logical switch connecting the SRs, using the backplane logical switch VNI) to the edge device implementing the active T1 SR in the primary datacenter. As described above, in some embodiments a backplane logical switch is automatically configured by the network managers to connect the SRs of a logical router. This backplane logical switch is stretched across all of the datacenters at which SRs are implemented for the logical router, and therefore logical network gateways are implemented at each of these datacenters for the backplane logical switch. In some embodiments, the network managers link the SRs of a logical router with the logical network gateways for the backplane logical switch connecting those SRs, so that they are always implemented on the same edge devices. That is, the active SR within a datacenter and the active logical network gateway for the corresponding backplane logical switch within that datacenter are assigned to the same edge device, as are the standby SR and standby logical network gateway. If either the SR or the logical network gateway need to failover (even if for a reason that would otherwise affect only one of the two), then both will failover together. Keeping the SR with the logical network gateway for the corresponding backplane logical switch avoids the need for extra physical hops when transmitting data messages between datacenters. Thus, the T1 SR at the primary datacenter may receive outbound data messages from either the other T1 SRs at secondary datacenters or MFEs at host computers within the primary datacenter. The primary T1 SR performs stateful services (e.g., stateful firewall, load balancing, etc.) on these data messages in addition to routing the data messages. In some embodiments, the primary T1 SR includes a default route to route data messages to the DR of the T0 logical router to which the T1 logical router is linked. Depending on whether the data message is directed to a logical network endpoint (e.g., connected to a logical switch behind a different T1 logical router) or an external endpoint (e.g., a remote machine connected to the Internet), the T0 DR will route the message to the different T1 logical router or to the T0 SR. For traffic from remote external machines directed to logical network DCNs behind a T1 logical router, in some embodiments these data messages are always received initially at the primary datacenter T1 SR (after T0 processing). This is because, irrespective of in which datacenter the T0 SR receives an incoming data message for processing by the T1 SR, the T0 routing components are configured to route the data message to the primary datacenter T1 SR to have the stateful services applied. The primary datacenter T1 SR applies these services and then routes the data message to the T1 DR. The edge device in the primary datacenter that implements the T1 SR can then perform logical processing for the T1 DR and the logical switch to which the destination DCN connects. If the DCN is located in a remote datacenter, the data message is sent through the logical network gateways for this logical switch (i.e., not the backplane logical switch). Thus, the physical paths for ingress and egress traffic could be different, if the logical network gateways for the logical switch to which the DCN connects are implemented on different edge devices than the T1 SRs and backplane logical switch logical network gateways. T0 logical routers, as mentioned, handle the connection of the logical network to external networks. In some embodiments, the T0 SRs exchange routing data (e.g., using a routing protocol such as Border Gateway Protocol (BGP) or Open Shortest Path First (OSPF)) with physical routers of the external network, in order to manage this connection and correctly route data messages to the external routers. This route exchange is described in further detail below. In some embodiments, the network administrator defines a T0 logical router as well as the datacenters to which the T0 logical router spans through the global network manager. One or more T1 logical routers and/or logical switches may be connected to this T0 logical router, and the maximum span of those logical forwarding elements underneath the T0 logical router is defined by the span of the T0 logical router. That is, in some embodiments, the global manager will not allow the span of a T1 logical router or logical switch to include any datacenters not spanned by the T0 logical router to which they connect (assuming they do connect to a T0 logical router). Network administrators are able to connect the T1 logical routers to T0 logical routers in some embodiments. For a T1 logical router with a primary site, some embodiments define a link between the routers (e.g., with a transit logical switch in each datacenter between the T1 SRs in the datacenter and the T0 DR), but mark this link as down at all of the secondary datacenters (i.e., the link is only available at the primary datacenter). This results in the T0 logical router routing incoming data messages only to the T1 SR at the primary datacenter. The T0 SRs can be configured in active-active or active-standby configurations. In either configuration, some embodiments automatically define (i) a backplane logical switch that stretches across all of the datacenters spanned by the T0 logical router to connect the SRs and (ii) separate transit logical switches in each of the datacenters connecting the T0 DR to the T0 SRs that are implemented in that datacenter. When a T0 logical router is configured as active-standby, some embodiments automatically assign one active and one (or more) standby SRs for each datacenter spanned by the T0 logical router (e.g., as defined by the network administrator). As with the T1 logical router, one of the datacenters can be designated as the primary datacenter for the T0 logical router, in which case all logical network ingress/egress traffic (referred to as north-south traffic) is routed through the SR at that site. In this case, only the primary datacenter SR advertises itself to the external physical network as a next hop for logical network addresses. In addition, the secondary T0 SRs route northbound traffic to the primary T0 SR. So long as there are no stateful services configured for the T0 SR, some embodiments also allow for there to be no designation of a primary datacenter. In this case, north-south traffic may flow through the active SR in any of the datacenters. In some embodiments, different northbound traffic may flow through the SRs at different datacenters, depending either on dynamic routes learned via routing protocol (e.g., by exchanging BGP messages with external routers) or on static routes configured by the network administrator to direct certain traffic through certain T0 SRs. Thus, for example, a northbound data message originating from a DCN located at a first datacenter might be transmitted (i) from the host computer to a first edge device implementing a secondary T1 SR at the first datacenter, (ii) from the first edge device to a second edge device implementing the primary T1 SR at a second datacenter, (iii) from the second edge device to a third edge device implementing the T0 SR at the second datacenter, and (iv) from the third edge device to a fourth edge device implementing the T0 SR at a third datacenter, from which the data message egresses to the physical network. Some embodiments, as mentioned, also allow for active-active configuration of the T0 SRs. In some such embodiments, the network administrator can define one or more active SRs (e.g., up to a threshold number) for each datacenter spanned by the T0 logical router. Different embodiments either allow or disallow the configuration of a primary datacenter for the active-active configuration. If there is a primary datacenter configured, in some embodiments the T0 SRs at secondary datacenters use equal-cost multi-path (ECMP) routing to route northbound data messages to the primary T0 SRs. ECMP is similarly used when routing data traffic from a T0 SR at one datacenter to a T0 SR at another datacenter for any other reason (e.g., due to an egress route learned via BGP). In addition, when an edge device implementing a T1 logical router processes a northbound data message, after routing the data message to the T0 DR, the processing pipeline stage for the T0 DR uses ECMP to route the data message to one of the T0 SRs in the same datacenter. As with T1 logical router processing, southbound data messages do not necessarily follow the exact reverse path as did the corresponding northbound data message. If there is a primary datacenter defined for a T0 SR, then this SR will typically receive the southbound data messages from the external network (by virtue of advertising itself as the next hop for the relevant logical network addresses). If no T0 SR is designated as primary, then any active T0 SR at any of the datacenters may receive a southbound data message from the external network (though typically the T0 SR that transmitted corresponding northbound data messages will receive the southbound data messages). The T0 SR in some embodiments, is configured to route the data message to the datacenter with the primary T1 SR, as this is the only datacenter for which a link between the T0 logical router and the T1 logical router is defined. Thus, the T0 SR routes the data message to the T0 SR at the primary datacenter for the T1 SR with which the data message is associated. In some embodiments, the routing table is merged for the T0 SR and T0 DR for southbound data messages, so that no additional stages need to be executed for the transit logical switch and T0 DR. In this case, at the primary datacenter for the T1 logical router, in some embodiments the merged T0 SR/DR stage routes the data message to the primary T1 SR, which may be implemented on a different edge device. The primary T1 SR performs any required stateful services on the data message, and proceeds with routing as described above. In some embodiments, the local managers define the routing configurations for the SRs and DRs (of both T1 and T0 logical routers) and push this routing configuration to the edge devices and host computers that implement these logical routing components. For logical networks in which all of the LFEs are defined at the global manager, the global manager pushes to the local managers the configuration information regarding all of the LFEs that span to their respective datacenters. These local managers use this information to generate the routing tables for the various logical routing components implemented within their datacenters. For instance, for a T1 logical router, each secondary SR is configured with a default route to the primary T1 SR by the local manager at the T1 SR. Similarly, the primary SR is configured with a default route to the T0 DR in some embodiments. In addition, the primary SR is configured with routes for routing data traffic to the T1 DR. In some embodiments, a merged routing table for the primary SR and DR of the T1 logical router is configured to handle routing southbound data messages to the appropriate stretched logical switch at the primary T1 SR. For a T0 logical router, the majority of the routes for routing logical network traffic (e.g., southbound traffic) are also configured for the T0 SRs by the local managers. To handle traffic to stretched T1 logical routers, the T0 SRs are configured with routes for logical network addresses handled by these T1 logical routers (e.g., network address translation (NAT) IP addresses, load balancer virtual IP addresses (LB VIPs), logical switch subnets, etc.). In some embodiments, the T0 SR routing table (merged with the T0 DR routing table) in the same datacenter as the primary SR for a T1 logical router is configured with routes to the primary T1 SR for these logical network addresses. In other datacenters, the T0 SR is configured to route data messages for these logical network addresses to the T0 SR in the primary datacenter for the T1 logical router. In some embodiments, a network administrator can also define LFEs that are specific to a datacenter and link those LFEs to the larger logical network through the local manager for the specific datacenter (e.g., by defining a T1 logical router and linking the T1 logical router to a T0 logical router of the larger logical network). In some such embodiments, configuration data regarding the T1 logical router will not be distributed to the other datacenters implementing the T0 logical router. In this case, in some embodiments, the local manager at the specific datacenter configures the T0 SR implemented in this datacenter with routes for the logical network addresses related to the T1 logical router. This T0 SR exchanges these routes with the T0 SRs at the other datacenters via a routing protocol application, thereby attracting southbound traffic directed to these network addresses. In addition, one or more of the T0 SRs will generally be connected to external networks (e.g., directly to an external router, or a top-of-rack (TOR) forwarding element that in turn connects to external networks) and exchange routes with these external networks. In some embodiments, the local manager configures the edge devices hosting the T0 SRs to advertise certain routes to the external network and to not advertise others, as described further below. If there is only a single egress datacenter for the T0 SR, then the T0 SR(s) in that datacenter will learn routes from the external network via a routing protocol and can then share these routes with the peer T0 SRs in the other datacenters. When there are multiple datacenters available for egress, typically all of the T0 SRs will be configured with default routes that direct traffic to their respective external network connections. In addition, the T0 SRs will learn routes for different network addresses from their respective external connections, and can share these routes with their peer T0 SRs in other datacenters so as to attract northbound traffic for which they are the optimal egress point. In some embodiments, in order to handle this route exchange (between T0 SR peers, between T1 SR peers (in certain cases), and between T0 SRs and their external network routers), the edge devices on which SRs are implemented execute a routing protocol application (e.g., a BGP or OSPF application). The routing protocol application establishes routing protocol sessions with the routing protocol applications on other edge devices implementing peer SRs as well as with any external network router(s). In some embodiments, each routing protocol session uses a different routing table (e.g., a virtual routing and forwarding table (VRF)) for each routing protocol session. For T1 SRs, some embodiments use the routing protocol session primarily to notify the other peer T1 SRs that a given T1 SR is the primary SR for the T1 logical router. For example, when the primary datacenter is changed or failover occurs such that the (previous) standby T1 SR in the primary datacenter becomes the active primary T1 SR, the new primary T1 SR sends out a routing protocol message indicating that it is the new T1 SR and default routes for the other T1 SR peers should be directed to it. In some embodiments, the routing protocol application uses two different VRFs for route exchange for a given T0 SR. First, each T0 SR has a datapath VRF that is used by the datapath on the edge device for processing data messages sent to the T0 SR. In some embodiments, the routing protocol application uses this datapath VRF for route exchange with the external network router(s). Routes for any prefixes identified for advertisement to the external networks are used by the datapath to implement the T0 SR, and the routing protocol application advertises these routes to the external networks. In addition, routes received from the external network via routing protocol messages are automatically added to the datapath VRF for use implementing the T0 SR. In addition, in some embodiments, the routing protocol application is configured to import routes from the datapath VRF to a second VRF (referred to as the control VRF). The control VRF is used by the routing protocol application for the routing protocol sessions with other SRs for the same T0 logical router. Thus, any routes learned from the session with an external network router at a first T0 SR can be shared via the control VRF to all of the other T0 SRs. When the routing protocol application receives a route from a peer T0 SR, in some embodiments the application adds this route to the datapath VRF for the T0 SR on that edge device only so long as there is not already a better route in the datapath VRF for the same prefix (i.e., a route with a shorter administrative distance). On the other hand, when primary/secondary T0 SRs are configured, the routing protocol application at the secondary T0 SR adds routes learned from the primary peer T0 SR to the datapath VRF in place of routes learned locally from an external network router in some embodiments. It should be noted that while the above description regarding use of both a datapath VRF and a control VRF refers to a T0 SR that is stretched across multiple federated datacenters, in some embodiments the concepts also apply to logical routers generically (i.e., any logical router that has centralized routing components which share routes with each other as well as with an external network or other logical routers). In addition, the use of both a datapath VRF and a control VRF applies to logical routers (e.g., T0 logical routers) of logical networks that are confined to a single datacenter. SRs of such logical routers may still have asymmetric connections to external networks and therefore need to exchange routes with each other. For edge devices on which multiple SRs are implemented (e.g., multiple T0 SRs), different embodiments may use a single control VRF or multiple control VRFs. Using multiple control VRFs allows for the routes for each SR to be kept separate, and only provided to other peer SRs via an exclusive routing protocol session. However, in a network with numerous SRs implemented on the same edge device and each SR peering with other SRs in multiple other datacenters, this solution may not scale well because numerous VRFs and numerous routing protocol sessions are required on each edge device. Thus, some embodiments use a single control VRF on each edge device, with different datapath VRFs for each SR. When routes are imported from a datapath VRF to the control VRF, these embodiments add a tag or set of tags to the routes that identifies the T0 SR. For instance, some embodiments use multiprotocol BGP (MP-BGP) for the routing protocol and use the associated route distinguishers and route targets as tags. Specifically, the tags both (i) ensure that all network addresses are unique (as different logical networks could have overlapping network address spaces) and (ii) ensure that each route is exported to the correct edge devices and imported into the correct datapath VRFs. In addition, some embodiments use additional tags on the routes to convey user intent and determine whether or not to advertise routes in the datapath VRF to external networks. For instance, some embodiments use BGP communities to tag routes. As described above, routes in the datapath VRF for a given SR may be configured by the local manager, learned via route exchange with the external network router(s), and added from the control VRF after route exchange with other SR peers. Routes that a first T0 SR learns from route exchange will be imported into the control VRF and thus shared with a second T0 SR in a different datacenter (and third T0 SR, etc.). However, while these routes may be added to the datapath VRF for the second T0 SR, they should not necessarily be advertised out to external networks by the second T0 SR, because the T0 SRs should not become a conduit for routing traffic between the external network at one datacenter and the external network at another datacenter (i.e., traffic unrelated to the logical network). Accordingly, some embodiments apply a tag to these routes when exchanging the routes with other T0 peers, so that these routes are not further advertised. Different tags are applied to routes that should be advertised, to identify LB VIPs, NAT IPs, logical networks with public network address subnets, etc. The preceding Summary is intended to serve as a brief introduction to some embodiments of the invention. It is not meant to be an introduction or overview of all inventive subject matter disclosed in this document. The Detailed Description that follows and the Drawings that are referred to in the Detailed Description will further describe the embodiments described in the Summary as well as other embodiments. Accordingly, to understand all the embodiments described by this document, a full review of the Summary, Detailed Description and the Drawings is needed. Moreover, the claimed subject matters are not to be limited by the illustrative details in the Summary, Detailed Description and the Drawing, but rather are to be defined by the appended claims, because the claimed subject matters can be embodied in other specific forms without departing from the spirit of the subject matters.

