Datasets:

xNoper

/

pubmed-test-memsum-20sent

like 0

[ [ ", the association between malaria and intestinal helminth coinfection in pregnancy and stillbirth has not been studied .", "few studies have studied the association between malaria and helminths in pregnancy , with conflicting results .", "given that 98% of stillbirths occur in developing countries , especially sub - saharan africa , which also has a high burden of malaria and intestinal helminth infections , it is important to investigate the role of these infections in contributing to stillbirth .", "even though stillbirths represent a large proportion of perinatal deaths , causes of stillbirths are poorly understood in ghana . to our knowledge", "stillbirth accounts for more than half of perinatal mortality in developing countries . in sub - saharan africa ," ], [ "determination of malaria antigen in plasma was done using the malaria antigen celisa ( cellabs , brookvale , australia ) .", ". an intrauterine death of a fetus during labor or delivery was considered a fresh stillbirth , and an intrauterine death of a fetus sometime before the onset of labor , where the fetus showed degenerative changes was considered a macerated stillbirth .", "induced abortion : the purposeful interruption of an intrauterine pregnancy with the intention other than to produce a live - born infant , and which does not result in a live birth . " ], [ "variables that were significant ( p < .05 ) on bivariate analysis and those that are known to be associated with stillbirth based on previous studies were entered into a regression model . through this procedure , we calculated odds ratios ( or ) and 95% confidence intervals ( ci ) .", "correlation analyses were performed to identify potential multicollinearity between independent variables . to determine factors associated with stillbirth , we used multiple logistic regression .", "differences in socio - demographic and obstetric characteristics by stillbirth were assessed by chi - square or t - test ." ], [ ". a higher proportion of women who were single did not receive sp during pregnancy , had fewer than 5 anc visits , had low folate levels , were anemic , had had a prior induced abortion or a prior stillbirth and delivered a stillborn infant compared to their counterparts ( table 1 ) . of the 746 women , 407 ( 54.6% ) had neither infection , 147 ( 19.7% )", "overall , the mean age of the women was 26.8 years ( range : 15 to 48 years ) ; 21.1% were single , 30.2% were primigravidae , 30.6% were anemic , 29.5% had a prior induced abortion , and 5.2% had a history of stillbirth ( table 1 ) . ", "were infected with p. falciparum only , 68 ( 9.1% ) were infected with helminths only , while 124 ( 16.6% ) were coinfected . a higher proportion of women with either organism presented with stillbirth than women with neither infection .", "women with malaria irrespective of whether or not they had intestinal helminths had a 90% increased odds of stillbirth .", "we obtained both malaria and intestinal helminth results from 746 women , and data analysis was limited to these women .", "seven hundred and eighty five ( 785 ) women were recruited into the study before delivery in the two hospitals in kumasi .", "low serum folate , severe anemia , prior induced abortion and prior stillbirth were each strongly , independently associated with stillbirth , with increased odds ranging from over 3-fold to a 6-fold increase ( table 3 ) ." ], [ "factors associated with stillbirth were malaria , severe anemia , low serum folate concentration , past induced abortion , and history of stillbirth .", "more studies need to be conducted to further assess the association between stillbirth and malaria and intestinal helminth coinfection .", "this study demonstrated that the study population had a relatively high rate of stillbirth ( 5% of all deliveries ) .", "the fact that most of the stillbirths were fresh suggests that higher quality intrapartum care could reduce stillbirth rates .", "it is important to conduct further studies to investigate risk factors of stillbirth to determine which stillbirths are preventable so that targeted interventions can be developed and tailored for resource - poor settings ." ] ]

[ [ "we previously reported a novel subtype of type 1b diabetes that we referred to fulminant type 1 diabetes . in fulminant type 1 diabetes", "type 1 diabetes is characterized by insulin deficiency resulting from destruction of pancreatic cells and subclassified into type 1a ( autoimmune ) and type 1b ( idiopathic ) diabetes .", "measurement of serum cpeptide level is effective for assessing the ability of endogenous insulin secretions . in particular , it is valuable to presume residual cell capability for type 1 diabetic patients . with a conventional method , enzyme immunoassays ( eia ) , low levels ( usually < 0.07 ", ", remarkably acute and almost complete cell destruction occurs and nearly no insulin secretion remains , even just after the disease onset .", "however , we can now detect up to 0.003 nmol / l ( 0.01 ng / ml ) serum cpeptide levels using a high sensitivity method , chemiluminescent enzyme immunoassay ( cleia ) .", ", we evaluated serum cpeptide levels measured by cleia and clarified the clinical features of fulminant type 1 diabetic patients based on residual endogenous insulin secretions .", "it enables us to know more precise levels of serum cpeptide in patients who have almost no insulin secretion , such as patients with fulminant type 1 diabetes . in the present study" ], [ "we studied 12 patients with fulminant type 1 diabetes ( 5 males and 7 females ) .", "sevenpoint ( fasting and 120 min postprandial for each meal and bedtime ) capillary blood glucose concentrations were measured in seven of the 12 patients for at least two days , and mean mvalue was calculated in each patient .", "every patient was usually followed every month in our outpatient clinic and insulin doses were adjusted for targeting nearly normal glucose levels ( hba1c < 6.5% , fasting glucose level < 5.6 mmol / l [ 100 mg / dl ] , 120min postprandial glucose level < 7.8 mmol / l [ 140 mg / dl ] ) . the data of hba1c , glycoalbumin , bodyweight and daily dosages of insulin were measured every 9 months ( from january to september in 2006 ) and expressed as mean of 9 months measurements .", "eight of the 12 patients were receiving multiple daily injections and three patients were receiving continuous subcutaneous insulin infusion .", "these patients were diagnosed as having fulminant type 1 diabetes between 19882006 , and had been followed in our hospital for more than 0.5 years since the disease onset ." ], [ "we studied 12 patients with fulminant type 1 diabetes ( 5 males and 7 females ) .", "sevenpoint ( fasting and 120 min postprandial for each meal and bedtime ) capillary blood glucose concentrations were measured in seven of the 12 patients for at least two days , and mean mvalue was calculated in each patient .", "every patient was usually followed every month in our outpatient clinic and insulin doses were adjusted for targeting nearly normal glucose levels ( hba1c < 6.5% , fasting glucose level < 5.6 mmol / l [ 100 mg / dl ] , 120min postprandial glucose level < 7.8 mmol / l [ 140 mg / dl ] ) . the data of hba1c , glycoalbumin , bodyweight and daily dosages of insulin were measured every 9 months ( from january to september in 2006 ) and expressed as mean of 9 months measurements .", "eight of the 12 patients were receiving multiple daily injections and three patients were receiving continuous subcutaneous insulin infusion .", "these patients were diagnosed as having fulminant type 1 diabetes between 19882006 , and had been followed in our hospital for more than 0.5 years since the disease onset ." ], [ "the significance of differences between the two groups was evaluated by pearson s correlation coefficient and mvalue was evaluated by mann " ], [ "maximal concentrations of serum cpeptide evaluated by cleia were 0.020.10 nmol / l ( 0.060.29 ng / ml ) in four patients and < 0.003 nmol / l ( 0.01 ng / ml ) in eight patients .", "residual insulin secreting capacity shown as serum cpeptide level and daily dosages of insulin indicated a significant negative correlation ( * p < 0.01 ) .", "serum cpeptide concentrations of the former four patients ranged from 0.007 to 0.10 nmol / l ( 0.020.29 ng / ml ) and those of the latter eight patients were always less than 0.003 ", "detectable serum cpeptide levels in 4 patients ( , , , ) ranged from 0.007 to 0.10 nmol / l , however serum cpeptide levels in eight patients were always < 0.003 nmol / l .", "patients who kept more serum cpeptide levels needed significantly fewer daily dosages of insulin ( p < 0.01 ; figure 2 ) .", "the patients with detectable serum cpeptide levels showed a significantly lower mvalue ( median 2.94 , range 0.966.15 ,", "relationship between maximal serum cpeptide level(nmol / l ) and daily dosages of insulin ( unit / kg ) .", "there were no significant correlations between hba1c , glycoalbumin , bmi , duration of disease and serum cpeptide levels ." ], [ "our present results suggest that even very low levels of serum cpeptide could reduce daily dosages of insulin and stabilize blood glucose controls in fulminant type 1 diabetes .", "the patients who had more residual endogenous insulin secreting capacity needed fewer daily dosages of insulin injection .", "these results suggest that even very low endogenous insulin secreting capacity would improve the doses of required insulin and stability of blood glucose controls in patients with fulminant type 1 diabetes .", "in the present study , we clarified a significant negative correlation between serum cpeptide levels and daily dosages of insulin ." ] ]

[ [ "the cnt were functionalized by a 1,3-dipolar cycloaddition reaction of azomethine ylides using a one - pot functionalization procedure described elsewhere13 leading to the formation of pyrrolidine - type groups bonded to the cnt surface .", "two types of cnt were investigated , nc7000 from nanocyl and mwnt sa from sigma aldrich ( catalog reference 659258 ) , both produced by chemical vapor deposition ( cvd ) .", "the unzipping process produces functionalized gnrs with widths equal or larger than 35 nm for gnr nc7000 and 350 nm for gnr mwnt sa . for this reason , a model of functionalized graphene ( see figure 6 ) , as opposite to finite gnr , was chosen .", "graphene layers and their intermolecular interactions were modelled with the mm3 force field that has been found to give accurate intermolecular structures.17 all the calculations were performed with the tinker molecular mechanics suite18 using three - dimensional periodic boundary conditions.19 the shape and dimensions of unit cells containing five functionalized graphene layers with different concentrations of functional groups were systematically obtained by energy minimization .", "additional data for the characterization for the gnr : thermogravimetric analysis ( tga ) and fourier - transform infrared spectroscopy ( ftir ) , is provided as supporting information ." ], [ "as a service to our authors and readers , this journal provides supporting information supplied by the authors .", "such materials are peer reviewed and may be re - organized for online delivery , but are not copy - edited or typeset . technical support issues arising from supporting information ( other than missing files ) should be addressed to the authors ." ] ]

[ [ "this paper focuses on interspecies pathogenic interactions within the red complex , in particular the combinations of p. gingivalis - t .", "these bacteria are not usually found alone , but in combination in the periodontal pockets , suggesting that some bacteria may cause destruction of the periodontal tissue in a cooperative manner .", "furthermore , coaggregation , nutrient effects , and modulation of virulence factors by periodontopathogens or by interspecies interactions between periodontopathogenic and nonpathogenic organisms have been reported to contribute to oral microbial pathogenesis .", "periodontal diseases are polymicrobial immune - inflammatory infectious diseases that can lead to the destruction of periodontal ligaments and adjacent supportive alveolar bone . the subgingival plaque contains more than 700 bacterial species , and some of these microorganisms have been shown to be responsible for initiation / progression of periodontal diseases [ 1 , 2 ] .", "studies using animal models have reported the synergistic pathogenicity of mixed infections with p. gingivalis - t .", "potential therapies using normal inhabitants of the oral microbiota that have an antagonistic relationship with the red complex are discussed .", "the red complex , which includes porphyromonas gingivalis , treponema denticola , and tannerella forsythia ( formerly bacteroides forsythus ) , encompasses the most important pathogens in adult periodontal disease ." ], [ "these findings suggest that the gingipains of p. gingivalis play an important role in the pathological synergism between p. gingivalis and t. forsythia .", "a combination of t. forsythia strains isolated from periodontitis patients and p. gingivalis also showed synergistic pathogenesis in a rabbit abscess model .", "the growth - promoting interaction between p. gingivalis and t. forsythia may be partly related to synergistic virulence in a murine abscess model . \n", "the researchers indicated that the virulence of p. gingivalis and t. forsythia mixed infection resulted from the immune - inflammatory responses and the lack of humoral immune protection during periodontitis in rats . " ], [ "these results suggest that p. gingivalis and t. denticola act synergistically ( with no synergy between the bacteria ) to stimulate the host immune response and to induce alveolar bone loss in a rat model of periodontitis .", "\n t. denticola , a small oral spirochete , is frequently found with p. gingivalis in progressing periodontitis lesions [ 1 , 3335 ] .", "synergistic virulence of mixed p. gingivalis and t. denticola infection has been assessed in several animal lesion models . using a murine abscess model ,", "coculture of p. gingivalis fdc 381 and t. denticola atcc 35405 induced synergistic biofilm formation and coaggregation ." ], [ "investigated the inflammatory response of an in vitro macrophage / epithelial cell coculture model following mono- or mixed infections with whole bacterial cells of the red - complex and their lipopolysaccharide ( lps ) .", "epithelial cells and macrophages play a major role in the host response to periodontopathogens , and secretion of inflammatory mediators and matrix metalloproteinases ( mmps ) by these host cells contribute to periodontal tissue destruction .", "the ability of periodontopathogens to degrade cytokines and chemokines in vivo may play an important role in their pathogenicity by disrupting the host inflammatory response . recently , polymicrobial infection with p. gingivalis , t. denticola , and t. forsythia in a rat model of periodontal disease was investigated .", "this suggested that the host response to the polymicrobial infection was altered , resulting in enhanced evasion of protective immune responses by the bacterial consortium ." ], [ ", we discuss the significance of interbacterial antagonism for maintenance and recovery of a healthy oral microbiota .", "the disruption of the harmonic relationship between the host and commensal microorganisms is considered to be an important factor for the development of oral pathologies .", "most therapeutic modalities for treatment of periodontitis aim to remove pathogens and kill all bacteria in the periodontal pocket . understanding the effect of interbacterial interactions on the pathogenesis of periodontitis" ] ]

[ [ "the cls was developed to continuously monitor habitual iop fluctuations over a 24-hour period by measuring changes in the eye s circumference in the area of the corneoscleral junction.12,13 once a cls is placed on an eye , the iop fluctuation can be measured automatically without interference with the subject s sleep .", "short - term ( 24-hour ) iop fluctuation can be measured using a contact lens sensor ( cls ) .", "the measurement obtained with a cls has been shown to be accurate and reproducible.14 in the present study , we investigated the relationship between short - term and long - term iop fluctuations .", "since an assessment of short - term iop fluctuation requires that the iop be measured at night , it burdens both the patient and his or her examiner(s ) .", "candidate factors associated with glaucoma progression include increased baseline intraocular pressure ( iop ) , increased mean iop , increased peak iop , and greater iop fluctuation.38 de moraes et al reported that the peak iop is a better predictor of vf deterioration compared to the mean iop.9 the study is supported by an investigation of an animal model of glaucoma which demonstrated a more predictive role of the maximum iop in structural change , compared to the mean iop.10 it is difficult to identify the peak iop because it might occur while the patient is asleep . if the peak iop is to be determined using goldmann applanation tonometry ( gat ) , the iop must be measured many times ." ], [ "the long - term iop fluctuation was defined by four parameters : 1 ) the mean of the eligible iop ( mmhg ) determined during the follow - up ; 2 ) the iop difference ( mmhg ) , which we defined as the difference between the maximum iop and the minimum iop ; 3 ) the standard deviation of iop ( sd - iop , mmhg ) which was calculated from all eligible iop values ; and 4 ) the peak iop ( mmhg ) , which was defined as the maximum iop .", "the 24-hour iop was monitored with a triggerfish cls ( sensimed , lausanne , switzerland ) .", "the diagnosis of glaucoma was made if both of the following criteria were satisfied : 1 ) the presence of glaucomatous optic disk neuropathy ( a cup / disk ratio of 0.7 or the presence of notching ) accompanied by corresponding vf defects , and 2 ) a threshold sita 30 - 2 examination showing a glaucoma hemifield test result ", "this was a retrospective study . fifty adult glaucoma patients ( 25 men , 25 women )", "we defined the number of glaucoma drops as the number of drops prescribed when the subject s iop was measured by cls .", "for the patients who had underwent a cataract surgery during the follow - up period , we excluded the iop data obtained before cataract surgery , and used the iop data obtained after the cataract surgery .", "the range of iop fluctuations , which was defined as the difference between the maximum value ( mveq ) and the minimum value measured during the 24-hour course , was calculated from the iop fluctuation data .", "we used the spearman rank correlation coefficient for determining the correlation of the long - term iop fluctuation index and short - term iop fluctuation ." ], [ "this was a retrospective study . fifty adult glaucoma patients ( 25 men , 25 women )", "all 50 patients underwent a comprehensive ophthalmic examination , including test of refraction and visual acuity , goldmann gonioscopy , gat , a fundus examination , and automated perimetry ( humphrey field analyzer ; carl zeiss meditec ag , jena , germany ) . the study and the research protocol", "after the nature and possible consequences of the study were explained to the subjects , written informed consent was obtained from each subject .", "were approved by the institutional review board of the university of toyama ( approval no 23 - 100 ) , and the procedures used conformed to the tenets of the declaration of helsinki ." ], [ "the diagnosis of glaucoma was made if both of the following criteria were satisfied : 1 ) the presence of glaucomatous optic disk neuropathy ( a cup / disk ratio of 0.7 or the presence of notching ) accompanied by corresponding vf defects , and 2 ) a threshold sita 30 - 2 examination showing a glaucoma hemifield test result ", "2 ) the subject had spherical equivalent < + 6 or > 6 d. in this study , we included patients who had undergone a previous cataract surgery at least 2 years prior to the enrollment in the study .", "we defined the start of the follow - up period when the patients were diagnosed with glaucoma .", "we included patients who met the requirement of > 2-year follow - up period after the cataract surgery .", "for the patients who had underwent a cataract surgery during the follow - up period , we excluded the iop data obtained before cataract surgery , and used the iop data obtained after the cataract surgery .", "we also included the cases in whom the glaucoma medications were changed or added during the follow - up period .", "outside normal limits , and a cluster of three contiguous points on the pattern deviation plot depressed at the p<0.05 level ( occurring in age - matched normal subjects ) not crossing the horizontal meridian which are compatible with glaucoma ." ], [ "this device is based on a novel approach to iop monitoring in which changes in corneal curvature and circumference are assumed to correspond to changes in the iop .", "the range of iop fluctuations , which was defined as the difference between the maximum value ( mveq ) and the minimum value measured during the 24-hour course , was calculated from the iop fluctuation data .", "the cls consists of a highly oxygen - permeable soft contact lens , the key elements of which are two sensing - resistive strain gauges that are capable of recording circumferential changes in the area of the corneoscleral junction .", "the unit of measurement used for the monitoring of iop fluctuation with the cls is not mmhg but mveq , which is unique to the cls .", "we defined the number of glaucoma drops as the number of drops prescribed when the subject s iop was measured by cls .", "patients who were taking glaucoma medication continued to take the medication during the measurement period .", "one eye of each subject was monitored . if both eyes had glaucoma , we measured the eye with the worse vf which also met the inclusion criteria ." ], [ "the long - term iop fluctuation was defined by four parameters : 1 ) the mean of the eligible iop ( mmhg ) determined during the follow - up ; 2 ) the iop difference ( mmhg ) , which we defined as the difference between the maximum iop and the minimum iop ; 3 ) the standard deviation of iop ( sd - iop , mmhg ) which was calculated from all eligible iop values ; and 4 ) the peak iop ( mmhg ) , which was defined as the maximum iop ." ], [ "we used the spearman rank correlation coefficient for determining the correlation of the long - term iop fluctuation index and short - term iop fluctuation .", "all statistical analyses were performed using the jmp 10 software program ( sas institute inc . , cary , nc , usa ) ." ], [ "these healed within a few days without any additional eye drops . as shown in figure 1 and table 2 , the short - term iop fluctuation was significantly correlated with the mean iop ( p=0.001 ) , the iop difference ( p=0.0207 ) , the sd - iop ( p=0.0061 ) , and the peak iop ( p=0.0017 ) .", "we classified the subtypes of glaucoma as primary open - angle glaucoma ( 30 eyes including 15 normal - tension glaucoma eyes ) , primary angle - closure glaucoma ( one eye ) , and pseudo - exfoliation glaucoma ( 19 eyes ) .", "we defined normal - tension glaucoma as untreated iop that had never been > 21 mmhg among the primary open - angle glaucoma eyes .", "we were able to successfully measure the 24-hour iop with the cls in all of the subjects .", "some subjects had minor complications : conjunctivitis , slight hyperemia , or peripheral corneal edema .", "the short - term and the long - term iop fluctuations were moderately but significantly correlated ." ], [ "we classified the subtypes of glaucoma as primary open - angle glaucoma ( 30 eyes including 15 normal - tension glaucoma eyes ) , primary angle - closure glaucoma ( one eye ) , and pseudo - exfoliation glaucoma ( 19 eyes ) .", "we defined normal - tension glaucoma as untreated iop that had never been > 21 mmhg among the primary open - angle glaucoma eyes ." ], [ "we were able to successfully measure the 24-hour iop with the cls in all of the subjects .", "some subjects had minor complications : conjunctivitis , slight hyperemia , or peripheral corneal edema ." ], [ "as shown in figure 1 and table 2 , the short - term iop fluctuation was significantly correlated with the mean iop ( p=0.001 ) , the iop difference ( p=0.0207 ) , the sd - iop ( p=0.0061 ) , and the peak iop ( p=0.0017 ) . the short - term and the long - term iop fluctuations were moderately but significantly correlated ." ], [ "the mean iop as well as peak iop , the iop difference , and sd - iop of long - term iop fluctuation was correlated with the short - term iop fluctuation measured with a cls .", "measuring the iop fluctuation with a cls could thus become a standard method of measuring short - term iop fluctuation .", ", this study is the first to analyze the relationship between long - term and short - term iop fluctuations with a cls .", "thus , the short - term and the long - term iop fluctuations were significantly correlated ." ], [ "it was reported that glaucoma medication could make the circadian iop fluctuation smaller.20 holl et al reported that a cls could not measure the effect of topical medication or body position.21 adherence of a cls to the cornea might alter the effects of topical medications .", "second , short - term iop fluctuation was assessed with a cls on different days , although some studies reported a good reproducibility of the results of short - term iop fluctuation with a cls.2225 third , the value in mveq measured with a cls can not be converted to mmhg .", "mottet et al reported that the iop measurement using a cls is an accurate and reproducible method to characterize the iop rhythm but does not allow estimating the iop value in mmhg corresponding to the relative variation of the electrical signal measured.14 to address these problems , further studies are necessary ." ], [ "in conclusion , long - term and short - term iop fluctuations were significantly correlated .", "measuring iop fluctuation with a cls could be useful to predict long - term iop fluctuation ." ] ]

[ [ "the aim of this study was to evaluate the influence of three different luting protocols ( total - etch , self - etch , and self - adhesive ) on shear bond strength of cad / cam rnc material , based on cad / cam technology , to dentin .", "resin cements have been selected for their advantageous mechanical and adhesive properties compared with conventional luting agents .", "the use of resin luting agents also appears to be essential in determining an effective stress distribution , which will prevent crack initiation .", "bond strength to ceramic material is influenced by the composition of the ceramic substrate as well as by mechanical and chemical interaction between substrate and bonding agent .", "a requirement for the successful function of a cad / cam restoration is adequate adhesion between ceramic and tooth substance ; however , the literature is unclear on which cement , ceramic , conditioning treatment , and dentine bonding agent produce the highest bond strength ." ], [ "paul , mn , usa)group 2 : ult - se : disks were cemented on the dentin surface , which had been treated with scotchbond universal adhesive , with the adhesive resin cement ( relyx ultimate)group 3 : u2-sa : disks were cemented on the dentin surface with the dual polymerization resin luting agent relyx unicem 2 automix . \n ", "paul , mn , usa ) group 2 : ult - se : disks were cemented on the dentin surface , which had been treated with scotchbond universal adhesive , with the adhesive resin cement ( relyx ultimate ) group 3 : u2-sa : disks were cemented on the dentin surface with the dual polymerization resin luting agent relyx unicem 2 automix .", "the specimens were randomly assigned to 3 groups of 10 teeth each [ figure 1 ] according to different luting procedures ( total - etch , self - etch , and self - adhesive ) .", "group 1 : ult - te : disks were cemented on the dentin surface , which had been acid - etched with scotchbond universal etchant phosphoric acid ( 3 m espe , st .", "group 1 : ult - te : disks were cemented on the dentin surface , which had been acid - etched with scotchbond universal etchant phosphoric acid ( 3 m espe , st .", "ind com , cotia , sp , brazil ) with a 600-grit silicon carbide abrasive paper disks for 5 s , to obtain a flat and uniform dentin surface and reduce any micromechanical interlocking that could affect the real bonding influence of the tested adhesive cements . before cementation , to remove the smear layer and to treat the dental surface with cleaning solution , the dentin surface was rinsed for 1 min with a cotton pellet impregnated with tubulicid blue ( dental therapeutics ab , saltsj - boo , sweden ) without fluorine . the surface was then rinsed and dried before cementation ; the labial surface of each incisor was cleaned for 10 s with a mixture of water and fluoride - free pumice and rubber polishing cup in a low - speed handpiece .", "five surfaces were identified : mesial , lingual , distal , buccal , and occlusal ." ], [ "characteristics of materials tested the disks were subsequently cemented to the exposed dentin of 30 bovine permanent mandibular incisors freshly extracted and stored in a 0.1% ( wt / vol ) thymol solution , which were used as a substitute for human teeth .", "the criteria for tooth selection included intact buccal enamel with no cracks caused by extraction , the absence of caries , and adequate dimension of the crown .", "in the present in vitro study , 30 disks ( 5 mm in diameter , 3 mm thick ) were designed with cerec software 4.2 platform ( sirona dental gmbh , salzburg , austria ) and obtained by milling from rnc blocks for cad / cam ( lava ultimate restorative , 3 m espe , st .", "specially fabricated cylindrical teflon mold with an internal diameter of 14 mm were filled with the acrylic resin and allowed to cure , thus encasing each specimen while allowing the buccal surface of dentin to be exposed .", "then the roots of the teeth were embedded in self - curing , fast - setting acrylic resin ( rapid repair , degu dent gmbh , hanau , germany ) ." ], [ "paul , mn , usa)group 2 : ult - se : disks were cemented on the dentin surface , which had been treated with scotchbond universal adhesive , with the adhesive resin cement ( relyx ultimate)group 3 : u2-sa : disks were cemented on the dentin surface with the dual polymerization resin luting agent relyx unicem 2 automix . \n ", "paul , mn , usa ) group 2 : ult - se : disks were cemented on the dentin surface , which had been treated with scotchbond universal adhesive , with the adhesive resin cement ( relyx ultimate ) group 3 : u2-sa : disks were cemented on the dentin surface with the dual polymerization resin luting agent relyx unicem 2 automix .", "five surfaces were identified : mesial , lingual , distal , buccal , and occlusal .", "group 1 : ult - te : disks were cemented on the dentin surface , which had been acid - etched with scotchbond universal etchant phosphoric acid ( 3 m espe , st .", "group 1 : ult - te : disks were cemented on the dentin surface , which had been acid - etched with scotchbond universal etchant phosphoric acid ( 3 m espe , st .", "a vinyl ring with an internal diameter of 4.5 mm was applied under the dentin surface to standardize the adhesion area . for all groups ,", "a thin layer of cement was applied and distributed to the bonding surface of the cylinders by means of a heidemann spatula . on each specimen ,", "as suggested by the manufacturer , every surface was light - polymerized for 20 s at a light intensity of 1000 mw / cm using a light - emitting diode ( led ) curing light in soft start - polymerization mode ( celalux 2 high - power led curing light , voco gmbh , cuxhaven , germany ) . the power output ( light intensity ) of the led was measured with a cure rite radiometer ( caulk - dentsply mod .", "the specimens were randomly assigned to 3 groups of 10 teeth each [ figure 1 ] according to different luting procedures ( total - etch , self - etch , and self - adhesive ) ." ], [ "the maximum load necessary to debond was recorded in newton ( n ) and calculated in mpa as a ratio of newton to the surface area of the cylinder ( the calculated shear bond strength was determined by dividing the strength at which bond failure occurred by the bonding area ) .", "after storing , the specimens were all submitted to a shear bond strength test to check the strength of adhesion between the two substrates , dentin , and rnc .", "specimens were placed in a universal testing machine , secured in the lower jaw of the machine so that the bonded cylinder base was parallel to the shear force direction .", "teeth were secured in the lower jaw of the machine so that the bonded cylinder base was parallel to the shear force direction .", "specimens were stressed in an occlusogingival direction at a crosshead speed of 1 mm / min [ figure 2 ] .", "this test is defined as a test in which two materials are connected by an adhesive agent and loaded in shear until separation occurs ." ], [ "analysis of variance ( anova ) was applied to determine whether significant differences in debond strength values existed among the groups .", "descriptive statistics , including the mean , standard deviation , median , and minimum and maximum values were calculated for all groups .", "statistical analysis was performed with stata 12.0 software ( stata , college station , texas , usa ) ." ], [ "as showed in figure 3 , post - hoc tukey testing showed that the highest shear strength values ( p < 0.001 ) were reported in group 2 ( ult - se ) .", "descriptive statistics ( mpa ) of the different groups shear bond strength values ( mpa ) obtained in the three groups .", "anova showed the presence of significant differences among the various groups ( p < 0.0001 ) .", "the lowest data ( p < 0.001 ) were recorded in group 3 ( u2-sa ) ." ], [ "the aim of this study was to investigate the influence of different luting protocols ( total - etch , self - etch , and self - adhesive ) on the shear bond strength values between dentin and this innovative rnc material , based on cad / cam technology .", "retention form of the preparation , marginal integrity , and clinical micro - leakage are the key parameters used to judge the effectiveness of a resin composite cement system .", "accurate and meticulous procedures during the cementation phase may play an essential clinical role in achieving a valuable connection between the dentin and the ceramic restoration .", "three different luting protocols have been evaluated in this study : total etch / etch and rinse protocol ( group 1 - ult - te : sco35% phosphoric acid + scotchbond universal adhesive + relyx ultimate conventional resin cement ) ; self - etch protocol ( group 2 - ult - se : scotchbond universal adhesive + relyx ultimate conventional resin cement ) , and self - adhesive protocol ( group 3 - u2-sa : relyx unicem 2 automix self - adhesive resin cement ) ." ], [ "within the limitations of this in vitro study , conventional resin cements ( coupled with etch and rinse or self - etch adhesives ) showed better shear strength values compared to self - adhesive resin cements .", "then , for the tested polymeric cad / cam materials , the use of additional adhesives for conditioning is necessary .", "furthermore , conventional resin cements used together with a self - etch adhesive reported the highest values of adhesion . however , future researches are needed to evaluate the bond strength to new ceramic / polymer prosthetic materials ." ], [], [ "the authors of this manuscript declare that they have no conflicts of interest , real or perceived , financial or non - financial in this article" ] ]

[ [ "therefore , the goals of this study were to evaluate volume - based care for women with uterine cancer aged 50 years and younger using a statewide population database .", "recently , there has been an interest in elucidating patterns of care for patients treated with uterine cancer .", "uterine cancer is the most common diagnosed gynecologic cancer among women in the united states , with 43,470 estimated new cases and approximately 7,950 estimated deaths in 2010 .", "has also focused on the positive relationship between surgeon and hospital case volume and clinical outcomes for malignancies treated with technically complex surgical procedures .", "numerous studies have evaluated the association of surgeon case volume with clinical outcomes for various procedures and have shown that higher surgeon volume is associated with improved outcomes [ 1013 ] . while specialty training is critically important to quality cancer care , recent attention", "more specifically , prior studies have not evaluated whether care provided by high - volume surgeons at high - volume centers leads to differences in resource allocation and short - term survival among younger patients .", "uterine cancer in young women is often associated with early - stage disease , well - differentiated tumors , and a good prognosis [ 68 ] . the actual care delivered to" ], [ "a subgroup analysis among women 50 years with regards to surgeon and hospital uterine cancer volume was performed to evaluate the risk of in - hospital related death and associations with the length of hospital stay , hospital - related costs , and icu length of stay .", "the main study objective was to characterize volume - based care among women 50 years when compared to women > 50 years .", "all adult female patients , 18 years of age and older , who underwent a surgical procedure including a hysterectomy for a malignant uterine neoplasm in maryland between january 1 , 1994 until december 31 , 2005 were included in the study .", "based on previous research in volume - based care in uterine cancer , surgeons performing 100 cases of uterine cancer per study period were categorized as high volume , and those performing < 100 cases of uterine cancer per study period as low volume .", "the study design was a cross - sectional analysis of hospital discharge data from the nonfederal acute care hospitals in maryland collected by the maryland health services cost review committee ( hscrc ) .", "surgeons were included in the analysis if they performed at least one uterine cancer surgery during the entire study period . based on previous research in volume - based care in uterine cancer , hospitals with 200 cases of uterine cancer per study period" ], [ "a total of 6,181 women who met the criteria for a primary surgical procedure for a malignant uterine neoplasm were identified in the state of maryland during the period of 19942005 .", "in total , 894 different surgeons provided primary uterine cancer surgical care , although not all surgeons provided continuous care for the entire duration of the study period .", "most of the women aged 50 years and younger were white ( 78.0% ) , had insurance coverage through an hmo ( 40.3% ) , and were treated in a community - based hospital ( 67.4% ) ( table 1 ) .", "women aged 50 years and younger comprised 13.6% ( n = 844 ) of the cases .", "50 years of age and younger , those admitted to a high - volume hospital were more likely to have higher adjusted cost of hospital - related care ( p = 0.01 ) ( table 4 ) .", "younger women were more likely to have shorter length of hospitalization stay ( p < 0.0001 ) and lower adjusted cost of hospital - related care ( p = 0.0002 ) ." ], [ "the information obtained in this study increases our current knowledge of volume - based care of young women diagnosed with uterine cancer and may be useful in developing strategic planning in order to improve the care offered to this population .", "due to the lack of previous reports of case volume among uterine cancer , a third limitation of the current study is that our selected volume criteria have not been widely validated as outcomes measures . despite these limitations , the current study provides the most extensive evaluation on volume - based care among young women that underwent surgery for uterine cancer .", "our analysis of the hscrc database from 19942005 confirms that younger women have lower short - term mortality than older women diagnosed with uterine cancer .", "several studies have demonstrated that age is an independent predictor of overall survival [ 4 , 5 ] .", "also , uterine cancer in young women is often associated with early - stage disease , well - differentiated tumors , and a good prognosis [ 68 ] ." ] ]

[ [ "in iden 2012 , many diverse experiences associated with basic procedures to advanced techniques of endoscopic retrograde cholangiopancreatography ( ercp ) were highlighted in great enthusiastic lectures by world renowned experts .", "interesting cases entitled \" interesting cases in pancreatobiliary endoscopy \" were introduced in video forum . in this highlight summary of interesting presentations", ", i will present a summarized review about basic procedures of ercp like balloon dilation for common bile duct ( cbd ) stones , advanced techniques like endoscopic necrosectomy for necrotizing pancreatitis , recently proposed management for the prevention of post - ercp pancreatitis , and spyglass direct visualization system through which we can directly observe the cbd and pancreatic duct ." ], [ "eplbd is easy to use and effective for the removal of common bile duct ( cbd ) stones , but still debates exist on safety issue . since eplbd requires only a small endoscopic sphincterotomy ( est ) or none at other occasions , eplbd is generally believed to avoid the complications of a full est .", "lee and han1 conducted a large retrospective multicenter study , in which a total of 946 consecutive patients with large cbd stones were enrolled in this study .", "serious adverse events occurred in 95 patients ( 10% ) , after which the following guidelines of eplbd in order to pursuit zero mortality were suggested ; 1 ) eplbd should be avoided in patients with distal cbd strictures ; 2 ) full est should be avoided immediately before eplbd ; 3 ) the balloon should be inflated gradually ; 4 ) inflation should be discontinued in cases of persistent balloon waist ( 75% rule ) ; 5 ) not to be inflated beyond the maximum diameter of the dilated cbd ; and 6 ) convert to an alternative stone removal or drainage method any time there is difficulty in removing the stone .", "because it was multicenter study analyzing the safety of eplbd based on large numbers of cases , experienced experts will agree with the above referred recommendations , though it was studied retrospectively ." ], [ "kahaleh and freeman2 recently made recommendations to minimize risks of ercp in international digestive endoscopy network ( iden ) 2012 as follows ; adequate selection of patients undergoing ercp , skilled operators using novel techniques for prompt identification , which is key to successful prevention and management .", "pancreatitis is the most common complication associated with ercp procedure with average rate of about 5% .", "techniquerelated issues have long been recognized to be important in causing post - ercp pancreatitis .", "he also mentioned about specific techniques to reduce risk of post - ercp pancreatitis , such as pancreatic stents , more promising pharmacological agents including non - steroidal anti - inflammatory drug , and enema for prevention of post - ercp pancreatitis .", "risk factors for the occurrence of post - ercp pancreatitis include younger age , indication of suspected sphincter of oddi dysfunction , history of previous post - ercp pancreatitis , absence of elevated serum bilirubin levels , and female sex are usually at increased risk ." ], [ "new possibility that eus - guided endoscopic pancreaticobiliary drainage can replace the percutaneous techniques and obviate surgery was shown in iden 2012 .", "kahaleh3 referred that endoscopic debridement and stent insertion can reduce high morbidity and mortality of surgery in severe necrotizing pancreatitis .", "endoscopic necrosectomy using repeats session of debridement and plastic stents insertion has been more frequently used within the last decade and half .", "additionally he described techniques of transmural drainage and endoscopic debridement , how to make the transenteric access into the pancreatic necrosis , how to make active endoscopic irrigation with a gastroscope and debridement of cystic contents using biopsy forceps , and roth nets and polypectomy snares in detail .", "fully covered self - expandable metal stents might provide a safer and more efficient drainage through a larger diameter stent .", "this technique is evolving continuously as we attempt to optimize the post - procedural outcomes ." ], [ "there were attractive video lectures during iden 2012 dealing with advanced techniques for pancreaticobiliary visualization including direct peroral cholangioscopy , spyglass direct visualization system , forward - viewing echoendoscopy , and contrast - enhanced eus and elastography accompanied with actual interesting cases for each .", "kahaleh4 mentioned that the single operator cholangioscopy ( soc ) system ( spyglass ; direct visualization system , natick , ma , usa ) may offer an interesting compromise in terms of size ( 10 fr diameter ) and complexity of use .", "soc is challenged by the size of the biopsy obtained and the stiffness of the forceps ( spybite ; boston scientific , natick , ma , usa ) fitting within the working channel of the system .", "soc can be a great step to realize intraductal visualization as well as therapy , but the best is yet to come .", "sensitivity of forceps biopsy through the cholangioscope was far higher for intrinsic ( 66% ) than extrinsic ( 8% ) malignant lesions . conclusively , spyglass ( direct visualization system ) has not only been used as a platform for advanced intraductal imaging with probe based endomicroscopy and spyglass - guided stone fragmentation ; but also for photodynamic therapy to treat bile duct cancer ." ], [ "pancreatobiliary endoscopy is continuously evolving area with new techniques and we attempt to optimize the postprocedural outcomes ." ] ]

[ [ "regarding to complications related to b19 virus infection during pregnancy and lack of study about its infection prevalence in ardabil county , this study was conducted with the aim of determination of the prevalence of parvovirus and igg in pregnant women in ardabil .", ", we tried to determine prevalence of serum parvovirus infection in pregnant women and its association with some of the parameters such as number of lived children , number of family members , number of commensalts and amount of hemoglobin .", "parvovirus b19 is a small , uncoated dna virus belonging to the family parvoviridae ( 1 ) .", "parvovirus infection of mothers is diagnosed using serologic or an immune assay enzyme b19 igm and b19 igg ( 12 ) .", "b19 igg positive serologic evidence of previous infection with the virus that leads to lifelong immunity . in this study" ], [ "the questionnaire consisted of two parts : part i including mother s age , location , number of family members ( father , mother , sister , brother ) , number of children , number of commensalts , and in part ii information about blood test of pregnant women , were recorded . for measurement of igg antibodies in serum samples against b19 virus ,", "the elisa kit euroimmune , ( germany ) was used as follows : 100 l of serum 1/201 diluted patients and 100 l of each of the standards were added to micro plate wells in which the viral antigen was coated .", "the serum of blood samples were isolated and were stored at 20 c , until analysis .", "the samples were incubated for 1 h at room temperature , then the wells were washed and 100 l goat , anti - human , anti - igg antibody binded to the peroxide was added to each sample and they kept at room temperature for one more hour .", "5 ml of blood was taken from participant in care centers and was referred to the reference laboratory , immediately .", "the significant levels of 0.05 were used for all statistical analysis . in order to consider the principles of medical ethics ," ], [ "distributions of seroprevalence of parovirus b19 among pregnant women in residence location are shown in table 1 .", "distribution of serology parvovirus b19 prevalence among pregnant women based on residence location the average age of participants with positive serology was 24.774.26 years , and the mean age of those with negative serology was 22.983.58 years .", "there was no significant relationship between residence location and prevalence of serum parvovirus b19 ( p=0.475 ) ." ], [ "results of this study showed that the prevalence of b19 in pregnant women in ardabil was 69.1% .", "comparison between the average number of sero - positive children and seronegatives revealed that the number of children did nt related to the prevalence of parvovirus that is in accordance with the shahraki et al .", "the relation between the number of children and outbreak of parvovirus was significant ( 24 ) that is not consistent with our results .", "the difference between rural and urban areas in the prevalence of b19 virus was not significant ." ], [ "the results of this study showed a high susceptibility of pregnant women to parvovirus b19 in ardabil region and immunity to the virus increases with age . in our study , a significant correlation was not found between the prevalence of parvovirus and the number of living children , number of family member , number of commensalts and hemoglobin content . considering that a high percentage of infected pregnant women with parvovirus b19 in the ardebil region , health education and screening for the virus , especially in pregnant women with anemia is recommended to prevent fetal complications ." ] ]

[ [ "there is both growing recognition and scientific evidence that interventions of physical activity and exercise programs ( paeps ) have a favorable impact on patients with psychiatric disorders.17 these findings have been reported among groups of patients with major depressive disorders ( mdds),6,8,9 schizophrenia,10,11 post - traumatic stress disorder ( ptsd),12,13 alcohol abuse,14,15 sleep disorders,16 or autism spectrum disorders.17 the neurophysiological mechanisms underlying the beneficial effects of pa on psychological functioning and wellbeing are complex , although there is increasing evidence that regular , acute , and chronic pa does have an impact at the molecular level18,19 and on brain plasticity.1,20,21 in parallel , psychological mechanisms are involved ; specifically , regular pa has a favorable influence of self - esteem among patients with psychiatric disorders,22 on body image and physical self - concept,23 and , most importantly , on dimensions of anxiety and depression.6,9,24 however , it is widely reported that patients with psychiatric disorders are less physically active and do exercise less than healthy peers,2527 potentially increasing and maintaining the risk for further physical and mental health problems . among those seeking treatment ,", "our aim in this study was to explore the extent to which these programs are implemented in the inpatient treatment of psychiatric disorders in the german - speaking part of switzerland .", "psychiatric hospitals provide an excellent environment to initiate physical activity , as they offer supervised free training during a phase in which patients are under few time constraints . in view of the potential of paeps as adjunct treatment reported in the literature to date ,", "an understanding of the implementation of paeps in practice , and the experiences of program staff , is an important factor for the future translation of research findings to clinical practice ." ], [ "during spring 2012 , all psychiatric hospitals of the german - speaking part of switzerland ( n=55 ) were identified via publicly accessible lists on the internet . to be enrolled in the study , the minimum requirement was that psychiatric hospitals treated not only outpatients but also inpatients and that the official language was german ; that is to say , staff and inpatients communicate in german or swiss german .", "data collection was done online , as this was judged to be both time saving for participants and a reliable method to gather data.28 we used commercially available software ( unipark ; http://www.unipark.de ) , as this is an easily applied tool for the creation of internet - based studies .", "the aim of the phone call and the study were explained , and , if agreed , the url of an online survey was transmitted via email .", "participants needed ~1520 minutes to complete the survey . a questionnaire with multiple choice response options was developed expressly for this study , in order to address the specific areas of inquiry .", "importantly , the user of the software receives the raw data of the answers but not participants ip address , ensuring both data security and participants anonymity .", "moreover , the online survey was designed to avoid repeated participation ( ip addresses already used are automatically blocked ) ." ], [ "during spring 2012 , all psychiatric hospitals of the german - speaking part of switzerland ( n=55 ) were identified via publicly accessible lists on the internet . to be enrolled in the study , the minimum requirement was that psychiatric hospitals treated not only outpatients but also inpatients and that the official language was german ; that is to say , staff and inpatients communicate in german or swiss german .", ", participants could take part in a prize draw ( ten vouchers of chf 30.00 [ approximately usd 30.00 ] from a known national supermarket ) , although to do so they needed to provide an email address .", "next , nb contacted all identified hospitals by phone calls and asked for a brief talk with the staff member responsible for the paeps .", "the aim of the phone call and the study were explained , and , if agreed , the url of an online survey was transmitted via email .", "ethical approval was not required by the institutional review board of the university of basel because the survey was not addressed to patients or underage people .", "all participants were informed that participation was voluntary and that all data would be gathered anonymously ; written informed consent was obtained on the first page of the questionnaire ." ], [ "data collection was done online , as this was judged to be both time saving for participants and a reliable method to gather data.28 we used commercially available software ( unipark ; http://www.unipark.de ) , as this is an easily applied tool for the creation of internet - based studies .", "importantly , the user of the software receives the raw data of the answers but not participants ip address , ensuring both data security and participants anonymity .", "furthermore , the software provider guarantees that all data are stored on a server that is not accessible to any third party .", "moreover , the online survey was designed to avoid repeated participation ( ip addresses already used are automatically blocked ) ." ], [ "a questionnaire with multiple choice response options was developed expressly for this study , in order to address the specific areas of inquiry ." ], [ "the findings are based on descriptive statistics such as mean , standard deviation , median , or percentage .", "furthermore , chi - square tests were performed to calculate associations between dimensions as specified in more detail in the text ." ], [ "all participants reported that in order to improve the paeps offered by the hospital , staff would require advanced vocational training in sport and exercise sciences and advanced vocational training in adapted physical activity for psychiatric patients .", "of the 55 psychiatric hospitals in german - speaking switzerland approached , staff members of 48 ( 87.3% ) took part in the survey . in all , 42 respondents ( 87.5% ) were physiotherapists , three ( 6.25% ) had a master s degree in sports science , and three ( 6.25% ) did not answer to this item .", "thirty - five ( 72.9% ) answered that the main goal of a paep was to improve patients psychological state , 45 ( 93.75% ) answered that a further main goal was to improve patients social skills , and 17 ( 35.42% ) answered that a further main goal was to improve patients physical status ." ], [ "of the 55 psychiatric hospitals in german - speaking switzerland approached , staff members of 48 ( 87.3% ) took part in the survey . in all , 42 respondents ( 87.5% ) were physiotherapists , three ( 6.25% ) had a master s degree in sports science , and three ( 6.25% ) did not answer to this item .", "80% of respondents reported personality disorders and mood disorders , ~78% reported anxiety , stress - related , and somatoform disorders , ~65% reported substance use disorders , 55% reported schizophrenia and nonmood psychotic disorders , 50% reported mental disorders due to existing physiological conditions , and 5%15% reported intellectual disabilities , pervasive and specific developmental disorders , behavioral and emotional disorders , and unspecific mental disorders .", "of the 48 respondents , 32 ( 66% ) were working in a general psychiatric hospital , eight ( 17% ) were working in a university psychiatric hospital , and eight ( 17% ) were working in psychiatric wards of a somatic hospital .", "twenty ( 43% ) hospitals had > 200 beds for inpatients , nine ( 19% ) hospitals had 99200 beds , 15 ( 32% ) had between 50 and 99 beds , and three hospitals reported < 50 beds for psychiatric inpatients ." ], [ "as depicted in figure 1 , all psychiatric hospitals ( 100% ) offered relaxation techniques , and 47 ( 97% ) offered sports therapy ( fitness , swimming , ball sports , and endurance training ) , 46 ( 96% ) offered general physical activity , 40 ( 85% ) offered physiotherapy / remedial gymnastics , 28 ( 59% ) offered so called body therapies such as feldenkrais or bioenergetics , 27 ( 57% ) offered far - east techniques ( tai chi and qigong ) , and ten ( 22% ) offered hippotherapy .", "therefore , the majority of hospitals offered more than one type of paep content . as regards the frequency with which paeps took place , responses ranged from once per week to five times per week .", "factors that were reported as limiting the frequency of sessions were staff availability , sports hall and/or equipment availability , and the size of the hospital : hospitals with a lower number of beds offered fewer and less frequent paeps ( ( n=48 , df=18 ) = 16.45 ; p<0.05 ) . as regards", "thirty - six ( 75% ) participants reported that the availability and equipment of the current paep infrastructure were sufficient , five ( 10.4% ) reported that the infrastructure was well to very well equipped , whereas seven ( 14% ) reported that the availability and equipment of the infrastructure were not or not at all sufficient .", "all paeps were attended on a voluntary basis ( 100% ) , although 40 ( 83.3% ) respondents emphasized that patients were made aware of the programs and encouraged to attend the paeps .", "furthermore , participants reported that patients seemed generally moderately to rather highly motivated to participate in the paeps ." ], [ "all participants responded that in their view , paeps improved patients physical and psychological status . regarding the hypothesized importance of the programs , answers ranged from a little importance ( n=8 ; 16.6% ) , to moderate importance ( n=38 ; 79% ) ; two ( 4.16% ) answered that the importance of paeps was large ( figure 3 ) .", "thirty - five ( 72.9% ) answered that the main goal of a paep was to improve patients psychological state , 45 ( 93.75% ) answered that a further main goal was to improve patients social skills , and 17 ( 35.42% ) answered that a further main goal was to improve patients physical status .", "all participants reported that after discharge , their patients no longer had access to the paeps offered as part of inpatient treatment .", "none of the participants answered that a paep was aimed at improving patients coping strategies ( note that multiple answers were possible ; figure 4 ) .", "no associations between the main goals of paeps and the most frequently treated disorders were observed ( ( n=48 ; df=27 ) = 0.45 ; p=0.78 ) ." ], [ "all participants answered that they rely on their own experience and vocational training to plan and organize the paep sessions .", "furthermore , the majority ( n=40 , 83.3% ) also reported benefiting from the experiences and advice of their peers .", "no respondent stated that they sought or obtained information from specific internet sites or scientific publications ." ], [ "all participants answered that paeps were an integrated treatment modality of the hospital . in all", ", 38 ( 79.16% ) reported that they were particularly motivated to lead paeps and 30 ( 62.5% ) reported that the hospital s medical staff recognized the beneficial effects of paeps .", "nobody answered that paeps were offered because supplementary vocational training was available , because the hospital had the existing infrastructure , or because of scientific evidence supporting the benefits of such programs ." ], [ "all participants reported that the main treatment regimen of the hospital comprised medication ( 100% ) , psychotherapy ( 100% ) , and occupational therapy ( 100% ) .", "thirty ( 62.5% ) answered that within the main treatment regimen , the potential benefits of paeps was fairly well accepted ; ten ( 20.83% ) answered that it was well accepted , four ( 8.3% ) answered that it was not well accepted , and four ( 8.3% ) did not know ." ], [ "all participants reported that in order to improve the paeps offered by the hospital , staff would require advanced vocational training in sport and exercise sciences and advanced vocational training in adapted physical activity for psychiatric patients ." ], [ "the present survey is the first to give an overview of the existence and role of paeps in psychiatric hospitals of the german - speaking part of switzerland .", "the key findings of the present survey are that all psychiatric hospitals of the german - speaking part of switzerland whose staff participated in this survey offer a broad variety of paeps . furthermore , ~25% of all patients", "specifically , the pattern of results shows that paeps are well established and integrated in the treatment regimen .", "staff involved in these programs also felt that specific extended vocational training would allow them to improve their skills and optimize the existing programs .", "all respondents reported that they felt that participation in peaps impacted favorably on patients psychological status ." ], [ "the pattern of results of the present online survey suggests that psychiatric hospitals of the german - speaking part of switzerland offer a broad variety of physical activity and exercising programs to their inpatients , although only 25%50% of inpatients take part in programs .", "staff responsible for paeps state that specific extended vocational training is required to offer activities suited to patients with psychiatric disorders . finally , given that many psychiatric patients may have motivational and volitional deficits , more systematic efforts seem warranted to increase exercise motivation and promote behavioral skills to maintain a more physically active lifestyle among inpatients in psychiatric care settings .", "staff are unanimous in the view that these programs are physically and psychologically beneficial . after discharge" ] ]

[ [ "the aims of this study were to ( 1 ) determine current practice of np 's assessment of and intervention strategies with older adult drivers in southeastern north carolina ; ( 2 ) assess the nps knowledge deficits in assessing safe driving capability of the older adults ; and ( 3 ) assess nps current knowledge of resources available for older adult drivers and their families . assessment and intervention of safe driving in the older adult", "the purpose of this critical incident study was to identify strategies utilized by nps in the assessment and intervention of older adult drivers in southeastern north carolina .", "healthcare providers have standards of care or published guidelines to assess , treat , and evaluate chronic diseases such as the jnc guidelines for hypertension .", "a similar guideline for assessment , intervention , and evaluation of driving safety in the older adult would prove beneficial .", "the current guidelines published by the american medical association in collaboration with the national highway traffic safety administration ( nhtsa ) are considered opinion - based according to one author ( [ 5 , 9 ] ) ." ], [ "johnson found nps to be comfortable performing the physical assessment as it relates to driving ability such as vision , hearing , and cognitive status , but they reported being uncomfortable approaching or discussing the topic of driving safety and/or driving termination .", "johnson also concluded that early assessment , discussions , and intervention of safe driving were preferred by the older adult , rather than a discussion of driving termination .", "even though this study focused on nps , many other healthcare disciplines such as physicians , social workers , and occupational therapists have a vested interest in driving safety of the older adult .", "johnson interviewed 25 nps on their perceptions of their role in assessing driving ability in the older adult driver who lives in an urban region .", "a literature review was performed using these databases : ebsco host , pubmed , nursing @ ovid , proaquest nursing and allied health , science direct , and web of science .", "american 's average life expectancy has increased at the same time death rates for the 65 to 84 age group have decreased . as our population ages , there is an increased need for specialized geriatric care that includes a comprehensive , holistic approach .", "keywords used were as follows : older adult , elderly , geriatric , driving , safety , assessment , and nurse practitioner ." ], [ "critical incident interviews aimed at identifying specific behaviors and strategies used by nps when assessing and intervening with older drivers were conducted with a sample of 21 nps recruited through the north carolina nurses association ( ncna ) council of nurse practitioners - coastal region .", "a qualitative research method developed by flanagan , the critical incident technique , was selected as the design for this study .", "the primary objective of the critical incident technique is the development of a behavioral classification system or taxonomy to find solutions to practical problems or to determine the prevalence and distribution of critical behaviors .", "the critical incident technique is a tool used to create a functional description of behavioral activity . according to flanagan , obtaining a description of the activity", "the critical incidents were initially reviewed by an advanced practice nurse with a specialty in gerontology and an expert in using critical incident methodology to determine which incidents should be included in the analysis .", "critical incident studies have been widely used by health service researchers to identify and categorize behavioral responses of healthcare providers in significant and decisive situations [ 17 , 18 ] .", "( 2 ) what strategies did you use to approach that driver about the issue of driving safety ?" ], [ "a total of 21 nurse practitioners in the southeast region of the united states ( us ) participated in this study .", "the predominantly female sample ( n = 20 , 95% ) had a mean age of 48.3 years ( sd 11.3 years ; range 2968 years ) . the average length of employment as a nurse practitioner was 9.1 years ( sd 8.4 years ) .", "self - ratings of comfort in approaching older adults about their driving safety were higher at 8.0 ( sd 2.3 , 110 scale ) .", "the participants ' self - rating of competence in assessing older driver 's safety reflected a moderate level of success at 6.6 ( sd 1.3 , 110 scale with 1 very poor and 10 excellent ) .", "approximately one - half of the participants ( 47.6% ) achieved specialty certifications reflecting widely varied areas of advanced nursing practice including : adult , geriatrics , psychiatric mental health , diabetes , oncology , hospice , and wound , ostomy , and continence nursing .", "the majority of the participants earned master 's degree ( n = 18 , 85.7% ) ." ], [ "two incidents ( 3% ) described referring the patient to a medical specialist , while one incident ( 2% ) described the importance of avoiding the use of inappropriate , high - risk medications with older adult drivers . when participants ( nurse practitioners ) were asked to list perceived barriers for driving cessation , the most frequently mentioned barriers included resistance from the patient with denial , lack of alternative transportation , spousal denial , and increased isolation .", "a total of 66 critical incidents were reported which described strategies that nurse practitioners use in practice to increase safety in older adults .", "a total of 89 incidents described strategies that nurse practitioners used in assessing an older driver 's safety . when the incidents were analyzed , 11 major categories emerged with an interrater agreement of 95% .", "a listing of the most frequent barriers that nurse practitioners face in working with older adult drivers is presented in table 4 .", "the two most common strategies were using therapeutic communication to initiate a nonthreatening conversation about driving safety and expressing concern for the older adult 's driving safely .", "categories included the following : involving family members , using therapeutic communication , referring patient to occupational / physical therapy , conducting a vision examination , using a step approach to driving termination , using objective data , referring patient to the department of motor vehicles , referring patient to a medical specialist , and limiting medications on the beers list ." ], [ "nps ranked the most helpful intervention was to involve family members and the least helpful intervention was the lack of family guidance from the provider . dealing with patient concerns about lack of transportation , especially in rural areas , and resistance to driving termination were the two most common perceived barriers .", "the demographics of nps nationally were a mean age of 51 years , white ( 85.4% ) , black / african american ( 3% ) , female ( 9.4% ) , having a graduate level degree ( 97.2% ) , and having practiced as a np for 11 years .", "the wide variation in ways which nps make the determination to address driving in older adults and the lack of consistent guidelines for dealing with this issue should be noted .", "the participants in this study closely represent the national np demographics . compared to the 2012 national aanp sample survey ,", "obtaining collateral information from family members ranked just below obtaining physical exam or objective data . using therapeutic communication techniques and a concern of safety for the older adult were the most common strategies used in approaching the older adult about driving .", "this study identified strategies used by nps in the assessment and intervention of older adults in one geographical region ." ], [ "simply making themselves aware of resources available to them and the older adult , such as the online aarp driver safety program that can be found at http://www.aarp.org/home-garden/transportation/driver_safety/ would prove beneficial .", "nps and np students should also be aware of community resources available in their areas of clinical practice .", "occupational therapists have developed guidelines for them to use in assessment of older adult drivers .", "standardized curriculum for nurse practitioner students does not require faculty to address concerns of older adult drivers ; therefore , few nps graduate with this training .", "nps are trained to provide a holistic approach to patient care and approximately half of all nps practice in the primary care setting .", "as the supply of primary care physicians is expected to decrease , the number of nurse practitioners ( nps ) is expected to increase 94% between 2008 and 2025 .", "development of an evidenced - based clinical guideline for assessment and intervention with older adult drivers would be used similarly .", "nps feel comfortable using evidenced - based clinical guidelines to guide their clinical practice with common chronic disease management .", "there is a need for the development of clinical guidelines that nps can use efficiently during a routine office visit ." ], [ "it is clear that nps value the relationship they have with their patients and they value the need to intervene when public safety is at risk .", "development of evidenced - based clinical guidelines would prove beneficial for nps to use in clinical practice , as long as the guidelines were able to be used quickly and efficiently .", "this study shows the varied and inconsistent clinical practice of nps assessing and intervening with older adults drivers . who is to say that one strategy is better than the other ?" ] ]

[ [ "left ventricular noncompaction cardiomyopathy ( lvnc ) is a very rare cardiomyopathy characterized by an increase in the noncompacted , trabeculated myocardium adjacent to compacted myocardium in the left ventricular ( lv ) .", "we present a case of lvnc in an adult patient with its clinical and imaging findings .", "though current research suggests a developmental arrest in embryogenesis as the underlying pathology , the etiology of lvnc are not fully understood .", "echocardiography may not visualize the apical region optimally , leading to underestimation of the degree of lv noncompaction .", "historically , lvnc has been diagnosed by echocardiography when the ratio of noncompacted to compacted myocardium is > 2 .", "the patients will often present with a spectrum of disease severity ranging from no symptoms to cardiac arrhythmias , cardiac failure , thromboembolism or even sudden cardiac death ." ], [ "a 24-year - old female patient was initially referred to our vascular department for investigation of bilateral lymphedema .", "thus , the clinical impression was proximal myopathy mostly mitochondrial or congenital , congenital lymphedema , lv noncompaction with lv ejection fraction of 40% , and normal rv function .", "on subsequent follow - up visits , she reported a history of interval improvement apart of occasional palpitations with no history of shortness of breath , syncope or dizziness . she has been advised to do regular physiotherapy and to wear compressive stockings for her lymphedema .", "( b ) shows mild dilatation of the left ventricle , prominent left ventricle wall trabecular network ( arrowheads ) and only a thin compacta ( arrows ) further investigation showed elevated creatine kinase and electromyography findings consistent with myopathy ." ], [ "historically , the prevalence of lvnc has been underestimated due to the lack of knowledge about this rare condition and its similarity to other diseases of the myocardium and endocardium .", "nevertheless , the early and precise diagnosis is mandatory to rule out other underlying diagnoses and to allow a timely start of standard hf and anticoagulation therapy , thus preventing further complications .", "sporadic and familial forms of noncompaction have been described . in the original report of isolated noncompaction", "bellet and gouley described the first case of noncompaction in an autopsy of a newborn infant with aortic atresia and coronary ventricular fistula ." ], [ "some trabeculae show delayed hyperenhancement despite having a normal compacted to noncompacted myocardial ratio , suggesting that lv noncompaction may be a more diffuse disease process than previously suspected .", "cmri follow - up examinations would be helpful to assess a potential change of noncompacted or compacted mass in a chronological sequence . in conclusion", "the use of delayed hyperenhancement sequences improves the correlation between cmri and the parameters of the clinical stage of the disease .", ", cmr can distinguish lvnc from other cardiomyopathies and normal hearts with high sensitivity and specificity ." ] ]

