section_summaries
sequencelengths 1
17
| abstract
stringlengths 18
2.93k
|
---|---|
[
[
"therefore , studies evaluating accelerated artificial aging / thermal cycling have been suggested in the literature.12 thus , while the self - etching system reduces the inconvenience of excessive demineralization of the tooth,1,2 the association of the er : yag laser with the conventional adhesive system should be evaluated , enamel resistance to acid dissolution after irradiation with er : yag is shown in the literature.4,8 in view of the questions raised , the aim of this study was to evaluate the in vitro bond strength of orthodontic brackets bonded with : total etch , total etch with previous application of er : yag laser and the self - etching adhesive systems after thermal - mechanical cycling , simulating 1 year of treatment .",
"the null hypothesis tested was that there would be no statistically significant difference among the bond strength values when the adhesive systems and laser for orthodontic bracket bonding were used ."
],
[
"the experimental groups were submitted to varying thermal - mechanical cycles , using a fatigue simulator appliance ( er 11000 , erios , so paulo , brazil ) . in order to simulate 1 year of clinical treatment",
"this measurement was made in accordance with the scores that ranged from 0 to 3 : 0 no composite resin adhered to enamel ; 1 less than half percent of composite resin on enamel ; 2 more than half percent of composite resin on enamel ; and 3 all composite resin on enamel , showing the bracket mesh impression.17,18 afterward , the samples were prepared and submitted to analysis by sem in order to visualize the adhesive remnant and/or the enamel condition after bracket removal .",
"the following adhesive systems were used : transbond xt ( xt ) , transbond plus self etch primer system ( sep ) and er : yag laser associated with the adhesive system transbond xt ( er : yag / xt ) as specified in table 1 . in the group in which previous irradiation with er : yag laser ( kavo key iii , kavo , kirchdorf biberach , germany ) was performed ,",
", 100,000 mechanical cycles and 500 thermal cycles were performed , which ranged between 5c and 55c ( iso 11405).14,15 a universal test machine ( emic , so jos dos pinhais , brazil ) was used , with a 50 kg load applied parallel to the vestibular enamel surface , in the incisor - cervical direction close to the enamel / adhesive interface , at 0.5 mm / min until fracture occurred.15,16 the force required to remove the brackets was measured in newton ( n ) and the shear strength in megapascals ( mpa ) .",
", the samples were analyzed under a stereomicroscope lens ( kozo optical and electronical instrumental , nanjing - jiangsu , people s republic of china ) , at 20 magnification to determine the adhesive remnant index ( ari ) .",
"prophylaxis of the tooth enamel on the vestibular surface of all the teeth was performed with pumice stone , without fluoride ( ss white ) and water for 10 seconds . in the groups ,",
"a total of 48 stainless steel orthodontic brackets for maxillary central incisors were used , with a mesh base of 1.5 mm height4.0 mm wide ( roth 0.022 0.030 kirium abzil indstria e comrcio ltda . ,",
"for all the groups , the brackets were positioned with transbond xt resin ( 3 m ) on the base , excess was removed and light polymerization was performed for 10 seconds on each surface of the bracket ( mesial , distal , cervical and incisal ) ."
],
[
"the inclusion criteria used for selecting the teeth were tooth enamel without cracks / fractures and without previous application of chemical agents such as thymol , hydrogen peroxide , alcohol or formol .",
"ltda , so paulo , brazil ) , under irrigation and uniform , constant pressure in order to obtain a flat vestibular surface . to prepare the experimental groups ,",
"the experimental procedures were performed on 48 recently extracted deciduous bovine incisors obtained from discarded jaws after slaughter of the animals.13 the teeth were extracted following the procedures of a minimum of trauma .",
"86 , ss white , rio de janeiro , brazil ) and the pulp chamber was cleaned and obliterated with utility wax .",
"the surface was abraded with water and abrasived paper of 200 , 400 , 600 and 1200 grits ( 3 m , sumar , brazil ) with the aid of a polishing machine ( panambra tcnica imp .",
"the teeth were placed in pvc tubes measuring 25 mm20 mm ( tigre , joinville , brazil ) with the vestibular surface positioned at the bottom of the base , and then they were embedded in acrylic resin ( vipi , so paulo , brazil ) .",
"after this , the coronal pulp was removed with a dentin curette ( duflex lucas no .",
"wallis test power equal to 75% . a sample size of ( n ) 16 elements in each group was found ( pass 11 , ncss , llc , kaysville , ut , usa ) ."
],
[
"the following adhesive systems were used : transbond xt ( xt ) , transbond plus self etch primer system ( sep ) and er : yag laser associated with the adhesive system transbond xt ( er : yag / xt ) as specified in table 1 . in the group in which previous irradiation with er : yag laser ( kavo key iii , kavo , kirchdorf biberach , germany ) was performed ,",
"a total of 48 stainless steel orthodontic brackets for maxillary central incisors were used , with a mesh base of 1.5 mm height4.0 mm wide ( roth 0.022 0.030 kirium abzil indstria e comrcio ltda .",
"maximum pressure was applied during bracket bonding in order to standardize the force exerted and the thickness of the resin pellicle , as soon as they were placed on the teeth .",
"prophylaxis of the tooth enamel on the vestibular surface of all the teeth was performed with pumice stone , without fluoride ( ss white ) and water for 10 seconds . in the groups ,",
"for all the groups , the brackets were positioned with transbond xt resin ( 3 m ) on the base , excess was removed and light polymerization was performed for 10 seconds on each surface of the bracket ( mesial , distal , cervical and incisal ) .",
"the wavelength of 2.94 m was used with a # 2051 handpiece and spot diameter of 0.63 mm ( table 1 ) ."
],
[
"the experimental groups were submitted to varying thermal - mechanical cycles , using a fatigue simulator appliance ( er 11000 , erios , so paulo , brazil ) . in order to simulate 1 year of clinical treatment ,",
"100,000 mechanical cycles and 500 thermal cycles were performed , which ranged between 5c and 55c ( iso 11405).14,15"
],
[
"a universal test machine ( emic , so jos dos pinhais , brazil ) was used , with a 50 kg load applied parallel to the vestibular enamel surface , in the incisor - cervical direction close to the enamel / adhesive interface , at 0.5 mm / min until fracture occurred.15,16 the force required to remove the brackets was measured in newton ( n ) and the shear strength in megapascals ( mpa ) .",
"the results were obtained with the aid of the computer software program ( tesc ) connected to the emic universal test machine ."
],
[
"this measurement was made in accordance with the scores that ranged from 0 to 3 : 0 no composite resin adhered to enamel ; 1 less than half percent of composite resin on enamel ; 2 more than half percent of composite resin on enamel ; and 3 all composite resin on enamel , showing the bracket mesh impression.17,18 afterward , the samples were prepared and submitted to analysis by sem in order to visualize the adhesive remnant and/or the enamel condition after bracket removal .",
"after the shear bond test , the samples were analyzed under a stereomicroscope lens ( kozo optical and electronical instrumental , nanjing - jiangsu , people s republic of china ) , at 20 magnification to determine the adhesive remnant index ( ari ) .",
"images were captured by means of a specific software program coupled to the sem ( inspect 550 , fei ) , allowing photomicrographs to be obtained ."
],
[
"the data obtained were statistically analyzed by means of kruskal wallis and mann whitney tests with bonferroni correction to verify differences between the studied groups , since the distribution of data was not considered normal , according to the shapiro ",
"the ari data , which were presented as an ordinal qualitative variable , were statistically analyzed with kruskal wallis and dunn tests .",
"the analyses were performed using the statistical software program statistical package for the social sciences ( spss ) statistics version 20.0 ( ibm , armonk , ny , usa ) ."
],
[
"xt / er : yag , it was observed that the dental ablation performed by er : yag laser promoted the formation of craters and imperfections in the enamel , which were restricted to the ablated area , without the occurrence of fractures or cracks ( figure 1 ) . in groups xt and sep , by means of sem ,",
"the condition in which there was greatest predominance of ari=0 was that of group xt / er : yag . the score 0 was the most found in the groups , representing adhesive failures .",
"after simulation of 1 year of treatment , it was observed that xt and sep groups presented the highest shear bond strength values , without statistical differences between them .",
"however xt / er : yag group showed a reduction in mean bond strength values ( table 2 ) .",
"the exception was group sep , in which there was predominance of ari=3 ( all the adhesive remnant on the enamel surface with the impression of the bracket base ) ( table 3 ) . in group",
"the inferential and descriptive statistics of the bond strength of the groups are shown in table 2 ."
],
[
"after simulation of 1 year of treatment , it was observed that xt and sep groups presented the highest shear bond strength values , without statistical differences between them .",
"the inferential and descriptive statistics of the bond strength of the groups are shown in table 2 .",
"however xt / er : yag group showed a reduction in mean bond strength values ( table 2 ) ."
],
[
"the condition in which there was greatest predominance of ari=0 was that of group xt / er : yag .",
"the exception was group sep , in which there was predominance of ari=3 ( all the adhesive remnant on the enamel surface with the impression of the bracket base ) ( table 3 ) ."
],
[
"in group xt / er : yag , it was observed that the dental ablation performed by er : yag laser promoted the formation of craters and imperfections in the enamel , which were restricted to the ablated area , without the occurrence of fractures or cracks ( figure 1 ) . in groups xt and sep , by means of sem ,"
],
[
"the constant development of materials and techniques for dental bonding offers various clinical options for bonding orthodontic accessories . in this study , after simulation of 1 year of orthodontic treatment , the conventional and self - etching adhesive systems were found to show adequate bond strength ; however , previous enamel treatment with er : yag laser ( 60 mj , energy density 19.24 j / cm ) reduced the bond strength of brackets bonded to enamel .",
"therefore , in vitro studies require further investigation to elucidate the influence of these resinous materials and the behavior of the er : yag laser ( associated to different irradiation parameters and/or subjected to erosive cycles ) on the surface of the dental enamel , contributing to the improvement of longevity of the adhesive techniques of brackets and their clinical applicability ."
],
[
"within the limitations of this study , after simulation of 1 year of orthodontic treatment , by means of thermal - mechanical cycling , it was possible to observe that : \n the conventional ( xt ) and self - etching ( sep ) adhesive systems presented similar mean bond strength values between them.the previous application of er : yag laser , within the parameters used , associated with the use of the conventional adhesive system ( xt ) promoted the lowest bond strength values.with exception of the group treated with self - etching adhesive , a large portion of the failures occurred at the enamel / adhesive interface . the conventional ( xt ) and self - etching ( sep ) adhesive systems presented similar mean bond strength values between them .",
"the previous application of er : yag laser , within the parameters used , associated with the use of the conventional adhesive system ( xt ) promoted the lowest bond strength values .",
"with exception of the group treated with self - etching adhesive , a large portion of the failures occurred at the enamel / adhesive interface ."
]
] | objectivethe aim of this study was to evaluate in vitro bond strength of metal brackets bonded with : total etch , total etch with erbium : yttrium aluminum garnet laser ( er : yag ) and self - etching adhesive systems , submitted to thermal - mechanical cycling , simulating 1 year of orthodontic treatment.materials and methodsfor the study , 80 bovine incisors were randomly divided into 3 experimental groups ( n=16 each ) : xt- acid etching + transbond xt , xt / er : yag- transbond xt associated with er : yag laser irradiation ( =2.94 m , 60 mj , 10 hz ) and sep- transbond plus self etching primer . samples were submitted to thermal - mechanical cycling , simulating 1 year of orthodontic treatment . afterward , the shear bond strength test was performed in a universal test machine at a speed of 0.5mm / min . samples were evaluated under a stereomicroscope and by scanning electron microscopy for analysis of enamel surface and adhesive remnant index . data were analyzed using kruskal wallis and mann whitney ( with bonferroni correction ) statistical tests.resultsstatistically significant difference was observed between the groups studied ( p<0.05 ) . groups xt and sep showed the highest bond strength values , without statistical difference between them , while group xt / er : yag showed reduction in bond strength values . higher frequency of adhesive failures between enamel and adhesive system was verified for groups xt and xt / er : yag.conclusionthe conventional ( xt ) and self - etching ( sep ) adhesive systems showed mean bond strength values , similar between them , whereas the previous application of er : yag laser promoted the lowest bond strength values . |
[
[
"here we are reporting two cases of mma in infants presented with severe high ag metabolic acidosis mimicking as dka in one case and septic shock in an another case even without any initial apparent symptoms .",
"the incidence rate of mma is 1 in 50,00080,000 newborns but it is more common in countries with high amount of consanguinity and countries with no systematic newborn screening , like developing countries .",
"methylmalonic acidemia ( mma ) encompasses a heterogeneous group of disorders that is characterized by impaired metabolism of methylmalonic acid that is generated during the metabolism of certain amino acids ( isoleucine , methionine , threonine , or valine ) .",
"mma may present suddenly in older infants without initial apparent symptoms , which may mimic septic shock and diabetic ketoacidosis ( dka ) and without early recognition can lead fatal consequences .",
"patients typically presents at the age of 1-month to 1-year with varied presentations of symptoms ranging from poor feeding , vomiting , dehydration , shock , hypoglycemia , hyperammonemia and hyperglycemias with high anion gap ( ag ) metabolic acidosis if left untreated can lead coma or even death ."
],
[
"we report an 8-month - old male child presented in an emergency department with hypotensive shock , respiratory failure and disseminated intravascular coagulation with a short history of nonspecific low grade fever associated with upper respiratory infection and vomiting since 1-day .",
"ketoacidosis remain persisted even after the 24 h of reversal of shock requiring sodium bicarbonate infusion ."
],
[
"we report an 8-month - old male child presented in an emergency department with hypotensive shock , respiratory failure and disseminated intravascular coagulation with a short history of nonspecific low grade fever associated with upper respiratory infection and vomiting since 1-day .",
"ketoacidosis remain persisted even after the 24 h of reversal of shock requiring sodium bicarbonate infusion ."
],
[
"we report an 8-month - old male child presented in an emergency department with hypotensive shock , respiratory failure and disseminated intravascular coagulation with a short history of nonspecific low grade fever associated with upper respiratory infection and vomiting since 1-day .",
"ketoacidosis remain persisted even after the 24 h of reversal of shock requiring sodium bicarbonate infusion ."
],
[
"we report a 2 case of previously healthy 1-year - old male child with altered sensorium with a short history of vomiting and low grade fever with no history of seizures . on examination child",
"persistence of severe high ag metabolic acidosis after 24 h of admission with hemoglobin a1c 4.9% , underlying metabolic disorder was suspected and was investigated to rule out organic acidemia and had high levels of methyl malonic acid ."
],
[
"methylmalonic acidemia is a rare autosomal recessive disease in which there is a deficiency in conversion of methylmalonic coenzyme a ( coa ) to succinyl coa .",
"we report two cases of infants with mma with sudden decompensation associated with high ag severe metabolic acidosis without any initial signs and symptoms . in first case infant with presented as mimic septic shock responded well to fluid management , but ketoacidosis was persisted even after the shock was corrected .",
"the unusual presentation of our patients , mimicking dka and septic shock reminds us of the wide spectrum of clinical signs of organic acidemia . in very young patients with severe acidosis and metabolic decompensation , or"
]
] | methylmalonic acidemia ( mma ) is most common inherited type of organic acidemia . it has diverse presentation in older infants without any initial apparent symptoms . mma sometimes present with sudden metabolic decompensation , which may mimics common emergencies like septic shock and diabetic ketoacidosis ( dka ) without early recognition can be fatal . in born error of metabolism especially organic acidemia should be suspected in any infant presented with severe high anion gap metabolic acidosis . we report two cases of mma in infants presented acutely mimicking dka and septic shock . |
[
[
"we present here a case of pleural tb in a patient on infliximab for ankylosing spondylitis .",
"reactivation of latent tuberculosis ( tb ) is a serious hindrance to continuation of therapy ."
],
[
"a 36-year - old male presented to our hospital in 2006 with low back ache inflammatory type with symmetric joint pains involving large joints such as shoulder joints , hip joints , knee joints , and small joints such as metacarpophalangeal joints , elbow joints , and metatarsophalangeal joints .",
"imaging revealed kyphoscoliosis of thoracic spine , syndesmophytes at multiple levels giving the appearance of bamboo spine [ figure 1 ] .",
"diffuse ossification of interspinous and paraspinal ligaments with fusion of thoracic and lower cervical vertebra was present .",
"radiograph showing bamboo spine in view of hla - b27 , more than 2 spa features and typical radiological features , ankylosing spondylitis was considered ."
],
[
"ankylosing spondylitis is a chronic , systemic , inflammatory disease that affects primarily the sacroiliac joints and spine . it is a spondyloarthropathy with a prevalence of 0.1%0.4% globally .",
"hence , meticulous screening and close monitoring of patients on infliximab for any symptoms and signs of tb are important as there is a risk even though the screening tests have come out be negative .",
"to conclude , severity of disease , use of other medications such as corticosteroids , and the presence of comorbidities also contribute to infections in addition to tnf inhibitors alone .",
"the rate of development of active tb among rheumatoid arthritis patients on anti - tnf therapy has dropped by 83% with the help of screening .",
"suppressing the action of tnf- can help in relieving the symptoms of ankylosing spondylitis by reducing the inflammatory process , but at the same time , it weakens immune response to microbes such as tubercle bacilli .",
"target - related adverse effects with tnf inhibitors are infections , opportunistic infections , malignancies , demyelinating conditions , hematologic abnormalities , congestive heart failure , autoantibodies ( antinuclear antibody and anti - double - stranded dna ) , hepatotoxicity , dermatologic reactions , and lupus - like syndromes , whereas the agent - related adverse effects are administration reactions and immunogenicity ."
],
[],
[]
] | we present a case of pleural tuberculosis ( tb ) in a patient on infliximab for ankylosing spondylitis . a 36-year - old male presented to our hospital with low back ache of inflammatory type along with multiple symmetric inflammatory type of joint pain . further clinical examination , laboratory and radiological investigations were suggestive of ankylosing spondylitis . he was initially treated with nonsteroidal anti - inflammatory drugs but citing poor response it was decided to initiate biologic therapy using infliximab ( antitumor necrosis factor - alpha ) . mantoux test and chest radiograph were done before the therapy to rule out tb . following three doses of infliximab , patient came with complaints of fever and cough for 1 week . on investigation , it was found to be a case of pulmonary tb . this shows the importance of close monitoring of patient for tb among patients on infliximab even though the screening test has come out to be negative . |
[
[
"myoepithelial carcinoma ( mc ) is a rare tumor with an incidence of 0.2% of all salivary gland tumors . most of the reported cases of mc arise in the parotid gland ( 4875% ) , followed by minor salivary glands , and the submandibular gland .",
"the first case was described by higashiyama et al . , in 1998 . since then , only seven cases have been reported in literature ."
],
[
"a mentally retarded 13-year - old girl , with a history of congenital hypothyroidism and cystic lymphangioma in the left dorsal region , operated in 2004 , had consulted for cough and dyspnea in september 2010 .",
"the histopathological and the ihc review at the institut bergoni in france concluded the diagnosis of myoepithelial carcinoma of the soft tissues with intermediate malignancy .",
"the progression was marked by the disappearance of the pulmonary opacities [ figure 1 ] ."
],
[
"our patient represents the first pediatric case , described in the literature , having primitive pulmonary mc .",
"they include mucoepidermoid carcinoma , adenoid cystic carcinoma , acinic cell carcinoma , oncocytoma , epithelial ",
"the originality of our case is the disappearance of the pulmonary opacity spontaneously , without any treatment .",
"mc was cited as being synonymous with epithelial myoepithelial carcinoma . as mc and epithelial ",
"myoepithelial carcinoma of the salivary gland are distinguished by the presence or absence of ductal cells , their pulmonary counterparts must also be differentiated .",
"it arises from the submucosal bronchial glands of the lower respiratory tract . in the world health organization classification , published in 2004 ,"
],
[
"our case represents , to the best of our knowledge , the first pediatric case having primitive pulmonary mc .",
"the histopathological study familiarizes the diagnosis , but a further ihc study is needed to confirm the diagnosis and to eliminate other etiologies .",
"surgery represents the main treatment for the operable forms . to the best of our knowledge ,",
"we have reported the first case , with spontaneous regression of this tumor , without any treatment ."
]
] | primary myoepithelial carcinoma ( mc ) of the lung is exceedingly rare . we report here , to the best of our knowledge , the first pediatric case having primitive pulmonary mc . the originality of our case was the disappearance of the pulmonary opacity spontaneously , without any treatment . the difficulties in our case were the diagnosis of this rare entity and its subsequent treatment . in fact , given the rarity of these tumors , recommendations regarding chemotherapy or radiation , were difficult to formulate . |
[
[
"we report a case of severe hemorrhagic cystitis caused by nts that resulted in shock and syncope in a patient with uncontrolled diabetes .",
"as environmental and personal sanitation improves , the incidence of typhoidal salmonellosis tends to decrease , while the incidence of non - typhoidal salmonellosis markedly increases , .",
"uti caused by nts presents as either pyelonephritis or cystitis , , ; cases of hemorrhagic cystitis are extremely rare .",
"the most common clinical manifestation of nts is gastroenteritis , and the condition includes bacteremia , focal infection , and an asymptomatic carrier state . of the manifestations , urinary tract infection ( uti ) is unusual and rare , , and occurs in immunocompromised individuals , including patients with a malignancy , human immunodeficiency virus infection , or diabetes mellitus and patients receiving corticosteroid therapy or treatment with other immunotherapeutic agents , ."
],
[
"a 41-year - old man came to the emergency room for a fever that had developed 10 days earlier , and was accompanied by pus - like urine .",
"he responded well to treatment and was discharged in good condition with oral antibiotics and oral hypoglycemic agents .",
"after 10 days in the hospital , the patient 's urine output decreased suddenly and he developed severe lower abdominal distension and syncope .",
"an emergency ct scan showed that the urinary bladder was severely distended and filled with a mass suspicious of hematoma ( fig .",
"3 ) . however , there was no stone , mass or focal mechanical injury , i.e foley catheter injury ."
],
[
", we describe a case of hemorrhagic cystitis due to nts , which caused massive bleeding , shock , and syncope in a patient with uncontrolled diabetes .",
"extraintestinal manifestations , which have a rare incidence of about 28% , include endocarditis , pericarditis , arteritis , soft tissue infection , uti and pneumonia .",
"non - typhoidal salmonellosis is a disease of great public health importance . unlike s. typhi and s. paratyphi ,",
"uti related to nts presents as cystitis , pyelonephritis , renal abscess , or asymptomatic pyuria , ."
],
[]
] | hemorrhagic cystitis is defined by lower urinary tract symptoms that include dysuria , hematuria , and hemorrhage and is caused by viral or bacterial infection or chemotherapeutic agents . reports of hemorrhagic cystitis caused by non - typhoidal salmonella ( nts ) are extremely rare.we report a case of a 41-year - old man with hemorrhagic cystitis from nts that caused massive bleeding and shock . the patient was hospitalized for uncontrolled diabetes and obstructive uropathy related to severe cystitis . a urine culture was positive for group d nts . this case demonstrated that hemorrhagic cystitis in a patient with a risk factor such as diabetes can be a manifestation of local extra - intestinal nts infection . |
[
[
", we will summarize the current state of research on relativistic mergers , beginning in section 2 with a description of the astrophysical processes that produce merging binaries and the expected parameters of these systems .",
"binaries composed of neutron stars ( nss ) and black holes ( bhs ) have long been of interest to astrophysicists .",
"bh - ns systems are an expected byproduct of binary stellar evolution , and properties of the population may be inferred from population synthesis studies calibrated to the observed ns - ns sample ( see , e.g. , ) . in this review",
"the phases of the merger are briefly described in section 3 . in section 4 , we discuss the numerical techniques used to generate quasi - equilibrium ( qe ) sequences of ns - ns configurations , and we summarize the qe calculations that have been performed"
],
[
"it is difficult to describe the evolutionary pathways that form ns - ns binaries without discussing bh - ns binaries as well , and it is important to note that the joint distribution of parameters such as merger rates and component masses that we could derive from simultaneous gw and em observations will constrain the underlying physics of binary stellar evolution much more tightly than observing either source alone .",
"many population synthesis models have attempted to understand binary evolution within our galaxy by starting from a basic parameter survey of the various assumptions made about ce evolution , supernova kick distributions , and other free parameters . in [ 323 , 79 ] ,",
"population synthesis calculations for both merging ns - ns and bh - ns binaries typically favor the standard channel in which the first - born compact object goes through a common - envelope ( ce ) phase , although other models have been proposed , including recent ones where the progenitor binary is assumed to have very nearly - equal mass components that leave the main sequence and enter a ce phase prior to either undergoing a supernova [ 42 , 54 ] . simulations of this latter process have shown that close ns - ns systems could indeed be produced by twin giant stars with core masses 0.15 m , though twin main sequence stars typically merge during the contact phase . in the standard channel ( see , e.g. , [ 44 , 178 ] , and figure 1 for an illustration of the process ) , the progenitor system is a high - mass binary ( with both stars of mass m 810 m to ensure a pair of supernovae ) .",
"merging ns - ns and bh - ns binaries , i.e. , those for which the merger timescale is smaller than the hubble time , are typically formed through similar evolutionary channels in stellar field populations of galaxies ( both may also be formed through dynamical processes in the high - density cores of some star clusters , but the overall populations are smaller and more poorly constrained ; see for a review ) ."
],
[
"the qualitative evolution of ns - ns mergers , or indeed any compact binary merger , has long been understood , and may be divided roughly into inspiral , merger , and ringdown phases , each of which presents a distinct set of challenges for numerical modeling and detection . as a visual aid",
", we include a cartoon summary in figure 2 , originally intended to describe black hole - black hole ( bh - bh ) mergers , and attributed to kip thorne .",
"constructing qe sequences for a given set of ns parameters requires sophisticated numerical schemes , but not supercomputer - scale resources , as we discuss in section 4 below , focusing first on the numerical techniques used to construct qe binary data in gr , and the astrophysical information contained in the gw emission during the inspiral phase ."
],
[
"gravitational schemes include newtonian gravity ( newt. ) , lowest - order post - newtonian theory ( pn ) , conformal thin sandwich ( cts ) including modified forms of the spatial metric ( mod .",
"gravitational schemes include newtonian gravity ( newt. ) , lowest - order post - newtonian theory ( pn ) , conformal thin sandwich ( cts ) including modified forms of the spatial metric ( mod .",
"numerical methods include ellipsoidal formalisms ( ellips. ) , self - consistent fields ( scf ) , numerical grids ( grid ) , multigrids , and multipatch , green s function techniques ( greens ) , spectral methods ( spectral ) , or sph relaxation ( sph ) . with regard to eos models , ",
"while dynamical calculations are required to understand the gw and em emission from bh - ns and ns - ns mergers , some of the main qualitative features of the signals may be derived directly from qe sequences . from the variation of total system energy with binary angular velocity along a given sequence , it is possible to construct an approximate gw energy spectrum degw / df immediately from qe results , essentially by performing a numerical derivative ( see figure 6 ) .",
"numerical methods include ellipsoidal formalisms ( ellips. ) , self - consistent fields ( scf ) , numerical grids ( grid ) , multigrids , and multipatch , green s function techniques ( greens ) , spectral methods ( spectral ) , or sph relaxation ( sph ) . with regard to eos models , ",
"physical eos models include the fps , sly , and apr nuclear eos models , along with their parameterized approximations and other physically motivated models .",
"physical eos models include the fps , sly , and apr nuclear eos models , along with their parameterized approximations and other physically motivated models ."