11257379

SUMMARY FIG. 1is a diagram of a ground-based air traffic control (ATC)10center, a ground-based aircraft operations center (AOC)12, and an aircraft14in flight. Although described as being a ground-based aircrafts operation center, the aircraft operation center12can be located anywhere such that it is remote, or otherwise separate, from the aircraft14. Each of the ground-based ATC10and the ground-based aircrafts operations center12can include one or more computing circuits, such as microprocessors or microcontrollers, that can be configured with firmware or other configuration data, programmed with software, or hardwired to perform certain functions and tasks related to the flying, monitoring, and maintenance of the aircraft14. The aircraft14includes one or more electronic subsystems16, such as a flight management computer (FMC, hereinafter called a flight management system (FMS)), central maintenance computer (CMC), and an aircraft condition monitor (ACM), a communication management unit (CMU)18, and one or more data busses20, for example, an Aeronautical Radio INC. (ARINC) 429 bus, over which the CMU and the other one or more subsystems are configured to communicate with one another (other examples of the one or more busses20include an avionics full-duplex switched Ethernet (AFDX), a back-plane bus, and Ethernet). Each of the electronic subsystems16and the CMU18can include one or more respective computing circuits, such as a microprocessor or microcontroller, and respective other circuits, such as peripheral circuits and sensors. The computing circuits and other circuits can be configured with firmware or other configuration data, programmed with software, or hardwired to perform certain functions and tasks related to the flying, monitoring, flight-application processing, and maintenance of the aircraft14. For example, each of one or more of the computing circuits can execute one or more software applications to implement the functions of the corresponding subsystem. Although not shown inFIG. 1, the CMU18includes an AOC data engine, which is configurable by a loadable AOC database (not shown inFIG. 1), and which provides the CMU with the ability to communicate with systems, subsystems, and human/machine interfaces (both onboard and off board the aircraft30) including the aircraft operations center12; hereinafter, the CMU is referred to as the “CMU” or the “CMU AOC.” Because the CMU18is database configurable, an airline can configure the CMU to perform custom communication functions and operations without going to the trouble of requesting the aircraft manufacturer to re-certify the CMU software. For example, an airline can configure the AOC data engine such that the CMU18defines a message that includes available data (e.g., flight-status data) or a value that the CMU, or other system or subsystem, calculates from the available data, sends the message to a pilot via a computer display in the cockpit, and allows the pilot to review, and to forward selectively, the information to, e.g., ATC10or the aircraft operations center12, via a cockpit human-machine-interface (HMI) device (e.g., a device, such as a Multi-Control Display Unit (MCDU) that includes a display and a keypad or other input device) associated with the computer display; the AOC data engine may also be configured such that the CMU allows the pilot to add his/her commentary to the forwarded information either by selecting from a menu or by entering the commentary by typing or voice. Furthermore, an airline can configure the AOC data engine such that the CMU18performs an action, e.g., notifies the pilot, ATC10, or the aircraft operations center12, upon occurrence of a “triggering” event, e.g., the aircraft altitude drifts out of a specified range. But, as described below, the CMU18can be configured to perform an action only relative to data to which the CMU has access. The CMU18includes an Aircraft Communications Addressing and Reporting System (ACARS) router22for sending and receiving datalink messages between the aircraft and the ground. During operation, each of the electronic subsystems16broadcasts certain information (hereinafter “data”) to the CMU18via the ARINC 429 bus (one of the one or more busses20), and, as described above, the CMU is configured to route at least some of this data to the ATC10or to the aircraft operations center12via the ACARS router22. Examples of a subsystem16so broadcasting such data to the CMU18via the ARINC 429 bus20include an FMS broadcasting the current altitude and the current airspeed of the aircraft14periodically (e.g., every one second), and broadcasting, upon the aircraft arriving at a waypoint along the aircraft's flight path, the current time, the elapsed time and the distance the aircraft traveled since the aircraft was at the immediately previous waypoint, and the current airspeed of the aircraft. Furthermore, the ground-based aircraft operation center12is configured to request and to receive, from each of at least one of the electronic subsystems16, other data that the electronic subsystem does not periodically broadcast over the ARINC 429 bus20. Examples of such non-broadcast data include but not limited, the current flight plan stored in the FMS for the aircraft14. In more detail, to request non-broadcast data from a target one of the electronic subsystems16, the ground-based aircraft operations center12generates a data-request message that identifies the target electronic subsystem and that has an ACARS-compatible format, and sends the data-request message to the ACARS router22. For example, the data-request message includes an identifier (e.g., an address) of the target electronic subsystem16, and includes an address, or other description, of the requested data. In response to the data-request message from the ground-based aircraft operations center12, the CMU32generates, and sends to the service provider for the ground-based aircraft operations center, an acknowledgement of having received the data-request message. The service provider may, or may not, pass the acknowledgement to the ground-based aircraft operations center12. The ACARS router22routes the data-request message from the ground-based aircraft operations center12to the identified target electronic subsystem16via the ARINC 429 bus20. Alternatively, the ACARS router22drives the data-request message onto the ARINC 429 bus20, and the target electronic subsystem16intercepts the data-request message in response to an identifier (e.g., an address of the target electronic system) contained within the data-request message. The target electronic subsystem16responds to the received data-request message by processing, generating, or retrieving the requested data, by generating an ACARS-compatible data-response message that includes a payload with the requested data and that includes the requested destination, and by sending the data-response message to the ACARS router22via the ARINC 429 bus20. The ACARS router22routes the data-response message to the ground-based aircraft operations center12via the ground service provider (not shown), and the ground-based aircraft operation center extracts the data from the data-response message and consumes the data in any suitable manner. Assume, for purpose of example, that an FMS of the subsystems16is configured to publish, on the ARINC 429 bus20, the altitude of the aircraft10at two-second intervals, but is not configured to publish, on the ARINC 429 bus, flight-plan data that represents the flight plan that is stored in, implemented (while the aircraft30is on autopilot) by, and updated by, the FMS. Therefore, if the flight plan is changed in midflight (e.g., the pilot requests permission to fly above or around turbulence, and ATC10grants the request), then the CMU AOC18cannot be configured, and, therefore, is unable, to inform, automatically, the ground-based aircraft operations center12of the change in the flight plan in a timely manner because the FMS16does not publish all of the flight-plan data on the ARINC 429 bus20, and, therefore, because the CMU does not have full access to the flight-plan data. Because the ground-based aircraft operations center12does not “know” of the change in the flight plan, the ground-based aircraft operations center cannot, and does not, update the flight-plan information. For example, if the change in the flight plan is likely to result in the aircraft14arriving early at the destination airport, consequences of the ground-based aircraft operations center12not updating the flight-arrival information include the destination airport not having a gate prepared to receive the aircraft when the aircraft lands, and pre-scheduled transportation for a passenger of the aircraft not arriving at the airport in time to pick up the passenger upon his/her arrival at the destination airport. And if the change in the flight plan is likely to result in the aircraft arriving late at the destination airport, consequences of the ground-based aircraft operations center12not updating the flight-arrival information include tying up an airport gate for longer than necessary. A potential solution to the problem of the CMU18being unable to provide the ground-based aircraft operations center12with particular information from an electronic subsystem16onboard the aircraft14is to modify the subsystem to broadcast the particular information on the ARINC 429 bus20at periodic intervals, or upon the occurrence of an event (e.g., the aircraft14reaching a particular altitude, reaching a particular distance from the airport of arrival, or reaching a particular waypoint along the aircraft's flight path). But unfortunately, this potential solution may be relatively expensive and time consuming, and may nullify any competitive advantage that it might otherwise render to an airline. A modification to an electronic subsystem16, such as an FMS, often requires the agreement of the aircraft manufacturer and of government bodies overseeing air travel (e.g., the Federal Aviation Administration (FAA) in the United States), and obtaining such agreement can be lengthy and expensive. Furthermore, a so-modified electronic subsystem16is subject to a lengthy, expensive, and rigorous re-certification process before it can be placed into service onboard aircraft. Moreover, even assuming that such a modification developed, and provided to an airline, by an avionics manufacturer, is approved and implemented, the modified electronic subsystem16might provide no competitive advantage to the airline because other airlines would be able to obtain the modified subsystem from the developing avionics manufacturer or from another subsystem manufacturer. Another potential solution to the problem of the CMU18being unable to provide the ground-based aircraft operations center12with particular information from an electronic subsystem16onboard the aircraft14is to configure a computer circuit of the ground-based aircraft operations center to request (e.g., periodically or upon occurrence of an event) the unpublished data (e.g., the flight-plan data) from the electronic subsystem16(e.g., the FMS) by sending a data-request message to the target electronic subsystem via the ACARS router22. But unfortunately, this potential solution may be relatively expensive because it may consume a significant amount of the bandwidth of the air-to/from-ground communication links and may consume a significant amount of the processing throughput of the ground-based aircraft-operations-center's computer(s). Typically, an airline pays a fee for each ACARS message (or for each ACARS message over a threshold number per billing period) that the ground-based aircraft operations center12sends to, or receives from, the aircraft14. Therefore, configuring the ground-based aircraft operations center12to request, periodically, unpublished data from a target electronic subsystem16onboard the aircraft14can cause the airline to incur significant messaging fees, plus the air/ground subnetwork may not support all the extra data communications traffic. Furthermore, configuring the ground-based aircraft operations center12to request, periodically, unpublished data from one or more target electronic subsystems16onboard one or more aircraft14can increase, significantly, the messaging load, and thus the overall processing load, of the computer circuit(s) of the ground-based aircraft operations center. Furthermore, a similar lack-of-data problem may plague systems and subsystems other than the aircraft operations center12. For example, a pilot of the aircraft30may wish to inform the aircraft operations center12when the aircraft reaches the altitude peak of its ascent (or the pilot may wish to inform ATC10when the aircraft reaches the altitude peak of its ascent if the ATC does not otherwise have access to this information). But if the data needed to determine when the aircraft14reaches the peak of its ascent is not published on the one or more busses20(including, e.g., an ARINC 429 bus), and, therefore, is unavailable to the CMU18, then the pilot cannot so inform the aircraft operations center12(or ATC10). And unlike the aircraft operations center12, which may be able to request data not published on the one or more busses20, there is no way for the pilot or CMU18to request, from the other electronic subsystems16, data that the electronic subsystems do not publish on the one or more busses20. Other examples of situations in which lack of published data may prevent the occurrence of a desired operation include the lack of published data preventing the CMU18, or other onboard system or subsystem, from predicting, in real time, the fuel burn and the fuel reserve for the aircraft14at various points along the flight path, and from notifying the pilot of the occurrence of an event such as when the aircraft14reaches a certain distance (e.g., twenty miles) from the airport of arrival. Therefore, a need has arisen for a technique for obtaining unpublished data from an electronic subsystem16onboard a vehicle, such as the aircraft14, without the time, cost, loss of competitive advantage, and other complexities associated with modifying the electronic subsystem, and without significantly increasing the processing load of the computer circuit(s) of a communications center such as the ground-based aircraft operations center12and without significant air/ground bandwidth utilizing. An embodiment of a communication management unit (CMU) that can meet this need includes an emulator circuit and a data-mining circuit. The emulator circuit is configured to generate a data request having a same format as a data request from a vehicle operations center or other communications center, to send the data request to a subsystem disposed on a vehicle, and to receive data sent by the subsystem in response to the data request. And the data-mining circuit is configured to provide at least some of the received data to a determining circuit configured to determine information in response to the provided data. For example, such a CMU can request flight-plan data from a flight management system (FMS) by sending, to the FMS, an emulated data-request message having the same or similar format as a data-request message that the ground-based aircraft operations center12is configured to send to the FMS. That is, the CMU is configured to “fool” the FMS into “thinking” that the data-request message originated from the ground-based aircraft operations center12. Because the emulated data-request message has the same, or a similar, format as a data-request message from the ground-based aircraft operations center12would have, the FMS responds to the emulated data-request message with a data-response message just as the FMS would have responded to a data-request message from the ground-based aircraft operations center. The CMU intercepts and mines data from the data-response message, and provides the mined data to a determiner circuit, which determines one or more pieces of information (e.g., estimated flight arrival time) from the mined data. “Intercept” means that the CMU receives and acknowledges receipt of the data-response message if required, and that the ACARS router22does not transmit the data-response message to the ground-based aircraft operations center12. Furthermore, “mining” data means that the CMU may extract and send to the determiner circuit only the portion of the data in the data-response message used by the determiner circuit to determine a particular piece of information. For example, if the data-response message from the FMS16includes all of the flight-plan data, then the CMU18may extract, from the data-response message, only the portion of the flight-plan data that the determiner circuit uses to estimate the arrival time of the aircraft14at the destination airport. Furthermore, the determiner circuit can be part of the CMU18, can be separate from the CMU but still be onboard the aircraft14, or can be separate from the CMU and remote from the aircraft (e.g., can be part of the ground-based aircraft operations center12). Because one can modify a CMU to operate as described above by modifying software or firmware, and not hardware, modifying the CMU is often less time consuming, less costly, and has less-stringent certification requirements, than modifying the hardware of an electronic subsystem16or of the ARINC 429 bus20. Furthermore, a CMU so modified and configured does not increase the messaging load, or overall processing load, of the ground-based aircraft operations center12. Moreover, because an airline typically “owns” the CMU configuration, the above-described modifications that an airline makes to the CMU can be proprietary to the airline. That is, to modify the CMU, the airline does not need the permission of the aircraft manufacturer or of a subsystem manufacturer, and, therefore, does not need to make the modification available to competing airlines.