[ [ "the objective of this study was to analyze the clinical records of lung cancer patients who underwent surgical resection to evaluate the clinical characteristics and outcomes of patients with incidentally detected lung cancer and patients with symptomatic lung cancer .", "there is little information , however , on the clinical characteristics and outcomes of patients with incidentally detected early stage lung cancer from strictly controlled randomized trials .", "lung cancer is the most common cause of cancer mortality in the western world , accounting for approximately 5% of all deaths in many countries .", "in fact , some studies suggest that frequent chest radiographic screening is associated with an 11% relative increase in lung cancer mortality compared with less frequent screening", "results from several studies suggest that frequent chest radiographic screening does not result in reduced lung cancer mortality , a conclusion reinforced by the prostate , lung , colorectal , and ovarian ( plco ) cancer screening trial [ 3 , 4 ] .", "five - year survival for those with pathological stage ia non - small cell lung cancer ( nsclc ) is 73% whereas metastatic disease has a dismal prognosis ( 13% 5-year survival ) .", "one of the main concerns is that the extrapolation of findings from tightly controlled trials to real - life mass screening programs requires uniform standards and high quality controls not easily achievable in most institutions ." ], [ "all patients undergoing pulmonary resection with a curative intention for non - small cell lung cancer ( nsclc ) in the british hospital in buenos aires between january 1986 and july 2009 were eligible for inclusion in this retrospective study .", "patients were classified into two groups : group 1 ( asymptomatic ) : patients who had no symptoms attributable to lung cancer at the time of imaging ( patients whose cancer was detected by a medical checkup or under evaluation for other diseases ) , and group b ( symptomatic ) : patients with lung cancer - related symptoms .", "the charts of patients classified as having asymptomatic incidentally detected lung cancers were reviewed to check if the indications for imaging really were not based on any potentially cancer - related symptom .", "mediastinoscopy has not been performed routinely in this series unless the ct scan demonstrated mediastinal lymph node enlargement , pet suggested a malignant involvement of hilar or mediastinal nodes , or high- risk criteria of n2 were present .", "preoperative staging was performed according to the 7th tnm classification system of the international association for the study of lung cancer using chest computed tomography ( ct ) and abdominal ct or ultrasonography in all patients .", "our thoracic oncology centre keeps a database of all patients evaluated , with data entered prospectively at the time of their initial evaluation .", "preoperative data included methods of diagnosis and a symptoms questionnaire , tobacco exposure history , and medical history ." ], [ "of 593 patients included in this study ( 68.3% male , median age 60.9 , and range 2386 years ) 320 patients were asymptomatic ( asx ) ( 53.9% ) .", "the overall 5-year survival rates were higher for asx patients : 66.2% and 46.0% for asx and symptomatic patients , respectively ( p = 0.001 ) ( figure 1 ) . amongst the stage", "i patients , the 5-year survival rates were 81.2% in asx patients and 58.6% in sx patients ( p = 0.014 ) ( figure 2 ) . when only stage ia was considered , 5-year survival rates were not different ( 71.2 versus 84.1% , p = 0.191 ) ( figure 3 ) . when analysis was restricted to t1a tumors", "two hundred and thirty ( 71.8% of the asx patients ) were diagnosed incidentally on chest x - ray and the remaining on ct scan . amongst the patients with symptoms ,", "the leading complaints that resulted in the indication for imaging were the appearance of new cough or the increase of a previously manifested clinical picture suggestive of pneumonia and haemoptysis ( table 1 ) . amongst the 320 asx patients ," ], [ "our study shows that the incidental finding of non - small cell lung cancer occurred more frequently in smokers and in patients with a history of previous malignancy .", "our study shows that patients with incidentally detected lung cancer had a better survival because they had smaller cancers and earlier - stage disease .", "also , our asx patients were slightly older ( contrary to the study by raz et al . ) and more frequently smokers which may mean a higher degree of awareness of their risk for lung cancer as the higher prevalence of previous malignancy may have been one of the reasons for routine radiological surveillance . however , it is noticeable that more than 70% of patients in our group ( as in other series ) were studied by chest - x - ray , a method that has proved to be ineffective and that is not recommended as a screening tool by any major medical organizations .", "the proportion of early stages of lung cancer was higher amongst our patients with incidental findings .", "it shows that a screening program must assure that the health care system can provide all the necessary resources to treat the incidental findings and also the education to guarantee the availability of well - qualified primary care providers trained to encourage patients to follow diagnosis and treatment recommendations once a suspicion of lung cancer is raised from the imaging studies ." ], [ "in summary , our study shows that lung cancer as an incidental finding is not uncommon even amongst nonsmokers and that the better survival of patients with asymptomatic nsclc is related to the greater number of patients with earlier - stage disease .", "future research is needed to prospectively identify those patients not represented in the nslt who might benefit from ldct screening ." ] ]

[ [ "the main objective of our study was to show the long - term effects of fusion on the adjacent joints using our technique .", "the frequency of these complaints seems to be predicted by the alignment of the fusion which should be optimal [ 3 , 6 , 12 ] . in our clinic , we perform hip fusions with our standard technique using a cobra plate ; however , in those complex cases where optimal alignment and optimal fixation can not be achieved by this method we use the technique with a subtrochanteric pendulum osteotomy to achieve the correct alignment . even in the most difficult cases", "hip arthrodesis as a solution for hip - related problems is mainly superseded by total hip arthroplasty ( tha ) and , in the current treatment of hip disorders , there is hardly room left for arthrodesis of the hip .", "this method enables the optimal combination between a stable connection of the remaining femoral head neck and pelvis and an optimal alignment of the leg ." ], [ "were fused with the cobra plate technique and 14 with the arthrodesis with subtrochanteric pendulum - osteotomy technique .", "the clinical investigation consisted of : range of motion of hips and knees , mobility of the back , laxity of the knee joint , leg length discrepancies and quadriceps strength .", "since a hip arthrodesis can have a negative influence on the contralateral hip joint , the back and knees , we included these adjacent joints in this analysis .", "for complex cases in which the optimal combination of fixation of the arthrodesis and perfect limb alignment is not possible , for instance in septic arthritis with severe destruction of the joint or severe osteonecrosis , we performed an arthrodesis with a subtrochanteric pendulum - osteotomy .", "we prefer to perform a cobra plate technique , which was initially developed by schneider and later modified by several others , eliminating the need for the pelvic osteotomy [ 13 , 14 ] .", "the abductors are spared by performing a trochanteric osteotomy which is fixed on / over the cobra plate after the arthrodesis is performed ." ], [ "after an average follow up of 18.9 years ( range 5.631.4 ) , six patients had died .", "of which both received the arthrodesis for a destructive septic arthritis . in one of them", "one patient suffered from a deep venous thrombosis which was treated with anticoagulants . in two patients a deep infection occurred ,", "the clinical and radiological results for the arthrodesis and adjacent joint will be discussed separately . \n", "the remaining 30 patients were invited for follow - up and intensively screened . in this group of difficult hip disorders" ], [ "this descriptive study of our fusion techniques shows a good outcome measured by the smfa and a good vas for pain for all related joints after an average of 19 years of follow - up .", "if the arthrodesis is performed with an optimal alignment of the leg , complaints from the adjacent joints are minimal , even in the long term , and an acceptable quality of life can be obtained .", "we found that the mobility and quality of life were good for patients with an arthrodesis .", "although hip arthrodesis has lost it popularity it still is an option for young patient with severe hip disorders , while leaving the possibility to perform a tha at a later stage ." ] ]

[ [ ", we have divided the current review into two sections focusing on ( 1 ) protozoan infection and ( 2 ) helminth infection .", "lts play important roles in both th1 and th2 immune responses , which are involved in the defense against protozoan and helminth infections , respectively . in light of the current research on the role of lts in infectious diseases", "leukotrienes ( lts ) , first described by samuelsson 's group [ 1 , 2 ] , are a class of lipid mediators involved in several diseases but classically known for their effects on asthma and allergy .", "in addition , immunodeficient individuals , such as hiv patients , are characterized by low lt production , which has been associated with impaired immune responses and infection control ." ], [ "the main effects of lts , in both innate and adaptative immune responses , during the protozoan infections are illustrated in figure 1 .", "the downregulation of ltc4 by e. histolytica in inflammatory but not nave macrophages might be associated with the pathogen 's evasion mechanisms .", "therefore , the modulation of ltb4 during infection in association with the modulation of the immune system during leishmania transmission ( by saliva from the insect vector ) in synergism with genetic factors ( susceptibility ; th2 ) could markedly affect leishmania infection in humans .", "the effects of ltc4 inhibition on the course of malaria infection as well as the influence in the malaria pathogenesis are not known . in the experimental cerebral malaria model , mice infected with plasmodium berghei showed increased ltb4 production in the serum .", "mouse strains resistant ( c57bl/6 ) to leishmania infection mount th1 immune responses against leishmania .", "protective immunity against toxoplasmosis and chagas disease is mediated by th1 cells , cd8 t cells , and ifn- .", "the major protozoan parasites with clinical importance for human diseases are plasmodium ssp , leishmania ssp , trypanosoma cruzi , toxoplasma gondii , trichomonas vaginalis , and entamoeba histolytica [ 1517 ] .", "chagas ' heart disease is a severe clinical manifestation of trypanosoma cruzi infection . in chronic chagas disease ," ], [ "the main effects of lts , in both innate and adaptative immune responses , during the helminth infections are illustrated in figure 3 .", "in vivo models of infection with b. malayi could be used to better understand the role of cyslts in the pathogenesis of filariasis .", "together , these results suggest that cyslt inhibition might influence liver remodeling in s. mansoni infection . in this way , cyslt1 antagonists ( such as montelukast , zafirlukast , and pranlukast ) [ 4 , 122 , 123 ] , which are currently used in asthma treatment , could be evaluated for their effects on schistosomal granuloma remodeling in experimental or human schistosomiasis .", "similar to schistosomiasis , fasciolosis causes liver alterations , which can range from fibrosis to cirrhosis .", "toxocara canis is an intestinal parasite of dogs and is the etiologic agent of toxocariasis , also known as visceral larva migrans syndrome ( vlms ) .", "the function of lts in schistosomula is not known ; however , their production might accelerate parasite elimination and/or modulate the pathogenesis of schistosomiasis .", "parasitic worm survival in the host for longer periods depends on the ability of the parasite to evade the host immune system . the aba-1 protein from ascaris lumbricoides ( human parasite ) and ascaris suum ( pig parasite )" ], [ "lts are associated with the control of helminth and protozoan infections through their ability to modulate inflammatory processes and/or to promote direct cytotoxicity of protozoans . in addition , lts may also be associated with exacerbated pathogenesis in protozoan diseases , such as cerebral malaria , and helminthic diseases , such as schistosomal granulomas .", "interestingly , some helminths ( b. malayi ) might use the lts to complete their development to adult worms .", "in addition , other parasites produce lts ( s. mansoni and f. hepatica ) or produce enzymes involved in lt biosynthesis ( dirofilaria immitis ) . taken together ," ] ]

[ [ "we recently provided evidence that deficiencies in enzymes responsible for replicating g quadruplex ( g4 ) structures , such as the specialized dna polymerase rev1 and helicases fancj , wrn , and blm , can lead to localized changes in histone modifications and gene expression ( sarkies et al .", "we proposed that persistent replication fork stalling at g4s in mutants such as rev1 or fancj leads to pathologically long daughter strand gap formation , resulting in local uncoupling of dna synthesis from parental histone recycling .", "further , we show that , across the genome , chronic exposure to hu results in an altered pattern of gene expression similar to that seen in cells lacking the g4-unwinding helicases fancj , wrn , and blm , and that affected genes are enriched in g4 motifs .", "here we test this hypothesis by examining the effect of hydroxyurea ( hu)-induced nucleotide pool depletion on the epigenetic stability of a sensitive reporter locus , bu-1 , in chicken dt40 cells ( sarkies et al .", "we show that chronic treatment with low - dose hu induces stochastic instability of bu-1 expression , characterized by loss of the chromatin marks h3k4me3 and h3k9/14ac seen in the normally active locus ." ], [ "we therefore examined the pattern of histone modification at the bu-1 promoter by chromatin immunoprecipitation ( chip ) from bulk populations of cells exposed to hu .", "this revealed a striking degree of expression instability despite the small number of cell cycles through which the cells had passed ( figure 1e ) . using our previously described monte carlo simulation of bu-1a loss as a replication - dependent phenomenon ( schiavone et al . , 2014 ) , we estimated a per - division probability of generating of a bu-1a state during culture in hu of c. 0.15 . to obtain additional evidence that this induced transcriptional instability of bu-1 reflected decreased dna polymerase processivity , we asked whether bu-1 variants could be induced by aphidicolin .", "this is consistent with much of the dysregulation of expression resulting from processes that are not related to a coordinated physiological response either to treatment with hu or ablation of fancj or wrn and blm helicases .", "nonetheless , the degree of overlap in the dysregulated transcriptomes in these three conditions suggest that cells treated with hu and cells lacking fancj and wrn / blm face similar challenges . however , the enrichment of g4s in affected genes , while statistically significant , is still relatively modest , suggesting that other factors , such as secondary effects or other dna secondary structures , may be contributing as well .", "while treatment with hu resulted in dysregulation of genes with gene ontology ( go ) terms associated with cellular stress and nucleotide metabolism , a large number of miscellaneous go terms also were enriched to a similar degree ( table s2 ) ." ], [ "we have been able to explore directly the interaction between global replication stress induced by nucleotide depletion and a dna secondary structure to demonstrate how they conspire to exacerbate replication - dependent epigenetic instability .", "we have provided evidence that two parallel epigenetic perturbations contribute to permanent and transient epigenetic changes following an episode of replication stress .", "notably , the observation that the g4-binding ligand nmm can induce bu-1a expression instability at a dose that does not significantly impact on global replication dynamics provides strong evidence that g4 structures form readily during normal replication and that they are usually promptly resolved . the synergy between replication stress caused by nucleotide depletion and structured dna is of considerable potential importance to understanding the development of cancer .", "although the cell line we used in this study , dt40 , is itself transformed , we found no evidence of significant stress to the dna replication program under normal growth conditions . however , growth of the cells in low - dose hu recapitulated the key features of the acutely stressed replication observed in oncogene - expressing primary cells ( bester et al ." ], [ "dt40 cells culture and the strategy for removing and replacing the + 3.5 g4 motif in the bu-1 locus have been described previously ( schiavone et al . , 2014 ) .", "genetic manipulation of the + 3.5 g4 motif was performed in the bu-1a allele of cells in which the motif had been removed from the bu-1b allele to avoid the transvection - like effect between the alleles ( schiavone et al . , 2014 ) .", "rna was extracted from three independent wild - type cell populations treated for 7 days with hu and allowed to recover for another 7 days , as well as from three untreated parallel controls .", "written r scripts were used to identify and plot genes co - dysregulated between different mutants .", "genes that showed a change of > 0.25 log2 units relative to the mean wild - type intensity , with a p value of < 0.05 ( t test ) , were identified as exhibiting statistically significant transcriptional dysregulation . custom", "dna molecular combing was conducted 3 days into culture with 150 m hu .", "bu-1a cells were isolated after hu treatment using a moflo sorting cytometer ( dako - cytomation ) ." ] ]

[ [ "our strategy utilizes fourier transform ( ft)-based measurements in the solar portion of the optical spectrum , for optimally combining spatial resolution , spectral resolution , speed , and dynamic range .", "we have developed a set of small area , high - brightness spectroscopies that are appropriate for characterizing prototypes of light - harvesting devices utilizing plasmonic contact materials , for understanding the details of light - matter interactions in these systems .", "our primary interest in developing a set of rapid , high - sensitivity characterization tools capable of probing the influence of the perforated metal nanostructure , including pore size and pitch , as well as film thickness on the optical transmission modes , and ultimately the effect on solar cell performance .", "the aim is both to enable rapid screening of test device structures and to design structures capable of providing specific physical insight into coupling between the device active area and the modes of the patterned metal film ." ], [ "we achieve these advantages in the solar spectral region with an inexpensive benchtop source a true - cw high - brightness laser - driven light source ( energetiq eq-99 ) .", "primarily , the pulsed nature of the laser supercontinuum was found to generate small but detectable electrical transients that added significant noise to low - eqe regions of the spectrum .", "the key to the experiment is achieving solar ( or higher ) spectral irradiance levels in a spot size of < 100 m in order to achieve high signal / noise external quantum efficiency ( eqe ) measurements on prototype devices ." ], [ "the overall photon flux achieved is also quite high due to strong focusing of the light beam , exceeding 4.5 10 ms with high spatial resolution .", "we match the source , coupling , and focusing optics in order to optimize the throughput and achieve a high - brightness white - light spot .", "( the colour version of this figure is included in the online version of the journal . ) with the combination of a high - radiance light source and microscope focusing optics , we can achieve high - spectral irradiances for highly sensitive quantum efficiency measurements on small area devices .", "because g is proportional to both the area of the source and the solid angle into which it propagates , we aim to match the collimating and focusing optics without introducing a bottleneck ( e.g. the multimode optical fiber ) . the combination of the laser - driven light source and a parabolic mirror results in g ~ 3 10 mm sr , a value well matched to a 0.22 numerical aperture fiber with a 0.2 mm core size ( ~4.5 10 mm sr maximum g ) .", "we obtain nearly 1:1 imaging , with the core diameter of the multimode fiber limiting the ultimate spot size ." ], [ "( b ) spectral irradiance in the visible and near infrared with the 10 and 50 objectives compared to the solar air mass 1.5 standard ( astm g-173 ) .", "( a ) beam profile of the image formed using the eq-99 laser - driven light source and a low magnification 10 objective .", "because g is proportional to both the area of the source and the solid angle into which it propagates , we aim to match the collimating and focusing optics without introducing a bottleneck ( e.g. the multimode optical fiber ) . the combination of the laser - driven light source and a parabolic mirror results in g ~ 3 10 mm sr , a value well matched to a 0.22 numerical aperture fiber with a 0.2 mm core size ( ~4.5 10 mm sr maximum g ) .", "we obtain nearly 1:1 imaging , with the core diameter of the multimode fiber limiting the ultimate spot size .", "we match the source , coupling , and focusing optics in order to optimize the throughput and achieve a high - brightness white - light spot ." ], [ "with the combination of a high - radiance light source and microscope focusing optics , we can achieve high - spectral irradiances for highly sensitive quantum efficiency measurements on small area devices .", "the spectral irradiance is shown in figure 1(b ) for the output of the ldls microscopy system with the 10 and 50 objectives , along with the solar air mass 1.5 ( astm g173 - 03 ) spectrum for comparison .", "the key metric is that the solar spectral irradiance can be matched or exceeded across the visible and nir , particularly in the visible region of the spectrum , where we achieve in excess of 10 times higher irradiances .", "these numbers can be further improved since a 50:50 beam splitter ( optimized for the visible ) is used to direct light into the microscope objective .", "the overall photon flux achieved is also quite high due to strong focusing of the light beam , exceeding 4.5 10 ms with high spatial resolution .", "replacing the dielectric optic with a metallic one would double the output in the visible , but result in even more significant gains in the nir .", "however , for the purposes of this study , the irradiances achieved are more than sufficient for our measurements ." ], [ "in order to demonstrate the utility of a technique having simultaneously high spatial resolution , spectral resolution , and high sensitivity , we examined a set of prototype organic photovoltaic devices that employed a nanostructured plasmonic ag thin film as a transparent electrical contact .", "first , we discuss the photophysical properties of the perforated metal films with sub - wavelength apertures , in order to best match the contact s optical properties to the light absorption bands in the organic active area .", "this allows us to quickly prototype and characterize photovoltaic devices employing plasmonic and photonic structures ." ], [ "there are several factors that must be considered when evaluating performance of these devices , including scattering of light perpendicular to the direction of incidence , enhancement of absorption and radiative rates in near fields via the purcell effect , and photonic confinement of the propagating modes in the fully assembled device stack .", "we demonstrate that high - sensitivity photocurrent spectroscopy can be achieved on small - area organic photovoltaic devices with greater than six orders of magnitude dynamic range in the eqe spectra .", "these methods can be used to understand the interactions between the plasmonic modes of sub - wavelength metal hole arrays and an organic absorber ." ] ]

[ [ "based on comprehensive studies of hsps , this review offers important information regarding the mechanism related with the characteristic procedure of signal pathway according to the specifically cared substrate of each hsp , structural characteristics , specifically expressed location and those roles .", "accumulated studies show that hsp families are located in various sites within cell ; hsp10 , hsp60 , and hsp75 are located in mitochondria , however , others are present in the cytoplasm , cytosol , endoplasmic reticulum and nucleus in physiological conditions ( xu , 2002 ) .", "hsp families are made up by range from 10 to more than 100 kda in molecular size , and are located in various cellular compartments .", "the expressional locations of homologue or cognate members of hsps ( such as hsc70 vs hsp70 or hsp90 vs hsp90 ) are arbitrary according to the accumulated evidences indicating cell or tissue restricted expressions in vivo systems .", "the following general description involving molecular chaperones shows the outline regarding the maintenance of physiological homeostasis of living body .", "heat shock proteins ( hsps ) are a group of proteins that repress the denaturation of molecules by various stressful circumstances such as exercise , gravity , heat , oxygen , ca etc .", "hsp family has a structurally common chaperone subset controlling the form of proteins folding ( misfolding , facilitating , or reconstructuring ) , which maintains homeostasis of proteins to stressful circumstances ( dimauro et al . , 2016 ) ." ], [ "hspbs are also interacting with cytoskeleton proteins to maintain the homeostasis of cytoskeleton proteins by preventing those from damages , which results in conservation of the cell function .", "hsp16.5 has been structurally studied that it has dimeric -crystallin domain as a basic structural domain unit and this common domain is possibly related with the basic function as a molecular chaperone ( bertz et al . , 2010 ) .", "it has been reported that hsp10 is a by - product during the process of neoplastic cell proliferation and is considered as a growth factor in the cell ( quinn and morton , 1992 ) .", "hsp10 ( chaperonin ) is considered as a suppressor of maternal immune response via releasing from fetal placental unit ( noonan et al . , 1979 ) .", "hsp10 is also known as an obligatory autocrine growth factor in tumor cells ( quinn et al . ,", "hspb1 , hspb6 , hspb7 , and hspb12 are involved in the development of respiratory morphology such as cardiac muscles and the lethal myopathy in diaphragm and cardiomyopathy is caused with the lack of those hspbs ( juo et al . , 2016 ; ke et al . , 2011 ; rosenfeld et al . ," ], [ "the hsp60 family has been shown to be involved in the development of many diseases , such as adjuvant arthritis in rats , rheumatoid arthritis in humans , insulin - dependent diabetes mellitus in mice , and systemic sclerosis in humans .", "hsp47 acting as a chaperone for procollagen has been also found to be involved in atherosclerosis .", "these findings identify hsp47 as a novel constituent of human coronary atheroma , and selective upregulation by stress raises the possibility that hsp47 may be a determinant of plaque stability .", "hsp60 forms a large ( 970 kda ) hetero - oligomeric protein complex called the tcp1 ring complex ( containing tcp1 and several other proteins ) , which is essential for protein assembly .", "collagen , an extracellular matrix substrate , requires hsp47 to be transported within the cell and folded from three helices .", "hsp47 located in endoplasmic reticulum and functions to support collagen folding and its release to extracellular environments ." ], [ "hsp90 is an essential component of the glucocorticoid receptor , assembled in a complex of several proteins .", "hsp70 is in the cytosol and has family of grp78 which plays role in helping protein folding assembly and refolding , transporting and blocking protein degradation in endoplasmic reticulum .", ", hsp70 plays a role in the assembly and transport of newly synthesized proteins within cells , as well as in the removal of denatured proteins .", "hsp90 binds steroid receptors , protein kinases , intermediate filaments , microtubules , and actin microfilaments in a specific manner ." ], [ "hsp100 is located in the cytoplasm and cochaperones with hsp40 , hsp70 , and hsp90 .", "hsp110 is in the cytosol and nucleus ( dimauro et al . , 2016 ) . hsp110 and hsp70 super family commonly have the presence of a loop structure and hsp110 helps immune response ( zuo et al . , 2016 ) .", "hsp110 is also in working with hsp70 or grp78 to fold proteins and counter stress for cell survival ( gething and sambrook , 1992 ; hartl , 1996 ) .", "there are comparatively very rare studies regarding large hsps especially in the effect of exercise on the expression of large hsp and its function .", "( 2016 ) vaccinated with purified hsp110 results in reduced cancer metastasis thus large hsps amplify inflammatory signals in the cellular environment , suggesting potential endogenous immuno - stimulation during injury such as infection ( zuo et al . , 2016 ) ." ], [ "provoking these pathways in a positive way ( e.g. , physical exercise ) enhance hsps signal pathway and maintain / improve vital function of hsps in the living body .", "over several decades , hsps have been known as a potent factor playing a role in maintaining the homeostasis of living body .", "the broad ranges of hsps are organelle - specifically expressed within the body to play physiological roles via interacting with various signal pathways .", "versatile functions of hsps according to those wide ranges of molecular weight that care those each substrate have been increasingly attentive with other research subjects such as exercise , carcinogenesis , muscles , etc ." ] ]

[ [ "adenoid cystic carcinoma was first described by billroth in 1859 and called \" cylindroma \" due to its characteristic histologic appearance1 . in 1953 ,", "adenoid cystic carcinoma is a malignant salivary gland tumour characterized by a deceptive histologic pattern , indolent , locally invasive growth with high propensity for perineural invasion , local recurrence and distant metastasis .", "the present case report is unique as it shows presentation of adenoid cystic carcinoma as a solitary ulcer on the floor of the mouth rather than the classical nodular swelling ." ], [ "based on the clinical features and the histopathologic report , a final diagnosis of adenoid cystic carcinoma t4an0m0 was made.(fig .", "based on the history given by the patient and the clinical features , a provisional diagnosis of carcinoma of the floor of the mouth t4an0m0 , chronic generalized periodontitis , partially edentulous in respect to tooth # 7 , # 5 , # 3 , # 13 , # 14 , # 15 , # 24 , # 19 , # 25 , and # 31 was made .", "a 56-year - old male patient presented with a chief complaint of an ulcer in the left floor of the mouth for one week .", "lesions presenting as solitary ulcers on the floor of the mouth were considered in the differential diagnosis ." ], [ "adenoid cystic carcinoma is a malignant tumour with a deceptively benign histological appearance , characterized by indolent locally invasive growth with a high propensity for local recurrence and distant metastasis . according to the literature", "adenoid cystic carcinoma usually presents as a slowly growing , firm , unilobular mass in the glands .", "thus , the aim of this article is to emphasise that though the literature states that adenoid cystic carcinoma ulcerates the superficial lesional mucosa , it can also present as an ulcerative lesion .", "however , in our case it presented as a solitary ulcer on the floor of the mouth .", "the present case differs from usual cases of adenoid cystic carcnioma with respect to site and presentation , making it a rare entity ." ] ]

[ [ ", we share the design and implementation of the registry and propose a management information system for diabetes registry in puducherry district .", "a community - based cohort study showed the incidence of diabetes in rural puducherry to be 21.5 for 1000 person - year follow - up . in this context", ", a pilot project was set up to establish a diabetes registry in the primary health care setting of puducherry . here", "it is essential for similar registry in all states to implement and monitor activities under the national program for prevention and control of cancer , diabetes , cardiovascular diseases , and stroke . to make the registry sustainable and replicable", "india leads the world with the largest number of patients with diabetes earning the dubious distinction of being termed the diabetes capital of the world . according to the diabetes atlas 2015 published by the international diabetes federation , the number of people with diabetes in india is currently around 69.2 million and is expected to rise to 123.5 million by 2040 .", ", the first diabetes registry was set up in goa as a public private partnership , with the aim of population - based disease management .", "diabetes registries are used in many countries for population management of diabetes , outcomes management , and development of clinician decision support system , for example , national diabetes register ( ndr ) in sweden , new york glycated hemoglobin ( hba1c ) registry , and singapore diabetes registry ." ], [ "patients with diabetes registered in the chronic disease clinics run at phcs receive free insulin injections and oral hypoglycemic drugs along with regular blood sugar monitoring .", "union territory of puducherry has one of the best health care delivery services in the country .", "primary health care is delivered through a network of 27 primary health centers ( 12 urban and 15 rural ) and 52 subcenters , besides 8 hospitals .", "the study was planned in two phases : development of diabetes registry and development of management information system for diabetes [ figure 1 ] .", "design of the diabetes registry project data elements captured for the diabetes registry and source of data the research assistant underwent intensive training on all aspects of the study interview techniques , data recording , anthropometry , data entry , communication skills , organization of health systems , functioning of phc , etc .", "patients with a diagnosis of diabetes mellitus ( dm ) , enrolled in chronic disease clinics at the selected phcs were the participants .", "case report forms ( crfs ) were developed for collecting information required for the diabetes registry in terms of demographic characteristics , risk factors , complications , coexisting chronic conditions , lifestyle and medical management , and clinical outcomes phase i. the data elements captured in crfs for the registry are shown in figure 2 . the follow - up card for obtaining data for registry maintenance" ], [ "patients with diabetes registered in the chronic disease clinics run at phcs receive free insulin injections and oral hypoglycemic drugs along with regular blood sugar monitoring .", "union territory of puducherry has one of the best health care delivery services in the country .", "primary health care is delivered through a network of 27 primary health centers ( 12 urban and 15 rural ) and 52 subcenters , besides 8 hospitals .", "the study was planned in two phases : development of diabetes registry and development of management information system for diabetes [ figure 1 ] .", "design of the diabetes registry project data elements captured for the diabetes registry and source of data the research assistant underwent intensive training on all aspects of the study interview techniques , data recording , anthropometry , data entry , communication skills , organization of health systems , functioning of phc , etc .", "patients with a diagnosis of diabetes mellitus ( dm ) , enrolled in chronic disease clinics at the selected phcs were the participants .", "case report forms ( crfs ) were developed for collecting information required for the diabetes registry in terms of demographic characteristics , risk factors , complications , coexisting chronic conditions , lifestyle and medical management , and clinical outcomes phase i. the data elements captured in crfs for the registry are shown in figure 2 . the follow - up card for obtaining data for registry maintenance" ], [ "outcome targets could be set based on desired clinical outcomes , for example , proportion of patients with glycemic control , ldl < 130 mg / dl , and blood pressure < 130/80 mm hg .", "the proposed flow of information from the phcs to the nodal office ( in the directorate of public health ) would constitute the management information system for diabetes . based on the registry compiled , patient level indicators in terms of a number of patients who achieved glycemic control , compliance to treatment , existing level of complications , proportion of patients screened for complications in the past year , etc .", "second phase involves setting up a management information system based on monthly reporting of a number of patients with diabetes , glycemic control , referrals , and compliance to treatment from all these centers .", "process targets such as proportion of patients with hba1c , low - density lipoprotein ( ldl ) , microalbuminuria , or foot examination done in the past 1 year would be designed .", "patients with a diagnosis of dm , enrolled in chronic disease clinics at these phcs , were enlisted in the registry .", "data in the compiled registry can be categorized as ( 1 ) demographics , ( 2 ) risk factors , ( 3 ) disease and treatment details , ( 4 ) glycemic control , and ( 5 ) microvascular end - organ disease data . around 2177 patients with diabetes", ", the research assistant spent nearly 1015 min per patient to review all the details in the patient notebook , conduct interview regarding risk factors and treatment - seeking behavior , and perform anthropometry ." ], [ "banners intimating the process , timings , and requirements were put up , and notices were issued to patients with diabetes indicating the same .", "health workers facilitated the distribution of registration cards and created awareness and sufficient publicity for registration among the patients . during the chronic diseases clinics ,", "patients with a diagnosis of dm , enrolled in chronic disease clinics at these phcs , were enlisted in the registry .", "consent from the participants for use of clinical data was sought after they are explained about the registry and its purpose .", "a unique i d number was created for each patient based on phc code ( 3 digits ) , presence of comorbidity ( dm or diabetic and hypertensive [ dh ] ) , and patient identification ( 3 digits ) .", "the medical officer in charge also assisted in quality control by verifying a proportion of randomly chosen participants .", "details on their demographic characteristics , information on diabetes and coexisting chronic conditions , and clinical outcomes were recorded .", "registration was scheduled for 5 days a week on fixed timing , for a period of 12 months ." ], [ "banners intimating the process , timings , and requirements were put up , and notices were issued to patients with diabetes indicating the same .", "registration was scheduled for 5 days a week on fixed timing , for a period of 12 months .", "health workers facilitated the distribution of registration cards and created awareness and sufficient publicity for registration among the patients ." ], [ "consent from the participants for use of clinical data was sought after they are explained about the registry and its purpose .", "patients with a diagnosis of dm , enrolled in chronic disease clinics at these phcs , were enlisted in the registry .", "a unique i d number was created for each patient based on phc code ( 3 digits ) , presence of comorbidity ( dm or diabetic and hypertensive [ dh ] ) , and patient identification ( 3 digits ) .", "during the chronic diseases clinics , all patients with diabetes were approached and explained the purpose of this registry .", "details on their demographic characteristics , information on diabetes and coexisting chronic conditions , and clinical outcomes were recorded ." ], [ "the medical officer in charge also assisted in quality control by verifying a proportion of randomly chosen participants ." ], [ ", the research assistant spent nearly 1015 min per patient to review all the details in the patient notebook , conduct interview regarding risk factors and treatment - seeking behavior , and perform anthropometry .", "this was done to maintain brevity without compromising on data quality and utility of register at the clinics .", "time taken to complete the registration process at each phc was variable and depended mainly on the number of clinic days and efficiency of the existing system ( ranging from 6 to 12 weeks at each center ) ; completion of registry took around 14 months .", "data in the compiled registry can be categorized as ( 1 ) demographics , ( 2 ) risk factors , ( 3 ) disease and treatment details , ( 4 ) glycemic control , and ( 5 ) microvascular end - organ disease data . around 2177 patients with diabetes", "discussions were held with a few health workers and medical officers before finalizing the register .", "six patients had type 1 dm ; 332 patients received insulin from the phcs . on an average" ], [ "second phase involves setting up a management information system based on monthly reporting of a number of patients with diabetes , glycemic control , referrals , and compliance to treatment from all these centers .", "this requires the use of register by the staff - in - charge of the clinics on a regular basis for monitoring patient care and follow - up .", "the proposed flow of information from the phcs to the nodal office ( in the directorate of public health ) would constitute the management information system for diabetes . based on the registry compiled , patient level indicators in terms of a number of patients who achieved glycemic control , compliance to treatment , existing level of complications , proportion of patients screened for complications in the past year , etc .", "process targets such as proportion of patients with hba1c , low - density lipoprotein ( ldl ) , microalbuminuria , or foot examination done in the past 1 year would be designed .", "the target for a process indicator for each patient would be availability of investigation reports during the stipulated interval ( 1 year ) .", "outcome targets could be set based on desired clinical outcomes , for example , proportion of patients with glycemic control , ldl < 130 mg / dl , and blood pressure < 130/80 mm hg .", "based on monthly reporting of activities , process and outcome measures can be designed to monitor the services provided ." ], [ "the singapore diabetes registry was built to enhance the continuity of care for patients with diabetes and facilitate greater efficiency in outcome measurement .", "efforts to achieve improved outcomes for diabetes require an organized population - based approach to diabetes management using all of the components of the chronic illness care model that identifies the six essential elements of a health - care system the community , the health system , self - management support , delivery system design , decision support , and clinical information systems .", "any delivery system seeking to manage their patients with diabetes using a disease management program that is internally integrated within their primary care delivery system must develop a registry for diabetes as an essential element of the program .", "potential applications of diabetes registry in this project in puducherry , this pilot project was started with the aim of creating a population - based diabetes registry . in the first phase , known patients with diabetes availing services at the selected phcs were enrolled .", "the swedish ndr was initiated in 1996 with 41,000 patients as a tool for local quality control and benchmarking against the national treatment aims .", "a web - based interactive gis system , saudi national diabetes registry , was designed to serve as an electronic medical file for patients with diabetes retrieving data from medical files by trained registrars .", "this can be expanded to the entire population for registering all known patients with diabetes through house - to - house enumeration . the proposed design and methodology of implementation can be useful to plan such registries for chronic diseases under the national health program ." ], [ "this study has documented the methodological details , and the learning experiences gained while developing a diabetes registry at the primary health care level and the scope for upscaling to a management information system for diabetes and a state - wide registry .", "john 's medical college and research institute , bengaluru , with training supported by nhlbi - uh , global health initiative for chronic diseases ." ], [ "john 's medical college and research institute , bengaluru , with training supported by nhlbi - uh , global health initiative for chronic diseases ." ], [] ]

[ [ "therefore , this study was conducted to understand the association of sh with abnormalities in the serum lipid profile and aip in apparently healthy adult females .", "the study also aims to find out whether any correlation exists between aip and serum tsh levels among sh cases .", "thus , though the effect of overt hypothyroidism on abnormalities in lipid parameters has already been established , the relationship between sh and lipid metabolism needs further study .", "however , research on the complex interrelationship between sh and lipid ratios and aip has been extremely rare .", "furthermore , there is insufficient information regarding the effect of sh on lipid ratios and aip .", "aip , which is a good surrogate marker of sdldl , has been indicated as a superior predictor of cardiovascular risk than the previously used lipid parameters ." ], [ "included in sh group and eu group , the lipid ratios were calculated as tc / hdl - c , tg / hdl - c , and ldl - c / hdl - c .", "logistic regression was performed to ascertain the effects of age , tc , tg , hdl , ldl , tg / hdl , tc / hdl , ldl / hdl , and aip on sh . variables which are significant at < 0.1 in simple regression were considered for multiple regression analysis and because of multicollinearity , only one of the following variables were included in the model at a time : tg , tg / hdl , and aip .", "for the study , the following results were noted : serum tsh , ft3 , ft4 , tc , tg , hdl - c , and ldl - c . for each subject", "next , the reports of the subjects were collected with special emphasis on serum fasting glucose , liver function tests , renal function tests , complete blood count with peripheral smear , and routine examination of urine .", "based on the ft3 , ft4 , and tsh values , the subjects were classified into sh and eu groups according to the inclusion criteria .", "study subjects were taken from the records of apparently healthy adult females coming for a master health check to our hospital from june 1 , 2014 , to may 30 , 2015 .", "the study was a retrospective , time - bound , hospital - based , case control study carried out by detailed analysis of patient records in the department of biochemistry at a medical college in southern india ." ], [ "since the data were not normally distributed , the difference in lipid parameters , lipid ratios , and aip between sh group and eu group , were compared using mann ", "logistic regression was performed to ascertain the effects of age , tc , tg , hdl , ldl , tg / hdl , tc / hdl , ldl / hdl , and aip on sh . variables which are significant at < 0.1 in simple regression were considered for multiple regression analysis and because of multicollinearity , only one of the following variables were included in the model at a time : tg , tg / hdl , and aip .", "whitney u - test and a p < 0.05 was considered statistically significant . in the sh group , aip and tsh were correlated using spearman 's correlation .", "the data were analyzed using spss statistical software ( v 16 ; ibm corporation , armonk , ny , usa ) . to describe continuous variables , mean and standard deviation was used ." ], [ "aip has a significantly higher risk ( or = 22.38 ) than tg ( or = 1.01 ) or tg / hdl ( or = 1.42 ) .", "the data presented in table 3 shows the comparison of lipid ratios such as tc / hdl - c , tg / hdl - c , and ldl - c / hdl - c between sh and eu groups .", "it includes mean and standard deviations of tc , tg , hdl - c , and ldl - c of eu and sh groups . the differences between the means of tc , tg , and ldl - c were found to be statistically significant while that for hdl - c was found to be insignificant ( p = 0.712 ) .", "* difference of the means of aip between eu and sh groups is statistically significant ( p = 0.002 , < 0.05 ) correlation between atherogenic index of plasma and thyroid stimulating hormone in subclinical hypothyroidism group .", "however , there was a statistically significant ( p < 0.05 ) difference between the means of ft3 , ft4 , and tsh of the sh and eu groups ." ], [ "thus , the positive association of dyslipidemia and sh indicates a need for regular screening of sh patients for dyslipidemia to enable early diagnosis and treatment of the condition . even in patients who have a normal conventional lipid profile , lipid ratios , and aip", "control study , where we retrospectively studied patient records to investigate the abnormalities in conventional lipid profile , lipid ratios , and aip in sh .", "however , studies on the abnormalities in lipid ratios and aip which are better markers of cardiovascular risk than conventional lipid profile are rare . with this background", "the study also aimed to find out if there was any correlation between tsh and aip levels in sh . in our study", "however , this is a cross - sectional study and so , whether sh leads to high aip could not be determined . moreover ,", "the molecular basis for this association can only be elucidated by experimental studies with animal models ." ], [ "an atherogenic lipid profile is a prequel to cardiovascular and cerebrovascular diseases , and hence , its association with sh in general and calculation of aip , in particular , could provide avenues for early diagnosis and rigorous management of dyslipidemia in hypothyroidism .", "abnormalities found in conventional lipid profile as well as in lipid ratios and aip imply sh to be a risk factor for dyslipidemia and atherosclerosis .", "this study helped to bridge the knowledge gap as well as paucity of indian data available regarding the complex interplay between thyroid hormones and atherogenic lipid parameters , particularly in sh .", "the study also emphasizes the importance of aip in the detection of atherogenic risk in sh patients , even in the presence of minor dyslipidemia ." ], [], [] ]

[ [ "this review discusses the regulation of hif- by gsk-3 and compares it with hydroxylase - dependent hif- protein regulation .", "indeed , different kinases , among them glycogen synthase kinase 3 ( gsk-3 ) , have been identified to directly phosphorylate hif- proteins .", "the ability of mammals to respond to an inadequate o2 supply , commonly termed hypoxia , is crucial for their survival .", "in addition to hypoxia , hif -subunits were also found to respond to various growth and coagulation factors , hormones , cytokines , or stress factors already under normoxia .", "hif -subunits are tightly regulated , and post - translational hydroxylations in response to hypoxia appear to be of major importance ." ], [ "the hif -subunit represents the stable nuclear subunit primarily represented by the ubiquitously found arnt ( arylhydrocarbon receptor - nuclear translocator ) protein ; however , arnt2 or artn3 , although to a lesser extent , also appear to be able to take part in the formation of hif dimers ( reviewed by semenza5 ) .", "together , the different hif - and -subunits may give rise to the formation of several combinations of hif dimers.5,10 hif-1 and hif-2 are the best - studied hif- isoforms .", "the residues between n - tad and c - tad represent an inhibitory domain ( amino acids 604785 in hif-1 and amino acids", "in their active form , hifs are heterodimeric transcription factors consisting of an - and -subunit ." ], [ "this hydroxylation prevents interaction with the coactivator proteins cbp / p300.4144 thus , the major posttranslational modification appears to be the oxygen - dependent hydroxylation.36,37", "hif -subunit activation under hypoxia is mainly the result of an increased protein stability and coactivator recruitment , although transcriptional and translational mechanisms also were shown to be involved in hif -subunit activation.22,2630 as a result , hif- proteins accumulate , translocate to the nucleus , and dimerize with hif- to form a functional transcription factor.31 thus , in the presence of oxygen ( ie , normoxia ) , hif- proteins become degraded .", "the prolyl hydroxylation and ubiquitination can be further promoted by the binding of phd2 to os938 and that of hif-1 , vhl , and elongin c to ssat2 , respectively.39,40 in addition to prolyl hydroxylation , a conserved asparagine residue ( n803 in hif-1 and n852 in hif-2 ) in the c - tad is hydroxylated by the factor - inhibiting hif in an oxygen - dependent manner ." ], [ "the pkb / akt targets hdm2,54,55 mammalian target of rapamycin ( mtor),56 and gsk-357 were shown to contribute to changes in hif- protein levels ; however , only gsk-3 was shown to do this directly , ie , by phosphorylating hif- proteins .", "the pi3k / akt pathway is considered to control hif-1 within the cell via regulation of hif-1 protein synthesis and stability .", "in addition to hydroxylation , hif- transcriptional activity and protein stability appear also to be dynamically regulated by other posttranslational modifications such as acetylation , s - nitrosylation , sumoylation , and phosphorylation ( for review , see dimova and kietzmann45 ) .", "however , it appeared that hif- proteins are not directly phosphorylated by pkb / akt but , rather , by a pkb / akt target .", "indeed , a panel of protein kinases is reported to be involved in hif-1 phosphorylation , either directly ( table 1 ) or indirectly.4752 although the individual action of certain kinases on hif-1 regulation was mainly studied in vitro ( table 1 ) , the in vivo mechanisms are likely much more complex ." ], [ "together , these results demonstrate that hif-1 protein stability is regulated in a dynamic manner involving different ubiquitin ligases and deubiquitinases .", "in contrast , the oxygen - independent but phosphorylation - dependent ubiquitination of hif-1 is counteracted by ubiquitin - specific protease 28-mediated deubiquitination .", "as such , the hydroxylation- and vhl - dependent ubiquitination and degradation of hif-1 under normoxia is opposed by the deubiquitinase vdu2 .", "gsk-3 is a serine / threonine kinase that was first identified as a negative regulator of glycogen synthesis ; inhibition is achieved through phosphorylation of glycogen synthase.58,59 since its initial discovery , gsk-3 has been found to be involved in numerous signaling pathways initiated by diverse stimuli and to contribute to the regulation of cell proliferation , stem cell renewal , apoptosis , and development , which are processes often associated with hypoxia . because of these multiple involvements ," ], [ "the finding that gsk-3 is involved in the degradation of hif-1 indicated similarities with the destruction of -catenin in the canonical wnt signaling pathway . in this pathway ,", "gsk-3 and -catenin are part of a destructive complex in which binding of gsk-3 and -catenin promotes phosphorylation of -catenin by gsk-3 , which requires priming phosphorylation by casein kinase 1 , -isoform .", "similarly , gsk-3-mediated phosphorylation of hif-1 recruits fbw7 , and thus targets hif-1 for ubiquitylation and proteasomal degradation.99 those very similar scenarios imply interference or interconnection of both the wnt/-catenin and hypoxia / hif-1 signaling on the level of gsk-3 ." ], [ "because regulation of hif- protein stability is critical for its activation , identification of kinases contributing to hif- stability may provide a link explaining normoxic hif- stabilization by extracellular stimuli . in light of this , dysregulation of gsk-3 is thought to underlie the pathogenesis of various diseases that are also associated with hypoxia and changed hif- levels , such as type 2 diabetes mellitus , alzheimer s disease , mood disorders , cardiovascular diseases , and cancer.122 thus , given that gsk-3 upstream regulation leads to inhibition of gsk-3 and hif-1 accumulation , this raises the question whether it is an option to target gsk-3 in those diseases and disregard the adverse effects . although research from the last decade has demonstrated that a number of kinase pathways contribute to hif-1 regulation , data for hif-2 or hif-3 are limited .", "hypoxia and hifs play important roles in many critical aspects of physiological and pathological processes .", "most solid cancers contain hypoxic areas , and clinical data demonstrate that overexpression of hif-1 is associated with an increased risk for patient mortality . in line ,", "taking into consideration the overlapping , but different , roles of the hif- proteins , more knowledge about the phosphorylation - dependent regulation of hif-2 and hif-3 is necessary to better understand both already - observed general and different effects .", "activation of multiple oncogenic pathways including growth factor signaling coupled with enhanced kinase signaling is a common event in tumors , thus making it likely that kinases are involved in the modulation of hif- function .", "downregulation of hifs interferes with tumor growth , vascularization , invasion , and metastasis , as well as radiation and chemotherapy ." ] ]

[ [ "of relevance to the current study , there is evidence that fs cells play a role in the absorption of ions and water from the luminal spaces [ 46 ] , which could involve the activity of an apical na / h exchanger .", "the current results support the view that fs cells play a major role in regulating the ionic composition and volume of the interstitial and follicular fluid and suggest that nhe2 serves as an absorptive na / h exchanger on the luminal surface of fs cells that counters fluid accumulation resulting from cftr - mediated secretion of anions .", ", it was shown that pituitaries from mice lacking nhe2 exhibited significant histopathological changes , particularly in the pars distalis and pars intermedia , both of which are derivatives of the primitive gut ectoderm ." ], [ "basement membrane redundancy was quantified by drawing a line perpendicular to the endothelial cell basal lamina up through the basement membranes to the closest fs cell basal lamina .", "intersections of that grid lying over the following cytoplasmic and nuclear features were counted for pars distalis : ( 1 ) fs cell canalicular space , ( 2 ) obvious fs cell cytoplasm and nuclei ( mainly where the cells were adjacent to canalicular lumens ) , ( 3 ) nuclei and cytoplasm of somatotrophs and mammotrophs ( as a single group of cells containing large granules ) and other endocrine cells ( those with smaller granules ) , ( 4 ) lipid droplet inclusions , ( 5 ) blood vessels and vascular luminal contents ( endothelium , red cells , and vascular space ) , and ( 6 ) negative areas ( those which were not tissue content , such as grid bars , edges , folds , and tears ) .", "although it was not possible to absolutely identify the cell types in 1.5 m thick sections at the light microscopic level , morphological consistencies among cell types allowed for a reasonable separation of the large granule cells , granule cells with smaller granules , fs cells , and capillaries .", "the number of cells per light micrograph was approximately 200 ; metaphase cells were counted and the percentage of cells in mitosis calculated . ", "animals were separated into two age groups , age 1 : 17 days to 2.5 months , age 2 : 4 months1 yr , and 37 mice were used . the number ( n ) of mice in any given analysis or bar graph is given in the legend .", "genotypes were determined by pcr analysis of dna isolated from tail biopsies using a set of 3 primers that simultaneously amplified wild - type and nhe2-null alleles . forward ( 5-catctctatcacaagttgcccacaatcgtg-3 ) and reverse ( 5-gtgactgcatcgttgagcagagactcg-3 ) primers from the 5 and 3 ends of exon 2 amplified a 450-base pair product from the wild - type allele . a reverse primer ( 5-gacaatagcaggcatgctgg-3 ) complementary to sequences within the neomycin resistance gene cassette , which was inserted into exon 2 , and the forward primer described above amplified a 221-base pair product from the targeted allele . ", "some of these slides were stained with hematoxylin and eosin ( h&e ) and others were prepared for in situ hybridization .", "data points from wt mice were pooled since no significant differences were found in morphometry within age comparisons ." ], [ "the relative levels of expression suggest that expression of nhe2 mrna might be restricted to a limited area of the pituitary or to a small subset of pituitary cells . in situ hybridization", "the order and incidence of junctional complexes , desmosomes , and desmosomal - mitochondrial associations in a tally made from electron micrographs revealed a significant reduction from wt in the number of desmosomes which were associated with 2 mitochondria ( table 1 ) . ", "northern blot analysis of pituitary and colon rna ( figure 2 ) showed that nhe2 mrna is expressed in the pituitary , but at much lower levels than in colon , the tissue in which the highest levels of nhe2 are expressed .", "the increase in the vd of fs cells appeared to be fs cell hypertrophy rather than hyperplasia ; this backed up the fact that there was no statistically significant increase in the number of mitotic cells in the nhe2 mice ( nhe2 : 0.022 0.17 ; wt : 0.003 0.02 , p = .48 ) . while the vd of folliculo - stellate cells increased in nhe2 mice , in several other respects , fs cell morphology and ultrastructure were similar to those of wt fs cells ( figure 5 ) .", "junctional complexes , intercellular spaces , membrane interdigitations , microvilli , and pinocytotic vesicles / caveolae are not different in nhe2 than in wt samples , as counted in this study ." ], [ "thus , if ion secretion serves an important function in the pituitary , as suggested by studies on the pig cystic fibrosis model and human infants with cystic fibrosis , then one might expect that disease conditions or drugs that impair ion secretion or homeostatic regulation of the volume and ionic composition of the canalicular fluid would affect pituitary function and human health .", ", it has long been reported that pituitary function is impaired in cystic fibrosis , the most common genetic disease in humans , and recent work showed that cftr is expressed in pituitary and that the absence of its activity impairs hormone secretion ( , and references therein ) . in conclusion ,", "the absence of apparent effects on growth and development suggests that dilation of the canaliculi resulting from the loss of nhe2 is a relatively benign defect .", "the dilation of the canaliculi suggests that nhe2 is the major absorptive mechanism that counters the accumulation of canalicular fluid resulting from ion secretion by fs cells .", "lipid droplet accumulation in the cytoplasm of cells is a well - recognized indicator of cell stress and pathology [ 4245 ] ." ] ]

[ [ "autonomic neuropathy ( an ) has long been recognized as a significant health risk and leads to reduced quality of life ( qol ) , increased mortality and morbidity and increased health care costs ( 1 - 2 - 3 ) .", "our hypotheses are that the beta - blocker , metoprolol , would inhibit sympathetic tone less than the combination alpha- and beta - blocker , carvedilol .", "second , we hypothesize that carvedilol will also result in an increase in parasympathetic activity .", "is known to be cardioprotective and is associated with greater longevity in geriatric and heart disease patients ( 16 , 18 ) .", "propranolol and metoprolol have been studied previously for their effect on diabetic autonomic nerve dysfunction , and these drugs affect only sympathetic inhibition ( 19 , 20 ) .", "cardiovascular autonomic neuropathy ( can ) is an end - stage condition and is characterized by structural deficits due to loss of parasympathetic or sympathetic neurons that innervate the heart and blood vessels , resulting in abnormalities in heart rate ( hr ) control and vascular dynamics ( 3 ) .", "eta1-adrenergic agonists ( beta - blockers ) are known to reduce sympathetic activity ( 17 ) and thereby alter sb .", "thus , carvedilol has a broader affect on the ans , which may explain why it further reduces mortality ( 23 ) ." ], [ "the registry consists of 147 arrhythmia - free patients diagnosed with noninsulin - dependent ( type 2 ) diabetes mellitus from eight ambulatory clinics located in new york , pennsylvania , new jersey , maryland and virginia .", "the patient selection method and demographics , and the three noninvasive autonomic measurement methods used for screening , are described in the companion article ( 24 ) .", "eg3 patients were case - matched to the study population patients with respect to comorbid conditions such as hypertension ( htn ) and cardiovascular disease ( cvd ) , as well as age , gender , height and weight .", "each experimental patient in the registry performed a baseline p&s study ( test n ) the day of the prescribed change to their beta - blocker . to remain in the registry ,", "there needed to be documentation of the patient s compliance according to grouping , for at least 3 months , after which the patient performed a follow - up p&s study ( test n+1 ) .", "the responses are normalized to 1.0 in the baseline test to highlight the changes ( ) in response to beta - blocker titration ." ], [ "normalized lf ( lfnu ) increases in response to discontinuing carvedilol , and decreases in response to discontinuing metoprolol ( fig .", "2b , top ) to discontinuing either agent increases significantly ( p<0.001 for carvedilol response and p<0.010 for metoprolol response ) , and the average parasympathetic responses decrease significantly ( p<0.001 ; fig . 2b , middle ) . for both p and s , the change in response to carvedilol is greater than that for metoprolol", "the average sb response to discontinuing carvedilol increases , whereas the average sb response to discontinuing metoprolol decreases . for those patients continuing beta - blocker therapy without any adjustment ( fig .", "3b , middle ; p<0.010 ) in response to carvedilol , and increases in response to metoprolol .", "4 , top row ) . in response to increasing beta - blocker , tsp increases in response to carvedilol ( p<0.001 ) and decreases in response to metoprolol ( p<0.010 ) ( see fig ." ], [ "lf increases in response to discontinuing carvedilol , which is consistent with a significant increase in sympathetic activity as compared with the decrease in parasympathetic activity . however , lf decreases in response to discontinuing metoprolol .", "this dichotomy may also be due to the dual alpha- and beta - adrenergic activity of carvedilol having greater sympathetic affect . given that lf is defined as a measure of sympathetic activity as modulated by parasympathetic activity ( 25 ) , the effect of discontinuing metoprolol on the lf measure may indicate a weaker sympathetic rebound and a relatively stronger decrease in parasympathetic activity .", "our study concurs with , and expands upon , previously reported effects of beta - blockers in restoration of autonomic balance ( 20 ) .", "more specifically however , our study shows that carvedilol , which is both an alpha- and beta - adrenergic blocker , demonstrates a greater response than metoprolol , which is a pure beta - blocker , and demonstrates clear differences on the effects on sympathovagal balance ( sb ) .", "these results suggest that carvedilol not only reduces overall sympathetic dominance , but concomitantly increases parasympathetic activity , while metoprolol only reduces relative sympathetic dominance . after weaning from beta blockers , an increase in sympathetic activity and decrease in parasympathetic activity", "significant increases in the sb response to withdrawing carvedilol indicate a shift in the autonomic balance toward a more sympathetic dominant state , as our results reflect ." ], [ "the subpopulation of patients who continued current beta - blocker therapy without any adjustment can be considered the control group . as shown in figure 2c , no significant changes in average hemodynamic responses are demonstrated ( note the scale of the ordinate ) . similarly , as shown in figure 3c , no significant changes in average parasympathetic or sympathetic responses are demonstrated .", "the changes in the p&s method are consistent with the hemodynamic changes observed for the same group ( p = 0.055 ) . as seen in figure 4c , the hrv - alone , spectral analysis method showed statistically significant responses to the continuation of beta - blockers .", "the spectral analysis of hrv - alone changes are not consistent with the hemodynamic changes observed for the same group ( p = 0.880 ) .", "carvedilol further decreased the lf measure ( assumed to represent sympathetic tone ) and increased the hf measure ( assumed to represent parasympathetic tone ) , whereas metoprolol decreased hf and produced no change to the lf measurements ." ], [ "while beta - blockers cause decreases in mhr , sbp and sympathetic activity ( see figs . 2 and 3 ) , the net desired effect is an overall reduction in relative sympathetic activity .", "these results suggest that carvedilol not only reduces overall sympathetic dominance , but concomitantly increases parasympathetic activity , while metoprolol only reduces relative sympathetic dominance .", "4a , top ) in response to carvedilol with respect to metoprolol is demonstrated . since tsp is based on the arithmetic sum of lf and hf ( 25 ) , and since the lf measure decreases , and the hf measure increases , the change in tsp indicates a relatively greater increase in the hf with carvedilol than with metoprolol .", "similarly , increase in e / i ratio , rangehr and hrv , and the greater sdnn increase in response to carvedilol over metoprolol is significant .", "3a ) responses to the introduction of metoprolol are greater than that to carvedilol due to overall reduction in relative sympathetic activity , a significantly greater increase in tsp ( fig .", "therefore , the change in tsp would indicate a net , relative increase in parasympathetic activity ." ], [ "lf increases in response to discontinuing carvedilol , which is consistent with a significant increase in sympathetic activity as compared with the decrease in parasympathetic activity . however , lf decreases in response to discontinuing metoprolol .", "increases in mhr , bp and sympathetic activity increase significantly more after weaning from carvedilol than weaning from metoprolol .", "after weaning from beta blockers , an increase in sympathetic activity and decrease in parasympathetic activity is expected .", "this dichotomy may also be due to the dual alpha- and beta - adrenergic activity of carvedilol having greater sympathetic affect . given that lf is defined as a measure of sympathetic activity as modulated by parasympathetic activity ( 25 ) , the effect of discontinuing metoprolol on the lf measure may indicate a weaker sympathetic rebound and a relatively stronger decrease in parasympathetic activity .", "significant increases in the sb response to withdrawing carvedilol indicate a shift in the autonomic balance toward a more sympathetic dominant state , as our results reflect ." ], [ "establishing and maintaining normal parasympathetic and sympathetic balance may reduce morbidity risk and minimize mortality risk .", "the development of ad is a multifactorial process , and maintaining sb may improve longevity and decrease morbidity and mortality . thus , it is likely that combination therapies directed at the various components of the pathogenic pathway will be needed to reduce the development of autonomic nerve fiber dysfunction .", "with intensification of glycemic control , accord demonstrates a 22% increase in sudden deaths associated with ad .", "carvedilol has a more profound effect in reducing sympathetic activity as compared with the pure beta - blockade of metoprolol .", "our results also suggest that carvedilol not only reduces overall sympathetic dominance , but concomitantly increases parasympathetic activity .", "overall , the hemodynamic results are consistent with the known effects of changes in specific beta - blocker vs alpha- and beta - blocker therapy ( 21 - 22 - 23 ) . the combination of alpha- and beta - blocker decreases sympathetic tone and increases parasympathetic tone , whereas a pure beta - blocker precipitates a reflex increase in alpha - adrenergic activity , leading to less of an increase in parasympathetic tone .", "noninvasive measures of hemodynamic and autonomic responses to changes in beta - blocker therapy were collected ." ], [ "establishing and maintaining normal parasympathetic and sympathetic balance may reduce morbidity risk and minimize mortality risk .", "the importance of autonomic assessment is emphasized by the current reports from the diad study ( 28 ) and the accord study ( 29 , 30 ) .", "with intensification of glycemic control , accord demonstrates a 22% increase in sudden deaths associated with ad .", "thus , it is likely that combination therapies directed at the various components of the pathogenic pathway will be needed to reduce the development of autonomic nerve fiber dysfunction .", "the development of ad is a multifactorial process , and maintaining sb may improve longevity and decrease morbidity and mortality .", "diad demonstrates that abnormal hrv is associated with a prediction of greater increased risk of major adverse cardiovascular events ( maces ) ." ] ]