],
[
"ns - ns binaries are highly relativistic systems , numerous groups now run codes that evolve both gr metric fields and fluids self - consistently , with some groups also incorporating an ideal magnetohydrodynamic evolution scheme that assumes infinite conductivity . the codes that evolve the gr hydrodynamics or magnetohydrodynamics ( grhd and grmhd , respectively ) equations are many and varied , incorporating different spatial meshes , relativistic formalisms , and numerical techniques , and we will summarize the leading variants here .",
"more complicated flux - limited diffusion schemes , in which the neutrino fluxes for given species and energies are given by explicit formulae that limit to the correct values for zero optical depth ( free - streaming ) and very large optical depth ( diffusion ) , have been used as a post - processing tool to investigate the merger remnants in newtonian ns - ns mergers , but have yet to be applied to full gr simulations . finally , radiation transport schemes to evolve em and neutrino fluxes passing through fluid configurations have been implemented in numerical gr codes [ 80 , 103 ] , but have yet to be used in binary merger simulations .",
"microphysical treatments include physically motivated eos models or quark - matter eos and neutrino leakage schemes .",
"microphysical treatments include physically motivated eos models or quark - matter eos and neutrino leakage schemes.abbrev.refs.grav.mhdmicrophysicskt[134 , 144 , 145 , 265 , 264 , 287 , 288][285 , 286 , 282 , 332]gr*phys .",
"of the full gr codes used to evolve ns - ns binaries , almost all are grid - based and make use of some form of adaptive mesh refinement ."
],
[
"just as in ns - ns mergers , magnetic fields play very little role during inspiral , and unlike the case of ns - ns mergers there is no opportunity to boost fields at a vortex sheet that forms when the binary makes contact , nor in a hmns via differential rotation . while the mri may be important in determining the thermal evolution and mass accretion rate in a post - merger disk , such effects will likely be observable primarily on longer timescales . just as full - gr ns - ns simulations do not indicate that such mergers are likely sources of the r - process elements we observe in the universe , bh - ns simulations in full gr make the same prediction : no detectable mass loss from the system whatsoever , at least in the calculations performed to date .",
"the role of magnetic fields in bh - ns mergers has only been investigated recently [ 66 , 92 ] , in simulations that apply an initially poloidal magnetic field to the nss in the binary .",
"since the first ns - ns merger calculations , there have been two main directions for improvements : more accurate relativistic gravitation , resulting in the current codes that operate using a self - consistent fully gr approach , and the addition of microphysical effects , which now include treatments of magnetic fields and neutrino / em radiation . noting that several of the following developments overlapped in time , e.g. , the first full gr simulations by shibata and ury are coincident with the first pn sph calculations , and predate the first cf sph calculations , we consider in turn the original newtonian calculations , those performed using approximate relativistic schemes , the calculations performed using full gr , and finally those that have included more advanced microphysical treatments . before reviewing fully dynamical calculations of ns - ns mergers , it is worthwhile to ask how much information can already be deduced from qe calculations , which may be performed at much smaller computational cost , as well as from semi - analytic pn treatments and related approximate techniques",
"the final fate of a merging system is highly dependent on the gravitational formalism ; ns - ns merger remnants only undergo collapse in quasi - relativistic and fully gr schemes .",
"the pericenter distance plays a critical role in the evolution of eccentric bh - ns mergers as well ."
],
[
"image reproduced by permission from , copyright by aps . while ns - ns merger calculations have seen tremendous progress in the past decade , the future remains extremely exciting . between the addition of more accurate and realistic physical treatments , the exploration of the full phase space of models , and the linking of numerical relativity to astrophysical observations and gw detection ,",
"returning to the questions posed in section 6 , we can now provide the current state of the field s best answers , though this remains a very active area of research and new results will certainly continue to modify this picture . \n with regard to the final fate of the merger remnant , calculations using full gr are required , but the details of the microphysics do not seem to play a very strong role .",
"there remain many unsolved problems that will be attacked over the course of the next decade and beyond ."
]
] | we review the current status of studies of the coalescence of binary neutron star systems . we begin with a discussion of the formation channels of merging binaries and we discuss the most recent theoretical predictions for merger rates . next , we turn to the quasi - equilibrium formalisms that are used to study binaries prior to the merger phase and to generate initial data for fully dynamical simulations . the quasi - equilibrium approximation has played a key role in developing our understanding of the physics of binary coalescence and , in particular , of the orbital instability processes that can drive binaries to merger at the end of their lifetimes . we then turn to the numerical techniques used in dynamical simulations , including relativistic formalisms , ( magneto-)hydrodynamics , gravitational - wave extraction techniques , and nuclear microphysics treatments . this is followed by a summary of the simulations performed across the field to date , including the most recent results from both fully relativistic and microphysically detailed simulations . finally , we discuss the likely directions for the field as we transition from the first to the second generation of gravitational - wave interferometers and while supercomputers reach the petascale frontier . |
[
[
"the nmdars have long been considered the main target for the treatment of excitotoxicity - related neuronal injury , and a variety of antagonists or blockers of nmdars have been developed .",
"this short review focuses on the specific negative modulation of nmdars by a neuronal calcium sensor ( ncs ) protein , dream / calsenilin / kchip3 .",
"the intracellular ca can in turn function as a second messenger , mediating a variety of signaling cascades .",
"excessive activation of nmdars by glutamate mediates neuronal damage in many neurological disorders including ischemia and neurodegenerative diseases ( choi et al .",
"unfortunately , the results of clinical trials have been disappointing because of the obvious side effects associated with blocking the physiological roles of nmdars ( chen and lipton , 2006 ) .",
"therefore , a better understanding of the mechanism of how nmdars can be modulated by regulatory proteins should help in the development of new therapeutic agents to counteract overactive nmda receptor function , and may represent an alternative to treating nmdar - mediated excitotoxic injury .",
"the nmdars constitute a major class of ionotropic glutamate receptors and play an essential role in synaptic transmission , plasticity , and memory ."
],
[
"activation of nmdars requires a simultaneous binding of two co - agonists , glutamate , and glycine with different biophysical properties of ion permeation .",
"nmdars are believed to be heterotetrameric complexes composed of combinations of the obligatory nr1 subunit and nr2 and/or nr3 subunits ( chazot and stephenson , 1997 ; laube et al ."
],
[
"calcium - dependent nmda receptor desensitization and inactivation provides a feedback mechanism capable of regulating subsequent ca entry into the postsynaptic cell through nmda channels ( figure 1 ) .",
"nmda receptors are also regulated by other intracellular signals and proteins , including calcium , protein kinases , protein phosphatase calcineurin , and calcium - sensitive proteins such as calmodulin ( legendre et al . , 1993 ; vyklicky , 1993 ; lieberman and mody , 1994 ; tong et al . , 1995 ; ehlers et al . , 1996 ) .",
"schematic representation for inhibitory effect of dream / calsenilin / kchip3 on nmdars in a ca - sensitive manner . upon activation of nmdars by glutamate",
"dream functions as a ca - sensitive modulator for the negative feedback control of nmdar function ."
],
[
"all share a conserved carboxy - terminal core region that contains four ef - hand - like calcium binding motifs , but have a variable amino - terminal region that causes diverse modulation of kv4 trafficking and channel function ( an et al .",
"the downstream regulatory element antagonist modulator ( dream ) protein , first identified in the nucleus as a ca - regulated transcriptional repressor through its binding to dna at specific regulatory elements , contains four ca - binding ef - hand domains and belongs to the ncs family ( carrion et al . , 1999 ; burgoyne , 2007 ) .",
"the dream protein functions as a dimer , whereas outside the nucleus kchip3 is a monomer and regulates the surface expression and gating kinetics of kv4 channels ( an et al . , 2000 ;",
"kchip4 , also known as calsenilin - like protein ( calp ) , binds to ps2 which is known to facilitate intramembranous -cleavage of -amyloid protein precursor ( app ) ( morohashi et al . , 2002 ) ."
],
[
"this study not only indicates the significance of the balance between kv4 channel function and nmdar activity , but also suggests the formation of a functional complex between dream / kv4.2/nmdars that regulates the synaptic efficacy mediating synaptic plasticity and learning .",
"findings from co - immunoprecipitation experiments show that dream antibody can immunoprecipitate endogenous nr1 subunit and dream protein from rat hippocampal tissue ( zhang et al . , 2010 ) .",
"psd-95 is a major scaffolding protein in the postsynaptic density , tethering nmdars to signaling proteins , and is critical for nmda receptor function ( kim and sheng , 2004 ) .",
"by taking advantage of mice lacking the dream protein , they demonstrated that the facilitated learning induced by decreased expression of kv4.2 in dream mice requires the activation of nmda receptors containing the nr2b subunit ( fontan - lozano et al . , 2011 ) ."
],
[
"excitotoxicity is caused by overactivation of nmda receptor function , and inhibition of nmdars can reverse the neuronal toxicity .",
"in general , the pro - apoptotic role of dream closely correlates with its interaction with presenilins , the production of amyloid beta ( a ) and the modulation in ca signaling , whereas the anti - apoptotic role of dream is conferred by its transcriptional repressor activity on the apoptotic protein hrk .",
"the pro - apoptotic role of dream is selectively induced during ab toxicity . because of the involvement of presenilins/-secretase in a formation and neuronal death , dream coordinates with presenilin activity to play a crucial role in these processes through binding with the c - terminus of presenilins ( jo et al . , 2003 , 2004 ) .",
", we noticed that cell viability is affected by the amount of exogenous dream gene and the method of transfection ."
],
[
"therefore , targeting regulatory proteins of nmdars may represent an alternative approach to treating nmdar - mediated excitotoxic damage and providing neuroprotection .",
"this negative modulation of nmda receptor function by dream likely provides a feedback mechanism by which overactive nmda receptors are inhibited .",
"the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .",
"the ncs protein dream / calsenilin / kchip3 acts as an auxiliary subunit and suppresses nmda receptor channel function ."
],
[
"the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest ."
]
] | n - methyl - d - aspartate receptors ( nmdars ) are glutamate - gated ion channels highly permeable to calcium and essential to excitatory neurotransmission . the nmdars have attracted much attention because of their role in synaptic plasticity and excitotoxicity . evidence has recently accumulated that nmdars are negatively regulated by intracellular calcium binding proteins . the calcium - dependent suppression of nmdar function serves as a feedback mechanism capable of regulating subsequent ca2 + entry into the postsynaptic cell , and may offer an alternative approach to treating nmdar - mediated excitotoxic injury . this short review summarizes the recent progress made in understanding the negative modulation of nmdar function by dream / calsenilin / kchip3 , a neuronal calcium sensor ( ncs ) protein . |
[
[
"amisulpride came into the indian market a few years back with hypes and hopes in the management of schizophrenia .",
"all available reports suggest that chance of eps is very less with amisulpride at doses < 400 mg / day .",
"its selective affinity for dopamine receptors in the limbic structures , but not in the striatum , leads to a low risk of extrapyramidal side effects .",
"although this antipsychotic does not block serotonin receptors at all , it is a high - affinity and highly selective d3/d2 receptor antagonist with atypical properties .",
"its broad spectrum effectiveness with lower chances of extrapyramidal symptoms ( eps ) and metabolic syndrome did help psychiatrists to treat schizophrenia and related disorders more effectively .",
"however , there are sporadic reports of drug - induced eps including dystonia and akathisia even in patients receiving low doses of amisulpride . here"
],
[
"a 30-year - old male with schizophrenia for the past 10 years now presented with predominantly negative symptoms .",
"the patient returned on the 24 day with severe parkinsonian symptoms . in this patient also , there was no prior history of parkinsonism .",
"after 7 days , parkinsonian symptoms improved considerably and clozapine was introduced at a dose of 25 mg / day which was subsequently increased to 100 mg / day on the 10 day and the patient was discharged .",
"subsequent follow - up showed no parkinsonian symptoms and he had modest improvement in negative symptoms . a 48-year - old male with schizophrenia for the last 20 years"
],
[
", the lower incidence of eps which is claimed by western researchers as well as pharmaceutical companies should be studied well in the indian context .",
"since the discovery that clozapine induces fewer eps and is more effective for negative symptoms than conventional antipsychotics for the treatment of schizophrenia , psychopharmacological research has focused on the development of drugs that block central 5-ht2 receptors more than d2 receptors .",
"combined 5-ht2/d2 receptor antagonism is the most current explanation for the so - called atypical profile of some antipsychotics .",
"it has also been suggested that extrastriatal binding could mediate the effect on negative symptoms .",
"amisulpride at low doses binds selectively to dopamine d2 , d3 autoreceptors , thereby enhancing dopaminergic transmission and thus might be effective for negative symptoms ."
],
[],
[]
] | amisulpride , recently introduced atypical antipsychotic , is well - known for its broad spectrum effectiveness and lower profile for extrapyramidal side effects ( eps ) . its selective affinity for dopamine receptors in the limbic structures , but not in the striatum , leads to a low risk of extrapyramidal side effects . here , we report two cases of eps associated with lower dose of amisulpride . the proposed mechanism for its causation is also discussed . authors invite more studies , specifically from the indian context to find out the incidence of eps and other associated side effects . |
[
[
"based on national reports , the prevalence of diabetes has been raised during three decades in iran and also a recent national survey about hl has shown that majority of people has inadequate knowledge .",
", in english language . with regard to lacking of appropriate measurement tool for patients with diabetes in persian ( farsi ) language , this study aimed to provide evidence for the psychometric properties of the iranian ( persian language ) version of dnt-15 .",
"older studies of low hl reported adverse effects on diabetes - related health outcomes ; however , more recent studies showed no association between hl levels and intensity , frequency or incidence of outcomes , and thus the effect of hl on the health of people with diabetes is yet unclear .",
"however , there are different tools to measure hl and numeracy skills in general population in different languages , only diabetes numeracy test-15 ( dnt-15 ) has been developed specifically to measure numeracy skills in patients with diabetes as first scale by huizinga et al .",
"there is a developing frame of the literature that discovers the association between hl and health outcomes in people with diabetes .",
"diabetes is the most common metabolic disease with a dramatic increase rate of prevalence throughout the world , which has an important impact on the public health and quality of life of the patients .",
"the hl of patients has obtained more attention as a risk factor for poor adherence to treatment and adverse outcomes in chronic disease 's management particular in diabetes care .",
"the world health organization has defined health literacy ( hl ) as the cognitive and social abilities which determine the incentive and ability of individuals to increase access to understand and use information in ways , which promote and preserve good health . "
],
[
"the dnt was designed to evaluate nutrition , exercise , glucose monitoring , oral medication , and insulin skills that patients may encounter during daily diabetes self - management .",
"use refill patterns and dates , and oral titration schemes and insulin use ( seven questions ) including interpretation of syringes , correction or sliding - scale insulin use , insulin adjustment for carbohydrate intake , and titration instructions [ table 1 ] .",
"this group included experts in diabetes , certified diabetes educators , methodologist , primary care providers , and registered dietitians , behavioral researchers in diabetes , and literacy and numeracy experts . finally , the dnt was to address the clarity of items for patients with diabetes .",
"blood - glucose monitoring skills are evaluated by three items about number hierarchy , glaciated hemoglobin , and calculating supplies needed .",
"eight items assess the oral medication use and insulin use . oral medication ( one question )",
"a convenience sample of 120 patients with diabetes was interviewed in the diabetes clinic affiliated to institute of endocrinology and metabolismof an item at clinic visits . any person diagnosed with type 1 and or type 2 diabetes which was able to read ( at least eight grades ) and speak persian language .",
"description of diabetes numeracy test items in this phase , the original questionnaire was translated by two independent health professionals from english to persian .",
"many patients with diabetes use calculators ; therefore , participants were allowed to use calculators during the administration of the dnt to emulate real - life circumstances .",
"cultural equivalent to the word ( semantic ) , a term equivalent ( idiomatic ) , and equivalent experience ( experiential ) , and conceptually equivalent ( conceptual ) were performed by an expert panel ."
],
[
"use refill patterns and dates , and oral titration schemes and insulin use ( seven questions ) including interpretation of syringes , correction or sliding - scale insulin use , insulin adjustment for carbohydrate intake , and titration instructions [ table 1 ] .",
"many patients with diabetes use calculators ; therefore , participants were allowed to use calculators during the administration of the dnt to emulate real - life circumstances .",
"the dnt was designed to evaluate nutrition , exercise , glucose monitoring , oral medication , and insulin skills that patients may encounter during daily diabetes self - management .",
"items are scored as binary outcomes correct or incorrect and no partial credit is given .",
"blood - glucose monitoring skills are evaluated by three items about number hierarchy , glaciated hemoglobin , and calculating supplies needed .",
"eight items assess the oral medication use and insulin use . oral medication ( one question )",
"dnt scores are reported as percent correct ( with a possible range of 0% to be 100% ) ."
],
[
"in this phase , the original questionnaire was translated by two independent health professionals from english to persian ."
],
[
"in this phase , the questionnaire that translated in the previous step , gave to two professional translators whose native language were english , and they are sufficient dominance in persian language .",
"the translators did not communicate with one another and did not know the original english version ."
],
[
"this group included experts in diabetes , certified diabetes educators , methodologist , primary care providers , and registered dietitians , behavioral researchers in diabetes , and literacy and numeracy experts . finally , the dnt was to address the clarity of items for patients with diabetes .",
"interviewees were asked specific questions about each item to evaluate the understandability of the wording . if an item was unclear , the interviewee was told the purpose of the item and then encouraged to suggest a different format or wording . in response to the interviews , the scale was reformatted and slightly reduced to the final 15-items .",
"cultural equivalent to the word ( semantic ) , a term equivalent ( idiomatic ) , and equivalent experience ( experiential ) , and conceptually equivalent ( conceptual ) were performed by an expert panel .",
"in this phase , a group of experts was reviewed , all phases , including verification and cross - cultural equivalent ( cross - cultural equivalence ) .",
"reliability was evaluated by internal consistency ( kuder - richardson 20 ) , and validity was evaluated through content validity ratio ( cvr ) and content validity index ( cvi ) ."
],
[
"a convenience sample of 120 patients with diabetes was interviewed in the diabetes clinic affiliated to institute of endocrinology and metabolismof an item at clinic visits . any person diagnosed with type 1 and or type 2 diabetes which was able to read ( at least eight grades ) and speak persian language .",
"potential participants were excluded if they corrected visual acuity was > 20/50 using a rosenbaum pocket vision screener , or if they had a diagnosis of significant dementia , psychosis , or blindness ."
],
[
"difficult issues for participants included titration schemas , food label interpretation , insulin adjustment instructions , and items that required multi - step math ( e.g. , calculating insulin dosage based on carbohydrate intake and glucose level ) .",
"questions 2 , 5 , 6 , 7 , 8 , 9 , and 11 were answered accurately respectively by 89.1% , 78.2% , 87.4% , 72.3% , 85.7% , 84% , and 83% of participants for this study .",
"however , questions 14 and 15 , which required patients to interpret a word problem and apply multiple numerical steps to determine their insulin dosage , was only answered correctly , respectively by 41% , 54% of the participants .",
"the 15-item persian version of the dnt has highly reliable , as determined by internal consistency kuder - richardson ( kr-20 = 0.90 ) .",
"content validity was examined by the expert panel ( cvr : 089 and cvi : 0.86 ) ."
],
[
"for example , study participants had a difficult time with the multi - step math required to calculate a correction dosage of insulin when instructions were presented as a sequence of sentences .",
"this example provides an important lesson for health care providers and educators in effective communication styles for all clinical care recommendations .",
"the short version of the dnt-15 demonstrated internal consistency and construct validity in relation to reading skills in persian ( farsi ) language in iranian population .",
"more studies are needed to further understand the role of numeracy tailored interventions for the management of diabetes .",
"this item was encompassed to mirror clinical practice regarding how patients are currently instructed to take their insulin .",
"scores on the dnt-15 showed a direct correlation with level of education in this study which is consistent with other reports .",
"the dnt-15 can provide a measurement of diabetes - specific numeracy and provide more information on the role of disease - specific numeracy in future studies ."
],
[
"the persion ( farsi ) version of dnt-15 is a reliable and valid tool to measure of diabetes - specific numeracy skills for patients with diabetes ."
]
] | background : low health literacy ( hl ) of patients has obtained more attention as a risk factor for poor adherence to treatment and adverse outcomes in chronic disease 's management particular in diabetes care . diabetes numeracy test-15 ( dnt-15 ) has been developed specifically for this purpose . the objective of the current study is to evaluate psychometric properties of iranian ( persian ) version of the dnt-15.methods:the shortened version of the dnt ( 15-items ) was completed by 120 patients with diabetes . the kuder richardson formula 20 for internal consistency was conducted . content validity , criterion - related validity , and construct validity were also evaluated.results:the average score on the dnt was 72% and took an average of 25 minutes to complete . the dnt-15 had a very good internal reliability ( kr-20 = 0.90 ) and also content validity ( content validity ratio : 089 and content validity index : 0.86).conclusions : the dnt-15 ( persian version ) is a reliable and valid measure of diabetes - related numeracy skills for iranian patients with diabetes ; however , additional studies are needed to further explore the association between diabetes - specific numeracy and acculturation and their impact on diabetes - related outcomes in iranian population . |
[
[
"we therefore applied a protein array approach that provides accurate and precise quantification of twelve proteins with known lung or vascular effects in a cohort of pediatric patients with ph .",
"our objective was to determine whether there is a clinically relevant association between any of the panel constituents , individually or combined , with hemodynamic parameters , disease prognosis , and relevant adverse outcomes .",
"\n pulmonary hypertension ( ph ) encompasses a diverse group of disorders , all characterized by an elevation in pulmonary arterial pressure and pulmonary vascular resistance ( pvr ) .",
"circulating protein biomarkers have the potential to meet these objectives . the role of inflammation in the pathobiology of ph has recently been emphasized [ 69 ] .",
"recent developments in protein array technology allow high throughput , multiplex analysis with excellent sensitivity , precision , and specificity .",
"pediatric ph is associated with significant morbidity and mortality , and differs from ph as manifest in adults in several important ways , such as the development of ph in a growing lung ."
],
[
"most subjects were ventilated because they were children . in addition , the reactivity to inhaled nitric oxide was calculated by taking the difference in mean pap between room air and with nitric oxide . the adverse outcome used in the predictive models",
"the data were obtained with the patient breathing room air , prior to testing pulmonary reactivity with the use of vasodilator therapy . for right - heart catheterization",
"we used fick with assumed oxygen consumption in those patients with shunts and thermodilution in all others to measure cardiac output and then calculate cardiac index .",
"the improvement in risk prediction associated with the addition of the protein biomarker pc was assessed by calculation of a net reclassification improvement ( nri ) measure .",
"plasma samples were collected from 70 pediatric patients with ph ranging in age from newborn to 21.3 years old .",
"spearman rank correlation coefficients were used to estimate the association between the hemodynamic variables and protein markers .",
"invasive arterial monitoring was used to measure the systemic vascular resistance index ( svri ) ."
],
[
"the study population consisted of 70 pediatric patients with ph : 36% ipah and 64% with apah . of these ,",
"none of the biomarkers correlated with the change in mean pap in response to inhaled no . to assess the potential additive predictive ability of the proteins we measured ,",
"score statistics were used to identify the top predictive clinical markers and determine the added value of a protein marker index over the top clinical predictor . the resulting clinical model identified pap as the top predictor . using this model as a base model , the pcs of the protein measurements were added as predictors and the selection process was repeated .",
"the first of these were univariate models that were estimated to determine the association of each protein individually with the adverse outcome variable .",
"significant improvement was seen with the addition of the protein measurements ( nri p value = 0.01 ) indicating that their inclusion enhanced the models ability to correctly classify patients ."
],
[
"our study demonstrates that quantification of a panel of cytokines and growth factors has potential applications in clinical trial design by identifying patients at risk for an adverse event .",
"of interest and clinical relevance is the fact that we have shown that by simply adding the quantification of a set of plasma proteins , it is possible to markedly improve our ability to predict outcomes in children with ph .",
"this observation stimulated our efforts to develop a practical and noninvasive approach to the management of pediatric pulmonary hypertension that can be used in a routine setting .",
"our data ( table 1 ) indicate a surprisingly high morbidity and mortality , even in children with mild pulmonary hypertension , and they underscore the fact that this is a very high - risk group .",
"in addition , we identified a combination of all twelve proteins which associated well with adverse events and had similar predictive ability compared to the top hemodynamic predictor . "
],
[
"we suggest that , based on our findings , additional evaluation of cytokines and growth factors is warranted because there is growing evidence that these determinations may be relevant for disease management .",
"serial sampling and assessment of longitudinal changes might provide important additional insights , but these findings indicate that even a single point in time determination can predict the future clinical course .",
"this study adds to the growing body of literature indicating that inflammation is important in pediatric ph and that circulating ( blood ) biomarkers can be important tools in prediction and prognostic evaluation of pediatric patients with ph .",
"it is clear that the next step is to validate these findings in a larger scale study including several groups of well - characterized subjects .",
"we intentionally examined a heterogeneous group of patients in this study in order to explore patterns of biomarker expression .",
"the potential for growth factors , egf and vegf , to aid in the management of ph is important and novel ."
]
] | background . management of pediatric pulmonary hypertension ( ph ) remains challenging . we have assessed a panel of circulating proteins in children with ph to investigate their value as predictive and/or prognostic biomarkers . from these determinations , we aim to develop a practical , noninvasive tool to aid in the management of pediatric ph . methods . twelve cytokines and growth factors putatively associated with lung or vascular disease were examined in plasma specimens from 70 children with ph using multiplex protein array technology . associations between hemodynamics , adverse events , and protein markers were evaluated . results . epidermal growth factor ( egf ) and il-6 were associated with important hemodynamics . of the twelve proteins , vegf and il-6 were significantly , univariately associated with the occurrence of an adverse event , with odds ratios ( 95% confidence intervals ) of 0.56 ( 0.330.98 ) and 1.69 ( 1.032.77 ) , respectively . when hemodynamic predictors were combined with protein markers , the ability to predict adverse outcomes within the following year significantly increased . conclusions . specific circulating proteins are associated with hemodynamic variables in pediatric ph . if confirmed in additional cohorts , measurement of these proteins could aid patient care and design of clinical trials by identifying patients at risk for adverse events . these findings also further support a role for inflammation in pediatric ph . |
[
[
"t1d is a chronic autoimmune disease where cd4 + and cd8 + t cells recognizing islet autoantigens are likely the mediators of selective destruction of pancreatic islet beta cells .",
"although direct demonstration of the prominent role of t cells in the disease progression is provided only in animal models , the preclinical period of the disease in humans is marked by the presence of circulating islet - related autoantibodies to beta cell antigens including insulin , glutamic acid decarboxylase ( gad ) , isoforms gad65 and gad67 , the insulinoma - associated antigen ( ia2)/tyrosine phosphatase - like molecule , ia-2 or phogrin , and proinsulin . from the 1990s",
"mhc tetramer technology was initially introduced to target antigen - specific cd4 + t cells in patients with viral , bacterial infections , tumors . in reference to human autoimmunity class ii tetramers"
],
[
"the presence of flu tetramer positive cells was assessed in randomly selected samples by staining after flu peptide stimulation . in order to verify the specificity of the reactivity of the gad65 hla a*0201 tetramer in the detection of gad65 nonapeptide reactive t cells and as control of nonspecific",
"a positive control of stimulation was introduced in all the experiments in order to prove that in vitro stimulation worked in all subjects , including those from whom no gad specific t cells were detected . ",
"the staining with the flu tetramer was carried out either by direct assay ex vivo or after stimulation of the same pbmc first with the flu peptide ( 3.5 g / ml ) for 4 days followed , after washing the cells , by an incubation with il-2 for 2 days .",
"in parallel experiments control cell cultures were set up by incubating pbmc from the same individual with il-2 ( 25 iu / ml , sigma ) for 4 days , in place of the gad65 peptide , in order to ensure that pbmc would live for the entire culture period prior to the flow cytometry analysis ( vide infra ) . at the end of the 4 days ,",
"binding , pbmc of randomly selected t1d patients and controls were cultured separately with the gad65 nonapeptide , the flu nonapeptide , and il-2 .",
"9 hla - a*0201 positive pediatric patients ( 4 males and 5 females , age of onset range 9.2 years to 16.4 years , mean 12.8 years ) were recruited from lazio region at the onset of t1d at the unit of pediatric endocrine autoimmune diseases at the children 's hospital bambino ges , rome ( table 1 ) .",
"we also included 6 long - term hla - a*0201 positive pediatric t1d patients ( between 8 months to 4 years and 5 months after diagnosis ) .",
"this test was performed in order to verify that we could obtain an increased sensitivity of the flu tetramer staining after flu peptide stimulation ."