11466718

FIELD The subject matter herein generally relates to fixing members. BACKGROUND Often items have the need to be fixed in relation to a machining element. However the items are not always exact in their manufacture and tolerances must be accounted. This often requires repositioning of pins and other retaining elements for each item.

11364828

FIELD OF THE INVENTION The present invention generally relates to a seat assembly, and more particularly, to a seat assembly having cushioned components with cushioning materials that include integrated air bladder assemblies. BACKGROUND OF THE INVENTION Adjustable comfort settings for a seat assembly are desired. Cushioned components provided with pneumatic air bladders integrated into cushioning materials provides users adjustable comfort settings for a seat assembly while maintaining a desired seat profile. SUMMARY OF THE INVENTION According to one aspect of the present invention, a seat assembly includes a cushioned component having a lattice matrix. The lattice matrix includes a first portion defined by a first pattern of interconnected links which defines a first set of cells. A second portion of the lattice matrix is defined by a second pattern of interconnected links which defines a second set of cells. The first portion of the lattice matrix includes a density profile that is different than a density profile of the second portion of the lattice matrix. An air bladder is disposed within a core portion of the lattice matrix. The air bladder includes a non-porous outer casing surrounding an interior cavity. The outer casing and the lattice matrix are integrated components comprised of a common material to define a monolithic structure. According to another aspect of the present invention, a cushioned component includes a deflectable lattice matrix. The deflectable lattice matrix includes a porous network of interconnected links. An air bladder is disposed within a core portion of the lattice matrix and is operable between inflated and deflated conditions. The air bladder includes a non-porous outer casing surrounding an interior cavity. The outer casing and the lattice matrix are integrated components comprised of a common material to define a monolithic structure. According to yet another aspect of the present invention, a cushioned component includes a deflectable lattice matrix. The deflectable lattice matrix includes a porous network of interconnected links. An air bladder is operable between inflated and deflated conditions. The air bladder and the lattice matrix are integrated components comprised of a common material to define a monolithic structure. These and other aspects, objects, and features of the present invention will be understood and appreciated by those skilled in the art upon studying the following specification, claims, and appended drawings.

11521911

CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to Malaysian Application No. PI2020004457, filed on Aug. 28, 2020, which is incorporated herein in its entirety. BACKGROUND Embedded computing products are mainly personal computer (PC) systems used as edge devices for internet-of-things (IOT) applications. These edge devices are generally fanless systems, whereby a top surface of the edge device may be made of a heat sink (e.g., aluminum) for cooling purposes. The heat sink draws heat away from a heat source or a heat-generating component. In general, a base of the heat sink has a metal pedestal that makes contact with a processor die (i.e., a heat source) for a direct heat transfer. The metal pedestal is required for clearing any interference between components (such as resistors, capacitors, and dual in-line memory modules) around the processor die. A gap filler, also known as a thermal interface material, is further disposed between the processor die and the metal pedestal to fill up any microscopic unevenness on the surface of the process die to avoid any air gap that hinders heat dissipation. Arranged in this manner, the heat generated by the processor die is transferred to the heat sink via the thermal interface material and the metal pedestal. However, whenever the location and/or height of the process die changes due to an improved or new design of the edge devices, a relocation and/or resizing of the metal pedestal may be required. Furthermore, the modifications to the metal pedestal may be more complicated and time consuming if the processor die is a multi-chip package.

11488638

BACKGROUND Servers, e.g., just a bunch of drive (JBOD) storage servers, may contain a hundred or more electronic devices, such as HDDs. At times the devices may need to be transferred from the chassis to a different storage fixture, e.g., for the service of certain parts of a JBOD. Because of the number of devices, the transfer process is usually tedious and time-consuming, especially if done as a single HDD at a time for a JBOD. As a result, service times requiring the removal of a number of drives are unnecessarily long. Furthermore, as a result of long service times, hot swap servicing, servicing of the server while it is in operation, of numerous HDDs may cause undesired transient thermal situations in which components exceed data sheet temperature maximums. Thus, what is needed is an apparatus that provides the capability to remove and subsequently re-install multiple electronic devices at the same time.

11228017

CROSS-REFERENCE TO RELATED APPLICATION This application claims the priority of Chinese Patent Application No. 201710953291.X entitled with “packaging cover plate and method for manufacturing the same” submitted on Oct. 13, 2017, the disclosure of which is incorporated herein in its entirety by reference. TECHNICAL FIELD The present disclosure relates to the field of display technology, particularly to a light emitting diode display, a packaging cover plate for the display, and a method for manufacturing the same. BACKGROUND A Light Emitting Diode display, in particular OLED (Organic Light Emitting Diode), is a display lighting technology that has been gradually developed in recent years. Especially in the display industry, the Light Emitting Diode display is considered to have broad application prospects due to its high response, high contrast, and flexibility. SUMMARY The present disclosure provides a packaging cover plate, including a cover plate body and a groove structure disposed on a first surface of the cover plate body, wherein the cover plate body comprises a flexible ceramic material, and the groove structure is filled with an adhesive material and a thermally conductive material. Optionally, the groove structure includes a first groove and a second groove that are isolated from each other, wherein the first groove is filled with the adhesive material; and the second groove is filled with the thermally conductive material. Optionally, the first groove and the second groove are a linear long groove or a curved long groove; Both the first groove and the second groove are a plurality of grooves and parallel to each other, and the first groove and the second groove are arranged between each other. Optionally, the first groove and the second groove have a width of 0.5 mm to 1 mm. A length of the first groove and the second groove is generally larger than the length of the packaging region. That is, the first groove and the second groove extend to the outside of the packaging region. And the length of the first groove and the second groove may be set according to the size of the light emitting device, for example, preferably 3 cm to 220 cm. The interval between the adjacent first groove and the second groove is 0 to 1 mm. The first groove and the second groove have a depth of 10% to 50% of the depth of the packaging cover plate, for example, on the basis of a typical glass thickness of 0.5 mm, the depth of the first groove or the second groove is 0.05 mm-0.25 mm. Optionally, the first groove is a polygon (such as regular hexagons, quadrilaterals, etc.); and the second groove is a polygonal groove surrounding the first groove. Optionally, the first groove is a regular hexagonal groove; the second groove is a regular hexagonal ring groove surrounding the first groove; and the six sides of the first groove are in one-to-one correspondence with the inner six sides of the second groove. Optionally, the second groove is a plurality of grooves, and the outer six sides of any one of the second groove coincide with the outer side of six of the second groove adjacent thereto, and a plurality of the second groove cover the entire first surface of the cover plate body; the inner six sides of the second groove are in one-to-one correspondence with the six sides of the first groove, and coincide with the six sides of the first groove respectively. Optionally, the flexible ceramic material is a composite material composed of a host material and a binder material; the host material is at least one selected from the group consisting of Al2O3, BN, ZrO2, MgO, CeO2, Y2O3, Si3N4, and La2O3; and the binder material is at least one selected from the group consisting of epoxy resins, rubbers, and paraffin waxes. Optionally, the adhesive material contains organosilane-based materials containing inorganic fillers. Optionally, the thermally conductive material is at least one selected from the group consisting of graphene, carbon nanotubes, graphite powder, aluminum oxide, and aluminum nitride. As another embodiment, the present disclosure also provides an organic light emitting diode display, including a substrate, an organic light emitting diode functional layer on the substrate, a packaging adhesive, the packaging cover plate described above and a drying member, wherein the packaging adhesive is applied on the first surface of the cover plate body, thereby completing the package. As another embodiment, the present disclosure also provides a method for manufacturing a packaging cover plate, including: a step of providing a cover plate body comprising a flexible ceramic material; a step of forming a groove structure on the first surface of the cover plate body; and a step of filling the groove structure with an adhesive material and a thermally conductive material. Optionally, the step of filling the groove structure with an adhesive material and a thermally conductive material includes: formulating the adhesive material into a solution (preferably a dilute solution having a concentration of 0.5% by mass to 1% by mass) using a solvent; and formulating the thermally conductive material into a paste using a solvent; filling the solution into the groove structure by knife coating, spray coating or inkjet printing; and filling the paste into the groove structure by screen printing, spray coating or spot coating; and drying the dilute solution and the paste in the groove structure. Optionally, the step of forming a groove structure on the first surface of the cover plate body includes: forming a first groove and a second groove that are isolated from each other on a first surface of the cover plate body, filling the first groove with the adhesive material, and filling the second groove with the thermally conductive material. Optionally, the first groove and the second groove is each formed into a linear long groove, a curved long groove or a hexagonal groove. In the case of forming the hexagonal grooves, the first groove is configured as a regular hexagonal groove; the second groove is configured as a regular hexagonal ring groove surrounding the first groove; and the six sides of the first groove are in one-to-one correspondence with the inner six sides of the second groove.

11467708

TECHNICAL FIELD This application relates to a method, a computer-readable medium and a device for providing improved activation of a virtual object, and in particular to a method, a computer-readable medium and a device for activation of a virtual object in an augmented reality, a virtual reality or a mixed reality for providing a touchless gesture-based user interface. BACKGROUND Virtual Reality, or VR, has been known since the late 1970s and many solutions have been proposed for how to provide user input including wearing special gloves or keypads, especially for handling, such as when selecting and activating a virtual object. Some examples of such systems are proposing to use a motion sensor (such as an accelerometer and/or a gyroscope) for determining the movements of a user's head and thereby tracking what the user is watching in the virtual reality. However, as the user's head is used for input and the virtual reality is often well encompassing and comprising more content than is displayed at an instance in time, and as the virtual reality often comprises many objects which may all be associated with different functions and gestures, users are often confused and find it difficult to handle such systems and to select and execute correct or desired functions, at least before substantial training has been performed. There is thus a need for a VR device that facilitates user's perception enabling them to navigate complex Virtual reality landscapes. SUMMARY It is an object of the teachings of this application to overcome the problems listed above by providing a VR device comprising a controller configured to: present a Virtual Reality space comprising at least one virtual object being associated with a gesture for executing an action associated with said virtual object; determine that the virtual object is in a Line Of View; and providing a graphical marking of the virtual object; wherein the graphical marking includes an indication of the associated gesture. Such a VR device is enabled to facilitate human perception by providing an indication of what gesture is associated with what icon so that commands can be given swiftly and accurately. In one embodiment, the controller is further configured to provide a see-through view. The see-through view prompts and instructs the user to input a gesture and also provides (real time) feedback on the gesture being made. In one embodiment, the VR device comprises a mobile communications terminal, such as a smartphone. In one embodiment, the VR device comprises an internet tablet or a (laptop) computer. In one embodiment, the VR device comprises a game console. In one embodiment, the VR device comprises a media device such as a television set or media system. In one embodiment the VR device comprises a pair of Augmented Reality or Virtual Reality glasses. It is also an object of the teachings of this application to overcome the problems listed above by providing a method for use in a VR device comprising a display, said method comprising presenting a Virtual Reality space comprising at least one virtual object being associated with a gesture for executing an action associated with said virtual object; determining that the virtual object is in a Line Of View; and providing a graphical marking of the virtual object; wherein the graphical marking includes an indication of the associated gesture. It is a further object of the teachings of this application to overcome the problems listed herein by providing a computer readable medium comprising instructions that when loaded into and executed by a controller, such as a processor, in a VR device cause the execution of a method according to herein. The inventors of the present invention have realized, after inventive and insightful reasoning that by providing a graphical indication of an associated gesture as a marking of a selectable virtual object, possibly along with an animation (through a morphing) of the gesture and feedback of the gesture (through a see-trough view), a user's perception is facilitated greatly into being able to associate a virtual object, such as an icon, with a gesture, understanding how the gesture is to be made and receiving feedback of his gesture without risking to lose focus or confusing one icon with another as regards their associated gestures. The user is also not forced to look at different sections or portions of the display to perceive the same amount of information. Furthermore, no written text is required which reduces the need for optical or prescription glasses (which is sometimes a problem when wearing VR glasses). Additionally, the concept taught herein saves display space. Moreover, the concept taught herein reduces the power consumption and requirements of a VR device. It should be explicitly noted that the simplicity and elegancy of the proposed solution is at the core of this invention and provides for a user interface that greatly facilitates human perception. The concepts taught in this application are also applicable to augmented realities and mixed realities. For the purpose of this application Virtual Reality will thus be taken to also include augmented realities and mixed realities. Other features and advantages of the disclosed embodiments will appear from the following detailed disclosure, from the attached dependent claims as well as from the drawings. Generally, all terms used in the claims are to be interpreted according to their ordinary meaning in the technical field, unless explicitly defined otherwise herein. All references to “a/an/the [element, device, component, means, step, etc.]” are to be interpreted openly as referring to at least one instance of the element, device, component, means, step, etc., unless explicitly stated otherwise. The steps of any method disclosed herein do not have to be performed in the exact order disclosed, unless explicitly stated.