[ [ "2location of barcelos , state of amazonas , brazil , 2010 , and number of blood samples collected by teams ( a - f ) and city district for screen tests . \n \n", "the city of barcelos , where this study was conducted , is located on the right bank of the negro river , 490 km from manaus , the capital of am ( \n fig . 2 \n ) . \n", "\n location of the study area - \n the administrative district of barcelos is located north of am . to the east , it borders the state of roraima ; to the southeast and south , it borders the district of santa isabel do rio negro and , to the north , it borders venezuela ( latitude 058'1 \" south of the equator and longitude 6256 \" west of greenwich ) .", "survey and samples - \n the new serological survey was conducted in the main settlement of barcelos and covered the entire resident population that was willing to participate in the survey after providing informed consent . for minors ,", "( \n 2011 \n ) for the detection of anti- \n t. cruzi \n antibodies .", "each team was composed of two health agents ; the two laboratory technicians each supervised three of the teams and all six teams were monitored by the postgraduate student . in total , 4,880 blood samples were collected on filter paper in accordance with the technique of souza and camargo ( \n 1966 \n ) for the screening test : 770 samples were collected by team a ( so sebastio ) , 925 by team b ( so lzaro ) , 1,000 by team c ( so francisco ) , 728 by team d ( nazar ) , 817 by team e ( vila linhares ) and 640 by team f ( aparecida ) . all the blood samples on the filter paper were eluted in 250 l of phosphate - buffered saline ( ph 7.2 ) and were tested using the iif test , as recommended by fife and muschel ( \n 1959 \n ) and souza and camargo ( \n 1966 \n ) , as adapted by ostermayer et al ." ], [ "4titres of igg of immunofluorescence in serum from confirmatory serological tests in barcelos , state of amazonas , brazil , 2011 .", "3percentage of positive immunefluorescence by age group in the screen tests in barcelos , state of amazonas , brazil , 2010 . \n \n", "the numbers of blood samples collected on filter paper , along with the percentage of positivity for \n t. cruzi \n infection , varied according to the number of people living in the area and their degree of exposure to infection in rural areas , especially in relation to piassava harvesters and their families ." ], [ "however , among the 46 individuals in this group who underwent xenodiagnosis and polymerase chain reaction ( pcr ) analysis , we only isolated \n t. cruzi \n in 19% of the individuals through xenodiagnosis and the pcr was only positive in these cases ( coura et al .", "the prevalence of \n t. cruzi \n infection in barcelos was observed to vary according to the intensity of exposure . in a group of 244 highly exposed individuals", ", we found that 11% were serologically positive ( iif and tesa - blot ) .", "additionally , the low titres of anti- \n t. cruzi \n antibodies demonstrated in the present study favoured occurrences of cross - reactions with other infections .", "finally , we recommend that the serological diagnosis of \n t. cruzi \n infection in the amazon region should be made using at least two different techniques , e.g. , immunofluorescence and elisa and confirmed by western blot analysis when possible .", "1999 \n ) certainly occurred due to cross - reactions with a variety of diseases that are endemic in this area , including malaria , american cutaneous leishmaniasis , tuberculosis , leprosy and \n trypanosoma rangeli \n infection .", "( 1998a , b ) demonstrated only two lineages of \n t. cruzi \n in the area ( tci and z3 ) ." ], [] ]

[ [ "survival data were evaluated according to the histologic tumor types , presence or absence of lymph node metastasis , number of lymph nodes involved , classification of lymph node metastasis , area of metastasis , number of metastatic foci , maximum diameter of metastasis , and tma .", "animals that were alive and that died of unknown causes or causes unrelated to the tumor were censored . among the most common causes was visceral ( calazar ) leishmaniasis ( leishmania chagasi ) , which is endemic in the city of belo horizonte , minas gerais , brazil , where the research was conducted .", "the size of the largest metastatic deposit , measuring 0.06 mm , was used to classify lymph node metastasis as isolated tumor cells ( itc ) .", "the animals with malignant mammary tumors were assessed , and the endpoints were defined according to the type of analyses : histologic tumor types ( 827 days of followup ; 84 animals ) , presence or absence of lymph node metastasis ( 1112 days of followup ; 84 animals ) , number of lymph nodes involved ( 778 days of followup ; 84 animals ) , classification of metastasis ( 778 days of followup ; 84 animals ) , area of metastasis ( 285 days of followup ; 33 animals ) , number of metastatic foci ( 537 days of followup ; 33 animals ) , maximum diameter of metastasis ( 285 days of followup ; 33 animals ) , and tma ( 778 days of followup ; 24 animals ) ." ], [ "one hundred and seventyeight regional lymph nodes ( 162 inguinal , 14 axillary , and 2 location not available ) were assessed from 97 female dogs with malignant mammary tumors .", "the intact or spayed animals were subjected only to the surgical treatment of their mammary tumors , without adjuvant treatment , at the hospital of the veterinary school of the federal university of minas gerais ( ufmg ) between 2008 and 2013 . before surgery , all animals had complete clinical examinations that included hematology and serum biochemistry .", "feed , but not water , was withheld for 36 hours before surgery . moreover , the dogs underwent thoracic radiography to rule out distant metastasis at the time of diagnosis and abdominal ultrasound examination only when serum biochemical changes or increased abdominal size were observed . the surgical technique ( e.g. , simple tumor removal , simple mastectomy , regional mastectomy , and radical mastectomy ) was chosen according to the number of lesions and sites , considering the lymphatic drainage and established prognostic factors such as lesion size and existence of skin or muscular adherences , as previously described.34 the present study included 3 ( 3.1% ) simple mastectomies , 46 ( 47.4% ) regional mastectomies , and 43 ( 44.4% ) radical mastectomies ; the type of surgery was unknown for 5 dogs .", "all of the tumors were completely excised , and the muscle fascia was not removed in any cases .", "the inguinal lymph nodes were resected en bloc , along with the inguinal mammary gland , whenever this gland was removed , or in the same manner as the axillary lymph nodes when they were enlarged , adherent , or firm ." ], [ "in addition , all animals with metastasis were stratified according to the number of lymph nodes involved , the number of metastatic foci , the maximum diameter of metastasis , and the area of metastasis ( maximum width maximum length ) . moreover , when > 1 metastatic focus was identified in 1 lymph nodes in the same patient , individual metastatic areas were summed to calculate the total metastatic area ( tma).8 for all of these analyses , a cutoff ( mean plus 1 standard deviation [ sd ] ) was established for stratification into groups .", "all of the metastatic foci were measured to obtain an average metastatic area in animals that had > 1 metastatic focus .", "the size of the largest metastatic deposit , measuring 0.06 mm , was used to classify lymph node metastasis as isolated tumor cells ( itc ) .", "the animals were organized into 5 groups according to a classification of metastasis adapted from human medicine : a ( animals without metastasis ) ; b ( animals with macrometastases : lymph node metastases > 2 mm ; fig 1a ) ; c ( animals with micrometastases : foci of neoplastic cells with diameters ranging from 0.2 to 2 mm ; fig 1b ) ; d ( animals with itc : foci of neoplastic cells < 0.2 mm ; fig 1c ) ; and e ( animals with nonmeasurable metastasis ) .", "neoplastic cells in the lymphoid parenchyma or distributed in the lymphatic sinuses ( i.e. , subcapsular , medullary , or both ) in h&estained sections were considered metastases as previously described.21 when > 1 lymph node in the same patient was affected by several metastatic foci , the largest metastatic focus was measured ( maximum diameter ) for the classification of metastasis as macrometastases , micrometastases , or itc .", "the number of lymph nodes involved , the maximum diameter of the lymph node metastases and the number of metastatic foci from each animal were used to obtain the averages for each group ." ], [ "the animals with malignant mammary tumors were assessed , and the endpoints were defined according to the type of analyses : histologic tumor types ( 827 days of followup ; 84 animals ) , presence or absence of lymph node metastasis ( 1112 days of followup ; 84 animals ) , number of lymph nodes involved ( 778 days of followup ; 84 animals ) , classification of metastasis ( 778 days of followup ; 84 animals ) , area of metastasis ( 285 days of followup ; 33 animals ) , number of metastatic foci ( 537 days of followup ; 33 animals ) , maximum diameter of metastasis ( 285 days of followup ; 33 animals ) , and tma ( 778 days of followup ; 24 animals ) .", "survival time was defined as the period ( days ) between surgical tumor removal and date of death from disease .", "animals that were alive and that died of unknown causes or causes unrelated to the tumor were censored . among the most common causes was visceral ( calazar ) leishmaniasis ( leishmania chagasi ) , which is endemic in the city of belo horizonte , minas gerais , brazil , where the research was conducted .", "other causes of death were external causes ( road accidents ) , orthopedic surgery , and cardiorespiratory and neurological conditions ." ], [ "survival data were evaluated according to the histologic tumor types , presence or absence of lymph node metastasis , number of lymph nodes involved , classification of lymph node metastasis , area of metastasis , number of metastatic foci , maximum diameter of metastasis , and tma .", "survival curves were calculated using the kaplan meier estimator , and statistical significance was examined using a logrank test , after a normality test , with p < .05 considered significant ." ], [ "stratification of animals with measurable metastasis ( i.e. , macrometastases , micrometastases , and itc ) distributed in groups according to the area of metastasis , number of metastatic foci , maximum diameter , and tma is presented in table 1 .", "carcinomas in mixed tumors were the most common cancer , and the rarest tumors were lipidrich carcinoma , malignant adenomyoepithelioma , pleomorphic lobular carcinoma , malignant phyllodes tumor , and invasive micropapillary carcinoma , all of which were included in the group of rare types of malignant mammary tumors ( table 1 ) ." ], [ "these findings are similar to those reported in the literature.22 , 23 , 24 , 25 , 26 \n to our knowledge , this study is the first to describe the prognostic significance of identifying a higher number of lymph nodes positive for metastasis in dogs , as has been reported in humans.1 , 39 another novel aspect is the use of a more accurate technique for measuring metastases , which yields a more detailed representation of the metastatic load of the lymph nodes in these animals . in this study , dogs with lymph node metastases with diameters > 7.32 mm had lower overall survival .", "however , the independent prognostic relevance of lymph node status in dogs with mammary tumors is still poorly established in multivariate analysis.23 , 45 , 46 \n", "another interesting finding was that the presence of itc in the lymph nodes of dogs with malignant mammary tumors was associated with lower overall survival in comparison to dogs with no metastatic malignant mammary tumors .", "the findings in this study may help in future proposals for the standardization of these methods of analysis , showing the real prognostic relevance of the occurrence of lymph node metastasis in malignant mammary tumors of dogs ." ], [ "a more detailed classification system and staging that takes into account differences in the sizes of macrometastases identified in female dogs should be considered , and additional studies should be conducted to confirm these findings .", "moreover , macrometastases and itc in regional lymph nodes are associated with a worse prognosis in dogs with malignant mammary tumors subjected only to surgical treatment .", "the identification of 1 metastatic lymph nodes is considered a parameter for prognostic assessment in affected animals ." ] ]

[ [ "these lesions though may cause life threatening hemorrhage , watchful observation is still considered as a treatment option in these patients ." ], [ "a 71-year - old male presented with pulsatile swelling over the right side of face and over the forehead in october 2009 .", "patient was evaluated with computed tomography ( ct ) angiogram , which showed aneurysm of the external carotid artery with thrombus within and multiple aneurysm of the branches of external carotid arteries .", "treatment option of excising the aneurysm with ligation of external carotid aneurismal branches was discussed with the patient . since the swelling was asymptomatic for the past 34 years , patient was not willing for any procedure .", "the patient has been on follow up for the past 4 years without any new symptoms or increase in size of the aneurysm ." ], [ "aneurysm of the external carotid artery and its branches have been described in cases due to trauma , iatrogenic injury , dental extraction , and also due to head and neck cancer because of tumor infiltration or due to radiation therapy .", "geriatric patients with aneurysm are first consulted by a primary care physician and hence primary care physician at the community level has a major role in following these patients and referring these patients to specialized vascular centre .", "increase in size of the aneurysm or impending rupture necessitates the need for referral to specialized center .", "multiple aneurysm of external carotid artery this case was discussed for the rarity of idiopathic multiple aneurysm [ figure 3 ] of the external carotid artery [ figure 4 ] and the need for individualized treatment protocol to be followed , as in this case , only watchful observation . in this world of evolving surgical techniques and newer treatment modalities , conservative treatment still has a role to play .", "the need for surgical intervention or endovascular stenting does not arise in our patient who has this aneurysm for 34 years and was on follow up for the past 4 years without any symptoms [ figure 1 ] .", "pulsatile swelling over the face , forehead , and scalp in this setting , the role of primary care physician is important to decide upon surgical or conservative management after having discussion with the patient ." ], [ "even in the era of advanced medical technology practices , treatment should be individualized and the choice rests with the patient .", "primary care physicians have a major role in follow up of these patients and decide upon referring these patients to specialized vascular center thus lessen the burden of vascular centre in following these patients ." ] ]

[ [ "this paper examines the personality of mothers and its relationship to severity of addiction of their sons .", "offspring interactions can dramatically influence the child s behavior as they age.1 the focus of this study is to examine retrospectively the potential relationship between maternal personality characteristics , as measured by the minnesota multiphasic personality inventory ( mmpi ) , and drug dependence in their sons .", "it is a follow up to our previous work on childhood parenting styles of the substance - dependent patient.8", "the hypothesis is that certain personality traits in mothers may help predict an at - risk population of their sons for the development of drug dependence .", "this is likely one of the earliest poetic descriptions of a current topic of great interest to psychiatrists and research neuroscientists , namely the impact of early psychosocial factors on subsequent neuronal development and ultimate phenotypic presentation ." ], [ "all study subjects were informed they were participating in a volunteer study examining the relationship between a mother s personality and drug dependence in their children .", "patients were diagnosed according to diagnostic statistical manual ( dsm iv).9 the control group consisted of 35 mothers of non - drug - dependent subjects .", "we applied the arabic version prepared by melika et al.10 substance - dependent patients were assessed with the addiction severity index ( asi).11 the asi is a semi - structured interview designed to address 7 potential problem areas in substance use disorder patients : medical status , employment and support , drug use , alcohol use , legal status , family / social status , and psychiatric status . in 1 hour , a skilled interviewer can gather information on recent ( past 30 days ) and lifetime problems in all of the problem areas .", "personality profiles of mothers of both groups were compared , and those of mothers of dependent patients were correlated to the 7 dimensions of the asi .", "the items of each scale were selected for their ability to separate medical and psychiatric patients from normal control subjects .", "mothers from both groups fulfilled the following inclusion criteria : \n age between 40 and 60.not suffering substance use disorders or any other psychiatric disorders.not suffering significant medical disorder .", "age between 40 and 60 . not suffering substance use disorders or any other psychiatric disorders ." ], [ "differences between quantitative variables for the addicts group and the control group were assessed using student s t - test .", "the association between the different study scales for mother and their offspring was assessed using correlation analysis .", "the mmpi scales for mothers were classified into risk grades and differences between the study groups were assessed using pearson s chi - square test ." ], [ "there was a significant negative correlation between social introversion and asi scores of drug / alcohol use , and family history ( p = 0.007 and p = 0.003 , respectively ) .", "significant positive correlations were observed between scores of social status impairment and those of psychiatric and legal status impairment ( p= 0.005 and p = 0.04 , respectively ) .", "significant positive correlations were observed among mothers of substance - dependent patients on scores of depression , hypochondrias , and psychopathic deviance ( p = 0.003 , and p = 0.01 respectively ) .", "results showed significant positive correlation between scores of hysteria and psychopathic deviance and asi legal status impairment ( p = 0.023 and p = 0.019 , respectively ) .", "the mean age of mothers of patients was 50 , while that of the control was 44.8 years .", "depression scores were in the normal range ( 45 to 50 ) in 5% of study group compared to 22% of the control group ( p = 0.003 ) .", "negative scores for hysteria were seen in 15% of the study group , compared to 40% of the control group ( p = 0.02 ) .", "scores on the hysteria scale were higher than 70 in 4% of study group compared to none of the control group .", "paranoia scale scores were positive in 4% of the study group , compared to 1% of controls ( p = 0.03 ) .", "depression scores were higher than 70 ( pathological ) in 8% of study group compared to only 1% of control group .", "no paranoia was detected in 10% of the study group , compared to 40% of controls ." ], [ "any primary interventions which might decrease pathologic drug use would be beneficial . these and other data strongly support the importance of early mother child assessment and intervention when clinically indicated . although the role of family varies somewhat based on cultural norms , the effect of early maternal nurturing on neuronal development and subsequent phenotypic expression is not affected by socio - cultural variations .", "the role of parenting in the development of drug abuse is a widely discussed topic .", "similarly , andersson and eisemann3 reported that parenting perceived as rejecting was linked to maladaptive psychosocial behaviors , including drug abuse .", "schweitzer and lawton12 and brook et al1 have independently reported mothers assessed as cold , indifferent , controlling , and intrusive were a major risk factor for the development of adolescent drug use .", "future research needs to focus on identifying cost - effective and clinically effective early intervention strategies through prospective , longitudinal trials .", "behavioral scientists appreciated the highly complex nature of parental interactions , particularly maternal , and have demonstrated the role of nurturing in early life to the development of pathophysiologic functioning in later years of the offspring .", "it is far more effective to work with mothers than to treat drug addiction in their grown children ." ] ]

[ [ "could mediate in inflammatory cytokines regulation , we study the effect of our extracts on ox - ldl - activated thp-1 macrophages , measuring the expression and release of several inflammatory mediators .", "designed to identify natural compounds with anti - inflammatory potential , we have studied thyme oils from three different species ( thymus vulgaris , thymus zygis , and thymus hyemalis ) . to determinate whether thyme oils could have immunomodulation properties and", "extracts from thyme have been used in traditional medicine for the treatment of several respiratory diseases like asthma and bronchitis and for the treatment of other pathologies thanks to several properties such as antiseptic , antispasmodic , antitussive antimicrobial , antifungal , antioxidative , and antiviral [ 7 , 8 ] .", "the use of medicinal plants , or extracts from them , has been traditionally practiced worldwide in the prevention and treatment of several chronic diseases such as cardiovascular diseases , intestinal inflammatory diseases , inflammatory bowel disease , arthritis , diabetes , allergies , multiple sclerosis , parkinson 's and alzheimer 's diseases , and others .", "cardiovascular disease , the leading cause of death in western countries , is a preeminent health problem worldwide ." ], [ "results observed in this work suggest that supercritical thyme s1 and s2 fraction oils from thymus vulgaris , thymus zygis , and thymus hyemalis may act as effective inhibitors of oxldl - induced proinflammatory cytokines ( tnf- , il-1 , and il-6 ) secretion , and also as enhancers of the anti - inflammatory cytokine il-10 secretion , in macrophage thp-1 cells . in summary , co2 supercritical thyme extracts showed anti - inflammatory properties by ( a ) reducing the release of proinflammatory cytokines , and ( b ) increasing the anti - inflammatory secretion in activated macrophages .", "these results may suggest that essential oils from thyme extracts could be used as novel options for treatment of chronic diseases based on inflammatory processes .", "cytokines are considered to be key players in the inflammatory response involved in atherosclerosis and other chronic inflammatory - based diseases ( cibds ) . among these , interleukin ( il)-1 , il-6 , il-10 , and tumor necrosis factor- ( tnf- ) are expressed in atherosclerotic lesions by endothelium cells , macrophages , and smooth muscle cells [ 29 , 30 ] .", "the most interesting observation made during these studies was that treatment of oxldl - activated thp-1 cells with thyme oils had different effects on proinflammatory and anti - inflammatory expression : tnf- , il-6 , and il-1 expressions were inhibited while il-10 expression was enhanced .", "several natural compounds are known for their beneficial properties to some diseases or their derived complications and particularly concerning anti - inflammatory effects . in our experiments , were observed significant cellular responses elicited by the treatment of thp-1 cells with thyme fractions ." ], [ "oil extracts toxicity was assessed using the mitochondrial - respiration - dependent 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium ( mtt ) reduction method .", "dried and cryogenic grinded leaves from three varieties of thymes ( thymus hyemalis , thymus zygis , and thymus vulgaris ) were subjected to supercritical fluid extraction with co2 .", "thp-1 cells were plated in 96-well plates , differentiated and incubated with different concentrations of extract for 24 and 48 hours at 37c in 5% co2 . after treatment", "extracts from the three thyme species were fractionated using a two - cascade depressurized system and samples were collected in each of the two ( separators 1 and 2 ) separators .", "the supercritical extractions were carried out in a pilot - plant - scale supercritical fluid extractor ( thar technology , pittsburgh , pa , usa , model sf2000 ) of 2 l capacity using pure supercritical co2 at a pressure of 300 bar and a temperature of 40c .", "compounds thymol , carvacrol , borneol , and linalool were identified by comparison with standard mass spectra obtained in the same conditions and compared with the mass spectra from library wiley 229 .", "rests of the compounds were identified by comparison with the mass spectra from wiley 229 library and by their linear retention index .", "cells were pelleted via centrifugation and assessed for viability using the trypan - blue exclusion method ." ] ]

[ [ "one of its main indices is the number of published articles or science production in a specific field of sciences . in addition , citations of papers is another index that mostly is used as a proxy of application of papers .", "aim to monitoring and assessment of scientific trends , scientometrics provides reliable , practical methods that measure , evaluate and analyze scientific products of specific fields . in these regards , using qualitative , quantitative and computational approaches , different indicators are increasingly employed to show the pattern of research performed by researchers , universities , institutes , and countries .", "the trends in published papers , citations , and collaborative researches in the fields of obesity / overweight , as the proxy of knowledge production , reviewed , during the past 24-year period .", "considering above , the aim of this paper is scientometrics analysis of obesity / overweight knowledge productions in the middle east region countries .", "researchers , practitioners , and policy - makers call for updated valid evidences to monitor , prevent , and control of obesity", "the prevalence of obesity continues to rise worldwide with an alarming priority in developed and developing countries .", "we specifically focused on iran and assessed its contribution in obesity / overweight researches by more details ." ], [ "present study is scientometric analysis of obesity / overweight scientific papers among middle east countries from 1990 to 2013 . reviewing the publication number , publication trends , citations , and collaborative institutions , iran has been compared with other countries of the region and also with global indices . for its", "we also introduce top institutions , journals , and collaborative research centers in the field of obesity / overweight . using methods of reviews and considering emtree , terms of obesity , overweight , and ", "most coverage in health and biomedicine discipline , we systematically searched scopus database . as it was the only sources for multidisciplinary citation reports , we select it as the valid source of citation reports of knowledge products .", "anthropometric indexes , search strategy has designed by researchers committee and validated by external scientific group . the name of middle east countries were identified according to free encyclopedia of wikipedia including ; bahrain , cyprus , egypt , iraq , iran , israel , jordan , kuwait , lebanon , oman , palestine , qatar , saudi arabia , syria , turkey , united arab emirates , and yemen ( in alphabetical order ) .", "period of study was limited to 19902013 , and there was no limitation for language .", "in addition , all of the collaborative papers extracted and analyzed for middle east countries ." ], [ "the time trend of citations of obesity / overweight publication by middle east countries , 19902013 in overall , in the field of obesity / overweight , iran had the most collaborative papers respectively with usa ( 180 , 4.6% ) , uk ( 140 , 3.6% ) , and canada ( 66 , 1.7% ) .", "given scopus data , globally , during 19902013 , 415,126 papers have been published in the fields of obesity / overweight . from them , 136,595 were affiliated to usa , 33,927 to uk , and 20,019 to germany . during this period , 14,792 published papers were affiliated to middle east countries .", "the time trend of obesity / overweight publication by middle east countries , 19902013 pearson chi - square test confirmed a significant time trends of published papers between region countries ( p = 0.000 ) .", "p - trends of total number of papers and total number of citations of middle east 's countries obesity / overweight related papers , 1990 - 2013 as it shows in table 2 , based on the pearson chi - square test results , all of region countries have significant time trends in their obesity / overweight publications citations ( p = 0.000 ) ." ], [ "given scopus data , globally , during 19902013 , 415,126 papers have been published in the fields of obesity / overweight . from them , 136,595 were affiliated to usa , 33,927 to uk , and 20,019 to germany . during this period , 14,792 published papers were affiliated to middle east countries .", "compare with other countries in the regions ; after turkey ( 7092 papers : 47.94% ) and israel ( 5214 paper : 35.25% ) , it has achieved to third position .", "p - trends of total number of papers and total number of citations of middle east 's countries obesity / overweight related papers , 1990 - 2013", "the time trend of obesity / overweight publication by middle east countries , 19902013 pearson chi - square test confirmed a significant time trends of published papers between region countries ( p = 0.000 ) .", "table 2 shows the p - trends of total number of papers and the total number of citations , in middle east 's countries , during the 19902013 ." ], [ "as it shows in table 2 , based on the pearson chi - square test results , all of region countries have significant time trends in their obesity / overweight publications citations ( p = 0.000 ) .", "the time trend of citations of obesity / overweight publication by middle east countries , 19902013", "the comparative situations of citations time trends of obesity / overweight publications is presented in figure 2 ." ], [ "in overall , in the field of obesity / overweight , iran had the most collaborative papers respectively with usa ( 180 , 4.6% ) , uk ( 140 , 3.6% ) , and canada ( 66 , 1.7% ) .", "contributions of middle east 's countries in obesity / overweight related papers , 1990 - 2013", "for example from bahrain publications , 197 cases have been published by contribution of only internal researchers and academic members of bahrain scientific centers .", "the situation of contributions of middle east 's countries in obesity / overweight related papers have been shown in table 3 .", "red marked zeros refer to situations in which , there were no any joint contribution for common publications between two countries that have been indicated in the top of leading rows .", "the diagonal diameter of table ( green marked number ) shows papers that there was no partnership between the countries in their publication .", "usa also had the most participation in publications of all other 16 middle east countries ." ], [ "in overall , in global level , most of obesity / overweight papers published in the field of medicine ( 76.7% ) , after that , the highest proportion of publications respectively , belonged to , biochemistry ( 23.3% ) , and agricultural and biological sciences ( 12% ) . in iran , publications approximately follow this distribution .", "considering the results , 64% of iranian papers were completely related to medicine , 11% were published in the field of biochemistry , genetics and molecular biology , and 6% were aligned to the fields of agricultural and biological sciences .", "figure 3 compares the distribution of publications subject area of obesity / overweight publications at national , regional and global levels . the distribution of subject area of obesity / overweight publication at national , regional and global levels" ], [ "contribution of national universities / scientific institutes in publication of obesity / overweight papers , 19902013 regarding the sources of publications in global level , the three first journals are ; international journal of obesity ( 5396 ; 1.30% ) , plos one ( 4280 ; 1.03% ) , and obesity surgery ( 4033 ; 0.99% ) . in iran , iranian journal of endocrinology and metabolism , journal of research in medical sciences , and archives of iranian medicine , respectively with 3.47% , 2.78% , and 2.19% of national publication contribution , were the top three sources of obesity - related publication .", "considering the role of universities or other scientific institutes in publication of obesity / overweight papers ; the first three effective institutes with the most publications are ; va medical center , brigham and womans hospital , and inserm , respectively with 1.25% , 0.81% , and 0.78% of global participation in knowledge production .", "harvard school of public health with insignificant difference is the fourth producing center of obesity publications ( 3,154 papers , 0.87% ) . in iran ,", "after that , shahid beheshti university of medical sciences counterpart in 15% of knowledge productions .", "the third rank belonged to isfahan university of medical sciences ( 14% contribution ) [ figure 4 ] ." ], [ "during this period , the most prevalent type of obesity - related publications was original articles that consist 90% of all knowledge products . after these review articles ( 4% ) and letters ( 2% ) set on next levels ." ], [ "these recent rapid increasing trends in research outputs can be attributed to the attention to research by country policy - makers up to the highest level of leadership that has caused a national comprehensive commitment on research policy , facilities , and resources .", "the results of the present study verify iran 's position in obesity / overweight publications between other middle east countries. scientific evidences have emphasized that overweight and obesity become one of the most important health priority , with increasing trends , which need special attention and quick response . designing and implementation of these preventive or controlling programs require to accurate information and scientific evidences that have provided through scientific papers and reports .", "third , we assessed collaboration between middle east countries in related research fields ; and fourth , we explain the situation of iran as one of the most effective knowledge productive country in the region in details .", "first , we focused on specific obesity / overweight domain to clarify the exact situation of knowledge production .", "the increase in the number of related multidisciplinary faculties as well as research centers and consequently the increase of related specialists , students , research projects , and dissertations are inevitably positive factors which influence the rise in the number and citations of papers in this field .", "in this regard , after turkey , iran had the third ranks of high citation order . between out of regions countries , usa had the most participation in the publication of all 17 middle east countries . inside the region , saudi arabia and egypt with 145 collaborative papers had the first collaborative position ." ], [ "to the best of our knowledge , this is the first scientometrics analyses of obesity / overweight knowledge productions in the middle east region countries that provide practical information for better research planning in related multidisciplinary fields . despite the ascending trends in research outputs , more efforts required for promotion of collaborative partnerships .", "these results also could be useful for better health policy and more planned studies in this field ." ] ]

[ [ "the sagittal alignment of the spine has important ramifications to the health - related quality of life.1 it varies with age,2 \n 3 gender,4 spinal disease,5 \n 6 and body position.7 \n 8 \n 9 \n 10 many researchers have evaluated the sagittal alignment of the cervical spine . however , they used different neck positions,7 \n 8 as well as different radiographic views .", "the purpose of this study is to determine if the radiographic parameters for sagittal cervical alignment are comparable between these two views .", "most commonly , these are cervical spine lateral radiographs and whole - spine lateral radiographs.4 \n 11 \n 12 \n 13 \n 14 however , to the best of our knowledge , there is no literature comparing the sagittal cervical parameters between these two views ." ], [ "cervical spinal morphology was measured using the standard techniques to obtain the following parameters for the two different radiographs : occipital c2 angle : cobb angle between the mcgregor line and the inferior end plate of axis ( fig .", "additionally , we calculated the ratio of c2 central offset distance to c4 ap diameter and the ratio of plumb lines ' distance to c4 ap diameter to reduce the radiographic magnification ( figs . 5 , 6 ) .", "this retrospective study included adult patients from a single institution who had the radiographs taken to evaluate the neck pain .", "6 ) \n angle ( occipital c2 ) is formed by mcgregor line and the inferior end plate of the axis ; angle ( c2c7 ) , by the inferior end plate of c2 and inferior end plate of c7 ; angle ( c7sternal ) , by the inferior end plate of c7 and the anterior border of sternum ; angle ( sternal slope ) , by the anterior border of sternum and the horizontal line . \n", "c2 central offset distance ( a ) is the distance between the center of c2 body and the line tangential to the posterior cortex of c7 body ; t1 slope ( ) is the angle between the superior end plate of t1 body and the horizontal line . \n", "5 ) c2 central offset distance : the distance between the center of c2 body and the line tangential to the posterior cortex of c7 body ( fig ." ], [ "this retrospective study included adult patients from a single institution who had the radiographs taken to evaluate the neck pain .", "the criteria for inclusion were as follows : ( 1 ) age 20 years or older at the time of evaluation ; ( 2 ) no contraindication for radiographic exposure ( e.g. , pregnancy , tumor ) ; ( 3 ) agreement of patients to take both radiographs ." ], [ "cervical spinal morphology was measured using the standard techniques to obtain the following parameters for the two different radiographs : occipital c2 angle : cobb angle between the mcgregor line and the inferior end plate of axis ( fig .", "6 ) \n angle ( occipital c2 ) is formed by mcgregor line and the inferior end plate of the axis ; angle ( c2c7 ) , by the inferior end plate of c2 and inferior end plate of c7 ; angle ( c7sternal ) , by the inferior end plate of c7 and the anterior border of sternum ; angle ( sternal slope ) , by the anterior border of sternum and the horizontal line . \n", "c2 central offset distance ( a ) is the distance between the center of c2 body and the line tangential to the posterior cortex of c7 body ; t1 slope ( ) is the angle between the superior end plate of t1 body and the horizontal line . \n", "5 ) c2 central offset distance : the distance between the center of c2 body and the line tangential to the posterior cortex of c7 body ( fig .", "4 ) c2c7 angle : cobb angle between the inferior end plate of c2 and the inferior end plate of c7 ( fig .", "4 ) c7sternal angle : cobb angle between the inferior end plate of c7 and the anterior border of sternum ( fig ." ], [ "finally , we compared the statistical difference of the previously mentioned parameters with the errors of measurement for the two different radiographs .", "the statistical significance level was set at p < 0.05 . the intraobserver and interobserver reliability were calculated using the reliability statistics by intraclass correlation for the cobb angle and the distance .", "the differences in continuous variables between the two groups were examined with a paired t test .", "the power was 0.8 for paired t tests with the effect size of 0.5 and error probability of 0.05 .", "the intraclass correlation values were graded using previously described semiquantitative criteria : excellent for values in the 0.9 to 1.0 range , good for 0.7 to 0.89 , fair / moderate for 0.50 to 0.69 , low for 0.25 to 0.49 , and poor for 0.0 to 0.24 .", "the power analysis was performed by g*power version 3.1.5 ( universitt kiel , germany ) ." ], [ "the measurements of the cobb angles in the cervical spine lateral radiographs had 0.979 intraobserver reliability and 0.966 interobserver reliability .", "the difference of the intraobserver measurements for the cobb angles in the cervical spine lateral radiographs was 0.58 2.74 degrees , and the difference of the interobserver measurements was 0.73 3.43 degrees .", "the difference of the intraobserver measurements for the cervical spine distance in the lateral radiographs was 0.26 3.05 mm , and the difference of the interobserver measurements was 0.90 5.48 mm . for the whole - spine lateral radiographs , the measurements of the cobb angles had 0.969 intraobserver reliability and 0.803 interobserver reliability .", "the difference of the intraobserver measurements for the cobb angles in the whole - spine lateral radiographs was 0.36 3.65 degrees , and the difference of the interobserver measurements was 4.08 7.78 degrees ." ], [ "our results suggest that to determine the alignment of only the cervical spine , there is no advantage to using whole - spine lateral radiographs .", ", this study is the first comparing sagittal cervical parameters between the cervical spine lateral view and whole - spine lateral view . in conclusion ,", "the 95% confidence limits for intra- and interobserver variability of the cobb method in the cervical lateral radiographs were 5 and 9 degrees with the traditional manual method.16 in many cases , a 5-degree variation between the measurements in the whole - spine lateral radiographs by the traditional manual cobb method is acceptable.17 in the current study , the mean difference of the intra- and interobserver measurements for the cobb angles in the cervical spine lateral radiographs with digital methods was 0.58 and 0.73 degrees .", "however , this finding does not take into account the overall spinal alignment , for which whole - spine lateral radiograph are necessary ." ] ]

[ [ "this \n family is identified by the presence of a cyclohexene ring spiro - linked \n to a tetronic acid moiety ( figure 1 , fragment \n a ) that is embedded in a macrocycle ( figure 1 , fragment b ) . in several cases , the structure also contains a trans - decalin ring ( figure 1 , fragment \n c ) and is decorated by various deoxy oligosaccharides ( figure 1 , fragment d ) . in terms of biological profile ,", "one of the most notable examples of an antitumor \n antibiotic is mitomycin c , a microbial metabolite that is used currently \n for the treatment of breast and bladder cancer . among other antitumor antibiotics , daunorubicin and its \n semisynthetic derivative doxorubicin represent chemotherapeutic leukemia \n agents in clinical settings .", "the \n search for new antitumor antibiotics led to the discovery of \n chlorothricin ( 1 ) , a complex polyketide produced by various streptomyces strains .", "spirotetronate \n polyketides exhibit potent antibacterial and antitumor activities \n and a documented value as tools in the elucidation of new biological \n pathways . as such", "a subset of these drugs \n has been classified as antitumor antibiotics based on their ability \n to block cell growth by interfering with dna , the genetic \n material in cells .", ", they represent highly promising leads in drug discovery . \n to appreciate their untapped potential , in this review", "its intriguing \n chemical structure and bioactivity defined a new family of microbial \n metabolites , commonly referred to as spirotetronate polyketides ." ], [ "recently sssmuth and co - workers proposed a classification \n of tetronates based on two main categories : the linear tetronates \n and the spirotetronates . on the basis \n of biosynthetic considerations", ", the latter subgroup can be divided \n into two classes : class i ( generic structure 4 ) , which \n contains the spirotetronate moiety within a varying size macrocycle , \n and class ii ( generic structure 5 ) , which additionally \n contains a decalin moiety ( figure 2 ) .", "the above classification stems from a common biosynthetic \n pathway that accounts for construction of these compounds .", "quartromicins 10 , unusual spirotetronate polyketides containing four spirotetronate \n subunits , lie outside these two classes due to their peculiar structure and unique biosynthesis .", "representative members of the class ii spirotetronates include maklamicin \n ( 11 ) ( containing a c11 macrocycle ) , tetronolide ( 12 ) ( the aglycon of tetrocarcin a containing a c13 macrocycle ) , and chlorothricolide ( 2 ) ( the aglycon of chlorothricin containing a c13 macrolactone ) . in this class", "is also included versipelostatin aglycone \n ( 13 ) , which contains the largest c17 macrocyclic \n motif isolated to date .", "representative \n members of the class i spirotetronates in order of increasing macrocyclic \n length are abyssomicin c ( 6 ) ( containing a c11 macrocycle ) , okilactomycin d ( 7 ) ( containing a c13 macrocycle ) , and spirohexenolide a / b ( 8/9 ) ( containing a c15 macrocycle ) . \n" ], [ "the biosynthetic pathways of the class \n ii polyketide spirotetronates \n have been elucidated for chlorothricin , tetrocarcin a , kijanimicin , and versipelostatin .", "biosynthesis \n of the uncommon tetronitrose is proposed to occur from 25 via aminotransferase and methylation , while the precise mechanism \n for the carbamate biosynthesis still remains elusive .", "in general , the biosynthesis of spirotetronates occurs through \n condensation of acetic acid units via the type i polyketide synthase \n pathway ( scheme 1 ) . as shown in the biosynthesis of abyssomicin c and okilactomycin , construction \n of the class i spirotetronates proceeds by elongating their carbon \n chain via incorporation of propanoyl and/or acetyl units ( 14/15 ) to the acyl carrier protein ( acp ) .", "was recently elucidated \n by the sun and leadlay groups and shown to proceed via acetylation \n and subsequent elimination , thereby forming dienophile 19 . an intramolecular diels ", "incorporation of \n a glyceryl unit , via coa intermediate 17 , forms tetronate 18 likely via a \n claisen condensation followed by lactonization . the precise mechanism \n for the elimination of the c-5 hydroxy group" ], [ "although there is no information for direct \n binding of 51 to a protein target , its effect on the \n upr signaling pathway offers a novel tool to understand er - induced \n stress and pharmacologically regulate related illnesses .", "isolated \n from a marine verrucosispora , abyssomicin c ( 6 ) and its atropisomer \n ( 29 ) ( figure 3 ) are the first \n known natural products to block para - aminobenzoic \n acid ( paba , 41 ) biosynthesis.paba is a biosynthetic precursor of folic acid \n ( vitamin b9 ) , and as such , it is essential for dna synthesis / repair \n and cell survival ( scheme 3 ) . on the other hand , lack of folic acid", "thus , in addition to its pharmaceutical promise , 62 could be used as a tool to study the cck - b / cck - a signaling \n pathway .", "studies on the \n effect of the abyssomicin motif in paba biosynthesis \n have been performed with atrop - abyssomicin ( 29 ) and are highlighted in scheme 3 .", "studies \n in breast cancer cells have suggested an alternative mechanism of \n action of 47 that proceeds by inhibiting phosphorylation \n of the pi3k / akt signaling cascade .", "in addition , kijanimicin was \n shown to exhibit robust anticancer and \n antimalarial activities in mouse models", "both compounds display potent \n activity against many gram - positive bacteria , while 11 also exhibits moderate antitumor activity against hela and mcf7 \n breast cancer cells ." ], [ "thus , in addition to its pharmaceutical promise , 62 could be used as a tool to study the cck - b / cck - a signaling \n pathway .", "it should be noted , however , that the direct cellular target of 1 is under debate and may involve interaction with components \n in the cell membrane that may account for the observed downstream \n effects .", "efforts to discover \n new gastric atp - ase inhibitors led to \n the isolation of a88696f ( 61 ) and its \n dehydroxylated counterpart a88696c ( 60 ) .", "chlorothricin ( 1 ) was shown \n to inhibit the activity of pyruvate carboxylase , a key enzyme that converts pyruvate to oxaloacetate , thus \n allowing consumption of glucose through the krebs cycle ( figure 11 ) .", "moreover , an inhibitory effect of 1 on malate dehydrogenase , an enzyme that oxidizes malate to oxaloacetate \n in the krebs cycle , has also been reported .", "although the potential \n anticancer properties of chlorothricin ( 1 ) have not been \n investigated , c-31 hydroxychlorothricin ( figure 1 ) was shown to exhibit antitumor activity at 40 \n mg / kg against implanted ehrlich carcinoma cells in mice with an ld50 of 295 mg / kg ." ], [ "a stereocontrolled \n diels alder reaction has been implemented by the roush group \n for the synthesis of the quartromicin spirotetronate unit . in addition , this group reported a strategy of connecting subunits 115 and 116 together using lithium halogen exchange \n and cecl3 coupling .", "in this part of the review , \n we highlight the key steps toward the \n synthesis of selected spirotetronates . when possible , we compare the \n various strategies in terms of overall efficiency . abyssomicin c ( 6 ) and its atropisomer 29 contain a rigid oxabicyclo \n [ 2.2.2 ] octane substructure that encapsulates the spirotetronate moiety . \n to date , three chemical syntheses of 6 and 29 have been reported .", "interestingly , this finding supports \n the notion that abyssomicin c ( 6 ) is a biosynthetic progenitor \n of 32 and further validates the proposed mechanism of \n abyssomicin c deactivation as presented in scheme 3 .", "the yoshii and roush syntheses of the decalin \n moiety 92 , common to both tetronolide and kijanolide , \n are summarized in scheme 9 ." ], [ "it is \n evident that a methodical fragment - based approach to this structure , \n in combination with chemical biology studies , will be highly beneficial , \n as it could reveal the role of the spirotetronate motif , the effect \n of the macrocyclic size , and the role of the decalin system . in turn", "several studies \n have documented the significance of the carbohydrate \n chains for the observed antibiotic activity of spirotetronates . however , with the exception of abyssomicins , there is no clear understanding \n of the biological significance of the spirotetronate aglycone core . \n at present ,", "in addition to a dearly needed scalable \n synthesis , advances in microbial biosynthesis should offer a potential solution to large - scale \n production or semisynthesis of a lead candidate .", "a combination of \n these efforts should unveil the pharmacological value of spirotetronates \n and would have significant impact in current efforts toward personalized \n medicine .", ", \n this effort would allow a detailed evaluation and optimization of \n the spirotetronate pharmacophore .", "nonetheless , the vast majority of these strategies \n have not yielded sufficient amounts of compound for a methodical structure activity \n relationship study , thereby hampering rational drug design .", "more than 40 years after the discovery of chlorothricin , \n the spirotetronate \n family has grown to include over 70 macrocycles of various sizes that , \n in certain cases , are decorated with carbohydrate side chains . in \n addition to their potent antitumor and antibiotic activities ,", "this underscores the enormous \n significance of the spirotetronate polyketide family to biology in \n addition to their pharmacological potential ." ] ]

[ [ "thus , in order to understand and combat candida pathogenesis , it is important to study candida biology directly , and having access to the phased genome assembly opens up multiple new research opportunities .", "the candida genome database ( cgd , http://www.candidagenome.org/ ) is a freely available online resource , based on the saccharomyces genome database ( sgd , www.yeastgenome.org ; ( 1 ) ) , which collects , organizes , and makes available candida gene , protein and sequence information to the fungal research community .", "since its inception in 2004 , cgd has been tasked with maintenance of the primary genome sequence and annotation for the c. albicans reference strain sc5314 .", "all dna sequences for the entire chromosomes , coding and non - coding regions , as well as translation products , are available for download at http://www.candidagenome.org / download/. an important part of cgd 's mission is to incorporate and annotate large - scale datasets from published experiments on candida species , and to make them easily available for exploration and analysis by our users . for several years we have provided genexplorer ( 34 ) to display and analyze microarray datasets .", "assembly 22 allows powerful , allele- and haplotype - specific analyses of the overall genome structure , function and evolution . to facilitate genome - wide research" ], [ "cgd was originally based upon assembly 19 , a diploid , contig - level assembly built from the genomic sequence that had just been completed ( 27 ) , and which included gene models , sequence corrections , and functional annotations provided by a group of volunteer researchers known as the annotation working group ( 28 ) .", "since its inception in 2004 , cgd has been tasked with maintenance of the primary genome sequence and annotation for the c. albicans reference strain sc5314 .", "assembly 20 was incorporated into cgd ( 30 ) ; assembly 20 was the first chromosome level assembly for c. albicans , though it consisted of what are referred to as reftigs , wherein each of the chromosomes in the assembly consist of a mosaic of the two haplotypes ( 31 ) .", "we have also re - analyzed the haplotype assignments for the entire chromosome 3 , which led to an exchange of 845 kb between chromosome 3a and chromosome 3b .", "the most recent major update to the sequence is assembly 22 ( 33 ) , which was generated using illumina - based sequencing of sc5314 as well as a collection of congenic strains homozygous for specific chromosomes , which allowed the construction of a phased diploid assembly of the genome .", "cgd then took over the task of curating all the candida - related information based on published experimental data , comparative genomics predictions and improved sequence information ( 29 ) . in 2006 ,", "improving the reference sequence is an ongoing project and we are currently focusing our efforts on intergenic regions , repetitive sequences and segmental duplications ." ], [ "since 2010 , cgd has used a versioning system to track genome sequence releases , and their associated annotations .", "subsequently , the chromosomal coordinates of a gene are changed , based on curation of a paper that provides evidence for updating the gene model .", "the version designation appears in the name of each of the relevant sequence and feature annotation files that are available at cgd , so the exact source of the sequence data is always clear .", "when the next weekly file check is performed , and the new file is noted to contain curatorial updates to gene names in the database , but no new changes to the structural annotation or to the sequence itself , the new version designation becomes s05-m01-r02 .", "later , a change to correct a sequencing error is made , and the new version designation becomes s06-m01-r01 .", "cgd recommends that authors note in their materials and methods sections of published papers what version of the genome they were working with when they performed an analysis , so that the analysis is reproducible ." ], [ "locus summary pages ( lsp ) exist for every chromosomal feature in cgd and provide a primary way to access gene - specific information .", "assembly 22 allows powerful , allele- and haplotype - specific analyses of the overall genome structure , function and evolution . to facilitate genome - wide research", "with assembly 22 , it became possible to implement a new position based systematic nomenclature for chromosomal features .", "the previous systematic names , dating back to assembly 19 , consisted of the orf19 prefix followed by a unique but somewhat arbitrary number . the new systematic name is based on the known chromosomal location and haplotype , and it consists of the chromosome ( c1-c7 and cr for the eight nuclear chromosomes , cm for the mitochondrial chromosome ) , a unique number indicating the order of features along chromosomes , the strand ( w for watson or c for crick ) and the haplotype ( a or b ) . for example", "all dna sequences for the entire chromosomes , coding and non - coding regions , as well as translation products , are available for download at http://www.candidagenome.org / download/.", ", cgd provides access to all the data in downloadable files that can be used by researchers ' own bioinformatics tools ." ], [ "jbrowse allows users to quickly view large - scale sequence data in a genomic context , at multiple zoom - levels of resolution , from base pairs in individual sequence reads to read - density summaries across large genomic regions .", "we provide the high - throughput dna sequence data ( 33 ) that was the basis of assembly 22 , described above .", "the display includes parallel tracks of annotated sequence features , allowing seamless navigation between jbrowse and the locus summary pages for each feature ( figure 1 ) .", "jbrowse is highly flexible and customizable : users may easily load their own sequence datasets and analysis tracks , for display in the context of genomic features , or for comparison with datasets and tracks provided by cgd .", "in addition , we provide chromatin occupancy data ( chip - seq ) for the wor1p transcription factor during white - opaque switching ( 41 )", "recently , to provide access to the growing number of datasets from experiments that use high - throughput sequencing technologies , we have deployed the jbrowse genome browser ( 35 ) .", "an important part of cgd 's mission is to incorporate and annotate large - scale datasets from published experiments on candida species , and to make them easily available for exploration and analysis by our users . for several years" ], [ "the reference sequence for an organism is not static while sequencing technologies continue to advance ( both in accuracy and read lengths ) , there is always the possibility that updates will improve the reference sequence .", ". they will provide insight into the genomic variation that exists in each of the candida species .", "cgd will strive to incorporate such refinements as soon as they become available to maintain the reference sequence and annotation current .", "it is likely in the near future that many distinct strains of candida species will be sequenced , and cgd will endeavor to incorporate these into the database as well", "additional high throughput sequencing datasets may also allow refinement of the genome annotations , such as novel additional transcripts , or the addition of 5 and 3 utrs to each of the genes .", "they may also allow the annotation of functional elements within non - transcribed regions , such as transcription factor binding sites from chip - seq studies .", "for example , either pacbio or oxford nanopore sequencing ( very long reads , though with high error rates ) , coupled with existing illumina data ( short reads , but low error rates ) may better resolve telomeric and other repeat sequences , which are hard to resolve even with the original sanger reads .", "another question is whether the sequence of a single instance of a strain is a reasonable representation of the reference sequence indeed , given candida albicans propensity to undergo rearrangement and loss of heterozygosity under stress , different lab isolates of ostensibly the same strain might have different sequences ." ], [ "national institute of dental and craniofacial research at the us national institutes of health [ r01 de015873 ] . funding for open access charge : nih . conflict of interest statement ." ] ]

[ [ "the interaction term for osa and obesity on homa- was calculated to determine whether the association between osa and homa- was modified by obesity status . to exclude the potential confounding effect of medication for diabetes or dyslipidemia on glucose metabolism", "in addition , to examine the additive effect of eds and osa on glucose metabolism , ors for ifg only , igt only , ifg + igt , and diabetes were evaluated in subjects with osa according to the presence or absence of eds compared with those without osa . for logistic regression", "odds ratios ( ors ) for ifg only , igt only , ifg + igt , and diabetes were calculated according to the tertile of ahi to demonstrate the dose - response relationship .", "variables associated with glucose metabolism were compared by ancova after adjusting for age , sex , and bmi among the groups stratified by osa and obesity . for ancova , we confirmed the homogeneity of the slope between the covariates and the dependent variables in subjects with or without osa .", "the following five models were fit for each outcome : model 1 was adjusted for age and sex ; model 2 was adjusted for age , sex , alcohol consumption , smoking status , exercise , presence of hypertension or cvd , and medication for dyslipidemia ; model 3 was the same as model 2 and adjusted for bmi ; model 4 was the same as model 2 and adjusted for wc ; and model 5 was the same as model 2 and adjusted for vfa in subjects who underwent abdominal ct scan . to exclude the potential confounding effect of medication for diabetes or dyslipidemia on glucose metabolism", "insulin resistance was estimated with the homeostasis model of assessment for insulin resistance ( homa - ir ) and calculated as fasting glucose ( mmol / l ) fasting insulin ( u / ml ) / 22.5 ." ], [ "insulin resistance was estimated with the homeostasis model of assessment for insulin resistance ( homa - ir ) and calculated as fasting glucose ( mmol / l ) fasting insulin ( u / ml ) / 22.5 .", "all participants responded to an interviewer - administered questionnaire and underwent a comprehensive physical examination .", "the presence of chronic illnesses , including diabetes , hypertension , dyslipidemia , and cardiovascular disease ( cvd ) , was noted as were prescribed medications .", "homa -cell function ( homa- ) ( % ) was calculated as 20 fasting insulin ( u / ml ) / fasting glucose ( mmol / l ) 3.5 ( 15 ) .", "diabetes was defined by american diabetes association criteria , using a 75-g oral glucose tolerance test ( fasting plasma glucose [ fpg ] 7.0 mmol / l or 2-h plasma glucose [ 2hpg ] 11.1", "glucose tolerance status was assessed by american diabetes association criteria ( 12 ) as follows : ifg only ( 5.6 fpg", "obesity was defined as bmi 25 kg / m according to the asian - specific bmi cutoffs from the world health organization report ( 14 ) ." ], [ "the total area of intra - abdominal fat was delineated by manual tracing within the muscle wall , and the visceral fat area ( vfa ) was defined as an area with an attenuation range between 190 and 30 hounsfield units .", "the scans were conducted at 120 kv with a slice thickness of 5 mm at the level of the l4l5 vertebral interspace .", "for subjects who participated in the fifth biennial examination ( n = 820 ) , single - slice computed tomography ( ct ) scanning ( brilliance 64 ; philips , cleveland , oh ) was used to quantify intra - abdominal adipose tissue ." ], [ "the apnea - hypopnea index ( ahi ) was high ( cronbach = 0.996 and 1.00 for each rater ) , and interrater reliability was strong ( cronbach = 0.998 ) . although we did not perform a validity study to compare psg recordings obtained in the home and laboratory settings , the sleep heart health study clearly demonstrated that the median respiratory disturbance index was similar in the unattended home and attended laboratory settings , with differences of a small magnitude in some sleep parameters ( 18 ) .", "recording channels were one for electroencephalography ( c4a1 ) , one for electrooculography ( right upper outer canthus to left lower outer canthus ) , one for chin electromyography , one for modified lead ii electrocardiography , one for airflow from nasal airflow pressure transducer , two for respiratory effort from chest and abdominal respiratory inductance plethysmography , one pulse oximeter , and one position sensor .", "overnight sleep study was performed at home with a portable device ( embletta x100 ; embla systems , san carlos , ca ) .", "data were scored by two well - trained technicians who had 5 years of experience with psg monitoring and scoring according to standard guidelines ( 16,17 ) . internal consistency for scoring", "two trained sleep technologists visited each subject s home in the evening , applied sensors , and instructed the subject on how to start and stop the recording .", "obstructive apnea was defined when airflow dropped by 90% of the baseline with ongoing chest and abdominal movement , and hypopnea was defined as a reduction in airflow by 30% associated with at least a 4% oxygen desaturation .", "the duration threshold for the respiratory events was 10 s. ahi was calculated , and osa was defined as an ahi 5 ( 1,16,19 ) ." ], [ "daytime sleepiness was assessed with the epworth sleepiness scale ( ess ) ( 20 ) , a well - validated and frequently used subjective eight - item , self - administered questionnaire .", "subjects were asked to score the likelihood of falling asleep in eight different situations with different levels of stimulation .", "the higher the ess score , the greater propensity for sleepiness implied . in the current study" ], [ "the interaction term for osa and obesity on homa- was calculated to determine whether the association between osa and homa- was modified by obesity status . to exclude the potential confounding effect of medication for diabetes or dyslipidemia on glucose metabolism", "in addition , to examine the additive effect of eds and osa on glucose metabolism , ors for ifg only , igt only , ifg + igt , and diabetes were evaluated in subjects with osa according to the presence or absence of eds compared with those without osa . for logistic regression , we calculated adjusted r and hosmer - lemeshow statistics to assess model adequacy .", "odds ratios ( ors ) for ifg only , igt only , ifg + igt , and diabetes were calculated according to the tertile of ahi to demonstrate the dose - response relationship .", "variables associated with glucose metabolism were compared by ancova after adjusting for age , sex , and bmi among the groups stratified by osa and obesity . for ancova", ", we confirmed the homogeneity of the slope between the covariates and the dependent variables in subjects with or without osa .", "subject characteristics at baseline were compared among groups stratified by the presence or absence of osa and obesity by student t test for continuous variables and test for categorical variables .", "nonnormally distributed variables , such as hba1c , homa - ir , homa- , ahi , and triglyceride level , are presented as the median and interquartile range for each group , and the differences were tested after logarithmic transformation .", ", the same analyses were repeated after excluding subjects who were taking these medications . to evaluate the impact of osa on ifg only , igt only , ifg + igt , and diabetes according to the presence or absence of obesity , multivariate logistic regression analyses were conducted . in the analysis ," ], [ "association between osa and abnormal glucose metabolism according to obesity status supplementary table 4 shows the joint effect of osa and eds on glucose tolerance categories . in the nonobese group , compared with subjects without osa , nonsleepy subjects with osa had higher ors for diabetes , but sleepy subjects with osa had the highest ors for diabetes ( hazard ratio 5.78 [ 95% ci 2.0516.3 ] ) .", "osa was significantly associated with diabetes even after adjusting for vfa in nonobese subjects . in an analysis to show the dose - response relationship , nonobese subjects with the highest ahi tertile had the highest ors for ifg + igt or diabetes ( supplementary table 2 ) .", "the presence of osa showed higher ors for ifg + igt and diabetes , even after adjusting for several confounding variables , including bmi or wc .", "about 36.6% of nonobese and 58.2% of obese subjects had osa . however , the severity of osa was mostly mild and moderate ( 27 , 8.8 , and 0.8% of nonobese and 38.4 , 14.6 , and 5.2% obese subjects had mild , moderate , and severe osa , respectively ) . among 396 subjects with diabetes , 351 had a history of diabetes of whom 142 were treated with oral hypoglycemic agents ( n = 140 ) or insulin ( n = 4 ) .", "subjects with osa were older and had a higher 2hpg , hba1c , bmi , wc , vfa , and homa - ir than those without osa , regardless of obesity . in the nonobese group , subjects with osa had higher fpg and triglyceride levels and lower homa- and hdl cholesterol levels than those without osa .", "however , in the obese group , only insulin and homa - ir levels were associated with osa ." ], [ "the current study provides original evidence that the presence of mild to moderate osa in nonobese individuals confers a higher risk for impaired glucose metabolism , even after adjusting for important risk factors .", "osa can be responsible for the future risk for diabetes and cvd in nonobese individuals , whereas the prognostic implication of osa in obese individuals is unclear .", "in this large community - based cohort study , we demonstrated the differential association between osa and impaired glucose metabolism according to the presence of obesity . of note", ", osa was significantly associated with abnormal glucose metabolism in nonobese subjects , even after adjusting for several confounding variables , including generalized or visceral adiposity . to our knowledge , this study is the first to show that the impact of osa on glucose metabolism is more evident in the nonobese than in the obese population .", "in the current study , we demonstrated that the joint effect of osa and eds on the or for diabetes was highly significant only in nonobese subjects .", "therefore , the differential impact of eds on glucose metabolism according to obesity status may be responsible for the discrepant effect of osa in subjects with or without obesity in the current study ." ] ]

[ [ ", we present magnetic resonance imaging ( mri ) and fluorine-18-fluorodeoxyglucose ( f - fdg ) positron emission tomography ( pet)/ct findings in a patient with primary uterine peripheral t - cell lymphoma .", "however , the diagnosis of primary uterine lymphoma is often delayed due to its low incidence and nonspecific clinical presentation .", "primary uterine non - hodgkin 's lymphomas are extremely rare accounting for < 1% of all extranodal non - hodgkin 's lymphomas .", "approximately 24% of non - hodgkin 's lymphomas are considered to be of extranodal origin ." ], [ "the imaging and pathologic findings were consistent with primary peripheral t - cell lymphoma of the uterus ( stage , ii e ) . after 3 circles of chemotherapy , a follow - up mri showed decreased thickness of the uterine wall ( figure 4 ) .", "ct = computed tomography , fdg = fluorodeoxyglucose , mri = magnetic resonance imaging , pet = positron emission tomography .", "this mass showed inhomogeneous hypointensity on unenhanced t1-weighted images , hyperintensity on diffusion - weighted imaging , relative hypointensity compared to the surrounding myometrium on t2-weighted images , and lower enhancement than the surrounding myometrium on enhanced t1-weighted images ( figure 1 ) .", "saggital t2-weighted mr image ( c ) showed the mass ( arrows ) involved both the endomerium and myometrium , resulting in diffuse enlargement of the uterus .", "this mass showed relative hypointensity compared to the surrounding myometrium . on transverse ( d ) , coronal ( e ) , and saggital ( f ) enhanced t1-weighted images , this mass showed lower enhancement ( arrows ) than the surrounding myometrium .", "mri showed an ill - defined mass involved both the uterine corpus and cervix , resulting in diffuse enlargement of the uterus .", "transverse unenhanced t1-weighted image ( a ) showed an inhomogeneous hypointense mass ( arrows ) in the uterus . corresponding transverse diffusion - weighted imaging ( b ) showed peripheral hypointensity of the mass ." ], [ "the combination of chemotherapy and irradiation is the most effective treatment regimen for uterine lymphomas . on mri , diffuse enlargement of the uterus , relatively homogeneous signal intensity , and multinodular growth pattern", "primary uterine non - hodgkin 's lymphomas are extremely rare accounting for < 1% of all extranodal non - hodgkin 's lymphomas .", "the mean age of patients with primary uterine non - hodgkin 's lymphoma at presentation is 55 years and abnormal uterine bleeding is the most frequent complaint .", "this case indicates uterine lymphoma should be included in the differential diagnosis of abnormal uterine fdg accumulation along with physiological endometrial uptake , postpartum uterus , adenomyosis , endometrial hyperplasia , leiomyoma , cervical cancer , endometrial cancer , choriocarcinoma , uterine sarcoma , and uterine metastasis . in conclusion , primary uterine non - hodgkin 's lymphoma should be taken into consideration when a uterine tumor shows large size , relative hypointensity on both t2-weighted images and enhanced t1-weighted images compared to the surrounding myometrium , and intense fdg uptake on pet / ct ." ], [ "written informed consent was obtained from the patient for publication of this case report and any accompanying images .", "ethical approval was obtained from the ethics committee of changhai hospital , shanghai , china ." ] ]