],
[
"this test is an alternative to control the nonspecific binding of tetramer to t cells with the use of an irrelevant peptide .",
"this test is an alternative to control the nonspecific binding of tetramer to t cells with the use of an irrelevant peptide .",
"with pbmc of the normal controls , the percentage of cd3/cd8/gad65 reactive t cells was comparable in the 3 stimulation conditions . in principle , we assume that the specific reactivity could be detectable in each single sample only after gad65 peptide stimulation . ",
"with pbmc of the normal controls , the percentage of cd3/cd8/gad65 reactive t cells was comparable in the 3 stimulation conditions . in principle , we assume that the specific reactivity could be detectable in each single sample only after gad65 peptide stimulation . ",
"the population of cd3+/cd8+/gad65 reactive cells was shown in panel ( f ) ( 4.04% of total cell population).il-2 treatment affected differentially the detection of cd3+/cd8+/gad65 reactive t cells in t1d patients versus control ( p = .07 t1d patients versus controls ) ( figure 1 ) . in pbmc of t1d patients the percentage of cd3+/cd8+/gad65 reactive t cells were significantly more pronounced in comparison to those registered with pbmc of controls after stimulation with the same gad65 peptide ( p = .001 t1d versus controls , figures 1 and 2 ) . \n"
],
[
"previous studies [ 19 , 20 ] clearly demonstrated that mhc class ii tetramers can efficiently detect gad65 reactive cd4 + t cells in pbmc of t1d patients . ",
"tetramers containing autoantigenic peptides have clinical utility in autoimmunity for diagnostic and , potentially , therapeutic applications [ 1929 ] . ",
"gad65-specific hla dr0401-restricted clones could be even derived from a diabetic patient using tetramers as stimulating agent . ",
"these encouraging data prompted us to trace gad65 autoreactive t cells in t1d ; in the present investigation hla - a*0201 tetramers were therefore constructed with a ",
"we have chosen the second approach , because we believe that preincubation with the peptide might induce a limited specific t cell expansion in vitro and , therefore , may increase the chance to awake autoreactive cd8 + t cells ."
],
[
"a valid statistical evaluation of results will help to establish an appropriate cutoff value of positivity in the assay .",
"this can be achieved by testing pbmc of a large number of t1d patients , normal controls , and especially prediabetic high - risk individuals ."
]
] | type 1 diabetes ( t1d ) is an autoimmune disease , in which pancreatic cells are destroyed in genetically predisposed individuals . while the direct contribution of autoantibodies to the disease pathogenesis is controversial , it is generally recognised that the mechanism of cell destruction is mediated by autoreactive t cells that had escaped the thymic selection . we aimed to design a method to detect circulating cd8 + t cells autoreactive against an epitope of the glutamic acid decarboxylase autoantigen , isoform 65 ( gad65 ) ex vivo in t1d patients by using hla class i tetramers . low frequencies of gad65 peptide - specific cd8 + cytotoxic t lymphocytes were detected in peripheral blood lymphocytes ( pbmc ) of normal controls after gad65 peptide - specific stimulation . conversely , their frequencies were significantly higher than in controls in pbmc of t1d patients after gad65 peptide stimulation . these preliminary data are encouraging in order to develop a reliable assay to be employed in large - scale screening studies . |
[
[
"the ability to screen a large library of compounds against an important protein target such as nf-b using aluminescence assay amenable to high - throughput screening would be invaluable in developing new treatments and diagnostic tools for inflammation and autoimmune diseases .",
"therefore , the rapid and convenient detection of transcription factor activity is important for the development of inhibitors for the treatment or prevention of these diseases .",
"transcription factors are a class of proteins that regulate gene expression by binding to specific dna sequences within the regulatory regions of genes ( 1 ) . due to their important role in the regulation of gene expression ,",
"the transcription factor nf-b has been identified as an important regulator for key pro - inflammatory mediators such as tnf- , which is involved in the immune response , apoptosis and cell cycle regulation ( 53 ) ."
],
[
"expression of the p50 protein from the t7 promoter was induced for 5 h at 30c by the addition of 0.1 mm isopropyl-1-thio--d - galactopyranoside ( final concentration ) .",
"the digestion reaction was quenched by the addition of 25 mm edta and diluted to 1 ml with a solution of the ruthenium complex ( 1 m , final concentration ) and [ fe(cn)6 ] ( 600 m , final concentration ) in tf buffer ( 10 mm tris , ph 7.4 , 50 mm kcl , 1 mm dtt , 1 mm mgcl2 , 10% glycerol ) . the solution was then allowed to stand for 10 min and the luminescence spectrum was measured using an excitation wavelength of 450 nm .",
"the fractions containing the p50 protein were combined and dialyzed against 10 mm tris buffer solution ( ph 7.9 , 10% glycerol , 1 mm edta , 50 mm nacl and -mercaptoethanol ) . the purity of the expressed p50 proteins were estimated to be > 90% pure using electrophoresis on sds "
],
[
"expression of the p50 protein from the t7 promoter was induced for 5 h at 30c by the addition of 0.1 mm isopropyl-1-thio--d - galactopyranoside ( final concentration ) .",
"the fractions containing the p50 protein were combined and dialyzed against 10 mm tris buffer solution ( ph 7.9 , 10% glycerol , 1 mm edta , 50 mm nacl and -mercaptoethanol ) . the purity of the expressed p50 proteins were estimated to be > 90% pure using electrophoresis on sds ",
"the cells were grown at 37c in a shaking incubator until the absorbance of the culture at 600 nm was 0.6 .",
"the cell debris was pelleted by ultracentrifugation ( 27 500 rpm , 4c and 40 min ) ."
],
[
"hairpin ( hp ) containing one nf-b binding site : \n 5-agttgaggggactttcccaggccagaaggagcctgggaaagtcccctcaact-3 5-agttgaggggactttcccaggccagaaggagcctgggaaagtcccctcaact-3 double - strand containing one nf-b binding site : \n 5-agttgaggggactttcccaggc-33-tcaactcccctgaaagggtccg-5 5-agttgaggggactttcccaggc-3 3-tcaactcccctgaaagggtccg-5 double - strand containing two nf-b binding site : \n 5-ttgagggactttccgaacatgcaggcaagctggggactttccagg-33-aactccctgaaaggcttgtacgtccgttcgacccctgaaaggtcc-5 5-ttgagggactttccgaacatgcaggcaagctggggactttccagg-3 3-aactccctgaaaggcttgtacgtccgttcgacccctgaaaggtcc-5 double - strand without nf-b binding site : \n 5-ttgttacaactcactttccgctgctcactttccagggaggcgtgg-33-aacaatgttgagtgaaaggcgacgagtgaaaggtccctccgcacc-5 5-ttgttacaactcactttccgctgctcactttccagggaggcgtgg-3 3-aacaatgttgagtgaaaggcgacgagtgaaaggtccctccgcacc-5"
],
[
"the digestion reaction was quenched by the addition of 25 mm edta and diluted to 1 ml with a solution of the ruthenium complex ( 1 m , final concentration ) and [ fe(cn)6 ] ( 600 m , final concentration ) in tf buffer ( 10 mm tris , ph 7.4 , 50 mm kcl , 1 mm dtt , 1 mm mgcl2 , 10% glycerol ) . the solution was then allowed to stand for 10 min and the luminescence spectrum was measured using an excitation wavelength of 450 nm .",
"the appropriate oligonucleotide ( 0.02 m ) was first annealed in tris buffer solution ( 10 mm , ph 7.4 , 100 mm nacl , 1 mm edta , final concentration ) by incubating at 95c for 5 min , followed by gradual cooling to room temperature over a period of 1 h. the p50 subunit and the annealed oligonucleotide mixture in tf buffer ( 10 mm tris , ph 7.4 , 50 mm kcl , 1 mm dtt , 1 mm mgcl2 , 10% glycerol ) were incubated for 20 min at 37c , after which 40 units of exoiii ( neb ) were added and the mixture was incubated for an additional 50 min at 37c ."
],
[
"the overactivation of nf-b has been associated number of autoimmune and inflammatory diseases and it is thus considered an important drug target ( 53,54 ) . the label - free assay described herein can be readily applied to a high - throughput format using 96-well plates .",
"due to the low cost of the label - free oligonucleotides and the ruthenium metallointercalator , large chemical libraries can be screened in an inexpensive and high - throughput manner , allowing the identification of small molecule nf-b inhibitors for treating autoimmune and inflammatory diseases .",
"the principle behind our assay for the detection of transcription factor activity is based on the 35 activity of exoiii and a luminescent transition metal complex which is switched - on in the presence of double - stranded dna ( scheme 1 ) . in the presence of double - stranded dna , the ruthenium complex [ ru(phen)2(dppz ) ] ( scheme 1 ) intercalates into the double - stranded dna and is emissive , presumably through suppression of non - radiative decay by solvent interactions .",
"this label - free assay is based on the inhibition of exoiii catalyzed digestion of the oligonucleotide by the binding of the p50 subunit . to validate the mechanism of this method",
", we designed a hairpin oligonucleotide that contained the nf-b binding site [ -gggactttc- ] ( 56 ) ."
],
[
"a luminescent ruthenium metallointercalator is used to probe the double - stranded substrate leading to a switch - on effect in the presence of the transcription factor .",
"our method is based on the principle that the binding of the transcription factor prevents the exoiii catalyzed digestion of a double - stranded substrate .",
"this method allows the detection of transcription factor activity without the need for time - consuming experiments such as gel mobility shift assays or dna footprinting .",
"the luminescence enhancement was shown to be proportional to the concentration of the transcription factor nf-b subunit p50 .",
"therefore , this assay can be used to identify modulators that can activate or inhibit transcription factor dna binding , for the diagnosis and treatment of diseases linked with irregular transcription factor activity .",
"in conclusion , we have described the first label - free luminescence detection method for transcription factor activity .",
"we have also demonstrated that in the presence of a known nf-b inhibitor oridonin , the luminescence response of the ruthenium complex was decreased ."
],
[
"funding for open access charge : the hong kong baptist university ( frg2/09 - 10/070 ) ."
]
] | transcription factors are involved in a number of important cellular processes . the transcription factor nf-b has been linked with a number of cancers , autoimmune and inflammatory diseases . as a result , monitoring transcription factors potentially represents a means for the early detection and prevention of diseases . most methods for transcription factor detection tend to be tedious and laborious and involve complicated sample preparation , and are not practical for routine detection . we describe herein the first label - free luminescence switch - on detection method for transcription factor activity using exonuclease iii and a luminescent ruthenium complex , [ ru(phen)2(dppz)]2 + . as a proof of concept for this novel assay , we have designed a double - stranded dna sequence bearing two nf-b binding sites . the results show that the luminescence response was proportional to the concentration of the nf-b subunit p50 present in the sample within a wide concentration range , with a nanomolar detection limit . in the presence of a known nf-b inhibitor , oridonin , a reduction in the luminescence response of the ruthenium complex was observed . the reduced luminescence response of the ruthenium complex in the presence of small molecule inhibitors allows the assay to be applied to the high - throughput screening of chemical libraries to identify new antagonists of transcription factor dna binding activity . this will allow the rapid and low cost identification and development of novel scaffolds for the treatment of diseases caused by the deregulation of transcription factor activity . |
[
[
"the objective of the present study was to perform a parallel analysis employing psm to investigate the equivalency of results with those obtained in the prior mr analysis .",
"although considered the gold standard for evaluating treatment effectiveness , randomized clinical trials ( rcts ) have important limitations .",
"multivariable regression ( mr ) methods are commonly used to control for confounding factors in observational studies .",
"the matching process involves diagnostic checks regarding the balance of covariates across groups and provides information about the quality of the inferences that can be drawn from the subsequent analysis.3 propensity score matching ( psm ) has been increasingly used in epidemiologic studies of medical treatment effectiveness.1 a propensity score represents the propensity of a particular subject to receive a particular treatment , based on the subject s pre - treatment characteristics.1,4,5 the score combines many covariates into a single variable and enables individuals from each treatment group with similar covariate values to be matched , as a quasi - randomization method.3 subjects who can not be matched are excluded from the analysis .",
"as pharmacotherapy is a primary means for reducing exacerbations , data concerning real world treatment effectiveness is of interest to health care providers , health care organizations , and health plans ."
],
[
"using psm methods , we conducted a parallel analysis of copd - related health care utilization and costs in patients with copd receiving initial maintenance therapy ( imt ) with fsc , tio , or ipr , and we compared the results to those of a previous mr analysis .",
"the tio patients and ipr patients were separately matched to fsc patients based on propensity score ; that is , patients initiating therapy with tio were matched to patients initiating with fsc , and patients initiating therapy with ipr were matched to patients initiating with fsc .",
"the study population included health plan members with diagnosed copd who were new to maintenance therapy with fsc 250 g/50 g , tio , or ipr ( alone or in fixed dose combination with albuterol ) .",
"the propensity to be a patient whose initial maintenance therapy was tio ( or alternatively , ipr ) incorporated the following baseline factors in the logistic regression equation : sex , age category , geographic region , comorbidities , copd - related health care utilization , non - copd - related health care utilization , copd medication use , and copd - related medical services costs .",
"the specific content of the dataset has been described previously.13 in the prior retrospective , observational cohort study , copd - related clinical and economic outcomes were evaluated in patients who received one of three imt medications for copd ( fsc , tio , or ipr).13 the study perspective was that of the health plan provider organization , and only direct costs were considered ."
],
[
"this is typically the amount the health plan pays , plus any member liability ( eg , co - payment , deductible , or coinsurance amount ) . for claims with missing charges due to capitation arrangements ,",
"calculated costs were based on allowed amounts , which most closely resemble the direct health care cost burden of illness .",
"administrative data were obtained from the ims lifelink health plan claims database ( ims health , watertown , wa ) , which contains enrollment and demographic data , and health care and outpatient pharmacy claims from more than 40 million members of more than 70 us health plans .",
"the dataset included patient demographic and enrollment data , outpatient pharmacy claims , and medical services claims ( outpatient , ed , and inpatient claims , including both facility claims and professional services claims ) for january , 2004 to june , 2009 ."
],
[
"in the prior retrospective , observational cohort study , copd - related clinical and economic outcomes were evaluated in patients who received one of three imt medications for copd ( fsc , tio , or ipr).13 the study perspective was that of the health plan provider organization , and only direct costs were considered .",
"the study population included health plan members with diagnosed copd who were new to maintenance therapy with fsc 250 g/50 g , tio , or ipr ( alone or in fixed dose combination with albuterol ) .",
"the primary cost outcomes were mean copd - related medical services costs , outpatient pharmacy costs ( copd controller and relief medications , oral corticosteroids , and antibiotics ) , and total costs ( the sum of the two ) .",
"the patient eligibility criteria and selection process have been described in detail previously.13 the primary utilization outcomes were incidence and mean number of copd - related outpatient visits , outpatient visits associated with an antibiotic prescription fill , outpatient visits associated with an oral corticosteroid fill , hospitalizations , ed visits , and hospitalization and/or ed visits ( combined endpoint ) .",
"the multivariable models controlled for age , sex , treatment , comorbidities ( including asthma and heart disease ) , and copd - related health care utilization at baseline .",
"bivariate analyses were used to compare differences between treatment cohorts in health care utilization and cost outcomes for the 12-month follow - up period ."
],
[
"the tio patients and ipr patients were separately matched to fsc patients based on propensity score ; that is , patients initiating therapy with tio were matched to patients initiating with fsc , and patients initiating therapy with ipr were matched to patients initiating with fsc .",
"the propensity to be a patient whose initial maintenance therapy was tio ( or alternatively , ipr ) incorporated the following baseline factors in the logistic regression equation : sex , age category , geographic region , comorbidities , copd - related health care utilization , non - copd - related health care utilization , copd medication use , and copd - related medical services costs .",
"the utilization factors were hospitalization count and binary variables for outpatient visit , outpatient visit associated with an oral corticosteroid fill , outpatient visit associated with an antibiotic fill , ed visit , and hospitalization and/or ed visit ( combined endpoint ) .",
"bivariate analyses were used to compare differences in outcomes in the 12-month period following initiation of maintenance therapy for the fsc - tio and fsc - ipr matched cohorts .",
"since the psm treatment groups were already matched for baseline characteristics , and our interest was only in the treatment effect , the psm regression models contained only a factor for case imt ( tio or ipr ) , with fsc used as the reference medication .",
"the matched samples were created based on each patient s predicted probability ( propensity ) of assignment to the case treatment ( tio or ipr ) ."
],
[
"a total of 32,338 patients met patient selection criteria in the mr analysis : 12,595 fsc patients , 9126 tio patients , and 10,617 ipr patients . for the psm analysis , 89.1% ( 8135 ) of the tio patients",
"nonetheless , both analyses show that tio and ipr patients have higher ors , compared to fsc patients , for outpatient visit , outpatient visit with oral corticosteroid , ed visit , and hospitalization / ed visit .",
"however , in the psm analysis , irrs for outpatient visits with oral corticosteroid and for hospitalizations were no longer significant .",
"3.4% of fsc patients and 4.5% of tio patients had one or more ed visit . in the ipr - fsc psm analysis , 3.8% of fsc patients and",
"for example , in the mr analysis , 3.6% of fsc patients , 4.7% of tio patients , and 7.3% of ipr patients had one or more ed visit ( p < 0.001 for all differences between tio and fsc and between ipr and fsc).19 in the tio - fsc psm analysis ,"
],
[
"baseline demographic , clinical , and utilization characteristics of the cohorts after matching on propensity score are shown in table 1 ( tio - fsc ) and table 2 ( ipr - fsc ) , along with p values for unpaired significance tests . paired",
"matching between the ipr and fsc patients involved more factors . after matching , differences were present for some baseline characteristics : mean copd - related outpatient visits ( p = 0.02 ) , mean all - cause outpatient visits ( p < 0.001 ) , and mean days supply of sabas ( p = 0.007 ) .",
"similarly , excluded ipr patients , when compared to fsc patients not matched to ipr patients , were older ( 68.6 vs 60.4 years , p < 0.001 ) and more likely to be male ( 58.4% vs 37.0% , p < 0.001 ) , not to have asthma ( 6.6% vs 45.3% , p < 0.001 ) , to have lower use of leukotriene modifiers ( 1.5% vs 14.6% , p < 0.001 ) and sabas ( 6.2% vs 45.1% , p < 0.001 ) , and to have significantly higher copd - related medical service costs ( $ 5437 vs $ 220 , p < 0.001 ) .",
"the tio and fsc groups were well balanced with respect to baseline characteristics ; the groups were different only in mean copd - related outpatient visits ( p < 0.001 ) .",
"the excluded tio patients , when compared to fsc patients who were not matched to tio patients , were older ( mean , 66.9 vs 60.1 years , p < 0.001 ) and more likely to be male ( 68.7% vs 39.8% , p"
],
[
"fsc was associated with higher pharmacy costs ( fsc , $ 917 [ 95% ci : $ 897936 ] ; ipr , us$614 [ 95% ci : $ 601627 ] ) , but lower medical service costs ( fsc , $ 1122 [ 95% ci : $ 10991146 ] ; ipr , us$1746 [ 95% ci : $ 17091784 ] ) , and total costs compared to ipr ( fsc , us$2039 [ 95% ci : $ 19962083 ] ; ipr , us$2360 [ 95% ci : $ 23112411 ] ) .",
"fsc was associated with lower medical services costs ( fsc , us$1085 [ 95% ci : $ 10611108 ] ; tio , us$1316 [ 95% ci : $ 12881345 ] ) , and total health care costs compared to tio ( fsc , $ 2037 [ 95% ci : $ 19932081 ] ; tio , us$2267 [ 95% ci : $ 22182316 ] ) .",
"for example , in the mr analysis , 3.6% of fsc patients , 4.7% of tio patients , and 7.3% of ipr patients had one or more ed visit ( p < 0.001 for all differences between tio and fsc and between ipr and fsc).19 in the tio - fsc psm analysis ,",
"the original mr analysis found that , in each of the five categories of utilization events , a lower percentage of fsc patients compared to ipr patients experienced events .",
"for each outcome measure , the percentage of patients with an encounter was lower in the fsc cohort than in the tio and ipr cohorts , although , in the psm analysis , because of the excluded younger fsc and older tio patients , the fsc percentages increased slightly and the tio percentages decreased slightly , diminishing the absolute differences between the two groups . with the exception of pharmacy costs , differences in costs that were significant in the mr analysis were also significant in the psm analyses .",
"differences in copd - related costs that were significant in the mr analysis were also significant in the psm analysis ."
],
[
"for each outcome measure , the percentage of patients with an encounter was lower in the fsc cohort than in the tio and ipr cohorts , although , in the psm analysis , because of the excluded younger fsc and older tio patients , the fsc percentages increased slightly and the tio percentages decreased slightly , diminishing the absolute differences between the two groups . with the exception of pharmacy costs , differences in costs that were significant in the mr analysis were also significant in the psm analyses .",
"the fsc group had a lower percentage of patients with an outpatient visit , outpatient visit associated with an oral corticosteroid , ed visit , or hospitalization / ed visit .",
"in contrast to the mr analysis , the psm analysis found no difference in the percentage of patients with a hospitalization ( p = 0.25 ) or outpatient visit associated with an oral corticosteroid ( p = 0.08 ) .",
"several significant differences between the tio and fsc groups seen in the mr analysis were also seen in the psm analysis .",
"fsc was associated with lower medical services costs ( fsc , us$1085 [ 95% ci : $ 10611108 ] ; tio , us$1316 [ 95% ci : $ 12881345 ] ) , and total health care costs compared to tio ( fsc , $ 2037 [ 95% ci : $ 19932081 ] ; tio , us$2267 [ 95% ci : $ 22182316 ] ) ."
],
[
"the original mr analysis found that , in each of the five categories of utilization events , a lower percentage of fsc patients compared to ipr patients experienced events .",
"these findings were essentially duplicated in the psm analysis , despite the exclusion of 20% of the ipr patients .",
"differences in copd - related costs that were significant in the mr analysis were also significant in the psm analysis . fsc was associated with higher pharmacy costs ( fsc , $ 917 [ 95% ci : $ 897936 ] ; ipr , us$614 [ 95% ci : $ 601627 ] ) , but lower medical service costs ( fsc , $ 1122 [ 95% ci : $ 10991146 ] ; ipr , us$1746 [ 95% ci : $ 17091784 ] ) , and total costs compared to ipr ( fsc , us$2039 [ 95% ci : $ 19962083 ] ; ipr , us$2360 [ 95% ci : $ 23112411 ] ) .",
"( p values for all differences were < 0.001 in the mr analysis , and ranged from < 0.001 to 0.03 in the psm analysis ) ."
],
[
"for example , in the mr analysis , the statistically significant hospitalization / ed visit ors for tio and ipr ( with respect to fsc ) are 1.28 and 1.72 , respectively ; these values are 1.21 and 1.67 in the psm analysis , respectively .",
"the mr and psm analyses produced fairly similar ors for various categories of health care utilization , with ors produced by the psm analysis being slightly lower .",
"nonetheless , both analyses show that tio and ipr patients have higher ors , compared to fsc patients , for outpatient visit , outpatient visit with oral corticosteroid , ed visit , and hospitalization / ed visit .",
"the ipr and fsc comparison also showed higher ors for hospitalization and for an outpatient visit with an antibiotic .",
"however , while the mr analysis calculated slightly higher odds for hospitalization for tio ( or : 1.19 [ 95% ci : 1.041.37 ] ) compared to fsc , the psm analysis found no difference ( or : 1.10 [ 95% ci : 0.941.28 ] ) , nor was any difference in risk found between tio and fsc for an outpatient visit with an antibiotic ( or : 1.14 [ 95% ci : 0.981.32 ] ) ."
],
[
"the irrs for health care utilization events in the tio and ipr groups with reference to the fsc group are shown in figure 5 .",
"again , both analytic methods yielded fairly similar irrs , with the psm analysis producing slightly lower irrs for all categories of utilization . in all comparisons in the psm analysis , as in the mr analysis , ipr patients were found to be at significantly higher risk for events , compared to fsc patients . for the tio group compared to the fsc group ,",
"however , in the psm analysis , irrs for outpatient visits with oral corticosteroid and for hospitalizations were no longer significant ."
],
[
"in this analysis of data from an observational , retrospective cohort study of initial maintenance therapies for copd , we demonstrated the similarity of results using two analytic approaches to observational research .",
"specifically , we compared results from a psm analysis with those from a previously published , parallel mr analysis.13 we found that both methods yielded similar health care utilization and cost outcomes .",
"other researchers have reported that results from the two methods appear to be consistent when there is large overlap between groups in propensity for a given treatment , which ensures minimal loss of observations , and when outcomes can be modeled with a relatively large number of events per covariate.1,4,24 our findings support this view and suggest that , with regard to less frequent events , in particular when effect sizes may be small , consideration should be given to analyzing outcomes using both methods , assuming a large proportion of subjects can be matched . while psm is a more transparent method , in the sense that it allows one to see the degree of equality between groups after matching , in this study , psm provided little advantage over mr in terms of the validity of the results . because of the inevitable reduction in sample size and change in overall composition of treatment groups being compared , the choice of whether to use psm or mr will depend on the question being investigated , whether a population effect is being measured , and whether review of a non - representative population of patients receiving treatment is acceptable ( or even preferred ) .",
"both mr and psm methods adjust associations between treatment effects and outcomes to reduce potential bias from observed covariates .",
"since both mr and propensity matched analyses attempt to reduce bias through adjustment using covariates , the ability to do this is dependent on the capture of all relevant factors . in this analysis",
"however , we did control for two key characteristics of interest disease severity and exacerbation frequency by using prior copd - related health care and pharmacy utilization ( particularly oral corticosteroids / antibiotics ) as proxy measures ."
],
[
"further , this analysis underscores the need for researchers to have a good understanding of the populations undergoing treatment and the factors associated with both receipt of treatment and occurrence of the measured outcomes .",
"while some sample size was lost in the psm analysis , results from both methods were similar in direction and statistical significance .",
"results obtained in our analysis suggest that both mr and psm methods are appropriate analytic techniques for addressing and mitigating bias in observational research . in this example of an observational study of maintenance therapy for copd ,",
"more than 80% of the original treatment groups used in the mr analysis were matched to a comparison group for the psm analysis ."
]
] | purposeto investigate equivalency of results from multivariable regression ( mr ) and propensity score matching ( psm ) models , observational research methods used to mitigate bias stemming from non - randomization ( and consequently unbalanced groups at baseline ) , using , as an example , a large study of chronic obstructive pulmonary disease ( copd ) initial maintenance therapy.methodspatients were 32,338 health plan members , age 40 years , with copd initially treated with fluticasone propionate / salmeterol combination ( fsc ) , tiotropium ( tio ) , or ipratropium ( ipr ) alone or in combination with albuterol . using mr and psm methods , the proportion of patients with copd - related health care utilization , mean costs , odds ratios ( ors ) , and incidence rate ratios ( irrs ) for utilization events were calculated for the 12 months following therapy initiation.resultsof 12,595 fsc , 9126 tio , and 10,617 ipr patients meeting mr inclusion criteria , 89.1% ( 8135 ) of tio and 80.2% ( 8514 ) of ipr patients were matched to fsc patients for the psm analysis . methods produced substantially similar findings for mean cost comparisons , ors , and irrs for most utilization events . in contrast to mr , for tio compared to fsc , psm did not produce statistically significant ors for hospitalization or outpatient visit with antibiotic or significant irrs for hospitalization or outpatient visit with oral corticosteroid . as in the mr analysis , compared to fsc , ors and irrs for all other utilization events , as well as mean costs , were less favorable for ipr and tio.conclusionin this example of an observational study of maintenance therapy for copd , more than 80% of the original treatment groups used in the mr analysis were matched to comparison treatment groups for the psm analysis . while some sample size was lost in the psm analysis , results from both methods were similar in direction and statistical significance , suggesting that mr and psm were equivalent methods for mitigating bias . |
[
[
"in spite of the relatively high accuracy of endoscopic ultrasound - assisted fine - needle aspiration ( eus - fna ) in diagnosing lymphomas , inadequate sampling by eus - fna often makes it difficult to perform immunohistochemical analysis , thus limiting its application in the classification of lymphoma .",
"we report an eus - assisted retroperitoneal lymph node biopsy performed in a patient who had developed enlarged retroperitoneal lymph nodes with an unknown cause .",
"the advantages of notes include reduced trauma , faster recovery , absence of scarring , and painlessness , and such procedures have been regarded as third - generation surgery . here",
"natural orifice transluminal endoscopic surgery ( notes ) is a surgical technique by which procedures such as exploration , biopsy , organ resection , and anastomosis can be performed using an endoscope passed through a natural orifice [ such as the mouth , stomach , colon ( or rectum ) , vagina , bladder , or esophagus ] and then entered into the abdominal cavity , mediastinum , or thoracic cavity through an internal incision ."