11513999

FIELD OF THE INVENTION The invention relates generally to data archiving in computers, and more particularly to a system, method and computer program product for storing and retrieving multimedia data in a client-server archive library with metadata encapsulation. BACKGROUND The availability of various computer-based devices and computer networks, and the growing amount of images and video contents being generated by computer applications in different fields, lead to a demand for efficient methods for archiving such data at remote data storage libraries. As an example, in the medical field, a large amount of patient imaging data including X-rays, computed tomography images (CTI), magnetic resonance images (MRI), ultra-sound video recordings, etc. are generated everyday at hospitals and medical clinics. The image and video data is often stored in a digital format to facilitate its handling, transmission, storing and retrieving. At the present, the Digital Imaging and Communications in Medicine (DICOM) format is a commonly used standard for handling medical images and video data. Typically, images and video data come from decentralized workstations and client devices such as laptop computers, PDAs, workstations, as well as computers that are connected to an image-producing equipment like a MRI system at a hospital. These decentralized client computers often need to retrieve previously stored images and video data from a server and data archive library systems that are connected to the server for data archiving. Current data archiving solutions typically use tape library systems where workstations and client devices are connected to one or more servers, and the servers are connected to one or more libraries. In large data centers, such as those providing imaging for health care, entertainment, weather, military, and space exploration applications, these servers and libraries are often interconnected in a grid computing environment. The computing grid allows much flexibility in the sharing of image and video data. However, the amount of data for archive and retrieval is staggering and in the Exabyte (1000 Petabyte) scale. To mitigate the unnecessary transfer of unwanted data during the search for specific data, the desired data must be identified based on information other than the data itself, before the entire set of images or video streams are retrieved from the tape library to the user. Such a technique for screening of data improves the overall performance and usability of the archive system. From the foregoing, there still exists a need for an efficient system, method and computer program product for storing and retrieving image, video, and other multimedia data in a client-server archive library. SUMMARY The invention relates to archiving and retrieving multimedia data in a client-server library with metadata encapsulation. More particularly, the invention provides an efficient system and method for archiving image and video data from decentralized client computers. The server receives and holds the images to be archived in an image logical partition which includes a directory of the images. The images are encapsulated with their metadata before being stored in the library along with a closed copy of the image directory. The details of the preferred embodiments of the invention, both as to its structure and operation, are described below in the Detailed Description section in reference to the accompanying drawings. The Summary is intended to identify key features of the claimed subject matter, but it is not intended to be used to limit the scope of the claimed subject matter.

11343001

CROSS-REFERENCE TO RELATED APPLICATIONS This patent application is a U.S. National Phase of PCT International Application No. PCT/NL2019/050810, filed Dec. 5, 2019, which claims priority to European Application No. 18210480.2, filed Dec. 5, 2018, which are both expressly incorporated by reference in their entireties, including any references contained therein. FIELD OF THE INVENTION The invention relates to a photon exchange based quantum network. BACKGROUND A photon exchange based quantum network is described in an article by P. C. Humphreys et al. titled “Deterministic delivery of remote entanglement on a quantum network use quantum entangled states”, published in Nature 558, 268-273 (2018). As known per se, quantum networks can be used to secure communication and to perform quantum computing. A quantum network contains a plurality of physical sub-systems, referred to as quantum network nodes. In a photon exchange based quantum network physical sub-systems are used wherein each physical subsystem has the ability to emit single photons that are entangled with an internal degree of freedom of the physical sub-system. In known photon exchange based quantum networks nitrogen vacancy centers (NV centers) in diamonds, trapped atomic systems (for example cesium or calcium atoms in a cavity) or quantum dots may be used in physical subsystems. Furthermore, the photon exchange based quantum network comprises a detection station, the quantum network nodes being coupled to the detection station via an optical path, such as an optical fiber or free space through the air. In an embodiment, a single detection station may be used for a set of quantum network nodes, to act as a central node, but more than one detection station may be used, that can be at the same location as a node. A key step for the implementation of quantum networks is the generation of entanglement, i.e. the operation procedure that provides that in its quantum mechanical description the state function of a combination of at least two of the physical subsystems cannot be expressed as a product of state functions of the individual physical subsystems. Instead the state function of the combination may be a sum of different products of state functions of the individual physical subsystems multiplied by different coefficients. In a photon exchange based quantum network the entanglement across the network is generated by using a detection station to detect photons emitted by different network nodes. To entangle two physical subsystems a detector is used that provides for detection of individual photons from both physical subsystems indiscriminately in the detection station. In the quantum mechanical description, photon emission is associated with only part of the states of an individual physical subsystem (node). A preparation procedure is used that ensures that, at least with high likelihood, the state function of the individual physical subsystems in the quantum mechanical description is a coherent mixture of states with and without associated photon emission ability. At this point the individual physical subsystems are not entangled. Subsequent to the preparation of the system a light pulse is applied to each of the individual physical subsystems to stimulate the emission of a photon, dependent on the state of the subsystem. Detection of a photon in the detection station can, under suitable conditions, herald that entanglement has been achieved. However, the reverse is not true: absence of detection of any photon can be due to absence of emission or another source of failure, such as photon loss during transmission. A major challenge for photon exchange based quantum networks is that the probability of detection of photons associated with the quantum network nodes is small (e.g. of the order of 0.001). Many photons are lost in optical collection and in the transmission path, for example in an optical fiber coupling the nodes to the detector. Physical subsystems like NV centers, or another type of trapped atoms like for example based on cesium and calcium, e.g. comprising an atom trapped in a cavity, produce photon states corresponding to wavelengths outside the optimal band used for optical fiber communication, which increases loss when the physical subsystems are far apart. Humphreys et al. use an excitation laser outside the quantum nodes and optically splitted the light in order to get parallel pulses from the excitation laser to the quantum network nodes via optical fibers. At the quantum network nodes these pulses provide for emission of photons from the nodes, which are collected and travel to the detection station. At the detection station, these photons are detected by the single photon detectors. To be able to make use of entanglement, a stable phase relation between the states is needed. In the case of Humphreys et al. this requires a stable difference between the cumulative optical phase delays from the optical splitting of the light, to the quantum network nodes and all the way up to the detection station. Humphreys et al use a fiber stretcher in the optical path from one of the quantum network nodes to compensate for, relatively slow, phase variations. The optical phase delay of the fiber stretcher is adjusted using feedback control of the phase compensation during time slots of a time multiplexing scheme, that has further time slots for transmission of photons from the NV centers. Humphreys et al. refer to an article by Hensen et al., titled “Experimental loophole-free violation of a Bell inequality using entangled electron spins separated by 1.3 km” published in Nature, volume 526, pages 682-686 (29 Oct. 2015). Hensen et al. disclose a scheme with local excitation lasers at the quantum nodes, instead of the excitation laser at the detection station. Hensen et al. use a scheme to achieve entanglement that requires that the local lasers imprint the same phase difference in successive time bins, i.e. over two hundred nano seconds. To accomplish this, Hensen et al. (supplement) use a feedback loop to control the wavelength of the laser of a first node, based on a frequency comparison with light from the laser of a second node that is transmitted directly between the nodes. US20120328290 discloses a quantum communication system with a receiver and a plurality of transmitters and its use in secure key distribution. Each transmitter comprises an interferometer with an optical phase modulator in one arm. The interferometer is used to pass polarized pulses from a laser diode to a polarization maintaining fiber. The system provides for a feedback signal from the receiver to the transmitter to control an arm length in the interferometer. The polarization is adjusted to minimize reduction of the count rate due to polarization drift. Similarly, the tuning of the trigger time of the laser diode is adjusted to minimize the effect of photo arrival time drift based on detection results. US20160234018 discloses a quantum communication system with a plurality of transmitters for realizing quantum channels in combination with transmitters for classical channels. SUMMARY Among others it is an object to provide a photon exchange based quantum network with relatively high photon loss. A method of operating a photon exchange based quantum network according to claim1is provided. In both a first and second quantum network node, a pulse of light from the laser of the node to a sub-system like an NV center, a trapped atomic system, or a quantum dot, in the node. A light transmission path, which may comprise an optical fiber or a free space path, is provided from each node to a detection station, for passing a photon from the sub-system. Light from the laser of the node is also supplied into the light transmission path in a time slot preceding a time point at which the network node supplies the pulse of light from the laser of the node. In the detection station a photon arrival detector detects the times of arrival of photons from the light transmission path. Furthermore, optical phase and/or frequency modulator(s) between a photon arrival detector and the respective light transmission paths, are used to adapt the optical phase and/or frequency transmission of light from the light transmission paths, so as to establish predetermined phase relations between a reference laser and light from the light transmission paths in the time slots. The adapted optical phase and/or frequency transmission is maintained during observation time slots at which photons from the sub-systems arrive. Thus synchronization of the light supplied from the different quantum network nodes at the photon arrival detector can be maintained without requiring additional transmission paths, even if long transmission paths such as optical fibers or free space connections to and from a satellite are used. In an embodiment, optical frequency converters are used in the quantum network nodes, between the NV center and laser on one hand and the transmission path to the detection station on the other hand. This makes it possible to use standard optical communication fibers in the transmission paths between the quantum network nodes and the detection station, which reduces photon loss, compared to use of fibers operating at optical frequencies of photons produced by the sub-systems. Typically, frequency conversion involves pumping with an additional laser. By using optical phase and/or frequency modulators in the detection station to control the phase, no additional measures are needed to compensate for instability introduced by such additional lasers.

11337216

BACKGROUND Field The present disclosure relates to a wireless communication apparatus, a method of controlling the wireless communication apparatus, and a non-transitory, computer-readable storage medium. Description of the Related. Art Technologies to perform wireless LAN communication using access points (hereinafter referred to as “APs”) have hitherto been known. In order to perform secure wireless LAN communication between a wireless communication apparatus and the APs, it can be necessary to set various communication parameters including an encryption method, an encryption key, an authentication method, and an authentication key. Device Provisioning Protocol (DPP) was developed in Wi-Fi Alliance as a method of transmitting such communication parameters through a wireless LAN. In the DPP, a configurator that provides the communication parameters, provides, to an enrollee that receives the communication parameters, information called a connector, which is necessary to connect to the APs. In the DPP, a bootstrap process to acquire public key information using a QR Code®, Bluetooth® Low Energy (BLE), or the like is defined. In addition, a DPP Authentication process, which is an authentication process for device authentication, and a DPP Configuration process, which is a setting process to transmit the communication parameters, are also defined in the DPP. Japanese Patent Laid-Open No. 2015-23441 discloses a communication parameter setting method in which a user, via a mobile terminal, selects an AP, which is a connection destination, to set the communication parameters of a communication apparatus. In this communication parameter setting method, the communication apparatus scans surrounding APs and transmits information about the APs detected through the scanning to the mobile terminal. The mobile terminal displays a list of APs in a user interface (UI) of the mobile terminal using the information received from the communication apparatus. Upon selection of an AP by the user, the communication parameters to communicate with the selected AP are transmitted from the mobile terminal to the communication apparatus. Transmission of the communication parameters from the mobile terminal, which operates as the configurator, to the communication apparatus, which operates as the enrollee, by applying the DPP using the BLE to the communication parameter setting method described in Japanese Patent Laid-Open No. 2015-23441 is considered. Upon activation of a communication parameter setting application in response to an operation by the user with the UIs of the configurator and the enrollee, the configurator and the enrollee start the bootstrap process. In addition, the enrollee starts scanning using the wireless LAN to detect surrounding APs. In the bootstrap process, the enrollee transmits bootstrap information required in a DPP authentication process of, for example, the public key and a media access control (MAC) address. The bootstrap information is transmitted using the BLE in an advertising packet. The configurator receives the advertising packet to acquire the bootstrap information. Then, the configurator transmits a DPP Authentication Request (authentication request) to the enrollee through the wireless LAN based on the acquired bootstrap information, to establish wireless LAN connection with the enrollee. Then, the configurator receives the AP list from the enrollee through the wireless LAN and transmits the communication parameters of the AP selected by the user to the enrollee. Since the enrollee performs the scanning through the wireless LAN after activating the communication parameter setting application in the above communication parameter setting process, high power consumption is caused in the enrollee. In addition, it is required for the enrollee to be in a state (a reception idle state) in which the enrollee is capable of receiving the DPP authentication request until the DPP authentication request is transmitted from the configurator. Higher power is consumed in the reception idle state, compared with a sleep state in which a transmission-reception function is deactivated. In particular, when the enrollee is a battery-powered apparatus, such as a camera, the power consumption may become a problem. Although the power consumption in the enrollee is capable of being reduced if the configurator performs the scanning, the user-friendliness of the system is reduced when the wireless LAN channel supported by the configurator is different from that of the enrollee. For example, there can be a case in which the configurator supports 2.4 GHz and 5 GHz while the enrollee supports only 2.4 GHz. In this case, the configurator may display an AP list including the APs operating at 5 GHz even though the connection using the wireless LAN with the enrollee would be disabled at 5 GHz. Accordingly, the user may erroneously select APs operating at 5 GHz even though the connection using the wireless LAN with the enrollee would be disabled at 5 GHz. SUMMARY Various embodiments of the present disclosure seek to address the above-mentioned problems which exist in the conventional technology. A feature of the present disclosure is to provide a wireless communication apparatus capable of reducing the power consumption in the own apparatus in provision of authentication information about the own apparatus to another wireless communication apparatus to acquire communication parameters. According to various embodiments of the present disclosure, there is provided a wireless communication apparatus that is able to perform a first wireless communication and a second wireless communication, the second wireless communication having power consumption lower than that of the first wireless communication, the wireless communication apparatus comprising: a receiving unit that receives, from another wireless communication apparatus through the second wireless communication, information indicating a channel which the another wireless communication apparatus is able to use in the first wireless communication; a selecting unit that selects a communication parameter to be provided to the another wireless communication apparatus based on the information received by the receiving unit, the communication parameter being required by the another wireless communication apparatus to connect to an apparatus that forms a network in which the first wireless communication occurs; and a transmitting unit that transmits the communication parameter selected by the selecting unit to the another wireless communication apparatus through the first wireless communication. Further features will become apparent from the following description of exemplary embodiments with reference to the attached drawings.