[ [ "recent data have proposed that this might be a consequence of neurovascular compression on the left ventrolateral medulla .", "there is evidence for this in the heart , kidney and skeletal muscle but it has not been confirmed in studies of the hepatomesenteric circulation . in other words , it is difficult to provide evidence for a ubiquitous abnormality of sympathetic function in all vascular beds although the overall integrated haemodynamic profile can be ascribed to increased sympathetic discharge .", "this combination of increased sympathetic discharge coupled to a reduced parasympathetic activity suggests that the abnormality in essential hypertension is one of integrated function in the medulla oblongata .", "again , the inappropriately high level of vascular resistance for the increase in cardiac output is a hallmark of early hypertension .", "an early cross - sectional study of mild hypertension reported that the predominant hemodynamic feature was a high cardiac output and this observation has been confirmed consistently since . although not invariably so , the high cardiac output is accompanied by an increased heart rate and several studies have demonstrated that when oxygen consumption is measured , both cardiac output and this parameter are raised . in the mild early stages of essential hypertension", "however , over this period the high cardiac index and normal total peripheral resistance pattern changes to a low cardiac index high resistance pattern .", "other studies demonstrated that autonomic blockade of the heart in mild hypertensive patients restored cardiac output to normal and there was a combination of increased sympathetic tone and decreased parasympathetic activity in such individuals [ 4 , 5 ] ." ], [ ", changes in tpr in response to low / modest stimulation appear to be a relevant parameter of tpr reactivity .", "assuming that methoxamine is the most specific agonist , these results are suggestive for functional rather than structural changes being contributory to the hyper - responsiveness to modest receptor stimulation . from a pathophysiological perspective", "in other words , in vivo studies do not actually support the hypothesis that structural changes amplify vasoconstrictor responses throughout the circulation .", "korner and angus developed a theory with respect to the role of an increased wall : lumen ratio in the resistance vasculature , which maintains the elevated peripheral resistance in hypertension .", "the corollary of what has been described above , namely the existence of excessive sympathetic nervous activity in the early stages of the development of hypertension being the trigger for the majority of this disorder then it is tempting to regard the small artery as changing shape in consequence . in a study of small artery structural characteristics in first degree offspring of hypertensive patients , in whom one would predict an increasing propensity to developing hypertension , there was no evidence of any alteration despite mean blood pressures being higher . also , in another study in young genetically hypertension - prone spontaneously hypertensive rats ( shr ) , where non - constricting ligatures were placed on the iliac artery and the animals allowed to mature until a point when the ligature compressed gradually on the vessel , the pressures in the hind limb were kept low and structural changes were not observed .", "more marked stimulation leading to 5- or 6-fold increases in tpr may lead to increased responsiveness but these are unlikely to be relevant for the maintenance or development of most hypertension ." ], [ "the structural difference between large conduit and medium - sized arteries and downstream resistance vessels is apparent in many models of hypertension : for example , in a hypertensive model brought on by chronic nitric oxide synthase inhibition .", "to understand how hypertension produces non - hypertrophic changes in small arteries , one must look at the physiological role of the resistance vasculature . at normal pressures , these vessels exhibit a level of contraction ( myogenic tone ) , which is independent of neurohormonal influences and in functioning in this way the response enables arteries to constrict or dilate in response to changes in upstream pressure .", "in addition , the magnitude and duration of an increase in intraluminal pressure plays a role in determining the remodelling response .", "this process known as the myogenic response is only observed in smaller resistance arteries , which mediate autoregulation of blood flow and stabilize capillary pressure .", "if an individual has untreated hypertension then there will be prolonged myogenic constriction as the resistance vasculature endeavours to protect the target organs downstream from pressure - induced damage brought about by an increase in blood flow ." ], [ "eutrophic inward remodelling is a process of structural adaptation observed in most forms of hypertension including the onset of hypertension and milder hypertensive states .", "however , a few animal models of hypertension , such as a model developing hypertension independent of the renin angiotensin system ( bph-2 mice ) , demonstrate hypertrophy as the predominating structural change .", "the protective effect of ace inhibition in the kidney has been presumed to be a consequence of an inhibition of angiotensin ii induced efferent arteriolar myogenic tone . of course it could be argued that the effects of blood pressure lowering would be important on stroke development and , in consequence , ace inhibition is working by its antihypertensive effects .", "it is now clear that rhoa signalling plays a central role in both calcium sensitization and regulation of actin dynamics in small artery remodelling .", "other studies have demonstrated that the myogenic component of renal autoregulation is impaired in the fawn hooded rat ( the tubuloglomerular feedback component of renin autoregulation is unchanged ) compared with controls thereby causing glomerular hypertension and hyperfiltration , which explains why the kidneys are susceptible to the deleterious effects of moderate hypertension ." ], [ "there is little evidence to suggest that hypertension is associated with abnormalities of contractile function . both in vitro and in vivo studies", "of course , longitudinal experiments in human beings are awaited but it is clear that endothelial function can be improved with the use of angiotensin receptor antagonists and ace inhibitors and recent studies have demonstrated in human beings that the combination of an angiotensin receptor blocker and a statin is an extremely powerful one for improving endothelial function .", "have suggested that contraction is normal although there is controversy about whether the structural alterations in the vascular wall lead to exaggerated constriction and vascular amplification ( see above ) .", "for example , there is often associated dyslipidaemia and there is clear evidence that oxidized low - density lipoprotein ( ldl ) can reduce the bioavailability of nitric oxide and as a result of this there is evidence of abnormal endothelium dependent dilator function which has been reported in patients with high blood pressure and dyslipidaemia , patients with dyslipidaemia and coronary artery disease or the subcutaneous vasculature of patients with hypercholesterolaemia ." ], [ "the molecular basis of the physiological remodelling response to hypertension is slowly being understood . the replacement of eutrophic inward remodelling by a pathological change such as hypertrophy appears to herald the development of an increased risk of circulatory disease .", "the obvious attraction is that the identification of the , at risk patient will mean that scarce healthcare resource can be targeted at such individuals with maximum benefit in terms of circulatory protection .", "future research should look at why this occurs and whether effective antihypertensive medication can reverse this and improve outcome for individual patients .", "the challenge ahead is to identify those that are going to develop hypertrophic remodelling against a background of sustained high blood pressure and more indirect measurements of structural changes in blood vessels are urgently required ." ], [ "the authors state that there is no conflict of interest with the view state in this paper ." ] ]

[ [ ", we summarize evidence from both animal models and human studies on the in vivo functions of the annexin a2/s100a10 system .", "annexin a2 ( a2 ) belongs to the annexin family of ca - regulated phospholipid binding proteins , which are expressed in plants , animals , and protists throughout the phylogenetic tree .", ", we focus exclusively on the growing body of evidence that annexin a2 and its partner protein p11 contribute to human health and disease ." ], [ "thus , directed p11 targeting may prove useful in the treatment of refractory pain disorders .", "together , these findings provide a link between fibrin accumulation and diminished neoangiogenesis and imply that new therapeutic avenues for proliferative retinal vascular disorders , such as retinopathy of prematurity or diabetic retinopathy , could involve blockade of a2 in addition to inhibition of angiogenic growth factors . in the central nervous system ,", "elevated levels of circulating hc have been associated with both thrombotic and atherosclerotic vascular disease , although therapies that lower plasma hc have not been shown to reduce the risk of recurrent cardiovascular disease .", "thus , a2 or its analogs may constitute a useful adjuvant to conventional thrombolytic treatment by reducing the effective dose of tpa , thereby limiting its potential toxicity . the fibrinolytic system appears to modulate the development of plaque - like vascular lesions in mouse models of atherosclerosis in a complex fashion .", "these findings are significant in view of reported neurotoxicity and cerebral hemorrhage associated with the use of tpa in the treatment of thrombotic stroke in humans [ 5759 ] ." ], [ "at diagnosis , acute promyelocytic leukemia ( apl ) is commonly associated with life - threatening hemorrhage . in apl ,", "this study confirms the role of the a2 system in fibrinolytic bleeding in patients with apl .", "these data suggest that annexin a2 may represent a significant modifier gene that shapes the clinical expression and natural history of sickle cell disease .", "it is characterized by thrombosis and recurrent fetal loss in association with circulating antiphospholipid antibodies ." ] ]

[ [], [ "however , the outcome of pregnancy in dialysis patients has been much improved , and the overall rate of successful fetal outcome is reported to be 76% ( 1 ) .", "pregnancy in patients with end - stage renal disease ( esrd ) is rare , and kidney disease before pregnancy is associated with poor fetal outcome .", "we present a case of successful pregnancy in an adpkd patient on hemodialysis ( hd ) .", "this is mainly due to a multidisciplinary approach that incorporates intensive dialysis and aggressive management of anemia and hypertension .", "autosomal dominant polycystic kidney disease ( adpkd ) is the most common inherited renal disease , and approximately half of the patients progress to esrd by age of 60 ( 2 ) . with regard to pregnancy , fertility" ], [ "secondly , our team evaluated the risk of stunted intrauterine fetal growth by her massively enlarged kidneys .", "firstly , the risk of pregnancy in a dialysis patient and the need for intensive dialysis were discussed with her family .", "we considered a unilateral nephrectomy at the second trimester to secure the intraabdominal space , but the risk was determined to outweigh the benefits in this case ." ], [ ", we sought to determine the best way to secure fetal survival and a good maternal outcome .", "although pregnancy remains risky in adpkd patients with esrd undergoing long - term hemodialysis , outcomes can be improved by optimizing management through a multidisciplinary team of nephrologists , obstetricians , and neonatal care specialists . intensified dialysis , proper anemia management , and improved", "first , the management of ckd - related complications and the hd schedule were reviewed .", "prophylactic hemodialysis was needed in 1 case ( 8) , and in another case series , we found a pkd patient who underwent nocturnal hd , which is seldom performed in korea ( 10 ) . with this background", "preconception counseling is needed in all women on dialysis because most of the pregnancies reported were unplanned .", "pregnant women with a favorable outcome were found to have lower predialysis bun levels compared to those with adverse fetal outcomes ( 11 ) ." ] ]

[ [ "a 78-year - old woman presented with weakness , fatigue and hemoglobin of 8.3 g / dl , to another clinic in september , 2009 , and she was given erythrocyte suspension replacement .", "since her transfusion dependency increased , she was considered for lenalidomide treatment in april , 2013 .", "after 10 days of treatment , her liver enzymes increased more than 3 times of normal values and she had thrombocytopenia ( platelet count : 38.000/mm ) then her treatment was postponed for two weeks she restarted lenalidomide treatment at daily doses of 5 mg after liver enzymes and platelet counts returned to normal . during", "further follow - up , increase in liver enzymes and severe thrombocytopenia were not detected ; her hemoglobin value increased and transfusion dependency was not observed ( figure 1 ) .", "she had regression in her existing complaints with blood replacement therapy , but after one month , same complaints reappeared with a low hemoglobin value and she was referred for further investigation to the outpatient clinic of hematology of our university faculty of medicine . her hematologic parameters ar that time were as follows : white blood cell count of 6390/mm , neutrophils 3785/mm , hemoglobin 8.1 g / dl , mean corpuscular volume ( mcv ) 95 fl , and platelets 211.000/mm . with the provisional diagnosis of myelodysplastic syndrome due to an isolated anemia unrelated to nutritional status , bone marrow aspiration biopsy was performed ." ], [ "less often adverse events of fatigue , rash and diarrhea can be noted . in conclusion , in isolated 5q - syndrome which is a mds subgroup and characterized by transfusion dependency ; lenalidomide can decrease transfusion dependency with a tolerable adverse event profile that can be overcome with dose modifications .", "one of the major problems during the progression of the disease in transfusion - dependent mds patients is the iron overload secondary to transfusion and the dependency for chelation therapy to treat iron overload .", "isolated 5q - syndrome presents with normal or increased thrombocyte counts in peripheral blood and anemia with frequent transfusion replacement dependency . in clinical studies", "in myelodysplastic syndrome , interstitial deletion in the long arm of chromosome 5 is a common cytogenetical abnormality seen in 16 - 28% of the patients .", "this syndrome is rarely seen ; therefore , there is not enough data about isolated 5q - syndrome as well as lenalidomide therapy in our country ." ] ]

[ [ "afterwards , many researches conducted on the level of response to hbv vaccine among iranian children and ample data on the coverage rate of vaccine together with evaluation of vaccine responsiveness published in iran so far . in this study , a systematic review and meta - analysis was performed to provide the statistic power on investigations performed nationally and to provide a summary of the results .", "historically , the potency of immune response after immunization against hepatitis b has been assessed by measuring antibody to hbsag .", "most clinical complications associated with hepatitis b are manifested in conditions , particularly cirrhosis and hepatocellular carcinoma ( hcc ) as consequences of chronic infection .", "naively speaking , one would expect that the ultimate decline is reaching ; however , this is not the case ; universally , about 5 - 20% of vaccine failure among recipients has been reported manifested by different levels of hypo- or nonresponsiveness to hbv vaccination ( 4 , 5 ) .", "the global reported decline in hbsag prevalence , especially from hbv endemic area ( such as south east asia , alaska , etc . ) has been come as something of a surprise .", "the primary goal of hepatitis b prevention is reduction of chronic hbv infection and hbv - related chronic liver disease .", "the persistence of anti - hbs above the protection level ( > 10 iu / ml ) in vaccine recipient is the main goal ." ], [ "we performed a comprehensive search on pubmed , isi , scopus , iran medex and scientific information database ( sid ) , on published describing anti - hbs levels in children below 15 years ( after six months to 15 years old ) who received three doses of hbv vaccine following epi .", "the primary outcome was frequency of persons with protective levels of anti - hbs ( > 10 iu / ml ) following hbv vaccination .", "the secondary outcome was frequency of nonresponders to hbv vaccine ( < 10 iu / ml ) .", "the main inclusion criterion was all studies that included subjects under 15 years old who received 3 doses of hbv vaccine ( regardless of type and brand of vaccines ) .", "iran for searching in english databases ( hbv vaccine , anti - hbs , expanded program on vaccination , prevalence , responders and nonresponders ) were used for conducting a more efficient search .", "statistical heterogeneity of reported prevalence was explored by chi - square ( or chi2)-based q - test and was regarded to be statistically significant at the 10% significance level ( p < 0.10 ) . to gain better insight into the prevalence of dyslipidemia and its heterogeneity throughout iran" ], [ "the primary outcome was frequency of persons with protective levels of anti - hbs ( > 10 iu / ml ) following hbv vaccination .", "the secondary outcome was frequency of nonresponders to hbv vaccine ( < 10 iu / ml ) ." ], [ "the main inclusion criterion was all studies that included subjects under 15 years old who received 3 doses of hbv vaccine ( regardless of type and brand of vaccines ) .", "we excluded all studies in which individuals received vaccine episodes out of vaccination schedule ( less or more administrations ) and in those with any medical interventions ( such as using adjuvant , booster doses etc . ) .", "moreover , we did not include surveys that investigated responsiveness to vaccine in those with medical conditions ( children born to hbsag positive mothers , thalassemia , dialysis , received hb vaccine plus immunoglobulin , predisposing factors for immunodeficiency such as hiv , etc . ) ." ], [ "data was extracted from selected studies including the name of author , year of publication , the mean age of participants and the levels of anti - hbs in different case - studied .", "iran for searching in english databases ( hbv vaccine , anti - hbs , expanded program on vaccination , prevalence , responders and nonresponders ) were used for conducting a more efficient search .", "studies that had an adequate handling of incomplete outcome data , were free of selective reporting , included an adequate intervention description , had appropriate criteria for participant recruitment and included an adequate outcome explanation were considered low - bias risk trials .", "the studies with one or more unclear or inadequate quality component were considered high - bias risk trials .", "the authors assessed the risk of bias in the included studies using a risk - of - bias tool .", "we merged the subjects who harbored levels between two extremes ; 10 and 100 iu / ml , as responders ( because some studies assigned these levels as hypo - responsiveness ) .", "the medical subject headings ( mesh ) including entry terms of pubmed and emtree of scopus with affiliation to " ], [ "statistical heterogeneity of reported prevalence was explored by chi - square ( or chi2)-based q - test and was regarded to be statistically significant at the 10% significance level ( p < 0.10 ) . to gain better insight into the prevalence of dyslipidemia and its heterogeneity throughout iran", "the authors were not blinded to the names of studies authors , journals and results .", ", we analyzed our findings using random - effects model with a 95% confidence interval ( ci ) .", "any disagreements were resolved through discussion among the authors until consensus was reached ( kappa coefficient : 78% ) .", "data are expressed as percentages for categorical variables and means and sds ( standard deviation ) for continuous variables .", "the analyses were conducted with stata software , version 11.0 , produced by statacorp , the usa ." ], [ "response to vaccine according to ethnic groups ( turkish , arab , kurdish , turkmen , etc . ) and geographic area was evaluated ; however , no strong correlations were found ( p 0.826 and 0.896 , respectively ) . ", "furthermore , prevalence of anti - hbc was between 0 and 7.5% in different reports ( table 1 ) . in those studies which compared the rate of responsiveness to hbv vaccine between urban and rural area", "meta - regression analysis showed that with increase in age , the number of responders to vaccine decreased significantly ( p = 0.001 ) ( table 2 ) .", "table 1 shows summary of iranian studies on immunization program . in total , these investigations were performed on 11639 children who received full three doses of vaccine ." ], [ "altogether , 0 to 1.29% prevalence of hbsag together with 0 to 2.5% anti - hbc from different provinces underscored the usefulness of hbv vaccination for substantial reduction in hbv endemicity in iran .", "there are ample data on the vaccine coverage rate , response to the vaccine , amnestic response to booster doses etc . among iranian healthy children .", "interestingly , between years 1995 and 2014 , there was no significant difference in the mean anti - hbs titers between iranian studies ( p = 0.428 ) . this finding together with this issue that the type of vaccine used did not show any significant differences between the rate of response to vaccine ( p > 0.05 ) , indicate the reasonable potency and antigenicity of vaccine used in iranian epi , which were already assessed by our lab in vivo and in vitro studies ( 52 , 53 ) . despite some studies showed some differences in response to hbv vaccine between rural and urban areas ( 54 - 57 )", "third , there was no substantial difference between iranian and other international investigations in the rate of nonresponsiveness to hbv vaccine .", "there have been numerous published data on the rate of response to hbv vaccine internationally ; the reported rate of hbv vaccine responsiveness ranged between 41.6 and 98.3% ( table 4 ) .", "what is the impact of low level of anti - hbs on acquisition of hbv infection ?" ] ]

[ [ "avoiding glenoid component malposition in terms of version and inclination is therefore an important technical goal , which may be very demanding due to a variety of issues related to patient anatomy and surgical technique .", "it is the most recent development in this field , and its effectiveness in both the version and inclination planes of glenoid component placement has been demonstrated for both total anatomical and reverse shoulder arthroplasties .", "improperly - placed implants are at risk of dislocation , increased component wear and loosening , and the need for revision surgery .", "this type of pre - operative planning has grown in popularity across a wide range of orthopaedic subspecialties including total hip and knee arthroplasty , pelvic and acetabular procedures and spinal deformities , with varying degrees of success .", "surgical planning for these patients can be improved using three - dimensional ( 3d ) reconstructions of ct scans , but recreating that same plan at surgery can be difficult .", "patient - specific instrumentation has the potential to provide a similar level of accuracy as computer - assisted navigation , but without such problems or additional surgical steps ." ], [ "a ) reverse prosthesis in a left shoulder and guided central pin drilling ; b ) native glenoid and patient - specific bone models are compared to check accurate placement of the guide on a very deformed scapula ; c ) central screw drilling completed over a guide pin that keeps its stability due to the integrity of the far cortex with no glenoid vault perforation , made possible with an accurate drilling direction .", "virtual surgical planning requires the definition of the axis for the glenoid baseplate component , by creating patient - specific surgical guides .", "a ) glenoid central pin placement for an anatomical prosthesis in a right shoulder ; b ) good exposure of the anterosuperior glenoid rim is required for the proper seating of the guide .", "the technique for exposure and the use of instruments for bone preparation over a guidewire is identical whether or not the patient - specific instrumentation is used ." ], [ "in addition to single - use patient - specific instrumentation ( psi ) , it should be noted that reusable and adjustable psis are also available from some manufacturers . in the longer term , this technology may prove to be of lower cost than single - use psis and should result in a reduction of the time from planning to use of the instrument ." ], [ "the purpose of those studies was to examine the effectiveness of patient - specific planning and a patient - specific drill guide for glenoid component placement in shoulder arthroplasty .", "the conclusions drawn are similar in all . in 2011 , suero et al evaluated the safety and accuracy of a custom glenoid jig created using pre - operative ct imaging , with 3d modeling for glenoid component implantation .", "comparison between the pre - operative plan and the result on post - operative ct scans of seven patients showed that a ct - based custom alignment can reliably guide the placement of the glenoid component during conventional and reverse shoulder arthroplasty , without technical difficulties or complications . in their level" ], [ "current evidence suggests that the use of psi can assist in the avoidance of significant glenoid baseplate orientation errors , especially by less experienced surgeons , resulting in fewer malpositioned glenoid components .", "however , the surgeon s expertise and intuition remains invaluable , both in the pre - operative planning and in the final component implantation , especially concerning the reaming depth .", "custom - made guides will play an important role in the placement of the central pin on glenoids with severe deformation , in cases where the best anatomical landmarks may have vanished and the use of bone grafting is anticipated ." ], [ "ng has received financial support outside of the current work in the form of consultancy and lecture fees from zimmer biomet ." ] ]

[ [ "despite expanded indications for conservative surgery of urothelial tumors ( ut - formerly transitional cell carcinoma ) of the upper urinary tract ( uut ) , radical nephroureterectomy ( nue ) with complete removal of the distal ureter including the bladder cuff is the standard surgical technique used for most patients with ut of the uut .", "thus , we have decided to start clnue with excision of the ureterovesical junction with collin 's knife followed by clnue .", "exclusive laparoscopic sharp excision of the bladder cuff with intracorporeal suturing [ 1115 ] appears too difficult for us .", "the main problem with this procedure is the risk of occlusion of the ureter to prevent spillage of urine containing tumor cells during laparoscopic pluck nephroureterectomy .", "choosing the best procedure for this group of patients in everyday clinical practice is frequently a challenging task . while laparoscopic nephrectomy as a part of nue was first described in 1991 and it is to - date broadly accepted , the approach to the distal ureter and the timing of the ureterectomy are still disputed .", "however , we found a significant risk of incomplete resection of the intramural part of the ureter ." ], [ "thirteen underwent some type of open surgery ( advanced cases with open nephrectomy or laparoscopic nephrectomy with open ureterectomy for tumor of the distal ureter ) and 21 nue by clnue- ivlc ( main inclusion criteria : not suitable for conservative treatment , no tumor of distal ureter , no advanced tumor by ct , no contraindications to laparoscopy , or no concomitant bladder tumor ) .", "four underwent conservative surgery ( one ho : yag ablation , one ureteroscopic resection , one nephroscopic resection with resectoscope , and one open resection of the ureter ) and 34 nue .", "the study is prospective , but due to the absence of a standard technique for nue , the study was not randomized and comparative . from 1/2010 to 1/2012 , 38 patients with suspected ut of uut were indicated for surgical treatment .", "the patient is rotated to the flank position and a standard laparoscopic nephrectomy via a transperitoneal approach is performed [ 10 , 22 ] . the transperitoneal approach is more familiar to us than the retroperitoneoscopic one .", "this phase is delicate due to the relatively narrow operation space and the close relation of iliac vessels and the bowel .", "the ureterovesical junction is excised transurethrally with collin 's knife ( the paravesical adipose tissue must be clearly visible ) . from the suprapubic region ,", "the ureter is completely separated and the hem - o - lok clip must be clearly visible to constitute proof of completion of the ureterectomy ." ], [ "a few points to emphasize include : four complications ( clavien ii 2x , iiib and v ) wound infection at the site of extraction ( staphylococcus aureus ) , urine leakage from the pelvic drain for 6 days ( bladder catheter was removed on the 8 postoperative day following cystoradiography that did not reveal leakage ) , one open prostatectomy on the 2 postoperative day because of an enlarged prostate ( bph with hematuria ) , and one patient died of heart failure on the day of operation . in four cases ( 19.0% )", "right , turb transurethral resection of bladder tumor , up - um ureter proximal - middle , uc ", "application of the clip failed and clnue was concluded with a non - occluded ureter and the risk of dissemination of tumor cells in urine paravesically . in the first case the patient had a ureteral stent and the ureter was incrassate , which is why we did not want to apply 10 mm port to facilitate the introduction of the hem - o - lok clip size l. in another case , the stented ureter was also incrassate and we introduced a 10 mm port to the urinary bladder and applied a size l clip without difficulty .", "abbreviations : ae adrenalectomy for adenoma , bcg history of intravesical instillation of bcg , bt urinary bladder tumor , eskd end - stage kidney disease , l left , m male , mo " ], [ "our experience prompted us to review this topic in two recent publications [ 10 , 22 ] and now we will focus the discussion on complete laparoscopic nue with emphasis on the method of removing the distal part of the ureter including the bladder cuff . in our view , due to the disadvantages mentioned in the introduction , the method involving a stapler should be abandoned .", "the laparoscopic ne with ensuing sharp excision of the ureterovesical junction and closing of the defect with suture is an ideal but challenging method .", "we prefer a variant of excision of the ureterovesical junction but with another method for sealing of the ureter .", "suprapubic transvesical single - port technique for control of lower end of ureter during laparoscopic nephroureterectomy ." ], [ "the main disadvantage seems to be the risk of an unclosed defect of the urinary bladder , but based on our own experience , as reported in this paper and the available literature , we have not found any significant complications emerging from this .", "clnue- ivlc is a relatively simple , reproducible , and minimally invasive method with minimal risks of tumor spillage and seeding .", "another disadvantage is failure in applying the hem - o - lok clip , in which the technique is concluded without closing the ureter , and is generally thought to carry a higher risk of extravesical tumor recurrence , but as described recently , this technique has comparable oncological results to the open distal ureterectomy [ 3 , 6 ] .", "the method whereby closing of the ureter is performed allows the procedure ( nue ) to be completed safely in complicated cases ( obesity , advanced cases , previous intraabdominal surgery etc . ) .", "failures in clip application were experienced only in early cases and , with increasing experience , this problem was avoided ." ] ]

[ [ "segmental copy - number variations ( cnvs ) , involving the gain or loss of several hundreds of bases to several hundred kilobases ( kb ) of the genome , can be an important source of genetic variation among human populations of different ethnic groups as well as among individuals .", "therefore , more data regarding cnvs should be accumulated from japanese populations . in this report , we focus on cnvs which were observed at a high frequency ( 5.0% of the individuals ) in the population residing in hiroshima and nagasaki , japan by acgh with bac - clones as targets .", "molecular genetics analyses and cytogenetic analyses have provided significant information about these variations in the human genome , specifically as they relate to disease , such as cancer , and to congenital malformation ( see [ 1 , 2 ] , and review in ) . following", "the development of methodologies and the introduction of new research platforms [ 49 ] , information regarding the nature and pattern of cnvs from representative populations have accumulated .", "polymorphic cnvs have received considerable attention since they might play an important role in the etiology of common diseases .", "examinations of a relatively large number of individuals from various specific ethnic groups have recently been conducted using different array platforms , such as bac - arrays [ 1013 ] , oligo - arrays [ 1416 ] , and others ." ], [ "lymphoblastoid cell lines were derived from a cryopreserved archive of approximately 1000 families consisting of father , mother , and offspring from hiroshima and nagasaki for whom permanent cell lines have been established by epstein - barr ( eb ) virus transformation of peripheral b - lymphocytes . the composition of the families has been reported elsewhere .", "cloned dnas for microarray targets were isolated from bacterial cultures using nucleobond bac 100 ( nippon genetics , tokyo ) . with respect to stage ( 1 ) ,", "in the study , the population studies were conducted at two stages : stage ( 1 ) : 80 unrelated japanese individuals were examined using bac - acgh with an array having 2,241 bac clones , and stage ( 2 ) : 133 unrelated japanese individuals were examined using bac - acgh that contained 2,622 bac - clones .", "prehybridization was conducted in order to block repetitive sequence binding of target dna on the arrays , and to prevent nonspecific binding of probe dna to the targets . following the initial incubation ( overnight at 37c ) ,", "high molecular weight genomic dna was isolated using conventional methods as described in detail elsewhere ." ], [ "we summarized the genes and disease - related genes in omim which overlap to the bac - clone region with our cnvs ( table 2 ) .", "the main purpose of this paper is to report the accumulation of the data about highly polymorphic cnvs found in 5.0% of the individuals .", "all bac - clone regions contained at least one mrna , although the functions of a majority of those mrnas are not known yet ( data not shown ) .", "as shown in table 1 , 680 polymorphic cnvs were observed on 16 bac - regions .", "the cnv data obtained in our studies are summarized in table 1 in addition to the presence or absence of cnvs already reported in the databases .", "it was noteworthy that the majority of bac clones containing our cnvs were known to overlap to at least one cnv reported in the database ." ], [ "we report our highly polymorphic cnvs in bac clones , which were reported to contain genes , expected to be related to phenotypic heterogeneity of each individual , based on the tcag database .", "we examined 213 unrelated japanese using bac - acgh and found a total of 680 cnvs on 16 bac clones .", "the cnvs in the human genome are often associated with developmental disorders and susceptibility to diseases .", "many cnvs were reported to be closely related to disease phenotypes , and recent studies based on advanced molecular technologies , such as genomewide association studies [ 2729 ] and next generation sequencing [ 30 , 31 ] , reported that many genes appear to play important roles in the etiology of common diseases .", "since the genes mentioned are good candidate markers for enabling us to examine the etiology of common diseases and phenotypical heterogeneities among individuals , our highly polymorphic cnvs should be able to become good markers in future studies .", "we focused on genes reported in the above database , although many mrna were listed in the database in addition to genes ( table 2 ) ." ], [ "we are currently planning to examine the same population using a high - density oligo - array platform to accumulate more cnv data for japanese .", "the oligo platform is known to be more effective in detecting smaller cnvs ( around a few kilobases ) , even though this approach is less effective in tracing cnvs in genomic regions of complex structure that are covered by the bac approach conducted in this study .", "the reason , as mentioned before , is that the bac platform and oligo methods complement each other .", "we expect to construct a more definite japanese cnv database by the combination of bac- and oligo - platform arrays ." ], [ "the majority of the polymorphic cnvs presented on bac clones that overlapped with regions of segmental duplication , and had been previously reported in other publications .", "we conducted population screening for 213 unrelated japanese , and observed 680 highly polymorphic cnvs .", "moreover , it is expected that the cnvs might be good surrogate markers for detecting etiological genes , even if cnvs did not directly affect the genes themselves ." ] ]

[ [ ", pain is frequently viewed in the elderly as a normal process of aging.1 it is estimated that 49%83% of the 1.8 million residents in long - term care have acute or chronic pain , yet the recognition and treatment of pain still presents a challenge.26 recognizing a spectrum of pain behaviors beyond the traditional self - reporting methods , and increasing this knowledge among clinicians and support staff , is still a significant challenge in the provision of care to the elderly .", "the aim of this research was to examine if concomitance exists between cognition and pain in the elderly residing in long - term care .", "predominantly , pain and cognitive decline often coexist in the elderly , with approximately 47% of residents in nursing homes having a diagnosis of dementia.2 pain assessment and treatment is complex , because residents have varying degrees of cognitive function , complicating how their needs are communicated .", "pain control is a primary concern across all care settings . though a universal care concern", "when these symptoms do coexist , little is known about the interaction of pain and cognitive decline , beyond laboratory imaging of the brain from a pathophysiological perspective.7,8 empirical studies both support and refute poor neurocognitive performance in conjunction with increased pain intensity.913 evaluating longitudinal data to assess if a relationship exists between pain and cognitive decline may assist in addressing these ambiguous findings ." ], [ "modeling whether chronic pain leads to worsening or declining cognition , thereby contributing to worsened pain , would test the theoretical constructs of this relationship .", "the significance and correlation of these variables creates a foundation for building additional models , with secondary needs and resident outcomes .", "information of the relationship between pain and cognition adds to an understanding of how resident outcomes occur , and how quality initiatives can be approached .", "in a sample of nursing home residents , is cognitive decline a predictor of increased pain", "theoretical modeling using clinical data is a method used to evaluate resident characteristics and symptoms for inter - relationships between variables ." ], [ "the use of federally - mandated resident assessment surveys is a cost - effective , time - efficient tool to gain insight into resident care needs , and an opportunity to increase our understanding of resident symptom pathways and the effectiveness of interventions used .", "this enables resident outcomes to be more accurately measured through symptoms and treatments , determining the most effective and cost - conscious actions .", "evaluating cognition in conjunction with pain helps clarify if treating either symptom lessens the severity of the other , or if the symptoms are independent .", "using existing clinical data to test theoretical constructs adds valuable information to the validity of the models posited against real world , resident care data .", "if pain and cognition were parallel to and not antecedent of each other , a symptom model would be inaccurate , making it difficult to determine where and what symptoms could be treated . neglecting to include variables as a predictor of the other yields an incomplete clinical picture and theoretical model , making it difficult to find and measure care solutions because the root causes were not fully described . understanding the clinical pathways and interrelationships of resident symptoms is essential to the strategic planning and prioritizing of resident care needs . resource allocation in a struggling medicare - funded system", "understanding the relationship between cognition and pain establishes how these two variables could be included in a theoretical framework .", "organic brain disorders cause a progressive process of cognitive decline.14 if it is not possible for patients to regain a normal level of cognitive function , then the process is degenerative" ], [ "considerable issues exist in the detection of pain in residents with moderate - to - severe cognitive impairment . a lower incidence of pain is reported as cognition declines , largely due to measurement and communication issues.23,24 the detection of pain behavioral cues by both formal and informal caregivers have marked differences depending on the resident s cognitive status , especially with the interpretation of body movements.25 a case report presented by ashpole and katz17 described a patient with a lifelong history of pain ( somatoform pain disorder ) .", "after the onset of dementia , the patient s self - reports of pain sharply declined .", "the pain symptoms were posited to be presenting as an altered mood ( eg , depression or irritability ) and cognitive decline .", "quality of life declines with chronic untreated pain , especially as the intensity of pain increases.27 to date , the relationship between cognition and pain has been evaluated in case reports and pathophysiological studies , but not as a large - scale analysis of concomitance .", "pain is an intricate sensory experience involving physiological , pathological , social , cognitive , and emotional factors.17,18 sensory process is modulated by cognitive load.1922 cognitive load helps to describe how hard it is for the individual to make sense of a stimulus ." ], [ "future theoretical constructs , including the complete model , would further evaluate the relationship of secondary needs ( ie , depression , weight loss , social isolation , higher risk of falls , decreased activities of daily living , impaired gait ) , and how appropriate interventions mitigate the occurrence of secondary needs .", "appropriate interventions to primary needs could improve resident quality of life , use healthcare resources more efficaciously , and reduce staff burden .", "this theoretical framework enables the clinician to translate a complex system encompassing such factors as resident , caregiver , environment , and outcomes , into a measurable tool to improve care .", "the long - term consequence of unresolved , need - driven behaviors gives rise to additional behavioral symptoms and secondary unmet needs .", "proximal issues , eg , a decline in physical state and social and environmental causes , precipitate improvement or exacerbation of the original need : resolving the resident s pain .", "the concept of need - driven behaviors31 and the framework extending this model to include the consequences of need - driven , dementia - compromised behaviors32 serves as the theoretical platform for this research study .", "the need - driven behavior , ie , pain , is a coexisting symptom to cognitive state , a background factor ." ], [ "data were collected from 20012003 ( inclusive ) on residents residing in medicare- receiving nursing homes across the united states .", "pain is not a care - planning trigger from the resident assessment protocol ( rap ) however , it is a quality measure.33 mds items have demonstrated good - to - excellent validity and reliability3436 with interrater and test retest reliability from 0.400.80 , depending on the item section.34 a composite score was used to detect pain from core mds items ( pain items analyzed are detailed in table 1 ) .", "data collection was retrospective and no interventions were tested . the mds is a nationally required assessment providing information on the quality of care provided in nursing homes.16 core items from the mds instrument are used for care planning to trigger events or symptoms requiring intervention ( eg , pressure ulcers , delirium , cognitive loss , falls , and mood state ) .", "noncompletion of the cognitive , communications / hearing , mood and behavior , and psychosocial well - being sections of mds adheres to the instructions given to assessors completing the resident assessment forms .", "the ps items highly correlated with a pain sites summary score.24 additional dimensions of affective and behavioral items are also included to aid in detecting pain across cognitive states ( figure 2 ) . the cognitive performance scale ( cps ) was used to determine resident cognitive state .", "pain and cognition scores were hypothesized to be inversely related . increasing pain score items indicated higher levels of pain .", "a sensitivity of 0.94 and specificity of 0.94 were shown,40 indicating that the utility of this instrument is viable in determining resident cognitive status from mds - derived scores ." ], [ "noncompletion of the cognitive , communications / hearing , mood and behavior , and psychosocial well - being sections of mds adheres to the instructions given to assessors completing the resident assessment forms .", "data were collected from 20012003 ( inclusive ) on residents residing in medicare- receiving nursing homes across the united states .", "minimum data set ( mds ) 2.033 annual assessments were used as the data source , including all residents aged 65 years .", "comatose residents were excluded from the sample , because key item sections ( sections b f ) could not be scored .", "the university of central florida institutional review board ( irb ) assigned an exempt status to the study ." ], [ "the mds is a nationally required assessment providing information on the quality of care provided in nursing homes.16 core items from the mds instrument are used for care planning to trigger events or symptoms requiring intervention ( eg , pressure ulcers , delirium , cognitive loss , falls , and mood state ) .", "pain is not a care - planning trigger from the resident assessment protocol ( rap ) however , it is a quality measure.33 mds items have demonstrated good - to - excellent validity and reliability3436 with interrater and test retest reliability from 0.400.80 , depending on the item section.34 a composite score was used to detect pain from core mds items ( pain items analyzed are detailed in table 1 ) . the significance ( p = 0.01 ) and validity of the measures used in the pain index", "the ps items highly correlated with a pain sites summary score.24 additional dimensions of affective and behavioral items are also included to aid in detecting pain across cognitive states ( figure 2 ) .", ". the cps instrument uses key mds items from sections b , c , and g of the resident assessment form.38,39 the cps measure correlates highly ( r 0.70 ) with the folstein mini - mental status examination ( mmse).40 the mds - derived cps scores were converted to mmse average totals .", ". a cps score of 6 converts to an average mmse of 0.4 , a 3 to 15.4 , and 0 to an mmse of 24.9.38 in validation testing of the cps scores against the mmse , a sensitivity of 0.94 and specificity of 0.94 were shown,40 indicating that the utility of this instrument is viable in determining resident cognitive status from mds - derived scores .", "the averaged scores could range from 0.04 ( severe impairment ) to 24.9 , an intact cognitive state", "the pain index includes fries pain scale37 ( ps ) items ( eg , j2a for pain frequency and item j2b , pain intensity ) ." ], [ "the spss statistical modeling program , amos ( v 6.0 ; spss inc ) , was used to build the covariance model of pain and cognitive state at three different time intervals for 2001 , 2002 , and 2003 .", "pain and cognition scores were hypothesized to be inversely related . increasing pain score items indicated higher levels of pain .", "the covariance model was evaluated for integrity - of - fit statistics ; however , the model is simplistic , with only six discrete measures and five residual terms , so fit statistics would indicate a recently identified model . due to the required large sample size to run structural equation modeling , assessment of statistical power", "is complex.41,42 sample size requirements generally are the number of free parameters ( n = 17 ) times five to ten , to estimate sample size ." ], [ "model 1 depicts cognitive decline as a predictor of increased pain , and model 2 represents the inverse model , increasing pain as a predictor of cognitive decline .", "very little association was found between cognition and pain variables , regardless of the time interval .", "the majority of the sample , 60%67% , was moderately - to - severely cognitively impaired . a one - way repeated measure anova was calculated for cognition and pain .", "the covariance models indicate pain ( 13 ) and cognition ( 13 ) measurements were stable over time with previous measures being a good predictor of subsequent measures .", "select mds items were collected on 56,494 subjects with a mean age of 83 years . in total ,", "a significant effect was found for cognition ( f(2,112986 ) = 5949.23 ; p < 0.01 ) and pain ( f(2,112986 ) = 271.82 ; p < 0.01 ) ." ], [ "these findings support kovach s model of consequences of need - driven , dementia- compromised behaviors ( c - ndb).32 cognition ( background factor ) and pain ( proximal factor ) exist as contributing aspects of how need - driven behaviors are manifested and communicated .", "the sample data do not confirm the presence of concomitance between pain and cognition in this long - term care population .", "results suggest the importance of assessing memory function when managing physiologically distressed residents , because this information aids in determining the best methods to assess resident pain.26,47,48 over the 3-year period , declines in cognitive status occurred which were consistent with the progression of organic brain disease .", "increase their awareness of affective , cognitive , and behavioral indicators of pain , the reliability of mds for pain measures will continue to be a concern .", "supplemental theoretical modeling could evaluate latent growth models , with predictors combining pain , cognition , age , sex , and facility characteristics , enabling a greater understanding of pain and cognition in the elderly beyond this concomitance study ." ], [ "a global assessment of concomitance between pain and cognition offers a unique insight towards a better understanding of the relationship of pain and cognition in a general nursing home population .", "investigating whether cognition is a predictor of pain in a concomitant relationship helped to define how secondary patient outcomes might be mediated .", "further research should be used to link cognition , resident ability to communicate , and levels of pain for significance with quality of life measures like depression , disturbances in gait , weight loss , decreased activity , declines in functional status , or social isolation . in the case of most organic brain diseases , instead of returning to a normal level of cognitive functioning , a progressive decline occurs .", "pain is a cycle that can be intervened upon , and symptoms can be lessened through medicinal and non - medicinal treatments , improving resident comfort . with an understanding of the role of cognition in identifying how pain is communicated , we can improve pain detection and uniformity of measures to ameliorate symptoms .", "this research sought to ascertain whether in fact a relationship exists between pain and cognition , and if so , to gain preliminary insight into the relationship .", "the significance of confirming , theoretical frameworks with advanced multivariate analysis is an opportunity to evaluate interactions of key variables ." ] ]

[ [ "the objective of this study is to compare the laparoscopy with laparotomy for the treatment of pic with respect to various demographic , perioperative and postoperative parameters .", "the advantages of laparoscopic surgery include decreased postoperative pain , a short recovery period and improved cosmesis .", "peritoneal inclusion cyst ( pic ) is defined as an aggregate mass of variable sized , fluid - filled mesothelial - lined cysts of the pelvis , upper abdomen and retroperitoneum 1 .", "the treatment options are observation , hormonal management , imaging - guided aspiration , image - guided sclerotherapy and surgical excision 1 , 7 - 10 . although complete surgical resection is recommended by some authors 11,12 , recurrence after surgical treatment has been reported in about half of the patients 1 . however , most studies have been case reports and small series , and there is a lack of long - term follow - up data" ], [ "the outcome was assessed according to the operative time , the estimated blood loss , the serum ca-125 level , the number of septations of the cyst , the difference of hemoglobin between pre - operation and the one day post - operation , the length of hospital stay , the perioperative and postoperative complications , and recurrence of pic .", "we categorized the follow - up results of the operation to complete remission , clinically successful and recurrence .", "we conducted a retrospective study involving patients who were operated on at the saint vincent hospital , catholic medical college , during the period january 2003 - december 2009 .", "if a patient 's symptoms improved and the mean diameter of the longitudinal and transverse dimensions of a cyst decreased by more than 50% , then the operation was considered as clinically successful . however , if the mean diameter of a cyst increased by over 50% the operation was considered as recurrence 13 .", "the operating time was defined as the time from entry into the operating room to the time of the delivering the patient to the postoperative anesthesia care unit . for each patient , subsequent follow - up evaluations were performed by clinical assessment and an ultrasound examination in the outpatient clinic .", "the size of the cyst was defined as the mean diameter of the longitudinal and transverse dimensions and the height of the cyst ." ], [ "the operation was done under general anesthesia with the patients in the trendelenburg position . after disinfection and sterile coverage , we started with a small horizontal incision for placing the veres needle .", "after insufflation of co2 to a limited pressure of 12mhg , a 10 mm re - usable trocar was placed and the camera was inserted . however , when peritoneal adhesion was suspected by lifting the abdomen around the umbilicus , we tried the open method for entry of a 10 mm trocar 14 .", "somerville , nj , usa ) was applied to the site of the former adhesion to prevent further adhesion . after deflating the intra - abdominal carbon dioxide gas ,", "the peritoneum was incised over the cyst with scissors or monopolar cutting with low voltage . with the use of meticulous dissection close to the abdominal and pelvic structures ,", "the cyst was placed into an endobag ( sejong corporation , incheon , korea ) , and the sac and cyst were extracted through the 10-mm port .", "the bowels were moved out of the pelvic and the inner genital organs were inspected ." ], [ "laparotomy was done either through a horizontal incision above the symphysis or by vertical incision depending on the size of the cyst and the previous operative scar .", "the peritoneum was incised over the cyst with mayo scissors or metzenbaum . with the use of meticulous dissection close to abdominal structures ,", "somerville , nj , usa ) was applied to the site of the former adhesion to prevent further adhesion . after bleeding control ,", "opening and inspection of the abdominal cavity , and pushing the bowels out of the pelvis were done ." ], [ "a laparoscopy was performed in 35 patients and a laparotomy was performed in 48 patients . of the 35 patients , 4 underwent laparoscopic adhesiolysis of the pic and 31 underwent laparoscopic complete resection of the pic .", "of the 48 patients in the laparotomic group , 11 underwent only adhesiolysis of the pic , and 37 underwent complete resection of the pic .", "of the 5 cases in laparoscopic group , 2 cases underwent ultrasonography - guided aspiration and 3 cases underwent repeat laparoscopic cyst resection without further recurrence .", "five cases recurred in the laparoscopic group and 10 cases recurred in the laparotomic group ( table 4 ) .", "the total complication rate was lower in the laparoscopic group than that in the laparotomic group ( p=0.037 ) . in the laparoscopic group , two patients had postoperative ileus .", ", we performed a univariate analysis to determine the impact of age , the mean number of previous abdominal operations , the type of operation , the number of septations in the cyst and concurrent disease on recurrence ." ], [ "laparoscopic surgery is a safe , effective and reliable method for the treatments of pic .", "pic is a rare tumor of an unknown origin , and it is most frequently encountered in women of reproductive age .", "a comparative study between laparoscopy and sclerotherapy as a minimal invasive technique may be necessary . however , our study is the first study that has compared laparoscopy with laparotomy for the treatment of pic , and we showed that the laparoscopy is superior to the laparotomy .", "observation with serial imaging is a feasible management option for asymptomatic patients with an incidentally discovered pic 15 .", "laparoscopic surgery may reduce the perioperative and postoperative complications and hasten the recovery and return to routine activity .", "the recommended treatment is complete resection and the importance of surgery for making the diagnosis and treatment is supported by most authors 10,12 ." ] ]

[ [ "however , these relationships are complex and have yet to be fully clarified . in this study , we evaluated changes in serum leptin levels during pregnancy in overweight / obese and normal - weight pregnant women .", "in addition , we evaluated the percent and total body weight gain as possible factors influencing the levels of this adipocytokine in obese and non - obese pregnant women .", "obesity is currently considered to be one of the major public health problems worldwide ; consequently , the number of obese women who become pregnant increases each year .", "the risks of most of these complications are amplified by excessive weight gain during pregnancy , which proportionally increases the degree of obesity .", "elevated levels of this adipocytokine are also associated with gdm [ 22,2426 ] , pre - eclampsia , and intrauterine growth restriction ( iugr ) ." ], [ "we conducted a prospective , longitudinal study in which included 42 pregnant women in low - risk prenatal care between september 2010 and june 2011 at the teaching hospital and maternity in juiz de fora , minas gerais , brazil . in total ,", "thirty of them were excluded during the study for various reasons , including voluntary withdrawal from prenatal care in the institution ( n=11 ) , withdrawal of consent to participate in the study ( n=3 ) , referral to high - risk prenatal care ( n=8 ) , preterm delivery ( n=4 ) , and spontaneous abortion ( n=4 ) .", "inclusion criteria were : age greater than or equal to 20 years , gestational age less than 12 weeks at the beginning of prenatal confirmed by ultrasonography , and singleton pregnancy .", ", the pregnant women underwent clinical and laboratory evaluations 3 times during pregnancy ( gestational weeks 912 , 2528 , and 3437 ) .", "based on the total weight gain and pre - pregnancy weight of the patient , we calculated the percent weight gain . during each study visit for prenatal care", "total weight gain was calculated by subtracting the weight measured at the last prenatal visit before birth , performed between weeks 37 and 40 , from the pre - pregnancy weight reported at the first visit .", "next , linear regression analyses were performed using maternal weight vs. gestational age , and leptin levels vs. gestational age . to compare leptin levels across the 3 time periods defined in this study ," ], [ "gestational ages were verified using the parameters collected from ultrasounds performed between weeks 11 and 13 of pregnancy . if necessary , the results were used to retrospectively correct the calculations made on the first visit , which were based on last menstrual period as determined by the patient .", "total weight gain was calculated by subtracting the weight measured at the last prenatal visit before birth , performed between weeks 37 and 40 , from the pre - pregnancy weight reported at the first visit .", "the anthropometric characteristics collected for the study group included the patients weights and heights . weight was measured in kilograms ( within 100 grams ) using a filizola calibrated electronic balance ( personal line 200 ; filizola s.a .", "based on the total weight gain and pre - pregnancy weight of the patient , we calculated the percent weight gain .", "pre - pregnancy weight was obtained by patient records , and was collected during the first prenatal visit .", "pre - pregnancy bmi was calculated from the ratio of body mass ( kg ) to squared height ( m ) and classified into 2 groups " ], [ "during each study visit for prenatal care , we obtained a maternal serum sample , which was preserved in triplicate in labeled 2-ml cryogenic tubes ( cral , sp , brazil ) and stored in a thermo scientific freezer ( model 902 ; thermo electric scientific , winchester , va , usa ) at 80c for subsequent analysis .", "serum leptin levels ( ng / ml ) were analyzed with enzyme - linked immune sorbent assays ( elisa ) using a human leptin elisa kit ( kac2281 ; invitrogen corporation , carlsbad , ca , usa ) according to the manufacturer s instructions .", "the inter - assay coefficient of variation was 3.9% for 150.6 pg / ml and 5.3% for 240.7", "these measurements were performed by researchers in the clinical immunology and immunopathology laboratory at the center for reproductive biology , federal university of juiz de fora .", "the readings were taken using an elisa microplate reader ( expert plus ; asys hitech , eugendorf , austria ) at 450 nm ." ], [ "for the statistical analyses , pregnant women were divided into 2 groups according to their bmis ( < 25 kg / m or 25 kg / m ) .", "next , linear regression analyses were performed using maternal weight vs. gestational age , and leptin levels vs. gestational age . to compare leptin levels across the 3 time periods defined in this study ,", "subsequently , we used the t test to compare absolute weight gain and percent weight gain between the 2 groups .", "a 1-sided anova was performed on the 2 groups , which was followed by a post hoc bonferroni test .", "all of the statistical analyses were performed using graphpad prism 5.0 ( graphpad software , inc . , la jolla , ca , usa ) ." ], [ "the socio - demographic and clinical / obstetric characteristics of the cohort are described in table 1 . we found that 95.2% ( 40/42 ) of the women were between 20 and 30 years of age , 66.7% ( 28/42 ) were nulliparous , 95.2% ( 40/42 ) had no history of pre - eclampsia during previous pregnancies , and 100% had no previous history of gdm , macrosomia , or stillbirths . as for family history ( fh ) ,", "figure 1 shows that , in the course of gestation , there was a progressive increase in maternal weight gain in both the non - overweight ( bmi < 25 kg / m ) and the overweight / obese ( bmi 25 kg / m ) groups of pregnant women .", "83.3% ( 35/42 ) did not have a fh of pre - eclampsia , 76.2% ( 32/42 ) did not have a fh of dyslipidemia , and 78.6% ( 33/42 ) did not have a fh of obesity .", "however , when we compared the percent weight gain during pregnancy between g1 and g2 , there was a significantly higher percent weight gain in g1 compared to g2 ( p<0.001 ) ( figure 4b ) .", "additionally , when the mean serum leptin levels were compared during the first ( t1 ) , second ( t2 ) , and third ( t3 ) trimesters of pregnancy , we concluded that there were significant increases ( t1 vs. t2 , p<0.01 and t1 vs. t3 , p<0.001 ) in leptin levels in group 1 ( non - overweight or g1 ) , as seen in figure 3 .", "however , we did not observe a significant increase in leptin levels ( p>0.05 ) during the 3 trimesters in group 2 ( overweight / obese or g2 ) ." ], [ "this study contributes to the body of knowledge available on the topic of evaluation of obesity in pregnancy and its association with serum leptin levels .", "recently , obesity and leptin have been the subject of many studies [ 3032 ] , but there is still a significant gap in knowledge about the behavior of this hormone in women who were not overweight and those who were overweight / obese during pregnancy . from a methodological standpoint ,", "the changes in serum leptin levels during pregnancy have been well established through many studies for nearly 2 decades [ 3234 ] . however , there are still many gaps in knowledge about the levels of this adipocytokine in pregnant women in relation to bmi and gestational weight gain .", "similar data were also observed by misra in the analysis of the serum leptin levels in non - overweight and in overweight / obese pregnant women ." ], [ "in summary , our results indicate that the significantly greater increase in serum leptin levels in non - overweight pregnant women may be explained by the significantly higher percent weight gain in this group compared to overweight / obese women .", "this study suggests that controlling both weight gain and the percent weight gain during the prenatal period may be an important preventive measure to control leptin levels during pregnancy and its subsequent medical complications ." ] ]

[ [ "extracellular superoxide dismutase ( sod3 ) is an enzyme known to catalyze dismutation of the highly reactive , superoxide anion into longer - lived and more stable hydrogen peroxide .", "our results confirm the previously documented anti - inflammatory role of sod3 and additionally , for the first time , we show that it can downregulate both cia and peritonitis even in the absence of functional nox2 complex and phagocyte oxidative burst .", "previous work with collagen - induced arthritis ( cia ) suggests that both genetic transfer of the sod3 gene as well as a small molecular sod mimetic have the ability to ameliorate arthritis .", "however , it should be noted that during inflammation these superoxide producers are not nearly as efficient superoxide producers as the nox2 complex . in the current work we studied the role of sod3 in collagen - induced arthritis ( cia ) to understand whether the therapeutic effect of sod3 on arthritis operates through attenuating the biological effects of the induced oxidative burst produced by the nox2 complex . to avoid artifacts introduced by chemical inhibitors of nox2 complex [ 1416 ]", "the anti - inflammatory properties of sod3 have been studied in models of pulmonary disease and peritonitis [ 2 , 6 ] ." ], [ "the previously described ncf1 ( protein also called p47phox ) mouse , which carries a point mutation globally and completely abolishing nox2 complex derived ros production , has been backcrossed onto the b10.q background and shown to contain only the causative mutation using a 10 k snp typing chip .", "the isolated rna was dnase treated with deoxyribonuclease i ( fermentas ) in the presence of ribolock rnase inhibitor ( fermentas ) .", "disease development was evaluated macroscopically three times a week before the booster immunization and daily after the boost .", "in the arthritis experiments ade - sod3 , ade - lacz ( vector control ) , and pbs ( injection control ) were injected locally in the left front paw in 25 l injection volume containing 2,5 10 pfu virus .", "the experiments were performed in accordance with the national and eu guidelines and the study was approved by the oulu section of the national animal experiment board ( elinkoelautakunta , ella ) with ethical approval numbers eslh-2008 - 02873 , eslh-2008 - 07941 , and esavi-0000497/041003/2011 . replication deficient adenoviral e1-partially - e3-deleted adbglii vectors ( developed from serotype ad5 ) expressing rabbit sod3 ( ade - sod3 ) or bacterial -galactosidase lacz ( ade - lacz ) were used in both in vitro and in vivo experiments .", "arthritis was boosted day 19 with 50 g rat type ii collagen emulsified in incomplete freund 's adjuvant intradermally at the base of the tail ." ], [ "similarly to the wild - type mice , ade - sod3 treatment in ncf1 paws induced significantly smaller difference between the virus - treated and pbs - injected paws than ade - lacz virus injection ( significant d24 and d25 after immunization ) , again confirming the arthritis limiting effect of sod3 ( figure 3(b ) ) .", "adenoviral sod3 gene delivery reduced the superoxide predominant ros signal 37% compared to the ade - lacz control virus when investigated two days after transduction with ade - sod3 and ade - lacz viruses ( figure 1 ) .", "sod3 expression significantly reduced the number of peritoneal infiltrating cells in proteose peptone and il-1 induced peritonitis in wild type mice ( figure 4(a ) ) .", "starting from d20 the ncf1 mice started to develop arthritis with significantly higher mean score than the wild - type mice ." ], [ "sod3 polymorphisms are associated with copd , coronary artery disease , myocardial infarction as well as acute lung injury and related mortality .", "however , in this report we show that overexpression of sod3 downregulated inflammation even in the absence of phagocyte oxidative burst , thus highlighting the capacity of sod3 to affect cellular processes independently of nox2 complex ' superoxide production .", "sod3 is an enzyme that has been shown to give rise to therapeutic responses in damaged tissues such as reduced ischemia - reperfusion injury , arthritis , peritonitis , hind limb injury , and lung injury models .", "we confirmed the presence of virally delivered sod3 mrna in the paws d25 and thus confirmed that the decrease in arthritis severity coincided with substantial adenovirus driven sod3 expression ." ], [ "thus , we conclude that the anti - inflammatory effect of sod3 is not dependent on superoxide produced by the nox2 complex derived phagocyte oxidative burst and thus acts via other signaling pathways .", "the anti - inflammatory function of sod3 is not compromised by the lack of functionality of the nox2 complex as both ncf1 and ncf1 mice develop milder inflammation when treated with sod3 .", "we report that sod3 limits inflammation in cia and peritonitis both in the presence and in the absence of phagocyte oxidative burst ." ] ]

[ [ "injury to iliac vessels remains exceedingly rare , given its posterior position within the pelvis , representing only 0.4% of vascular injuries . in this case , we highlight a delayed presentation of external iliac artery occlusion secondary to motor - scooter handlebar syndrome , in a paediatric patient .", "traumatic arterial occlusion following major or minor blunt trauma , especially in the absence of any other bony injury , is a rare phenomenon . ", "additional factors which need to be considered include : smaller vessel size or vessel spasm , higher risk of infection , tendency for re - stenosis and continuing growth .", "motor - scooter handlebar syndrome is one such type of arterial occlusion affecting vascular structures following direct blow by a handlebar of a motorbike or bicycle to the groin .", "we review previous paediatric cases of this unusual vascular injury to highlight the pathology and most appropriate management option .", "pathophysiology and management of vascular injuries in the paediatric population vary significantly compared with the adult population ." ], [ "a 15-year - old male presented to the emergency department following a direct blow from his bicycle handlebars to his groin .", "he underwent a right external iliac thromboendarterectomy with patch repair using a saphenous vein graft .", "due to its extent , retrieval of the entire thrombus was incomplete and a second groin incision near the junction of the common femoral with external iliac ( at the inguinal ligament level ) was required .", "the long saphenous vein was harvested and the defect closed with patch repair extending from proximal iliac to proximal femoral vessel ." ], [ " motor - scooter handlebar syndrome is an uncommon form of arterial blunt injury following a direct blow by the handlebar of motorbikes or bicycles .", "we provide an unusual cause of external iliac occlusion secondary to bicycle handlebar injury to the groin .", "open arterial thromboendarterectomy with graft or patch repair is the standard of care for such cases in trauma centres .", "all patients presenting with groin injury from this mechanism should be carefully investigated with duplex sonography and monitored for risk of vascular injury ." ], [] ]