],
[
"the diagnosis was : non - hodgkin lymphoma , germinal center b - cell - like diffuse large b - cell lymphoma [ figure 6 ] .",
"the diagnosis was non - hodgkin lymphoma , germinal center b - cell - like diffuse large b - cell lymphoma the patient was given standard postoperative treatments and nursing care including ecg monitoring , ceftazidime as prophylaxis against infection , proton pump inhibitors , and nutritional support .",
"the site nearest to the retroperitoneal lymph nodes in the posterior wall of the gastric body was chosen for puncture .",
"then , enucleation of the targeted lymph node was performed using an it knife [ figure 5 ] .",
"ct scan showing multiple , enlarged soft tissue - density images in the abdominal cavity pet - ct showing the accumulation o f abnormal radioactivity in soft tissue - density images in the abdominal cavity eus - fna of a lymph node eus - fna showing a few heterotypic cells to obtain adequate tissue samples of the enlarged lymph nodes for immunohistochemical analysis , we performed eus - assisted retroperitoneal lymph node biopsy .",
"were used for resection of the gastric wall and enucleation of the lymph node . a pair of hot forceps ( fd-410lr , olympus corporation , tokyo , japan ) was used for gastric wall hemostasis ."
],
[
"wang et al . presented a case of laparoscopy - assisted transgastric endoscopic biopsy of a retroperitoneal lymph node . in this case ,",
"our experience suggests that this is an alternative and minimally invasive approach for the biopsy of retroperitoneal lymph nodes .",
"these studies showed that eus was very useful for creating transgastric access and locating the targets . in this study , we successfully used eus - assisted notes to perform enucleation of a retroperitoneal enlarged lymph node without laparoscopic assistance .",
"eus - fna was first used for tissue biopsy of tumors around the gastrointestinal tract . in spite of its high accuracy",
"pathological evidence is an indispensable part of the diagnosis and differential diagnosis of lymphoma and is significant for the classification of lymphomas ."
],
[]
] | since its introduction in the early 1990s , endoscopic ultrasound - assisted fine - needle aspiration ( eus - fna ) has been used for sampling of extraintestinal mass lesions and peri - intestinal lymphadenopathy . although eus - fna is highly accurate , lymphomas can be challenging to diagnose using eus - fna . we present the case of a 60-year - old male who had experienced upper abdominal discomfort for 1 month . computerized tomography ( ct ) examination revealed multiple soft - tissue shadows located above the pancreatic body . the biggest shadow had a cross - sectional area of 7.7 cm 7.2 cm . positron emission tomography - ct ( pet - ct ) imaging showed increased uptake of 18f - fdg by these soft - tissue shadows . to investigate further , eus was performed and it revealed the presence of multiple hypoechoic round lymph nodes . during the procedure , eus - fna was performed , but only a few dyskaryotic cells were observed by cytological evaluation . eus - assisted retroperitoneoscopy and lymph node biopsy were performed to obtain more tissue for immunohistochemical analysis and subclassification of lymphoma . finally , the patient was diagnosed with non - hodgkin lymphoma , germinal center b - cell - like diffuse large b - cell lymphoma by this technique . eus - assisted transendoscopic retroperitoneal lymph node biopsy is an alternative procedure for the diagnosis of lymphomas . |
[
[
"recent studies showed that crp is a strong predictor of future coronary artery disease in healthy men and women the purpose of the present study is to quantitatively evaluate the serum levels of crp in both male and female subjects with various degrees of periodontitis ( chronic and aggressive form ) and compare them with controls who have a clinically healthy periodontium .",
"periodontitis is a local inflammatory process mediating destruction of periodontal tissues triggered by bacterial insults periodontal subgingival pathogens affect local and systemic immune and inflammatory response . local inflammatory response to these gram - negative bacteria and bacterial products is characterized by the infiltration of periodontal tissues of the inflammatory cells , including polymorphonuclear leucocytes , macrophages , lymphocytes , and plasma cells .",
"termed acute phase response and the substances undergoing characteristic alteration of serum levels are termed acute phase reactants .",
"crp is a type i acute phase protein that is produced by the liver in response to diverse inflammatory stimuli ."
],
[
"group ii : ( generalized aggressive periodontitis ) 15 subjects with generalized pattern of severe periodontal destruction with al of at least 5 mm on 8 or more teeth .",
"criteria for the plaque index : \n 0:no plaque in the gingival area.1:a film of plaque adhering to the free gingival margin and adjacent area of the tooth . the plaque may be recognized only by running a probe across the surface.2:moderate accumulation of soft deposits within the gingival pocket and on the gingival margin and/or on the adjacent tooth surface that can be seen by the naked eye.3:abundance of soft matter within the gingival pocket and/or on the gingival margin and adjacent tooth surface . \n ",
"clinical parameters for the study were plaque index , gingival index , bleeding index , probing pd , and clinical attachment level .",
"group iii : ( chronic periodontitis ) 15 subjects diagnosed with moderate and severe forms of chronic periodontitis were included .",
"probing pd was measured from the gingival margin to the probable pd at the mesiobuccal , midbuccal , distobuccal , mesiolingual , midlingual , and distolingual surface of all the teeth and clinical attachment level was measured from the cementoenamel junction , to the probable pd of all the teeth on the same surfaces , using the williams periodontal probe to the nearest millimeter .",
"patients with known systemic diseases and presence of other chronic infections , patients taking contraceptive pills , pregnant or lactating females . based on the periodontal status ,",
"plaque index ( silness and loe ) scoring was done for 6 surfaces of all the teeth distobuccal , buccal , mesiobuccal , mesiolingual , lingual , and distolingual ."
],
[
"mouth mirror , williams periodontal probe , explorer , tweezer , disposable 5cc syringe , spirit cotton swab , handcuff , and edta - coated glass test tube ."
],
[
"patients aged between 25 and 50 years , they should not have received any antibiotic therapy in the previous 3 months .",
"they should not have undergone any extractions or periodontal therapy in the previous 3 months ."
],
[
"group ii : ( generalized aggressive periodontitis ) 15 subjects with generalized pattern of severe periodontal destruction with al of at least 5 mm on 8 or more teeth .",
"moderate periodontitis : subjects with a minimum of 20 natural teeth , at least 1 molar tooth in each quadrant and at least 4 sites with al > 2 mm and < 4 mm and pd > 5 mm and < 7 mm .",
"patients with known systemic diseases and presence of other chronic infections , patients taking contraceptive pills , pregnant or lactating females . based on the periodontal status ,",
"group i : ( control group ) 15 subjects with attachment loss ( al ) 2 mm and pocket depth ( pd ) < 3 mm were included .",
"group iii : ( chronic periodontitis ) 15 subjects diagnosed with moderate and severe forms of chronic periodontitis were included .",
"severe periodontitis : subjects with a minimum of 20 natural teeth , at least , 1 molar tooth in each quadrant and at least 4 sites with al > 5 mm and pd > 7 mm ."
],
[
"criteria for the plaque index : \n 0:no plaque in the gingival area.1:a film of plaque adhering to the free gingival margin and adjacent area of the tooth . the plaque may be recognized only by running a probe across the surface.2:moderate accumulation of soft deposits within the gingival pocket and on the gingival margin and/or on the adjacent tooth surface that can be seen by the naked eye.3:abundance of soft matter within the gingival pocket and/or on the gingival margin and adjacent tooth surface . \n ",
"probing pd was measured from the gingival margin to the probable pd at the mesiobuccal , midbuccal , distobuccal , mesiolingual , midlingual , and distolingual surface of all the teeth and clinical attachment level was measured from the cementoenamel junction , to the probable pd of all the teeth on the same surfaces , using the williams periodontal probe to the nearest millimeter .",
"clinical parameters for the study were plaque index , gingival index , bleeding index , probing pd , and clinical attachment level .",
"plaque index ( silness and loe ) scoring was done for 6 surfaces of all the teeth distobuccal , buccal , mesiobuccal , mesiolingual , lingual , and distolingual .",
"a film of plaque adhering to the free gingival margin and adjacent area of the tooth . the plaque may be recognized only by running a probe across the surface .",
"abundance of soft matter within the gingival pocket and/or on the gingival margin and adjacent tooth surface ."
],
[
"about 45 ml of blood sample was collected from each of the subjects from the brachial vein , by aseptic technique using a 5 cc syringe and transferred to an appropriately labeled tube and allowed to clot , centrifuged , and the smear layer removed carefully .",
"the serum thus obtained was stored at 20c for the analyses at a later date ."
],
[
"serum crp levels were assessed by means of a commercially available high - sensitivity crp ( hs - crp ) enzyme immunoassay ."
],
[
"pearson 's correlation was used to assess the correlation between severity of periodontitis and serum crp levels . in the present study ,",
"mean values of each parameter were compared between the groups using one - way analysis of variance with post hoc test of least significant difference method .",
"analysis of covariance was used for comparison of mean values between the groups to adjust the age .",
"statistical package for social science ( spss ) version 15 was used for statistical analysis ."
],
[
"comparison of c - reactive protein levels among all the groups the results of the present study indicated an increase in serum crp levels in subjects with generalized aggressive periodontitis and chronic periodontitis compared with controls .",
"a total number of 45 male and female subjects with the age range between 25 and 50 years participated in the study .",
"clinical parameters , such as bleeding on probing , showed a positive correlation with crp levels in aggressive periodontitis group and a positive correlation was also seen for probing pd , clinical attachment level , and crp in chronic periodontitis group of subjects .",
"was found in the crp level between groups i and ii and between groups ii and iii and between groups i and iii [ table 1 ] .",
"of particular concern could be the elevation in crp levels in younger individuals as represented by aggressive periodontitis patients that may contribute to an early cvd in susceptible patients .",
"all the patients who participated in the study were systemically healthy and were adjusted for factors known to elevate crp levels ."
],
[
"earlier it was considered simply as a chronic localized infection ; however , a growing body of evidence suggests that the pathology of periodontitis may affect the outcome of several systemic diseases , such as myocardial infarction , stroke , or preterm low birth weight babies gram - negative anaerobes present in large numbers in subgingival dental plaque in periodontal pockets affect the local and systemic inflammatory response .",
"recent studies have indicated that serum crp of patients with periodontal diseases is elevated with deep periodontal pockets , severe attachments loss , subgingival microflora , and alveolar bone loss .",
"this is similar to the results of earlier studies , which revealed increased bleeding on probing depth and al to be significantly associated with elevated crp concentrations .",
"l is a significant indicator of risk of atherosclerosis , cvd , and type 2 diabetes .",
"both periodontal and cvds share several risk factors , including smoking , diabetes mellitus , age , socioeconomic status , obesity , and psychologic stress . the epidemiologic evidence to date show a significant but modest relationship between periodontitis and cvd ."
],
[
"clinical parameters such as bleeding on probing showed a positive correlation with crp levels in aggressive periodontitis group and a positive correlation was also seen for probing pd , clinical attachment level , and crp in chronic periodontitis group subjects .",
"the results of the present study indicated an increase in serum crp levels in subjects with generalized aggressive periodontitis and chronic periodontitis as compared with controls , which was statistically significant .",
"however , the result of the present study can not be used to determine the causality of the associations between periodontitis and crp due to some limitations , one being the small sample size and the other is that the study is only cross - sectional . moreover",
", the subjects might have undiagnosed systemic factors that could influence the crp levels . but keeping in view the results of the earlier studies and that of the present study , it would be appropriate if large sample based , well - controlled , longitudinal trials are performed to determine the relationship between periodontitis and elevated crp levels and the effect of periodontal therapy on serum crp concentration ."
]
] | background : periodontal subgingival pathogens affect local and systemic immune responses and initiate an acute phase systemic inflammatory response characterized by the release of c - reactive proteins ( crps ) . this study has been carried out to evaluate the serum concentration of crps , which can be used as a marker of periodontal disease as well as a risk indicator for cardiovascular diseases.materials and methods : in a retrospective study a total number of 45 subjects were selected from the outpatient department of periodontics a mean age of 40 years . based on the periodontal status , the subjects were divided into 3 groups of 15 subjects each . group i : control group [ with attachment loss ( al ) 2 mm and pocket depth ( pd ) < 3 mm ] , group ii : generalized aggressive periodontitis ( al 5 mm ) , group iii : chronic periodontitis ( al 2 mm , pd 5 mm ) , which includes moderate and severe periodontitis . the clinical parameters recorded were plaque index , gingival index , bleeding index , probing pd , and clinical attachment levels and scoring was done on 6 surfaces of all teeth . for the crp assessment , blood samples were collected from subjects at the time of clinical examination . analysis of covariance was used for comparison of mean values between the groups to adjust the ages ( p value < 0.05).results : overall , the mean crp levels were high in subjects with generalized aggressive and chronic periodontitis compared with controls . this was found to be statistically significant . a statistically significant difference ( p = 0.012 ) was found in the crp level between groups i and ii and between groups ii and iii , and between groups i and iii.conclusion:the results of the present study indicated an increase in serum crp levels in subjects with generalized aggressive periodontitis and chronic periodontitis as compared with the controls . |
[
[
"the efficacy and safety of tpe is the subject of recent reviews and guidelines from professional bodies including the american society for apheresis and the american academy of neurology .",
"therapeutic plasma exchange ( tpe ) is used for many indications in patients presenting to a variety of medical disciplines .",
"although apheresis registry data have been published , these do not include details of practical differences between mtpe and ctpe or the advantages of each method . between november 2010 and march 2011 , we had the opportunity to evaluate mtpe and ctpe techniques at our institution .",
"here we describe three patients with unequivocal indications for therapeutic plasma exchange who were all treated with both mtpe and ctpe .",
"however , strong recommendations on practical aspects of the delivery of tpe are not available .",
"one uncontrolled comparison carried out > 25 years ago used a ctpe device that is no longer available . in another study ,",
"both , plasma is selectively removed and replaced typically with human serum albumin or fresh frozen plasma , chosen on the basis of the indication for tpe and patient clinical parameters ."
],
[
"in the autumn of 2011 , we had made access to both membrane tpe and a centrifugal tpe system .",
"we therefore decided to use the ctpe ( spectra optia apheresis ) device with regional citrate anticoagulation of the extracorporeal circuit .",
"exchange volumes , anticoagulation , replacement fluid employed and additional calcium supplementation used in tpe are prescribed in our unit on the basis of a written protocol ( see figure 1 ) . \n",
"we feared that the administration of such high doses of heparin could lead to systemic anticoagulation in a patient at risk of pulmonary haemorrhage .",
"patient characteristics cyp , cyclophosphamide ; mp , methylprednisolone ; aav , anca - associated vasculitis ; tpe , therapeutic plasma exchange ; hd , haemodialysis anti - gbm ."
],
[
"we therefore decided to use the ctpe ( spectra optia apheresis ) device with regional citrate anticoagulation of the extracorporeal circuit .",
"we feared that the administration of such high doses of heparin could lead to systemic anticoagulation in a patient at risk of pulmonary haemorrhage .",
"2317144 940 12ctpe2563 21112 2028 4 plasma exchange procedures during the first treatment , an initial heparin bolus of 1000 iu was used and the heparin infusion rate was 1000 iu / h . these doses were with 13 iu / kg lower than per protocol ( 33 iu / kg ) , as the patient had a renal biopsy the day before the exchange . at 55 min into the procedure ,",
"the set was changed and the patient received a further bolus of 2000 iu heparin in addition to a continued heparin infusion of 1000 iu / h . two hours after the second bolus ( time 115 min ) , the filter clotted again and the set was replaced for a second time .",
"the patient received a fourth bolus of heparin ( 2000 iu ) at 190 min and the heparin infusion rate was increased to 1500 iu / h . the third attempt to complete the exchange was uneventful but the total cumulative dose of heparin was 8750 iu .",
"as per our treatment guidelines , the patient should have received on average of 5500 iu of heparin for a 4 l exchange but we had to use up to 9000 iu to complete tpe ."
],
[
"the second patient was a 24-year - old male ( 94 kg ) with a crescentic glomerulonephritis at renal biopsy , haemoptysis and anti - gbm antibodies .",
"significant problems with filter clotting were encountered despite high doses of heparin used . during the first session of mtpe ,",
"a second mtpe procedure was carried out successfully without clotting but 8500 iu of heparin was needed in a patient who should have only received 6000 iu according to the local protocol .",
"the patient 's renal function did not recover and he received maintenance dialysis until a successful transplant 23 months after presentation .",
"the prescribed session was completed , but a total of 7750 iu heparin was used .",
"a final plasma exchange was delivered using mtpe , requiring a total heparin dose of 7000 iu ."
],
[
"the third patient was a 57-year - old man ( 81 kg ) with anca - associated vasculitis , presenting with constitutional symptoms , skin , neurological and renal manifestations and bloody diarrhoea .",
"he was treated with cyclophosphamide and corticosteroids initially and , in the absence of response to these interventions , tpe was prescribed .",
"the fourth plasma exchange was an mtpe procedure where clotting occurred 30 min into the procedure ( heparin infusion : 1000 iu / h ; bolus : 1500 iu ) . heparin infusion rate was increased to 1500 iu / h , two additional boluses of 2000 iu and later on a 1000 iu bolus were given and the prescribed tpe was completed without further clotting using a new disposable set . in total ,",
"subsequently , his renal function declined and he started on peritoneal dialysis 15 months after his initial presentation ."
],
[
"therapeutic plasma exchange is a well - established treatment for renal diseases . over a 5-month period , we had the opportunity to compare the ease of use , safety and reliability of mtpe and ctpe methods in three patients with severe renal disease .",
"the most significant observation in our study was the high frequency with which the filter clotted using mtpe with conventional heparin anticoagulation despite doses of heparin larger than advocated in our local mtpe protocol . on occasions ,",
"we performed 36 plasma exchange procedures on these patients , 9 using mtpe and 27 using ctpe .",
"in addition , even though we used central access on the patients reported , the centrifugal device also has the advantage that it can be used with peripheral access and also operates in single needle mode ."
],
[
"\n centrifugal tpe with citrate anticoagulation is an alternative to membrane - based tpe and heparin anticoagulation.membrane-based tpe may require substantial doses of heparin to anticoagulate the extracorporeal circuit .",
"centrifugal tpe with citrate anticoagulation is an alternative to membrane - based tpe and heparin anticoagulation .",
"membrane - based tpe may require substantial doses of heparin to anticoagulate the extracorporeal circuit ."
]
] | therapeutic plasma exchange ( tpe ) is a well - established treatment modality for nephrology patients , using two conventional methods : membrane ( mtpe ) or centrifugal tpe ( ctpe ) . although the efficacy of both treatments has been described , there are few reports that compare these methodologies . here we describe three nephrology patients who were treated with both mtpe and ctpe . the mtpe method , but not the ctpe method , was associated with persistent difficulty anticoagulating the extracorporeal circuit in all three patients . in mtpe procedures , the doses of heparin bolus and infusion rate were important determinants of whether the circuit clotted . with a heparin bolus at or below 2000 iu , clotting occurred in 67% of treatments , dropping to 25% with a bolus of > 2000 iu . likewise , a heparin infusion rate during the procedure was indicative of clotting . with a maintenance infusion of < 2000 iu / h , most circuits clotted . no clotting was observed during ctpe procedures using acid citrate dextrose formula a solution as an anticoagulant of the extracorporeal circuit . overall , difficulties maintaining the extracorporeal circuit in mtpe required the use of additional disposable sets , high doses of heparin and nursing time . in addition , mtpe procedures took longer to perform than ctpe . |
[
[
"university hospital cases ( 15 male and 20 female dogs ) included those with tumor , cataract , \n glaucoma , keratitis , hip dysplasia , cushing syndrome and herniated intervertebral discs . \n",
"determination of qrdr mutations , pmqrs , -lactamases and chl - resistance \n genes : mutations in qrdrs of gyra , parc , \n pare and gyrb were examined by direct dna sequencing of \n pcr products , as described by everett et al . .",
"the respective primer pairs \n and probes ( table 1 ) used for \n acrb , tolc and gapa in this study were \n designed according to the sequence of e. coli strain k12 substrain mg1655 , \n which is deposited in genbank ( accession number u00096 ) .",
", \n blatem and blashv , were detected \n by pcr and direct dna sequencing .",
"pmqr genes ( qnra , qnrb , \n qnrs , aac ( 6 ) ib - cr and qepa ) were \n detected by pcr using specific primers ( table \n 1table 1.sequences of oligonucleotides and fluorescence - labeled oligonucleotides used for \n pcr , direct sequencing and real - time rt - pcr in this studygeneforward primer ( 53)reverse primer ( 53)fluorescent probe ( 53)purposereferencegyraacgtactaggcaatgactggagaagtcgc cgtcgatagaacpcr and sequencinggyrbtgtatgcgatgtctgaactgctcaatagcagctcggaatapcr and sequencingparctgtatgcgatgtc tgaactgctcaatagcagctcggaatapcr and sequencingparetaccgag ctgttccttgtggggcaatgtgcagaccat cagpcr and sequencingqnraagaggatttctcacgccaggtgccaggcacagatcttgacpcrqnrbggmathgaaattcgccactgtttgcygyycgccagtcgaapcrqnrsgcaagttcattgaacagggttctaaaccgtcgagttcggcgpcraac ( 6)-ibttgcgatgctctatgagtggctactcgaatgcctggcgtgtttpcr and sequencingqepaaactgcttgagcccgtagatgtctacgccatggacctcacpcrblatematgagtattcaacattttcgttaccaatgcttaatcagtgpcr and sequencingblashvatgcgttatattcgcctgtgttagcgttgccagtgctcgapcrcata1agttgctcaatgtacctataaccttgtaattcattaagcattctgccpcrcata2acactttgccctttatcgtctgaaagccatcacatactgcpcrcata3ttcgccgtgagcattttgtcggatgagtatgggcaacpcrflorcgccgtcattcctcaccttcgatcacgggccacgctgtgtcpcrcmlattgcaacagtacgtgacatacacaacgtgtacaaccagpcracractatcaccctacgctctatcttcgcgcgcacgaacatacccgaacccggatcacactctrt - pcracrbgcggtcgtgtgaagaaagtttaactcccaacgagaagaggagaatgaccatcagcagcacgaacataccagtrt - pcrthis studytolcggtacgttgaacgagcaggatcccatcagcaatagcattctgttccctggcactgaacaatgcgctgagcaart - pcrthis studygapaaaaggcgctaacttcgacaagaacggtggtcatcagacctcaacgataacttcggcatcart - pcrthis studya ) m , a , or c ; h , a , or c or t ; y , c , or t. ) and direct dna sequencing [ 4 , 15 , 21 ] . to \n identify the amp - resistance mechanism , -lactamase genes , viz .",
"staphylococcus aureus atcc29213 , \n enterococcus faecalis atcc29212 , e. coli atcc25922 and \n pseudomonas aeruginosa atcc27853 were used as controls ."
],
[
"isolation of fluoroquinolone - resistant e. coli using enr - supplemented dhl agar \n plates : to investigate fluoroquinolone - resistance mechanisms and the occurrence \n of multidrug resistance involving fluoroquinolone , we selected enr - resistant e. \n coli on enr - supplemented dhl agar plates ( fig . \n 1fig .",
"the prevalence of chl - resistant and enr - resistant isolates was also \n significantly higher in the university hospital than in the community clinics samples ( table 2 ) ."
],
[
", we suggest that it may be important to share the history of antimicrobials usage \n across the first and secondary medical care settings of companion animals to avoid treatment \n with several antimicrobials in the same period and to avoid extensive , continuous treatment \n with the same class antimicrobial . in conclusion , this study revealed that the higher prevalence of concomitant resistant and \n intermediate interpretations to fluoroquinolones , aminopenicillins and chl in isolates from \n the university hospital than in isolates from the community clinics was due not only to the \n acquisition of specific resistance mechanisms , such as -lactamases , cata1 \n and qrdr mutations , but also to overexpression of the acrab tolc efflux pump in canine \n e. coli .",
"it indicated a need \n to investigate the mechanism underlying the emergence of this multidrug - resistance \n phenotype . to characterize in detail the fluoroquinolone - resistant isolates obtained from the \n university hospital and community clinics studied here , we investigated \n antimicrobial - resistance mechanisms of e. coli isolates derived from dogs \n using enr - supplemented dhl agar plates .",
"in this study , e. coli isolates with resistant or an intermediate \n interpretation to aminopenicillins , chl or fluoroquinolone were more frequently obtained \n from dogs admitted to the universal hospital than from those admitted to the community \n clinics . remarkably , isolates with resistance to fluoroquinolones",
"more frequently showed \n resistance to aminopenicillins , cephalosporins , gen , dsm and chl , as compared with \n fluoroquinolone - susceptible isolates .",
"tolc than did \n enr - resistant e. coli isolates derived from the community clinics cases ."
]
] | abstractunderstanding the prevalence
of antimicrobial - resistance and the relationship between emergence of resistant bacteria
and clinical treatment can facilitate design of effective treatment strategies . we here
examined antimicrobial susceptibilities of escherichia coli isolated from
dogs admitted to a university hospital ( university hospital ) and companion animal clinics
( community clinics ) in the same city and investigated underlying multidrug - resistance
mechanisms . the prevalence of e. coli with intermediate and resistant
interpretations to ampicillin ( amp ) , enrofloxacin ( enr ) and chloramphenicol ( chl ) was
higher in the university hospital than in the community clinics cases . use of
antimicrobials , including fluoroquinolone , was also significantly higher in the university
hospital than in the community clinics cases . upon isolation using enr - supplemented agar
plates , all enr - resistant isolates had 34 nucleotide mutations that accompanied by amino
acid substitutions in the quinolone - resistance - determining regions of
gyra , parc and pare , and 94.7% of all
isolates derived from the university hospital showed amp and/or chl resistance and
possessed blatem and/or cata1 . the average
mrna expression levels of acra , acrb and
tolc and the prevalence of organic solvent tolerance , in isolates
derived from enr - supplemented agar plates were significantly higher in the university
hospital than in the community clinics isolates . thus , e. coli derived
from the university hospital cases more often showed concomitant decreased
susceptibilities to aminopenicillins , fluoroquinolones and chl than did those derived from
the community clinics ; this was related to an active acrab tolc efflux pump , in addition
to acquisition of specific resistance genes and genetic mutations . |
[
[
"this example highlights the importance of exercising due diligence and not automatically jumping to conclusions with regard to the diagnosis of immune - related adverse events ( iraes ) such as pneumonitis during treatment with pd-1 or ctla-4 inhibitors .",
"this report presents a case in point : a 47-year - old woman with triple - negative breast cancer on a clinical trial called primetime ( nct02518958 ) who received the anti - pd-1 inhibitor nivolumab and the experimental anticancer agent rrx-001 for 18 weeks ; initially treated for pneumonitis , an ",
"expected autoimmune complication of nivolumab , based on the development of dyspnea and ct abnormalities . the overall clinical picture , nevertheless , was atypical , which prompted the investigating team to aggressively pursue alternate possibilities , ultimately leading to the correct diagnosis : pulmonary tumor thrombotic microangiopathy or pttm .",
"the problem with this medical aphorism is that it actively encourages the clinician to turn a deaf ear ( and a blind eye ) to the possibility of lesser known and , therefore , more easily overlooked disease states that mimic or "
],
[
"2 ) . based on the proposed involvement of vegf and pdgf in the pathogenesis of pttm , the primary investigator planned to treat the patient with sunitinib , which dually inhibits vegf and pdgf pathways",
"pttm is distinct from simple embolic obstruction because it is characterized by ( 1 ) the systemic activation of coagulation with the generation of intravascular fibrin and the consumption of procoagulants , leading to a disseminated intravascular coagulation - like picture , present in this case and ( 2 ) remodeling of the pulmonary vasculature due to expression of vegf and pdgf from embolic tumor cells ( see fig ."