11296359

CROSS-REFERENCE TO RELATED APPLICATIONS The present application is a national phase entry under 35 U.S.C. § 371 of International Application No. PCT/KR2018/010013, filed on Aug. 29, 2018, which claims priority from Korean Patent Application Nos. 2017-0118694, filed on Sep. 15, 2017, and 2018-0101413, filed on Aug. 28, 2018, the disclosures of which are incorporated by reference herein. TECHNICAL FIELD The present invention relates to a non-aqueous electrolyte solution and a lithium secondary battery including the same, and particularly, to a non-aqueous electrolyte solution including a HF indicator and a pouch-type lithium secondary battery including the same. BACKGROUND ART Currently, in line with the rapid development of electric, electronic, communication, and computer industries, a significant amount of research has been conducted on high performance, high stability batteries which may be used as driving power sources therefor, and, among them, a lithium secondary battery is receiving the most attention because the lithium secondary battery is advantageous in that energy density per unit weight is about three times higher than that of a conventional lead-acid battery, a nickel-cadmium battery, a nickel-hydrogen battery, or a nickel-zinc battery, and fast charging is possible. Lithium secondary batteries may be divided into a lithium ion battery using a liquid electrolyte solution and a lithium polymer battery using a polymer electrolyte depending on the type of the electrolyte used. It is important for the lithium ion battery to constantly maintain quality of the electrolyte solution, and the quality is evaluated according to amounts of water, hydrofluoric acid (HF), and anions contained in the electrolyte solution. That is, when a trace amount of water or an anion component (Cl−, SO4−, etc.) is contained in the electrolyte solution, a lithium salt, such as LiPF6or LiBF4, among components of the electrolyte solution of the secondary battery reacts therewith to generate a vapor or gas, such as free HF or hydrochloric acid (HCl) (see the following Reaction Formula 1) [Reaction Formula 1] LiPF6+4H2O→LiF+5HF+H3PO4 In this case, when a concentration of the generated HF gas is normally increased to 150 ppm or more, the HF gas causes a rapid oxidation reaction to degrade the performance of a negative electrode, and manganese (Mn) is dissolved from a positive electrode by the HF gas to reduce battery lifetime. Furthermore, the HF gas becomes a cause of battery explosion. Thus, control of the concentration of the HF gas and water in the non-aqueous electrolyte solution to be less than a few ppm during the preparation of the lithium secondary battery is an important issue. Recently, a method has been used in which, after quality inspection is performed to measure the concentration and amount of water and HF in the electrolyte solution using an acid-base titration method or a concentration analysis method before shipping products, the products are shipped. In the acid-base titration method, an electrolyte solution is diluted with deionized water to be used as a sample, a basic material, such as NaOH, is mixed with deionized water to be used as a titration reagent, the time when the color of the indicator changes is measured to obtain an end point, and an amount of an acid is calculated using the end point. However, since the method is to detect HF present in the electrolyte solution before the electrolyte solution is injected into the lithium secondary battery, it is disadvantageous in that HF gas generated in the secondary battery after the injection may not be measured. Furthermore, in a case in which a lithium bis(oxalate)borate (LiBOB) component is present in the electrolyte solution, since the water contained in the titration reagent and the water used to dilute the electrolyte solution react with the LiBOB to form boric acid and both the boric acid formed and the HF are detected, the method is disadvantageous in that it is difficult to calculate an accurate concentration of the HF. Also, the concentration analysis method is a method of selectively analyzing the concentration of HF in the electrolyte solution containing the HF. However, this method has a limitation in that the measurement of the HF gas generated in the secondary battery may not be possible, because the acid reacts with the water in the titration reagent and, simultaneously, reacts continuously with moisture in the air over time to continuously increase the amount of the acid. Thus, there is a need to develop a method which may more simply and easily detect HF gas generated after the preparation of a secondary battery without disassembling the secondary battery. PRIOR ART DOCUMENT Korean Patent No. 10-0923860 DISCLOSURE OF THE INVENTION Technical Problem An aspect of the present invention provides a non-aqueous electrolyte solution including a hydrofluoric acid indicator (hereinafter, referred to as ‘HF indicator’). Another aspect of the present invention provides a lithium secondary battery in which HF generated during the preparation of the secondary battery may be easily detected by including the non-aqueous electrolyte solution. Technical Solution According to an aspect of the present invention, there is provided a non-aqueous electrolyte solution including an electrolyte salt, an organic solvent, and a HF indicator. The HF indicator is a material in which discoloration occurs when exposed to HF, wherein, as a representative example, the HF indicator may include pyrocatechol violet. The HF indicator may be included in an amount of 0.1 wt % to 0.4 wt %, particularly 0.1 wt % to 0.3 wt %, and more particularly 0.1 wt % to 0.2 wt % based on a total weight of the non-aqueous electrolyte solution so that the HF indicator may be visually confirmed. According to another aspect of the present invention, there is provided a pouch-type secondary battery including: an electrode assembly including a positive electrode, a negative electrode, and a separator disposed between the positive electrode and the negative electrode; a non-aqueous electrolyte solution; and a pouch case accommodating the electrode assembly and the non-aqueous electrolyte solution, wherein the pouch case includes: a lower case including an accommodating part which accommodates the electrode assembly and the non-aqueous electrolyte solution, and an upper case formed in one piece with the lower case to seal the accommodating part from the exterior of the pouch case, wherein at least one of the lower case and the upper case includes a transparent identification part (observation part) for internal observation of the accommodating part from the exterior of the pouch case. The transparent identification part (observation part) may have at least one shape of a circular shape, a polygonal shape, and a rectangular shape. The transparent identification part (observation part) may be formed by adhering a polyethylene (PE) resin to both sides of a hole formed by punching the pouch case. An area of the transparent identification part (observation part) may be in a range of 1% to 10%, for example, 1% to 7% of a total area of one surface of the pouch case. Advantageous Effects In the present invention, generation of HF gas may be visually confirmed without disassembling a cell by providing a non-aqueous electrolyte solution including a HF indicator, which may accurately measure the generation of hydrofluoric acid by changing its color when it is exposed to the HF gas, and a pouch case in which a transparent identification part capable of observing the inside is formed. Thus, since a secondary battery from which an excessive amount of HF gas is generated may be easily detected in a secondary battery production line, a defect detection operation may be performed easily and accurately, and, thus, an effect of minimizing defect rate of products may be achieved.

11381035

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates generally to an electrical connector assembly, and particularly to the plug connector and the receptacle connector mateable with each other with corresponding metal locking mechanism. 2. Description of Related Arts U.S. Pat. No. 9,991,631 discloses the mated plug connector and receptacle connector wherein the receptacle is equipped with a deflectable latch unitarily formed on the insulative receptacle housing and the plug connector is equipped with a stationary locking protrusion unitarily formed on the insulative plug housing and interengaged with the deflectable latch. Anyhow, such latch mechanism may tend to be worn out after repeated use. It is desired to provide an electrical connector assembly with the endurable latch mechanism for long time use. SUMMARY OF THE INVENTION To achieve the above object, an electrical connector assembly includes a receptacle connector and a plug connector mateable with each other. The receptacle connector includes an insulative receptacle housing, a plurality of receptacle contacts retained in the receptacle housing, and a pair of metallic latches on two sides. The insulative receptacle housing includes a base and a pair of side arms extending forwardly from two opposite ends of the base along a front-to-back direction and spaced from each other in a transverse direction perpendicular to the front-to-back direction to commonly form a receiving space thereamong. The receptacle contacts extend into the receiving space. Each side arms forms a receiving groove communicating with the receiving space in the transverse direction. A pair of metallic latches are received within the corresponding receiving grooves, respectively, with the corresponding locking heads projecting into the receiving space in the transverse direction. The plug connector includes an insulative plug housing and a pair of immovable metal locking pieces thereon. The insulative plug housing includes a front face and a pair of side faces. The metal locking piece defines an L-shaped structure with a front section hidden behind and parallel to the front face, a rear section hidden behind and parallel to the side face, and a middle section with a locking protrusion for engagement with the locking head of the deflectable latch of the receptacle connector during mating. Other advantages and novel features of the invention will become more apparent from the following detailed description of the present embodiment when taken in conjunction with the accompanying drawings.