[ [ "this paper will address the most common secondary causes of resistant hypertension ( drug - induced , obstructive sleep apnea , primary aldosteronism , and chronic kidney disease ) , which are frequently encountered in hypertensive patients and are , therefore , the most interesting from the clinical point of view .", "therefore , practicing physicians need to implement evidence - based medicine . the effective management of patients with resistant hypertension requires an appropriate combination of physiology and pharmacology , taking into account the unique characteristics of each case in order to tailor the therapeutic approach to the individual patient .", "the advent of antihypertensive therapy has substantially reduced the occurrence of cardiovascular events . however , antihypertensive therapy failed to achieve blood pressure control in all patients , with hypertension control rates remaining in general disappointingly low .", "blood pressure goals are not attained in some patients despite the simultaneous use of several antihypertensive medications .", "an extensive workup of all patients with uncontrolled hypertension is scientifically unsound , is very costly and requires immense human and technical resources .", "several terms have been used to define this condition : refractory hypertension , difficult - to - treat hypertension , difficult - to - control hypertension ; however , the term resistant hypertension seems to prevail . ", "in addition , this paper will attempt to provide a rational for the workup and treatment of patients with resistant hypertension ." ], [ "it has to be noted , however , that atypical drug combinations have been used in most of these studies as required by study protocols .", "data from small observational studies show a wide variation ( from 5% to 50% ) according to the studied populations [ 210 ] .", "therefore , the evaluation of the prevalence of resistant hypertension requires a large , prospective , population - based study , specially designed for this aim .", "in addition , patients with resistant hypertension frequently have comorbidities that are known to increase cardiovascular morbidity and mortality , such as chronic kidney disease , diabetes , and obesity .", "moreover , patients with resistant hypertension have higher rates of target organ damage than the general hypertensive population and are thus at increased cardiovascular risk .", "data from small clinical studies point towards an increased cardiovascular risk in patients with resistant hypertension ." ], [ "in addition , blood pressure control might be achieved more difficult in heavy drinkers due to poor adherence in antihypertensive therapy .", "alcohol consumption is another important factor [ 210 ] . large alcohol consumption ( > 3 drinks per day ) has been shown to result in blood pressure elevation .", "excessive dietary salt intake is common in patients with resistant hypertension and contributes to treatment resistance by blunting the blood pressure reduction of most antihypertensive drugs , including diuretics and inhibitors of the renin - angiotensin axis [ 210 ] . ", "several lines of evidence indicate a graded positive correlation between body mass index and blood pressure levels , while weight loss results in blood pressure reduction .", "the role of physical inactivity in patients with resistant hypertension has not been adequately studied . ", "it has been shown that blood - pressure control is more difficult to be achieved in obese than lean hypertensive patients .", "insulin resistance , sympathetic nervous system overactivity , sodium retention , and activation of the renin - angiotensin system have been implicated in the pathogenesis of obesity - induced hypertension ." ], [ "however , this paper will focus on the drugs that are widely used , represent the most common causes of drug - induced hypertension , and are thus of major clinical importance : nonsteroidal anti - inflammatory drugs ( nsaids ) and oral contraceptives .", "drug - induced hypertension is among the most common causes of secondary hypertension and is frequently encountered in everyday clinical practice .", "however , despite the frequent occurrence of drug - induced hypertension , primary care physicians frequently miss the opportunity to detect and appropriately manage this iatrogenic form of secondary hypertension . therefore", ", a detailed and meticulous medical history is of utmost importance in patients with resistant hypertension , since the identification and subsequent withdrawal of the offending drug may alleviate treatment resistance .", "reliable data evaluating the efficacy of the various antihypertensive drug categories in anti - vegf - induced hypertension are missing .", "the recognition of the pathogenetic mechanisms that contribute to blood pressure elevation with vegf - inhibitors might be helpful in identifying the most appropriate drugs for the management of these patients ." ], [ "several studies have reported an extremely high prevalence of osa in patients with resistant hypertension .", "a vast amount of evidence demonstrates an association between obstructive sleep apnea ( osa ) and hypertension .", "sympathetic nervous system activation plays a crucial role in the pathogenesis of hypertension in patients with osa . enhanced upper airway resistance and intermittent hypoxia", "further , larger studies are needed , however , to confirm these beneficial effects of spironolactone in patients with osa .", "the exact nature of the association between osa and aldosterone excess remains to be elucidated . whether osa results in aldosterone excess or aldosterone excess contributes to osa , or another underlying factor ( like obesity ) promoting both aldosterone excess and osa has not been clarified ." ], [ ". the other forms of endocrine hypertension , presented in table 3 , are less frequently encountered in hypertensive patients and , therefore , represent rare causes of resistant hypertension .", "since this paper addresses the most common secondary causes of resistant hypertension , readers interested in endocrine hypertension may refer to other recently published reviews [ 146 , 147 ] .", "historically , pa has been considered a rare disease , affecting about 1% of hypertensive patients [ 124127 ] .", "in addition , the clinical presentation of these endocrine forms of secondary hypertension is usually so characteristic that is really hard to be missed .", "however , several studies performed in the last decade report a much higher prevalence of pa ( > 10% ) , suggesting an epidemic of this condition [ 128133 ] ." ], [ "hypertension is commonly found in patients with chronic kidney disease ( ckd ) , with 75% of ckd patients taking antihypertensive drugs . on the other hand ,", "another important key aspect in patients with ckd is the assessment of urinary albumin excretion .", "it seems that the relationship between hypertension and ckd is bidirectional ; the kidney is both the victim and the culprit in this relationship .", "it has been observed that restrictions in diuretic use were the primary cause of resistant hypertension in patients with ckd .", "it is , therefore , not surprising that the prevalence of resistant hypertension in patients with ckd is over 50% .", "all recent guidelines recommend lower blood pressure goals in patients with ckd , especially when frank albuminuria is present [ 149151 ] ." ], [ "carotid baroreceptor stimulation and renal sympathetic denervation have shown promising preliminary results in patients with resistant hypertension [ 214 , 215 ] . however , further studies are needed to establish their role in the management of resistant hypertension .", "two new approaches have revived the use of interventional techniques for the management of resistant hypertension .", "we will , therefore , attempt to provide a step - by - step approach for the evaluation and treatment of patients with resistant hypertension .", "although it seems rational for patients with resistant hypertension to be referred to specialized hypertension clinics , the initial evaluation can be performed by primary care physicians .", "patient - related problems . adherence to antihypertensive treatment is of utmost importance for the effective management of arterial hypertension .", "patient - related problems . adherence to antihypertensive treatment is of utmost importance for the effective management of arterial hypertension .", "however , further studies are needed to establish their role in the management of resistant hypertension . \n despite the wide application of antihypertensive therapy ," ] ]

[ [ ", we evaluated the feasibility of coronary intervention using the sheathless gc in patients with small ras .", "the use of transradial coronary angiography and intervention ( tri ) is increasing because of its low rates of major vascular access - related complications and the potential for early mobilization.1)2 ) a large - bore guiding catheter ( gc ) with a large - bore introducer sheath is needed in patients with complex lesions , but they can not be used in patients with a small radial artery ( ra ) because they can cause forearm discomfort and ra spasm and occlusion,3 ) which are significant limitations to the transradial approach . to conquer this limitation , gc that does not require", "this system can be used to insert the gc into the ra without the use of an introducer sheath .", "the sheathless gc system ( sheathless eaucath , asahi intecc , japan ) consists of a hydrophilic gc and a central dilator .", "1 ) . with this feature , the sheathless gc system enables performance of tri even in patients with small ras .", "furthermore , the hydrophilic coating that is present along the entire length of the gc may be helpful in reducing radial pain and ra spasm . here", "the outer diameter of the 6.5 french ( fr . ) sheathless gc ( 2.16 mm ) is smaller than a 5 fr ." ], [ "we defined procedural success as the successful implantation of stent(s ) with final thrombolysis in myocardial infarction flow grade 3 and residual stenosis < 30% , despite the selection of the gc .", "all patients underwent diagnostic coronary angiography using a 5 fr . conventional catheter through a 5 fr .", "patients who required primary percutaneous coronary intervention ( pci ) were excluded because preparation of a sheathless gc that is composed of two pieces ( a catheter and a central dilator ) requires more time than a conventional one - piece gc .", "the ostium of the selected coronary artery was engaged by the gc and pci was performed .", "the sheathless gc with the central dilator was advanced along the 0.035-inch wire to the proximal ascending thoracic aorta ." ], [ "patients who required primary percutaneous coronary intervention ( pci ) were excluded because preparation of a sheathless gc that is composed of two pieces ( a catheter and a central dilator ) requires more time than a conventional one - piece gc .", "all patients underwent diagnostic coronary angiography using a 5 fr . conventional catheter through a 5 fr .", "all procedures were performed in the left ra unless the patient had a history of previous angiography through the right ra ." ], [ "we administered 5,000 units of heparin through the ra after insertion of the 5 fr .", "a loading dose of 600 mg clopidogrel and 300 mg aspirin was given to all patients at least three hours before the procedure .", "introducer sheath . an additional dose of 5,000 units heparin was given through the same route before pci ." ], [ "the mean of the maximal and minimal diameter of the selected segment of ra was used to determine the size of the ra using a computer - assisted quantification method ( ge , us ) . because the outer diameter of the 5 fr .", "a 30- to 40-mm long segment of ra from the tip of the introducer sheath was selected for the determination of the mean diameter .", "introducer sheath was approximately 2.3 mm in diameter , a small ra was defined as a diameter 2.3 mm .", "the ra was punctured using a 20-g venous needle at a point 5 - 10 mm proximal to the styloid process after subcutaneous infiltration with 0.6 ml of 2% lidocaine . a 5 fr .", "angiography of the ra was performed after injection of normal saline ( 10 ml ) with 200 g of nitroglycerine .", "normal saline ( 10 ml ) with 200 g of nitroglycerine was injected into the ra through the introducer sheath to prevent ra spasm ." ], [ "the sheathless gc with the central dilator was advanced along the 0.035-inch wire to the proximal ascending thoracic aorta .", "the ostium of the selected coronary artery was engaged by the gc and pci was performed .", "the sheathless gc was composed of two parts : a hydrophilic catheter and a central dilator .", "after the diagnostic angiography , the sheath was exchanged for the sheathless catheter over a standard 150 cm j - tipped 0.035-inch ( terumo , japan ) wire . the shape and size of the sheathless gc" ], [ "we defined procedural success as the successful implantation of stent(s ) with final thrombolysis in myocardial infarction flow grade 3 and residual stenosis < 30% , despite the selection of the gc ." ], [], [], [ "a total of 25 patients ( 29 lesions ) with a small ra who underwent pci using a sheathless gc were included in this study .", "two of three bifurcated lesions were treated with a kissing balloon technique and one lesion was treated with two stents by using a modified t - stenting technique .", "only one patient , who developed ra spasm during coronary angiography using a conventional 5 fr catheter , complained of forearm pain during pci . although there was no immediate access site complication including hematoma and bleeding , two patients lost pulse in the ra used as the access site without hand ischemia during a median 357 ( 140 - 432 ) days of follow - up .", "one lesion consisting of restenosis of a previously implanted drug - eluting stent was treated using balloon angioplasty with a cutting balloon .", "two of the successfully treated lesions required conversion to a conventional gc after insertion of the 6 fr ." ], [ "our study shows the feasibility of tri using a sheathless gc in 25 consecutive patients ( 29 lesions ) with small ras ( diameter 2.3 mm ) .", "this patient developed severe ra spasm before using the sheathless gc and the operator has difficulty in performing diagnostic coronary angiography with the conventional 5 fr .", "the use of a sheathless gc was feasible in almost clinical settings for patients with small ras regardless of complexity or severity of the lesion .", "however , disengagement of the gc and limitations in the setting of primary pci should be taken into account ." ], [ "the use of a sheathless gc was feasible in almost clinical settings for patients with small ras regardless of complexity or severity of the lesion .", "however , disengagement of the gc and limitations in the setting of primary pci should be taken into account ." ] ]

[ [ "the most widespread type is the alternative splicing at acceptor sites with the pattern nagnag ( n stands for a , c , g , or t , throughout the paper we write t instead of u also when referring to an rna sequence ) ( 12,15,16 ) .", "as most of the human genes with multiple exons express more than one transcript , alternative splicing is considered to be a major mechanism for producing a complex proteome from a limited number of genes ( 1 ) .", "furthermore , we recently found evidence for alternative splicing at donor splice sites with the motifs gtngtn , gcngtn and gtngcn ( denoted as gyngyn donors , y stands for c or t ) where both gt / gc donors are used ( 17 ) .", "finally , tassdb annotates nagnags that are affected by a snp and also contains 51 tandem acceptors whose nagnag pattern can only be observed in another snp - allele and not in the human genome reference sequence .", "( est)/mrna data 16% of all nagnags and noteworthy 39% of the tandem acceptors with a haghag pattern ( also denoted ", "we denote a tandem splice site as confirmed if the usage of both splice sites is represented by at least one est / mrna and unconfirmed otherwise ." ], [ "as alternatively spliced nagnag acceptors and gyngyn donors occur in a large number of lineages including vertebrates , flies and nematodes , tassdb stores information about the tandem splice sites of eight species : homo sapiens , canis familiaris , mus musculus , rattus norvegicus , gallus gallus , danio rerio , drosophila melanogaster and caenorhabditis elegans .", "thus , we collected the following data : the splice site motif , its genomic locus , its location in the transcript ( 5/3-utr or cds with intron phase 0/1/2 ) , the impact of the splice event on the protein , the sequences and length of the up-/downstream exon and the intron , and information about the ests / mrnas that indicate usage of one of the two splice sites . as the degree of similarity of a splice site to the overall consensus is an important criterion to distinguish alternatively from non - alternatively spliced nagnag acceptors ( 15 ) , we also computed the maximum entropy scores for both splice sites in a tandem ( 35 ) .", "our annotation pipeline is based on transcript - to - genome mappings taken from the ucsc genome browser ( 33 ) .", "apart from the refseq annotation that was used for all species , we additionally used ensembl transcripts for human , rat , chicken , zebrafish , the ucsc ", "the primary aim of tassdb is to provide information that is specific for the tandem splice site and the putative alternative splice event .", "screenshot of the advanced search interface : one can search for genes harboring tandem splice sites with a specific pattern [ such as gtngcn for tandem donors or haghag ( plausible ) for tandem acceptors ] , a certain number of ests / mrnas matching both splice forms , a location in the utr or cds and a specific protein impact ." ], [ "to identify alternatively spliced nagnags and gyngyns , we used blast against all ests and mrnas from the respective species as described in refs ( 12,17 ) .", "apart from the refseq annotation that was used for all species , we additionally used ensembl transcripts for human , rat , chicken , zebrafish , the ucsc ", "our annotation pipeline is based on transcript - to - genome mappings taken from the ucsc genome browser ( 33 ) .", "as alternatively spliced nagnag acceptors and gyngyn donors occur in a large number of lineages including vertebrates , flies and nematodes , tassdb stores information about the tandem splice sites of eight species : homo sapiens , canis familiaris , mus musculus , rattus norvegicus , gallus gallus , danio rerio , drosophila melanogaster and caenorhabditis elegans .", "intron structure as well as the annotation of the open reading frame was taken from the ucsc annotation .", "knowngene set for human , mouse , rat ( 34 ) , flybase transcripts for drosophila and wormbase transcripts for c.elegans ." ], [ "thus , we collected the following data : the splice site motif , its genomic locus , its location in the transcript ( 5/3-utr or cds with intron phase 0/1/2 ) , the impact of the splice event on the protein , the sequences and length of the up-/downstream exon and the intron , and information about the ests / mrnas that indicate usage of one of the two splice sites . as the degree of similarity of a splice site to the overall consensus is an important criterion to distinguish alternatively from non - alternatively spliced nagnag acceptors ( 15 ) , we also computed the maximum entropy scores for both splice sites in a tandem ( 35 ) .", "the primary aim of tassdb is to provide information that is specific for the tandem splice site and the putative alternative splice event .", "thus , the protein impact of the cagcag is the insertion / deletion ( indel ) of a ser in nm_024165 but indel ala in nm_002636 ( figure 1a ) .", "( b ) example of a nagnag acceptor that is only confirmed according the exon - intron structure of one but not a second transcript .", "we found est evidences for alternative cagcag splicing if the upstream first exon is used ( enst00000225603 ) but not if the downstream first exon is used ( nm_006807 ) ( figure 1b ) ." ], [ "( ii ) show all tandem splice sites where both splice forms are represented by at least three ests / mrnas and that are located in the 5-utr .", ", tassdb provides an advanced search interface where the user can restrict the search to gyngyns or nagnags with the following features : ( i ) pattern of the splice site , ( ii ) number of ests / mrnas that match both splice forms , ( iii ) location in the utr or in the coding sequence ( cds ) ( as well as specific intron phases ) , and ( iv ) protein impact ( figure 2 ) .", "the detailed result tables also provide links to the ests / mrnas for both splice forms as well as links to the ucsc genome browser .", "the result of the search consists of two parts : ( i ) summary table of affected genes and their number of tandem splice sites and ( ii ) detailed tables with information about the tandem splice sites .", "screenshot of the advanced search interface : one can search for genes harboring tandem splice sites with a specific pattern [ such as gtngcn for tandem donors or haghag ( plausible ) for tandem acceptors ] , a certain number of ests / mrnas matching both splice forms , a location in the utr or cds and a specific protein impact .", "the most frequent use of tassdb might be a search for tandem splice sites of a given gene . to this end , tassdb provides a quick search interface where a user only specifies a gene symbol or a transcript accession and gets the entire information of both confirmed and unconfirmed gyngyns and nagnags for this gene .", "thus , tassdb can be used to retrieve large datasets for further computational analysis of tandem splice sites ." ], [ "summary of the current content of tassdb total number of transcripts used for detecting tandem splice sites .", "it is evident that tandem splice sites are widespread in all eight species and that with the exception of c.elegans for nagnags numerous of them are already known to be alternatively spliced ." ], [ "since the database was designed to store information about any tandem splice site , an extension to tandem splice sites that are more than 3 nt apart is conceivable .", ", we plan to include bos taurus , xenopus tropicalis , takifugu rubripes and anopheles gambiae as more ests and annotated genes become available .", "furthermore , information about conservation of these splice events in other species as well as more data about the protein impact may be included .", "as tandem splice sites seem to occur in all species allowing alternative splicing , it would be desirable to include information for other species . in the future" ] ]

[ [ "associated bicuspid pulmonary valve , aortic valve atresia and heterotaxy have also been described.9 congenital pulmonary vein stenosis is a very rare association with cor triatriatum.10 the morbidity and mortality of cor triatriatum sinistrum is high in those who are symptomatic in infancy .", "heart defects are the leading cause of birth defect - related deaths.4 however ; the use of echocardiography has improved description of congenital heart diseases and their early diagnosis.5 this , has led to dramatic increases in survival of children with serious heart defects .", "significant sequel is unusual with cor triatriatum dextrum as it is not commonly associated with life - threatening symptoms or major congenital cardiac defects ." ], [ "a female baby seen on the second day of life was delivered by a 25-year - old primiparous youth corper .", "she gave birth to a 3.6-kg baby girl who cried immediately after , and breastfeeding commenced .", "secundum atrial septal defect [ figure 1 ] the child is presently being followed - up regularly . during her last visit , at 7 months of age", "the mother attended antenatal clinic in federal medical centre owerri from the 16 week of gestation .", "the child was transferred to the special care baby unit from the postnatal ward on account of history of fever on day 2 of life .", "however , during the 8 week of pregnancy , the mother had threatened abortion for which some drugs were given ( injections and tablets names unknown ) at a hospital in lagos" ], [ ", we reported a case of an asymptomatic congenital - heart defect a five - chambered heart - cor triatriatum , an extremely rare condition .", "the case demonstrates the need for comprehensive evaluation of patients and provision of cardiac investigative facilities ( x - ray , ecg and echocardiograph machines ) in health facilities . in our patient , it was an incidental finding at a routine follow - up clinic .", "this was the first case of a five - chambered heart seen and managed in the federal medical centre owerri .", "subsequent investigative evaluations led to the confirmation of the diagnosis of a five - chambered heart in a child who has remained asymptomatic .", "the dearth of facilities in our hospital is obvious here , where the patient had to be referred to the university of nigeria teaching hospital enugu for echocardiograph ." ] ]

[ [ "our aim was to investigate the mirnas ( oncogene or tumor suppressor ) , whose expression might be altered due to inhibition of tgf- signaling pathway .", "recently , a new layer of cellular mechanisms as microrna ( mirna)-mediated gene expression has been identified that is implicated in the post transcriptional negative regulation ( 17 - 20 ) .", "recent emerging evidence suggests manipulation of growth factors signaling by special inhibitors can alter mirnas expression in cancer cells in vivo and in vitro ( 30 - 35 ) .", "it has been documented that aberration of the growth factor signaling pathways specifically transforming growth factor- ( tgf- ) pathway play a vital role in tumor initiation , progression and metastasis ( 3 - 7 ) .", "several strategies based on either restoration of silenced mirnas or inhibition of overexpressed mirnas has opened a new area of research in cancer therapy including crc .", "several reports imply that targeting of tgf- signaling pathway at late stages of carcinogenesis could be a helpful tool for treatment of human cancers such as crc , glioblastoma and breast cancer ( 4 , 8) .", "the mirnas - mediated regulation networks can strictly influence the growth factors signaling pathways ( 24 , 25 ) ." ], [ "then , the animals were randomly divided into two groups of 8 to receive either sd-208 ( 50 mg / kg / d ) or vehicle ( dmso - containing deionized water ) orally for three weeks .", "four mirnas as potential onco - mirs ( mir-21 , 31 , 20a , 135b ) and four mirnas as potential suppressor - mirs ( let7-g , mir-133b , 145 , 200c ) involved in colon cancer , were selected from the sanger center mirna registry at http://www.sanger.ac.uk/software/rfam/mirna/index.shtml . microrna expression was analyzed by real - time quantitative polymerase chain reactions ( qpcr ) using the sybr green method ( parsgenom , iran ) .", "48 hr after treatment with 0.5 , 1 and 2 m concentrations of sd-208 , the cells were harvested for total rna extraction . the protocol for establishing the xenograft model of colon cancer", "obtained tumors after isolating from animals , were fixed in formalin or frozen for histological staining and rna extraction , respectively . to confirm colon adenocarcinoma ,", "after cell inoculation , xenograft tumors were allowed to achieve a size of 80 mm .", "after polyadenylation of total rna and cdna synthesis , mirnas were expanded by the specific primers for mature forms according to the manufacturer s instructions .", "tumor tissues tissues were excised and subjected to hematoxylin and eosin ( h&e ) staining ( dako , denmark ) as previously described ( 6 ) ." ], [ "briefly , the cells were trypsinized in exponential growth phase and were seeded in 6-well flat - bottom plates ( spl life sciences ; south korea ) at a density of 510 cells / well ( 2000 l media / well ) .", "48 hr after treatment with 0.5 , 1 and 2 m concentrations of sd-208 , the cells were harvested for total rna extraction .", "sw-48 cell line , a human colon adenocarcinoma cell line ( pasteur institute , tehran , iran ) was grown in 25 cm flask ( spl life sciences ; south korea ) containing rpmi-1640 medium ( gibco ; germany ) supplemented with 5% fetal bovine serum ( fbs ) ( gibco ; germany ) and 100 units / ml penicillin ( gibco ; germany ) ." ], [ "then , the animals were randomly divided into two groups of 8 to receive either sd-208 ( 50 mg / kg / d ) or vehicle ( dmso - containing deionized water ) orally for three weeks .", "after cell inoculation , xenograft tumors were allowed to achieve a size of 80 mm .", "the protocol for establishing the xenograft model of colon cancer was approved by the committee on the ethics of animal experiments of tehran university of medical sciences ( ethical code number ; erc / s/277 ) as previously described ( 6 ) .", "obtained tumors after isolating from animals , were fixed in formalin or frozen for histological staining and rna extraction , respectively .", "6-week - old female athymic c56bl/6 nude mice ( n= 8 per group ) were obtained from omid institute for advanced biomodels ( tehran , iran ) ." ], [ "to confirm colon adenocarcinoma , tumor tissues tissues were excised and subjected to hematoxylin and eosin ( h&e ) staining ( dako , denmark ) as previously described ( 6 ) ." ], [ "either sw-48 cells or tumor tissues at the mentioned time points after treatment with sd-208 , were subjected for total rna extraction using trizol reagent ( invitrogen ; germany ) according to the manufacturer s instructions . extracted total rna was stored at -80 c until use ." ], [ "four mirnas as potential onco - mirs ( mir-21 , 31 , 20a , 135b ) and four mirnas as potential suppressor - mirs ( let7-g , mir-133b , 145 , 200c ) involved in colon cancer , were selected from the sanger center mirna registry at http://www.sanger.ac.uk/software/rfam/mirna/index.shtml .", "rnu6b was used as an endogenous ( internal ) control , and the data were normalized compared to this housekeeping gene .", "after polyadenylation of total rna and cdna synthesis , mirnas were expanded by the specific primers for mature forms according to the manufacturer s instructions .", "microrna expression was analyzed by real - time quantitative polymerase chain reactions ( qpcr ) using the sybr green method ( parsgenom , iran ) .", "all reactions were performed in triplicate and the absence of contamination was verified using non - template controls .", "real - time pcr was performed on a bio rad cfx96 real - time pcr system ." ], [ "p - values less than 0.05 were considered to indicate statistically significant differences between data sets .", "data analysis was performed using the 2-cct method . the standard error of means was computed and analysis of variance ( anova , tukey s post tests ) completed via graphpad prism 5.0 software ." ], [ "the expression of mir-135b significantly was down - regulated either in cell culture ( a ) or developed tumors ( b ) in sd-208 groups compared to controls prediction of the target genes of mir-135b using bioinformatics analysis in order to determine the biological function of the down - regulated mirna , mir-135b , we further predicted the putative downstream targets of this mirna .", "we focused our attention on mir-135b because it was the only mirna affected by sd-208 either in vitro or in vivo . in silico analysis using targetscan ( http://www.targetscan.org/ ) showed that mir-135b potentially targets transcripts encoding known tumor - suppressor factors , such as apc ( adenomatosis polyposis coli ) , foxo1 ( forkhead transcription box1 ) , runx1 ( runt - related transcription factor 1 ) and esrra ( estrogen - related receptor alpha ) .", "to assess the potential toxicity effects of sd-208 , the expression levels of mirnas was examined by real time rt - pcr ( table 1 ) .", "our results showed that all the treated tumors express a lower number of mir-135b , but not other mirnas , compared to the control tumors ." ], [ "the expression of mir-135b significantly was down - regulated either in cell culture ( a ) or developed tumors ( b ) in sd-208 groups compared to controls prediction of the target genes of mir-135b using bioinformatics analysis in order to determine the biological function of the down - regulated mirna , mir-135b , we further predicted the putative downstream targets of this mirna .", "we focused our attention on mir-135b because it was the only mirna affected by sd-208 either in vitro or in vivo . in silico analysis using targetscan ( http://www.targetscan.org/ ) showed that mir-135b potentially targets transcripts encoding known tumor - suppressor factors , such as apc ( adenomatosis polyposis coli ) , foxo1 ( forkhead transcription box1 ) , runx1 ( runt - related transcription factor 1 ) and esrra ( estrogen - related receptor alpha ) .", "to assess the potential toxicity effects of sd-208 , the expression levels of mirnas was examined by real time rt - pcr ( table 1 ) .", "our results showed that all the treated tumors express a lower number of mir-135b , but not other mirnas , compared to the control tumors ." ], [ "in this study , we evaluated the effect of a tgf- receptor kinase inhibitor , sd-208 , on some potential onco / suppressor - mirnas expression in crc .", "although a number of studies have shown that chemotherapy drugs alter mirnas expression in many cancer cells , there is no report on the effect of tgf- receptor kinase inhibitors on mirnas in human crc .", "several chemopreventive agents have been shown to modulate the expression of numerous mirnas in cancer cells that lead to sensitization of cancer cells to chemotherapeutic agents ( 39 , 40 ) , suggesting the potential of mirnas as targets for anti - cancer drugs ( 18 , 20 ) .", "these findings indicate that anti - cancer effect of sd-208 may be not due to suppression of cell growth and proliferation ( 36 ) . since efficacy of this inhibitor is a controversial issue in cancer treatment , we hypothesized the unknown mechanism(s ) including alteration of cancer - related mirnas might be involved ." ], [ "hence , the tgri kinase inhibitor - based treatment may possibly uphold chemosensitivity in resistant colon cancer cells .", "the receptor kinase inhibitor sd-208 may partially inhibit colon tumorigenesis as well as chemoresistance by alteration of mirnas ." ] ]

[ [ "the aim of this study was to synthesize agnps using aqueous leaves extract of p. betle , characterized the agnps and evaluated the antibacterial activity of ag - extract nanoparticles against some gram positive and gram negative bacteria .", "the betel ( piper betle ) is the leaf belonging to the family piperaceae . the p. \n betle leaves possess antifungal , antiseptic , antihelmintic , antihypertensive etc .", ", 2011 claim that ethanolic extract of p. betle leaves show antibacterial activity against some food borne pathogens ( 13 ) . ", "antibacterial activity of the silver ion has been well established ( 6 ) and ag is currently used to control bacterial growth in a variety of applications , including dental work , catheters , and burn wounds ( 7,8 ) . in fact , ag ions and ag - based compounds are highly toxic to microorganisms , showing strong biocidal effects on as many as 12 species of bacteria including e. coli ( 9 ) . apart from these antimicrobial activities , ag - nps are also known to possess antifungal , anti - inflammatory , antiviral , anti - angiogenesis and antiplatelet properties ( 10 , 11 ) ." ], [ "coating of ag - extract nanoparticles with polyaniline \n coating on the extract - agnps were done according to the k. gopalakrishnan , 2012 ( 14 ) .", "antimicrobial activity using kirby - bauer s disc diffusion method \n antibacterial activities of the ag - extract nanoparticles were determined according to kirby - bauer s disc diffusion method ( 2006 ) with slight modifications .", "preparation of ag - extracts nanoparticles \n these above two solutions were mixed continuously for 30 min by magnetic stirrer and then stood for 2 h. after that uncoated ag - extract nanoparticles were prepared . \n", "biosynthesis of silver nanoparticles \n ag nanoparticles were made according to the recipe described in the literature ( creighton , 1979 ; suh js et al . ;", "preparation of p. betle leaf extract \n about 30 g of freshly , taxonomically authenticated healthy leaves of p. betle were collected in january 2014 from noakhali district of bangladesh .", "the reduction of pure silver ions was monitored by measuring uv - vis spectra of the reaction mixture .", "triply distilled water was used for solutions , and both solutions were chilled to ice temperature before mixing . by mixing both solutions , ag ions were reduced and clustered together to form monodispersed nanoparticles as a transparent solution in aqueous medium ." ], [ "the arising of functional groups in ftir spectrum indicates proper coating of leaf extract on silver nanoparticles .", "the ft - ir results imply that the ag - nps were successfully synthesized and capped with bio - compounds present in the p. betle extract by using a green method .", "\n characterization of the synthesized ag nanoparticles \n \n evaluation of ag - nps by visual assessment \n the formations of silver nanoparticles were confirmed through visual assessment . within 20 min of the reaction , color of the mixture turned into dark brown from its initial brownish yellow color ." ], [ "they showed potential antibacterial activity against both gram - positive and gram negative bacteria . in our study", "we have demonstrated a good method for developing a simple , safe , cost - effective , and ecofriendly preparation of agnps using aqueous extract of p. betle .", "the biosynthesized silver nanoparticles have spherical shapes and the particle size ranges from 10 to 30 nm approximately .", "application of these synthesized agnps based on our findings may lead to valuable discoveries in various fields , including medical devices and in the pharmaceutical and biomedical industries .", "we also found , gram positive bacteria are more susceptible on ag - extract nps rather than gram negative bacteria .", "the ftir spectra revealed the involvement of hydroxyl moieties and n - h bonding in the formation of ag - nps .", "the results obtained by this study can not be directly extrapolated to human ; further studies should be undertaken to elucidate the exact mechanism of action by which agnps - extracts exert their antimicrobial effect which can be used in drug development program for safe health care services ." ] ]

[ [ "there are two major categories ( ridden and in - hand ) with in - hand classes placing more \n emphasis on colouration of horses ( 80% of available marks ) . since the national championship \n has the greatest number of exhibitors and the emphasis on colour is greatest for in - hand \n classes , the investigation into show success was restricted to animals placed in the in - hand \n classes at the national championships in the following nine categories : under 148 cm \n stallion , mare , yearling , 2 & 3 year old ; over 148 cm stallion , mare , yearling , 2 & \n 3 year old and geldings 4 years and over .", "registration details of all 2,431 horses registered with the british palomino \n society were collected for the period 19832007 inclusive . of these animals ,", "1.colour combinations which have produced a registered palomino in the society \n within the last 25 years ) were removed from the analysis since parents with these combinations of \n details can not produce palomino offspring ( e.g. chestnut chestnut ) .", "many classes at local shows may only have one or two horses \n exhibited . to ensure that the results were comparing like with like , the data analysed \n focused entirely on the british palomino national championship show , where each class \n generally has more animals exhibited than would be the case in local shows . at this show \n", "details \n of the animal s name and the coat colour of both parents were collated . throughout the year" ], [ "of these horses , 13 ( 59% ) were the product of a chestnut \n cremello mating with the remaining horses being palomino palomino ( 5 ) ; chestnut palomino \n ( 2 ) ; and cremello bay ( 2 )", ". however , interestingly of the 7 horses which won the annual \n points scheme ( with one of the horses winning it in two consecutive years ) , only one horse \n ( a chestnut palomino ) was not the result of a chestnut cremello mating .", "were this \n type of cross , these data are supportive of the hypothesis that a large proportion of \n palominos registered with the society were intentionally bred for their colouring . table 2table 2.colour combinations which have produced a prize - winning palomino at the society s \n show within the last 25 years shows that the largest number of the palominos placed at least once at the \n national championships also came from a chestnut cremello mating . hence of the 90 \n ( following removal of 1 animal shaded in grey ) animals placed during this time , 60 ( i.e. \n 67% ) resulted from the only mating type guaranteed to give palomino offspring .", "table 1 shows that the largest number of \n registered palominos in this work , where the coat colour of both parents could be \n identified , came from a chestnut cremello mating , which is the only parental cross which \n guarantees a palomino offspring . since 356 of the animals ( i.e. 44% ) in this study" ], [ "in addition , due to \n restricted information being provided to the society by owners at the time of registration , \n only around a third of horses registered with the society met the criteria regarding \n parental information needed for inclusion in these analyses . despite these possible \n limitations ,", "this in turn poses an additional \n question ; has the society s ideal colour definition been influenced in favour of matings \n which are most likely ( or even guaranteed ) to produce a palomino foal ?", "one observation is very interesting , that the showing success achieved by the \n only possible parental combination which guarantees a palomino foal is disproportionally \n larger than that seen for registration of foals with the society .", "this is true for all \n definitions of success investigated : horses winning any prize at the national championship ; \n horses winning first prize at the national championship ; horses which finished in the top 8 \n of the annual points scheme ; and horses which won the annual point scheme .", "for example , judging of animals always has a degree of human subjectivity associated \n with it .", "this work is constrained by some potential limitations in terms of conclusions which may be \n drawn ." ] ]

[ [ ", we describe a case of a 73-year - old woman who developed an abdominal wall hematoma , which is a rare but serious complication of a pci via the femoral approach .", "abdominal wall hematoma is a rare condition that can give rise to an acute abdomen . in this report", "vascular complications are the most frequent adverse outcomes associated with percutaneous coronary intervention ( pci ) via the femoral artery .", "they contribute to in - hospital morbidity , mortality , and costs ; and furthermore , are associated with increased long - term risk of myocardial infarction and death ." ], [ "a 73-year - old woman , with a past medical history of hypertension , diabetes mellitus for 40 years , and chronic kidney disease stage 5 , because of diabetic nephropathy , presented to the emergency department with dyspnea ( nyha iv ) .", "we then checked the fluoroscopy and found that the guidewire was introduced into the circumflex iliac artery ( fig .", "the sheath site was clear with no evidence of bleeding , hence , we performed an abdominal computed tomography angiography to identify other causes of the bleeding , which revealed a right lateral abdominal wall hematoma about 5 cm in diameter ( fig .", "fourteen hours after pci , the patient complained of a right abdominal pain , with mild swelling of her right abdomen .", "however , the patient still complained of abdominal pain and ecchymotic patches appeared on her abdomen 3 days after the procedure ( fig ." ], [ "thus , we suggest that the following may be causative factors of a delayed abdominal wall hematoma following a pci : injury to the circumflex artery during guidewire insertion and the subsequent prolonged act associated with the use of periprocedural heparin in patients with chronic kidney disease .", "abdominal wall hematoma is a rare but potentially serious vascular complication that may develop after cardiac and peripheral angiographic procedures.1 ) predisposing factors include increased sheath size , repeat or multiple punctures of the artery , concomitant use of anticoagulants , advanced age , being female , and hypertension.2)3 ) there are two types of abdominal wall hematomas : spontaneous and iatrogenic .", "when vascular complications are suspected during the procedure , a staged pci should be considered to prevent periprocedural vascular complications and ensure a patient s safety . with more coronary angiographic procedures being performed , it is important for clinicians to consider the possibility of abdominal wall hematoma in this situation , especially when the patient has many predisposing factors .", "fluoroscopy - guided femoral artery puncture and guidewire insertion may reduce the rate pci - related vascular complications ." ] ]

[ [ "for the invasive treatment of symptomatic aortic stenosis several attractive options became available beyond conventional cardiosurgical implantation of stented bioprostheses or mechanical valves . besides stentless prostheses , in particular transcatheter procedures are of growing importance . ", "nevertheless the number of implanted stented bioprostheses in germany expanded or at least remained stable over the last years .", "thus , 9.704 bioprostheses were implanted in germany in 2010 , according to 84% of all implanted prostheses in aortic position .", "implantation of bioprostheses was associated with a 30-day - mortality of 3,3 % , which is higher than for mechanical valves ( 1,5% ) due to the fact that patients for bioprostheses are significantly older or suffer from more complex co - morbidities . ", "the purpose of this review is to summarize the features of the currently available bioprostheses in the light of competing procedures ." ], [ "there has been a continuous development to improve the design of stented bioprostheses with respect to hemodynamic profile , biological durability and ease of implantation .", "associated with the scalloped designs of stented bioprostheses a tension - free implantation with avoidance of paravalvular leaks can be expected . ", "the evolvement of low profile valves reduces the risk of coronary occlusion in patients with a small distance between annulus and coronary ostia .", "stented bioprostheses have proven to be effective even in small aortic roots regarding hemodynamic improvement , left ventricular mass reduction and improvement of the patient s quality of life . in vitro examinations showed pericardial valves to be slightly superior to porcine valves with regard to gradient and orifice area .", "additionally , accurate sizing prevents a patients - prosthesis - mismatch which could result in poor postoperative clinical performance . avoiding the use of running suture for stented valve implantation" ], [ "the currently available and established bioprostheses show rates of degeneration at 20 years around 15% in patients aged 65 or higher . the freedom from repeat aortic valve replacement reaches over 85% after 20 years in patients older than 60 years and 65% in all age groups . along with these convincing results of durability and freedom of re - implantation stented bioprostheses became also attractive for younger patients .", "lately transcatheter aortic valve implantation ( tavi ) with valve - in - valve implantation into the degenerated xenograft showed to be an additional option in high risk patients with the need for redo valve replacement .", "if a repeated valve replacement is necessary due to functional deterioration the operative mortality is acceptable with 4 to 6% and is mainly due to active endocarditis and comorbidities . " ], [ "stentless porcine valves were initially believed to have superior hemodynamic properties resulting in more effective reduction of left ventricular mass and better clinical performance according to nyha class .", "stented bioprostheses are still used more commonly than stentless ones because of their relative ease of implantation , their extensively documented long - term results , and the low risk associated with reoperation . ", "these findings could nt be yet approved by long - term follow up investigations [ 15 , 16 ] .", "nevertheless since the pulmonary valve has to been replaced by a bioprosthesis it is a demanding two valve procedure with prolonged cross clamping times . aside from this , special means are necessary for pulmonary autograft stabilization to prevent its degeneration .", "another biological approach is the use of an autograft like the ross procedure , where the patient s pulmonic valve is transferred to the aortic position .", "the ross procedure is suitable for children and young adults because it is compatible with further growth of the aortic root .", "bearing this in mind calls the more demanding implantation technique of stentless prostheses in question ." ], [ "nevertheless aortic valve replacement using a tissue valve remains controversial for patients younger than 60 years since there are studies reporting reduced mid - term results .", "thus , younger patients opting for a bioprosthesis can enjoy a normal quality of life without anticoagulation for many years but may need to undergo a second valve replacement procedure with an acceptable degree of risk .", "some younger patients are averse to oral anticoagulation and therefore prefer a biological valvular prosthesis .", "hemorrhagic complications are significantly more common in patients with mechanical valves because of anticoagulation . ", "the supposed advantage of the longer durability of a mechanical valve is also offset by the potential complications of oral anticoagulation , especially because anticoagulation is more difficult to manage in dialysis patients than in others . ", "chronic atrial fibrillation is no longer a contraindication to bioprostheses since permanent oral anticoagulation can be avoided if concomitant ablative surgery results in permanent conversion to sinus rhythm .", "there are only a few current randomized trials comparing the long - term results of biological and mechanical valves ." ], [ "substantial progress in valve technology led to the development of self - expanding valves . since a few years a number of bioprostheses are available for suture - less implantation which is usually combined with a limited surgical access . ", "implantation of conventional prostheses can be performed through a limited direct access like a hemi - sternotomy or a lateral access . reported large series show that aortic valve operations can be safely performed in experienced centers .", ". future will show the benefits of this procedure characterized by short cross clamping times and whether it can coexist with tavi procedures . " ], [ "in germany a massive increase of its application can be observed ; in 2010 nearly every fourth aortic valve replacement was performed as a tavi procedure .", "after its clinical inauguration by cribier in 2002 the transcatheter aortic valve implantation gained widespread use in high risk patients with aortic stenosis .", "the partner trial was a randomized trial comparing tavi with standard - of - care therapies in high risk patients .", "the two treatments were similar with respect to mortality , reduction in symptoms , and improved valve hemodynamics , but paravalvular regurgitation was more frequent after tavi and was associated with increased late mortality . ", "nevertheless there is still a lack of evidence that tavi is superior to open valvular replacement as the gold standard regarding long - term results . ", "current guidelines recommend the use of tavi restricted to patients with contraindications for open surgery or inacceptable perioperative risks .", "there are a growing number of publications reporting promising short term results in high risk patients ." ], [ "in addition the cost effectiveness of stented bioprostheses appears unbeatable and the surgical ease of implantation allows for cross - clamp times between 30 and 60 minutes .", "because life expectancies in general have risen , more and more elderly patients are presenting for valve replacement and for these patients a bioprosthesis is usually chosen .", "current studies reveal that bioprostheses of the most recent generation last longer than earlier types .", "overall , even in face of more innovative biological alternatives the implantation of stented bioprostheses is still a very interesting option and represents actually the most frequent valve implantation technique for aortic stenosis . especially in the light of growing use of interventional valve replacement", "there is the urgent need for complete nationwide registry with adequate long term follow up , quality of life information and relevant subgroup analysis to define new standards in the treatment of patients with aortic stenosis ." ] ]

[ [ "the above reasons and need , our study was directed to measure the psychological dependence , which is the root cause of high tobacco consumption among the rural population .", "this study will help and simplify the job of tobacco cessation centers by high - lighting the risk group in relation to high psychological dependence for tobacco consumption .", "the psychological dependence is seen in cases of use of illegal drugs , alcohol and tobacco .", "it aimed at identifying which form of tobacco consumption ( smoking or smokeless ) is causing psychological dependence and which particular age group in rural population is psychologically more dependent on tobacco .", "the motive was to draw the attention of the tobacco cessation centers so that they can target at specific age group in rural population , with a particular tobacco consumption habit .", ", the harmful effects of tobacco had been recognized historically in 16 century by king james i of england , shah abbas of persia and the mughal emperor jahangir of india , who tried to ban the consumption of tobacco among public .", "alcohol is known to be a potentially dangerous drug , and society still accepts it as such . on the other hand", " tobacco use has been considered a religious taboo by the sikhs since then . however , despite historical attempts to ban tobacco , its use has continued to grow in popularity as a non - productive time - pass ." ], [ "subjects with the habit of tobacco smoking or tobacco chewing were selected from a rural area and catchment area of dental college , with a population of nearly 2000 people .", "hence , overall all these 200 subjects were divided into following groups as : group i-100 subjects with tobacco smoking habit group ii-100 subjects with the use of smokeless tobacco both groups were further subdivided into following subgroups based on age : group a - with age ranging between 20 years to 30 years group b - with age ranging between 31 years to 40 years group c - with age ranging between 41 years to 50 years group d - with age including 51 years and above a standard questionnaire format of fagerstrom test for nicotine dependence ( ftnd revised version ) for smoking [ table 1 ] given by heatherton et al . and smokeless form of tobacco [ table 2 ] given by ebbert et al .", "the assessment of habit of tobacco consumption continued for enrolled subjects during dental health check up until 25 subjects with each 20 - 30 years , 31 - 40 years , 41 - 50 years , and 51 and above years of age for tobacco chewing and tobacco smoking separately were included in the survey .", "the tobacco consumption habit was assessed by direct questioning and by clinical examination . for clinical assessment presence of stains of tobacco chewing and tobacco smoking over teeth , and oral mucosa", "questionnaire form of ftnd revised version for smoking form of tobacco questionnaire form of ftnd revised version for smokeless form of tobacco 7 - 10 : person is highly dependent on nicotine and may benefit from a smoking cessation program based on treatment for nicotine addiction .", "below 4 : person has low to moderate addiction , but is not likely to need nicotine replacement therapy ." ], [ "7 - 10 : person is highly dependent on nicotine and may benefit from a smoking cessation program based on treatment for nicotine addiction .", "4 - 6 : person has low to moderate dependence on nicotine ; however , this does not rule out a smoking cessation program based on treatment for nicotine addiction .", "below 4 : person has low to moderate addiction , but is not likely to need nicotine replacement therapy .", "the calculated scores for all subjects were then statistically analyzed by using the karl pearson correlation ( r ) test and student 's t - test for the distribution of psychological dependence among the rural population ." ], [ "the statistical analysis of the study data revealed that tobacco chewing habit is more common and for a long duration in the subjects below the age of 40 years in rural population .", "so after the age of 40 years , the rural population seemed to be highly dependent on tobacco smoking as compared to tobacco chewing .", "study data revealed that , form of tobacco consumption ( either smoking or smokeless form ) does not have any influence over psychological dependence for age groups of 20 - 30 years and 31 - 40 years . a positive correlation [ table 4 ] was observed between duration of habit and ftnd score in all age groups , irrespective of the type of habit of tobacco consumption .", "distribution of mean and sd values of the duration of habit and ftnd score ( points ) in all groups under study when we compared group i with group ii for psychological dependence for tobacco use , statistical analysis revealed that people are highly dependent on tobacco smoking after age of 40 years ( 5.24 2.31 ; [ table 3 ] ) .", "subjects above 50 years of age were more indulged with the tobacco smoking habit as compared to tobacco chewing habit [ table 3 ] ." ], [ "these studies are descriptive in nature , mainly focusing on the percentage distribution of tobacco consumption among the rural population . the present study , mainly focused on measuring the nicotine dependence among the rural population , hence that the particular age group and the type of tobacco consumption habit associated with the psychological dependence can be targeted for cessation .", "the present study has revealed that tobacco smoking habit , especially , bidi smoking is more common after the age of 40 years among the rural population .", "subsequently , as per the present study findings , a hypothesis can be derived that , in rural areas , people above 40 years of age with tobacco smoking habit are at a higher risk for developing oral cancer due their high psychological dependence .", "younger age groups of rural areas showed a higher psychological dependence for tobacco chewing as compared to tobacco smoking [ table 3 ] .", "the mean duration of habit and ftnd score is high [ table 3 , figure 1 ] for tobacco smoking as compared to tobacco chewing after the age of 40 years ." ], [ "individuals above 40 years of age show a high psychological dependence for tobacco smoking as compared to tobacco chewing , and these individuals are at a risk for developing oral cancer due to higher tobacco consumption .", "present study highlights \n tobacco chewing habit is more prevalent among young individuals of the rural population.the type of habit either tobacco chewing or tobacco smoking does nt have any effect over psychological dependence among individuals below 40 years of age .", "hence , it is of prime importance to target such individuals for quitting tobacco consumption habit .", "hence , the young individuals should be targeted for tobacco cessation therapy irrespective of type of habit of tobacco consumption.individuals above 40 years of age show a high psychological dependence for tobacco smoking as compared to tobacco chewing , and these individuals are at a risk for developing oral cancer due to higher tobacco consumption.hence , it is of prime importance to target such individuals for quitting tobacco consumption habit . \n ", "hence , the young individuals should be targeted for tobacco cessation therapy irrespective of type of habit of tobacco consumption .", "the type of habit either tobacco chewing or tobacco smoking does nt have any effect over psychological dependence among individuals below 40 years of age ." ], [ "these findings could be a stepping stone for opening of tobacco cessation centers in rural area , which can target the rural population to put an end to the habit and hereafter reduce the incidence of oral cancer .", "present study is a grass root level based questionnaire survey to measure the psychological dependence of the rural population for tobacco consumption habit .", "based on the dependence level , the programme of tobacco cessation should be adequately implemented . among the rural population tobacco smoking habit", "the first step towards tobacco cessation is to know how much an individual is psychologically dependent on tobacco .", "the good news about the psychological part of addiction is that the mind can actually over - ride the brain and body ." ] ]

[ [ " while decreases in both breast cancer incidence and mortality have been apparent in recent years , the societal and economic impact of this malignancy continues to be enormous .", "positive associations between environmental and individual factors and increased risk of breast cancer development have been alleged for at least a century .", "several progresses were made in understanding the underlying mechanisms of cancer development and some drugs were recently approved for the preventive approach of this disease .", "thus , the current thinking is that prevention is a highly feasible approach to breast cancer control . despite several factors which increase the woman ' risk ( gender , age , and family history ) are not changeable , other modified risk factors such as alcohol intake , dietary fat , obesity in postmenopausal age , and hormonal stimulations have been identified and for these reasons interest in strategies to prevent breast cancer remains strong and intriguing .", "this process is similar in every epithelial cancer , and the ability to arrest one or the several of these steps may impede or delay the development of cancer .", "the epithelial carcinogenesis is a multistep , multipath , and multiyear disease of progressive genetic and associated tissue damage ( figure 2 ) . in detail , the carcinogenetic process starts with unspecified accumulations of genetics events which lead to a progressive dysplastic cellular appearance with genotypic and phenotypic alterations , deregulated cell growth , and finally cancer ." ], [ "the two major classes of antiestrogenic drugs , the selective estrogen receptor modulators ( serms ) and the aromatase inhibitors ( ais ) , have been recently used for their activity in breast cancer prevention .", "although the precise mechanism that causes breast cancer is not fully established itis recognized that hormones play a significant role in almost 70% of cases and current chemopreventive strategies have targeted hormonally responsive breast cancers .", "estrogen is well established as a promoter of cell division in the breast , where it causes proliferation of both normal and malignant cells ." ], [ "the results of this study were the first to show the benefit of tam in breast cancer prevention .", "however , the approval of raloxifene gives an important new option to postmenopausal women beyond that of tamoxifen , one that avoids an excess of endometrial cancers and reduces the risk of thromboembolic events .", "tam has been in clinical use for breast cancer treatment for more than 30 years to reduce the risk of both recurrence and contralateral neoplasia , 42% and 47% , respectively .", "in addition , 3 european tamoxifen prevention trials have been completed and have reported long - term follow - up data of the effect of this agent in bc incidence : the italian tamoxifen prevention study , the royal marsden hospital tamoxifen randomized chemoprevention trial , and the international breast cancer intervention study ( ibis)-1 . although they differ in many details in study design and other , these trials were similar enough to be evaluated together in an overview of their main outcomes .", "data from the star trial and the other raloxifene / placebo trial resulted in the approval of raloxifene by the us food and drug administration for a reduction in the risk of invasive breast cancer in postmenopausal women with osteoporosis and reduction in the risk of invasive breast cancer in postmenopausal women at high risk of invasive breast cancer ." ], [ "will look at the role of ana in affected postmenopausal women who underwent a locally excised ( or mastectomy ) hormone receptor - positive intraductal neoplasia with clear margins . in this second group ,", "the international breast cancer intervention ( ibis)-ii prevention trial , direct consequence of atac trial , is actually ongoing and is comparing anastrazole ( ana ) to placebo in 6000 postmenopausal women at increased risk to breast cancer . a second complimentary study ( ibis - ii )", "they are superior to tamoxifen , and we hypothesized that the major of er - positive breast cancer ( but not for er negative ) can be prevented by these drugs .", "thus , the third - generation aromatase inhibitors ( ais ) have been introduced into the treatment of breast cancer , and their greater efficacy compared to tamoxifen , along with a more favorable side - effect profile , makes them attractive agents for use in breast cancer prevention [ 35 , 36 ] .", "setting , third generation of ais ( anastrozole , letrozole , and exemestane ) has been found to superior to tamoxifen and be able to reduce the incidence of contralateral breast cancers by 37 to 55% [ 2833 ] .", "another prevention trial with ais ( map3 ) is actually underway with exemestane ( exe ) .", "high circulatory estrogen levels , as well as high aromatase levels in breast tissue , have been known to increase breast cancer risk ." ], [ "have been developed and many of these are still currently under investigation . these agents include retinoids , epidermal growth factor receptor ( egfr ) , tyrosine kinase inhibitors ( tkis ) , cyclooxygenase-2 ( cox-2 ) inhibitors , bisphosphonates , vitamin d receptor ( vdr ) , statins , peroxisome proliferator- activated receptor ( ppar ) , and others . a complete summary of involved agents , with their specific pathways , is shown in table 1 and a brief state of the art of the more compounds involved are analyzed below . ", "although a number of antiestrogenic agents are being extensively tested in clinical trials , all these agents affect the endocrine pathway and suppress only the development , of estrogen receptor ( er)-positive breast cancer .", "bisphosphonates , the drugs of choice for the treatment of osteoporosis , act on the mevalonate pathway and for this reason are currently of considerable interest in the treatment and prevention of breast cancer .", "thus , it is worth identifying new pathways , biomarkers , and agents that are effective in the treatment and prevention of these subtypes . with the accumulating knowledge in understanding the biology of cancer development several classes of a new generation of chemopreventive agents modulating the nonendocrine biochemical pathways", ". there is increasing evidence that presence of hyperinsulinemia and insulin resistance increased breast cancer risk , worsen , the prognosised and partly explained the obesity - breast cancer risk association in postmenopausal women [ 9398 ] .", "they have no effect in reducing the risk of er - negative breast cancer , which accounts for 2030% of breast cancers and has a poor prognosis ." ], [ "there is substantial evidence that together with the epithelial cells alterations the microenvironment dysfunction is crucial for carcinogenesis , and this makes the microenvironment an interesting target for breast cancer chemoprevention . in particular , there are many excellent publications which consider microenvironment as a good target for cancer therapy , but the application of chemoprevention to control the tumour microenvironment during the early stages of carcinogenesis is not yet adequately analyzed .", "many molecularly pathways and the correlated targeted drugs are actually in development for advanced cancer therapy , and they have potential activity and tolerability also in cancer chemoprevention setting .", "we will briefly explain a recent progress that indicates that the effects of chemopreventive agents on the microenvironment are an important aspect of their preventive action and that many classes of agents , which showed to have significant chemopreventive actions on epithelia , also have similar useful actions on the microenvironment .", ", hif-1 is considered a potential target for cancer therapy , and , recently , many efforts to develop new hif-1-targeting agents have been made [ 127130 ] ." ], [ "the personalized approaches in advanced cancer therapy and the evolution of molecularly targeted will streamline chemoprevention research and facilitate the development of rational , effective , and safe preventive drugs , involving different pathways and with the ability to modify carcinogenesis in early phases .", "safety is a very important point to take into account , because several large randomized prevention trials in several cancers have shown that major adverse events can prevent widespread public acceptance of active chemoprevention agents .", "despite the success of action showed for example in endocrine intervention is a promising starting point in order to continue to evolve with the rapid integration of molecular approaches into research and clinical practice .", "in conclusion , the success of chemopreventive approach depends on a tumor - specific risk model for identifying high - risk subjects , increasing preclinical drug test over the development novel and more safety chemopreventative agents , and identifying new surrogate endpoint using molecular pathways and new targets of drugs activity .", "it is urgent to find active agents in other fields as nonhormone - responsive lesions ." ] ]

[ [ "mean daily intake of water , wine , beer or cider , and sweet beverages was categorized in the questionnaire into six mutually exclusive levels : none , < 0.5 , 0.5 to 1 , 1 to 1.5 , 1.5 to 2.0 , and > 2 l. in the present analyses , the levels were grouped into three classes : < 0.5 , 0.5 to 1 , and > 1 l. other clinical and biological measurements are presented in the supplementary methods .", "smoking , dietary habits , degree of physical activity , and alcohol consumption were assessed using a self - administered questionnaire .", "we included 3,615 french men and women , aged 3065 years , with baseline fasting glycemia ( fg )", "logistic regression models were used to determine odds ratios ( ors ) and 95% cis corresponding to the comparison of incident hyperglycemia in middle and high classes of w - intake in comparison with the lowest class .", "adjustment variables were either known risk factors for type 2 diabetes or factors associated ( p < 0.10 ) with hyperglycemia and w - intake in our population .", "baseline means and percentages were compared between the three w - intake classes using anova or tests ." ], [ "we included 3,615 french men and women , aged 3065 years , with baseline fasting glycemia ( fg )", "incident hyperglycemia was identified by an fg 6.1 mmol / l or treatment for diabetes , and incident diabetes was identified by an fg 7.0 mmol / l or treatment of diabetes during at least one of the three follow - up examinations ( years 3 , 6 , and 9 ) .", "< 6.1 mmol / l , who participated in the 9-year follow - up d.e.s.i.r .", "participants provided written informed consent , and the protocol was approved by the ethics committee of bictre hospital , kremlin - bictre , france ." ], [ "mean daily intake of water , wine , beer or cider , and sweet beverages was categorized in the questionnaire into six mutually exclusive levels : none , < 0.5 , 0.5 to 1 , 1 to 1.5 , 1.5 to 2.0 , and > 2 l. in the present analyses , the levels were grouped into three classes : < 0.5 , 0.5 to 1 , and > 1 l. other clinical and biological measurements are presented in the supplementary methods .", "smoking , dietary habits , degree of physical activity , and alcohol consumption were assessed using a self - administered questionnaire ." ], [ "logistic regression models were used to determine odds ratios ( ors ) and 95% cis corresponding to the comparison of incident hyperglycemia in middle and high classes of w - intake in comparison with the lowest class .", "results are presented as means ( sd ) or median ( 25th75th percentiles ) for quantitative variables and as percentages for qualitative variables .", "adjustment variables were either known risk factors for type 2 diabetes or factors associated ( p < 0.10 ) with hyperglycemia and w - intake in our population .", "baseline means and percentages were compared between the three w - intake classes using anova or tests ." ], [ "the daily w - intake was negatively associated with the risk of new - onset hyperglycemia , even after adjustment for multiple metabolic risk factors .", "ors ( 95% cis ) for the association between daily w - intake at baseline and the risk of incident hyperglycemia ( fasting plasma glucose 6.1 mmol / l or treatment for diabetes ) are presented according to two statistical models ; variables for adjustment were either known risk factors for type 2 diabetes or factors associated ( p < 0.10 ) with hyperglycemia and w - intake in our population .", "baseline characteristics of the 3,615 normoglycemic participants are presented according to their class of w - intake ( table 1 ) . among them , during follow - up , 565 subjects became hyperglycemic and 202 developed diabetes .", "baseline characteristics of the study population and risk for new - onset hyperglycemia during follow - up , by classes of mean daily w - intake data are means ( sd ) or medians ( 25th75th percentiles ) for continuous variables and percentages of patients for categorical variables .", "thzd , thiazidic diuretics ; furo , furosemide ; homa - ir , homeostatic model assessment index of insulin resistance ; homa - b , homeostatic model assessment index of insulin secretion" ], [ "risk for hyperglycemia was negatively and independently related with self - reported w - intake in normoglycemic middle - aged individuals from the french general population", "however , the association was moderately attenuated when important metabolic risk factors and potential confounders were introduced as covariables in the analysis , including intake of other classes of beverages with known adverse long - term effects ( sweet and alcohol - containing drinks ) .", "the negative association of w - intake and risk for hyperglycemia was relevant among many subsets of participants , and those reporting a low w - intake ( < 0.5 l ) had a higher risk for hyperglycemia ( for example , participants in the high physical activity group ) ( supplementary table 1 ) . this indicates that identification of individuals with a w - intake of < 0.5 l may be widely relevant to target preventive interventions regarding the metabolic risk .", "it suggests that an increase in w - intake , an easy and costless intervention , could prevent or delay the onset of hyperglycemia and subsequent diabetes ." ], [] ]