],
[
"the observations in this case study strongly suggest that pd-1-induced pneumonitis should be a diagnosis of exclusion rather than a diagnosis by default , requiring a thorough work - up to rule out conditions that may mimic it , including pe , atypical pneumonia , pulmonary venous occlusive disease , congestive heart failure , and pttm . in the case of this acutely dyspneic patient , who initially received a",
" pneumonitis by default diagnosis , pttm was only identified when her shortness of breath deteriorated despite treatment with high dose steroids , alerting the principal investigator to the possibility of heart failure , which led to further investigation .",
"even though the case under discussion was refractory to standard therapies and the patient died before sunitinib , the multitargeted tyrosine kinase selective for vegf and pdgf receptors , could be started , it is reasonable to assume that early diagnosis and treatment would have resulted in a better outcome .",
", pttm requires background knowledge and a high index of clinical suspicion . in the absence of a biopsy ,"
],
[
"the patient described in this case report has given his informed consent as part of the primetime clinical study ( nct02518958 ) .",
"this study protocol has been approved by the walter reed national military medical center institutional review board ."
],
[]
] | a case report of a 47-year - old woman with triple - negative breast cancer on a clinical trial called primetime ( nct02518958 ) who received the anti - pd-1 inhibitor nivolumab and the experimental anticancer agent rrx-001 is presented . although initially diagnosed and treated for anti - pd-1-induced pneumonitis , clinical and radiological abnormalities triggered further investigation , leading to the diagnosis of pulmonary tumor thrombotic microangiopathy ( pttm ) . this example highlights the importance of exercising due diligence in determining immune - related adverse events and suggests that pd-1-induced pneumonitis should be a diagnosis of exclusion rather than a diagnosis by default . a case history and review of the literature are presented for pttm , which we propose to define as a paraneoplastic syndrome . |
[
[
"the new global initiative for chronic obstructive lung disease ( gold ) 2011 system for copd severity assessment added chronic symptoms and exacerbation history to the traditional system of rating the degree of airflow obstruction by spirometry .",
"we also examine how old and new classification systems align with patients and their pcps perceptions of copd severity .",
"furthermore , the new reclassifications do not have any better agreement with physician s or patient s own impressions about copd severity than the traditional system .",
"proven copd managed in primary care practices from across the us , we find that the new gold system does reclassify substantial proportions of copd patients as compared to just spirometry alone , but how they are reclassified varies greatly by which symptoms questionnaire is chosen .",
"the goal of these changes was to improve the clinical assessment and management of copd.17 since the introduction of the new gold assessment system there has been interest in understanding how it compares to the traditional spirometry - based staging system , but most studies to date have been conducted with copd patients recruited from university specialty clinics or research cohorts enrolled in longitudinal studies.1829 very few studies have been based on primary care copd populations.30 understanding how the new gold copd assessment system relates to the older spirometry - based severity system is a practical problem for primary care practitioners ( pcps ) who need to be able to rate the severity of their patient s lung disease and communicate that to the patient and to other health care providers.31 the primary objective of this analysis is to examine in a primary - care - based cohort how copd patients staged by the traditional gold spirometry - based severity system are reclassified by the new gold 2011 assessment systems . because the history of exacerbations is an important component of the new gold system , the severity stages and assessment groups are further stratified by exacerbation history ."
],
[
"this was a cross - sectional observational study of 899 copd patients treated in individual primary care practices from across the us .",
"patients were excluded if they had conditions that contraindicated the forced expiratory maneuver needed for spirometry , or were unable to complete study procedures , or had participated in a clinical trial within the prior 12 months . for this analysis , we only included patients who met the american thoracic society ( ats ) definition of spirometry proven copd ( ie , fev1/fvc ratio < 0.70 on tests meeting ats quality standards ) , and who provided all information needed for gold staging and appropriate self - assessment . of the 899 enrolled in the study , eight withdrew before completing spirometry testing , leaving 891 who completed the spirometry phase . of these , only 666 performed spirometry meeting ats quality standards , and provided complete clinical information needed to calculate the new gold stage .",
"four hundred and fifty - three of these were confirmed to have spirometry confirmed copd , and of these , only 445 properly completed the self - assessment questionnaire , and thus are the cohort included in these analyses .",
"following ats guidelines , relaxed spirometry testing was first used to capture three slow vital capacity results , and then forced spirometry testing was used to capture technically acceptable results for fvc and fev1 .",
"patients were classified into their traditional obstruction severity stage ( stages 14 , described as mild , moderate , severe , and very severe , respectively ) based on their % pfev1 using gold guidelines.16 patients were classified into their new gold mmrc grade ( abcd ) , and their gold cat grade ( abcd ) , by stratifying them by their % pfev1 and their mmrc or cat scores , as per the new gold recommendations . finally , we also classified patients by their pcps recorded history of exacerbations within the last 12 months .",
"all spirometry measurements are reported pre - bronchodilator because it was not feasible to do pre- and post - bronchodilator testing in all clinics .",
"spirometry results were sent to an independent respiratory therapist experienced and certified in pulmonary function testing for quality control review ."
],
[
"their practice characteristics are described in an earlier report.32 investigators identified potential subjects in electronic records using a stratified random sampling approach ( ie , selection of each nth patient ) to ensure unbiased selection .",
"a total of 95 pcps ( general internal medicine or family practice ) were recruited to participate in the study , and 83 pcps enrolled at least one patient .",
"patients were excluded if they had conditions that contraindicated the forced expiratory maneuver needed for spirometry , or were unable to complete study procedures , or had participated in a clinical trial within the prior 12 months . for this analysis , we only included patients who met the american thoracic society ( ats ) definition of spirometry proven copd ( ie , fev1/fvc ratio < 0.70 on tests meeting ats quality standards ) , and who provided all information needed for gold staging and appropriate self - assessment . of the 899 enrolled in the study , eight withdrew before completing spirometry testing , leaving 891 who completed the spirometry phase . of these , only 666 performed spirometry meeting ats quality standards , and provided complete clinical information needed to calculate the new gold stage .",
"patients aged 40 or older with english language ability and documented care for at least 1 year at the pcp s clinic were included in the study .",
"this was a cross - sectional observational study of 899 copd patients treated in individual primary care practices from across the us .",
"four hundred and fifty - three of these were confirmed to have spirometry confirmed copd , and of these , only 445 properly completed the self - assessment questionnaire , and thus are the cohort included in these analyses ."
],
[
"the 5-point scale was intended to correspond to the original gold copd staging system , which ranged from stage 0 for persons with risk factors or symptoms but no airflow obstruction , and stages 14 ( mild , moderate , severe , and very severe ) for those proven to have airflow obstruction .",
"data collection was performed by investigators during a scheduled office visit . during the visit , physicians recorded the patient s clinical history , spirometry results obtained during the visit , and health care resource utilization in a web - based case report form . prior to spirometry testing , investigators recorded their global assessment of the patient s copd severity at the time of the study visit on a 5-point scale , ranging from 1 ( no clinical symptoms or disease impact ) to 5 ( very severe ) .",
"patients completed a paper questionnaire to collect standardized assessments including the cat , mmrc , and a general assessment of severity at the time of the study visit on a 5-point scale , ranging from 1 ( very mild ) to 5 ( very severe ) .",
"data were collected from february 2012 to november 2012 . this study was approved and overseen by sterling institutional review board ( atlanta , georgia ) , study number 3,872 ."
],
[
"sites were provided an electronic , hand - held , microloop portable spirometer and associated spirometry pc software for the study .",
"following ats guidelines , relaxed spirometry testing was first used to capture three slow vital capacity results , and then forced spirometry testing was used to capture technically acceptable results for fvc and fev1 .",
"all spirometry measurements are reported pre - bronchodilator because it was not feasible to do pre- and post - bronchodilator testing in all clinics .",
"following enrollment of the first three patients at each study site , spirometry results were sent to an independent respiratory therapist experienced and certified in pulmonary function testing for quality control review .",
"were calculated using national health and nutrition examination survey iii reference values.33 prior to patient enrollment , investigators and study site staff completed real - time , study - specific training via an online meeting platform .",
"patients were asked not to use their copd medications on the morning of the test . predicted values and the percentage of predicted fev1 ( % pfev1 )",
"up to eight efforts were required from each patient to obtain up to three acceptable tests per ats guidelines .",
"training addressed study procedures , including standard ats spirometry procedures and use of the microloop spirometer ."
],
[
"patients were classified into their traditional obstruction severity stage ( stages 14 , described as mild , moderate , severe , and very severe , respectively ) based on their % pfev1 using gold guidelines.16 patients were classified into their new gold mmrc grade ( abcd ) , and their gold cat grade ( abcd ) , by stratifying them by their % pfev1 and their mmrc or cat scores , as per the new gold recommendations . finally , we also classified patients by their pcps recorded history of exacerbations within the last 12 months .",
"very few patients were self - described as very mild or physician - described as no clinical symptoms or disease impact , so these were combined with the mild or stage 1 category for all comparisons .",
"pcp and patient s self - assessed overall severity ratings were also used for classification ."
],
[
"this approach evaluates disagreement between levels of severity and provides a summary result ranging from 0 ( no agreement ) to 1 ( perfect agreement ) .",
"statistical comparisons of continuous variables were made with student s t - tests and analysis of variance , as appropriate .",
"counts and percentages were compared using chi - square analyses . to compare agreement between perceived severity measures and the spirometry - based severity results , a cohen s kappa coefficient was used .",
"all analyses utilized a two - sided p of 0.05 for significance and were performed using sas 9.2 ."
],
[
"none of the 40 gold cat group a patients were frequent exacerbators , so all would stay in group a. of the 199 patients in gold cat group b , 20 were frequent exacerbators and would therefore be upgraded to group d. therefore , after adjusting the gold cat system by exacerbation history according to the physician , 9% were in group a , 45% in group b , 4% in group c , and 42% in group d.",
"of the 433 patients who were reclassified under gold mmrc , seven of these group a patients and 12 group b patients would be promoted to groups c and d , respectively , because of their high risk for exacerbations .",
"we then stratified the history of exacerbations within the last 12 months by the gold spirometry , gold mmrc , and gold cat systems ( table 4 ) .",
"therefore , after adjusting the copd mmrc system by exacerbation history according to the physician , 33% were in group a , 22% in group b , 19% in group c , and 26% in group d. the exacerbation history by gold cat group did not increase steadily with severity ( gold cat groups a to d , table 4 ) ."
],
[
"the majority of patients in this cohort had moderate or severe airflow obstruction according to the traditional spirometry stage system ( table 2 ) .",
"patients self - assessments of their copd severity were poorly congruent with their spirometry - based stage ( =0.13 ) , and more were wrong about their severity stage than correct ( 46% underestimated and 13% overestimated ) ( figure 1 ) .",
"the pcp s severity ratings were also inconsistent and tended to underestimate their patient s severity ; 34% were accurate as compared to the traditional spirometry stage , with 57% underestimated and 9% overestimated , for an overall kappa of 0.11 ( figure 2 ) .",
"agreement between patient and their physician s assessments was also poor , with doctor s impressions tending to be less severe than the patient s ( figure 2 ) ."
],
[
"substantial proportions of patients from the old severity system are reclassified , but how they are reclassified varies greatly by whether the mmrc or cat system is selected . after application of the new gold mmrc system , 48% ( n=206 ) of the patients are re - stratified higher or lower than their spirometry level when distributed into the gold a , b , c , or d groups ( table 3 ) . among persons with mild airflow obstruction ( stage 1 ) ,",
"81% are allocated to group a , and the remainder to group b. at the other end of the spectrum , patients with the most severe airflow obstruction ( stage 4 ) tend to be in group d ( 70% vs 30% in group c ) .",
"patients with moderate airflow obstruction ( stage 2 ) are relatively evenly distributed between groups a and b , and patients with severe obstruction ( stage 3 ) are relatively evenly distributed between c and d. therefore , the mmrc system is re - stratifying patients in the middle ranges of airflow obstruction according to their chronic symptoms , while those with the highest and lowest degrees of obstruction tend to stay in the highest ( a ) and lowest ( d ) groups .",
"patients were then reclassified by the new gold system using their mmrc or cat scores ( table 3 ) .",
"however , the agreement between the gold mmrc level and either the physician s global impression of severity or the patients self - perception of severity is still poor ( =0.17 and 0.13 , respectively ) ( figures 1 and 2 ) .",
"furthermore , the agreements between gold cat severity level and either physician impression or patient self - assessment are even worse than by spirometry grade alone ( =0.07 and 0.09 , respectively ) ( figures 1 and 2 ) .",
"after reclassification by the new gold system using the cat scores , 41% ( n=179 ) of patients were re - stratified into a level higher or lower than their spirometry - based severity , but the distributions were much different than the mmrc results ( table 3 ) . among patients with the mildest obstruction ( stage 1 ) ,"
],
[
"we then stratified the history of exacerbations within the last 12 months by the gold spirometry , gold mmrc , and gold cat systems ( table 4 ) .",
"of the 433 patients who were reclassified under gold mmrc , seven of these group a patients and 12 group b patients would be promoted to groups c and d , respectively , because of their high risk for exacerbations . therefore , after adjusting the copd mmrc system by exacerbation history according to the physician , 33% were in group a , 22% in group b , 19% in group c , and 26% in group d. the exacerbation history by gold cat group did not increase steadily with severity ( gold cat groups a to d , table 4 ) .",
"we noted that physicians identified 14.8% of patients as frequent exacerbators ( two or more exacerbations requiring steroids in the previous 12 months ) while only 13.3% of patients self - reported two or more exacerbations requiring steroids , creating a possible misclassification error due to recall bias if patient history alone is used ( data for patient - reported exacerbations not shown ) .",
"as expected , the incidence of exacerbations within the last year increased with the severity of airflow obstruction ( gold fev1 stages 14 ) ( table 4 ) .",
"none of the 40 gold cat group a patients were frequent exacerbators , so all would stay in group a. of the 199 patients in gold cat group b , 20 were frequent exacerbators and would therefore be upgraded to group d. therefore , after adjusting the gold cat system by exacerbation history according to the physician , 9% were in group a , 45% in group b , 4% in group c , and 42% in group d.",
"the percentage of patients who had one exacerbation or frequent exacerbations also increased linearly by gold mmrc group ( gold mmrc groups a to d , table 4 ) ."
],
[
"the new gold copd assessment system adds chronic respiratory symptoms information and recent exacerbation history to reclassify persons into a two - dimensional matrix that should better characterize the disease impact on chronic symptoms and risk for exacerbations and be a more accurate guide for therapy.16,17 in this study of primary care copd patients , we found as expected that the traditional copd severity system based solely on spirometry did not correlate well with either patient or physician perception of severity , although there was a weak correlation between exacerbation history and degree of airflow obstruction .",
"the results of reclassifying primary care copd patients by the new gold assessment system varies greatly by whether the cat or mmrc system is chosen , and it is not clear that either adds much practical benefit to the traditional spirometry - based system .",
"unfortunately , our data suggest that face validity is not substantially improved by the gold mmrc system , and possibly worsened by the gold cat system . therefore , it is likely that the new gold system will also be limited by one of the main criticisms of the traditional spirometry - based system , that being a poor correlation with clinical perceptions about disease severity and health status .",
"furthermore , to become practical tools for primary care , severity assessment systems will need to be validated as accurate prognostic measures , such as in their ability to predict morbidity ( eg , risk for copd exacerbations ) and mortality ."
],
[
"we found that the new gold copd system reclassifies a substantial number of primary care patients as compared to the traditional spirometry - based severity system , but the reclassification is highly variable depending on whether the mmrc or cat system is chosen .",
"furthermore , the poor agreement between the patients and physicians global assessments of severity scales even by the gold mmrc system makes it doubtful that this new system is capturing the major determinates that affect their perceptions about their disease progression or current status .",
"it remains to be seen whether the new system improves pcps decisions about treatment or helps patients understand their lung disease ."
]
] | backgroundin 2011 , the traditional global initiative for chronic obstructive lung disease ( gold ) copd spirometry - based severity classification system was revised to also include exacerbation history and copd assessment test ( cat ) and modified medical research council dyspnea scale ( mmrc ) scores . this study examined how copd patients treated in primary care are reclassified by the new gold system compared to the traditional system , and each system s level of agreement with patient s or physician s severity assessments.methodsin this us multicenter cross - sectional study , copd patients were recruited by 83 primary care practitioners ( pcps ) to complete spirometry testing and a survey . patients were classified by the traditional spirometry - based system ( stages 14 ) and under the new system ( grades a , b , c , d ) using spirometry , exacerbation history , mmrc , and/or cat results . concordance between physician and patient - reported severity , spirometry stage , and abcd grade based on either mmrc or cat scores was examined.resultsdata from 445 patients with spirometry - confirmed copd were used . as compared to the traditional system , the gold mmrc system reclassifies 47% of patients , and gold cat system reclassifies 41% , but the distributions are very different . the gold mmrc system resulted in relatively equal distributions by abcd grade ( 33% , 22% , 19% , 26% , respectively ) , but the gold cat system put most into either b or d groups ( 9% , 45% , 4% , and 42% ) . the addition of exacerbation history reclassified only 19 additional patients . agreement between pcps severity rating or their patients self - assessment and the new abcd grade was very poor ( =0.17 or less).conclusionas compared to the traditional system , the gold 2011 multidimensional system reclassified nearly half of patients , but how they were reclassified varied greatly by whether the mmrc or cat questionnaire was chosen . either way , the new system had little correlation with the pcps or their patients impressions about the copd severity . |
[
[
"we report two cases of successful management of postoperative chylothorax , following surgery for congenital diaphragmatic hernia , both in full - term newborn babies , using an escalating regimen of octeriotide infusion .",
"somatostatin , or its analog octeriotide , has recently been used with success in a number of pediatric cases of postoperative and iatrogenic chylothorax . in pediatric patients",
"the most common causes of chylothorax in children are lymphoma and trauma caused by thoracic surgery .",
"postoperative chylothorax is a serious complication with a high mortality , which can approach 50% in untreated patients .",
"it is usually the result of leakage from the thoracic duct or one of its main draining lymphatic vessels ."
],
[
"left diaphragm was found to be very vascular , which is a known risk factor for postoperative chylothorax .",
"a term female 3.5-kg infant , diagnosed with left diaphragmatic hernia on antenatal ultrasound scan done at 19 week of gestation , was born by spontaneous vaginal delivery in a very good condition .",
"the infant was extubated successfully to nasal cannula and then to room air within 3 days after administration of octeriotide infusion ( day 20 postsurgical repair ) .",
"the octeriotide infusion was kept at the same dose ( 10 mcg / kg / hr ) for 5 days and then gradually reduced at a rate of 2 mcg / kg / hr every day over the next 5 days . within three days the baby was discharged home self - ventilating in room air and on full enteral feeding with monogen formula . during the phase of high pleural drainage the baby was also supported with i.v .",
"she was electively intubated and stabilized for surgical repair of diaphragmatic hernia which was done uneventfully on third day of life [ figures 1 and 2 ] . during surgery"
],
[
"left diaphragm was found to be very vascular , which is a known risk factor for postoperative chylothorax .",
"a term female 3.5-kg infant , diagnosed with left diaphragmatic hernia on antenatal ultrasound scan done at 19 week of gestation , was born by spontaneous vaginal delivery in a very good condition .",
"on postdischarge follow - up in neonatal and dietetic clinics she had symptomatic of massive gastroesophageal reflux which required antireflux medication .",
"she was electively intubated and stabilized for surgical repair of diaphragmatic hernia which was done uneventfully on third day of life [ figures 1 and 2 ] . during surgery"
],
[
"the baby was monitored closely for any evidence of glucose intolerance , liver and renal impairment .",
"management with formula feed containing medium chain triglycerides ( monogen ) and total parenteral nutrition did not reduce the amount of chylothorax drainage .",
"the baby was discharged home self - ventilating in room air and on full enteral feeding with monogen formula . during the phase of high pleural drainage the baby was also supported with i.v .",
"a term male 3.5 kg infant was born by spontaneous vaginal delivery in a good condition ."
],
[
"we reviewed the literature to find out the most effective dose or regimen of octeriotide infusion in the management of chylothorax following repair of congenital diaphragmatic hernia .",
"the chyle drainage was significantly reduced within 48 - 72 hours once a maximum dose was reached .",
"we started octeriotide infusion at a rate of 2 mcg / kg / hr which was gradually increased by 1 mcg / kg / hr every day till we reached a maximum dose of 10 mcg / kg / hr . after being at this dose for 48 hours , we observed a dramatic reduction of chylous drainage which kept on decreasing gradually over the next few days .",
"previously published studies on the use of octeriotide in postoperative chylothorax following repair of \n diaphragmatic hernia",
"the results , as expected , were very variable . based on these studies we constructed table 1 which shows a summary of therapeutic regimens of octeriotide in postoperative chylothorax following surgery for congenital diaphragmatic hernia .",
"similarly there is no established protocol for weaning the octeriotide infusion once chylothorax has resolved . in our two cases we weaned octeriotide by reducing the infusion at a rate 2 mcg / kg / hr every day .",
"recently , octreotide has emerged as an alternative option for management of patients with chylothorax resistant to conventional therapies ."
],
[
"octeriotide is a relatively safe second line therapy in the management of chylothorax secondary to surgery for congenital diaphragmatic hernia .",
"a trial of octeriotide therapy can prevent potential permanent surgical procedures like pleurodesis or pleuroperitoneal shunts ."
]
] | chylothorax , a known complication of surgery for congenital diaphragmatic hernia , can sometimes be resistant to treat . octeriotide ( somatostatin analogue ) can be useful in this situation . however , the dose and schedule of octeriotide therapy in neonates is not well established . we report two cases of resistant chylothorax following surgery for congenital diaphragmatic hernia which were successfully managed by using an escalating infusion of octeriotide . the literature on the subject is also reviewed . |
[
[
"rowe 's zygomatic elevator was then inserted behind the infra temporal surface of the zygoma , and bone was reduced into its correct anatomical position using superior , lateral and anterior force . an audible click and fullness of the cheek together with palpation for normal contour of the zygomatic bone and orbital rim gave an idea about the adequacy of the reduction .",
"the incision can be made from anterior to posterior or from medial to lateral and should extend through mucosa , submucosa , and any buccinators muscle fibers [ figure 4 ] .",
"one hand over the side of the face was used to assist in the reduction .",
"thirty patients with zygomatic complex fractures were treated with one point fixation [ figures 13 ] .",
"a four hole plate with a gap was fixed with 4 mm 2.5 mm screws on the zygomatic buttress [ figure 5 ] .",
"immediate post operative immediate peripheral nerve stimulation x - ray six months postoperative and peripheral nerve stimulation x - ray",
"preoperative peripheral nerve stimulation x - ray preoperative computed tomography scan under general anesthesia , nasoendotracheal intubation was done ."
],
[
"for all the patients , immediate postoperative and 6 months postoperative peripheral nerve stimulation x - rays were taken , and the x - rays review successful reduction .",
"none of the patients complained of any paresthesia , bony movements or pain in the frontozygomatic or zygomatic buttress region .",
"since intraoral approach was used , all the patients had an aesthetic facial profile without any unsightly scars ."
],
[
"we also found that one point fixation with a single mini plate at the zygomatic buttress through intraoral incision provided excellent stability and esthetics in the selected cases of simple zygomatic complex fractures without any comminution of the zygoma or the lateral orbital rim without or with minimal displacement and none of our patient complained of pain or palpation or bony movements in the postoperative study period of 6 months rather they were happy to get operated without any unaesthetic facial scars .",
"the fractured fragments of a tripod or tetrapod zygomatic complex fracture near these suture lines needs to be restabilized by open reduction followed by fixation .",
"the integrity of the zygoma bone is critical in maintaining normal facial width and prominence of the cheek ."
]
] | for decades , facial beauty and esthetics have been one of the most important quests of the human race . the lateral prominence and convexity of the zygomatic bone makes it the most important bone for providing the aesthetic facial look and sets up the facial width but at the same time this prominence and convexity makes this bone more vulnerable to injury . zygomatic complex fractures or tripod fractures are the second most common fractures after nasal fractures among facial injuries . several studies have been undertaken regarding the reduction and fixation of zygomatic fractures with mini plates and screws . in 2002 fujioka et al
in vivo studies successfully proved that one point fixation at the zygomaticomaxillary complex gives three point alignment and sufficient rigidity when the fractures are not comminuted . in this article , 30 cases have been reviewed with one point fixation of zygomatic complex tripod fractures at the zygomatic buttress through keen 's intraoral approach along with advantages and disadvantages . |
[
[
"sotos syndrome is a dysmorphic syndrome characterized by early overgrowth , developmental delay , advanced bone age and characteristic craniofacial appearance .",
"this report describes camptodactyly for the first time in a girl with sotos syndrome and provides further evidence that sotos and weaver syndrome are allelic disorders .",
"sotos syndrome results from mutation involving the nuclear receptor set - domain - containing protein ( nsd1 ) gene , located on chromosome 5q ."
],
[
"camptodactyly in sotos syndrome has not been previously described in literature to the best of our knowledge .",
"we describe a two and half years old girl born of non - consanguineous tamilian parents ."
],
[
"an association of sotos syndrome with tumor development was documented over 30 years ago and has been a point of debate ever since .",
"sotos syndrome was first recognized as a distinct clinical syndrome in new england in 1964 .",
"microdeletions of chromosome 5 were not detected in our case suggesting a likely point mutation in the nsd1 gene and further evidence of that weaver and sotos syndrome are allelic ."
]
] | we describe a girl with sotos syndrome presenting at two and a half years age with developmental delay . she has camptodactyly which has not previously been reported in sotos syndrome but is a common finding in weaver syndrome . both these conditions have been reported to have nsd1 gene mutations . this report is consistent with the conditions being allelic . |
[
[
"this case highlights that ultrasound can be an adjutant to chest radiography and ct in caring for patients with h7n9 influenza .",
"in march 2013 , cases infected with a novel reassortant avian - origin influenza a ( h7n9 ) virus emerged in china and had high mortality . that month",
"the onset of h7n9 influenza in this case was manifested by hyperpyrexia and flu - like symptoms and progressed to lobar pneumonia 4 days later ."
],
[],
[],
[
"written informed consent was obtained from the patient for publication of this letter and accompanying images ."
]
] | h7n9 influenza is a new emerging infection and has high mortality . both chest radiography and computed tomography ( ct ) had some limitations in assessing such patients . we performed daily lung ultrasound in a patient with h7n9 influenza . lung ultrasound and lung ultrasound score showed high consistency with ct and the progression of pneumonia . ultrasound can be adjutant to chest radiography and ct in caring for patients with h7n9 influenza . |
[
[
"the need for categorization of anomalies and congenital aberrancies formed due to developmental vascular defects produce identifiable birthmarks of the skin and mucosa and a variable degree of underlying soft tissue abnormalities .",
"involvement of the oral cavity is common but frequently requires unconventional treatment strategies for its management .",
"presently a surge in the knowledge of criterias to classify these various anomalies has put forth classifications purely with respect to histopathological features of the disease .",
"these lesions predominantly occur within the head and neck and affect approximately 1 in 22 children ."