11351205

FIELD OF THE INVENTION The present invention generally relates to therapeutic compositions and methods for increasing efficacy of an anti-cancer therapy. The present invention further relates to treating, preventing, or inhibiting an oncology-treatment induced condition (OTIC) induced by an anti-cancer therapy. BACKGROUND Cancer can be treated by surgery, chemotherapy (including hormonal therapy), radiation therapy, and/or targeted therapy (including immunotherapy). Many cancers either do not respond or respond poorly to such treatments, or recur following the termination of the treatment. Further, many anti-cancer therapies give rise to or are associated with deleterious health effects in the treated patient. For example, activation of the immune system associated with checkpoint inhibitor therapy is associated with onset or exacerbation of inflammation-associated conditions such as colitis. Therefore, there is an ongoing need for improved anti-cancer therapeutic compositions and treatments, as well as compositions and treatments that treat or inhibit the development or severity of conditions associated with anti-cancer treatments. SUMMARY In one aspect, the present disclosure provides a method for treating or preventing an oncology-treatment induced condition (OTIC) induced by an anti-cancer therapy, comprising administering to a subject a therapeutic composition comprising a microbial preparation; wherein the subject is treated with the anti-cancer therapy; and wherein the microbial composition comprises a fecal microbiota of a human donor. In some cases, the subject is administered the therapeutic composition after treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 1 day after treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 3 days after treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 5 days after treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 1 week after treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 4 weeks after treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 8 weeks after treatment with the anti-cancer therapy. In some cases, the subject is administered the therapeutic composition before treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 1 day before treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 3 days before treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 5 days before treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 1 week before treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 4 weeks before treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 8 weeks before treatment with the anti-cancer therapy. In some cases, the therapeutic composition prevents or inhibits the OTIC. In some cases, the subject is administered the therapeutic composition concurrently with the anti-cancer therapy. In some cases, the anti-cancer therapy is chemotherapy, and the subject is administered the therapeutic composition between consecutive chemotherapeutic administrations. In some cases, the anti-cancer therapy is radiation therapy, and the subject is administered the therapeutic composition between consecutive radiation therapy administrations. In some cases, the therapeutic composition increases the efficacy of the anti-cancer therapy. In some cases, the anti-cancer therapy comprises surgery, radiation therapy, administration of a chemotherapeutic agent, stem-cell transplant therapy, or targeted therapy. In some cases, the anti-cancer therapy is radiation therapy. In some cases, the anti-cancer therapy is a surgery which excises a tumor or an organ/tissue comprising cancerous cells. In some cases, the anti-cancer therapy comprises administration of a chemotherapeutic agent. In some cases, the chemotherapeutic agent is selected from the group consisting of: alkylating agents, alkyl sulfonates, aziridines, an ethylenimine, a methylamelamine, an acetogenin, a camptothecin bryostatin, cally statin, CC-1065, a cryptophycin, dolastatin, duocarmycin, eleutherobin, pancratistatin, a sarcodictyin, spongistatin, a nitrogen mustard, a nitrosurea, an antibiotic, a dynemicin; a bisphosphonate, an esperamicin, neocarzinostatin chromophore and related chromoprotein enediyne antibiotic chromophores, an aclacinomysin, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, ADRIAMYCIN doxorubicin, epirubicin, esorubicin, idarubicin, marcellomycin, a mitomycin, mycophenolic acid, nogalamycin, an olivomycin, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin an anti-metabolite, a folic acid analogue, a purine analog, a pyrimidine analog, an androgen, an anti-adrenal, a folic acid replenisher, aceglatone, aldophosphamide glycoside, aminolevulinic acid, eniluracil, amsacrine, bestrabucil, bisantrene, edatrexate, demecolcine, diaziquone, elformithine, elliptinium acetate, an epothilone, etoglucid, gallium nitrate, hydroxyurea, lentinan, lonidainine, a maytansinoid, mitoguazone, mitoxantrone, mopidanmol, nitraerine, pentostatin, phenamet, pirarubicin, losoxantrone, podophyllinic acid, 2-ethylhydrazide, procarbazine, PSK polysaccharide complex, razoxane, rhizoxin, sizofuran, spirogermanium, tenuazonic acid, triaziquone, 2,2′,2″-trichlorotriethylamine, a trichothecene, urethan, vindesine, dacarbazine, mannomustine, mitobronitol, mitolactol, pipobroman, gacytosine, arabinoside (“Ara-C”), cyclophosphamide, thiotepa, a taxoid, ABRAXANE Cremophor-free, an albumin-engineered nanoparticle formulation of paclitaxel and TAXOTERE doxetaxel, chlorambucil, GEMZAR gemcitabine, 6-thioguanine, mercaptopurine, methotrexate, a platinum analog, vinblastine, platinum, etoposide (VP-16), ifosfamide, mitoxantrone, vincristine, NAVELBINE, vinorelbine, novantrone, teniposide, edatrexate, daunomycin, aminopterin, xeloda, ibandronate, irinotecan (Camptosar, CPT-11), topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO), a retinoid, capecitabine, combretastatin, leucovorin (LV), oxaliplatin, Binimetinib (Mektovi), Encorafenib (Braftovi), lapatinib (TYKERB), an inhibitor of PKC-α, an inhibitor of Raf, an inhibitor of H-Ras, an inhibitor of EGFR, an inhibitor of VEGF-A, pharmaceutically acceptable salt, acid or derivative thereof, and combinations thereof. In some cases, the anti-cancer therapy is a stem-cell transplant therapy comprising a peripheral blood transplant, a bone marrow transplant, a cord blood transplant, or a skin-derived stem cell transplant. In some cases, the anti-cancer therapy is a targeted therapy. In some cases, the targeted therapy is an immuno-oncology therapy. In some cases, the immuno-oncology therapy comprises administration to the subject of at least one compound capable of recognizing a tumor-cell antigen and/or a cancer-cell antigen. In some cases, the at least one compound capable of recognizing a tumor-cell antigen and/or a cancer-cell antigen is an engineered protein, a fusion protein, an antibody, or a cytokine. In some cases, the tumor-cell antigen and/or a cancer-cell antigen is selected from the group consisting of: 2B4, 41BB, A2AR, ALK, a B-7 family ligand, BRAF, BTK, BTLA, CCR4, CD19, CD20, CD27, CD28, CD35, CD40, CD50, CD73, CD137, CD160/By55, CD172a/SIRPα, CD200, CD223, CD244, CEACAM, a CHK 1 kinase, a CHK2 kinase, cMET, CSF1R, CTLA-4, CXCR, DNMT, EGFr, GAL9, GITR, HDAC, HER-2, HVEM, ICOS, IDO, KIR, KRAS, LAG3, MEK, mTor, NKG2A, OX40, PARP, PD-1, PD-L1, PD-L2, STAT3, TGF-beta, TIGIT, TIM-3, TKI, a TLR (Toll like receptors), and combinations thereof. In some cases, the at least one compound is an antibody selected from the group consisting of: nivolumab, pembrolizumab, pidilizumab, RMP1-14, AGEN2034, cemiplimab, ipilimumab, 9D9, tremelimumab, AGEN1884, RG2077, and combinations thereof. In some cases, the immuno-oncology therapy is a cell-based immuno-oncology therapy. In some cases, the cell-based immuno-oncology therapy comprises adoptive cell transfer (ACT) to the subject. In some cases, the ACT is autologous or allogenic. In some cases, a cell used in the cell-based immuno-oncology therapy comprises a Chimeric Antigen Receptor (CAR) or an engineered T Cell Receptor (TCR). In some cases, a cell used in the immuno-oncology therapy is an antigen-presenting cell (APC) or a tumor infiltrating lymphocyte (TIL). In some cases, recognizing a tumor-cell antigen and/or a cancer-cell antigen inhibits downstream signaling of the tumor-cell antigen and/or cancer-cell antigen. In some cases, recognizing a tumor-cell antigen and/or a cancer-cell antigen enhances downstream signaling of the tumor-cell antigen and/or cancer-cell antigen. In some cases, targeted therapy comprises administration of a STING agonist. In some cases, the targeted therapy comprises administration of an interleukin. In some cases, the subject has a cancer. In some cases, the cancer is selected from the group consisting of: basal cell carcinoma, biliary tract cancer; bladder cancer; bone cancer; brain and central nervous system cancer; breast cancer; cancer of the peritoneum; cervical cancer; choriocarcinoma; colon and rectum cancer; connective tissue cancer; cancer of the digestive system; endometrial cancer; esophageal cancer; eye cancer; cancer of the head and neck; gastric cancer; glioblastoma; hepatic carcinoma; hepatoma; intra-epithelial neoplasm; kidney or renal cancer; larynx cancer; leukemia; liver cancer; lung cancer; melanoma; myeloma; neuroblastoma; oral cavity cancer; ovarian cancer; pancreatic cancer; prostate cancer; retinoblastoma; rhabdomyosarcoma; rectal cancer; cancer of the respiratory system; salivary gland carcinoma; sarcoma; skin cancer; squamous cell cancer; stomach cancer; testicular cancer; thyroid cancer; urothelial cancer; uterine or endometrial cancer; cancer of the urinary system; vulval cancer; lymphoma; Hodgkin's lymphoma; non-Hodgkin's lymphoma (NHL); B-cell lymphoma; small lymphocytic (SL) NHL; intermediate grade/follicular NHL; intermediate grade diffuse NHL; high grade immunoblastic NHL; high grade lymphoblastic NHL; high grade small non-cleaved cell NHL; bulky disease NHL; mantle cell lymphoma; AIDS-related lymphoma; Waldenstrom's Macroglobulinemia; chronic lymphocytic leukemia (CLL); acute lymphoblastic leukemia (ALL); Hairy cell leukemia; chronic myeloblastic leukemia; other carcinomas and sarcomas; and combinations thereof. In some cases, the cancer is bladder cancer, carcinoma of head and neck, colon and rectum cancer, kidney or renal cancer, melanoma, non-small cell lung cancer, triple-negative breast cancer, or urothelial cancer. In some cases, the cancer is classified as PDL-1+and/or CTLA4+. In some cases, the subject is refractory and/or non-responsive to the anti-cancer therapy. In some cases, the anti-cancer therapy is directed to a checkpoint molecule. In some cases, the anti-cancer therapy comprises administration of at least one of pembrolizumab, nivolumab, or ipilimumab. In some cases, the subject had not previously been diagnosed with the OTIC. In some cases, the OTIC is caused by the anti-cancer therapy. In some cases, the subject did not show symptoms of the OTIC immediately prior to administration of the anti-cancer therapy. In some cases, the subject showed symptoms of the OTIC immediately prior to administration of the anti-cancer therapy, and the OTIC is exacerbated by the anti-cancer therapy. In some cases, the subject is at risk of developing the OTIC. In some cases, the OTIC comprises bleeding in the subject. In some cases, the OTIC comprises gut dysmotility in the subject. In some cases, the subject experiences nausea, vomiting, bloating, and/or malnutrition. In some cases, the OTIC is a cancer-wasting/malnutrition syndrome. In some cases, the cancer-wasting/malnutrition syndrome is cachexia or sarcopenia. In some cases, the OTIC is a disorder related to the gut-brain axis. In some cases, the disorder related to the gut-brain axis is depression or anxiety. In some cases, the OTIC is an infection. In some cases, the infection is a viral infection. In some cases, the viral infection is due to a cancer-related virus. In some cases, the method further comprises administering the subject an antiviral compound. In some cases, the infection is a bacterial infection. In some cases, the bacterial infection is caused by an antibiotic-resistant bacteria selected from the group consisting of: Antibiotic-resistant Proteobacteria, Vancomycin ResistantEnterococcus(VRE), Carbapenem Resistant Enterobacteriaceae (CRE), fluoroquinolone-resistant Enterobacteriaceae, Extended Spectrum Beta-Lactamase producing Enterobacteriaceae (ESBL-E), and combinations thereof. In some cases, the OTIC is alopecia. In some cases, the anti-cancer therapy comprises administration of a chemotherapeutic agent. In some cases, the OTIC is a graft-versus-host disease (GVHD). In some cases, the anti-cancer therapy comprises a stem-cell transplant therapy or a cell-based immuno-oncology therapy. In some cases, the OTIC is selected from the group consisting of: a cardiovascular disease, a dermatologic disease, an autoimmune thyroid disease, hypothyroidism, hyperthyroidism, hypophysitis, thyroiditis, thyrotoxicosis, adrenal insufficiency, type 1 diabetes mellitus, an exocrine pancreas-related disease, inflammatory bowel disease, colitis, diarrhea, hepatitis, acute pancreatitis, a hematologic disease, fever, rigor, pruritus, hypotension, dyspnea, chest discomfort, rash, urticaria, angioedema, wheezing, tachycardia, anaphylaxis, a neurologic disease, an ophthalmologic disease, a pulmonary disease, pneumonitis, a renal disease, rheumatologic disease, a musculoskeletal disease, and combinations thereof. In some cases, the method further comprises administering to the subject a second dose of the anti-cancer therapy following the administering of the therapeutic composition. In some cases, the second dose of the anti-cancer therapy is at least as high as a first dose of the anti-cancer therapy administered prior to the administering of the therapeutic composition. In some cases, the second dose of the anti-cancer therapy is higher than a first dose of the anti-cancer therapy administered prior to the administering of the therapeutic composition. In some cases, an interval between administration of the first dose and second doses is reduced compared to an interval between consecutive doses of the anti-cancer therapy in a second subject not administered the therapeutic composition. In some cases, the therapeutic composition combines with the anti-cancer therapy to treat a cancer of the subject. In another aspect, the present disclosure provides a method for increasing the efficacy of an anti-cancer therapy, comprising administering to a subject a therapeutic composition comprising a microbial composition; wherein the subject is treated with the anti-cancer therapy; and wherein the microbial composition comprises a fecal microbiota of a human donor. In some cases, administering the therapeutic composition maintains or induces responsiveness of a tumor of the subject to the anti-cancer therapy. In some cases, administering the therapeutic composition increases the number or activity of a cell type of the immune system. In some cases, the cell type is selected from the group consisting of: T cells, B cells, dendritic cells, macrophages, neutrophils, NK cells, and combinations thereof. In some cases, administering the therapeutic composition shifts a ratio of immune cells in the subject in favor of a cell type capable of suppressing growth of a tumor. In some cases, the cell type capable of suppressing growth of a tumor is selected from the group consisting of: T cells, cytotoxic T lymphocytes, T helper cells, natural killer (NK) cells, natural killer T (NKT) cells, anti-tumor macrophages, B cells, dendritic cells, and combinations thereof. In some cases, administering the therapeutic composition shifts a ratio of immune cells in the subject against a cell type capable of protecting a tumor. In some cases, the cell type capable of protecting a tumor is selected from the group consisting of: myeloid-derived suppressor cells (MDSCs), regulatory T cells (Tregs), tumor associated neutrophils (TANs), M2 macrophages, tumor associated macrophages (TAMs), and a combination thereof. In some cases, the anti-cancer therapy comprises an immuno-oncology therapy. In some cases, the immuno-oncology therapy comprises administration to the subject of at least one compound capable of recognizing a tumor-cell antigen and/or a cancer-cell antigen. In some cases, the at least one compound capable of recognizing a tumor-cell antigen and/or a cancer-cell antigen is an engineered protein, a fusion protein, an antibody, or a cytokine. In some cases, the tumor-cell antigen and/or a cancer-cell antigen is selected from the group consisting of: 2B4, 41BB, A2AR, ALK, a B-7 family ligand, BRAF, BTK, BTLA, CCR4, CD19, CD20, CD27, CD28, CD35, CD40, CD50, CD73, CD 137, CD160/By55, CD172a/SIRPα, CD200, CD223, CD244, CEACAM, a CHK 1 kinase, a CHK2 kinase, cMET, CSF1R, CTLA-4, CXCR, DNMT, EGFr, GAL9, GITR, HDAC, HER-2, HVEM, ICOS, IDO, KIR, KRAS, LAG3, MEK, mTor, NKG2A, OX40, PARP, PD-1, PD-L1, PD-L2, STAT3, TGF-beta, TIGIT, TIM-3, TKI, a TLR (Toll like receptors), and combinations thereof. In some cases, the at least one compound is an antibody selected from the group consisting of: nivolumab, pembrolizumab, pidilizumab, RMP1-14, AGEN2034, cemiplimab, ipilimumab, 9D9, tremelimumab, AGEN1884, RG2077, and combinations thereof. In some cases, the immuno-oncology therapy is a cell-based immuno-oncology therapy. In some cases, the cell-based immuno-oncology therapy comprises adoptive cell transfer (ACT) to the subject. In some cases, the ACT is autologous or allogenic. In some cases, a cell used in the cell-based immuno-oncology therapy comprises a Chimeric Antigen Receptor (CAR) or an engineered T Cell Receptor (TCR). In some cases, a cell used in the immuno-oncology therapy is an antigen-presenting cell (APC) or a tumor infiltrating lymphocyte (TIL). In some cases, recognizing a tumor-cell antigen and/or a cancer-cell antigen inhibits downstream signaling of the tumor-cell antigen and/or cancer-cell antigen. In some cases, recognizing a tumor-cell antigen and/or a cancer-cell antigen enhances downstream signaling of the tumor-cell antigen and/or cancer-cell antigen. In some cases, treatment with the anti-cancer therapy comprises administration of multiple doses of the anti-cancer therapy to the subject. In some cases, the method further comprises administering to the subject a first and second dose of the anti-cancer therapy. In some cases, the first dose of the anti-cancer therapy is administered to the subject prior to administering the therapeutic composition. In some cases, the second dose of the anti-cancer therapy is administered to the subject after administering the therapeutic composition. In some cases, second dose is at least as high as the first dose. In some cases, the second dose is higher than the first dose. In some cases, an interval between administration of the first and second dose is reduced compared to an interval between consecutive doses of the anti-cancer therapy in a second subject not administered the therapeutic composition. In some cases, the subject is administered the therapeutic composition after treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 1 day after treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 3 days after treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 5 days after treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 1 week after treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 4 weeks after treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 8 weeks after treatment with the anti-cancer therapy. In some cases, the subject is administered the therapeutic composition before treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 1 day before treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 3 days before treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 5 days before treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 1 week before treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 4 weeks before treatment with the anti-cancer therapy. In some cases, the therapeutic composition is administered at least 8 weeks before treatment with the anti-cancer therapy. In some cases, the subject is administered the therapeutic composition concurrently with the anti-cancer therapy. In some cases, the subject has a cancer. In some cases, the cancer is selected from the group consisting of: basal cell carcinoma, biliary tract cancer; bladder cancer; bone cancer; brain and central nervous system cancer; breast cancer; cancer of the peritoneum; cervical cancer; choriocarcinoma; colon and rectum cancer; connective tissue cancer; cancer of the digestive system; endometrial cancer; esophageal cancer; eye cancer; cancer of the head and neck; gastric cancer; glioblastoma; hepatic carcinoma; hepatoma; intra-epithelial neoplasm; kidney or renal cancer; larynx cancer; leukemia; liver cancer; lung cancer; melanoma; myeloma; neuroblastoma; oral cavity cancer; ovarian cancer; pancreatic cancer; prostate cancer; retinoblastoma; rhabdomyosarcoma; rectal cancer; cancer of the respiratory system; salivary gland carcinoma; sarcoma; skin cancer; squamous cell cancer; stomach cancer; testicular cancer; thyroid cancer; urothelial cancer; uterine or endometrial cancer; cancer of the urinary system; vulval cancer; lymphoma; Hodgkin's lymphoma; non-Hodgkin's lymphoma (NHL); B-cell lymphoma; small lymphocytic (SL) NHL; intermediate grade/follicular NHL; intermediate grade diffuse NHL; high grade immunoblastic NHL; high grade lymphoblastic NHL; high grade small non-cleaved cell NHL; bulky disease NHL; mantle cell lymphoma; AIDS-related lymphoma; Waldenstrom's Macroglobulinemia; chronic lymphocytic leukemia (CLL); acute lymphoblastic leukemia (ALL); Hairy cell leukemia; chronic myeloblastic leukemia; other carcinomas and sarcomas; and combinations thereof. In some cases, the cancer is bladder cancer, carcinoma of head and neck, colon and rectum cancer, kidney or renal cancer, melanoma, non-small cell lung cancer, triple-negative breast cancer, or urothelial cancer. In some cases, the cancer is classified as PDL-1+ and/or CTLA4′. In some cases, the subject is refractory and/or non-responsive to the anti-cancer therapy. In some cases, administering the therapeutic composition results in treatment or inhibition of an oncology treatment-induced condition (OTIC). In some cases, the fecal microbiota is obtained from a stool sample of the human donor. In some cases, the fecal microbiota is from a single human donor. In some cases, the microbial composition comprises fecal microbiota from multiple human donors. In some cases, the fecal microbiota is a substantially complete fecal microbiota. In some cases, the microbial composition is substantially devoid of fiber. In some cases, the microbial composition further comprises at least one cultured bacterial strain. In some cases, the human donor has recovered from a cancer, in remission from a cancer, and/or previously responded to an anti-cancer therapy. In some cases, the human donor is the subject, and the fecal microbiota is obtained from the subject prior to treatment with the anti-cancer therapy. In some cases, the subject does not show symptoms of a cancer when the fecal microbiota is obtained. In some cases, the human donor is a healthy human donor. In some cases, the microbial composition comprises lyophilized bacteria. In some cases, the therapeutic composition further comprises a pharmaceutically-acceptable binder, disintegrant, filler, and/or preservative. In some cases, the therapeutic composition is formulated for enteric delivery of the microbial composition. In some cases, the therapeutic composition is administered orally. In some cases, the therapeutic composition comprises a capsule encapsulating the microbial composition. In some cases, the capsule comprises an exterior enteric coating that releases the microbial composition in the ileum or the colon of the subject. In some cases, the capsule releases the microbial composition in the ileum of the subject. In some cases, the exterior enteric coating comprises a compound selected from the group consisting of: methacrylic acid copolymer, cellulose acetate phthalate (CAP), hydroxypropylmethyl cellulose phthalate, polyvinyl acetate phthalate, carboxymethylethylcellulose, and EUDRAGIT®-type polymer (poly(methacrylic acid, methylmethacrylate), hydroxypropyl methylcellulose acetate succinate, cellulose acetate trimellitate, hypromellose (INN) hydroxypropyl methylcellulose (HPMC), shellac, and combinations thereof. In some cases, the subject is administered an antibiotic and/or a prebiotic prior to administration of the therapeutic composition. Additional aspects and advantages of the present disclosure will become readily apparent to those skilled in this art from the following detailed description, wherein only illustrative embodiments of the present disclosure are shown and described. As will be understood, the present disclosure is capable of other and different embodiments, and its several details are capable of modifications in various obvious respects, all without departing from the scope of the disclosure. Accordingly, the description is to be regarded as illustrative in nature, and not as restrictive.