[ [ "although patients who undergo dialysis suffer from a complex illness , there are compelling reasons to believe that the inadequate removal of organic waste is an important contributing factor to the illness itself .", "nevertheless , randomized trials examining the impact of increased clearance of traditional uraemic solutes have yielded disappointing results .", "hence , the interest of clinicians , followed by that of industry , in a new class of dialysis membranes aimed at enhancing the transport capabilities ( clearance ) of middle , large and even protein - bound molecules by using all the available membrane separation phenomena : diffusion , convection and adsorption , by designing and developing both high - performance ", "this further confirms a series of observational studies that had already demonstrated that , in terms of patient survival , techniques capable of increasing middle - molecule clearance , such as haemodiafiltration ( hdf ) , hold an advantage over the conventional hd . in recent years , scientists have been increasingly convinced that a large number of high - molecular - weight toxins increase their plasma concentration during uraemia and are responsible for a number of dialysis co - morbidities , such as an immune system imbalance , itching and so on .", "protein - leaking dialyser , we mean the dialyser capable of removing large molecules on the basis of convection enhancement ( super - flux ) or adsorption capabilities ." ], [ "the main aim of a dialysis filter is to better reproduce the physiological process of glomerular ultrafiltration .", "dialysis membrane clearance , however , is based on concentration differences rather than the convective separation of solutes and low - molecular - weight proteins from large serum proteins and blood elements . in an attempt to replicate glomerular ultrafiltration and the removal of ", "recently , the idea that the removal of a distinct class of uraemic toxins , such as 2-microglobulin , factor d , leptin and adrenomedullin , while minimizing albumin loss , could improve treatment outcome in end - stage renal disease ( esrd ) patients has led to the development of a series of dialysers known by the name of super - flux. super - flux dialysers have been designed to maximize convective transport by increasing the pressure drop along the membrane fibres .", "the same can be said of techniques such as hf or hdf based on the use of high fluxes attainable with high - flux dialysers . on the latter issues , however , a whole strand of literature is coming out in favour of the convective techniques , which is not only based on observational studies , as in the past , but on randomized controlled trials . the recent membrane permeability outcome ( mpo ) , a study in which 647 incident dialysis patients were randomly allocated to high - flux or low - flux dialysis membranes , demonstrated that the improved 2-microglobulin clearance led to an improved survival in those with albumin < 4 g / dl , with a 37% reduction in the mortality risk with the high - flux membrane ." ], [ "removing pbut from the blood by means of diffusion and convection ( containing the albumin loss ) is virtually impracticable ; however , pbut can be removed by using the adsorptive properties of particular biomaterials .", "a number of adsorption techniques are well known in the world of blood purification : with selectivity or without selectivity , working with plasma or whole blood , consisting of fibres or solid spheres . in this context", "the same toxic substances directly bind with protein ( pbut ) , originating from high - weight complexes ( 50200 kda ) potentially involved in important uraemia co - morbidities such as itching and altered immune response [ 1821 ] .", ", in some cases , an ionic treatment of the inner surface may enhance this adsorption mechanism .", ", only dialysers made with a synthetic membrane having adsorption capabilities should be taken into account ." ], [ "super - flux dialysers based on enhanced convection or adsorption , at least on the theoretical plane , could be widely used in clinical situations in which , apart from toxins of small molecular size , large quantities of mediators and toxic products are also produced , with a negative biological effect at a middle high molecular weight , or which are rapidly bound to the proteins .", "these filters make it possible to treat septic patients with acute renal failure and simultaneously provide the control of uraemia and fluid status as along with cytokine removal . in the field of haematological diseases , particularly in myeloma , early yet encouraging results have already been obtained in the light chain removal .", "hd with super - flux dialysers has been shown to be more effective than high - flux dialysis in reducing plasma homocysteine .", "hence , before opening the door to these new filters , it will be necessary to develop strategies in use to achieve a good clearance of waste and harmful products , while minimizing the risk of a huge loss of substances , such as proteins , useful for our organism 's biochemical homeostasis .", "however , an important side effect of super - flux dialysers , or at least some of them , might be plasma protein loss , and not only that of albumin but also coagulation factors , growth factors and hormones ." ] ]

[ [ "finally , our study showed that nf - y up - regulated the expression of dmrt7 by binding to two tandem ccaat - boxes in the proximal promoter region of the gene .", "deletion and site - directed mutagenesis were used to identify regions of the promoter that are required for transcriptional activity .", "emsa and chip analysis was employed to determine the binding relationship between transcription factor nf - y and the dmrt7 promoter .", "however , the transcriptional mechanisms regulating dmrt7 need to be studied further , which will contribute substantially to our understanding of the pathway of sex differentiation and spermatogenesis . here", "the genes doublesex in drosophila and mab-3 in caenorhabditie elegans were first identified as transcription factors containing a conserved zinc finger - like dna binding domain ( dm domain ) , which plays a key role in sexual development 1 - 3 ." ], [ "mouse testis nuclear extract used for electrophoretic mobility shift assays was prepared as described previously 31 .", "gc-1 ( a cell line from type b spermatogonia of mouse and show characteristics of a stage between type b spermatogonia and primary spermatocytes ) and cos 7 cells ( a cell line was obtained by immortalizing a cv-1 cell line derived from kidney cells of the african green monkey ) were maintained in high glucose dulbeccos modified eagles medium supplemented with 10% fetal bovine serum , plated in 48-well plates and transfected using lipofectamine2000 ( invitrogen , carlsbad , ca , usa ) .", "nf - yb and nf - yc were pcr - amplified from mouse testis cdnas and cloned into ecori site of the pcx - egfp vector by replacing the egfp fragment to generate expression plasmids ( pcx - nfya , pcx - nfyb and pcx - nfyc ) using primers : , 5cgtgaattcgccatggagcagtata3 and 5ctcgaattcttaggaaactcggatga3 for nf - ya ; 5atagaattcatcatgacaatggacgg3 and 5 tccgaattctcatgaaaactgaatttg3 for nf - yb ; 5gccgaattcaaaatgtccacagaag3 and 5ctcgaattctcagtctccagtcacct3 for nf - yc .", "all constructs were sequenced . for the construction of expression plasmids , the full - length cdnas of mouse wild - type nf - ya ,", "oligonucleotides corresponding to the ccaat box1 and box2 of the dmrt7 promoter were synthesized and annealed into double strands .", "a region of 257 bp around 10 kb downstream of the first exon of the dmrt7 was amplified as a control with primers : 5aataagtttccaaccgtgaagt3 and 5tatccaaggagatgggtaagtg3. the pcr products were cloned into t - easy vector ( promega , madison , wi , usa ) and sequenced for confirmation" ], [ "after several washes in tbst , detection of the secondary antibody was performed using the supersignal chemiluminescent substrate system ( pierce , rockford , usa ) .", "dmrt7 was detected by dmrt7 antibody ( 1:500 , genway biotech , inc . , san diego , ca ) and -actin was used as an internal control ( 1:1000 , santa cruz biotech , ca , usa ) .", "membranes were incubated with primary antibody for 1 h at room temperature , washed in tbst and probed with hrp conjugated secondary antibody ( 1:10000 , santa cruz biotech , ca , usa ) .", "aliquots of tissue extracts ( 50 mg ) were separated by electrophoresis in 10% sds - polyacrylamide gel ( page ) and transferred onto a 0.45 m membrane ( hybond - p ; amersham pharmacia biotech ) ." ], [ "to characterize functional elements in the dmrt7 promoter , the sequence from -407 to + 116 of dmrt7 was run in matinspector and tfsearch to find putative transcriptional elements .", "these results indicate that the ccaat box1 within the promoter region is capable of binding with transcription factor nf - ya in vitro .", "these results indicate that nf - y specifically binds to the dmrt7 promoter in vivo . to investigate the role of transcription factor nf - y in the activation of the dmrt7 promoter , both gc-1 and cos 7 cells were co - transfected with luciferase reporter driving by wild - type dmrt7 promoter ( -60/+116 construct ) or its mutants for ccaat sites , and nf - ya / b / c expression plasmids .", "these results showed that both ccaat box1 and ccaat box2 are important for transcriptional activation of the mouse dmrt7 gene .", "blast alignment of the promoter region of mouse , rat , and human dmrt7 genes revealed two highly conserved ccaat boxes : the ccaat box1 ( -48/-44 ) and the ccaat box2 ( -7/-3 ) ( figure 1b ) . to determine the functional elements required for promoter activity ," ], [ "to characterize functional elements in the dmrt7 promoter , the sequence from -407 to + 116 of dmrt7 was run in matinspector and tfsearch to find putative transcriptional elements .", "blast alignment of the promoter region of mouse , rat , and human dmrt7 genes revealed two highly conserved ccaat boxes : the ccaat box1 ( -48/-44 ) and the ccaat box2 ( -7/-3 ) ( figure 1b ) . to determine the functional elements required for promoter activity ,", "these results showed that both ccaat box1 and ccaat box2 are important for transcriptional activation of the mouse dmrt7 gene .", "several possible transcription - factor binding sites , which included ap-1 , sp1 , gata1 , e2f and ccaat box , were identified ( figure 1a ) ." ], [ "these results indicate that nf - y specifically binds to the dmrt7 promoter in vivo .", "these results indicate that the ccaat box1 within the promoter region is capable of binding with transcription factor nf - ya in vitro .", "these results indicate that transcription factor nf - ya can bind to dmrt7 promoter in vitro . to further determine whether nf - y binds to the mouse dmrt7 promoter in vivo , we performed chromatin immunoprecipitation analysis . because dmrt7 protein was only detected in testis ( figure 3a ) , we chose the testis for chip analysis .", "incubation of probe1 spanning from -58 to -31 ( containing ccaat box1 ) with the extract gave rise to the formation of a dna - protein complex ( figure 2 lane1 ) , which could be competed by the addition of an excessive amount of unlabelled oligo1 dna ( figure 2 lane5 ) , but not by the oligo1 dna with mutated ccaat box ( figure 2 lane7 ) .", "transcription factor prediction using the matinspector and tfsearch showed that potential transcription factor nf - y may bind to the ccaat boxes . to determine if nf - y binds to the ccaat boxes , electrophoretic mobility shift assays were carried out using nuclear extracts prepared from mouse testis and double stranded oligonucleotides .", "the amplified fragment was confirmed by sequencing . to rule out the possibility of non - specific binding of the nf - ya antibody , an additional pcr amplification of a distinct genomic region" ], [ "to investigate the role of transcription factor nf - y in the activation of the dmrt7 promoter , both gc-1 and cos 7 cells were co - transfected with luciferase reporter driving by wild - type dmrt7 promoter ( -60/+116 construct ) or its mutants for ccaat sites , and nf - ya / b / c expression plasmids .", "nf - yam29 has three amino acid substitutions at the c - terminal region of the nf - ya , which impairs its dna binding and acts as a dominant - negative mutant by sequestering the nf - yb / yc subunits into a defective complex 32 .", "the luciferase activity increased obviously when a wild - type promoter construct ( -60/+116 ) was co - transfected with nf - ya / b / c ( figure 4a ) .", "this result indicated tandem arrangement of the ccaat box1 and box2 may ensure maximum promoter activity of the dmrt7 .", "in addition , replacing the nf - ya / b / c expression plasmid with the dominant - negative construct ( nf - yam29 ) resulted in a marked reduction of luciferase activity in a dosage - dependent manner ( figure 4b ) .", "however , the luciferase activity was not upregulated obviously when co - transfected with mutants for ccaat box1 or box2 and was not upregulated absolutely when co - transfected with double mutants for ccaat box1 and box2 ( figure 4a ) ." ], [ "possible post transcriptional role of poly - adenylation in dmrt7 expression regulation was previously proposed 30 . because transcriptional regulation of the gene dmrt7 during spermatogenesis is an important process , in this study , we have explored promoter function of the gene and found that nuclear factor - y ( nf - y ) regulates transcription of mouse dmrt7 gene through binding to two conserved ccaat boxes in its proximal promoter region .", "dmrt7 is a member of the dm domain family of genes , which encodes proteins with a conserved dna binding dm domain .", "the results suggest that binding by nf - y to these two tandem ccaat boxes is important for regulation of the basal transcription of the dmrt7 gene in the mouse testis .", "these results provide evidence of the regulatory mechanisms that control the expression in testis of the mouse dmrt7 gene and will form the basis for understanding mammalian spermatogenesis ." ] ]

[ [ "primary retroperitoneal germ cell tumors account for approximately 30% of extragonadal germ cell tumors ( egcts ) and for about 10% of all primary malignant retroperitoneal tumors .", "we report the cases of a 33- and a 39-year - old man presenting with a retroperitoneal extragonadal tumor and bilateral tm without a focal testicular mass .", "nevertheless , it is still uncertain whether ultrasound surveillance is really necessary in patients with tm in the absence of other risk factors such as previous testicular cancer , a history of cryptorchidism or testicular atrophy .", "many studies have demonstrated an association between diffuse bilateral testicular microlithiasis ( tm ) and gonadal germ cell tumors and egcts [ 2 , 3 ] ." ], [ "we performed a scrotal ultrasonography ( us ) to rule out that this mass was a retroperitoneal metastasis of a primary testicular tumor : us showed bilateral classic tm ( defined as more than 5 calcifications scattered throughout the testicle ) , without a focal lesion ( fig .", "therefore , we decided to perform a total body ct to better characterize the mass and its relationship to adjacent structures .", "2 ) . comparing the current ultrasound images with previous us testicular images ( the patient underwent a scrotal us when he was 25 years old because of a testicular trauma )", "the mri images showed no slipped disks , but we unfortunately detected a voluminous retroperitoneal solid mass ." ], [ "a 33-year - old man came to our emergency department complaining of abdominal pain , vomiting , weight loss and mild jaundice .", "3 ) . the patient was sent to do an us to rule out the presence of a primary testicular tumor , which revealed bilateral tm without a focal hypoechoic lesion ; the microcalcification pattern was quite similar to that of a past ultrasound exam that was performed when the patient was 22 years old because of a suspected varicocele .", "ct and mri examinations showed a giant retroperitoneal mass made up by multiple necrotic - colliquative fluid areas with a multilocular aspect , which dislocated the inferior vena cava anteriorly and with possible infiltrating signs ; it also compressed the portal vein and the common bile duct with moderate dilatation of the intrahepatic ducts ( fig ." ], [ "an egct is by definition a germ cell neoplasm , displaying one of the histologic types associated with gonadal origin , but located outside the gonads .", "it remains uncertain , however , whether such tumors develop primarily at extragonadal sites or represent metastases of a primary testicular tumor .", "regarding the latter case , egct may have developed from burned out testicular tumors or they may just be metastatic lesions from primary testicular tumors that were not detected at the time of the diagnosis . a burned out gonadal primary tumor is a regressed tumor which is seen as an echogenic scar or a hypoechoic tissue on testicular ultrasound and which clinically presents with metastasis .", "primary testicular malignancy and egcts are often associated with tm [ 2 , 8 ] .", "these are useful serum markers in the diagnosis , prognosis , and follow - up of patients with germ cell tumors ." ], [ "on the basis of our direct experience , we highlight the importance of annual ultrasonographic surveillance of the testis and retroperitoneal space in patients with occasionally detected tm . besides , taking into account the increased risk of metachronous testicular malignancy in patients with previous egct [ 6 , 9 ] , we recommend yearly testicular ultrasound follow - up after surgical removal of retroperitoneal gonadic tumor .", "j. richenberg and n. brejt affirm that ultrasound surveillance is unlikely to benefit patients with tm in the absence of other risk factors ; on the contrary , in the presence of additional risk factors ( previous testicular cancer , a history of maldescent or testicular atrophy ) , patients are likely to be under clinical and ultrasound surveillance . nevertheless , it is still controversial whether performing sonographic surveillance is better than regular testicular self - examination in adult patients with classic tm and the absence of any known testicular tumor . in this setting ," ], [] ]

[ [ "administration of intrathecal chemotherapy is generally reserved for patients with leptomeningeal disease and positivity on cerebrospinal fluid ( csf ) testing , although large retrospective series have been equivocal on this topic.22 \n 23 \n", "surgical resection of cns lymphoma is generally a last resort and only offered in cases when the lesion is causing extreme mass effect and herniation syndromes .", "unfortunately , the standard chemotherapy regimens used in the treatment of systemic lymphomas have shown only little effect in prophylaxis or direct treatment of cns lymphomas.9 these drugs ( anthracyclines , vinca alkaloids , and some alkylating agents ) have poor blood brain penetration , and their toxicity profiles limit the dose at which they can be delivered to overcome this .", "methotrexate and cytarabine , in contrast , have poor blood brain barrier penetration but can be delivered at sufficient concentrations to overcome this and provide adequate concentration to the cns.10 initial studies showed improved overall survival from treatment with high - dose methotrexate and radiation at time of diagnosis , with response rates of up to 80 to 90% and 5-year median survival times in primary cns lymphoma.11 subsequent studies comparing high - dose methotrexate alone and combination high - dose methotrexate and radiation failed to prove robust survival benefit with combination therapy , especially in patients > 60 years of age , a growing segment of the disease.11 \n 12 \n 13 \n in addition , responses to radiation treatment have been found to be short lived and have failed to increase overall survival.14 the role of radiation therapy for cns lymphoma has shifted from initial treatment to salvage therapy over the past several decades.9 \n 15 treatment paradigms established for primary cns lymphoma have been used in the treatment of scnsl ; however , the failure rate remains high , with overall survival typically on the order of 2 months.16 \n more recently , more aggressive regimens have been suggested ." ], [ "administration of intrathecal chemotherapy is generally reserved for patients with leptomeningeal disease and positivity on cerebrospinal fluid ( csf ) testing , although large retrospective series have been equivocal on this topic.22 \n 23 \n", "surgical resection of cns lymphoma is generally a last resort and only offered in cases when the lesion is causing extreme mass effect and herniation syndromes .", "once the diagnosis has been established , treatment options for cns lymphoma can be broadly divided into chemotherapy , radiation , and surgery .", "unfortunately , the standard chemotherapy regimens used in the treatment of systemic lymphomas have shown only little effect in prophylaxis or direct treatment of cns lymphomas.9 these drugs ( anthracyclines , vinca alkaloids , and some alkylating agents ) have poor blood brain penetration , and their toxicity profiles limit the dose at which they can be delivered to overcome this .", "methotrexate and cytarabine , in contrast , have poor blood brain barrier penetration but can be delivered at sufficient concentrations to overcome this and provide adequate concentration to the cns.10 initial studies showed improved overall survival from treatment with high - dose methotrexate and radiation at time of diagnosis , with response rates of up to 80 to 90% and 5-year median survival times in primary cns lymphoma.11 subsequent studies comparing high - dose methotrexate alone and combination high - dose methotrexate and radiation failed to prove robust survival benefit with combination therapy , especially in patients > 60 years of age , a growing segment of the disease.11 \n 12 \n 13 \n in addition , responses to radiation treatment have been found to be short lived and have failed to increase overall survival.14 the role of radiation therapy for cns lymphoma has shifted from initial treatment to salvage therapy over the past several decades.9 \n 15 treatment paradigms established for primary cns lymphoma have been used in the treatment of scnsl ; however , the failure rate remains high , with overall survival typically on the order of 2 months.16 \n more recently , more aggressive regimens have been suggested ." ], [ "the results of the biopsy were consistent with b cell lymphoma . following the biopsy confirmation ,", "upon arrival to our institution , the patient was found to have diabetes insipidus . with a known history of systemic lymphoma ,", "the patient was taken for a right fronto - orbital craniotomy and translaminar terminalis approach for biopsy of the lesion ( fig .", "the patient was subsequently scheduled for a ct - guided biopsy of the supraclavicular lesion .", "this would place the patient at a low risk for developing a secondary cns lymphoma relapse.8 \n 24 \n approximately 7 months posttreatment , the patient was hospitalized at an outside medical center following a 1-week period of worsening mental status . on admission , the patient was found to have elevated serum sodium levels in the 160s , and further work - up revealed a suprasellar mass on head ct ( fig .", "a 36-year - old man presented to his primary care physician with complaint of a soft nontender mass on the left side of his neck ." ], [ "the classification of mediastinal dlbcl may have elevated the patient 's risk of progression to scnsl ; however , his lack of other indicative risk factors made this an uncommon occurrence in an already uncommon condition . despite the unusual presentation in this case ( panhypopituitarism )", ", the patient did have an isolated cns relapse within 6 months , and the mental status change resolved in response to mtx treatment .", "treatment and cns prophylaxis after the discovery of primary lymphoma is an area of active investigation .", "the age of diagnosis of both primary and secondary cns lymphoma has been steadily increasing , focusing more studies on treatment of an elderly population.31 \n 32 \n 33 \n 34 \n 35 \n as previously mentioned , the histologic grade of the primary lymphoma differentially influences the risk of developing scnsl . depending on whether the primary lymphoma is classified as indolent , aggressive , or highly aggressive ,", "this is partially due to the retrospective nature of the studies to date and the variance in treatment regimens among the different studies . also , the histopathology of the primary lymphoma is a determining factor in the efficacy of treatment ." ], [ "isolated scnsl is a rare disease in which standardized treatment guidelines have yet to be developed .", "this case is one particular example where a patient designated as low risk for developing scnsl did progress to an isolated occurrence of the disease .", "additionally , although treatment extended the patient 's survival time and resolved the change in mental status , the disease continued to progress and the patient succumbed to his illness ." ] ]

[ [ "we have applied a previously developed method for quantitative determination of the absolute levels of psh , psox , and pssg on all cellular proteins ( including membrane proteins ) in cultured mammalian cells , and combined these data with quantifications of gsh and gssg in the same cells . in this way", ", we have obtained a picture of the global changes in cellular thiol - disulfide redox status during differentiation of the resting b cell into an antibody - secreting plasma cell .", "we set out to investigate how this enormous load on the secretory machinery affects the global thiol - disulfide environment of the b cell .", "the cellular thiol - disulfide redox environment is defined by protein thiols ( psh ) and disulfides ( psox ) as well as low molecular weight thiols and disulfides . in mammalian cells ," ], [ ", we can quantitatively determine the cellular levels of total sulfhydryl equivalents in low molecular mass thiols and in protein .", "accordingly , the mean value of data obtained for each of the redox species during the four days was calculated , and the relative distributions of the different protein and glutathione sulfhydryl equivalents are given in table 1 . from these data , we concluded that the vast majority of cellular sulfhydryl equivalents exists in the reduced thiol form with only 5% and 9% of the ps and gs equivalents engaged in disulfide bond formation , respectively .", "thus , all the following data will be shown as sulfhydryl per amino acid ( sh / aa ) . as a model for b cell differentiation , we used a previously established system based on the murine b cell lymphoma 1.29 which can be induced by lipopolysaccharide ( lps ) to secrete igm [ 13 , 19 ] . to obtain a well - defined reference point for the differentiation of b cells into plasma cells", "the tca pellets were solubilized by sonicating in appropriate buffers with high concentrations of sds or urea to quantify the different sulfhydryl species in all cellular proteins including membrane proteins .", ", we quantified the thiol - disulfide status in uninduced b cells to obtain a reference point for differentiation into plasma cells ." ], [ "this study , for the first time , provides a quantitative overview of the cellular thiol - disulfide status during differentiation of resting b cells into antibody - secreting plasma cells .", "the transformation of resting b cells into antibody - secreting plasma cells involves an extensive expansion of the er and both er resident proteins and proteins involved in redox balance are up - regulated linearly during differentiation . how cells cope with this sudden increase in secretory activity has been the subject of numerous studies [ 22 , 23 ] .", ", we have for the first time characterized the changes in thiol - disulfide state during differentiation of b cells .", "the changes in glutathione redox state were caused by a general depletion of gs equivalents from differentiating b cells . ", "the extremely reducing glutathione redox potential of the cytosol , the vast majority of pssg is expected to be found in the oxidizing compartments of the cell . in a study of liver microsomes ," ], [ "for quantification of secreted glutathione , proteins in media from harvested cells were precipitated by the addition of tca to 10% ( v / w ) and incubated on ice for 30 minutes followed by centrifugation .", "thiol and disulfide species in tca supernatant and tca pellet fractions were quantified as described in .", "prior to quantification with 4-dps , bh was destroyed by the addition of hcl , as described in .", "disulfides were reduced with 2.1 mm thp ( calbiochem ) and thiols were derivatized by the addition of 6.4 mm sbd - f ( fluka ) for 1 hour at 60c . to compare samples , total protein content was determined by using a ninhydrin based assay . an hplc assay based on thiol derivatization with n-(1-pyrenyl)maleimides ( fluka ) was used to quantify gssg and total gs ( gsh + gssg ) from the supernatant as described in .", "the tca pellet , used for protein thiol quantification , was washed in 10% tca by four cycles of sonication and centrifugation . before the final centrifugation step , the suspension" ] ]

[ [ "cutaneous horn ( synonyms ; cornu cutaneum : cornu humanum ) is a conical , hyperkeratotic protrusion that often resembles an animal horn .", "the earliest documented case of cutaneous horn , or cornu cutaneum , was that of an elderly welsh woman in london who was displayed commercially as an anomaly of nature in 1588 .", "the term cutaneous horn is a morphologic designation referring to unusually cohesive keratinized material and not a true pathologic diagnosis .", "cutaneous horns have been a subject of curiosities and controversies . in the late eighteenth century , the london surgeons everard home and his brother - in - law john hunter are generally credited with the characterization of cutaneous horns as a medical disorder . though cutaneous horn has been described at various sites , horn over the penis is very rare and represents the most unusual site .", "the first case report of a penile horn was published as early as 1854 . since" ], [ "cutaneous horn occurs mainly in individuals who are above 50 years of age and penile horns are no exception to this rule .", "they are common in males after 50 years and probably coincide with the age group of occurrence of penile cancer . to this date", "lowe and mc cullogh reported that penile horn may be benign in 4256% of cases , premalignant in 2237% or frankly malignant in 2022% ." ], [ "cutaneous horn is a morphologic designation for a protuberant mass of keratin produced by unusual cohesiveness of keratinized material .", "pseudoepitheliomatous , keratotic and micaceous balanitis is another rare disease , which has been found to be associated with penile horn .", "the progression of cutaneous horn to malignancy though has been reported probably represents the manifestation of underlying tumor .", "similarly , verrucous carcinoma is another tumor which has been found to be associated with penile horn .", "causes of penile horn the role of human papillomavirus ( hpv ) in penile carcinoma is well studied ." ], [ "traumatic breakage of the horn is rare and can occur due to the projectile nature of the growth .", "penile horns present as elongated , keratinous , white or yellowish projections that range from a few millimeters to centimeters in size arising from the glans penis [ figures 1 and 2 ] ." ], [ "cutaneous horn can be classified as benign , premalignant and malignant based on the origin .", "the histopathology of the cause is diagnostic in most cases . from the histopathological point of view", "they have their starting - point in the rete mucosum , either from that lying above the papilla or that lining the follicles and glands .", "it consists of closely agglutinated epidermic cells , forming small columns or rods . in the columns" ], [ "approximately one - third of penile cutaneous horns are associated with an underlying malignancy , and so magnetic resonance imaging is helpful when there is uncertainty regarding the depth of infiltration or proximal extension .", "though histopathology is diagnostic certain other investigations are required particularly in patients with underlying malignancy ." ], [ "as kaposi noted more than a century ago , cutaneous horns can be removed by simple detachment and cauterization of the papillary base .", "hence , it is justifiable to perform a local surgical excision for the histopathological diagnosis of its base .", "stage one is establishing the diagnosis and next stage is a definitive treatment based on the histopathology . penile horn can hide either benign or malignant lesions .", "therefore , what is really important is not the cutaneous horn itself , but the subjacent disease .", "a wide local surgical excision is performed on the lesion in case of suspected malignancy to obtain the histopathological diagnosis .", "if the biopsy reveals squamous cell carcinoma , the treatment of choice is partial or complete penectomy with urethral diversion and perineal urethrostomy ." ], [ "the penile horn continues to fascinate the dermatologists and surgeons alike because of the morphological appearance and presentation .", "the penile horn is only a morphological entity and the true pathology masked by it ." ] ]

[ [ "high turnover affects the institution 's ability to consistently provide high - quality care and increases institutional costs related to the recruitment , orientation , and lower productivity of newly hired staff .", "the turnover rate ( employee separations ) of healthcare workers has created a cycle of exhaustion and discontent ." ], [ "the variables include pre and post training scores on the personal and organizational quality assessment questionnaire ( poqa - r ) , scores on the independently administered oums annual employee engagement survey , and separations from oums as reported by the human resources department as turnover rates .", "we will use a 5-year longitudinal design with repeated measures to examine the effect of diffusion of the heartmath healthcare program revitalizing care techniques within oums .", "the training sessions included a 5-hour presentation with a 2-hour follow - up program provided 2 or more weeks later .", "participants received an emwave2 training reinforcement device to use during the time period between the first training and the follow - up training .", "data from the emwave2 will provide personal reinforcement to the user and will not be collected or analyzed by the investigators .", "this is an oklahoma university medical system ( oums ) performance improvement educational intervention study ." ], [ "the most significant measured result noted after training 90% of the nursing leadership , vice presidents , directors , and managers and 93% of the oncology staff was the continued decline of the turnover rate to < 14% for the overall oncology oums service line within the first year of the program being instituted .", "this was an improvement from a 2009 high of 73% for one of the oncology service lines with a 34% at the time of training , when newly hired people were beginning to leave again , plateauing and even increasing the rate at that time .", "engagement scores for the oncology unit improved from the previous year , and the poqa scores for both the leadership group and the oncology group showed many significant improvements during the time of measurement ." ] ]

[ [ "we report our clinical experiences using the ascending aorta and aortic arch replacement with perfusion via the brachial and femoral arteries under moderate hypothermia .", "we tried to use antegrade and retrograde perfusion at the same time , with the aim of avoiding the fatal problems of either method alone .", "reported that cannulation via the brachial artery , instead of the axillary artery , could be useful for a good operative field , a short operation time , and brain protection .", "antegrade perfusion via the axillary artery shows better results than retrograde perfusion via the femoral artery ; nevertheless , both of them have benefits and drawbacks .", "whenever lesions in the ascending aorta and aortic arch have from direct aortic cannulation , arterial cannulation via the femoral artery has been used for a long time . however , because retrograde aortic dissection and nonperfusion into the true lumen are possible , the technique of selective antegrade perfusion under deep hypothermia using the axillary artery has become a standard perfusion method .", "the benefits of using selective perfusion under moderate hypothermia for brain protection have been reported in recent years ." ], [ "we reviewed 36 patients who had been operated using a perfusion method via the right brachial and femoral artery under moderate hypothermia .", "forty - six consecutive patients underwent replacements of the ascending aorta and aortic arch between july 2005 and may 2010 .", "we anastomosed the aortic arch vessels , including the innominate artery , to the side of the prosthetic graft in the shape of an island simultaneously or to the prosthetic graft with 4 branches ( intergard , maquet gmbh & co. , germany ) in an end - to - end manner , according to the range of the lesions . after finishing the anastomoses of the aortic arch", ", we anastomosed a 10-mm sized prosthetic graft to the side of the prosthetic graft in an end - to - side manner and used it as an arterial perfusion line .", "we analyzed the preoperative diagnoses , operations , cardiopulmonary bypass time , selective antegrade cerebral perfusion time under circulatory arrest , lowest core temperature , operation mortality rate , and neurologic deficits by retrospectively reviewing the medical records ." ], [ "there were no complications related to the cannulation of the right brachial artery in the axillary area . in 3 cases ,", "we performed ascending aorta replacement in 9 cases ( 25% ) , ascending aorta and hemiarch replacement in 13 cases ( 36% ) , ascending aorta and total arch replacement in 13 cases ( 36% ) , and total aortic arch replacement in 1 case ( 3% ) .", "the mean age of the patients was 61.9 years ( 29 to 79 years ) , and 19 were male and 17 were female .", "the preoperative diagnoses were acute type a aortic dissection in 31 ( 86% ) patients , and aortic aneurysm without dissection in 5 ( 14% ) patients .", "other complications were one case of reoperation due to bleeding , one case of mediastinitis and one case of vocal cord palsy ." ], [ "perfusion techniques for protecting the brain during surgeries of the ascending aorta and aortic arch have been controversial for a long time , but are constantly being developed .", "the complementary addition of retrograde cerebral perfusion has produced better operation results . though this technique continues to be used widely ,", "we therefore tried to perform antegrade and retrograde perfusion simultaneously , in order to provide against the fatal shortcomings of each approach .", "the mortality rate ( 13.8% ) was also higher than in previous studies , resulting from a higher rate of acute aortic dissection in our study group . even though methods of brain protection for ascending aorta and aortic arch operations are continuously progressing , there is still much debate about which sites are good to cannulate for arterial access , and to what degree it would be effective and safe to lower temperatures .", "for this reason , surgeries using antegrade perfusion techniques started to be reported , demonstrating good operative results . recently , selective antegrade cerebral perfusion using the axillary artery became a standard perfusion technique for performing ascending aorta and aortic arch operations [ 1,13 - 15 ] ." ], [ "using the right brachial and the femoral arteries as routes for arterial access under moderate hypothermia showed satisfactory results when there were lesions which made direct cannulation into the ascending aorta difficult during ascending aorta and aortic arch replacements .", "further studies are needed for to improve bilateral cerebral perfusion for more complete brain protection ." ] ]

[ [ "this in vitro study is focused on the toxic nature of a volatile smoke component - acrolein on the proliferation and attachment of human gingival fibroblasts .", "risk assessment has become increasingly important in the prevention of chronic diseases and has recently been applied to oral diseases due to the realization that severe forms of the two most prevalent dental diseases , i.e. , caries and periodontal disease are clustered in a minority of the population who are hypothesized at being at higher risk .", "cigarette smoking has long been associated with a variety of oral conditions including periodontal diseases .", "the risk revolution is one of the most significant advances that have occurred in medicine over the past decades . in the current state of incomplete knowledge of most human diseases ,", "consequently , a new paradigm emerging to control dental disease involves identification and targeting high risk individuals and intercepting the disease process .", "experimental data suggests that acrolein is detrimental to human gingival fibroblasts ( hgf ) survival and consequently to the oral connective tissue ." ], [ "human gingival fibroblasts between 3 to 6 passages were grown to confluency . for the attachment assay , the cell cultures seeded in a 96 well microtitration plates at a density of 45,000 cells / well .", "untreated cell cultures , obtained from the same biopsies as the test fibroblast cells , were utilized as the control group and the acrolein treated cells were considered as the study group .", "human gingival fibroblasts were seeded in 96 well microtitration plates at a density of 10,000 cells / dish in dmem with 10% fcs .", "the attached cells at each of the different concentrations of acrolein were removed with 0.25% trypsin and evaluated by a neubauer hemocytometer .", "human gingival fibroblasts ( hgf ) strains from healthy subjects with non - inflamed gingiva which did not bleed on probing were utilized .", "a total of 5 squares were counted and the concentration of human gingival fibroblast was evaluated using the formula c = n10/5 for 1 ml of suspension . in the present study , geometric mean and standard deviation were estimated for each study group after log transformation .", "human gingival fibroblasts were seeded in 96 well microtitration plate at a density of 45,000 cells / well in dmem containing 10% fcs ." ], [ "( a ) procuring gingival connective tissue ; ( b ) human gingival fibroblast in a mono layer ; ( c ) human gingival fibroblasts - acrolein treated ( 1:100000 molar ) ; ( d ) human gingival fibroblasts - acrolein treated(1:10000 molar )", "a conventional method was preferred over punch biopsy to delineate the epithelium from the underlying connective tissue .", "a split thickness flap was raised at the donor site using bard parker no-15 and careful dissection was carried out [ figure 1a ] .", "the biopsy tissue was collected in the sterile test tube containing dulbecco 's modified eagle 's medium ( dmem ) and transported to the laboratory ." ], [ "the tvg was discarded , and the cells resuspended in dmem containing 10% fetal calf serum ( fcs ) , and were then seeded into 25 cm tissue culture flask and incubated at 37c in an atmosphere of 5% co2 . the confluent layer of cells obtained was designated as first passage cells .", "trypsin - versene - glucose ( tvg ) solution containing 0.25% trypsin was added and incubated at 37c for 2 hours .", "after 3 washes in dmem supplemented with gentamycin , the tissues were minced into small pieces plated in petri dishes ." ], [ "about 24 wells seeded with 45,000 cells per well formed the sample group wherein three groups of 8 wells were treated with 10 , 310 and 10 m acrolein respectively in an atmosphere of 5% co2 and at a temperature of 37c .", "untreated cell cultures , obtained from the same biopsies as the test fibroblast cells , were utilized as the control group and the acrolein treated cells were considered as the study group .", "human gingival fibroblasts were seeded in 96 well microtitration plate at a density of 45,000 cells / well in dmem containing 10% fcs .", "the attached cells at each of the different concentrations of acrolein were removed with 0.25% trypsin and evaluated by a neubauer hemocytometer ." ], [ "human gingival fibroblasts were seeded in 96 well microtitration plates at a density of 10,000 cells / dish in dmem with 10% fcs .", "cells were incubated for 24 hours at a temperature of 37c in an atmosphere of 5% co2 to allow attachment to the plate .", "cell cultures were incubated in the presence of 10 310 , 10 , 310 and 10 concentrations of acrolein .", "culture wells were rinsed once to remove unattached cells and the culture medium was changed to fresh dmem with 10% fcs at 37c .", "the wells were trypsinized ( 0.25% ) to remove the cells and then counted using a hemocytometer ." ], [ "human gingival fibroblasts between 3 to 6 passages were grown to confluency . for the attachment assay , the cell cultures seeded in a 96 well microtitration plates at a density of 45,000 cells / well .", "the proliferation assay that was carried over a 5-day period incubated cells at concentrations of 10 ( c1 ) , 310 ( c2 ) , 10 - 5 ( c3 ) , 310 - 6 ( c4 ) , 10 - 6 ( c5 ) acrolein in an atmosphere of 5% co2 and at a temperature of 37c .", "a total of 5 squares were counted and the concentration of human gingival fibroblast was evaluated using the formula c = n10/5 for 1 ml of suspension . in the present study , geometric mean and standard deviation were estimated for each study group after log transformation .", "they were then incubated at concentrations of 10 ( c1 ) , 310 ( c2 ) , 10 ( c3 ) acrolein in an atmosphere of 5% c02 and at a temperature of 37c .", "the cells lying within this 1 mm area were counted and analyses was made using the formula c = n / v where c is the cell concentration ( cells / ml ) , n is the number of cells counted and v is the volume counted ( ml ) .", "the mean values were compared by one - way analysis of variance ( anova ) and further multiple range tests by tukey's- honestly significant difference ( hsd ) were employed to identify the significant groups at 5% level .", "the suspension was mixed thoroughly to disperse the cells and a small sample ( 20 l ) was collected into the tip of a pasteur pipette and transferred to the edge of the hemocytometer chamber ." ], [ "in contrast , the test group shows disruption of the fibroblast cytoskeleton leading to loss of shape and orientation . there is a dose dependent", "increase in vacuolisation and degeneration of the nucleus observed [ figure 1c and d ] .", "the present study , the human gingival fibroblast proliferation evaluated at five days indicated that the untreated cell cultures ( control group ) proliferated from 10,000 cells / well to an average of 29,697 cells / well [ table 4 , figure 2b ] . in the acrolein treated cell cultures ( study group ) , the proliferation ability decreases from 21,184 cells / well in the c5 ( 10 ) group to 10,154 in the c1 ( 10 ) group [ table 5 ] .", "further statistical evaluation indicates that : \n the mean value in the control group ( 29,697 ) is significantly higher than the mean values in the study group.the mean values of c5 ( 21,184 ) and c4 ( 20,068 ) are significantly higher than the mean values in c3 ( 16,691 ) , c2 ( 16,244 ) and c1 ( 10,154).further the mean values of c3 and c2 are significantly higher than c1 [ table 6 ] . thus a dose - dependent inhibition of proliferation is seen and at very high concentration ( 10 ) of acrolein a complete inhibition of proliferation is noted . \n ", "the number of cells attached / well decreased from a mean value of 29,930 in c3 group ( 10 - 5 ) to 20,505 in c1group ( 10 ) also the mean values in c3 ( 29,930 ) and c2 ( 27,441 ) were significantly higher compared to c1 ( 20,505 ) [ table 3 ] . in", "the human gingival fibroblast attachment evaluated at three hours indicated that acrolein caused a dose dependent inhibition of cell attachment [ table 1 ] . at low concentration of acrolein ( 10 - 5 )" ], [ "thus , maurizio s. tonetti stated that although no direct causative role of cigarette smoke on periodontal diseases has been proven , a connection is considered to be plausible .", "experimental evidence accumulated over the last two decades has indicated that cigarette smoking is a true risk factor for periodontitis .", ", many clinical and epidemiological studies have indicated that cigarette smoking significantly increases the risk factor for periodontal disease , especially in younger people .", "this has led to the current understanding that periodontitis is a multifactorial disease whose clinical manifestations are the result of specific interactions between particular genetic susceptibility traits and environmental factors .", "the current list of risk indicators and putative risk factors is being shaped by ongoing research efforts , and multiple attributes and exposures have been associated with increased odds of periodontitis .", "tonetti has indicated that this environmental exposure has been associated with 2 - 3 fold increase in the odds of developing clinically detectable periodontitis ." ], [ "this study confirms the hypothesis that cigarette smoke is a significant risk factor in the development and progression of periodontal disease and impairs the ability of gingival fibroblasts to maintain the integrity of the periodontal connective tissue ." ] ]

[ [ "this paper describes the development of a paediatric analgesia and sedation protocol , tailored to the specific setting of the medical research council ( mrc ) paediatric ward in the gambia , west africa .", "however , it is important to note , that an iterative process was employed beginning with a recognized need to improve pain management expressed by local clinical staff , and with feedback from local providers sought and incorporated throughout the development process .", "given the current state of knowledge in this area , and the wide variety of options now available for managing paediatric pain , many of these barriers can be overcome through adaptation of published guidelines to address the unique needs and barriers of specific health care settings .", "\n\t\t\t\t despite significant advances in our understanding of paediatric pain and the publication of pain management guidelines by several leading paediatric bodies in recent years , multiple studies and reviews show that pain in children continues to be poorly managed . as maclean et al .", "given these findings are based on their review of pain management practices in a paediatric teaching hospital in a high income country , it is perhaps not surprising this gap is larger in low income countries where resources , in their broadest sense , are more constrained . some barriers to managing a child 's pain are common to a wide variety of health care settings , such as lack of provider training in the recognition , assessment and management of pain , and attitudes and beliefs regarding pain and its management .", "although a combined paediatric and adult protocol was ultimately developed , only the paediatric portion is reported here .", "for clarity of presentation , the protocol development process will be described in 3 steps ." ], [ "as noted above , protocol development began with an expressed desire for a pain management protocol tailored to the mrc paediatric ward , to facilitate efforts by clinical staff toward improving pain management .", "based on the findings of the first two stages of protocol development outlined above , a draft protocol was created and circulated to key local informants and an expert in paediatric pain management for feedback and amendment . perhaps not surprising considering the iterative nature of the development process , with the exception noted below , no major changes were suggested . at this stage", "as a first step , key local informants including the senior clinician of the hospital , the matron , and another senior nurse , were interviewed to gain a comprehensive understanding of the hospitals resources , current practices and staff level of training , medication availability , and cost implications .", "as most published guidelines were developed in and for high income health care settings , during the review process and again in consultation with key local informants a list of issues relevant to paediatric pain management on the mrc ward was identified .", "discussions with physician and nursing staff , revealed both had little training or experience in pain management . for this reason it was felt that a more directive and structured protocol , with a strong educational component to accompany roll out of the protocol was needed . the second step in development of the protocol began with a review of published paediatric analgesia and sedation guidelines , the evidence base for their development where possible , and consultation with experts in paediatric sedation and analgesia .", "two important considerations emerged from this consultation process , which were shortage of airway support capabilities and limited staff training in pain assessment and monitoring . to further assess the airway capabilities on the ward" ], [ "the purpose of creating protocols is greater than reducing practice variation , it also creates new paradigms and changes the culture in which health care is delivered , with the protocol itself designed to be transient , and the development process and the changes it produces , more important than the product itself .", "in addition to the final product , that is , the paediatric pain management protocol tailored to the mrc ward , other benefits were gained through the process of development . as a result of the equipment survey ,", "ongoing education of clinical staff , particularly early in the implementation process and as new staff are hired , is essential to ensure safe and appropriate pain management procedures .", "equally important is early evidence that through the educational and feedback sessions , further interest in improving patient care was fostered among clinical staff . as one physician reported ", "intermittent reassessment and revision based on experiences in using the protocol is needed to allow for adaptation as the needs of the patients served and the resources and options available change .", "however , to ensure successful implementation of the protocol and ongoing improvements in paediatric pain management , further steps are needed .", "i encountered a case today where i would normally not have considered pain management , but after the session the other day , i decided i better do something . as clemmer and spuhler ( 1998 ) have argued , ", "two airway kits were created and placed together with other basic resuscitation equipment into a strategic location within the unit for ready access ." ], [ "published guidelines based on best available evidence , can and should be adapted to allow for optimal pain management given the resources and capabilities of a given health care setting .", "it is hoped that the development process and protocol described here will not only help to improve care on the mrc ward , but serve as an example to others working toward improving pain management in similar health care settings .", "despite some progress in recent years , pain continues to be undertreated globally , particularly in children , and particularly in low income countries ." ] ]

[ [ ", we investigated whether rge protects against h. pylori - induced gastric inflammation in mongolian gerbils .", "korean red ginseng extract ( rge ) inhibits h. pylori - induced oxidative damage in gastric epithelial cells .", "previously we showed hepatoprotective effects of korean red ginseng in rats and mouse liver , which may be contributed by its antioxidant activity .", ", we determined : the changes in lpo level , which is an index of oxidative membrane damage ; the activity of mpo , a biomarker of neutrophil infiltration ; the induction of inflammatory mediator keratinocyte chemoattractant factor ( kc ) , an il-8 homolog in rodents ; il-1 ; inos ; and the phosphorylation of ib , which reflects the activation of nf-b .", "the mongolian gerbil model is the best animal model for this purpose because h. pylori infection induces chronic gastritis , gastric ulcers , and intestinal metaplasia in these animals ." ], [ "the number of viable h. pylori in the animal stomach was determined as previously described .", "this level of rge supplementation ( 200 mg rge / gerbil ) was adapted from previous studies showing the protective effect of rge against oxidative stress - mediated epithelial damage .", "the homogenates were used for determining lpo level , mpo activity , and protein levels of kc , inos , phospho - specific ib and ib. for mrna level of kc , il-1 , and inos , total rna was isolated from a gastric mucosal sample by the guanidine thiocyanate extraction method .", "kc and inos mrna levels were reported relative to those of animals not inoculated with h. pylori that were fed the control diet .", "gerbils that were inoculated with h. pylori were fed the control diet ain76a and considered as a positive h. pylori control .", "as a negative control , mongolian gerbils that were not inoculated with h. pylori were fed the control diet ain76a .", "rge supplementation had no effect on any of these parameters in animals not infected with h. pylori , determined in our preliminary study ." ], [ "this suggests that rge supplementation may inhibit nf-b activation by suppressing phosphorylation of ib in the gastric mucosal tissues of h. pylori - infected mongolian gerbils .", "rge supplementation suppressed the h. pylori - induced increase in the lpo level of gastric mucosal tissues . to investigate the inhibitory effects of rge against h. pylori - induced inflammation , the expression levels of important inflammatory mediators ( kc , il-1 , inos )", "rge supplementation inhibited h. pylori - induced neutrophil infiltration in the gastric mucosal lesions of mongolian gerbils .", ". h. pylori - induced chronic inflammation was reduced by rge treatment . however , none of these differences between h. pylori - infected animals that were supplemented with rge and those that were fed the control diet were significant . taken together , rge improved the histological grade of pmn infiltration , intestinal metaplasia , and hyperplasia in mongolian gerbils , which suggests that rge has an anti - inflammatory effect against h. pylori - induced gastric inflammation ." ], [ "the present study demonstrates that dietary supplementation of rge fed to mongolian gerbils for 6 wk improves h. pylori - induced gastric lesions , as determined by histological observation .", ", rge supplementation inhibits neutrophil infiltration and lipid peroxidation , determined by mpo activity and lpo level , and attenuates the induction of inflammatory mediators ( kc , il-1 , inos ) , which results in suppression of h. pylori - induced gastric inflammation in mongolian gerbils .", "rge moderated the h. pylori - induced increase in neutrophil infiltration , mpo activity , lpo level , and the expression of inflammatory mediators ( kc , il-1 , inos ) .", "this demonstrates that rge has an anti - inflammatory effect on h. pylori - induced gastric inflammation in mongolian gerbils .", "therefore , rge may be beneficial for the prevention and treatment of h. pylori - associated gastric inflammation .", "rge was also associated with a reduction in i phosphorylation relative to that measured in animals fed the control diet ." ], [] ]

[ [ "we highlight recent findings that indicate the relevance of the cell wall in the interaction with the host immune cells and how this process is essential to prime and develop a protective immune response ( romani , 2004 ) and contributes significantly to the control and pathology of the infection ( casadevall and pirofski , 1999 ; casadevall and pirofski , 2001 ) .", "we aim to summarize here the structural and functional aspects of the cell wall in fungal pathogens .", "while several virulence traits have been identified in many fungal species , the cell wall is still the most promising target in drug discovery for different reasons .", "while the biology ( life cycle , metabolism and morphogenesis ) of all these fungal species greatly differ , they also share certain common features that enable a successful colonization of the human host and are able to counteract its defence mechanisms .", "the identification of novel therapeutic approaches to fight against disease is therefore of primary importance in basic research ." ], [ "the cell wall is an essential structure that maintains the viability of fungal cells , conferring their typical morphology and protecting the cell against external injuries . as the most external cellular structure of pathogenic microorganisms", "the cell wall is the structure sensed by the host immune cells . as a consequence ,", "it participates in triggering and orchestrating the whole innate and adaptive immune response against the microorganism .", "gxm is also released from the capsule and accumulates in tissues during infection , blocking effective immune responses and contributing to the pathology of the disease ( vecchiarelli , 2000 ) ." ], [ "we will summarize how this process occurs in the different fungal species with special emphasis in the model fungal pathogen c. albicans .", "different prrs recognize different pamps and contribute in this way to the generation of a balanced response against microorganisms ( underhill , 2003b ) ( fig . 2 ) .", "recognition of pathogens by the innate immunity requires the identification of pathogenassociated molecular patterns ( pamps ) .", "phagocytes are essential components of the innate system in the control of the fungal infection as they contribute to eliminate the microbe ." ], [ "the major component of cryptococcal capsule , gxm , is shed from the fungus and circulates in the blood and cerebrospinal fluid of patients with cryptococcosis .", "gxm binding to macrophage receptors triggers activation of nuclear factorkb ( nfb ) , but not mitogenactivated protein kinases ( mapk ) .", "dendritic cells are also able to stimulate mannoproteinspecific t cells , suggesting that dcs provide a crucial link between innate and adaptive immune responses to c. neoformans via a process that is dependent upon the efficient uptake of mannoprotein by mrs ( mansour et al . , 2006 ) . however , in the presence of macrophages , binding of encapsulated c. neoformans is minimal in absence of opsonins .", "dendritic cells pulsed with the yeast forms were able to generate an antifungal protective immunity , indicating that dcs can sense and differentiate between both morphologies and types of response that can lead to eradication of the microbe or acquisition of a commensalism state ( d'ostiani et al .", "however , a recent work indicates that the lectin pathway of complement activation in human neutrophils is important for the opsonophagocytosis of yeasts but not of bacteria ( brouwer et al . , 2008 ) ." ], [ "as stated before , the skeletal component of the cell wall of the majority of fungal pathogens is based on a core structure of 1,3 glucan covalently linked to 1,6 glucan and chitin .", "recent evidences suggest that the inflammatory response triggered by alveolar macrophages is different depending on the morphological stage and glucan exposure of the fungal cells recognized . in this sense ,", "in addition , tlr2 plays an accessory role with dectin1 in mediating the alveolar macrophage inflammatory response to live fungal cells .", "it is generally accepted that these skeletal components of the cell wall are found close to the cell membrane in an inner layer ; however , some chitin and glucan can be present throughout the thickness of the whole wall ." ], [ "the identification of the key components of such interplay at the molecular level ( signals , mechanisms and responses ) will have important consequences in the future and will surely allow better approaches to treat fungal infections .", "recognition of the different morphologies associated with fungi promises to be an attractive area for future research as they are important evasion mechanisms . in this sense , it is important to note the differential exposure of several structures of the cell wall ( such as glucan ) , depending on the fungal morphology with mannans and glycans acting as shields that may mask immune responses .", "may therefore provide essential information in order to develop novel antifungal therapies and a challenge for basic research .", "no studies have investigated the possible role of rna recognition systems ( that is , tlr3 , tlr7 and tlr8 ) in the host response to c. albicans infection .", "little is known about the recognition pathways of chitin , its role during c. albicans infections and recognition receptors . on the other hand ," ], [ "the identification of the key components of such interplay at the molecular level ( signals , mechanisms and responses ) will have important consequences in the future and will surely allow better approaches to treat fungal infections .", "it is clear that the pathogen host interaction results in a bidirectional talk , where both the microorganism and the host cells are in a permanent dialogue , influencing each other 's behaviour .", "may therefore provide essential information in order to develop novel antifungal therapies and a challenge for basic research .", "recognition of the different morphologies associated with fungi promises to be an attractive area for future research as they are important evasion mechanisms . in this sense", "although the surface structures being recognized by the host cells are beginning to be determined precisely , much more work is needed to understand the interaction of fungal pamps with their receptors on the host cell membrane .", ", it is important to note the differential exposure of several structures of the cell wall ( such as glucan ) , depending on the fungal morphology with mannans and glycans acting as shields that may mask immune responses .", "although both mannans and glucans can induce proinflamatory signals , the parallel stimulation of the mannan and glucan recognition pathways has a synergistic effect on the amplification of the immune response .", "for example , little is known about the recognition of components of the fungal cell wall like chitin , surface proteins or products that are secreted by fungal cells ." ] ]

[ [ "this paper discusses findings from various animal models that reveal the role of ps and fad - linked ps mutations in synapse formation and function .", "mutations in psen1 and psen2 genes , which encode polytopic proteins termed presenilin 1 ( ps1 ) and presenilin 2 ( ps2 ) , respectively , cause autosomal dominant early - onset familial alzheimer 's disease ( fad ) .", "thus , ps - dependent activation of notch signaling is essential for early development . transgenic expression of fad - linked mutant ps1 fully rescues the developmental phenotypes in mice with psen1 deficiency [ 16 , 17 ] , supporting the notion that fad - linked ps1 variants are functional , but acquired deleterious properties that have profound pathophysiological consequences .", "fad - linked ps variants enhance the production of highly fibrillogenic a42 peptides that are deposited early in the brains of patients with ad ." ], [ "several mouse models ( reviewed in ; see http://www.alzforum.org/res/com/tra/ ) and a few rat models [ 4750 ] have been developed in order to recapitulate the main pathological features of ad and elucidate the mechanisms by which fad - linked ps mutations contribute to ad pathogenesis . a variety of mouse models have been characterized such as mice expressing fad - linked ps variants harboring point mutations or deletion mutation [ 51 , 52 ] , and fad - linked psen1 knock - in ( ki ) [ m146v variant , i213 t variant and p264l variant ] , and e10 loop deletion ki .", "in addition , several groups have generated drosophila models ( reviewed in ) , and caenorhabditis elegans models ( reviewed in ) expressing human ps1 or ps2 bearing fad - linked mutations , in an effort to understand mechanistic contribution of ps to ad pathology and neuronal dysfunction .", "these fad - ps1 single transgenic or ki mouse models do not exhibit significant a deposition in the brain .", "therefore , the phenotypes described in these fad - ps1 single transgenic mice are not due to classical a pathology . in an attempt to reproduce more closely the human ad pathology , psen1 ki coexpressing app ", "ko models of psen1 and psen2 [ 610 ] , psen1 conditional ko [ 5860 ] , as well as double psen1 and psen2 conditional ko mice have also been created . in order to examine amyloid pathology , transgenic mice expressing app mutants in a ps null background", "have been developed ; such as psen1 conditional ko coexpressing app v717i variant and app v717f variant . in these models ," ], [ "synaptic transmission and long - term potentiation ( ltp ) contribute to several forms of memory storage . using slice preparations from transgenic mice ,", "we and others have demonstrated that expression of fad - linked ps1 does not alter basal synaptic transmission , but leads to higher degree of ltp induction in the hippocampus ( [ 57 , 6569 ] reviewed in ) . however , one group has reported impairment of synaptic transmission associated with an increase of paired - pulse facilitation , an index of presynaptic release , in neurons of 6 month - old psen1 m146v ki mice .", "we have observed an increase of spontaneous miniature excitatory postsynaptic current in cortical neurons isolated from psen1 ko mice , while others have reported that expression of mutant ps1 in cultured hippocampal neurons depresses synaptic transmission by reducing the number of synapses .", "finally , it has also been speculated that ps - dependent modulation of signaling pathways that are important in development may contribute to the neurodegenerative process . taken together , studies from various laboratories suggest that ps is specifically involved in cellular component(s ) necessary for synaptic transmission and plasticity , and that fad - linked mutations in ps1 may disrupt the normal cascade of synaptic events .", "intriguingly , single psen1 conditional ko mice do not show major changes in brain plasticity , suggesting that expression of ps2 might be sufficient to overcome the 6080% loss of ps1 in the forebrain of these animals . " ], [ "a distinct feature of the nervous system is the intricate network of synaptic connections among neurons .", "the changes in the strength and efficacy of existing synapses , as well as remodeling of connectivity through the loss and gain of synapses in the neuronal network , are believed to be the basis of learning and memory in the brain .", "this morphological plasticity suggests that long - term memory might be encoded by alterations in spiny structures and associated synaptic contacts .", "although the molecular mechanisms that underlie these morphological changes are not completely understood , emerging evidence supports at least two important signaling pathways that have been linked to dendrite spine formation and ad etiology : ( 1 ) camp - dependent activation of pka has been shown to be critical for the maintenance of the late phase of ltp , and downstream phosphorylation of creb has been linked to formation of new spines ." ], [ "many of these substrates function as cell - adhesion molecules or cell surface receptors and are known for their diverse functions during development and are involved in axon guidance , neuronal outgrowth and synaptogenesis [ 103113 ] .", "raft - dependent mechanisms facilitate trafficking of receptors in and out of the synapse and regulate synapse function ( reviewed in ) .", "camp / pka signaling plays a critical role in regulating short and long - term synaptic physiology .", "lipid rafts are known to serve as membrane platforms that compartmentalize diverse receptor - mediated signaling .", "lipid rafts play an important role in the maintenance of synapses through dendritic spine formation and ampa receptor function ." ], [ "these results suggest that mutation in ps might alter synaptic behavior following recovery of stress conditions .", "however , these subtle ca - mediated alterations may have profound impact later on that can affect synaptic and cognitive functions in disease states .", "however , it has been shown that l - type ca channel may be involved after stress induction at the neuromuscular junction in drosophila larvae expressing fad - linked ps1 mutant . accordingly , in this model system , the level of synaptic plasticity and memory paradigm was normal following heat shock stimulation or endoplasmic reticulum stress , but reduced after 24 h of stimulation recovery .", "several studies have concluded that fad - linked ps mutant expression in transfected cells and cultured neurons is associated with enhanced ca release from endoplasmic reticulum store .", "besides a direct interaction of -secretase substrates with intracellular phosphorylation cascades , one of the key features of ps function is its role in intracellular ca homeostasis ( reviewed in [ 22 , 150 , 151 ] ) ." ], [ "the identification and characterization of -secretase substrates and the mechanistic details on the successive cleavage of substrates by the -secretase have enhanced our understanding of how partial loss - of - function associated with fad - linked ps mutations can in fact lead to a gain of activities with reference to intracellular signaling associated with certain substrates such as dcc , erbb4 , and epha4 . at least in some cases , lack of -secretase processing leads to profound changes in synaptic structure and functions as a consequence of sustained intracellular signaling by substrate ctfs .", "still , the major task is to establish whether or not altered signaling directly contributes to ad pathogenesis and/or ad - related synaptic dysfunction .", "as details begin to emerge on additional -secretase substrates , it will be possible to determine whether -secretase cleavage of neuronal receptors is indeed a regulatory step that modulates physiological signaling downstream of ligand binding and ectodomain shedding .", "however , it is becoming clear that fad - linked mutations in ps proteins affect diverse physiological processes in addition to promoting the production of highly fibrillogenic a42 peptides ." ] ]