],
[
"a 9-year - old female patient reported to the department of oral & maxillofacial pathology , i.t.s cdsr , with a complaint of a painless growth with respect to left side of tongue .",
"on examination of the swelling a growth of 2 1 cm on the anterior part of the dorsal surface of tongue .",
"patient had given a history of trauma due to tongue bite around 3 months back and was enlarging slowly in size the swelling was initially small , peanut sized , which increased to the present size ."
],
[
"we reviewed the archival cases of lymphatic malformations in our department , the demographical information , location and histopathological features of which are shown in table 1 .",
"the only significant difference in the three archival cases and the present case was in the histopathological features of lymphangioma and hemangiolymphangioma .",
"the demographic information , location and histopathological features these anomalies present the necessity for sound discretion with regards to their approach therapeutically.although spontaneous regression of lesions is rarely encountered , the treatment seems to weigh heavily on individual assessments of the observer .",
"the origin of lesion is considered to be congenital abnormality of lymphatic system rather than true neoplasm .",
", it is argued that instead of being a congenital malformation , lymphangioma is a true neoplasm resulting from transformed lymphatic endothelial cells and/or stromal cells .",
"although histologically it is a benign disorder , local invasion into the muscle , bone , and underlying tissue can lead to severe deformity . in the present case ,"
],
[
"thus through the present article we would like to highlight the complexities which can arise from the terminal categorization of the large group of tumors called vascular neoplasms when based on their histopathological representation .",
"further detailed analysis of a larger case series would be imperative in the correct classification and diagnosis which could enormously help to accurately ascertain prognosis and direct treatment .",
"the vascular lesions consist of both blood vessels and lymphatic vessels . whether these can be termed as hemangiolymphangioma or just vascular malformation is still confusing ."
]
] | malformations of vascular nature originate as anomalies caused due to errors in vasculogenesis . these tumors are generally broadly classified into vascular tumors ( hemangiomas ) and vascular malformations ( venous malformations , arteriovenous malformations , lymphatic malformations ) . these descriptive tumors and malformations have been categorized based on the architectural assembly of vessels . lymphangiomas are further subclassified microscopically into capillary , cavernous , cystic and lymphangioendothelioma , depending upon their histopathological features . lymphatic malformations or lymphangiomas are uncommon congenital malformations of the lymphatic system , usually occurring in the head and neck region , characterized by collections of ectatic lymph vessels that form endothelial lined cystic spaces . advancements in the knowledge of pathogenesis of such vascular malformations are continuously changing their treatment protocols . early recognition is of utmost importance for initiation of proper treatment and avoiding serious complications . hemangiolymphangioma is a variant of lymphangioma showing vascular component . herewith , we present a case of vascular malformation diagnosed as hemangiolymphangioma histopathologically in a 9-year - old girl , along with a review of literature regarding its categorization . |
[
[
"participating women underwent two interventions for hpv dna detection : with \n verbal and diagrammatic instruction , they self - collected a vaginal specimen ; afterward , \n a health professional used a speculum and collected an endocervical specimen . \n dna isolation and hpv testing -",
"\n study population and sampling - this study was conducted between \n august - december 2011 and the women were recruited from central laboratory municipal \n campo grande , state of mato grosso do sul , brazil , when they were forwarded to \n gynaecological exams in the public health system .",
"samples \n that amplified the pgmy09/11 primers were genotyped by type - specific pcr using primers \n for high - risk hpv ( hr - hpv ) , hpv16 , 18 , 31 , 33 , 45 ( guo et \n al . 2007 ) and low - risk hpv ( lr - hpv ) , hpv6 , 11 ( silva et al . 2003 ) .",
"hpv dna detection was performed by polymerase chain \n reaction ( pcr ) amplification with the use of the pgmy09/11 primers ( gravitt et al .",
"statistical analysis - agreement between the self and \n clinician - collected samples was measured using kappa ( ) statistics .",
"women were eligible to participate if \n they were 18 years of age and had not undergone a hysterectomy ."
],
[
"a total of 30% ( 51/170 ) of the \n samples were hpv dna - positive .",
"six women tested \n hpv - positive on clinician - collected samples , but hpv - negative on self - collected samples . \n",
"hpv16 , the most frequently detected hr - hpv type , was present in six samples obtained by \n both methods .",
"we found a lower frequency of hpv infection in women 30 years ( p = 0.009 ) ."
],
[
"herein , we evaluated the hpv dna detection agreement between self and \n clinician - collected samples .",
", we demonstrated that the results of the self - collected sampling method \n are in good agreement with those of the clinician - collected sampling method for the \n detection and typing of hpv dna .",
"our results demonstrated that self - collection sampling \n generates comparable amounts of material for hpv testing to those of clinician samples \n ( both amplified 99.4% of the -globin gene ) .",
"the self - collection method is better accepted among women ; therefore , \n it could enhance cervical cancer screening program coverage and contribute significantly \n to reducing the incidence of cervical cancer .",
"use of the self - collected sampling method as a primary \n prevention strategy in countries with few resources could effectively identify those \n women with hr - hpv ."
]
] | women infected with human papillomavirus ( hpv ) are at a higher risk of developing
cervical lesions . in the current study , self and clinician - collected vaginal and
cervical samples from women were processed to detect hpv dna using polymerase chain
reaction ( pcr ) with pgmy09/11 primers . hpv genotypes were determined using
type - specific pcr . hpv dna detection showed good concordance between self and
clinician - collected samples ( 84.6% ; kappa = 0.72 ) . hpv infection was found in 30%
women and genotyping was more concordant among high - risk hpv ( hr - hpv ) than low - risk
hpv ( hr - hpv ) . hpv16 was the most frequently detected among the hr - hpv types . lr - hpv
was detected at a higher frequency in self - collected ; however , hr - hpv types were more
frequently identified in clinician - collected samples than in self - collected samples . hpv infections of multiple types were detected in 20.5% of clinician - collected
samples and 15.5% of self - collected samples . in this study , we demonstrated that the
hpv dna detection rate in self - collected samples has good agreement with that of
clinician - collected samples . self - collected sampling , as a primary prevention
strategy in countries with few resources , could be effective for identifying cases of
hr - hpv , being more acceptable . the use of this method would enhance the coverage of
screening programs for cervical cancer . |
[
[
", san diego , ca ) to stabilize extracellular atp and directly placed in the test chamber of a luminometer ( firezyme ) .",
"microglial cells ( 25 10/ well ) were plated in microtiter plastic wells in culture medium and incubated in a co2 incubator at 37c in the absence or presence of lps for 24 h. at the end of this incubation , the monolayers were thoroughly rinsed with saline solution and supplemented with 100 l of a special diluent buffer ( firezyme ltd .",
"after isolation , cells were kept in culture for 5 d in rpmi medium containing 2 mm glutamine , 5% human serum , 100 u / ml penicillin , and 100 g / ml streptomycin . il-1 and il-6 in the supernatant of lps ( sigma chemical co. ,",
"then , 100 l of luciferin - luciferase solution ( firezyme ) was added , and light emission was recorded . as a control ,",
"human monocytes were isolated from buffy coats by one - step gradient ( percoll ; pharmacia biotech spa , cologno monzese , italy ) or by adherence on plastic petri dishes . ",
"paola ricciardi - castagnoli ( university of milano , italy ) and were grown in rpmi 1640 medium ( paa , linz , austria ) supplemented with 2 mm glutamine and 10% ( heat - inactivated ) fcs ( life technologies ltd . ,",
"all reagents used were dissolved in endotoxin - free water ( sigma ) and checked for endotoxin contamination ."
],
[
"after isolation , cells were kept in culture for 5 d in rpmi medium containing 2 mm glutamine , 5% human serum , 100 u / ml penicillin , and 100 g / ml streptomycin . il-1 and il-6 in the supernatant of lps ( sigma chemical co. ,",
"human monocytes were isolated from buffy coats by one - step gradient ( percoll ; pharmacia biotech spa , cologno monzese , italy ) or by adherence on plastic petri dishes . ",
"paola ricciardi - castagnoli ( university of milano , italy ) and were grown in rpmi 1640 medium ( paa , linz , austria ) supplemented with 2 mm glutamine and 10% ( heat - inactivated ) fcs ( life technologies ltd . ,",
"st . louis , mo ) treated cells were measured with the intertext-1x mouse il-1 elisa kit and intertext-6x mouse il-6 elisa kit , respectively ( genzyme srl , cinisello balsamo , italy ) .",
"all reagents used were dissolved in endotoxin - free water ( sigma ) and checked for endotoxin contamination .",
"paisley , scotland ) , 100 u / ml penicillin , and 100 g / ml streptomycin as described previously ( 2 ) ."
],
[
"microglial cells ( 25 10/ well ) were plated in microtiter plastic wells in culture medium and incubated in a co2 incubator at 37c in the absence or presence of lps for 24 h. at the end of this incubation , the monolayers were thoroughly rinsed with saline solution and supplemented with 100 l of a special diluent buffer ( firezyme ltd . , san diego , ca ) to stabilize extracellular atp and directly placed in the test chamber of a luminometer ( firezyme ) . then",
", 100 l of luciferin - luciferase solution ( firezyme ) was added , and light emission was recorded . as a control ,"
],
[
"involvement of the p2z / p2x7 purinergic receptor in lps - dependent il-1 release may allow the development of new pharmacological antagonists ( i.e. , oatp and derivatives ) to modulate the in vivo production of this cytokine in pathological conditions such as septic shock or chronic inflammatory diseases .",
"we show that il-1 release is restored in lps - treated , oatpinhibited cells by the k ionophore nigericin , an agent known to cause il-1 release through a receptor - independent pathway ( 4 , 10 ) .",
"autocrine / paracrine stimulation of purinergic receptors can also in principle be prevented by exogenously added atp - consuming enzymes such as apyrase or hexokinase . ",
"1 shows that a 24-h incubation in the presence of 10 g / ml lps triggers release of il-1 and that this is blocked by pretreatment with the selective p2z / p2x7 inhibitor ( 13 ) oatp . to show that the effect of oatp is not due to a nonspecific inhibition of cell responses , we have also monitored il-6 release , which is much less affected . as further proof that oatp does not have nonspecific effects ,",
"thus we checked whether the potentiating effect of hexokinase is mediated by stimulation of the p2z/ p2x7 receptor by accumulated adp ."
],
[
"oxidized atp inhibits lps - dependent release of il-1. n13 microglial cells were incubated in 24-well plates in rpmi medium supplemented with 10% fcs at a concentration of 2 10 and incubated 24 h in the presence or absence ( controls ) of 10 g / ml lps . in the experiments with oatp , cells were treated with this inhibitor ( 300 m ) for 2 h and then rinsed before addition of lps . stimulation with nigericin ( 20 m ) was performed for 30 min after removal of oatp .",
"microglial cells were plated in 24-well plates as described in fig . 1 for il-1 secretion or microtiter plastic wells as described in materials and methods for atp release and stimulated with lps for 24 h in a co2 incubator at 37c .",
"macrophages were isolated from three different donors ( a c ) as described in materials and methods and plated in microtiter plastic wells at a concentration of 50 10/well . after plating ,",
"data for il-1 release are duplicates from a single experiment repeated with similar results with three different batches of microglial cells .",
"data for atp release are means of quadruplicate determinations sd from a single experiment repeated in three different occasions .",
"data are averages of duplicate determinations from a single experiment repeated on three separate occasions ."
]
] | microglial cells express a peculiar plasma membrane receptor for extracellular atp , named p2z / p2x7 purinergic receptor , that triggers massive transmembrane ion fluxes and a reversible permeabilization of the plasma membrane to hydrophylic molecules of up to 900 dalton molecule weight and eventual cell death ( di virgilio , f. 1995 . immunol . today . 16:524528 ) . the physiological role of this newly cloned ( surprenant , a. , f. rassendren , e. kawashima , r.a . north and g. buell . 1996 . science ( wash . dc ) . 272:735737 ) cytolytic receptor is unknown . in vitro and in vivo activation of the macrophage and microglial cell p2z / p2x7 receptor by exogenous atp causes a large and rapid release of mature il-1. in the present report we investigated the role of microglial p2z / p2x7 receptor in il-1 release triggered by lps . our data suggest that lps - dependent il-1 release involves activation of this purinergic receptor as it is inhibited by the selective p2z / p2x7 blocker oxidized atp and modulated by atp - hydrolyzing enzymes such as apyrase or hexokinase . furthermore , microglial cells release atp when stimulated with lps . lps - dependent release of atp is also observed in monocyte - derived human macrophages . it is suggested that bacterial endotoxin activates an autocrine / paracrine loop that drives atp - dependent il-1 secretion . |
[
[
"a 23-year - old engineering graduate presented with primary palmoplantar hyperhidrosis , for which he was advised an alternate day schedule of tap water iontophoresis ."
],
[
"he followed an alternate day schedule of 20 min utes immersion for initial 4 weeks , followed by once a week for next 8 weeks .",
"he achieved an excellent reduction in palmoplantar sweating without any adverse effect , within 3 months of starting iontophoresis . a simple user - made iontophoresis device",
"on his next visit , he presented with a very simple iontophoresis device that he devised on his own .",
"hence , using his engineering background he constructed this simple device based on basic mechanism behind iontophoresis .",
"the device was constructed with a rechargeable 12 volt battery , two aluminum trays and copper wires , and connecting clamps [ figure 1 ] ."
],
[
"tap water iontophoresis is a reliable and effective method for the treatment of palmar and plantar hyperhidrosis , when practiced with appropriate technique and timing .",
"iontophoresis is defined as passing of an ionized substance through intact skin by application of direct current ( dc ) .",
"many dermatologists consider simple tap water iontophoresis to be first line therapy for primary focal palmar and plantar hyperhidrosis .",
"the mechanism of production of anhidrosis is not completely understood ; however , obstruction of sweat duct has been suggested as a possible cause ."
],
[],
[]
] | iontophoresis is defined as passing of an ionized substance through intact skin by application of direct electric current . tap water iontophoresis is reliable and effective method for treatment of palmar and plantar hyperhydrosis when practiced with appropriate technique and timing . one of the major setback for using iontophoresis is that the apparatus is expensive and is not readily available . a simple user - made iontophoresis device have been described here , which could be easily constructed and used at home . |
[
[
"therefore , the implant selection and position in the femoral head are of paramount importance for different iff types in terms of the cut - out of the lag screw and implant failure . in this study , the effects of three factors ( lag screw positions , fracture types , and tad ) in the cut - out risk were evaluated using finite element analysis ( fea ) in a patient - specific femur .",
"the aim of the fea study was to assess how the different positions of the lag screw and fracture types can influence the risk of cut - out systematically .",
"implant selection is vital for the treatment of stable and unstable trochanteric femoral fracture types . in"
],
[
"the volume percentages of the trabecular bone exceeding the yield strength of the compressive strain for each position were calculated and compared to each other .",
"friction coefficients were defined as 0.42 for the interactions between the bone and the implant , 0.2 for the interactions between the implant and the fragment of the implant itself , and 0.46 for the interactions of the fragments of the fractured bone .",
"the models of dhs and fractured femur were combined with different lag screw positions in accordance with clinical practice .",
"the best lag screw location was determined according to the amount of minimum volume percentage .",
"the material of dhs was considered to be made of 316l stainless steel which is commonly utilized in the treatment of iff .",
"the compressive strain criterion was selected to predict the cut - out risk of the femoral head models in the trabecular bone according to schileo et al . ."
],
[
"hence , the results of tad proved incompatible in the regions of ps and s in a2.1 fracture type .",
"although the ps and s regions had higher tad values compared to the as , a , p , and i regions , the volume percentages of the trabecular failure in the ps and s regions were less than in as , a , p , and i regions .",
"the results demonstrated that the pi and ai regions had the higher risk and also the higher tad values .",
"pertaining to the results , as the most suitable region for the cut - out risk , the middle placement of the lag screw was determined with reference to the yield strain criterion of the trabecular bone ."
],
[
"the fea results showed that femur trochanteric fracture types are crucial for the treatment of the femur fractures .",
"for this reason , there is a possibility of the trabecular bone yielding at the tip of the lag screw in the unstable fracture models .",
", the effects of the varieties of the lag screw positions observed in clinical practices on the cut - out risk were evaluated using fe method in two types of the femur trochanteric fractures .",
"the cut - out risk of the lag screw in two iff types can be estimated by utilizing the technique of the fe simulations .",
"in other words , fracture types affect the cut - out risk in different lag screw positions .",
"some obvious distinctions were recorded between the stable ( 31-a1.1 ) and unstable ( 31-a2.1 ) fracture types in terms of the minimum principal strain distributions ."
],
[
"the bone density and the location of the lag screw at the femoral head are fundamental factors for the cut - out risk . in addition",
"furthermore , the method of tad used for the determination of the cut - out risk in clinical practices also proves to be useful as a predictor in our study .",
"all in all , we can supposedly say that the density distribution of the trabecular bone is a more efficient factor compared to the positions of the lag screw in the cut - out risk ."
]
] | background . in this study , the cut - out risk of dynamic hip screw ( dhs ) was investigated in nine different positions of the lag screw for two fracture types by using finite element analysis ( fea ) . methods . two types of fractures ( 31-a1.1 and a2.1 in ao classification ) were generated in the femur model obtained from computerized tomography images . the dhs model was placed into the fractured femur model in nine different positions . tip - apex distances were measured using solidworks . in fea , the force applied to the femoral head was determined according to the maximum value being observed during walking . results . the highest volume percentage exceeding the yield strength of trabecular bone was obtained in posterior - inferior region in both fracture types . the best placement region for the lag screw was found in the middle of both fracture types . there are compatible results between tip - apex distances and the cut - out risk except for posterior - superior and superior region of 31-a2.1 fracture type . conclusion . the position of the lag screw affects the risk of cut - out significantly . also , tip - apex distance is a good predictor of the cut - out risk . all in all , we can supposedly say that the density distribution of the trabecular bone is a more efficient factor compared to the positions of lag screw in the cut - out risk . |
[
[
"( 2004a ) , who compared neoplecostomus corumba ( neoplecostomus sp . in that work ) and n. paranensis using allozyme electrophoresis . in view of the difficulty in identifying species of this genus , in the present study , two populations of neoplecostomus , one from so domingos stream of the grande river in the municipality of muzambinho , in minas gerais state , and another from paraitiguinha stream of the tiet river basin in the municipality of salespolis , so paulo state ( both in the upper paran river basin ) were compared using allozyme gel electrophoresis in order to improve our understanding of the biodiversity within this genus",
", representatives of the genus neoplecostomus occur in the headwater streams of southern and southeastern brazil .",
"the order siluriformes is the most diverse and well - distributed within the ostariophysi , and includes 3093 species , 478 genera and 36 families ( ferraris jr , 2007 ) . in the neotropical region"
],
[
"specimens of the two populations reported here differed morphologically from the four species of neoplecostomus described for the upper paran river basin by the following characters : ( 1 ) a well - developed adipose fin distinguished them from n. corumba and n. paranensis that have a reduced / absent adipose fin or no adipose fin , respectively , and ( 2 ) homogeneously dispersed hypertrophied odontodes in the dorsal region of the head and not bordered by swollen skin vs. more hypertrophied odontodes in front of the eyes and the lateral margin of the snout surrounded by swollen skin in n. selenae , and more hypertrophied odontodes bordered by hypertrophied skin only on the lateral margin of the snout in n. yapo .",
"s/462800,79 w and an altitude of 1021 meters in the municipality of muzambinho , minas gerais state ( figure 2 ) .",
"twenty - nine specimens of neoplecostomus sp . 1 ( figure 1a ) were collected in paraitinguinha stream ( tiet river basin ) at 233039,84 ",
"2 ( figure 1b ) were collected in so domingos stream ( grande river basin ) , 212047,22 ",
"s/455132,22 w and an altitude of 786 meters in the municipality of salespolis , so paulo state ( figure 2 ) .",
"the fish were frozen in liquid nitrogen and transported to the universidade estadual de maring .",
"voucher specimens were deposited in the ichthyological collection of the ncleo de pesquisas em limnologia , ictiologia e aquicultura ( nuplia ) of the universidade estadual de maring ( neoplecostomus sp . 1 under accession number nup 6102 and neoplecostomus sp . 2 under accession number nup 6103 ) ."
],
[
"we analyzed 12 enzyme systems ( table 1 ) in two populations of neoplecostomus and obtained 19 loci ( table 2 ) with a total of 29 alleles . of the 49 individuals analyzed , 29 belonged to the morphotype neoplecostomus sp . 1 , collected in paraitinguinha stream , and 20 to neoplecostomus sp",
"the electrophoretic patterns of the 12 enzyme systems obtained in this study were similar to those reported by zawadzki et al .",
"the two populations differed at nine ( aat , acp , adh , gdh , idh , mdh - c , pgm and sorb-1 - 2 ) of the 19 loci .",
"the negative value of fis ( 0.0741 ) indicated an excess of heterozygotes for the idh locus in the neoplecostomus sp . 1 population .",
"1 ( from salespolis ) was monomorphic at all but one locus ( 5.26% polymorphism ; only the idh loci showed allelic variation ) ."
],
[
"our findings suggest that other genetically - differentiated populations may be revealed as more headwater streams in southeastern brazil are sampled .",
"in contrast to the marked genetic divergence seen here between the two populations , other studies based on allozyme characters in allopatric populations of loricariid fishes have found no diagnostic markers .",
"these characteristics suggest a possible restricted range and reduced gene flow among neoplecostomus species compared to other fish species .",
"likewise , in the present study , the low levels of genetic variability for the two populations of neoplecostomus may indicate that they are mainly sedentary and probably restricted to small areas .",
"the sedentary nature of these fish leads to mating within the same family group and results in low genetic variability ."
]
] | allozyme electrophoresis was used to examine 12 enzymatic systems in two populations of the genus neoplecostomus from the paran river basin . samples of neoplecostomus sp . 1 were collected in paraitinguinha stream of the tiet river basin , in the municipality of salespolis , so paulo state , and those of neoplecostomus sp . 2 from so domingos stream of the rio grande river basin , in the municipality of muzambinho , minas gerais state . the genetic variability of the two populations was estimated by nei s expected heterozygosity and was considered lower than average for populations of freshwater fish . the proportion of polymorphic loci was low ( only 5.26% for the locus idh ) . the low frequency of heterozygosity for both populations revealed a high fixation of alleles for each locus . homozygote excess was observed in both populations . the values of nei s genetic identity and the presence of loci with different allele frequencies in both populations may imply that the two populations belong to different species . the genetic variability between populations was compared to other data for loricariids . |
[
[
"this study aimed to evaluate the incidence of animal bites in the lorestan province in the west of iran , its distribution , and human rabies deaths from the disease over a period of eleven years from 2004 to 2014 to prevent its growing in future planning .",
"the growing cases of stray dogs and also the increasing number of animal bites and rabies distribution in many provinces has caused massive annual costs to prepare vaccines , serum , and preventive actions . and that more attention needs to be paid to control the disease and research about its different aspects . furthermore , wide geographical distribution , ecological diversity , and dependency of the risk factors of rabies to wildlife species , and also different levels of health knowledge , indicate that separate investigations should be conducted in different regions of the country .",
"although rabies is preventable with safe and effective vaccines , it is still a health problem so that approximately 60,000 deaths occur annually in the world , and most cases occur in asia and africa .",
"in addition to the public human health , the incidence of the disease in animals causes significant economic losses .",
"the incidence of animal bites in the world is estimated at 250 out of 1000 people . in iran",
"being aware of the epidemiology , prevalence , and at risk age groups , we can provide the officials with good ways to prevent this health problem in the health systems .",
"annually , in different parts of the world , more than 15 million people due to animal bites refer to special centers to treat ."
],
[
"questions included age , sex , the bitten organ , place of occurrence , the bite time , and the kind of aggressive animal .",
"a person is said rabies case whose infection is confirmed by the pasteur institute . during the study , the required information in all cases of animal bites and human rabies were collected by questionnaire .",
"is called one bitten by an animal and refers to the rabies prevention centers due to animal bites and fear of rabies .",
"the population of this study were comprised those bitten by animals from the beginning of 2004 to the end of 2014 .",
"they had referred to all medical science units in province belonging to lorestan university , to get rabies prevention treatment .",
"this was a descriptive cross sectional study performed in lorestan province , west of iran .",
"the population of lorestan province was obtained from management and planning organization of the province , and the calculations were conducted based on them ."
],
[
"distribution of animal bite cases in lorestan province , west of iran ( 2004 - 2014 ) based on gender , residency , age , bite site , type of biting animal and job frequency distribution of animal bite cases in lorestan province , west of iran ( 2004 - 2014 ) based on month and gender human rabies infections which were observed in four of all cases were confirmed by the pasteur institute of iran .",
"two of them were females ( 3 and 18-year - old ) who had been affected by a fox , and two were males ( 16 and 50-year - old ) .",
"during 2004 till 2014 , the number of animal bite cases in the province which has received preventive treatment care was 43,892 .",
"four cases , respectively , happened in the years 2009 , 2010 , 2012 , and 2013 .",
"seventy - eight percent of all cases of animal bites in rural areas and 22% in urban areas , respectively ."
],
[
"findings of this study showed that 43,892 people in the years 20042014 in lorestan province had been bitten by the animals . during this time , the animal bite was 223.23 out of 100,000 that in comparison to the same period all over iran was ( an average of 180/10,000 ) higher . increasing the incidence can lead to permanent educational programs in urban and rural health centers and health homes to prevent the occurrence of rabies in humans and raising awareness of the risk caused by the biting animals in the province . on the other hand , inaction and inadequacy of the measures taken by the animal",
"none of these people had referred for preventive services . in bahonar 's study in ilam province , where conditions are similar to lorestan province , four fatal cases were reported .",
"higher incidence of animal rabies in the mentioned areas is due to the climatic conditions where the presence of the main reservoirs of the disease including wolf - likes , and other wild animals are higher than lorestan province . in this study ,",
"most observed cases of animal bites and human rabies result from dog and canine bites .",
"( stray dogs ) rabies control committee , especially in the rural areas in most cities and the lack of widespread implementation of the vaccination of domestic dogs and cattle can increase the incidence of rabies .",
"dogs face wild animals more , especially wolves and canines , which statistically are the main source of disease ."
],
[
"due to the rather high rate of human rabies and animal rabies in the province , we can conclude that wildlife of the province is infected with the virus that causes disease in domestic animals , owner dogs or some cases , with human bites carry rabies to people . according to the results of this study and other studies , students and residents of villages are more at risk .",
"hence , training the people at risk about hurting and mistreatment of dangerous animals , ways of transmitting the disease , convincing the owners of sheep dogs and domestic dogs to go to the veterinary , and vaccination offices to vaccinate and collar their dogs and their dogs can play an important role in reducing the incidence of animal bites and rabies cause death ."