11273025

TECHNICAL FIELD The present disclosure relates to a delivery device for an expandable implant, in particular but not exclusively, the expandable implant may be located within the prostatic urethra of a patient to treat benign prostatic hyperplasia. Aspects of the invention relate to a delivery device for locating an expandable implant for treating benign prostatic hyperplasia within the prostatic urethra and to a method of delivering an expandable implant. BACKGROUND Benign prostatic hyperplasia (BPH) is a noncancerous disease that results in an enlargement of the prostate. As the prostate expands it may press against and place pressure on the urethra and bladder neck thereby making it difficult to pass urine out of the bladder. It is known to treat BPH in a variety of manners including through the use of medication or surgery in particularly bad cases. However, both of these approaches are undesirable. For example, in the US alone more than $5 billion is spent annually on medication to manage BPH. Furthermore, surgical solutions can be particularly invasive and uncomfortable for the patient. As such, there is a move in the industry towards the use of expandable implants that may be inserted within the urethra to alleviate the pressure applied to the urethra and bladder neck by the enlarged prostate. Expandable implants provide a minimally invasive and low cost solution for treating BPH. However, locating the expandable implant in the correct position within the urethra is challenging for a clinician. Furthermore, if the expander is deployed incorrectly it may be challenging and invasive to recover the deployed expander from the patient's body. An example of an expandable implant for treating BPH is described in WO 2017/081326. The expandable implant described in WO 2017/081326 should be positioned within the prostatic urethra between the bladder neck and external sphincter of a patient such that the expandable implant provides a radially outward force on the prostatic urethra to alleviate the symptoms of BPH. Positioning the expander accurately within the prostatic urethra is challenging for a clinician as the expander must be positioned accurately both in a longitudinal direction within the prostatic urethra and also circumferentially. For example, the expandable implant should be positioned longitudinally between the bladder neck and the external sphincter and also orientated such that the expander correctly engages the three lobes of the prostate. If the expander is deployed in an incorrect position or deployed accidently then a complex procedure may be required to remove or reposition the expander within the prostatic urethra. As such, there is a need to provide a minimally invasive delivery device that allows a clinician to accurately position and deploy the expandable implant within the prostatic urethra. WO 2017/081326 describes a delivery device for delivering an expander to a target site within a body lumen. The delivery device comprises an ejection element with a triangular cross-section configured to engage the expandable implant. The delivery device may be inserted into the urethra through the penis and advanced along the urethra to the target site. When the clinician is satisfied that the expander is in the correct position the ejection element is advanced distally and the expander is ejected from the delivery device. The problem with this delivery device is that the expander is not reliably and accurately positioned within the prostatic urethra of the patient. For example, advancing the ejection element causes the expander to spring or jump forward upon deployment thereby making it challenging to accurately position the expander both longitudinally and circumferentially within the prostatic urethra. This system relies on the expander to expand and self-locate relative to the anatomy which can be unreliable and unpredictable. Furthermore, deployment of the expander from the delivery device is achieved by actuating the handle in a single step thereby making the delivery device susceptible to accidental deployment and does not allow the clinician to reverse deployment of the expander if the clinician decides that the expander is not positioned accurately within the target site. It is an aim of the present invention to address one or more of the disadvantages associated with the prior art. SUMMARY OF THE INVENTION In general terms there is provided a delivery device for locating an expandable implant for treating BPH within the prostatic urethra of a patient, the delivery device comprising: an inner tube; and an outer sleeve moveable relative to the inner tube between a stored position and a deployed position; wherein the outer sleeve surrounds the inner tube to define an annulus therebetween and wherein the expandable implant is retained within the annulus when the outer sleeve is in the stored position. The outer sleeve may be moveable between a stored position and a deployed position. The stored position is a position in which the outer sleeve at least partially surrounds the expandable implant such that the implant is retained on the inner tube. When in the stored position the outer sleeve prevents the expandable implant expanding radially. The deployed position is a position in which the expander is uncovered by the outer sleeve such that the outer sleeve may expand radially. According to an aspect of the present invention there is provided a delivery device for locating an expandable implant for treating BPH within the prostatic urethra of a patient, the delivery device comprising: a first elongate element; and a second elongate element surrounding the first elongate element to define an annulus therebetween; wherein the second elongate element is retractable relative to the first elongate element, between: a stored position in which the second elongate element is configured to surround the implant thereby retaining the implant within the annulus; a partially-deployed position in which the second elongate element is configured to partially uncover the implant; and a fully-deployed position in which the second elongate element is configured to uncover the implant to an extent sufficient to allow the implant to expand radially within the prostatic urethra. The first elongate element may be, for example, an inner tube or rod and the second elongate element may be an outer sleeve. The first and second elongate elements may be elliptical and preferably cylindrical. The delivery device beneficially provides a device for accurately positioning and deploying an expandable implant for treating BPH within the prostatic urethra of the patient. The outer sleeve may retain the expandable implant or expander within the annulus by surrounding the expander and preventing radial expansion of the expander until the expander is correctly located within the prostatic urethra. The skilled reader will appreciate that whilst the expandable implant described above is for use in treating BPH the delivery system may be used in other applications in which an expandable implant is to be located within a body lumen. In an embodiment, when in the partially deployed position a distal tip of the second elongate element may be positioned proximally of a distal tip of the first elongate element. The partially deployed position beneficially uncovers a portion of the expander whilst retaining the expander in a compressed or stored configuration on the inner tube. This allows a clinician to view the expander relative to the anatomy thereby making it easier for a clinician to align the expander relative to the anatomy. Furthermore, moving the outer sleeve from the partially deployed position to the fully deployed position is a smaller longitudinal movement than from the stored to the fully deployed position which improves the accuracy of deployment of the expandable implant. In one embodiment the delivery device may comprise a third elongate element located between the first elongate element and the second elongate element. The third elongate element may an intermediate tube or a steering tube. In another embodiment the delivery device may comprise a retention feature for inhibiting movement of the expandable implant. The retention feature advantageously retains the expandable implant relative to the inner tube or the steering tube within the annulus. This is beneficial as it prevents longitudinal or angular movement of the expandable implant relative to the inner tube or steering tube prior to deployment of the expander. In an embodiment the retention feature may be located within the annulus. In one embodiment the outer sleeve may surround the retention feature when in the partially deployed position or in the stored position. This is beneficial as the outer sleeve prevents radial expansion of the expandable implant prior to full deployment of the expandable implant. Furthermore, the outer sleeve may be returned from the partially deployed position to the stored position if the clinician wants to abort the deployment of the expandable implant. In an embodiment the retention feature may comprise a protrusion on the inner tube. In another embodiment the retention feature may comprise a proximal protrusion and a distal protrusion located on the inner tube. The inner tube may comprise two, three or more sets of retention features configured to engage and retain the expandable implant. In another embodiment the protrusions may be located on or extending distally from the steering tube. The protrusions may be orientated on the inner tube or steering tube such that the expandable implant is orientated substantially correctly when the delivery device is inserted into the urethra. In another embodiment a slot for at least partially receiving the expandable implant may be defined between the distal protrusion and the proximal protrusion. The expandable implant may be received within the slot. The expandable implant may comprise an apex and the protrusion may be located between opposing sides of the apex when the expandable implant is located on the inner tube. In one embodiment a gap may be defined between a top or radially outer surface of the retention feature and an inner or radially inner surface of the outer sleeve when the outer sleeve is in the stored position or in the partially-deployed position, which gap is narrower than a radial thickness of a part of the implant to be engaged by the retention feature. In an embodiment the delivery device may comprise the expander and the implant or expander may comprise a wire retained by the retention feature and the gap may be less than the diameter of the wire. The gap beneficially provides clearance between the retention feature and the outer sleeve to allow the outer sleeve to move freely relative to the inner tube. Furthermore, the gap may allow fluids to flow along the annulus if the annulus forms part of an irrigation channel. In another embodiment the delivery device may comprise a handle connected to a proximal end of the inner tube and/or outer sleeve. The handle advantageously allows the delivery device to be held and gripped by a clinician. Furthermore, the handle may be operable to move the outer sleeve between a stored position, a fully deployed position and a partially deployed position. In an embodiment the handle may comprise a proximal grip and a distal grip. The handle may comprise a lever moveable between a locked position and an unlocked position. When the lever is in the locked position the outer sleeve is locked in the stored position. The lever may comprise an intermediate position and when the lever is in the intermediate position the outer sleeve is moveable from the stored position to the partially deployed position. The lever may comprise a fully deployed position. When the lever is in the fully deployed position the outer sleeve is moveable between the partially deployed position and the fully deployed position. In one embodiment the inner tube may comprise a distal end and the distal end of the inner tube may be located distally of a distal end of the expandable implant when the expandable implant is retained within the annulus, in use. In another embodiment the inner tube may comprise a distal end and the distal end may be located proximally of a distal end of the expandable implant and distally of a proximal end of the expandable implant when the expandable implant is retained within the annulus, in use. Beneficially, the inner tube provides support to the expandable implant when the expandable implant is retained on the inner tube such that the longitudinal struts of the expandable implant are maintained in a generally parallel orientation relative to each other when the implant is in the stored configuration. This advantageously promotes radial expansion of the implant during deployment and further reduces the possibility of the expandable implant becoming dislodged from the retention feature. Furthermore, the inner tube supports the expander when the delivery tube is being inserted into, and along, the urethra. This beneficially prevents the expander being compressed further by the urethra as this may cause the expander to disengage the retention features. In an embodiment the inner tube may comprise an inner lumen. The inner lumen may run along the length of the inner tube. Furthermore, the inner lumen may act as an irrigation channel for clearing the field of view and draining fluids from the bladder and or urethra. In one embodiment the delivery device may comprise an imaging device at least partially received within the inner lumen. In an embodiment the inner tube may be an imaging device. The imaging device may comprise an imaging chip or the imaging device may be a telescope. The imaging chip may be connected to an image display device and the wires connecting the imaging device to the image display device and power module may run through the inner lumen. The field of view of the imaging device may include at least a portion of the expander when the expander is in the stored configuration on the inner tube. This is beneficial as the imaging device may generate images of the expander relative to the anatomy of the patient. This allows the clinician to accurately locate and position the expandable implant relative to the anatomy by using the images from the imaging device. In an embodiment the imaging device may be moveable relative to the inner tube and may be fixed relative to the outer sleeve. As such, the imaging device may be moved relative to the inner tube when the outer sleeve is moved between the stored, partially deployed and fully deployed positions. In another embodiment the inner tube, optionally the imaging device, is moveable longitudinally relative to the steering tube between a distally advanced position and a proximally retracted position. A distal tip of the inner tube may be positioned distally with respect to the distal tip of the outer sleeve when the inner tube is in the distally advanced position. The outer sleeve may be outside a field of view of the imaging device when the first elongate element is in the distally advanced position. The imaging device may be configured such that its field of view captures at least a distal portion of the implant when the inner tube is in the proximally retracted position. In an embodiment the outer sleeve may comprise graduation marks spaced at intervals. The graduation marks beneficially provide a visual aid to the clinician when positioning the expander10in the desired longitudinal position. The graduation marks may be on the inner tube if the outer sleeve is transparent such that the graduation marks are visible to the clinician. In an embodiment the delivery device may comprise an expandable implant. The expandable implant may be supported by the first elongate element and at least partially covered by the second elongate element. A method of deploying an expandable implant within a patient's urethra, the method comprising: inserting a delivery tube into the urethra with the implant retained within and covered by the delivery tube; retracting the delivery tube proximally, relative to the implant, to a partially-retracted position in which the implant is at least partially uncovered while still being retained by the delivery tube; positioning the implant at a target site within the urethra; and deploying the implant at the target site by further retracting the delivery tube to an extent sufficient to release the implant from the delivery tube. Deploying the expander in a two-stage deployment process beneficially reduces the likelihood of the clinician deploying the expandable implant incorrectly. Furthermore, the partially deployed position allows the expandable implant to be aligned with the anatomy when it is partially uncovered. Inserting the delivery tube when the implant is covered by the outer sleeve is beneficial as it allows the delivery device to be easily inserted into the urethra without the expandable implant potentially catching on the anatomy. In one embodiment the method may comprise positioning the implant at the target site at a longitudinal position in the urethra between the patient's bladder neck and external sphincter. The method may comprise advancing a distal end of the delivery tube distally along the urethra to, or distally beyond, the bladder neck. This is beneficial as the anatomy along the length of the urethra may be viewed as the delivery device is advanced along the urethra. This allows the clinician to check for any obstructions within the urethra and to view the prostatic lobes. In an embodiment the method may comprise pulling the distal end of the delivery tube back from the bladder neck in a proximal direction. The bladder neck may be used as a datum for positioning the expandable implant in the longitudinal position. The delivery device may be advanced into the bladder. The delivery tube may comprise of graduation marks with which to position the expandable implant in a clinically acceptable position from the bladder neck datum prior to deployment. In another embodiment positioning the expandable implant comprises rotating the implant about a longitudinal axis of the delivery tube when positioning the implant at the target site. The implant may be rotated to align the implant with at least one prostatic lobe of the patient. In an embodiment the implant may comprise at least one apex and the implant may be rotated to align the at least one apex with the prostatic lobe. The expander may be secured relative to the delivery device such that rotating the delivery device rotates the expander. The method may comprise aligning at least one apex of the implant with the or each prostatic lobe. In one embodiment the delivery tube may comprise an inner tube and the inner tube is static relative to the urethra when the delivery tube is moved from the partially deployed configuration to the fully deployed configuration. The method may comprise holding the implant substantially stationary relative to the urethra when further retracting the delivery tube from the partially deployed to the fully deployed position. This is beneficial as the expandable implant may be secured to the inner tube when in the partially deployed configuration and thus the expander may remain in a substantially unchanged longitudinal position when the delivery device is moved to the fully deployed configuration. This is beneficial as it improves the accuracy of the deployment of the expandable implant from the stored position to the deployed position within the prostatic urethra. In one embodiment deploying the expandable implant may comprise expanding the implant radially. The expandable implant may be expanded radially from stored or compressed position to an expanded position. The expandable implant may be deployed by moving an outer sleeve longitudinally relative to the expandable implant. The expandable implant may be unsheathed or uncovered to allow the expandable implant to expand radially. In another embodiment moving the delivery tube to the partially deployed configuration may comprise operating a safety catch to enable the delivery tube to be moved or reconfigured. The method may further comprise moving the safety catch to a further position to enable the delivery tube to be further retracted from the partially-retracted position. In one embodiment the method may comprise retaining the implant by engagement with retaining formations that remain covered by the delivery tube in the partially-retracted position but that are exposed by said further retraction of the delivery tube to release the implant. The method may comprise advancing the delivery tube distally to cover the retaining formations before removing the delivery tube from the urethra. The method may comprise viewing the implant relative to the urethra from a viewpoint within the implant and disposed proximally relative to a distal end of the implant, when the delivery tube in the partially-retracted position. In an embodiment the method may comprise aligning at least one apex of the implant with the patient's verumontanum. The method may comprise locating the verumontanum between laterally-spaced longitudinally extending members of the implant. The method may comprise pulling back the implant proximally while avoiding contact of the apex with the verumontanum. The method may further comprise steering the delivery tube by bending at least a distal portion of the delivery tube along its length. In an embodiment the method may comprise moving the delivery tube from the fully deployed configuration to the stored configuration prior to removing the delivery tube from the urethra. In an embodiment the method may comprise viewing the expander relative to the urethra. Alternatively presented, the invention is a delivery device for locating an expandable implant within the prostatic urethra of a patient for treating BPH, the delivery device comprising: a first elongate element; and a second elongate element surrounding the first elongate element to define an annulus therebetween; wherein the second elongate element is retractable relative to the first elongate element, between: a stored position in which the second elongate element is configured to surround the implant thereby retaining the implant within the annulus; a partial-deployment position in which the second elongate element is configured to partially uncover the implant; and a full-deployment position in which the second elongate element is configured to uncover the implant to an extent sufficient to release the implant for radial expansion within the prostatic urethra. Furthermore, wherein when in the partially deployed position a distal tip of the second elongate element is positioned proximally relative to a distal tip of the first elongate element; further comprising a third elongate element disposed between the first elongate element and the second elongate element; further comprising at least one retention feature for inhibiting movement of the implant; wherein the retention feature is located within the annulus; wherein the retention feature comprises at least one protrusion; wherein the retention feature comprises a proximal protrusion and a distal protrusion; wherein a slot for at least partially receiving the expandable implant is defined between the distal protrusion and the proximal protrusion; wherein the second elongate element surrounds the retention feature when in the partial-deployment position and in the stored position; wherein a gap is defined between a radially outer surface of the retention feature and a radially inner surface of the second elongate element when the second elongate element is in the stored position and in the partial-deployment position, which gap is narrower than a radial thickness of a part of the implant to be engaged by the retention feature; wherein the retention feature is located on the first elongate element; wherein the retention feature is located on the third elongate element; wherein the first elongate element comprises a groove for at least partially receiving the retention feature; further comprising a handle connected to a proximal end of the first elongate element and/or the second elongate element; wherein the handle comprises a proximal grip and a distal grip; wherein the handle is operable to move the second elongate element between the stored position, the partial-deployment position and the full-deployment position; wherein the handle comprises a lever moveable between a locked position and an unlocked position, the second elongate element being locked in the stored position when the lever is in the locked position; wherein the second elongate element is moveable from the stored position to the partial-deployment position when the lever is in an intermediate position; wherein a distal end of the first elongate element is configured to be located distally of a distal end of the implant when the implant is retained within the annulus, in use; wherein the first elongate element comprises an imaging device; wherein the first elongate element comprises an inner lumen and wherein a telescope is at least partially received within the inner lumen; wherein the telescope is moveable relative to the first elongate element and is fixed relative to the second elongate element to be moved relative to the first elongate element when the second elongate element is moved between the stored, partial-deployment and full-deployment positions; wherein the first elongate element is moveable longitudinally relative to the third elongate element between a distally advanced position and a proximally retracted position; wherein a distal tip of the first elongate element is positioned distally with respect to the distal tip of the second elongate element when the first elongate element is in the distally advanced position; wherein the second elongate element is outside a field of view of the imaging device when the first elongate element is in the distally advanced position; wherein the imaging device is configured such that its field of view captures at least a distal portion of the implant when the first elongate element is in the proximally retracted position; wherein the first elongate element is an inner rod and the second elongate element is an outer sleeve; wherein the third elongate element comprises a steering tube; and/or in combination with an expandable implant that is supported by the first elongate element and is at least partially covered by the second elongate element.