[ [ "familial hypocalciuric hypercalcemia ( fhh ) is a heterogenic , autosomal dominantly inherited disorder characterized by hypercalcemia with ( relative ) hyperparathyroidism , and hypocalciuria 1 .", "we now report a family with fhh3 among whom two brothers had ptx performed due to suspected phpt with one of the brothers having a concomitant diagnosis of a neuroendocrine tumor ( net ) .", "classically , fhh is caused by inactivating mutations in the gene encoding the calciumsensing receptor ( casr ) on chromosome 3q13 , termed fhh type 1 ( fhh1 ) 2 , 3 , 4 ." ], [ "the hyperplasia in one gland was characterized by dense fibrosis with hyperplasia of both chief and oxyphil cells and loss of lipid cells . in the other glands ,", "the histopathological analysis of the glands from the index patients showed one gland with a focus of hyperplasia , two glands with diffuse hyperplasia , and an intrathyroidal process diagnosed as a parathyroid adenoma .", "biochemical testing and scans of the pituitary gland and the pancreas showed no signs of additional tumors . due to the patients young age and the clinical suspicion of a men1 syndrome ,", "the hyperparathyroid hypercalcemia was considered as a state of phpt and he was referred to ptx . prior to surgery , neck ultrasound suggested an enlarged parathyroid gland on the right inferior side of the thyroid gland , but a parathyroid scintigraphy ( pertechnetate/99mtcmibi ) did not support the finding .", "( c ) intrathyroid parathyroid adenoma characterized by uniform waterclear cells , a solid growth pattern , and with no lipid cells .", "the cooccurrence of hyperparathyroid hypercalcemia and a net leads to suspicion of a multiple endocrine neoplasia ( men ) syndrome , but additional genetic tests did not reveal mutations in cdc73 , ret , protooncogene , or men1 .", "histological pictures of the parathyroid glands from the index patient ( a c ) and his brother ( d ) ." ], [ "the histopathological analysis of the glands from the index patients showed one gland with a focus of hyperplasia , two glands with diffuse hyperplasia , and an intrathyroidal process diagnosed as a parathyroid adenoma .", "the hyperplasia in one gland was characterized by dense fibrosis with hyperplasia of both chief and oxyphil cells and loss of lipid cells . in the other glands , hyperplasia was also present and characterized by loss of lipid cells and increased amount of chief cells ." ], [ "our report calls for increased awareness of the presence of mutations in other genes than the casr , which may cause fhh .", "secondly , our report supports the previously reported notion on some patients with fhh3 having symptomatic hypercalcemia . finally , to avoid unnecessary surgery and risk of postsurgical hypoparathyroidism ,", "the cooccurrence of a net and hyperparathyroid hypercalcemia in a relatively young patient leads to the suspicion of a men1 syndrome .", "however , further characteristics of fhh3 patients need to be performed in order to clarify whether fhh3 is indeed associated with a more severe course , as well as whether there is any correlation to neuroendocrine tumors . in conclusion , we have reported the first case with cooccurrence of fhh3 and a net in the distal ilium . although our index case was most likely a phenocopy , resembling an atypical men1like syndrome , we believe that further attention should be paid to whether fhh3 may be associated with other endocrine tumors . furthermore , our cases underline the importance of considering fhh3 in families with hyperparathyroid hypercalcemia , including patients with a clinical suspicion of men1 who are mutationnegative , as this may spare patients for the worry of being diagnosed with a cancer susceptibility syndrome and ptx ." ], [ "the authors declare that there is no conflict of interest regarding the publication of this manuscript ." ] ]

[ [ "pathblast a server for querying linear pathways within a protein protein interaction ( ppi ) network ( 1)was subsequently extended to allow searching for more general structures ( 2 ) .", "the torque server implements a novel method for querying protein networks that does not require information on the interconnections ( topology ) among the query proteins ( 7 ) ( figure 1 ) .", "it was tested extensively on hundreds of queries of known complexes from a variety of species ( 7 ) .", "it was shown to yield far more matches than the qnet topology - based approach ( 2 ) , while providing results that are highly functionally coherent . \n", "in a network querying problem , one is given a small network , corresponding to a known pathway or a complex of interest . the goal is to identify similar instances in a large network , where similarity is measured in terms of sequence or interaction patterns .", "( a ) the query proteins ; ( b ) the queried network . colored vertices in the network match nodes of the same color in the query ." ], [ "the input for torque consists of : \n a query set of proteins in species a;their protein sequences;a ppi network for species b;the sequences of the network proteins . \n ", "the torque web server implements the algorithms in ( 7 ) for querying protein sets across species .", "a query set of proteins in species a ; their protein sequences ; a ppi network for species b ; the sequences of the network proteins .", "all inputs are in simple text format : \n the query set can be entered directly as a comma - delimited or whitespace - delimited list.protein sequences are given in the standard fasta format.the ppi network is given as a text file , where each row represents an interaction and contains the ids of the interacting pair and a confidence value for it in the range [ 0 , 1 ] . \n ", "examining the subnetwork identified by torque we find that it is functionally coherent ( nucleotidyltransferase activity , p < 1.4e 10 ) and significantly intersects the yeast alpha dna polymerase : primase complex , supporting its biological plausibility .", "currently , the server supports this option for the three target species saccharomyces cerevisiae , drosophila melanogaster and homo sapiens .", "it combines three approaches : a dynamic programming method utilizing color coding , integer linear programming and a fast heuristic based on shortest paths ." ], [ "a query set of proteins in species a ; their protein sequences ; a ppi network for species b ; the sequences of the network proteins .", "the input for torque consists of : \n a query set of proteins in species a;their protein sequences;a ppi network for species b;the sequences of the network proteins . \n ", "all inputs are in simple text format : \n the query set can be entered directly as a comma - delimited or whitespace - delimited list.protein sequences are given in the standard fasta format.the ppi network is given as a text file , where each row represents an interaction and contains the ids of the interacting pair and a confidence value for it in the range [ 0 , 1 ] . \n ", "currently , the server supports this option for the three target species saccharomyces cerevisiae , drosophila melanogaster and homo sapiens .", "the query set can be entered directly as a comma - delimited or whitespace - delimited list .", "it is possible to use a single fasta file ( input 2 ) for many queries , if it contains the sequences for all proteins in all queries ." ], [ "if several queries are submitted to the server at the same time , they are queued and executed sequentially . rather than waiting for the results online , they can be accessed later , in two ways : \n when a torque job is started , it is assigned a nine - digit job i d .", "the running time of torque is typically a few minutes , but may be up to an hour , depending on the size and other properties of the query ( for more details , see ( 7 ) ) .", "this i d can be used to access the results later from the main torque page.before submitting a query , the user may enter an email address .", "once torque has finished processing the query , the results will be sent to the email address provided .", "once torque has finished processing the query , the results will be sent to the email address provided .", "this i d can be used to access the results later from the main torque page . before submitting a query" ], [ "the web server generates a web page ( figure 2 ) with the image of the top - scoring match for the query in the target network , as well as an auxiliary file in.sif format that can be viewed using the cytoscape software ( 4 ) .", "the content of the.sif file includes , for each edge , a numerical value representing the confidence in the interaction it represents , as provided in the input .", "each vertex is labeled with its protein name in the ppi network and its matching query protein , if such exists .", "insertion vertices are shown in gray , and proteins from the query for which there was no match in the solution ( deletions ) are listed separately . \n", "the image shows the subgraph induced by the top - scoring match in the ppi network ." ], [ "examining the subnetwork identified by torque we find that it is functionally coherent ( nucleotidyltransferase activity , p < 1.4e 10 ) and significantly intersects the yeast alpha dna polymerase : primase complex , supporting its biological plausibility .", "this 13-member complex was queried in the yeast network ( 5430 proteins , 39 936 interactions ) .", "the following example uses as query the mouse dna synthesome complex , downloaded from the corum website ( http://mips.gsf.de/genre/proj/corum/index.html ) ." ], [ "the result is a subnetwork of the target network most similar to the query , and is presented both graphically and as a downloadable text file .", "the torque web server allows users to run topology - free queries on predefined or user - provided target networks ." ], [ ") ; german - israel foundation grant ( to r.s . ) ; postdoctoral fellowship from the edmond j. safra bioinformatics program at tel aviv university ( to f.h . ) . funding for open access charge" ] ]

[ [ "we present a case of perforating cutaneous metastasis from breast cancer with mucin 1 ( muci ) expression .", "skin metastases from internal neoplasms are an uncommon clinical finding with an overall incidence of 5.3% and the most common cause is breast cancer with an incidence of 23.9%.1 in general , skin metastases of breast cancer affect the dermis and histologically appear as malignant ductal epithelial cells in sheets , cords , glands , or are arranged in a diffuse infiltrate.2 the finding of transepidermal elimination on cutaneous metastases is exceptional and has only been reported in a few cases.3,4 mehregan classified transepidermal elimination into three types , and the elimination of dermal tumor nests corresponds to type 3 which involves an active interaction between epidermis and dermal connective tissue.5 although transepidermal elimination is the histological feature of the classical perforating disorders , it is also described in other cutaneous conditions and in tumors such as melanocytic nevus,6 eccrine poroma,7 malignant melanoma,8 pilomatricoma,9 and metastatic carcinoma.3,4 in this report", "cutaneous metastases are defined as dermal or hypodermal neoplastic tissue that has no contiguity with the primary tumor ." ], [ "in february 2010 , a 48-year - old argentine woman had undergone tumorectomy in her left breast with diagnosis of an invasive ductal carcinoma with low nuclear and histological differentiation grades ; estrogen ( er ) and progesterone ( pr ) receptors were negative and her2/neu was positive . in september 2011 , a mastectomy with immediate breast reconstruction was performed due to local tumor recurrence and the patient received systemic chemotherapy . in march 2012", "muci expression was studied and a strong reaction was found with a mixed pattern at the plasma membrane and in the cytoplasm ( figure 2 ) .", "tumor cells in the papillary dermis appeared to penetrate through the epidermis , suggesting transepidermal elimination ." ], [ "et al4 published a case of perforating cutaneous metastasis from an ovarian carcinoma which showed malignant cells in the dermis and hypodermis with areas of transepidermal elimination without epidermotropism .", " carcinoma ( 3% ) , alopecia neoplastica ( 2% ) , and a zosteriform type ( 0.8%).12 a diagnosis of cutaneous metastases is based on the clinical manifestations and the histopathologic study of the lesions .", "cutaneous metastases from breast carcinoma usually appear months to years after the diagnosis and treatment of the primary malignancy.10,11 the most common localizations are in the chest wall and abdomen , but they can also be found in the scalp and extremities.10 the clinical presentations vary over a wide range of different patterns .", "immunohistochemical staining of the tumor cells was positive for muci , as we report in our case ." ] ]

[ [ "the aim of this study was to describe how these clinical findings are associated with a decrease in lung function during exacerbations .", "patients with copd or asthma frequently experience exacerbations of their illness . studies from norway and the uk", "we also wanted to find out whether the strength of these associations would be affected when they could be described in terms of change from stable state .", "other sources of information that could reflect increased bronchial obstruction could be the symptoms of the patient , as well as chest findings and assessment of oxygen saturation ( spo2 ) by pulse oximetry .", "there is firm evidence for a favorable effect of systemic corticosteroids,6 for copd exacerbations the evidence refers mainly to clinical trials in hospitalized patients.4 in copd guidelines , the criteria for starting such treatment are not clear cut , but it is often recommended when symptoms are not relieved after stepping up treatment with inhaled bronchodilators.8 benefit from systemic corticosteroid treatment has to be weighed against adverse effects , such as increased fragility of the bones and increased blood levels of glucose.4 improvement in lung function has been a main outcome measure in studies on the effects of systemic corticosteroids.9,10 this implies that the acute deterioration of lung function associated with the exacerbation is a main target for the systemic corticosteroids ." ], [ "patients aged 40 years or older registered in the electronic medical record with a diagnosis of asthma or copd ( or both ) in the previous 5 years were identified , and a random sample of 1,111 patients was invited to participate . of the 380 patients who met for baseline registration between april 2009 and march 2010 , 376 were considered to be in a stable phase of their disease and were included in the study . out of those , 210 were diagnosed with asthma by their gps , 74 with copd , and 92 with both asthma and copd.11 they were all asked to visit their gp within 23 days if they experienced exacerbations of their lung disease the following 12 months .", "this observational prospective study was carried out in seven general practice offices in the north and south of norway .", "respiratory symptoms the previous week and relevant quality of life items were examined using the norwegian translation of the clinical copd questionnaire ( ccq).12 in the ccq , the symptoms short of breath at rest , short of breath doing physical activities , coughing , and production of phlegm were classified into scores from 0 ( never ) to 6 ( almost all the time ) , and a mean score of respiratory symptoms was calculated .", "respiratory symptoms the previous 24 hours were also reported by the gps based on history taking on a pop - up questionnaire and shortness of breath , coughing , phlegm production , and wheezing were classified into three grades : 1 ) not present or as normal , 2 ) more bothersome than normal , and 3 ) very bothersome .", "the post - bronchodilator forced expiratory volume in 1 second ( fev1 ) and forced vital capacity ( fvc ) were used in the analyses ." ], [ "patients aged 40 years or older registered in the electronic medical record with a diagnosis of asthma or copd ( or both ) in the previous 5 years were identified , and a random sample of 1,111 patients was invited to participate . of the 380 patients who met for baseline registration between april 2009 and march 2010 , 376 were considered to be in a stable phase of their disease and were included in the study . out of those , 210 were diagnosed with asthma by their gps , 74 with copd , and 92 with both asthma and copd.11 they were all asked to visit their gp within 23 days if they experienced exacerbations of their lung disease the following 12 months .", "this observational prospective study was carried out in seven general practice offices in the north and south of norway .", "all participants gave written consent , and the study was approved by the regional committee for medical and health research ethics in north norway ." ], [ "respiratory symptoms the previous week and relevant quality of life items were examined using the norwegian translation of the clinical copd questionnaire ( ccq).12 in the ccq , the symptoms short of breath at rest , short of breath doing physical activities , coughing , and production of phlegm were classified into scores from 0 ( never ) to 6 ( almost all the time ) , and a mean score of respiratory symptoms was calculated .", "the ccq also contains questions on depression and concern about the disease getting worse with the same score system and four questions on activity limitation due to the illness , also with a score system from 0 ( not limited at all ) to 6 ( totally limited ) .", "smoking habit and hospitalizations due to the lung disease the previous year were reported on a separate questionnaire . on a pop - up questionnaire in the electronic medical record the examining gp recorded comorbidities and treatment given , including antibiotics and systemic corticosteroids for exacerbations the previous year .", "the post - bronchodilator forced expiratory volume in 1 second ( fev1 ) and forced vital capacity ( fvc ) were used in the analyses .", "exacerbation of asthma or copd the year before baseline was defined as exacerbations that were treated with antibiotics and/or systemic corticosteroids or ended with hospitalization , a definition previously used for copd exacerbations.1 the gps also reported the presence of wheezes , crackles , diminished breath sounds , and prolonged expiration after auscultation of the lungs .", "post - bronchodilator spirometry was carried out 20 minutes after inhalation of 0.4 mg salbutamol .", "spirometry was carried out after the pulse oximetry , following the european respiratory society / american thoracic society guidelines.13 spirare sps310 spirometers ( diagnostica as , oslo , norway ) were used ." ], [ "the participants filled in the ccq , this time concerning the previous 24 hours . respiratory symptoms the previous 24 hours were also reported by the gps based on history taking on a pop - up questionnaire and shortness of breath , coughing , phlegm production , and wheezing were classified into three grades : 1 ) not present or as normal , 2 ) more bothersome than normal , and 3 ) very bothersome .", "chest findings , the crp value , and pulse oximetry were recorded as done at baseline .", "lung function testing was also carried out with the same procedure , but post - bronchodilator spirometry was not carried out ." ], [ "changes from baseline were found by subtracting baseline values from the values at exacerbation . significant increase in crp was defined as an increase of at least 10 mg", "a significant drop in fev1was defined as a drop of 10% from baseline15 and of at least 200 ml .", "how such a drop in fev1 was associated with baseline characteristics and symptoms , signs and test results at exacerbation was analyzed by chi - square test , fischer s exact test ( dichotomous variables ) , and mann whitney test ( the ccq variables ) .", "significant decreases in spo2 were defined as a reduction of at least 2% to 95% and 92% , respectively .", "associations with percentage change in fev1 from baseline were analyzed by linear regression making it possible to have the degree of change as outcome .", "likelihood ratios were calculated for findings significantly associated with the fixed drop in fev1 using online software ( m.k ." ], [ "a decrease in spo2 of at least 2% to a value of 92% was still strongly associated with a drop in fev1 .", "wheezing during exacerbation , as experienced by the patient , was the strongest indicator of change in fev1 among the symptoms , and prolonged expiration and any abnormal auscultation finding were now stronger indicators than crackles .", "the asthma and copd subgroups did not differ when it came to likelihood ratios of very bothersome wheezing experienced by the patients and crackles on auscultation .", "during the 1-year follow - up period , 109 patients visited their gp due to one or more exacerbations . for patients who visited the gp with several exacerbations ," ], [ "we have attempted to find alternatives to spirometry in assessing drop in lung function during asthma and copd exacerbations .", "one strong indicator of a significant drop in lung function was increased wheezing as experienced by the patient . as far as we know ,", "patient experienced wheezing was a stronger predictor of drop in lung function than were wheezes on auscultation .", "only one copd patient had spo2 92% at baseline , telling us that this is a relevant finding for primary care . a drop in fev1 was most frequently found in the patients with a copd diagnosis , and the fev1/fvc ratio at baseline was strongly associated with a change in lung function in the linear regression , indicating that the severity of the copd should be taken into account .", "decreased spo2 measured as spo2 92% was also strongly associated with a drop in fev1 .", "this finding has not been reported previously to be a sign of a drop in lung function ." ], [ "we have attempted to find alternatives to spirometry in assessing drop in lung function during asthma and copd exacerbations .", "one strong indicator of a significant drop in lung function was increased wheezing as experienced by the patient . as far as we know ,", "patient experienced wheezing was a stronger predictor of drop in lung function than were wheezes on auscultation .", "only one copd patient had spo2 92% at baseline , telling us that this is a relevant finding for primary care . a drop in fev1 was most frequently found in the patients with a copd diagnosis , and the fev1/fvc ratio at baseline was strongly associated with a change in lung function in the linear regression , indicating that the severity of the copd should be taken into account .", "decreased spo2 measured as spo2 92% was also strongly associated with a drop in fev1 .", "this finding has not been reported previously to be a sign of a drop in lung function ." ], [ "as part of a prospective study with baseline examinations , we were able to collect post - bronchodilator spirometry at stable state in all patients .", "the spirometry was well performed , and although fewer patients expired for more than 6 seconds during exacerbation than at baseline , there are reasons to believe that valid fev1 values were obtained .", "the cutoff level of 10% for drop in fev1 may be regarded as arbitrary , and the results are strengthened by using the percentage drop in fev1 as continuous outcome variable in linear regression .", "one good reason for doing this is the difficulties in differentiating between asthma and copd in many patients with obstructive lung disease.11,16 a second justification is the similar challenges in the two diseases when it comes to treating exacerbations with oral corticosteroids .", "however , we did not find any great benefit of taking the baseline findings into account .", "this has probably not resulted in any systematic selection bias influencing the association between findings and drop in lung function ." ], [ "we have not found studies evaluating wheezing , as experienced by patients , as a sign of drop in lung function , only as an independent predictor of copd in general.17 wheezing is not one of the items in score sheets for health status in copd patients , such as the ccq12 and the copd assessment test ( cat)18 and neither in the exacerbations of chronic pulmonary disease tool ( exact).19 decreased spo2 during copd exacerbations has been shown in previous studies,20,21 but decreased spo2 has not previously been linked to the magnitude of drop in fev1 .", "one may question why not just spirometry can be used in the assessment of lung function during asthma and copd exacerbations .", "the difficulties in interpreting auscultation findings also relate to crackles and prolonged expiration , which were stronger indicators of a drop in fev1 than wheezes in this study . to ask primary care patients with asthma or copd exacerbations about wheezing seems to be a simple and a rational approach when assessing change in lung function .", ". increased wheezing and low pulse oximetry values are probably useful to take into account when treatment with oral corticosteroids is considered .", "when a spirometry result from stable state is available and performed within the previous year , a new spirometry can usually give a valid measure of drop in lung function .", "however , we do not know to which degree treatment with oral corticosteroids should be based on a drop in fev1 ." ] ]

[ [ "we aimed to verify if dlp resulted in significant changes in cerebral blood flow ( cbf ) that could be visualized by tcd . therefore , we identified a group of subjects who developed plph following dlp and compared their pre- and post - puncture blood flow parameters with respective values of plph - free subjects .", "diagnostic lumbar puncture ( dlp ) is a frequent procedure used in the diagnosis of neural system disorders .", "transcranial doppler ultrasonography ( tcd ) enables us to assess blood flow in the intracranial arteries non - invasively . assuming that tcd parameters are influenced both by changes in cerebral vessel diameters and by fluctuations in icp [ 68 ] ,", "post - lumbar puncture syndrome is a common complication of dlp occurring in about 340% of patients [ 14 ] ." ], [ " 3.339.1 3.90.006hemoglobin in g / l , mean sd14.2 1.313.0 1.50.001 clinical characteristics of patients who developed post - lumbar puncture headache ( plph ) and in plph - free individuals lumbar puncture was performed in the lateral recumbent position , using the intervertebral space between l4 and l5 or between l5 and s1 , with the aid of a 22-gauge needle ( bd spinal needle quincke type point ) .", "exclusion criteria from this group included emergency lumbar punctures , inadequate temporal bone windows , stenosis of the middle cerebral arteries , hemodynamically significant stenosis of the common carotid arteries , atrial fibrillation , and patients who were immobilized .", "patients were subjected to diagnostic procedures due to cranial mononeuropathy ( n = 12 ) , polyneuropathy ( n = 7 ) , multiple sclerosis ( n = 13 ) , vertigo ( n = 7 ) , diffuse injuries of the brain or spinal cord ( n = 9 ) , epilepsy ( n = 5 ) , and other reasons.table 1clinical characteristics of patients who developed post - lumbar puncture headache ( plph ) and in plph - free individualsparameterplph - free ( n = 45)plph ( n = 21)p valueage in years , mean sd49.3 17.843.2 12.50.16women , n ( % ) 13 ( 28.9)16 ( 76.2)0.00031men , n ( % ) 32 ( 71.1)5 ( 23.8)0.00026history of headache , n ( % ) 9 ( 20)14 ( 66.7)0.00021 tension - type headache , n ( % ) 6 ( 13.3)11 ( 52)0.00034 migraine without aura , n ( % ) 3 ( 6.7)2 ( 9.5)0.21 other type of headache , n ( % ) 0 ( 0)1 ( 4.8)arterial hypertension , n ( % ) 12 ( 26.67)3 ( 14.29)0.26diabetes , n ( % ) 9 ( 20)2 ( 9.5)0.29hypercholesterolemia , n ( % ) 15 ( 33.3)4 ( 19.1)0.23hematocrit in % , mean sd41.8 ", "sixty - six patients were enrolled to this study , including 37 men and 29 women .", "following localization of the temporal window , the middle cerebral artery ( mca ) was identified .", "all tcds were performed by the same physician being experienced in neurosonology and unaware of plph presence and severity in patients examined .", "the mean age of these patients was 47.4 16.5 years ( range from 16 to 88 , table 1 ) ." ], [ "exclusion criteria from this group included emergency lumbar punctures , inadequate temporal bone windows , stenosis of the middle cerebral arteries , hemodynamically significant stenosis of the common carotid arteries , atrial fibrillation , and patients who were immobilized .", "this study included patients at the department of neurology , who required a scheduled dlp .", "all the procedures were approved by the local ethics committee of the ludwik rydygier collegium medicum in bydgoszcz ." ], [ " 3.339.1 3.90.006hemoglobin in g / l , mean sd14.2 1.313.0 1.50.001 clinical characteristics of patients who developed post - lumbar puncture headache ( plph ) and in plph - free individuals lumbar puncture was performed in the lateral recumbent position , using the intervertebral space between l4 and l5 or between l5 and s1 , with the aid of a 22-gauge needle ( bd spinal needle quincke type point ) .", "sixty - six patients were enrolled to this study , including 37 men and 29 women .", "all tcds were performed by the same physician being experienced in neurosonology and unaware of plph presence and severity in patients examined .", "following localization of the temporal window , the middle cerebral artery ( mca ) was identified .", "the mean age of these patients was 47.4 16.5 years ( range from 16 to 88 , table 1 ) .", "the presence and severity of plph was evaluated for 5 days , on a daily basis , using a numeric rating scale ( nrs ) .", "the volumes of collected cerebral fluid ranged from around 610 ml . all the procedures were performed between 11 and 12 a.m. following the procedure , the patients were ordered to stay in bed for 8 h. tcd was performed using a pioneer apparatus ( nicolet / eme ) with a 2-mhz probe ." ], [ "mean values of normally distributed variables were compared with student s t test for independent samples , whereas the variables whose distributions were not normal were compared with the non - parametric mann ", "distributions of discrete variables were compared between the groups with the aid of test .", "calculations were performed using statistica 7 ( statsoft , poland ) software , and statistical significance was defined as p 0.05 ." ], [ "post - lumbar puncture headache was observed in 21 out of 66 patients who underwent dlp ( 32% ) , whereas symptoms of post - lumbar puncture syndrome were not noted in the remaining 45 subjects ( 68% ) . in most patients ( 86% ) , the symptoms manifested on the first day following dlp , on average 17.7 10.2 h after the procedure ( range 744 h ) .", "l ) middle cerebral arteries of patients who developed post - lumbar puncture headache ( plph ) and in plph - free individuals in patients who developed plph , bilateral pre - puncture values of vmean and vmax were significantly higher and pi was significantly lower compared to unaffected individuals .", "moreover , hemoglobin concentration and hematocrit values were significantly lower in patients who developed headache compared to unaffected individuals ( table 1 ) . in plph cases , the post - puncture values of vmean and vmax were significantly lower than the respective baseline parameters .", "1).fig . 1correlation between post - lumbar puncture headache ( plph ) severity on numeric rating scale and pre - puncture gosling s pulsatility index ( pi ) in the left middle cerebral artery correlation between post - lumbar puncture headache ( plph ) severity on numeric rating scale and pre - puncture gosling s pulsatility index ( pi ) in the left middle cerebral artery", "significant puncture - related changes in bilateral vmean and vmax were not observed in patients who did not develop plph . after the puncture , a slight increase in pi was observed bilaterally in both groups , but these changes lacked statistical significance ( table 2 ) . when study results were stratified according to patient gender , significant post - puncture changes in vmean and vmax were observed only in women ( p < 0.01 and p < 0.07 in right and left mca , respectively ) .", "no significant differences were observed between these groups in terms of post - puncture vmean and vmax , but the post - puncture pi was still significantly lower in plph cases ( table 2 ) ." ], [ "post - lumbar puncture headache is believed to result from cerebrospinal fluid leakage through the post - puncture opening , with a subsequent decrease in intracranial pressure and cerebral vessel dilatation [ 13 , 5 ] .", "the findings of this study partially confirm the theory behind the etiology of plph stated in the introduction , and suggest that higher baseline values of vmean and vmax and low pi in bilateral mcas predispose patients to this condition .", "additional risk factors of plph were observed to include female gender , history of headaches , and decreased hematocrit and hemoglobin levels . finally , within the 24 h following puncture , significant decreases in vmean and vmax were observed in bilateral mcas of patients who developed plph .", "this theory was confirmed by our study . following the puncture , we observed significant decreases in vmean and vmax in bilateral mcas of patients who developed plph when compared to their respective pre - puncture values .", "similar puncture - related decreases in vmax in patients with plph were previously described by gobel et al . , but only affecting the right mca . in our study , significant puncture - related changes in vmean and vmax were not observed in bilateral mcas of plph - free individuals . presumably , the loss of cerebrospinal fluid in these patients was not significant enough to be reflected by compensative dilatation of cerebral vessels .", "baseline ( pre - puncture ) pi values in patients who later developed plph were significantly lower compared to subjects free of this condition ." ] ]

[ [ "in addition , we have added enrichment profile of various transcription factors obtained from chip - seq data sets . these promoters along with their annotations are provided as a user - friendly database , where each known and chip - seq promoter is linked to a new interface for visualization of enrichment profile . here , we describe the updates of our mpromdb , which enables users to study promoter activity at tissue / cell centric level for human and mouse genome .", "we have removed chip chip results and added active rnap - ii promoters identified after analyzing six different cell types of human and 10 different cell / tissue types of mouse chip - seq experiments performed with rnap - ii antibody .", "the mammalian transcriptome and proteome is far more diverse than expected from one geneone mrnaone protein paradigm ( 1 ) .", "although epd database ( 11 ) provides curated promoter sequences for eukaryotic organisms , it does not provide promoter activity information at tissue / cell centric level . in this update of mpromdb", "in fact , recent evidence suggests that at least half of the mammalian genes use alternative promoters generating multiple transcript variants ( 3,5 ) .", "therefore , a gene can yield transcript variants that differ in either their regulatory utrs or / and protein coding regions ; thereby expanding the complexity of mammalian genomes ( 35 ) . in particular , the role of alternative promoter activity is critical in transcriptional regulation , as their precise utilization allows the balanced expression of corresponding pre - mrna variants in different cell and/or developmental contexts ." ], [ "in this update , we have added ( i ) a comprehensive knowledgebase of known and novel promoters , ( ii ) promoters identified from rnap - ii chip - seq experiments , ( iii ) advance search and filter options and ( iv ) visualization of chip - seq profiles and promoters using gbrowse ( 12 ) .", "49627 488150142 893 summary of rnap - ii bound promoters identified in various tissues / cell types for human and mouse using chip - seq data sets furthermore , our analysis has identified promoters for 15 493 and 14 266 protein - coding genes in mouse and human respectively .", "after identification of significant rnap - ii bound peaks we apply our recently published program for prediction of rnap - ii bound promoters ( 10 ) .", "novel promoters. it is worth noting that 65% and 90% of novel promoters in mouse and human , respectively , are supported by additional sources ( novel gene models , mrnas , spliced ests , cage tags and orthologous gene model ) ( table s4 ) . \n", "following promoter prediction , we performed promoter annotation using our reference promoter knowledgebase as summarized in figures s1 and s2 . finally , we identified 48 366 mouse and 42 893 human promoters bound by rnap - ii where 39% and 42% of the promoters in mouse and human respectively were annotated as novel promoters ( table 1 ) . in case", "table 1.summary of rnap - ii bound promoters identified in various tissues / cell types for human and mouse using chip - seq data setsspeciestissue / cell typeno . of known promotersno . of novel promotersno . of tissue/ cell - specific promotersno . of cpg promotersno . of bidirectional promotersno . of total promotersmousebrain15 9485270397813 864137321 218liver12 3193189164210 421125015 508kidney15 0594632199512 879134819 691spleen908921218068273106711 210lung15 3735142193513 986137420 515embryonic stem cell(v6.5)11 8952880274512 063131414 775mouse embryonic fibroblasts b410 558226127310 898124112 819mouse embryonic fibroblasts b611 " ], [ "in this update , we have added ( i ) a comprehensive knowledgebase of known and novel promoters , ( ii ) promoters identified from rnap - ii chip - seq experiments , ( iii ) advance search and filter options and ( iv ) visualization of chip - seq profiles and promoters using gbrowse ( 12 ) .", "49627 488150142 893 summary of rnap - ii bound promoters identified in various tissues / cell types for human and mouse using chip - seq data sets furthermore , our analysis has identified promoters for 15 493 and 14 266 protein - coding genes in mouse and human respectively .", "after identification of significant rnap - ii bound peaks we apply our recently published program for prediction of rnap - ii bound promoters ( 10 ) .", "novel promoters. it is worth noting that 65% and 90% of novel promoters in mouse and human , respectively , are supported by additional sources ( novel gene models , mrnas , spliced ests , cage tags and orthologous gene model ) ( table s4 ) . \n", "following promoter prediction , we performed promoter annotation using our reference promoter knowledgebase as summarized in figures s1 and s2 . finally , we identified 48 366 mouse and 42 893 human promoters bound by rnap - ii where 39% and 42% of the promoters in mouse and human respectively were annotated as novel promoters ( table 1 ) . in case", "we have also added promoter regions of recently discovered non - coding genes class ( lincrna ) transcribed by rnap - ii ( 15,16 ) .", "table 1.summary of rnap - ii bound promoters identified in various tissues / cell types for human and mouse using chip - seq data setsspeciestissue / cell typeno . of known promotersno . of novel promotersno . of tissue/ cell - specific promotersno . of cpg promotersno . of bidirectional promotersno . of total promotersmousebrain15 9485270397813 864137321 218liver12 3193189164210 421125015 508kidney15 0594632199512 879134819 691spleen908921218068273106711 210lung15 3735142193513 986137420 515embryonic stem cell(v6.5)11 8952880274512 063131414 775mouse embryonic fibroblasts b410 558226127310 898124112 819mouse embryonic fibroblasts b611 " ], [ "mpromdb as a web - based application has many layers : the core application ( designed in django ) , a backend database ( mysql ) , a visualization component ( gbrowse ) and a web server ( apache ) ( see supplementary file 1 ) .", "the promoter information corresponding to a particular gene can be retrieved from the database using entrez geneid or gene symbol .", "gbrowse is simple but highly configurable web - based genome browser , which provides a fast and customizable interface for visualizing data that is stored in a backend database , as well as the data that is uploaded by the user .", "we also provide additional search and filter options such as selection of tissue / cell type , tissue / cell specific promoters , known / novel promoters and coding / non - coding gene promoters .", "the first level provides information ( promoter position , cpg type and bidirectional type ) regarding all promoters of the queried gene that are present in the promoter knowledgebase .", "visualization of the promoter position and chip - seq data enrichment profile is implemented using gbrowse ( 12 ) , an open source genome browser platform ." ], [ "in future , we plan to include epigenetic histone modifications profile identified from chip - seq data sets that are currently available at ncbi geo and integrate it to our promoter knowledgebase", "we believe that the updates will facilitate large - scale chip - seq data analysis and contribute toward the elucidation of mammalian transcriptional regulatory networks .", ". we will also continue to collect rnap - ii and transcription factors chip - seq data sets from a wider variety of tissues and cell types to routinely update mpromdb .", ", mpromdb will provide integrated transcriptional regulatory information for mammalian genomes in an easily accessible way .", "we also plan to include other mammalian data sets , and add additional features and search options to the frontend of the database . in conclusion" ], [], [ "funding for open access charge : national institutes of health grant ( # r01hg003362 to r.d . ) .", "nhgri / nih grant ( # r01hg003362 ) ; american cancer society research scholar grant ( # rsg-07 - 097 - 01 to r.d . ) ; and philadelphia healthcare trust . r.d . holds a philadelphia healthcare trust endowed chair position ." ] ]

[ [ "transplantations of mesenchymal stem cells ( mscs ) have shown great potential as a therapeutic agent for the treatment of a range of disorders , including wound healing , and have become the subject of numerous clinical trials . however , whilst the safety of msc transplantation does not seem to be an issue , the effectiveness of such treatment has exhibited considerable variability . this variation in effect is problematic when translating preclinical research into msc - based clinical therapy .", "we report that msc - cm promotes endothelial cell adhesion and migration , but that these effects show considerable donor - donor variability .", "hence , these and other studies have contributed to recent thought that the predominant regenerative activity of mscs is due to their secretion of factors that stimulate endogenous cells at wound sites . in this investigation , we have examined the effects of msc - cm on endothelial cells , using the cell line eahy-926 as a model system .", "further , we have identified extracellular matrix ( ecm ) proteins that are secreted by mscs using maldi / tof - tof mass spectrometry .", "we recently demonstrated that human msc - conditioned medium ( msc - cm ) was stimulatory to epidermal and fibroblast cell adherence and migration .", "other reports suggest that msc are pro - angiogenic also through their paracrine activity on endothelial cells . whilst there are reports that msc are capable of endothelial differentiation , engraftment into new vasculature is low in vivo .", "we provide data to suggest that ecm composition plays a major role in the donor - donor variation we have seen .", "these findings demonstrate proof of principle of the need to screen the msc secretome in order to optimise the application of mscs in the clinic ." ], [ "characterization of msc after three passages in culture , bone marrow derived cells were assessed by immunoprofiling for cd markers and by examining their differentiation potential to form osteoblasts , adipocytes and chondrocytes , by staining with alkaline phosphatase , oil red o , and toluidine blue respectively as per the criteria established for a msc phenotype by the isct .", "the adherent cell population obtained was consistent with the characteristics of mscs laid out by the international society for cellular therapy ( isct ) . conditioned medium", "coating of culture plates culture plates were coated with msc - cm or type - i collagen , decorin , or fibronectin ( all sigma - aldrich ) .", "scratch assays were established using previously published methods , in protein - coated tissue culture plates ( as described above ) .", "mscs were isolated from the iliac crest biopsies of bone marrow donors following ethical approval and with informed consent , as previously described .", "cell migration was automatically captured and analysed at hourly intervals using an incucyte live - cell imaging system ( essen bioscience ) .", "was generated from msc cultures of equal cell number in serum free conditions , using dmem / f12 supplemented with insulin , transferrin and selenium ( invitrogen ) ." ], [ "msc - cm coating of culture plates resulted in the significant enhancement of the spreading of eahy-926 endothelial cells upon the culture surface .", "hence , not only was there clear inter - donor variability in the ecm components of the msc secretome , but the presence of these proteoglycans seemed to be associated with a reduction in the efficacy of msc - cm . when type i collagen , decorin and fibronectin were used as culture substrata , the degree of eahy-926 endothelial cell spreading appeared to be similar upon both type i collagen and decorin and greatly enhanced upon fibronectin ( figure 2a , 2b ) .", "cells isolated from bone marrow meet the minimum criteria for identification as msc.cells are immunoreactive for cd73 , cd90 and cd105 , whilst lacking immunoreactivity for cd14 , cd34 and cd45 , as shown by histograms obtained by flow cytometry , and readily differentiate to form osteoblasts , adipocytes and chondrocytes in vitro .", "this result was subject to a marked inter - donor variability , with conditioned media generated by both msc-1 and msc-3 resulting in a significantly greater degree of eahy-926 endothelial cell spreading than that generated by msc-2 ( figure 2a , 2b ) ." ], [ "we have previously shown that msc - cm promotes the migration of skin cells in a wound healing model , and identified numerous potentially beneficial factors that may contribute to this effect .", "in vivo wound healing is , however , a complex process influenced by a host of cellular events , including angiogenesis . if msc can stimulate endothelial cells as suggested here and elsewhere this supports their potential use in the treatment of cutaneous wounds . in these experiments ,", "the relatively low number of individual donors examined during this study is a clear limitation , and although the results presented support the conclusions that ( i ) msc donor variation and secretome composition may account for differential effects of mscs on endothelial cells , and ( ii ) that this variation should be taken into consideration in msc - based regenerative medicine , subsequent investigation of greater numbers of samples is required to further authenticate these findings ." ], [ "these experiments have showed that msc - cm enhances both the rate of endothelial cell migration and the adherence of these cells to their culture surface , and that this effect was , in part , mediated by the presence of fibronectin .", "angiogenesis depends on endothelial cell migration and the actions of endothelial cell chemotactic factors , e.g. vegf and il-8 , and ecm proteins such as collagens , fibronectin and laminin .", "many of these pro - angiogenic factors have been found to be present within the msc secretome both within this investigation and in previous studies .", "overall , the data presented here support the hypothesis that msc may stimulate the formation of new vasculature , and that this may be an important aspect of msc - mediated enhancement of wound healing .", "the effects of msc - cm upon endothelial cell migration were not entirely induced by fibronectin , as suggested by the further enhancement of eahy-926 endothelial cell migration by msc - cm in the presence of exogenous fibronectin .", "it seems likely that these known mediators of angiogenesis might contribute to the effects of msc - cm upon eahy926 endothelial cells observed in these investigations ." ], [] ]

[ [ "preclinical data suggested that the 5-fu plus oxaliplatin combination is more cytotoxic when 5-fu is given as a short exposure , which gives a rationale for exploring the toxicity and efficacy of such protocols in advanced pancreatic cancer . in the current study , we conducted a randomized trial to compare two protocols ; flox and the 3-weeek bolus protocol regarding toxicity , response rate , and time to progression as primary end points , then overall survival as secondary endpoints .", "gemcitabine has been the solo player in the field of pancreatic cancer , treatment after replacing 5-fu since 1997 , and is still regarded as one standard of care for the first - line systemic chemotherapeutic treatment of patients with advanced pancreatic cancer worldwide .", "so far , only two randomized phase iii trials have demonstrated a significant prolongation of survival with the use of gemcitabine - based combination therapy with either erlotinib or capecitabine .", "the national comprehensive cancer network guidelines for pancreatic adenocarcinoma currently recommend second - line chemotherapeutic treatment after gemcitabine failure in selected patients using , for example , single - agent capecitabine or a combination therapy of fluorouracil , leucovorin and oxaliplatin ( folfox- ) like regimen . to date" ], [ "the required number of patients for this phase ii study was determined according to a jehan phase ii optimal design for a goal of 20% true clinical benefit ; with - and -error probability of 0.05 and 0.20 , respectively , an accrual of 24 patients assessable for response was planned .", "patients were randomly assigned to one of the treatment regimens ( block randomization at 4 ) , where 24 patients were enrolled for each treatment group .", "patients with advanced unresectable or metastatic pancreatic adenocarcinoma were enrolled under the following eligibility criteria . \n", "( i ) patients with histologically or cytologically proven locally advanced or metastatic pancreatic adenocarcinoma , ( ii ) with at least 1 bidimensionally measurable lesion ( world health organization ( who ) criteria ) ; ( iii ) eastern cooperative oncology group ( ecog ) ps of 1 - 2 ;", "ttp and os since the start of treatment were estimated on an intent - to - treat basis and analyzed according to the kaplan - meier method .", "the ttp was calculated from the first treatment infusion to the first objective evidence of disease progression assessed by ct scan measurements or early death or date of clinical deterioration and patient not assessable for response ." ], [ "forty - eight patients with unresectable or metastatic pancreatic cancer pretreated with gemcitabine ( including gemcitabine resistance or gemcitabine pretreated ) in ain shams university hospitals were included along the period between october 2008 and september 2011 .", "sixteen males out of total twenty - four cases were encountered in flox arm compared to 17 in 3-week bolus arm .", "median survival time was 8 months ( 95% ci , 4.012 ) . \n for 3-week regimen , two patients ( 8% ) had partial response , five patients ( 21% ) had stable disease , and four out of 8 patients with pain at presentation ( 50% ) had clinical benefit as shown in table 3 .", "for flox regimen this cost was approximately 1200 usd versus 1400 usd for the 3-weeks regimen ( due to mainly the amount of discarded oxaliplatin in every injection time that was more in the second regimen ) as in table 4 .", "the median time to progression was 4 months ( 95% ci , 1.85 ) ( range : 1.26 ) .", "the median time to progression was 3.9 months ( 95% ci , 24.6 ) ( range : 1.55.5 ) .", "median survival time was 9 months ( 95% ci , 3.513 ) as shown in figures 1(a ) and 1(b ) ." ], [ "the role of second - line chemotherapy after failure of first - line therapy in such cases is not well established , but a theoretical possibility exists in which salvage chemotherapy after the failure of first - line treatment may influence the survival . for the scale of patients with good performance status , progressing after first - line gemcitabine therapy , nccn recommends fluoropyrimidine - based chemotherapy .", "two regimens of oxaliplatin and bolus fluorouracil have been investigated , flox regimen that was used in metastatic colorectal cancer with adequate efficacy and acceptable toxicity profile .", "further studies with large number of patients investigating the efficacy and tolerability of such bolus regimens in gemcitabine - pretreated pancreatic cancer patients are warranted .", "the regimen was associated with 36% clinical benefit . in conclusion , combining oxaliplatin to bolus fluorouracil ( either in flox or 3-week regimens ) as a second line in gemcitabine pretreated patients with advanced or metastatic pancreatic adenocarcinoma showed encouraging efficacy , acceptable toxicity , and some clinical benefit specially when palliation or good quality of life is a target keeping in mind the simplicity in administration , the no need for hospitalization , and the less financial load specially with flox .", "adding oxaliplatin to continuous infusion fluoropyrimidine as a second - line salvage therapy for this category has been investigated in some phase ii trials [ 1012 ] . in a series of unselected patients" ] ]

[ [ "primary peritonitis due to s. pyogenes is an unusual condition because streptococcus pyogenes usually causes pharyngitis , erysipelas , and necrotizing fasciitis . in this report , we present the first case to the best of our knowledge of primary peritonitis due to s. pyogenes in korea .", "primary peritonitis constitutes less than 1% of peritonitis and spontaneous bacterial peritonitis usually occurs in patients with comorbid conditions . in absence of comorbid conditions , including liver cirrhosis , immunosuppression , or nephrotic syndrome , primary peritonitis is rare , particularly in cases of healthy young subjects ." ], [ "29-yr - old woman presented to the emergency room with lower abdominal pain on april 20 , 2011 .", "as physical , laboratory , and radiologic findings suggested acute peritonitis , laparoscopy searching for etiology was performed .", "abdominal ct revealed edematous swelling of the intestinal wall and ascites with peritoneal enhancement suggesting peritonitis ( fig .", "purulent ascites was found in the pelvic cavity but both ovaries and fallopian tubes were intact ( fig ." ], [ "primary peritonitis caused by streptococcus pyogenes is uncommon and rarely diagnosed in a healthy person without underlying diseases .", "spontaneous bacterial peritonitis due to streptococcus pyogenes in a cirrhotic child was reported in korea ( 1 ) but s. pyogenes peritonitis in a healthy person has not yet been reported in korea . therefore , this is the first case of primary peritonitis due to streptococcus pyogenes in a healthy person in korea ." ] ]

[ [ "carbon monoxide ( co ) is a colorless , odorless , and nonirritant gas that is lighter than air , and it is a product of incomplete combustion of hydrocarbons.1 ) accidental , suicidal or homicidal intoxications with co have a long history .", "acute co poisoning is an important clinical problem and may lead large proportion of patients to fatal death . moreover , frequent neurologic and cardiovascular consequences have been described.2 - 4 ) the neurologic manifestations of co poisoning have been well described , and include headache , dizziness , weakness , nausea , and confusion.3)4 ) cardiac consequences have been reported , including arrhythmias and electrocardiographic alterations , acute myocardial infarction , pulmonary edema , and cardiogenic shock.5)6 ) among these , myocardial injury is common in patients with moderate to severe co poisoning,2 ) manifested as elevated cardiac biomarkers and the changes of regional wall motion abnormality in echocardiography.7 ) on the other hand , an association between thromboembolic accidents and co poisoning has been shown less frequently in the literatures.8 - 14 ) we report a co poisoning case complicated by intracardiac thrombus ." ], [ "the patient has been free of symptoms and there have been no clinical features of neurologic or thromboembolic complications during the 3-months of follow - up .", "a 24-year - old female patient with no preexisting disease was brought to the emergency unit for altered mentality due to suicidal exposure to co. the duration of the exposure was unclear .", "the foremost diagnosis to exclude in this patient was intracardiac thrombus , and therefore we started anticoagulation therapy immediately .", ", she was questioned concerning recent potential precipitating conditions , such as surgery , immobilization and use of medications including oral contraceptives ." ], [ "in contrast , an association between thromboembolic accidents and co poisoning has been shown less commonly in the literatures . to our knowledge , this is the first korean case of acute co poisoning combined with ra thrombus formation . besides lv thrombus formation associated with transient apical ballooning of lv,15 ) there have been several reports regarding arterial and venous system thrombosis and related embolism including popliteal artery,8)9 ) superior sagittal sinus,10 ) vein of labbe,11 ) mesenteric artery,12 ) basillar trunk,13 ) and popliteal vein.14 ) a plausible explanation for thromboembolic events is the effect of co on platelets aggregation .", "co poisoning leads to some changes in blood vessel and co and nitric oxide exchange on platelet .", "co poisoning has special impact on organs sensitive to oxygen deprivation such as the heart , brain , and kidney .", "therefore , patients presented with co poisoning should undergo echocardiographic examination followed by serial ecg and cardiac enzyme evaluation ." ] ]

[ [ "the syndrome is a combination of features of inherited blistering skin disorders ( e.g. , dystrophic epidermolysis bullosa ) and congenital poikilodermas ( e.g. , rothmund - thompson syndrome ) and should be differentiated due to clinical overlap with hereditary acrokeratotic poikiloderma ( hap ) and dystrophic epidermolysis bullosa .", "kindler syndrome ( ks ) is a rare autosomal recessive genodermatosis , which was first described in a 14-year - old girl in 1954 by kindler and later by forman et al . in 1989 .", "the association of aggressive periodontitis with ks was based on a single case in 1996 and later confirmed with a larger population of patients ." ], [ "orthopantomograph showing retained deciduous and congenitally missing permanent teeth histopathologic examination of atrophic skin lesions in patients with ks reveals nonspecific features of poikiloderma .", "a 16-year - old female patient presented with the chief complaint of bleeding gums , ulcerations of buccal mucosa , missing teeth and difficulty in swallowing .", "multiple congenitally missing teeth , and retained deciduous teeth were reported [ figure 7 ] ." ], [ "a 16-year - old female patient presented with the chief complaint of bleeding gums , ulcerations of buccal mucosa , missing teeth and difficulty in swallowing .", "patient 's mother reported that she had two children ; one was healthy physically and mentally . both of her pregnancies and deliveries were normal , but history of the affected child revealed skin blisters beginning at the age of 3 months ." ], [ "cutaneous examination revealed multiple hypopigmented and a few hyperpigmented macules of variable sizes , distributed over his face , neck , trunk , and limbs [ figure 1 ] .", "areas of hyper- and hypo - pigmentation on face absence of palmar creases hyperkeratotic plaques on the flexures", "skin over the hands and neck was dry , atrophic and photosensitive to the sunlight ." ], [ "tongue showed reduced mobility and was quite hard due to fibrosis [ figure 4 ] .", "deep pockets with marked bleeding on minimal probing were present around the teeth . in certain areas , erythema extended to mucogingival junction ; resulting in appearance of desquamative gingivitis [ figure 5 ] ." ], [ "multiple congenitally missing teeth , and retained deciduous teeth were reported [ figure 7 ] ." ], [ "histopathologic examination of atrophic skin lesions in patients with ks reveals nonspecific features of poikiloderma .", "other histologic features include a prominence of dermal capillaries , pigmentary incontinence , and possibly , perivascular lymphocytic infiltrate .", "the epidermis is flattened and atrophic ; edema is present at the dermoepidermal junction , and the basal layer shows focal vacuolization with basal cell degeneration ." ], [ "reticulated hyperpigmentation , nail dystrophy , and leukoplakia are characteristic features of dyskeratosis congenita . unlike ks ,", "the associated features of dwarfism , cachexia , progressive pigmentary retinopathy , deafness , and birdlike faces differentiate cockayne 's syndrome from ks .", "an autosomal recessive pattern of transmission is usual , but sporadic cases are not uncommon . in ks , there is an unusual interruption and reduplication of the basement membrane and a broad reticular pattern of type vii collagen staining deep into the connective tissue beneath the basement membrane . it has also been suggested that ks and weary 's hap are variants of the same disease . however , the mode of inheritance , onset of blistering , photosensitivity and presence of eczema is different in these two syndromes .", "the additional features of these criteria are nail dystrophy , ectropion , palmoplantar keratoderma , leukokeratosis of lips , squamous cell carcinoma , anhidrosis , skeletal abnormalities , and dental problems . according to the proposed criteria ,", "mucosal involvement is very common and may lead to urethral , anal and esophageal stenosis . our patient presented with acral blisters in the neonatal period and childhood , diffuse poikiloderma , skin fragility and atrophic changes , which were more prominent on skin exposed areas .", "patients usually have a normal life span , but significant morbidity may be caused by secondary infections of congenital blisters ; mucosal involvement leading to urethral , anal and esophageal stenosis ; aggressive periodontitis , and ocular complications ." ] ]

[ [ "central serous chorioretinopathy ( cscr ) is a chronic idiopathic condition affecting young to middle - aged patients with men affected more commonly than women .", "nevertheless , it is associated with psychological stress and systemic corticosteroid therapy , which causes hyperpermeability of choriocapillaries , leading to dysfunctional degeneration of the rpe [ 1 , 2 ] .", "it is characterized by serous detachment of the neurosensory retina , with focal or multifocal areas of leakage of the retinal pigment epithelium ( rpe ) affecting the macular area . the exact cause of cscr is not clearly understood ." ], [ "a 23-year - old man presented with a sudden decrease of visual acuity of the right eye ( re ) 4 days after rhinoplasty for a deviation of the nasal septum .", "also , fa revealed the disappearance of rpe leakage and the retinal thickness of the macula measured with oct was 183 m ( fig .", "the optical coherence tomography ( oct ) sections through the macula depicted a mild neurosensory retinal detachment with an increase in retinal thickness equal to 245 m ( fig .", "one month after the operation , visual acuity of the re returned to 6/6 and the neurosensory retinal detachment disappeared .", "fundus examination revealed a well - delineated serous elevation of the macula and fluorescein angiography ( fa ) showed a focal rpe leakage ." ], [ "we present a case of cscr after rhinoplasty , which to the best of our knowledge has not been previously reported .", ", the use of xylometazoline may have enhanced the post - traumatic stress and induced adrenergic stimulation leading to an increase in the choroidal circulation and alteration of the pump action of the rpe , which is related with the development of the cscr .", "this case shows a possible association between the postoperative stress or the use of xylometazoline and cscr and widens the spectrum of drugs associated with the occurrence of the disease .", "however , the simultaneous increase in choroidal resistance has no effect on choroidal blood flow , which will be regulated to be maintained constant . in summary ,", "it is possible that a constitutionally determined susceptibility of the posterior blood - retinal barrier must be present so that , under the effect of exogenous or endogenous glucocorticoids , cscr develops .", "in fact , the use of imidazole derivatives like oxy- and xylometazoline , which directly stimulate alpha - receptors and are more alpha-2-selective , are associated with the manifestation of cscr [ 6 , 7 ] . in our case", "found elevated values of urinary free cortisol in patients suffering from cscr not exposed to exogenous glucocorticoids and without biological signs of endogenous cushing 's syndrome ." ], [] ]

[ [ "the aims of the present study are to ascertain the prevalence of cl / p among live births among four provinces in the west and north - west of iran with different ethnic / cultural .", "the prevalence of cl / p among live births in yazd province ( center of iran ) was 0.86/1000 births .", "reported the birth prevalence of oral clefts among three main ethnic groups in gorgan in the northern of iran .", "one of the most common anomalies in newborn infants is cleft lip and/or cleft palate ( cl / p ) .", ", no investigation evaluated this prevalence in the west and north - west area of iran .", "twelve provinces from 31 provinces of iran are in the west and north - west area , with different ethnic groups : azari , kurd , lur , bakhtiari , qashqai , guilak , and fars .", "isolated orofacial clefts or clefts that occur with no other major birth defects are one of the most common types of birth defects in the us . to understand the role of environmental and genetic factors in the development of clefts , many authors provide evidence in the form of epidemiological data on the prevalence of oral clefts ." ], [ "the population under study included all infants born alive in the university hospitals from the medical universities with a maternity unit in each of the capital cities from these four provinces .", "we gathered information of infants with cl / p who were born in hospitals , including the date and place of birth , gender , and type of clefts", "in a cross - sectional study ; over 5 years from 2008 to 2012 , we select four provinces such as [ figure 1 ] east azarbaijan , kurdestan , gilan , and markazi have different ethnic / cultural , and the prevalence of oral clefts was not reported in them until now .", "in addition , to study the effect of the place and date of birth , type of clefts , and gender that were tabulated from the infants with cl / p , prevalence was compared between the different groups using chi - square and fisher 's exact test .", "the population of tabriz , sanandaj , rasht , and arak were , 1,695,094 , 450,167 , 918,445 , and 599,634 , respectively .", ". the capital cities of them are tabriz , sanandaj , rasht , and arak city , respectively . at the 2011 census by the statistical center of iran ,", ". the relevant icd-10 diagnosis codes of cp , cl , cl / p are q35 , q36 , and q37 , respectively ." ], [ "in addition , to study the effect of the place and date of birth , type of clefts , and gender that were tabulated from the infants with cl / p , prevalence was compared between the different groups using chi - square and fisher 's exact test .", "prevalence was calculated by using the percentages of cl / p in the total sample ." ], [ "during the study , 52 infants with cl with or without cp ( cl / p ) or cp were born alive in hospitals with a maternity unit in four cities in the west and north - west of iran [ table 1 ] . in total , there were 107,317 registered live births during 2008 - 2012 .", "frequency of clefts live births in four west and north - west cities of iran from 2008 - 2012 based on sex and cleft type frequency ( annual prevalence of clefts per 1000 live births ) of cl / p in four west and north - west cities of iran from 2008 - 2012 according to the annual prevalence of clefts birth , the highest prevalence of clefts occurred in rasht city , and the electronic reports of live - birth infants of arak city had not any reports of children with clefts in 2011 .", "the greatest prevalence of girls with clefts was in rasht city and the boys with clefts was in arak city .", "the prevalence during 2008 - 2012 in rasht , arak , sanandaj , and tabriz cities was 557 , 352 , 503 , and 559/1,000,000 live births , respectively ( p = 0.000 ) like prevalence of arak is less than others significantly [ table 2 ] ." ], [ "the overall prevalence of cl / p in the population of four capital cities of four provinces in the west and north - west of iran was 0.48/1000 live births .", "there was a wide variation in the incidence of cl / p from 2008 to 2012 , and from city - to - city .", "the main purpose of the current study is to explore the distribution and prevalence of cl / p and type of clefts in the capital city of four provinces synchronously from 2008 to 2012 .", "this study was conducted to explore the prevalence of cl / p in the capital cities of four provinces in the west and north - west of iran by using electronic medical information from the hospitals . until now", "the highest incidence of cl / p occurred in rasht city of gilan province ( 1.27/1000 ) in 2011 .", ", the prevalence of oral clefts was not reported for the population of four provinces : markazi , east azarbaijan , kurdestan , and gilan .", "we used only electronic records ( hospital - based ) of children who were born in hospitals and eventually were diagnosed ." ], [ "the different gender effects on the prevalence of cl / p from city - to - city may be explained by environmental and/or genetic factors affecting the development of oral clefts .", "we explored the prevalence of cl / p in four capital cities of the west and north - west provinces of iran synchronously from 2008 to 2012 .", "overall , there were differences among the four cities in the prevalence of oral clefts .", "conversely , the effect of gender on the prevalence of cl / p also showed regional differences ." ], [ "this investigation was supported by grant 91 - 02 - 32 - 18216 from the vice - chancellor for research of iran university of medical sciences ." ], [], [ "shj contributed in the conception of the work , drafting and revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work .", "nj contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work ." ] ]

[ [ "based on the previous experimental studies and existing traditional and folk medicine knowledge about some of the cardiovascular beneficial effects concerning rosa damascena l. ( rd ) and quercus infectoria ( qi ) , we have selected these two herbal drugs for the present study .", "cardiovascular diseases ( cvds ) account for about 30 percent of all deaths worldwide , and hyperlipidemia , hypertension , and smoking are well known as the three major risk factors of the mortality rates of cvds . regarding the advances in the study and understanding of the mechanisms involved in the positive and negative effects of botanical drugs on health and diseases ,", "one of the areas which has gained attention in recent years is the protective and destructive effects of herbal agents on the cardiovascular system .", "the galls of q. infectoria have analgesic cns depressant , antiparkinsonian , antidiabetic [ 35 ] , anti - inflammatory , and antioxidant activity ." ], [ "the rd and qi groups were fed with normal rabbit chow supplemented with 1.5 g rd and qi extracts , respectively , in each kg of the diet for 45 days .", "cholesterol ( 0.5% ) and hydrogenated vegetable oil ( 16% ) were added to the diet of the hyperlipidemic ( h ) groups during the 45 days of this experiment .", "the h+qi and h+rd groups received 1.5 g qi and rd extracts , respectively , in each kg of their diet in addition to cholesterol and hydrogenated vegetable oil during the study .", "the fasting blood sample was taken from ear vein on the first and the 46th day of the experiment in order to measure the plasma total cholesterol ( tc ) , low - density lipoprotein ( ldl ) , high - density lipoprotein ( hdl ) , and the triglyceride ( tg ) levels by routine laboratory methods .", "the atherogenic indices of plasma , as markers of plasma atherogenicity , were calculated as tc / hdl and ldl / hdl . at the end of the experiment", "the maximum velocity of contraction ( max dp / dt ) and the maximum velocity of relaxation ( min dp / dt ) were calculated from the left ventricular pressure pulse . pressure - rate product ( prp ) , an indirect measure of myocardial oxygen demand , was determined as the product of the heart rate and mean arterial pressure ( ( mapheart rate) 1,000 ) .", "rabbits were kept under appropriate animal care and were randomly divided into 6 groups as control ( ctl ) , rd , qi , hyperlipidemic ( h ) , hyperlipidemic+rd ( h+rd ) , and hyperlipidemic+qi ( h+qi ) ." ], [ "the high - fat diet induced hyperlipidemia as significant increase in the tc , ldl , and tg and atherogenic indices in all groups compared to its related basal values ( table 1 , figures 1 and 2 ) .", "yet , in those animals which received a combination of rd and high - fat diet , systolic , diastolic , and the mean arterial pressures increased significantly whenever it was compared to its corresponding groups , that is , the ctl , rd , and h. in this study , the high - fat regimen alone or plus qi had no significant effect on the blood pressure compared to its matching groups ( figure 3 ) .", "consumption of normal chow alone or along with rd or qi for 45 days did not cause any significant change on the lipid profile and atherogenic indices of the ctl and qi groups . the triglyceride level , however , showed significant increase in the rd group ( p < 0.01 ) .", "two atherogenic indices of plasma , tc / hdl and ldl / hdl , significantly increased in the h and h+rd groups ( p < 0.001 versus ctl and rd groups ) ." ], [ "this study aimed to assess the influence of the chronic administration of a methanolic extract of two famous herbal drugs , that is , rosa damascena l. and quercus infectoria , on hemodynamic , heart performance , lipid profile , and plasma atherogenic indices of rabbits with / without high - fat diet .", "the results revealed the obvious beneficial effect of qi on harmful outcomes of a hyperlipidic diet as the attenuation of plasma atherogenic indices , the prevention of hyperlipidemia , and the improvement of the cardiovascular performance . on the other hand", "the combination of the negative effect of hyperlipidemia on the vascular vasodilatation along with the partial increase of heart contractility due to positive inotropic effect of rd is a likely reason for explaining the high blood pressure and lvsp in the h+rd group .", ", the rd administration showed a mild decreasing effect on plasma lipid profile and the atherogenic indices ." ], [ "regarding some side effects of synthetic lipid - lowering drugs , for example , myopathy and liver damages for statins [ 25 , 37 ] and gastric irritation , flushing , hyperuricemia , dry skin , and abnormal liver function for pl synthetic inhibitors , qi can be considered as a new candidate for reducing plasma lipids in future human studies .", " the results of this study revealed the significant antilipidemic and antiatherogenic effects of qi but not rd .", "in addition , the use of rd along with a high - fat diet increased the risk of hypertension in rabbits .", "this may be partly mediated by the inhibition of pl and hmg coa reductase enzymes .", "if our results can be extrapolated to human , this adverse effect of rd in cases with hyperlipidemia context should be considered and investigated ." ] ]