],
[],
[]
] | background : despite the progress made , animal bites and rabies are one of the important health problems in the country . the purpose of this study was to investigate the epidemiology of animal bites and rabies during 20042014 in lorestan province to prevent them in population of the province for the future prospective aspects.materials and methods : in a descriptive cross - sectional study , all those cases bitten in the province , during 2004 and 2014 , were studied . the required information about the age , sex , the bitten organ , type of the invasive animal time , and location of the event were collected in questionnaires and then analyzed.results:the total number of cases of animal rabies during the period of study was 43,892 , shown at the rate of 223.23 in 100,000 people . seventy - eight percent of animal bites in rural areas , 41.42% in the ages 1029-year - old , 26.8% of cases were students , 56.77% leg bites , and 82.5% of dog bites . four cases of human rabies were observed during this period.conclusions:rate of animal bites and rabies is high in lorestan province . controlling animals such as dogs and cats in the province through training people at risk , especially among the students , rural areas and inter - sectorial coordination to eliminate stray animals should be considered over and over . preventive actions to avoid bites are a priority . |
[
[
"the experimental results have shown that our algorithm is very efficient , which can find optimal or near - optimal conformations in a very short time for a number of sequences with lengths ranging from 20 to 100 monomers .",
"a branch and bound algorithm is proposed to find the native conformation for the two - dimensional ( 2d ) hp model .",
"since the problem is too difficult to be approached with fully realistic potentials , the theoretical community has introduced and examined several highly simplified models .",
"the methods used to find low energy structures of the hp model include genetic algorithm ( ga ; ref . 8 . , 9 .",
"these algorithms can find optimal or near - optimal energy structures for most benchmark sequences , however , their computation time is rather long . in this paper ,",
"the protein folding problem in the hp model has been shown to be np - complete , and hence unlikely to be solvable in polynomial time 5 .",
"although the hp model is extremely simple , it still captures the essence of the important components of the protein folding problem ( 4 ) .",
"one of them is the hp model of dill et al . 1 . , 2 . , 3 . where each amino acid is treated as a point particle on a regular ( quadratic or cubic ) lattice , and only two types of amino acids"
],
[
"the hp model is based on the assumption that the hydrophobic interaction is one of the fundamental principles in the protein folding .",
"an attractive hydrophobic interaction provides for the main driving force for the formation of a hydrophobic core that is screened from the aqueous environment by a shell of polar monomers .",
"the goal of the protein folding problem is to find the conformation with the minimal energy .",
"the energy of this conformation is 4 , which is the lowest energy state of the sequence .",
"it can be seen that each monomer occupies one lattice site connected to its chain neighbors ."
],
[
"in our algorithm , a conformation is built by adding a new monomer at an allowed neighbor site of the last placed monomer on the square lattice . in order to obtain a self - avoiding conformation ,",
"our algorithm is implemented by depth - first . here , emin is the minimal energy of the complete conformations ever built .",
"the probability 2 is chosen to be less than 1 because a partial conformation with energy below average is more promising than a high energy partial conformation . in this way , ek , the energy of the partial conformation , can be viewed as the energy expectation of the partial conformation after looking one step ahead and zk is expressed as the mean energy of the already generated partial conformations of length k. zk keeps a historical record , which is , to a large extent , conducive to the formulation of promising conformations .",
"a so - called branch and bound method is introduced in this paper . in this search method , only the promising nodes are kept for further branching and the remaining nodes are pruned off permanently . since a large part of the search tree is pruned off aggressively to obtain a solution , its running time is polynomial in the size of the problems . in our algorithm , we treat h monomers and p monomers differently . for a partial conformation where"
],
[
"it can be seen that the conformation has a single compact hydrophobic core for all sequences , which is analogous to the real protein structure .",
"for sequences with 24 , 36 , and 60 monomers , the corresponding conformations are all of the lowest energy . for the other two sequences with longer lengths , the corresponding conformations are also of near - optimal energy .",
"as shown in the table , our branch and bound algorithm can find the optimal lowest energy conformations for six sequences .",
"for the two long sequences of length 85 and 100 , respectively , our algorithm can find near - optimal energy conformations .",
"the cpu time for all sequences was less than 10 s except the sequence of length 64 , for which the cpu time was 39.46 s. it can be seen from unger and moult ( 12 ) that the number of steps of mc and ga methods increases badly with the increase of sequence lengths , therefore , it is imaginable that the computational speed of mc and ga methods in unger and moult ( 12 ) for practical applications is unacceptable .",
"the resulting folding conformations for sequences with 24 , 36 , 60 , 85 , and 100 monomers are given in figure 5 , respectively ."
],
[
"the branch and bound algorithm proposed in this paper is a novel and effective tool for the conformational search in the low - energy regions of the protein folding problem in the 2d hp model .",
"our algorithm is similar to the population control scheme ( 15 ) where individuals would have more opportunities to procreate if holding higher individual quality , and the pruning mechanism reduces considerably the computational burden of search .",
"the experimental results on 10 benchmark sequences demonstrate that our algorithm outperforms other three methods in terms of speed and efficiency .",
"we should point out that , the coding of this algorithm is very simple and hence it can be easily implemented by practitioners ."
]
] | a branch and bound algorithm is proposed for the two - dimensional protein folding problem in the hp lattice model . in this algorithm , the benefit of each possible location of hydrophobic monomers is evaluated and only promising nodes are kept for further branching at each level . the proposed algorithm is compared with other well - known methods for 10 benchmark sequences with lengths ranging from 20 to 100 monomers . the results indicate that our method is a very efficient and promising tool for the protein folding problem . |
[
[
", we present preliminary local control results on the treatment of six patients with cervical cancer who did not have a brachytherapy boost and were treated with an sbrt boost resulting in a total dose of 7785 gy to the cervix .",
"standard radiation therapy for cervical carcinoma patients undergoing primary chemosensitized radiation therapy usually consists of external beam therapy followed by an intracavitary brachytherapy boost ( eifel et al . , 2004 ) .",
"stereotactic body radiotherapy ( sbrt ) provides a potential alternative method to boost the cervix in those cases where brachytherapy is not performed .",
"using this approach , the brachytherapy serves to provide a tumorical dose to the cervix while limiting the dose to surrounding anatomy , such as the bladder and rectum , which have a lower dose tolerance ."
],
[
"this is a retrospective chart review of cervical cancer patients treated with combined external beam radiation and sbrt boost to the cervix at winthrop - university hospital from 3/2009 to 8/2011 .",
"all patients received a series of conventionally fractionated radiation therapy followed by an sbrt dose .",
"subsequently , we modified our treatment so that the conventionally fractionated treatment began with a dose of 45 gy to the pelvis using 15 mv photons followed by two imrt boosts , one to the uterus and cervix that increased the delivered dose to 50.4 gy and a second imrt boost to the cervix alone resulting in a total delivered conventionally fractionated radiation therapy dose of 61.2 gy .",
"one of two dose schemes was used . early in our program of treating cervical cancer patients with an sbrt",
"boost the conventionally fractionated treatment consisted of a 45 gy dose to the pelvis using 15 mv photons followed by an imrt boost to the cervix and uterus to a total delivered conventionally fractionated radiation therapy dose of 50.4 gy ."
],
[
"six consecutive cervical cancer patients were treated with combined external beam radiation and sbrt boost to the cervix at winthrop - university hospital from 3/2009 to 8/2011 .",
"in addition , for the five patients with a minimum of 12 months follow - up all ( 100% ) remain locally and distantly controlled with no evidence of disease .",
"all of these symptoms resolved by the time of sbrt boost . at a median follow - up of 14 months ( range , 128 months ) from completion of the sbrt boost",
"( a ) representative treatment plan for a patient receiving an sbrt boost of 20 gy delivered in four fractions .",
"grade 1/2 urinary and bowel toxicities occurred in four patients following conventional external beam radiation .",
"one patient refused brachytherapy ; all other patients were unable to receive a tandem and ovoid brachytherapy boost because of either anatomic ( n = 3 ) or medical ( n = 2 ) conditions ."
],
[
"this report demonstrates the feasibility of using robotic sbrt as an alternative to brachytherapy in cervical cancer patients unable to undergo brachytherapy . the motivation for this series stems from the markedly inferior reported outcomes for treatment of such patients with a conventionally fractionated radiation boost compared to brachytherapy .",
"other studies using a conventional linear accelerator have reported on a stereotactic boost for gynecologic cancers . in a case study ,",
"in addition , the lack of any failure for the five patients with a minimum of 12 months follow - up is highly promising compared to the ebrt boost results for which the cancer - specific overall survival at 1 year was already only 80% ( barraclough"
],
[
"this paper is the among the first to report on using robotic sbrt in patients with real - time motion tracking for the treatment of locally advanced cervical cancer in patients who are unable to undergo brachytherapy .",
"additional confirmatory prospective studies with larger numbers of patients and longer follow - up are required to validate the durability of these results .",
"these preliminary results suggest that cyberknife robotic sbrt is a safe and effective modality in the treatment of cervix cancer for those patients unable to undergo brachytherapy ."
],
[
"dr . haas has received speaker s honoraria from accuray inc . , sunnyvale , ca , usa ."
]
] | standard radiation therapy for patients undergoing primary chemosensitized radiation for carcinomas of the cervix usually consists of external beam radiation followed by an intracavitary brachytherapy boost . on occasion , the brachytherapy boost can not be performed due to unfavorable anatomy or because of coexisting medical conditions . we examined the safety and efficacy of using cyberknife stereotactic body radiotherapy ( sbrt ) as a boost to the cervix after external beam radiation in those patients unable to have brachytherapy to give a more effective dose to the cervix than with conventional external beam radiation alone . six consecutive patients with anatomic or medical conditions precluding a tandem and ovoid boost were treated with combined external beam radiation and cyberknife boost to the cervix . five patients received 45 gy to the pelvis with serial intensity - modulated radiation therapy boost to the uterus and cervix to a dose of 61.2 gy . these five patients received an sbrt boost to the cervix to a dose of 20 gy in five fractions of 4 gy each . one patient was treated to the pelvis to a dose of 45 gy with an external beam boost to the uterus and cervix to a dose of 50.4 gy . this patient received an sbrt boost to the cervix to a dose of 19.5 gy in three fractions of 6.5 gy . five percent volumes of the bladder and rectum were kept to 75 gy in all patients ( i.e. , v75 gy 5% ) . all of the patients remain locally controlled with no evidence of disease following treatment . grade 1 diarrhea occurred in 4/6 patients during the conventional external beam radiation . there has been no grade 3 or 4 rectal or bladder toxicity . there were no toxicities observed following sbrt boost . at a median follow - up of 14 months , cyberknife radiosurgical boost is well tolerated and efficacious in providing a boost to patients with cervix cancer who are unable to undergo brachytherapy boost . further follow - up is required to see if these results remain durable . |
[
[
"\n subjects and sampling - the study was carried out in porto velho , ro , \n an unstable malaria - endemic area , where p. vivax accounts for more than 75% of all \n malaria cases ( oliveira - ferreira et al .",
"symptomatic patients diagnosed with malaria infection by a thick blood smear in an \n outpatient clinic in porto velho were asked to participate in the study .",
"a total of 71 \n patients were enrolled for the study , 47 and 24 of whom were infected with p. vivax and \n p. falciparum , respectively .",
"the control group ( n = 12 ) was composed of apparently healthy \n individuals who lived in the same area , but were negative for malaria parasites as \n determined thick blood smear and had not reported any malaria episodes for at least one \n year .",
"patients returned 15 days later ( d15 - in the convalescent stage ) for \n follow - up examinations and paired blood samples were collected from 40 p. vivax and 15 \n p. falciparum infected patients .",
"asexual blood forms of p. falciparum or p. vivax were cleared from the peripheral blood \n of all patients included in the study following therapy and no parasite reappearance was \n observed during follow - up ."
],
[
"first , the cytokines il-5 , il-7 and gm - csf were not \n detectable in most plasma samples and no differences were observed in mcp-1 levels \n compared with controls . during the acute phase , p. vivax and p. falciparum patients had \n significantly higher il-6 , il-8 , il-17 , ifn- , tnf- , mip-1 and g - csf plasma \n concentrations than controls . to investigate changes in cytokine levels during \n infection , we compared cytokine levels in the sera from the same patient during the \n acute and convalescent phases and plasma levels of il-6 , il-8 , il-17 , ifn- , tnf- \n mip-1 and g - csf were higher during the convalescent phase .",
"1 : comparison of serum cytokines and chemokines levels between control , \n plasmodium vivax and plasmodium falciparum patients in acute and convalescent \n phase of infection .",
"1 compare circulating cytokine and chemokine levels in patients infected \n with p. vivax and p. falciparum .",
"although p. falciparum and \n p. vivax malaria patients have similar cytokine profiles during infection , p. falciparum \n patients presented higher levels of il-6 , il-8 , il-17 , ifn- , mip-1 and g - csf than p. \n vivax patients during the convalescent phase ."
],
[
". additionally , there are no reports of cytokine concentrations in humans 15 days after \n the beginning of treatment ; therefore , the data presented here could for the first time \n indicate a shift from a th1/th2 balanced response to a more pronounced th1-regulated \n immune response during the first 15 days of uncomplicated malaria treatment in brazilian \n endemic areas .",
"the findings of our study show that increased \n band cells and low lymphocyte and eosinophil counts are common during acute p. \n falciparum and p. vivax malaria .",
"a complex array of cytokines is released in adult patients with \n uncomplicated malaria infection with apparent feedback inhibition and cross - regulatory \n functions .",
"the most famous inflammatory marker of severe malaria is tnf- , which is \n closely associated with fever , paroxysms , anaemia , ce- rebral malaria and many other \n systemic infection symptoms ( karunaweera et al . \n",
"2005 ) . in our study , \n the cytokine and chemokine profiles in acute p. vivax and p.",
"il-10 appears to be involved during the acute phase of the disease and its \n decrease correlates with recovery as biological and clinical malaria features disappear . \n"
]
] | haematological and cytokine alterations in malaria are a broad and controversial
subject in the literature . however , few studies have simultaneously evaluated various
cytokines in a single patient group during the acute and convalescent phases of
infection . the aim of this study was to sequentially characterise alterations in
haematological patters and circulating plasma cytokine and chemokine levels in
patients infected with plasmodium vivax or plasmodium falciparum from a brazilian
endemic area during the acute and convalescent phases of infection . during the acute
phase , thrombocytopaenia , eosinopaenia , lymphopaenia and an increased number of band
cells were observed in the majority of the patients . during the convalescent phase ,
the haematologic parameters returned to normal . during the acute phase , p. vivax and
p. falciparum patients had significantly higher interleukin ( il)-6 , il-8 , il-17 ,
interferon- , tumour necrosis factor ( tnf)- , macrophage inflammatory protein-1 and
granulocyte - colony stimulating factor levels than controls and maintained high levels
during the convalescent phase . il-10 was detected at high concentrations during the
acute phase , but returned to normal levels during the convalescent phase . plasma
il-10 concentration was positively correlated with parasitaemia in p. vivax and p.
falciparum - infected patients . the same was true for the tnf- concentration in p.
falciparum - infected patients . finally , the haematological and cytokine profiles were
similar between uncomplicated p. falciparum and p. vivax infections . |
[
[
"1b ) , the findings revealed both column fracture of acetabulum without hip dislocation , but no presence of femoral head fracture or onfh .",
"on was diagnosed only when the radiographic findings provided a clear differentiation from wear of the femoral head2 ) . the joint pain increased due to the onfh",
", we performed a total hip replacement ( fig . 3b ) 12 months after the index surgery .",
"a 61-year male presented to the emergency department with a history of road traffic accident .",
"the patient 's 4-month postoperative x - ray revealed a radiolucent lesion in the superolateral part of femoral head , crescent sign , and sclerosis ."
],
[
"trauma is one of the most common causes of on , interruption of the blood supply to the affected segment of the bone being the cause of ischemia . in this case",
"late complications of acetabulum fractures include heterotopic ossification and onfh , which are present in less than 10% of the population3 ) .",
"the incidence of onfh is known to be high in transverse and posterior wall fractures associated with posterior dislocation6 ) . on",
"onfh is caused by inadequate blood supply to the affected segment of the subchondral bone .",
"the flow to the femoral head is potentially compromised10 ) so as to act in an accumulative stress theory , as suggested by kenzora and glimcher9 ) ."
]
] | osteonecrosis in isolated fractures of the acetabulum without dislocation of hip seems to be a known complication , but to our knowledge it has not been reported adequately . the causative nature of post - traumatic femoral head osteonecrosis has not been studied critically . the pathophysiology of osteonecrosis in this case also eludes us . striking evidence points towards the intra - operative blood loss and low mean arterial pressure possibly leading to hypo - perfusion of femoral head leading to osteonecrosis . fractures of the acetabulum pose a difficult problem for the patient and the surgeon because of possible complications . thus any surgeon involved in surgery for fractures of the acetabulum should be aware of the possibility of this potential complication . here is a 61-year male , who sustained a complex fracture of the acetabulum without hip dislocation , subsequently was treated surgically with internal fixation using an anterior approach , 10 months after surgery patient developed osteonecrosis of the femoral head . |
[
[
"herein , we report a case of iatrogenic tension pneumopericardium , which exhibit impending cardiac arrest .",
"pericardiocentesis is an invasive procedure which is usually performed in a patient who has pericardial effusion to resolve the pressure in the pericardial sac . in 1653 , riolanus ( 1 ) first described as a trephination of the sternum to relieve fluid surrounding the heart . due to frequent complications this procedure was out of interest until ultrasound guided technique emerged ( 2 ) ."
],
[
"a 70-year - old male presented with severe dyspnea and general weakness on march 8 , 2013 .",
"he was referred from a local hospital for pericardiocentesis and further work - up due to a large pericardial effusion .",
"the patient was transferred to a computerized tomography ( ct ) room for a chest ct to examine the cause of his pericardial effusion . before he left",
"the patient was admitted to the intensive care unit and subsequently transferred to a long - term care hospital . a contrast - enhanced computed tomography scan of the chest . ( a ) axial view showed the air compressing the right ventricle ( arrows ) and tip of the catheter inside pericardium ( arrow head ) ."
],
[
"physicians should be aware of this serious complication of pericardiocentesis and take extra precautions in handling drainage devices because this iatrogenic complication can lead to cardiac arrest and a medical dispute .",
"iatrogenic pneumopericardium is rarely reported after pericardiocentesis , but it can lead to tension pneumopericardium , which is a life threatening condition .",
"pneumopericardium is defined as the presence of air inside the pericardial space . in 1910 , wenkebach first described the x - ray findings of pneumopericardium , and in 1967 , cimmino ( 6 ) described the diagnostic features of pneumopericardium . in a review of the literature , toledo et al ."
]
] | pneumopericardium is defined as the presence of air inside the pericardial space . usually , it is reported as a complication of blunt or penetrating chest trauma , but rare iatrogenic and spontaneous cases have been reported . pneumopericardium is relatively stable if it does not generate a tension effect on the heart . however , it may progress to tension pneumopericardium , which requires immediate pericardial aspiration . we report a case of iatrogenic pneumopericardium occurred in a 70-year - old man who presented dyspnea at emergency department . the patient underwent pericardiocentesis for cardiac tamponade due to large pericardial effusion , and iatrogenic tension pneumopericardium occurred due to misuse of the drainage device . after evacuating the pericardial air through the previously implanted catheter , the patient became stable . we report this case to increase the awareness of this fatal condition and to help increase the use of precautions against the development of this condition during emergency procedures . |
[
[
"iran has one of the highest rates of road traffic crashes mortality rates in the world ; furthermore , driving accidents , after heart maladies , is nationally regarded as the second factor behind death in iran .",
"vehicles , which are characteristics of civilization have turned into a big problem in different social and public health respects due to increasing the number of the road and city accidents and high mortality rate . the most important factor behind death of those who are between one to forty",
"vital factors involved in occurrence of incidents are man , vehicles , road and environment from which contribution of man factor has been calculated 95% , the road and environment 28% and of vehicles 8% . analyzing the road accidents in iran shows that from the four factors , man is accounted as the most important agent of accidents . among these factors , drivers errors , risky behaviors of some professionals in the roads and a large portion of the public are the biggest contributors to the incidents .",
"due to this matter that individuals must avoid risks intrinsically , and saving themselves and others lives is a religious and intellectual duty it is questionable that why risk taking and doing risky behaviors are in high levels ?",
"changing risky driving behaviors like other risky behaviors , requires a concept basis for helping to explain how the behavior occurs , how health education is conducted and how health education affects this ongoing behavior .",
"risk taking has been identified as an important contributor to occurrence of many health problems like accidents ."
],
[
"the first part includes demographic information and accident records and the second part includes risky driving behaviors and risk taking attitudes , in which respondents show every deviation in driving by likert scale from 1 ( never ) to 5 ( almost always ) .",
"the most widely method used to investigate risky driving behaviors is based on self - reports which is the best method to collect information .",
"risk taking attitudes include attitudes toward rule violation and speeding , attitude toward the careless driving of others and concern for others [ figure 1 ] .",
"risky driving behaviors include speeding , distraction while driving , aggressive driving , violation of the road laws , not using the seat belts and incautious driving .",
"hence , in the present study , data collection tool is a questionnaire that measuring risk taking by two items of risky driving behaviors and risk taking attitudes . to design the questionnaire ,",
"risk taking can be measured by a questionnaire having two items of risk taking behaviors and risk taking attitudes .",
"this cross - sectional study was carried out in the center and west of iran ( isfahan and kermanshah ) upon 540 ordinary and taxi drivers who were driving regularly from bus terminals and travel agencies to other cities . because an overwhelming majority of inter - urban drivers consists of men , therefore"
],
[
"there is a high correlation between risk taking attitudes and risky driving behaviors ( p < 0.001 , r = 0.442 ) . in table 2 , the relationship between different variables has been displayed .",
"intercorrelations ( pearson 's r ) between factors measuring risk taking ( n=540 ) the results of logistic regression test showed that both independent variables of risky driving behaviors and risk taking attitudes are important for predicting the amount of individual 's risk taking ( p < 0.001 ) . however , risky driving behaviors had the highest regression coefficient ( = 0.73 for risky driving behaviors and = 0.43 for risk taking attitude ) which shows that risky driving behaviors have an important impact upon the rate of drivers risk taking .",
"aggressive driving , violation of the road laws and distraction are predictors of high risky driving behaviors , and attitude toward rule violation and speeding are predictors of risk taking attitudes ( p < 0.001 ) . among all of these variables ,",
"the logistic regression test also shows that risky driving behaviors can be a predictor driving accidents due to individuals risk taking ( p = 0.014 ) .",
"there is a significant relationship between the rate of risk taking and educations ( p < 0.001 ) ."
],
[
"the results of the present study showed that there is a reverse relationship between the rate of drivers risk taking and age ; which means , by increasing the age , the amount of risk taking has been reduced .",
"self - reports of driving accidents can be an indicator of individual 's driving behaviors in future , also one of the major motivations of man for a driving offense is their risk taking . in the present study , which has been carried out about aiming at measuring the amount of risk taking , a questionnaire has been designed as much as possible according to the islamic culture of iran .",
"however , the questionnaire had high validity and reliability to measure the amount of risk taking in iranian drivers . in studies which have done to measure risk taking ,",
"the results show that in iran although attitude toward risk taking has been located at a low level by different ways , a desired result was not obtained from the reduction of those high risky behaviors ; in fact , high rate of accidents and traffic incidences in iran indicate this matter well ."
],
[
"attention is paid to the driver celerity more than any other factors . whereas , in countries which have more organized driving laws , compliance with laws is noticed more and training needed is provided in this respect .",
"the current study shows that more evaluation is required concerning the impact of traffic safety interventions on attitudes and behaviors of iranian drivers . to reduce the amount of risk taking , the first important factor is increasing police control , reforming the penalties and effectiveness of driving fines .",
"one of ways for effectively of driving fines is making the deadline of fines payments in a short time .",
"insurance policies need to be modified in our country . to increase the amount of the risk aversion and need to be arranged , according to the driver 's character and records .",
"another factor is culture building in a way that driving laws be institutionalized . in the driving test in iran ,"
]
] | background : world health organization findings shows that up to year 2020 the number of fatality due to driving accidents will increases up to 65% , which is 80% is in developing countries . iran has one of the highest rates of road traffic accident mortality rate in the world.materials and methods : the cross - sectional study was carried out in the center and west of iran upon 540 ordinary and taxi drivers who were driving regularly from bus terminals and the travel agencies to other cities . data collection tool is a questionnaire that measuring driving risk taking by two items of risky driving behaviors and risk taking attitudes.findings:the results of this study showed that the averages of risk driving behaviors scores were higher than the average of risk taking attitudes scores . the results of logistic regression test showed that the risky driving behaviors can be a predictor of driving accidents due to individuals risk taking ( p = 0.014 ) . among all these variables , attitude toward rule violations and speeding , aggressive driving and violation of the road laws respectively are important predictive of drivers risk taking ( p < 0.0010).discussion and conclusion : although attitude toward risk taking has been located at a low level by different ways , a desired result was not obtained from the reduction of those high risky behaviors ; in fact , high - rate of accidents and traffic incidence in iran indicates this matter well . |
[
[],
[
"she was referred to saitama hospital due to severe headache and nausea on october 2008 .",
"brain mri detected a 1.5 cm abscess mass with extensive edema in the right frontal lobe .",
"we performed intensive therapy using some antibiotics that included cefotaxime and meropenem and depressants for intracranial pressure for six weeks .",
"there was a good prognosis for the woman and her fetus without any sign of neurological abnormalities ."
],
[
"early medical intervention is required before it is too late for brain abscess in pregnancy ."
],
[
"it causes poor prognosis for both mother and fetus , regardless of the state of pregnancy . unlike non - pregnant women",
"brain abscess caused by bacterial infection has extremely low incidence , and a high mortality rate of 30% ."
],
[
"a 24-year - old woman who lived in saitama , japan had three pregnancies , two childbirths , body mass index ( bmi ) of 22.3 , and unremarkable past medical and family histories .",
"table 1 shows a list of examinations performed in search of causal factors , while the results show the isolation of methicillin - sensitive staphylococcus aureus ( mssa ) from the throat . on the other hand , she had no dental problems . because of unremarkable upper gastrointestinal endoscopy findings and a negative fecal occult blood test result , the possibility of brain metastasis of a malignant tumor was ruled out .",
"she also had an uneventful first trimester , but developed a fever of > 39c at 22nd week , 1st day of pregnancy ."
],
[
"despite the extremely low incidence , brain abscess caused by bacterial infection has a high mortality rate of 30% and is therefore a disease with poor prognosis for both mother and fetus , regardless of the state of pregnancy .",
"it seems that the pregnant woman whose immunity was diminished is vulnerable to mssa , which was extremely rare and considered as a serious case . \n ",
"furthermore , the early administration of antiepileptic drugs is recommended because 70% of patients with a brain abscess develop epilepsy ( 13 ) .",
"brain abacess in pregnancy ( literature review ) the symptoms of brain abscess include headache , nausea , and localized neurological abnormalities ( 9 ) ."
],
[
"even infection by vulnerable bacteria becomes serious and early treatment intervention is desirable because immunity power diminishes during the pregnancy ."
],
[
"our treatment obtained ethics approval from the regional ethics committee responsible for human experimentation and conformed to the provisions of the declaration of helsinki ."
]
] | introductionbrain abscess in pregnancy is very rare , which mostly progresses to neurological abnormalities.case presentationthe patient is a 24-year - old pregnant woman . she was referred to saitama hospital due to severe headache and nausea on october 2008 . brain mri detected a 1.5 cm abscess mass with extensive edema in the right frontal lobe . we performed intensive therapy using some antibiotics that included cefotaxime and meropenem and depressants for intracranial pressure for six weeks . there was a good prognosis for the woman and her fetus without any sign of neurological abnormalities.conclusionearly medical intervention is required before it is too late for brain abscess in pregnancy . |
[
[
"caustic esophageal injury in infants is a devastating insult to the gastrointestinal tract and will often require major reconstructive surgery to replace the damaged esophagus . esophageal replacement with colonic",
"we report a case of cologastric stricture treated with resection and reconstruction of the anastomosis solely through an abdominal approach , which can offer less morbidity and mortality .",
"endoscopic dilation is relatively safe and effective for the initial treatment of anastomotic strictures , but surgical management is indicated in refractory cases . when surgery is required , graft revision utilizing both a thoracotomy and laparotomy is common .",
"interposition has been utilized since dale and sherman performed the first retrosternal colonic interposition in 1955 . up to 80% of patients with colonic interposition"
],
[
"the patient underwent resection of the cologastric anastomosis and the gastrojejunal anastomosis with ulcerated stomach , neo - cologastric anastomosis and neo - gastrojejunal anastomosis via a transabdominal approach without a thoracotomy .",
"he required emergent esophagectomy , proximal gastrectomy and reconstruction with a colonic interposition graft from the cervical esophagus to the stomach .",
"a 31-year - old male developed a caustic esophageal injury after ingestion of an alkaline solution when he was 2 years old .",
"the patient also had a pyloric stricture , for which a gastrojejunostomy was performed . over the next three decades , he required frequent hospital admissions for abdominal pain and dysphagia , and had multiple endoscopic dilations performed for a severe cologastric anastomotic stricture ( fig .",
"intraoperative endoscopy was utilized during the case to ensure that the cologastric anastomotic stricture was entirely resected . \n"
],
[
"severe esophageal damage may require resection with creation of a neo - esophagus . because these operations occur in children , complications in regards to the colonic interposition graft",
"classically , a transthoracic approach has been used to resect the entire colonic graft . in this situation",
"our patient had previously been refused surgery by multiple surgeons . if this relatively less complex surgical management was used , perhaps he would have had definitive treatment much earlier .",
"given our patient 's preoperative nutritional status , he would be at a predisposed risk for wound healing complications . via transabdominal approach ,",
"our patient did well with our transabdominal approach given the chronicity of his symptoms . in light of his clinical dilemma of continued non - operative versus operative intervention , his symptoms were relieved immediately .",
"to the best of our knowledge , this is the first written report of using a completely transabdominal approach for revision of the colonic graft ."