11491962

This application is a 35 U.S.C. § 371 National Stage Application of PCT/EP2018/083910, filed on Dec. 7, 2018, which claims the benefit of priority to Serial No. DE 10 2017 223 498.9, filed on Dec. 21, 2017 in Germany, the disclosures of which are incorporated herein by reference in their entirety. The disclosure proceeds from a hydraulic brake system for a vehicle and a corresponding operating method for a brake system of this type. BACKGROUND Hydraulic brake systems for vehicles with a brake master cylinder, a hydraulic unit and a plurality of wheel brakes are known from the prior art, which hydraulic brake systems comprises various safety systems, such as an anti-lock brake system (ABS), electronic stability program (ESP), etc., and can carry out various safety functions, such as an anti-lock braking function, a traction control function (ASR), etc. Via the hydraulic unit, control and/or regulating operations can be carried out in the anti-lock brake system (ABS) or in the traction control system (ASR system) or in the electronic stability program system (ESP system) for the build-up and dissipation of pressure in the corresponding wheel brakes. In order to carry out the control and/or regulating operations, the hydraulic unit comprises solenoid valves which are usually held in distinct positions on account of the forces of “magnetic force”, “spring force” and “hydraulic force” which act in opposite directions. Accordingly, there are the valve types of “normally open” and “normally closed”. In addition, bistable solenoid valves are known which change their state in the case of every energization and remain in said state even without a holding current until the next energization. SUMMARY The hydraulic brake system for a vehicle with the features disclosed herein and the corresponding operating method for a hydraulic brake system disclosed herein have the advantage that a bistable solenoid valve which changes between the stable states of “open” and “closed” in the case of energization is used, in order to shut in or enclose a current brake pressure in an associated wheel brake. Since the volume of a corresponding brake fluid is greatly temperature-dependent, great pressure fluctuations of the brake pressure which is enclosed in the corresponding wheel brake can occur as a result of temperature changes. In embodiments of the disclosure, pressure changes of the brake pressure which is enclosed in a wheel brake which can be produced, for example, as a result of temperature changes of this type can be equalized in an advantageous way. Embodiments of the present disclosure provide a hydraulic brake system for a vehicle, with a brake master cylinder, a hydraulic unit and a plurality of wheel brakes, the hydraulic unit comprising at least one brake circuit for brake pressure modulation in the wheel brakes. Here, at least one wheel brake is assigned a bistable solenoid valve which is looped into the corresponding fluid duct directly upstream of the associated wheel brake and, in a currentless open position, enables the brake pressure modulation in the associated wheel brake and, in a currentless closed position, encloses a current brake pressure in the associated wheel brake. In addition, a hydraulic force which is brought about by way of the enclosed brake pressure has a seat-opening effect in the corresponding bistable solenoid valve. In addition, an operating method is proposed for a hydraulic brake system of this type which, in the case of a pressure holding function, switches the bistable solenoid valve which is assigned to the at least one wheel brake into the currentless closed position and encloses a current brake pressure in the associated wheel brake, a hydraulic force which is brought about by way of the enclosed brake pressure having a seat-opening effect in the corresponding bistable solenoid valve. By way of the bistable solenoid valve, an additional function can be realized with low additional complexity on a usually present hydraulic unit with an ESP functionality, which additional function can enclose a current brake pressure in the corresponding wheel brake electrohydraulically and can hold it over a relatively long time period with a relatively low energy requirement. This means that the existing pressure supply, the pipelines from the hydraulic unit as far as the wheel brakes, and sensor and communications signals can be used not only for the ESP function and/or ABS function and/or ASR function, but rather also for an electrohydraulic pressure holding function in the wheel brakes. As a result, costs, installation space, weight and wiring can be saved in an advantageous way, with the positive effect that the complexity of the brake system is reduced. As a result of the indicated connection of the solenoid valve, the pressure which is shut in the wheel brake has a seat-opening effect. This means that the hydraulic force which is produced by virtue of the fact that the enclosed pressure acts on the projected area of the sealing diameter presses the sealing element out of its sealing seat counter to a counterforce. Therefore, the hydraulic force assists a magnetic force which is generated by a magnet assembly during opening of the bistable solenoid valve. Therefore, in the case of embodiments of the disclosure in contrast to a connection of the bistable solenoid valve, in the case of which connection the pressure which is shut in the wheel brake has a seat-closing effect, no counterpressure has to be generated via a fluid pump, in order thus to produce a pressure equalization when the bistable solenoid valve is to be opened. Since the bistable solenoid valve is looped into the corresponding fluid duct directly upstream of the associated wheel brake, the possible leakage points can be reduced in an advantageous way. Advantageous improvements of the hydraulic brake system for a vehicle and the operating method for a hydraulic brake system are possible as a result of the measures and developments described herein. It is particularly advantageous that the bistable solenoid valve can have a positive pressure function which opens the bistable solenoid valve in the currentless closed position and brings about a pressure equalization if the brake pressure which is enclosed in the corresponding wheel brake exceeds a predefined first threshold value. If the enclosed brake pressure rises on account of the temperature change, the positive pressure escapes if the predefined first threshold value of, for example, 90 bar is reached. Therefore, the system is protected against destruction as a result of positive pressure without expensive additional measures. Since the hydraulic force no longer has a seat-closing effect, but rather a seat-opening effect, a counterpressure does not first of all have to be generated by way of the fluid pump in order to open the bistable solenoid valve. In one advantageous refinement of the hydraulic brake system, in the currentless closed position of the bistable solenoid valve, a predefinable spring force acts in a seat-closing manner counter to the hydraulic force. As a result, the first threshold value of the positive pressure function for the enclosed brake pressure can be set simply via the predefinable spring force. In addition, a decreasing brake pressure which is caused, for example, by way of leakage or temperature decrease, brings about an increase in the excess force of the spring force with a closing effect with regard to the hydraulic force which decreases with the brake pressure. In a further advantageous refinement of the hydraulic brake system, the bistable solenoid valve can have a negative pressure function which can open the bistable solenoid valve in the currentless closed position, and can bring about a pressure build-up in the corresponding wheel brake via a fluid pump if the brake pressure which is enclosed in the corresponding wheel brake undershoots a predefined second threshold value. This means that the brake pressure in the corresponding wheel brake is increased again if the enclosed brake pressure undershoots the second threshold value by, for example, 30 bar. In a further advantageous refinement of the hydraulic operating method, in the currentless closed position, the bistable solenoid valve (10) can be opened in order to implement a positive pressure function and a pressure equalization can be brought about if the brake pressure which is enclosed in the corresponding wheel brake exceeds a predefined first threshold value. The first threshold value can correspond to a maximum permitted enclosed brake pressure in the corresponding wheel brake. Here, the first threshold value can be set via the predefined seat-closing spring force which acts counter to the hydraulic force and corresponds to a hydraulic force which acts in the case of the maximum permitted enclosed brake pressure which is calculated from the enclosed brake pressure and a sealing diameter of a corresponding valve seat of the bistable solenoid valve. This means that a compression spring of the bistable solenoid valve which acts in the closing direction is selected in such a way that the spring properties of the compression spring provide the desired spring force. In a further advantageous refinement of the operating method, the brake pressure which is enclosed in the wheel brake can be measured. As a result, a fluid pump can be activated and the bistable solenoid valve can be opened, in order to carry out a negative pressure function and to build up brake pressure in the corresponding wheel brake if the brake pressure which is enclosed in the wheel brake falls below a predefined second threshold value. One exemplary embodiment of the disclosure is shown in the drawing and will be described in greater detail in the following description. In the drawing, identical designations denote components or elements which carry out identical or analogous functions.