[ [ "multicentric reticulohistiocytosis ( mrh ) is a rare multisystem syndrome characterized by polyarthritis and papulonodular skin lesions with typical dermal infiltration of histiocytes and multinucleated giant cells .", "an association with hyperlipidemia ( 3058% ) , a positive skin tuberculin test ( 1250% ) , systemic vasculitis and autoimmune disease has been described . of utmost clinical importance", "the disease may involve the skin , tendon sheath , synovium , bone , liver , salivary gland , kidney , lymph node , heart and lung . in mrh ,", "we report , for the first time , a case of mrh presenting with liver carcinoma , thus highlighting the association of mrh with malignant disease ." ], [ "a 61-year - old man presented with a 4-month history of a nonpruritic rash , which started on his forearm and face after sun exposure and subsequently spread to the ear , scalp and upper chest , after which asymptomatic skin lesions appeared on the lateral margin of his finger .", "he had a sensation of a foreign body in his pharynx with difficulty in swallowing for about 1 month .", "physical examination showed a confluent erythematous eruption affecting his scalp , face , neck and the extensor aspect of his forearm , which was characterized by ruby - red , translucent and grouped papules ( fig .", "red nodules could also be found on the dorsum of the nose , lateral area of the fingers and tongue tip ( fig .", "the cutaneous symptoms improved significantly within 1 month ( several large nodules disappeared immediately ; later , the erythematous rash and grouped papules resolved and the patient 's arthralgia and swelling of joints gradually improved ) ." ], [ "this is the first case report of mrh with liver carcinoma . although the etiology of mrh is unknown , the possibility that mrh reflects a constellation of symptoms seen within paraneoplastic syndrome", "the results are presented in table 1 ( including the present case ) . for most of these cases ( including the present case ) , the onset of malignancy and mrh occurred within approximately 3 years , and in some cases , the onset of mrh also occurred in close proximity to the time of recurrence of a previously diagnosed malignancy [ 13 , 15 ] .", "mrh is so rare that fewer than 300 cases have been reported in the literature . in 1969 ,", "mrh , often referred to as lipoid dermato - arthritis , was first reported in 1937 by weber and freudenthal .", "snow and muller reported a malignancy rate of 25% in 133 cases of mrh reported in the literature until 1994 .", "eleven [ 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 ] of the 66 cases we reviewed ( english - language literature from 1995 until now ) had cancer and were evaluated for the following parameters : age , sex , type of neoplasm at presentation , duration preceding or following the diagnosis of cancer that mrh developed and treatment response of both the tumor and mrh ." ] ]

[ [ "the prognostic parameters ( tumor size , extra - thyroidal extension of ptc , and lymph node metastasis ) were analyzed . among the subtypes of ptc samples in this group ,", "the immunohistochemistry ( ihc ) of the p27 protein expression in the ptc tumor tissue from all 23 cases was analyzed using paraffin - embedded tissue .", "the nontumor portions of the patient samples were used to measure the mrna levels of the following cytokines : tumor necrosis factor ( tnf- ) , interferon ( ifn- ) , il-2 , il-4 , il-10 , and il-1. the 13 cases with concomitant ptc and lt were referred to as the objective group , and the 10 cases of ptc without lt were used as a reference or control group .", "the nontumor portions were used for measuring the mrna quantities of the cytokines , and the ptc portions were subject to immunohistochemical staining of cip1 ( p21)/kip1 ( p27 ) for protein expression analysis , as described in more detail in later section .", "although it is known to be meaningless to compare the levels of cytokines from the same specimen , the expressed cytokine levels could be ranked and compared in this research via a quantitative real - time pcr method . using the concept of relative quantification , the cytokine values were corrected for differences in quality and quantity by dividing the concentration of a target rna by the concentration of a reference rna in the same sample ( relative ratio = concentration of target / concentration of reference ) .", "its measurement was evaluated by the following two - tiered grading system : low grade ( negative staining or faint staining in less than 30% of the tumor cells ) and high grade ( positive staining in more than 30% of the tumor cells ) ( fig .", "two cases were not performed , for the ihc sections for p27 were devoid of tumor tissue ." ], [ "fresh surgical samples of ptc with ( 13 cases ) or without ( 10 cases ) lt were collected from the records in the department of pathology with the patients agreement and the formal permission of the irb .", "the prognostic parameters ( tumor size , extra - thyroidal extension of ptc , and lymph node metastasis ) were analyzed . among the subtypes of ptc samples in this group ,", "the patients ranged in age from 35 to 59 years old , with a mean age of 47 .", "the nontumor portions were used for measuring the mrna quantities of the cytokines , and the ptc portions were subject to immunohistochemical staining of cip1 ( p21)/kip1 ( p27 ) for protein expression analysis , as described in more detail in later section .", "- 0194 ) , 23 patients from the department of pathology , gangnam severance hospital , were enrolled in this study ." ], [ "although it is known to be meaningless to compare the levels of cytokines from the same specimen , the expressed cytokine levels could be ranked and compared in this research via a quantitative real - time pcr method . using the concept of relative quantification", ", the cytokine values were corrected for differences in quality and quantity by dividing the concentration of a target rna by the concentration of a reference rna in the same sample ( relative ratio = concentration of target / concentration of reference ) .", "the most common way to compare expression levels of different samples is to designate one of the samples as calibrator , where all other samples are compared to this calibrator . for normalization of the final results ,", " this means that the reference gene was calculated , but the target gene could not be detected despite many pcr amplification processes . in these cases", "the reference gene value ( actin and 18s rna ) and il-1 value were measured in every sample .", "the nontumor portions of the patient samples were used to measure the mrna levels of the following cytokines : tumor necrosis factor ( tnf- ) , interferon ( ifn- ) , il-2 , il-4 , il-10 , and il-1. the 13 cases with concomitant ptc and lt were referred to as the objective group , and the 10 cases of ptc without lt were used as a reference or control group ." ], [ "the immunohistochemistry ( ihc ) of the p27 protein expression in the ptc tumor tissue from all 23 cases was analyzed using paraffin - embedded tissue .", "nuclear p27 immunoreactivity was considered altered when the expression was less than 30% of previously published , clinically relevant levels . in 21 cases ,", "its measurement was evaluated by the following two - tiered grading system : low grade ( negative staining or faint staining in less than 30% of the tumor cells ) and high grade ( positive staining in more than 30% of the tumor cells ) ( fig .", "optimum primary antibody dilutions were predetermined , and appropriate positive control samples ( tissues known to be positive for the immunohistochemical marker ) and negative control samples ( test tissue sections without the addition of primary antibody ) were used for p27 ( novocastra , newcastle upon tyne , uk ) .", "when p27 immunoreaction was interpreted , only the nuclear staining on ptc cells was regarded as positive .", "two cases were not performed , for the ihc sections for p27 were devoid of tumor tissue ." ], [ "the pearson chi - square test was used to examine the relationships of cytokines ( tnf- , ifn- , il-2 , il-4 , il-10 , and il-1 ) and p27 expression with the clinicopathological characteristics .", "all reported p - values were 2-sided , and the significance was set at .05 ." ], [ "the expression levels of tnf- , ifn- , and il-4 were significantly higher in the cases with lt than in those without lt ( p<.05 ) . in terms of p27 as a surrogate marker for lymph node metastasis , the degree of p27 expression was not correlated with lymph node metastasis in this study ; high - grade expression of p27 had a tendency to occur in ptc cases with lt .", "hence , in this study , p27 was used as a surrogate marker of lymph node metastasis in the cases of microcarcinoma ( as an incipient carcinoma ) .", "finding , which revealed in the insufficiency of the ptc cases without lt to serve as a reference group , this study adopted a new goal to use the ptc cases with lt to analyze the relationship between cytokine immune profiles and prognostic parameters .", "therefore , the statistical analysis of this profiles solely made use of the ptc cases with lt ." ], [ "based on these factors , the cytokine expression in the ptc samples with lt represented a mixed th1 ( tnf- and ifn- ) and th2 ( il-4 and il-10 ) immunity . after manipulating data using the concept of a calibrator with il-1 , each sample of ptc without lt", "in contrast to the cases of ptc with lt , the cases without lt frequently exhibited nondetectable cytokine levels . among the six cytokines analyzed , the expression levels of ifn- , il-10 , and il-2 levels were too low to be measured . based on these data ,", "the subtypes of the ptcs with lt were determined to be the most conventional ( 11/13 , 84.61% ) , and those of only two cases were follicular variants ( 2/13 , 15.38% ) .", "the subtypes of the ptcs with lt were all conventional ( 10/10 , 100% ) .", "the cytokines expressed in ptc without lt represented a mixed th1 ( tnf- ) and th2 ( il-4 and il-1 ) immunity .", "the cytokine immune profiles were summarized into two groups : the cases with lt ( n=13 ) and the cases without lt ( n=10 ) .", "after manipulating the data using the concept of a calibrator with il-1 , each sample of ptc with lt was compared ( table 1 ) . among the six cytokines analyzed ," ], [ "the subtypes of the ptcs with lt were determined to be the most conventional ( 11/13 , 84.61% ) , and those of only two cases were follicular variants ( 2/13 , 15.38% ) .", "of the 13 cases of this type , six cases showed extrathyroidal tumor extension ( et ) ( 6/13 , 46.15% ) , and two cases presented with lymph node metastasis ( 2/13 , 15.38 % ) .", "the tumor sizes ranged from 0.2 to 1.1 cm , with an average of 0.55 cm ." ], [ "the subtypes of the ptcs with lt were all conventional ( 10/10 , 100% ) . three cases with et were present ( 3/10 , 30% ) .", "tumor sizes ranged from 0.1 to 1.5 cm , with an average of 0.61 cm ." ], [ "in all 23 cases , the cytokine immune profiles were summarized into two groups : the cases with lt ( n=13 ) and the cases without lt ( n=10 ) .", "the cytokines could have originated from inflammatory cells , thyroid tissue , and endothelial cells . in this research ," ], [ "after manipulating the data using the concept of a calibrator with il-1 , each sample of ptc with lt was compared ( table 1 ) . among the six cytokines analyzed ,", "tnf- , il-4 , and ifn- were relatively well expressed . based on these factors , the cytokine expression in the ptc samples with lt represented a mixed th1 ( tnf- and ifn- ) and th2 ( il-4 and il-10 ) immunity ." ], [ "in contrast to the cases of ptc with lt , the cases without lt frequently exhibited nondetectable cytokine levels . among the six cytokines analyzed , the expression levels of ifn- , il-10 , and il-2 levels were too low to be measured . based on these data ,", "after manipulating data using the concept of a calibrator with il-1 , each sample of ptc without lt was compared ( table 2 ) .", "the cytokines expressed in ptc without lt represented a mixed th1 ( tnf- ) and th2 ( il-4 and il-1 ) immunity ." ], [ "the expression levels of tnf- , ifn- , and il-4 were significantly higher in the cases with lt than in those without lt ( p<.05 ) . in terms of p27 as a surrogate marker for lymph node metastasis , the degree of p27 expression was not correlated with lymph node metastasis in this study ; high - grade expression of p27 had a tendency to occur in ptc cases with lt .", "the prognostic parameters ( tumor size , et , and lymph node metastasis ) were not statistically related to lt , but the cases without lt had a tendency for lymph node metastasis ( table 3 ) .", "the cases with lt had enhanced expression of the cytokines ( tnf- , ifn- , il-4 , il-10 , and il-2 ) compared to the samples of ptc without lt . among the five cytokines ,", "in contrast , lymph node metastasis occurred slightly more frequently in ptc cases without lt . conclusively", ", the degree of p27 expression did not show any correlation with lymph node metastasis in this study ( p=.15 ) ( table 4 ) ." ], [ "the cases with et had a tendency to demonstrate higher levels of cytokine expression than those with intrathyroidal tumor confinement ( table 6 ) .", "except for the il-4 cytokine , the expression levels of the cytokines tnf- , ifn- , and il-10 were lower in the cases with low - grade expression of p27 than those with high - grade expression of p27 , but there was no statistical significance ( table 5 ) .", "again , there was no statistical significance . in summary , although the data were not statistically significant , the trends follow a pattern where higher cytokine levels were present in the cases with high grade expression of p27 ( except for il-4 ) and et .", "hence , in this study , p27 was used as a surrogate marker of lymph node metastasis in the cases of microcarcinoma ( as an incipient carcinoma ) .", "due to this unexpected finding , which revealed in the insufficiency of the ptc cases without lt to serve as a reference group , this study adopted a new goal to use the ptc cases with lt to analyze the relationship between cytokine immune profiles and prognostic parameters .", "therefore , the statistical analysis of this profiles solely made use of the ptc cases with lt .", "in addition , the ptc cases in this study were mostly microcarcinomas , which might represent the incipient phase of the tumors ." ], [ "this study revealed the presence of mixed th1 ( ifn- , tnf- , and il-2 ) and th2 ( il-4 and il-10 ) immunity in lymphocytes in cases of ptc with lt .", "furthermore , except for il-4 , all cytokines were decreased in the cases with lt and p27 underexpression , which represents the increased possibility of lymph node metastasis . because il-4 is associated with aggressive ptc , the fact that all cytokine except il-4 were highly expressed in the cases with lt and increased p27 expression supports the hypothesis that high expression of cytokines except il-4 may contribute to anticancer effect on the ptc in terms of lymph node metastasis .", "this may implicate that the cases with lower levels of mixed th1 and th2 cytokines have a higher probability of having lymph node metastasis . considering the low cytokine expression in the cases with underexpression of p27 ( except for il-4 ) , our results indicate that mixed th1 and th2 immune cytokines have a tendency toward anticancer effects in terms of lymph node metastasis . to predict tumor prognosis from cytokine levels", "we propose that the higher expression of cytokines tnf- , ifn- , il-2 , and il-1 might inhibit nodal metastasis but not inhibit ( or possibly enhance ) the extrathyroidal extension . in view of helper t cell immunity , mixed th1 and th2 immunity seems to play a role in anticancer activity by inhibiting lymph node metastasis .", "the higher expression of cytokine levels had a tendency to be associated with high p27 immuno - reactivity ( table 5 ) ." ] ]

[ [ "an 83-year - old woman presented with sudden visual loss that had developed in both eyes ( oculus uterque , ou ) the previous day .", "her visual acuities included perception of light in the right eye ( oculus dexter , od ) and perception of hand motion in the left eye ( oculus sinister , os ) .", "fundus examination revealed mild retinal arterial narrowing and chalky - white disc swelling ou ( fig .", "lymphocytes , epithelioid histiocytes , and multinucleated giant cells had diffusely infiltrated into the entire vessel wall , especially in the arterial wall media ( fig .", "however , after 4 months , the patient 's visual acuities deteriorated to no light perception od and light perception os ." ], [ "these test results are known to be normal in non - arteritic aion . in conclusion , although this disease is rare in asians , gca - associated aaion should be considered when an elderly patient presents with sudden visual loss and disc edema .", "only a few biopsy - confirmed gca cases have been reported ; however , there have been no gca - associated aaion cases so far . to our knowledge , this is the first biopsy - confirmed report of gca - associated aaion in korea . our patient was diagnosed with silent gca , and the clinical features overlapped with non - arteritic aion .", "however , a nation - wide epidemiologic study would be needed to clarify the association of life span and gca incidence in asians . in korea ,", "however , the occurrence of gca is rare in african americans , hispanics , and asians [ 8 - 10 ] .", "gca should be strongly suspected when patients greater than 50 years of age present with headaches ." ] ]

[ [ "in addition , we characterized the particles with field \n emission gun scanning electron microscopy ( feg - sem ) and tunneling \n electron microscopy ( tem ) , energy - dispersive x - ray spectroscopy ( edx ) , \n x - ray powder diffraction ( xrd ) , and attenuated total reflection fourier \n transform infrared spectroscopy ( atr - ftir ) . combining these data we \n propose a possible explanation why specific minerals , in particular \n k - feldspars , are good in , whereas others are not .", "we performed experiments with the oil - immersion freezing \n method with pure and pretreated ( heated , enzymatic pretreated , milled ) \n dust particles .", "conclude that k - feldspar is the key \n component determining the ina of atmospheric mineral dusts . as already mentioned , the majority of the studies concentrated \n on the experimental description of the ice nucleation behavior of \n mineral dusts . in case of immersion freezing", "the main mineral \n dust particles found in the atmosphere are clays ( kaolinite , illite , \n montmorillonite ) , quartz , feldspars , and calcite . within the \n last years , extensive efforts have been made to better \n understand and predict the role of mineral dusts in the formation \n of atmospheric ice clouds .", "cloud microphysics determine cloud albedo in \n the visible and infrared ( ir ) spectral ranges , cloud lifetime , and \n precipitation properties ." ], [ "oil - immersion \n freezing experiments under a cryomicroscope were \n carried out to test the ina of different mineral dust samples . in \n addition , the particles were characterized regarding their surface \n and bulk properties by the following set - ups .", "in total the ina \n of 13 different mineral dust samples was investigated with the cryomicroscope . \n", "nucleation properties of the samples \n were obtained with an optical microscope and a homemade cryocell . \n", "the ina of the mineral dust particles was investigated \n with pure \n ( as purchased ) and freshly milled , heat - treated , and enzyme - treated \n particles .", "second , the most ice \n nucleation active samples were selected and \n heated at 523 k for 45 h. in addition , the feldspars and quartz \n i were also heated at 373 and 773 k to control for surface alteration \n with temperature and to remove possible organic impurities , which \n are known to promote ice nucleation in some cases , and to ensure that \n the ina is only related to the mineral phases .", "the surface areas of the quartz \n and montmorillonite samples were measured using a commercial liquid \n nitrogen adsorption system ( asap2020 , micromeritics ) .", "the studied samples are calcite , gypsum , three different quartz samples \n ( quartz i , quartz ii , quartz iii ) , microcline , albite , andesine , arizona \n test dust ( atd ) , montmorillonite , kaolinite , limestone , and volcanic \n ash ( table 1 ) ." ], [ "in total , the ina of 13 mineral dust samples was \n investigated with \n the cryo - microscope ( table 1 and supporting information ) .", "the most active species with t50 values > 247 k are quartz i , microcline , \n atd , \n and kaolinite .", "the most active dusts are quartz , microcline \n ( k - feldspar ) , atd , and kaolinite .", "the absolute \n number of active surface nucleation site density ns was calculated using the relation given in eq 1 , where fice is the frozen \n fraction at the given temperature t and s is the particle surface per droplet obtained directly from bet specific \n surface area.1 active surface site density depending on temperature plotted \n for \n all quartz samples .", "the minerals are grouped into nonsilicates , quartz , feldspar , \n clays , and natural samples ." ], [ "it can not be stated directly that only the mineral \n composition determines the ina as volcanic ash eruptions are often \n accompanied by sulfuric acid and other gases that may alter the surface \n and ice nucleation properties .", "on the basis of the experiments , we suggest that the \n defect density is different in the three quartz samples , and that \n it is increased by mechanical milling , which is known to generate \n nucleation sites .", "surface amphotericity and \n size matching between the ice structure and the solid surface has \n a strong influence on ina . obviously , it is not the perfect quartz \n surface itself that nucleates ice at a higher temperature ( see the \n low in activity of the coarse quartz iii ) , but rather local defects , \n which would support the concept of active sites", "adsorption \n of water through surface oh groups of the silica is reported , which is in agreement with later studies on \n kaolinite .", "k - feldspar rich volcanic ash has \n a larger tendency to act as a good in than ash containing mainly plagioclases \n ( na / ca - feldspar ) .", "the investigated volcanic ash \n acts as a rather poor in with a t50 of \n 238 k. the ash sample from the eyafjallajkull eruption 2010 \n is mainly composed of the weak in albite ( na - feldspar ) ." ], [ "the latest studies showed also good ice nucleation activities in the deposition \n mode for the orthoclase phase of k - feldspar , so the increased activity \n of k - feldspar need not be phase specific .", "our results indicate that the higher ina of the k - feldspar sample \n is an intrinsic property and not a result of adsorbed organic / biological \n material .", "the sem images of the feldspar \n samples are quite similar and a morphological difference can not explain \n the different ice nucleation behavior . on the basis of the tem - edx \n measurements , if ice nucleation occurs at macroscopic defect sites \n such as cracks , it is not due to a local element accumulation , but \n rather to the steric configuration there .", "the structure of feldspars is \n closely related to quartz , but si is partly substituted by al .", "the ion charge density of the cations of the mineral was already \n suggested to influence ice nucleation on mineral surfaces ." ], [ "different quartz samples showed \n a large discrepancy of their ina . \n with the presented idea of domains of molecular sites able to bind \n and arrange water molecules in an ice - like structure acting as ice \n nucleation sites", ", we suggest that the history of the quartz particles \n and dust particles in general has an important influence .", "the ice \n nucleation behavior of various mineral samples was investigated with \n a special focus on feldspars , which are known to be among the most \n ice nucleation active species .", ". \n the size of the cation , and its binding energy toward water are the \n key factors determining ina .", "the nucleation sites suggested here are not necessarily the same on \n each particle , but rather caused by a stochastic arrangement of functional \n groups which are able to bind water molecules .", "the feldspars are more ice nucleation active than most quartz samples , \n and k - feldspar is by far the most active in of the feldspar family", "ina is enhanced \n by introducing more defects to a quartz surface by mechanical milling . \n" ] ]

[ [ "phylogenetic relationships among genotypes 14 and wild boar , rabbit , rat , avian , bat , and ferret isolates of hepatitis e virus .", "genomic structure of strains from the united states was similar to that of 2 strains from the netherlands .", "the entire genome of strains from the united states shared relatively high nucleotide sequence identities ( 82.4%82.5% ) with strains from the netherlands ." ], [ "we amplified the entire genome of 2 ferret hev strains isolated from laboratory ferrets imported from the united states .", "nucleotide sequence comparisons showed that 2 ferret hev strains from the united states had high ( 99.6% ) identity and shared 98.6%100% identities with partial sequences of orf1 that were detected in the united states ( 11 ) , which indicated that genetically similar ferret hev was circulating in laboratory ferrets .", "ferret hev like particles derived from 1 of the isolates from the netherlands were cross - reactive with serum from hev - infected laboratory ferrets in the united states ( 11 ) . in conclusion , we isolated and identified 2 ferret hev strains from laboratory ferrets imported from the united states ." ] ]

[ [ "there are a few recent \n reports regarding the effectiveness of extracorporeal shock wave therapy ( eswt ) on \n neurogenic heterotopic ossification ( ho ) in the lower extremity , but to our knowledge , the \n use of eswt or rswt to treat neurogenic ho in the upper extremity has not been reported in \n the literature4 .", "radial extracorporeal shock wave therapy ( rswt ) generates pressure waves through the \n collision of solid bodies1 .", "we report 2 cases of rswt used to treat neurogenic ho in the upper extremities . in both \n cases , improvements in pain ,", "range of motion ( rom ) , muscle strength , and hand function were \n observed ." ], [ "a 49-year - old man was admitted to our physical medicine and rehabilitation ( pmr ) \n department .", "( a ) in case a , bone scan , x - ray , and musculoskeletal ultrasound demonstrate ho in the \n left shoulder and elbow .", "1.(a ) in case a , bone scan , x - ray , and musculoskeletal ultrasound demonstrate ho in the \n left shoulder and elbow .", "the target points of rswt were the ho area that \n could be seen with usg .", "a subarachnoid hemorrhage ( sa ) occurred 10 months prior to admission and \n neurogenic ho of the left shoulder and elbow was diagnosed 2 months before his admission ." ], [ "a 52-year - old man with a 6-month history of hypoxic brain injury was admitted to our pmr \n and diagnosed with neurogenic ho of the right elbow ( fig . \n 1 ) .", "pain was reduced from 8 to 0 on the nrs , and the patients remained pain - free \n for 1 month after treatment . in case a , rom of flexion , abduction , adduction , internal rotation , and external rotation \n of the left shoulder and additionally , flexion of the left elbow was improved and \n maintained .", "functional testing of hand strength and speed of hand movement showed \n improvements that were maintained at least for 1 month after the end of treatment ( table 1 ) .", "the \n strength of the hand and speed of hand movement improved , and these improvements were \n maintained at least for 1 month after the end of treatment ( table 1 ) .", "the intensity level ranged from 25 bars , and it was \n administered 5 times a week for 4 weeks , a total of 20 treatments . during rswt , all other \n treatments , including physical and occupational therapy , were continued as usual .", "follow up period was 4 weeks . improved score ; nt : not testable ; \n affected side in case b , right elbow flexion , supination , and pronation were improved , the improvements \n were maintained for 1 month . in contrast to case a , improvement in the mmt result was not \n seen ( table 1 ) . in the hand function test ," ], [ "eswt has been described in several case reports as a new treatment strategy for neurogenic \n ho , but it has been restricted to the lower extremities7 .", "ho is a complicated and significant medical problem characterized by abnormal growth of \n bone in soft tissues , commonly around large joints . in its severe form", "eswt has been shown to promote bone healing in stress fractures , \n avascular necrosis , and delayed and/or bony nonunion , and it has been widely used for \n managing the pain of various musculoskeletal conditions8 .", "based on the results of these studies , it is our opinion that \n imaging findings do not accurately reflect the pain and function caused by neurogenic \n ho .", "the improvements observed in rom , mmt , and hand function of the present two cases could be \n associated with pain reduction , since proper management of pain caused by neurogenic ho with \n rswt could have been the cause of the improvements in rom and hand function ." ] ]

[ [], [ "while the majority of these injuries occur when a child steps down the stairs , approximately 3 % of injuries will be associated with a caregiver falling while carrying a child .", "this specific mechanism has been shown to result in injury patterns that are more likely to necessitate hospitalization and more likely to involve trauma to the head and fractures to the extremities .", "while it is often necessary for a parent or caregiver to carry children in their arms while walking down stairs , the child may obstruct the caretaker s view on the stairway ( fig . ", "stairway falls are a leading cause of injury in patients less than 5 years of age [ 1 , 2 ] .", "this can lead to a fall by the caretaker and an injury to the child and/or caretaker . to date , several previous studies have been conducted evaluating stairway injuries in children , but none have focused on this specific mechanism ( fall from caregiver s arms ) or the injuries associated with these falls . the goal of this study was to identify injuries that may occur when a caretaker falls while carrying a child on a stairway , to understand the pathomechanics of this injury , and to perform a cost analysis of the injury.fig . ", "d bird s eye view of how the child can obstruct the caretaker s view on the stairway a side view of the caretaker s unobstructed view on the stairway .", "d bird s eye view of how the child can obstruct the caretaker s view on the stairway" ], [ "sixteen children were retrospectively found to have a fracture from a fall - in - arms injury sustained while a caregiver was going down stairs , and were included in this study .", "emergency department and orthopedic clinic records were reviewed between 2004 and 2012 to identify patients with an orthopedic injury after a fall from stairs .", "the following demographic and epidemiologic data were recorded for each patient : age , gender , location of injury , and mechanism of fall .", "patient identification occurred at a routine weekly fracture conference , where every emergency department fracture in which the orthopedic service was consulted was presented .", "if the patient met the inclusion criteria , they were then added to the database .", "this study was granted a waiver of informed consent , including permission and assent , in accordance with 45 cfr 46.116(d ) and 45 cfr 46.408 , and a waiver of hipaa authorization per 45 cfr 164.512(i ) ." ], [ "after a social service consultation and a skeletal survey were obtained in these cases , no patient was felt to be the victim of child abuse . for those children not requiring a skeletal survey ,", "five of the 16 children ( 31 % ) had a skeletal survey , as the treating physicians were concerned about possible child abuse ; the average total charge for those receiving a skeletal survey was $ 7,024 .", "the age at the time of injury averaged 14 months and ranged from 7 months to 51 months of age .", "three children ( 19 % ) required a closed reduction of their femur fractures in the operating room ; their total care charges averaged $ 23,568 . for the children", "interviews with the parents yielded information regarding the specifics of the fall and the possible pathomechanics of the child s injuries . the parent or caregiver noted in all cases that the child was being held in front as they descended the stairs ." ], [ "injuries incurred on stairs , particularly in patients under the age of five , can occur with relative frequency .", "this paper describes the type of orthopedic injuries sustained during a fall down stairs while in a caregiver s arms .", "the costs of treating these injuries are not insignificant , averaging nearly $ 7,000 , and the suspicion of child abuse can be both costly and unnecessary in the case of a true accident . while descending the stairs with a child in their arms , the caregiver should hold the child to the side so as not to obscure their vision of the step with one arm , ideally holding the handrail with the other .", "what our study adds to the literature is that nearly one - third of the children underwent a skeletal survey due to concerns regarding child abuse .", "although this model has not been validated , and was not employed here , it may provide guidance to treating physicians and can reduce costs and avoid exposing patients to unnecessary radiation from a skeletal survey . in our series , all caregivers were able to provide a detailed history regarding the nature of their child s injury , and subsequent non - accidental trauma work - ups suggested no cases of abuse . additionally , no child in our study had a concomitant injury other than the fracture ." ] ]

[ [ "prost - type pg derivatives ( that is , pg derivatives other than unoprostone ) are now the drugs of first choice for the treatment of glaucoma because of their potent intraocular pressure ( iop)-lowering activity , the low likelihood of systemic adverse reactions , the once - daily application , and good patient adherence . as of end", "july 2009 , tafluprost has been approved in 21 countries . no preservative - free tafluprost preparation has yet been marketed in japan , even though both a preservative - containing preparation ( tapros ) and a preservativefree preparation ( taflotan ) have been marketed in other countries .", "in addition , in 2008 tafluprost was marketed in some european countries and in japan .", "this review will describe the pharmacological profile of tafluprost ( the latest pg derivative ) and also the clinical studies of this drug conducted across the world , while focusing especially on those conducted in japan .", "to date , four prostaglandin ( pg ) derivatives ( unoprostone , latanoprost , travoprost and bimatoprost ) have been marketed across the world ." ], [ "( tokyo , japan ) , their original concept having been to develop a new product with an efficacy and safety comparable to or higher than those of latanoprost ( a prostanoid fp receptor agonist ) .", "we previously reported that the iop - lowering activity of each of these pg derivatives was absent in prostanoid fp receptor - knockout mice , indicating that the fp receptor is involved to a greater or lesser extent in the iop - lowering action of each pg derivative.8,9", "it has been reported that tafluprost not only has an affinity for the fp receptor that is about 12 times higher than that of latanoprost , but that it has almost no potential to bind to the other receptors.3 among the other pg derivatives , the affinity of travoprost for the prostanoid fp receptor has been reported to be 2.8 times as high as that of latanoprost.4 for both unoprostone and bimatoprost , the receptors on which they act were uncertain at the time of launch onto the market . however , each had been reported to have a low affinity for the prostanoid fp receptor.5,6 later , only nonmetabolized bimatoprost was found not to bind to the conventional fp receptor , but instead to the prostamide receptor , which is a complex receptor consisting of fp and splice - variant fp receptors.7 figure 2 shows images indicating the receptorbinding affinities of pg derivatives for various prostanoid receptors . a simple summary of these reports on the affinities of the existing pg derivatives for the fp receptor would be that tafluprost has the highest affinity for the fp receptor among the pg derivatives currently available ( notably , higher than that of latanoprost ) .", "prost - type pg derivatives ( ie , those other than unoprostone ) , were discovered as compounds that retained the 15-position hydroxyl group of natural pgf2 , and had high pharmacological activity ." ], [ "the iop - lowering activity of tafluprost has been demonstrated both in ocular normotensive monkeys and in laser - induced ocular hypertensive monkeys.3 in the former the maximal iop reductions achieved with a single dose of tafluprost ( 0.00002 to 0.0025% ) were dose - dependent , with statistical significance being reached at doses of 0.0005 and 00025% , and the potency of tafluprost at 00005% was almost equal to that of latanoprost at 0005% ( figure 3).3 similarly , in laser - induced ocular hypertensive monkeys , single - dose applications of tafluprost ( 0.00002 to 0.0025% ) induced a dose - dependent iop reduction.3 when normotensive monkeys received repeated doses of tafluprost ( 0.0015% , 0.0025% , or 0.005% ) once daily for 5 days , this drug exhibited iop - lowering effects not only on the first day , but also on the third and fifth days of administration , without an attenuation of efficacy over time ( figure 4).3 when 0.005% of latanoprost was administered instead in the same study , the iop measured at 24 hours after each dose was equal to the baseline iop level . however , when any one of the above concentrations of tafluprost was administered , the iop levels at the trough - points on the third to fifth days were significantly lower than those in the vehicle - treatment group ( figure 4).3 these results suggest that the duration of action of tafluprost may become longer upon repeated dosing .", "since we really do not have sufficient means of measuring blood flow in animal models and human eyes , the clinical relevance of improvement of ocular blood flow by pg derivatives including tafluprost should be verified in the future study . in a recent study ,", "they also noted that in a rat model of optic - nerve crush , treatment with tafluprost ophthalmic solution increased the survival rate of retinal ganglion cells .", "kanamori et al14 reported neuroprotective effects of tafluprost . in a rat model in which retinal ganglion cell apoptosis was induced by serum - removal or by glutamate exposure" ], [ "thus the penetration of tafluprost into the anterior chamber is apparently not affected by preservative benzalkonium chloride . at present , there are insufficient clinical data comparing tafluprost and other pg derivatives because of its short marketing history .", "the second phase iii clinical study of tafluprost was designed as a long - term dosing study primarily aimed at evaluating its safety in prolonged use . in that study involving 351 patients with open angle glaucoma ( including normotensive glaucoma ) or ocular hypertension ", "clinical studies on tafluprost have been carried out both in western countries1419 and in japan , in each case using preservativecontaining tafluprost preparations .", "of the three phase iii clinical studies conducted in japan , one was designed as a non - inferiority study aimed at comparing the efficacy of tafluprost with that of latanoprost . in that study" ], [ "thus the penetration of tafluprost into the anterior chamber is apparently not affected by preservative benzalkonium chloride . at present , there are insufficient clinical data comparing tafluprost and other pg derivatives because of its short marketing history .", "the second phase iii clinical study of tafluprost was designed as a long - term dosing study primarily aimed at evaluating its safety in prolonged use . in that study involving 351 patients with open angle glaucoma ( including normotensive glaucoma ) or ocular hypertension ", "clinical studies on tafluprost have been carried out both in western countries1419 and in japan , in each case using preservativecontaining tafluprost preparations .", "of the three phase iii clinical studies conducted in japan , one was designed as a non - inferiority study aimed at comparing the efficacy of tafluprost with that of latanoprost . in that study" ], [ "it is a clear , colorless aqueous ophthalmic solution , with a ph of 5.7 to 6.3 and an osmotic pressure ratio of 1.0 to 1.1 .", "thus , since this ophthalmic solution can be stored at room temperature and is supplied in a highly comfortable container , there is expected to be high adherence of patients to the dosing instructions .", "hyodo et al24 reported that this container was highly praised in an evaluation of various indicators of the impressions of users , and that elderly patients ( 65 years old ) could use it as easily as nonelderly patients .", "the phase iii clinical trial of 4 weeks aimed at comparing to latanoprost revealed that the incidence of adverse reactions did not differ between those two treatment groups ( 40.0% and 48.1% , respectively , p = 0.443 , fisher s exact test ) .", "this product is intended to be stored at room temperature , and its expiration period is 3 years after manufacture .", "it contains 15 g tafluprost per ml , a concentration that is the lowest among the pg derivative preparations on the japanese market ." ], [ "it is a clear , colorless aqueous ophthalmic solution , with a ph of 5.7 to 6.3 and an osmotic pressure ratio of 1.0 to 1.1 .", "it contains 15 g tafluprost per ml , a concentration that is the lowest among the pg derivative preparations on the japanese market .", "this product is intended to be stored at room temperature , and its expiration period is 3 years after manufacture .", "hyodo et al24 reported that this container was highly praised in an evaluation of various indicators of the impressions of users , and that elderly patients ( 65 years old ) could use it as easily as nonelderly patients .", "thus , since this ophthalmic solution can be stored at room temperature and is supplied in a highly comfortable container , there is expected to be high adherence of patients to the dosing instructions ." ], [ "tafluprost 0.0015% ophthalmic solution contains a new pg analogue with an iop - lowering activity and safety comparable to those of latanoprost . since it can be stored at room temperature and is supplied in a container that patients find easy to handle , there is expected to be a high patient adherence to the dosing instructions ." ] ]

[ [ "sleep disorders and diurnal sleepiness are frequent in parkinson s disease.1 polysomnography studies have shown rapid - eye - movement ( rem ) sleep dysregulation with rem sleep onset on diurnal naps2,3 and loss of muscle atonia,4 which is defined as excessive amount of sustained or intermittent elevation of submental electromyographic tone or excessive phasic submental or limb electromyographic twitching.4 loss of rem atonia is a core phenomenon of rem sleep behavioral disorder ( rbd),5 a condition characterized by vigorous and injurious motor behaviors during rem sleep.6 the orexin system plays a key role in rem sleep regulation .", "the loss of orexin neurons results in narcolepsy - cataplexy , a condition characterized by severe diurnal sleepiness , rem sleep onset during daytime naps , and cataplexies .", "rem sleep without atonia ( rswa ) and rbd have also been reported to occur in narcolepsy.7 orexin neurotransmission has been shown to be altered in parkinson s disease ( pd).810 however , polysomnographic data were not available in these postmortem studies .", "furthermore , we showed that ventricular orexin levels were not correlated with mean sleep latency , suggesting that orexin deficit might not be involved in daytime sleepiness in pd.11 thus , the clinical expression of orexin deficit in pd remains unknown.12 the objective of this study was to determine whether orexin - a levels in ventricular cerebrospinal fluid ( csf ) from pd patients were correlated with rem sleep without atonia ." ], [ "consecutive patients with idiopathic pd13 who were scheduled for deep brain - stimulation neurosurgery were invited to participate in the study , irrespective of whether they had sleep complaints .", "sleep stages were scored by two sleep specialists who had extensive experience with recordings in pd patients ( ab and xd ) , according to the modified american academy of sleep medicine criteria,14 with allowance for rswa .", "tonic and phasic emg activities were scored from the submental emg signal per 3-second mini - epochs of rem sleep containing or not containing any emg activity ( tonic , phasic , or a combination of both emg activities).17 we then reported loss of rem atonia as the percentage of rem sleep mini - epochs with any emg activity .", "we did not include patients taking medications known to affect sleep or rem atonia or patients with sleep apnea syndrome defined as an apnea / hypopnea index greater than ten per hour of sleep .", "rswa was scored as previously described by lapierre and montplaisir.16 tonic chin - muscle activity during rem sleep was defined as chin emg amplitude greater than twice the amplitude measured during a baseline emg signal for atonia .", "disease severity was assessed based on the motor subscore of the unified parkinson s disease rating scale iii after overnight withdrawal of dopaminergic treatment .", "ventriculography performed to assist in the proper placement of an electrode in the subthalamic nucleus require the removal of csf just before the injection of the contrast agent into the ventricle . in each of our patients ," ], [ "consecutive patients with idiopathic pd13 who were scheduled for deep brain - stimulation neurosurgery were invited to participate in the study , irrespective of whether they had sleep complaints .", "we did not include patients taking medications known to affect sleep or rem atonia or patients with sleep apnea syndrome defined as an apnea / hypopnea index greater than ten per hour of sleep .", "disease severity was assessed based on the motor subscore of the unified parkinson s disease rating scale iii after overnight withdrawal of dopaminergic treatment .", "the study was approved by the appropriate ethics committee , and informed consent was obtained from all patients prior to study inclusion ." ], [ "tonic and phasic emg activities were scored from the submental emg signal per 3-second mini - epochs of rem sleep containing or not containing any emg activity ( tonic , phasic , or a combination of both emg activities).17 we then reported loss of rem atonia as the percentage of rem sleep mini - epochs with any emg activity .", "rswa was scored as previously described by lapierre and montplaisir.16 tonic chin - muscle activity during rem sleep was defined as chin emg amplitude greater than twice the amplitude measured during a baseline emg signal for atonia .", "sleep stages were scored by two sleep specialists who had extensive experience with recordings in pd patients ( ab and xd ) , according to the modified american academy of sleep medicine criteria,14 with allowance for rswa .", "phasic emg events were defined as any burst of activity lasting 0.35 seconds and having amplitude greater than four times the baseline emg signal .", "sleep recordings were obtained during attended polysomnography 1 week before the scheduled date of neurosurgery .", "patients took their usual pd medications and were free to go to sleep when they wanted to ." ], [ "ventriculography performed to assist in the proper placement of an electrode in the subthalamic nucleus require the removal of csf just before the injection of the contrast agent into the ventricle . in each of our patients ,", "3 ml of ventricular csf was immediately frozen and stored at 80c until use for the orexin - a assay8" ], [ "the detection limit was 50 pg / ml , and intra - assay variability was 5% . each csf sample was tested in duplicate .", "orexin - a ( hypocretin-1 ) was measured in crude csf using a commercially available radioimmunoassay kit ( phoenix pharmaceuticals , belmont , ca , usa ) ." ], [ "correlations between orexin - a levels and sleep parameters were evaluated using spearman s rank - correlation test and the nonparametric mann - whitney test ." ], [ "we studied eight consecutive patients four males and four females whose clinical features are reported in table 1 .", "is considered clinically significant when any submental emg activity was present for more than 18% of the total rem sleep duration . according to this criterion , four of our patients had rswa ( # 2 , # 3 , # 4 , and # 7 ) .", "in contrast , orexin - a levels showed a significant positive correlation with the percentage of rem epochs without atonia , ie , percentage of 3-second mini - epochs classified as any ", "these four patients had higher median ( interquartile range ) orexin - a levels than the four patients with rem sleep atonia ( 235 pg / ml [ 215345 ] vs 94 pg / ml [ 44147 ] ; mann whitney test p = 0.036 , figure 1b ) .", "orexin - a levels did not correlate with total sleep time ( p = 0.23 ) , rem duration ( p = 0.45 ) , or rem latency ( p = 0.66 ) .", "no patients or bed partners reported violent movements during sleep , although the spouse of patient # 7 reported limb and body jerking ." ], [ "we studied eight consecutive patients four males and four females whose clinical features are reported in table 1 .", "no patients or bed partners reported violent movements during sleep , although the spouse of patient # 7 reported limb and body jerking .", "in all eight patients , surgery was performed under regional anesthesia between 10 am and 12 am ." ], [ "orexin - a levels did not correlate with total sleep time ( p = 0.23 ) , rem duration ( p = 0.45 ) , or rem latency ( p = 0.66 ) .", "in contrast , orexin - a levels showed a significant positive correlation with the percentage of rem epochs without atonia , ie , percentage of 3-second mini - epochs classified as any ", "is considered clinically significant when any submental emg activity was present for more than 18% of the total rem sleep duration . according to this criterion , four of our patients had rswa ( # 2 , # 3 , # 4 , and # 7 ) .", "these four patients had higher median ( interquartile range ) orexin - a levels than the four patients with rem sleep atonia ( 235 pg / ml [ 215345 ] vs 94 pg / ml [ 44147 ] ; mann whitney test p = 0.036 , figure 1b ) ." ], [ "our results show a significant relationship between ventricular csf orexin - a levels and rem sleep characteristics in patients with pd . despite the small number of patients", "our results suggest that orexin - a signaling may be associated with loss of muscle atonia during rem sleep in patients with pd . to our knowledge , this is the first study of potential correlations between ventricular csf orexin - a levels and polysomnographic data in patients with pd .", "pd patients with higher ventricular csf orexin levels exhibited larger numbers of rswa epochs than did patients with lower orexin levels , suggesting that preserved orexin drive may be involved in loss of rem atonia ." ], [ "the loss of rem atonia in patients with higher orexin levels illustrates the complexity of the symptoms induced by altered orexin neurotransmission in pd.28 experimental trials of orexin antagonists could be of interest in the transgenic mouse model of rswa ." ] ]

[ [ "for example : acu - tens ( tens applied to an acupoint ) and \n teas ( transcutaneous electric acupoint stimulation ) that involves any electric current \n applied to acupoints10 . in this study , two different areas of electrodes , 1 cm and 15 cm , \n te5 ( waiguan ) and pc6 ( neiguan ) acupoints . according to chinese traditional medicine \n stimulation of the te5 acupoint", "the latency of the \n pain threshold and its intensity in healthy subjects subjected to cold - induced pain was \n measured .", "this study analyzed \n whether the areas of electrodes elicit different effects . when tens is applied to acupoints \n frequency of 10 hz with sufficient intensity to promote muscle jerks .", "is indicated for arthritis in the wrist and finger joints , \n and that of the acupoint pc6 is indicated for pain in the forearm , carpal tunnel , and wrist , \n median nerve palsy , and pain and contracture in the elbow and arm .", "the technique of \n acupuncture analgesia with electrotherapy , with certain modifications , has created \n electroacupuncture which is used as a substitute for conventional acupuncture , and in cases \n where clinical acupuncture alone has noeffect5 , 6 ." ], [ "the first experimental group ( 8 \n males and 8 females ) was stimulated by acupuncture like tens on the te5 and pc6 acupoints \n with 1 cm electrodes ; the second experimental group ( 9 males and 7 females ) was \n also stimulated by acupuncture like tens on the same acupoints with 15 cm \n electrodes ; and the placebo group ( 10 females and 6 males ) were told they were receiving \n microcurrent stimulation of the deltoid muscle with a 15 cm electrode .", "subjects were allocated to three groups : the 1 cm electrode group , \n the 15 cm electrode group , and the placebo group .", "the subjects were subjected to two more cycles , the \n fifth and sixth following the same method described above , to evaluate the effect of tens \n post - treatment ( tens off ) . in the placebo group ,", "this was a single - blind , quasi - experimental study with a control and placebo .", "the subjects were asked to keep their hands in cold water for thirty more seconds , during \n this time ( depending on the tolerance ) they were asked to describe the painful sensation \n using a visual analog scale ( values from 0 to 10 , where 0 corresponds to no pain and 10 \n refers to the maximum tolerable pain ) to assess pain intensity .", "procedure was repeated , completing two cycles of cold - induced pain , with pretreatment \n time , lasting twenty minutes . in the third cycle after wiring for tens", "the time to the pain \n threshold and pain intensity were measured , and the procedure was repeated for a fourth \n cycle , twenty minutes of tens application in total .", "the subjects were allocated by \n raffle in blocks of four to each group in succession . during the period of experimentation \n subjects showed no pathological state in the region subjected to cold - induced pain , did not \n use allopathic and/or homeopathic drugs , showed no intolerance or phobia at low \n temperatures , and the female subjects , were not in a state of pre - menstrual tension or \n menstrual flow .", "subjects were subjected to the same procedure of the cold - induced \n pain test ( pre - treatment , treatment and post - treatment ) , but the electrodes were placed on \n the shoulder ( without connection to any acupoint ) on the belly of the anterior deltoid \n muscle and the individuals were told that they were receiving a microcurrent treatment , in \n which they would not feel any sensation ." ], [ "a acupuncture - like tens with electrodes with an area of 1 cm showed effects on \n the pain threshold latency during application , while acupuncture - like tens with \n 15 cm electrodes showed effects after tens application .", "results expressed in mean sd ( seconds ) * significant difference from pre - treatment the intensity of pain was reduced during tens treatment with 1 cm electrodes \n both in relation to the time before treatment and after treatment ( table 2table 2.pain intensity in the different periods of acupuncture - like tens with electrodes \n 1 cm , 15 cm , and placeboelectrodespretreatment(mean ranks)treatment(mean ranks)posttreatment(mean ranks)1 cm2.91.1**2.0 * 15 cm1.32.6 * 2.1placebo2.12.11.7friedman test . * significant difference from pre - treatment . * * significant difference \n from pre - treatment and post - treatment ) . with the 15 cm electrode", "the placebo group \n showed no significant changes in any experimental phase ( table 1table 1.the latency threshold ( seconds ) of pain in the different periods of acupuncture \n tens with electrodes of 1 cm , 15 cm , and placeboelectrodespretreatmenttreatmentposttreatment1 cm30.9 8.945.78 11.8 * 39.5 11.615 cm25.5 7.732.0 12.936.3 13.0*placebo25.2 10.725.2 7.622.4 7.4anova and post hoc newman - keuls .", "the sensation of pain increased in \n relation to the time before treatment . in the placebo group", "after treatment the tens groups ( 1 cm and \n 15 cm ) electrodes showed pain threshold latencies longer than the placebo \n group ." ], [ "to induce experimental pain without causing tissue injury we used a model called the cold \n pressure test , also known as the cold - induced pain test . in this model pain", "the \n combination of acupuncture - like tens and acupoints is a treatment choice for acute pain in \n the hand region .", "our findings support the view that acupuncture - like tens at 10 hz frequency , applied to pc6 \n and te5 acupoints with the parameters described above , increases the pain threshold latency \n during tens treatment with 1 cm electrodes and post - treatment with \n 15 cm electrodes .", "the pain intensity was reduced during tens treatment when \n applied to the acupoints with an electrode area of 1 cm .", "we found that the low frequency , high intensity tens was \n bearable , and prolonged the pain threshold latency in the acute phase , and that prolongation \n of the pain threshold latency was dependent on the size of the electrode .", "we suggest that as well as the \n measurement of pain intensity using the vas scale , some objective form of measurement is \n also used , such as the pain threshold latency , measurement of the conduction velocity of \n nociceptive fibers ." ] ]

[ [ "the aim of this study was to assess the exercise performance of young patients following the repair of tetralogy of fallot and to assess the influence of different variables related to the surgical repair on exercise testing .", "tetralogy of fallot ( tof ) is the most common form of cyanotic congenital heart disease .", "impairment in exercise tolerance after total repair of tetralogy of fallot has been frequently reported and speculated to be due to variable causes including residual right ventricular outflow tract ( rvot ) obstruction , branch pulmonary artery stenosis , pulmonary insufficiency , pulmonary pathology , and chronotropic incompetence . pulmonary regurgitation ( pr )", "has been shown to be related to the use of transannular patch during rvot reconstruction and aggressive infundibulectomy involving the pulmonary valve annulus .", "a number of children have premature ventricular beats after repair of the tetralogy of fallot .", "adverse effects of pr include progressive dilatation of rv , reduced exercise capacity , arrhythmia , and sudden death ." ], [ "it included 21 patients operated on for tetralogy of fallot compared to 15 healthy age- and sex - matched children .", "this study was carried out at the children 's hospital , pediatric cardiology department , ain shams university in the period from march 2008 to february 2010 .", "all patients underwent total correction for tof at ages ranging between 2 and 10 years .", "all patients were subjected to twelve - lead ecg to comment on rate , rhythm , p wave , axis , qrs duration , bundle branch block , and chamber enlargement .", "total correction was performed by closing the vsd and reconstruction of the rvot via either transatrial - transpulmonary or right ventriculotomy approaches .", "m mode , two - dimensional , and color doppler echocardiographic examination using ge health care ultrasound vivid 7 was done for all patients to comment on pulmonary valve regurgitation or residual stenosis , branch pulmonary arteries , right ventricular size , and function , residual vsd and leak across , movement of ivs , left ventricular function , and other associated cardiac anomalies ." ], [ ". cases with aortopulmonary shunt showed significantly lower work time , work stage , and max mets when compared with those without aortopulmonary shunt p < 0.05 . as shown in table 2 .", "while they showed significantly lower max sbp , max hr , max mets , and % of mets when compared to control p < 0.05 as shown in table 1", "the resting ecgs of all patients revealed normal sinus rhythm and rbbb , 16 patients with complete rbbb , and 5 patients with incomplete rbbb .", "cases showed lower work stage and time , but the difference did not reach a significant level p = 0.10 , 0.22 .", "qrs durations were prolonged but less than 180 msec in 19 patients , and more than 180 msec in only 1 patient .", "only one patient ( 4.7% ) of the study group developed exercise - induced complete heart block ( chb ) as detected by stress testing ." ], [ "the chb revealed by his exercise test probably contributed to the growth impairment of that child .", "we discovered that only one patient ( 4.7% ) of our study group developed exercise - induced complete heart block ( chb ) as detected by stress testing .", "however , our results are similar to samman et al . who were unable to demonstrate a relationship between the degree of pulmonary regurgitation and exercise capacity in patients with repaired tetralogy of fallot and ascribed these contradictory finding to the different methods used to measure the degree of pulmonary regurgitation in these studies in comparison with their study .", "pulmonary regurgitation has been attributed to the use of transannular patch during rvot reconstruction and aggressive infundibulectomy involving the pulmonary valve annulus .", "surgical correction of tof is directed at relieving all possible sources of right ventricular outflow tract obstruction .", "palliative aortopulmonary shunt procedures are performed prior to total correction to increase pulmonary blood flow in severely cyanotic infants ." ], [ "exercise tolerance after total correction of fallot tetralogy is slightly impaired on short - term followup .", "thus abnormal cardiac function and haemodynamic abnormalities secondary to pr and residual defects appear after longer periods of followup .", "patients with previous aortopulmonary shunts showed lower exercise performance when compared to those without previous aortopulmonary shunt .", "the present study did not reveal any serious ventricular arrhythmias since it is seen in those patients with the longest period of follow up .", "postoperative exercise testing in patients with tof can unmask a complete heart block that was not elicited by the standard 12-lead ecg recording ." ] ]

[ [ "since its original description by mc burney in 1894 , appendectomy has been one of the most common surgical procedures performed by surgeons . in the last decades ,", "laparoscopic appendectomy was an increasingly accepted treatment method for acute appendicitis , particularly for obese or female patients .", "however , notes has several disadvantages and limitations with the currently available instruments , including limited access and less familiar working angles and operative views . in the past few years", "natural orifice transluminal endoscopic surgery ( notes ) is a new approach that allows for minimal invasive surgery through the natural orifices such as mouth , anus , or vagina .", "this study aimed to summarize the recent clinical appraisals , feasibility , complications , and limitations of transvaginal appendectomy for humans and to outline techniques .", "less incision on the abdomen helps to reduce surgical pain , analgesic requirement , recovery time , hernia formation , intra - abdominal adhesion , and surgical site infection ." ], [ "electronic searches in december 2013 of the pubmed / medline , cochrane , google scholar , and ebscohost - academic search complete , including cinahl , used the key words [ ( vaginal or transvaginal ) and ( appendectomy or appendectomies or appendicectomy or appendicectomies ) ] .", "two reviewers ( mehmet ali yagci and cuneyt kayaalp ) assessed the list of titles and/or abstracts of the scanned articles at pubmed / medline and cochrane using the key words in a function of [ all fields ] .", "data for affiliation , number of the patients , age , clinical findings , inclusion and exclusion criteria , body mass index , history of previous abdominal surgery , trocar sites ( pure or hybrid ) and types , scope site and types ( flexible or rigid ) , vaginal access and colpotomy closure techniques , intraoperative and postoperative complications , operating time , conversion to conventional laparoscopy or open surgery , postoperative pain , length of hospital stay , time off work , long term sexual function , and cosmetic satisfaction were recorded .", "after pubmed and cochrane searches , we scanned the ebscohost - academic search complete and google scholar databases with the same key words but using the [ title ] function .", "transvaginal appendectomy was defined as a way of natural orifice translumenal endoscopic surgery for the appendix .", "the unpublished , potentially relevant , trials at the registered trials database at https://www.clinicaltrials.gov/ were searched as well .", "all the studies including congress proceedings and abstracts that describe the clinical course of patients were accepted for the analysis ." ], [ "a total of 154 articles were retrieved from the pubmed / medline database and no additional study was available in the cochrane library . after the elimination of the 96 irrelevant studies ,", "studies originated in europe , north / south america , and asia , and two of them included international multicenter data [ 6 , 13 ] .", "two studies [ 10 , 11 ] belonged to the same clinical series and their data were complementary ( early and late results ) . as a result , we analyzed 12 clinical studies contained in 13 articles .", "studies including inadequate patient data , concomitant hysterectomy , experimental studies , and duplicated data were eliminated and finally 13 articles [ 315 ] were selected for the analysis ( figure 1 ) .", "after the elimination of repetitive studies in several databases or sources , seven studies were added to the previously selected 58 articles .", "google scholar , ebscohost - academic search complete , https://www.clinicaltrials.gov/ , and reference cross - checking defined 26 , 17 , 6 , and 2 studies , respectively ( figure 1 ) .", "some studies had duplicated results [ 1622 ] and their latest or the most comprehensive versions were accepted for the analysis [ 6 , 1013 ] . there were a total of 112 transvaginal appendectomies .", "pure transvaginal appendectomy was performed on only 22% of the cases and the remaining were hybrid procedures ( 78% ) . when we compared the operating time and the complications for both techniques , there were no differences .", "those cases required additional abdominal trocar access and were accepted as a conversion to conventional laparoscopy ( 3.6% ) , but no case required conversion to open surgery .", "the mean length of hospital stay was longer in the german series ( 3.4 days ) because of their national health system , [ 3 , 9 ] , and the mean length of hospital stay was 1.25 days for the rest of the studies ." ], [ "transvaginal appendectomy during vaginal hysterectomy was first described in 1949 and , at the time , was performed by the gynecologists with the aim of incidental appendectomy [ 6 , 23 ] .", "as a conclusion , appendectomy is one of the most common emergency visceral surgical procedures . the early results of transvaginal appendectomy in this systematic review show some promise for improved postoperative pain and patient recovery .", "another technique for pure transvaginal appendectomy was reported using the placement of a single incision laparoscopic surgery ( sils ) port into the incised posterior vaginal fornix .", "no clear benefits of flexible endoscopes over the rigid scopes were seen in this systematic analysis . transferring the surgeons from open surgery to laparoscopic surgery provided the patients with a more comfortable postoperative course and a more rapid recovery .", "when compared to those results , this systematic review demonstrated that transvaginal appendectomy can be a rational alternative to conventional laparoscopic appendectomy in selected patients .", "reported that , before the first successful case , they experienced three prior conversions to conventional laparoscopic appendectomy due to technical difficulties with this pure endoscopic technique ." ] ]

[ [ "control evaluation , the odds of having been screened versus not screened in the case group of breast cancer deaths is compared to the same odds in the control group of invited women from whom the cases originate .", "we compared the mortality rate in the screened ( ms ) with not screened women ( mns ) .", "we assume that a confounder with a twofold relative risk on breast cancer death ( rrc ) , is present among 20% ( p1 ) of the women in the screened group and among 50% ( p2 ) in the not screened group .", "2 ) a heuristic device to address residual confounding in the mortality effect of breast cancer screening . both arrows on the left indicate the observed breast cancer mortality risk in the screened and not screened group , suggesting rra = 0.50 .", ", that the apparent rra is 0.50 , and a risk factor producing a twofold increase in risk of breast cancer death ( rrc ) is present among 20% ( p1 ) of the screened group and 50% ( p2 ) of the not screened group . then , the non - specific part of the apparent screening effect is 0.20 * 2 + 0.80 * 1 = 1.20 among the screened women , and 0.50 * 2 + 0.50 * 1 = 1.50 among the not screened women . the ratio of these non - specific effects is 1.2/1.5 = 0.80 , which is the influence of confounding ( c ) among the screened and not screened groups .", "both arrows on the left indicate the observed breast cancer mortality risk in the screened and not screened group , suggesting rra = 0.50 ." ], [ "2diagrams of the adjustment for residual confounding in the effectiveness measurement of breast cancer service screening .", "as an example , we report on a case control study conducted within the nijmegen breast cancer screening programme which started in 1975 . after adjustment for age , we found that the breast cancer mortality rate in the screened group was 65% lower than that of the not screened group : or = 0.35 and 95% confidence interval ( ci ) = 0.190.64 .", "dense mammographic breast pattern , for which a high relative risk of 6 has been reported , is a likely candidate for being treated as a confounding factor . despite its strength ,", "we assume that the risk magnitude of the factors applies to the incidence and mortality alike ." ], [ "we present an educated and pragmatic method to quantify the potential impact of residual confounding , and to de - bias the comparison of screened with unscreened groups , a method originally introduced by cornfield et al . .", "as we have shown , residual confounding does not have a great effect on these estimates of screening effectiveness .", "our results demonstrate that residual confounding has a minor influence on the observed screening effect . closely related to residual confounding", "previous screening programme evaluations have qualitatively discussed the magnitude of residual confounding bias on their effectiveness estimate [ 6 , 9 , 10 , 12 ] or estimated the amount of bias due to self - selection [ 7 , 8 , 11 ] .", "after having addressed for age , future breast cancer screening programme evaluations can ignore residual confounding .", "however , the aim of this study was to present a heuristic device to address residual confounding ." ] ]