]
] | a 31-year - old gentleman who had undergone an emergent esophagectomy and reconstruction with a colon interposition graft , presented with a long - standing cologastric stricture . he had undergone multiple attempts at endoscopic dilation over multiple decades with little symptomatic relief . he underwent a resection and reconstruction of the anastomosis entirely through an abdominal approach . he did well from surgery and experienced complete symptomatic relief immediately . complications of colon interposition grafts can occasionally be treated using an abdominal incision only . |
[
[
"therefore , we aimed to evaluate , for the first time , the rdw levels combined with mpv levels in patients with pd .",
"panic disorder ( pd ) is characterized by unexpected recurrent panic attacks that lead to distressing thoughts about future episodes , physical harm , and maladaptive preventive behaviors.1 the main characteristic , lack of objective triggers or clues , is helpful to distinguish pd from panic attacks that occur in the context of other psychiatric disorders .",
"platelets offer an interesting vantage point for understanding the neurophysiology of various psychiatric disorders.9 the mean platelet volume ( mpv ) , which is the measure of the platelet size , is the main determinant of the platelet function.10 although previous studies have investigated the role of mpv levels in pd , many have shown limited and controversial findings . on the other hand , to the best of our knowledge ,",
"increased rdw levels are often caused by impaired erythropoiesis or erythrocyte degradation.3 recent studies have suggested a relationship between increased rdw levels and certain diseases , such as cardiovascular disease ( cvd).4 moreover , there is a growing amount of evidence showing that inflammation has a key role in the pathogenesis .",
"the rdw is commonly used to distinguish iron deficiency - induced microcytic anemia and thalassemia , or hemoglobinopathies - related anemia ."
],
[
"this retrospective study included a total of 30 treatment - nave patients who were diagnosed with pd ( study group ) and 25 age- and sex - matched healthy volunteers ( control group ) between 18 and 59 years of age in the emergency medicine department of harran university .",
"none of the control subjects were on any medication or antioxidant vitamin supplementation , such as vitamins e and c. they were all free of acute or chronic diseases .",
"the control group consisted of a total of 25 healthy asymptomatic subjects with a nonspecific medical history and normal physical examination findings .",
"the white blood cell count ( wbc ) , mpv , and rdw levels were measured in both groups using the same devices and kits .",
"the patients with pd were diagnosed by a psychiatrist , according to the diagnostic and statistical manual of mental disorders , fifth edition criteria .",
"patients with hypertension , iron deficiency anemia , liver disease , coronary artery or heart valve disease , neurological deficits , pulmonary diseases , endocrine disorders , and urinary tract infections were excluded .",
"abbott cell - dynruby cell - dyn 3200 system device ( abbott laboratories , santa clara , ca , usa ) was used for the analysis of complete blood count ."
],
[
"this retrospective study included a total of 30 treatment - nave patients who were diagnosed with pd ( study group ) and 25 age- and sex - matched healthy volunteers ( control group ) between 18 and 59 years of age in the emergency medicine department of harran university .",
"none of the control subjects were on any medication or antioxidant vitamin supplementation , such as vitamins e and c. they were all free of acute or chronic diseases .",
"the control group consisted of a total of 25 healthy asymptomatic subjects with a nonspecific medical history and normal physical examination findings .",
"the white blood cell count ( wbc ) , mpv , and rdw levels were measured in both groups using the same devices and kits .",
"the patients with pd were diagnosed by a psychiatrist , according to the diagnostic and statistical manual of mental disorders , fifth edition criteria .",
"patients with hypertension , iron deficiency anemia , liver disease , coronary artery or heart valve disease , neurological deficits , pulmonary diseases , endocrine disorders , and urinary tract infections were excluded .",
"abbott cell - dynruby cell - dyn 3200 system device ( abbott laboratories , santa clara , ca , usa ) was used for the analysis of complete blood count ."
],
[],
[
"the wbc , mpv , and rdw levels were significantly higher in the patients with pd , compared to healthy controls ( p=0.001 , p=0.001 , and p=0.003 , respectively ) .",
"the mean wbc , mpv , and rdw levels were 9,173.032,400.31/mm , 8.191.13 fl , and 12.471.14% , respectively , in the study group .",
"there were no statistically significant differences in the age and sex between the two groups ( p>0.05 ) .",
"these values were found to be 7,090.241,032.61 , 6.850.67 , and 11.630.85 , respectively , in the healthy controls .",
"there was no significant difference in the platelet number between the study and control groups ( p>0.05 ) ."
],
[
"this study is the first to demonstrate that patients with pd have significantly higher rdw levels , compared to the healthy controls . in addition , wbc , mpv , and rdw levels were significantly higher in the patient group , compared to the control group .",
"our study findings show that the mpv and rdw levels can be used in pd .",
"we recommend these simple and relatively inexpensive methods for the initial examination and prognosis of the disease in these patients .",
"therefore , we conclude that an abnormal 5-ht metabolism in platelets may indicate the abnormal function of platelets and increased mpv levels ."
],
[
"in conclusion , this study is the first to demonstrate that the rdw levels combined with mpv levels significantly increase in patients with pd . we think that the increase in rdw and mpv levels can be attributed to the increase in sympathetic activity .",
"we believe that increase in rdw and mpv levels can be used as a novel marker for pd . however , further prospective clinical studies are required to confirm these findings ."
]
] | backgroundas the relationship between psychological stress and platelet activation has been widely studied in recent years , activated platelets lead to certain biochemical changes , which occur in the brain in patients with mental disorders . however , data relating to the mean platelet volume ( mpv ) in patients with panic disorder ( pd ) are both limited and controversial . herein , we aimed to evaluate , for the first time , the red cell distribution width ( rdw ) levels combined with mpv levels in patients with pd.patients and methodsbetween january 2012 and june 2015 , data of 30 treatment - nave patients ( 16 females , 14 males ; mean age : 3710 years ; range : 1859 years ) who were diagnosed with pd and 25 age- and sex - matched healthy volunteers ( 10 females , 15 males ; mean age : 3613 years ; range : 1859 years ) ( control group ) were retrospectively analyzed . the white blood cell count ( wbc ) , mpv , and rdw levels were measured in both groups.resultsthe mean wbc , mpv , and rdw levels were 9,173.032,400.31/mm3 , 8.191.13 fl , and 12.471.14% , respectively , in the pd group . these values were found to be 7,090.241,032.61 , 6.850.67 , and 11.630.85 , respectively , in the healthy controls . the wbc , mpv , and rdw levels were significantly higher in the patients with pd compared to the healthy controls ( p=0.001 , p=0.001 , and p=0.003 , respectively ) . however , there was no significant difference in the platelet number between the patients with pd and healthy controls ( p>0.05).conclusionour study results are the first to demonstrate that the rdw levels combined with mpv levels significantly increase among patients with pd . we believe that increased rdw and mpv levels can be used as a novel marker for pd . |
[
[
"\n peritoneal dialysis ( pd ) is a form of home - based renal replacement therapy for patients with end - stage kidney disease ( eskd ) that uses a patient 's peritoneum as a dialysis membrane across which water and solutes ( e.g. , electrolytes and glucose ) are exchanged between dialysis fluid and blood .",
"the outcome of pd patients remains poor and cardiovascular events ( cve ) continue to be the leading cause of death in pd patients .",
"an association between a decline in rrf in patients with ckd and progressively increased level of systemic inflammatory burden which is most marked in those receiving renal replacement therapy , such as haemodialysis , has been well established [ 11 , 12 ] . at present , there is no clear evidence to suggest any significant difference in the systemic inflammatory burden based on the type of dialysis modality received ( i.e. , haemodialysis versus peritoneal dialysis ) .",
"higher cve burden in chronic kidney disease ( ckd ) patients compared to those without ckd is astounding ( proportion of patients without cve 38.7% versus 61.7% ) . moreover",
"an increase in the delivery of dialysis dose has not translated into a mortality benefit in pd patients .",
"in contrast to the general population , advances in medical therapy for patients with cve ( e.g. , aspirin , lipid - lowering agents ) have not decreased the cve - related burden in patients with eskd ."
],
[
"its induction in hepatocytes in turn is regulated by cytokines such as interleukin-6 ( il-6 ) , which is a pleiotropic immunomodulatory cytokine that plays a critical role in many innate and acquired inflammatory processes .",
"dysregulation of il-6 signalling has been implicated in a variety of chronic disease pathologies and in immune and inflammatory diseases . however , the activities of these proinflammatory cytokines depend on the involved cell types and its microenvironment . for example , after an acute injury , tumor necrosis factor - like weak inducer of apoptosis ( tweak ) promotes tissue regeneration by stimulating progenitor cells but in chronic diseases where tweak is persistently activated it alters tissue repair by inhibiting differentiation of the same progenitor cells [ 22 , 23 ] .",
"the inflammatory pathways are clearly complex and dependent on many conditions ( e.g. , acute versus chronic , microenvironment ) and therefore are often difficult to clearly characterise .",
"inflammation can be defined as a localised protective response elicited by injury or destruction of tissues that serves to destroy , dilute , or sequester both the injurious agent and injured tissue .",
"crp levels can rise rapidly and markedly in response to acute inflammatory stimulus from increased synthesis by hepatocytes to contribute to host defense and innate immune response .",
"however , if inflammation becomes prolonged and persistent in the form of the so called chronic acute - phase reaction , it may lead to adverse consequences , such as decline in appetite , increased rate of protein depletion in skeletal muscle , hypercatabolism , endothelial damage , and atherosclerosis [ 1419 ] ( figure 1 ) .",
"there are several markers that can be measured to gauge the level of inflammatory burden , such as c - reactive protein ( crp ) ."
],
[
"as recently reported by the global fluid study , these two represent distinct underlying processes that likely require different preventative or therapeutic approaches .",
"in pd patients , inflammation can be broadly compartmentalised into two types , systemic and local intraperitoneal inflammation .",
"the reported prevalence of systemic inflammation measured using crp ranges between 12% and 65% in pd patients , depending on the cut - off value used to define the level of inflammation [ 25 , 26 ] .",
"a number of longitudinal studies have also been reported increasing burden of inflammation measured using interleukin-6 ( il-6 ) with longer time on pd at both systemic and intraperitoneal levels [ 2729 ] .",
"interest in inflammatory markers as targets of therapeutic intervention has been considerable as they are recognised as predictors of poor patient outcomes ( e.g. , mortality ) . however , prior to embarking on strategies to reduce inflammatory burden , it would be of paramount importance to define the underlying causes that drive the chronically inflamed state .",
"the present review aims to comprehensively describe clinical causes of inflammation in pd patients at which potential future therapeutic targets may be aimed ."
],
[
"more importantly , endotoxin is a strong proinflammatory stimulus and endotoxemia has been consistently associated with an increase in the level of systemic inflammation in ckd , hd , and pd patients . at present , it remains uncertain whether interventions , such as improvement in fluid status or the level of uraemia , can result in a decrease in endotoxemia and systemic inflammation in humans and should be studied in future .",
"a number of studies have reported an association between lowered rrf and higher systemic inflammatory burden in predialysis and dialysis patients [ 30 , 31 ] .",
"the use of biocompatible pd solutions may theoretically decrease the inflammatory burden at a systemic level by lowering the extent of peritoneal injury and gdp - mediated nephrotoxicity leading to residual renal function decline .",
"peritoneal membrane dysfunction can be clinically manifested as inadequate small solute clearance and ultrafiltration failure .",
"repeated exposures to conventional pd solutions and peritonitis episodes contribute to peritoneal injury , which in turn is an important cause of local inflammation with resultant adverse functional outcomes , such as higher peritoneal solute transport rate ( pstr ) [ 4345 ] ."
],
[
"beyond the aforementioned possible interventions for reducing inflammation in pd patients ( table 1 ) , there have only been a limited number of studies on treating the chronic inflammatory state in patients receiving pd .",
"these include the use of agents known to possess anti - inflammatory ( e.g. , statins ) or antioxidant properties ( e.g. , n - acetylcysteine ) that resulted in a decreased level of systemic inflammation burden .",
"although these outcomes are encouraging , they need to be interpreted with caution as they were relatively small sized studies ( largest study n = 76 ) from single - centres and their results have not been validated by others .",
"others have proceeded with targeted treatment in those diagnosed with clinical significant periodontitis with similar results ."
],
[
"although there are a number of potentially modifiable clinical causes of inflammation , a limited number of intervention studies to date have not been able to successfully identify effective strategies to lower inflammatory burden in this patient group .",
"future studies should focus on better defining of the pathogenic mechanisms underlying peritoneal and systemic inflammatory cascade in pd patients and evaluating the efficacy of interventions targeting these identified factors .",
"chronic inflammatory status is associated with a number of clinically significant adverse patient outcomes , including malnutrition , peritoneal membrane dysfunction , and cardiovascular events .",
"inflammation is a common complication of pd patients at both systemic and local ( i.e. , intraperitoneal ) levels ."
]
] | inflammation at both systemic and local intraperitoneal levels commonly affects peritoneal dialysis ( pd ) patients . interest in inflammatory markers as targets of therapeutic intervention has been considerable as they are recognised as predictors of poor clinical outcomes . however , prior to embarking on strategies to reduce inflammatory burden , it is of paramount importance to define the underlying processes that drive the chronic active inflammatory status . the present review aims to comprehensively describe clinical causes of inflammation in pd patients to which potential future strategies may be targeted . |
[
[
"we provided detailed information about \n the vector - borne diseases with a special focus on leishmaniasis risk , vectors and \n reservoirs in language understandable to the local bedouins communities .",
"the study sites were selected based on the distribution of cl cases in \n sinai to understand the potential role of both the sandfly and rodent in the dynamics of \n leishmania transmission ( samy \n 2009 , ministry of health of egypt , unpublished observations ) .",
"b : rodent burrows ; c : habitat of low hygiene support rodent and sandfly \n populations ; d : a sample of the outdoor habitats sampled in the study . \n \n",
"the restriction fragment length polymorphism - pcr approach \n was applied for the detection and identification of leishmania \n parasites in the rodent and sandfly isolates .",
". 1997 ) was used to estimate the \n biodiversity index for both the sandfly and rodent populations .",
"2 : sampling localities showing different habitat types . a : wire - box rodent \n traps used during the study with an individual rodent collected during the \n study ;",
"we also \n provided information for community - based control measures to help the communities to \n protect themselves against disease risk ."
],
[
"sandfly natural infection - the results of sandfly dissections revealed \n the presence of leishmania - like flagellates in 15 p. \n papatasi specimens ( 0.5% of 3,008 dissected females ) .",
"leishmania identification and characterisation - thirty - five samples \n from both the infected sandfly p. papatasi ( n = 6 ) and rodent \n reservoirs ( n = 29 ) produced viable cultures in nnn medium .",
"table iiinumber of rodents trapped in different districts of north sinai , egypt , \n from 2005 - 2011 and infection percentages with leishmania \n speciesel \n hassana n ( % )"
],
[
"this study represents a comprehensive report of seven years in north sinai and provides \n evidence for the circulation of only one species of the leishmania \n parasite .",
"due to such continuous disease dynamics in response \n to environmental changes , we plan in our future research to investigate the potential \n role of rodent populations in the circulation of the parasite in the sinai , to study in \n detail the coarse - resolution ecology and to study the biogeography of disease through \n mapping exercises and site suitability analysis using efficient quantitative \n techniques .",
"2003 ) , though the most recent study in \n sinai reported the incursion of cl caused by l. tropica in a remote \n border area of north sinai on the egyptian - palestinian border .",
"therefore , we carried out our study to reveal insight into the \n ecological system for cl transmission with regard to sandflies and rodents by examining \n of several criteria used by the who to implicate either the vector(s ) or \n reservoir(s ) .",
"there are several criteria adopted by the world health organization ( who ) to implicate \n p. papatasi as the potential vector for circulation of leishmaniasis \n in sinai , including anthropophilic behaviour , the ability to feed on the reservoir \n host(s ) , the presence of natural infections , the ability to support the growth of the \n parasite and the ability to transmit the parasite by bites ( who 2010 ) ."
]
] | cutaneous leishmaniasis ( cl ) is a neglected clinical form of public health importance
that is quite prevalent in the northern and eastern parts of egypt . a comprehensive
study over seven years ( january 2005-december 2011 ) was conducted to track cl
transmission with respect to both sandfly vectors and animal reservoirs . the study
identified six sandfly species collected from different districts in north sinai :
phlebotomus papatasi , phlebotomus kazeruni ,
phlebotomus sergenti , phlebotomus alexandri ,
sergentomyia antennata and sergentomyia clydei . leishmania ( -)-like flagellates were identified in 15 p.
papatasi individuals ( 0.5% of 3,008 dissected females ) . rodent
populations were sampled in the same districts where sandflies were collected and
eight species were identified : rattus norvegicus ( n = 39 ) ,
rattus rattus frugivorous ( n = 13 ) , rattus rattus
alexandrinus ( n = 4 ) , gerbillus pyramidum floweri ( n =
38 ) , gerbillus andersoni ( n = 28 ) , mus musculus ( n
= 5 ) , meriones sacramenti ( n = 22 ) and meriones
crassus ( n = 10 ) . thirty - two rodents were found to be positive for
leishmania infection ( 20.12% of 159 examined rodents ) . only
leishmania major was isolated and identified in 100% of the
parasite samples . the diversity of both the vector and rodent populations was
examined using diversity indices and clustering approaches . |
[
[
"presenting symptoms of ssa can vary , with chest and shoulder pain being the most common clinical features .",
"sternoclavicular joint septic arthritis ( ssa ) and its clinical presentation are infrequently seen and often difficult to manage .",
"after thorough literature search , no cases have yet been reported on ssa leading to vocal cord palsy .",
"vocal cord palsy is an important sign of thoracic and head and neck pathology that is caused by an extremely wide set of pathology ."
],
[
"a 67-year - old gentleman presented to the emergency department with a 3-week history of worsening dysphagia and hoarse voice .",
"the key finding was that of a left sternoclavicular joint collection and closely associated superficial anterior chest wall , soft tissue swelling and oedema ( fig . 2 ) .",
"examination by the otolaryngology team demonstrated no evidence of cervical lymphadenopathy but tenderness of the lower left anterior triangle , as well as evident swelling , erythema and mild bruising of the anterior chest wall . on questioning the patient regarding this , he revealed that he burnt his chest using a hot water bottle 3 weeks previously and he also admitted to having stiffness and pain in the left shoulder over this same period .",
"indirect laryngoscopy with flexible nasendoscopy revealed non - discrete swelling / oedema of the left pharayngeal wall and reduced mobility of the left vocal cord .",
"findings : left sternoclavicular joint collection and closely associated superficial anterior chest wall , soft tissue swelling and oedema ."
],
[
"vocal cord palsy can be due to weakness in one or both vocal cords , and diagnosis is made when reduced mobility is evident by laryngoscope examination . in a review of 117 cases ,",
"reports of fibrosing mediastinitis and descending necrotizing mediastinitis leading to vocal cord palsy have been documented .",
"the mild reactive mediastinal inflammation seen in the presented case has not been presented in the literature as a cause of vocal cord palsy .",
"it is clear from the haematological and radiological findings , as well as the response to treatment , that all the presenting features of this patient were as a result of the septic focus in the sternoclavicular joint .",
"significant contributing factors to these outcomes are the methicillin - resistant staphylococcus aureus ( mrsa ) strains , which are becoming increasingly prevalent .",
"a literature review of 180 cases shows mediastinitis as a clinical feature in up to 13% of patients with ssa ."
],
[]
] | sternoclavicular joint septic arthritis ( ssa ) is rare and often difficult to manage condition . the sternoclavicular joint is an unusual site of septic arthritis in healthy persons , but may be commonly involved in intravenous drug users , primary or secondary immunosuppressive disorders , infections or the presence of infected central lines . after thorough literature search , no cases have yet been reported on ssa leading to vocal cord palsy . the following case describes a male patient who presented to hospital with left vocal cord palsy and symptoms consistent with aero - digestive tract malignancy . radiological examination and subsequent response to treatment demonstrated the only causative pathology to be an ipsilateral septic sternoclavicular joint . |
[
[
"we have tried two options for the formation of nr arrays . in the first ,",
"the desired nucleation pattern was drawn in a polymethyl - methacrylate ( pmma ) layer , which was subsequently removed resulting in an all - zno structure . in the second route ,",
"the nucleation pattern was realized in a hard metal coating ; therefore , the fabricated nrs were electrically contacted at the anchoring surface .",
"solid ( vls ) method the metal catalyst droplet on the top of the nw can hinder the formation of the required schottky contact at the top electrode / nw interface . here , we demonstrate alternative fabrication routes which fulfill all the above crucial requirements by providing highly uniform , crystallographically oriented nrs in the 100-nm diameter range , in predefined , dense patterns .",
"our method benefits of the catalyst free , low temperature epitaxial growth , and the direct writing nanolithography ."
],
[
"the process flow for the fabrication of all - zno nr arrays is shown in fig .",
"the electrical characterization of the individual nws was carried out in air by conductive afm technique by means of a sii nanotechnology inc . ,",
"however , here the surface treatment process of zno substrate was followed by the deposition of a 30-nm - thick , high - quality ru layer by using ion - beam sputtering ( fig .",
"processing steps for the anchored zno array are : ru thin film deposition ( e ) , e - beam lithography ( f ) , arion milling ( g ) , and chemical nanorod growth after pmma removal ( h ) nanorods grown through a hard metal mask obtained by ar - ion milling are anchored in the single crystal substrate in the recessed dips etched during metal milling . thereby the fabrication of arrays of electrically contacted nrs",
"the processing steps for all - zno structure are : surface treatment of zno substrates ( a ) , pattern generation in pmma by e - beam lithography ( b ) , chemical nanowire growth ( c ) , and pmma removal ( d ) ."
],
[
"the processing steps for all - zno structure are : surface treatment of zno substrates ( a ) , pattern generation in pmma by e - beam lithography ( b ) , chemical nanowire growth ( c ) , and pmma removal ( d ) .",
"processing steps for the anchored zno array are : ru thin film deposition ( e ) , e - beam lithography ( f ) , arion milling ( g ) , and chemical nanorod growth after pmma removal ( h )",
"the process flow for the fabrication of all - zno nr arrays is shown in fig .",
"schematic process flow of all - zno ( a d ) and anchored ( e h ) nanorod arrays .",
"this step also helps to lift - off the parasitic zno debris formed in the solution volume ( fig .",
"the 250-nm - thick pmma resist layer was exposed by e - beam lithography in an elionix els-7500ex instrument ( fig ."
],
[
"however , here the surface treatment process of zno substrate was followed by the deposition of a 30-nm - thick , high - quality ru layer by using ion - beam sputtering ( fig .",
"nanorods grown through a hard metal mask obtained by ar - ion milling are anchored in the single crystal substrate in the recessed dips etched during metal milling .",
"thereby the fabrication of arrays of electrically contacted nrs is achieved . the process shown in fig .",
"the same chemical growth method was used as for the all - zno arrays ( fig .",
"the preparation condition details for both all - zno and anchored arrays are summarized in table 1 .",
"1f ) and was transferred into the hard metal film by ar ion milling ( fig ."
],
[
"the electrical characterization of the individual nws was carried out in air by conductive afm technique by means of a sii nanotechnology inc . ,",
"the obtained nanostructures were visualized by a hitachi s4800 field emission scanning electron microscope ( fesem ) .",
"the spring constant and resonant frequency of the used au - coated cantilever is 1.4 n / m and 26 khz , respectively .",
"transmission electron microscope ( tem ) images were obtained by a 200 kv jeol jem-2010 instrument ."
],
[
"the successful formation of a rectifying schottky contact between zno nr and the measuring tip could reproducibly be obtained .",
"increased contact force is required , which can be ascribed to the condensate formation on the nanorods ( inset ) in order to correctly describe the electrical behavior by an equivalent circuit and to separate the contributions of contact resistance , internal resistance of the nr , surface conductance , and piezoelectricity induced schottky barrier height change , a refinement of the measurement technique and further systematic investigation is required . still , in our work",
"fesem image of the cross section of anchored - type zno nanorods with indication of the size - distribution ( a ) , the parasitic ring remaining after removal of the pmma mask ( b ) , and from the ar - ion milled structure shown in the sketch in cross section ( c ) the tem observations revealed that both all - zno and anchored , contacted nrs are wurtzite type single crystals of high quality ( fig .",
"we believe that further down - scaling is limited mainly by the resolution of our e - beam lithography facility rather than by growth kinetics . in fig .",
"voltage characteristic recorded on an individual nanorod by conductive afm . in order to obtain reproducible results in air",
"3c ) . perspective view ( a ) and top view ( b ) fesem images on bottom contacted , anchored zno nanorods prepared by hard - mask method ."
],
[
"we have demonstrated that by using homoepitaxial chemical growth method highly uniform , single crystalline nr arrays arranged in a predefined pattern can be prepared . by changing the growth parameters , diameter and length of the nrs",
"we exploited two alternative synthesis routes using soft and hard under - layer to obtain all - zno and metal contacted , anchored nr arrays , respectively .",
"the arrays show excellent uniformity in length and the dense pattern ( ~30 nr/m ) can be adjusted to the top vibrating electrode of the nanogenerator .",
"the former one can be a promising candidate for nanopillar - based photonic crystals , especially if a refractive index contrast between the nr and the zno substrate is realized .",
"can be tuned in the range of 90170 nm and 500 nm2.3 m , respectively .",
"the monodispersity of the diameter of single crystalline nrs can be < 2% by maintaining an excellent uniformity in the longitudinal dimension .",
"on the other hand , anchored nr arrays contacted on the bottom are promising structures for nanopiezotronics ."
],
[
"this work was supported by the nanotechnology network project of the ministry of education , culture , sports , science and technology ( mext ) in japan , and by the hungarian fundamental research found ( otka ) under contract pd 77578 ."
]
] | highly uniform and c - axis - aligned zno nanorod arrays were fabricated in predefined patterns by a low temperature homoepitaxial aqueous chemical method . the nucleation seed patterns were realized in polymer and in metal thin films , resulting in , all - zno and bottom - contacted structures , respectively . both of them show excellent geometrical uniformity : the cross - sectional uniformity according to the scanning electron micrographs across the array is lower than 2% . the diameter of the hexagonal prism - shaped nanorods can be set in the range of 90170 nm while their typical length achievable is 0.52.3 m . the effect of the surface polarity was also examined , however , no significant difference was found between the arrays grown on zn - terminated and on o - terminated face of the zno single crystal . the transmission electron microscopy observation revealed the single crystalline nature of the nanorods . the current voltage characteristics taken on an individual nanorod contacted by a au - coated atomic force microscope tip reflected schottky - type behavior . the geometrical uniformity , the designable pattern , and the electrical properties make the presented nanorod arrays ideal candidates to be used in zno - based dc nanogenerator and in next - generation integrated piezoelectric nano - electromechanical systems ( nems ) . |
[
[
"this paper will discuss the general issue of data in critical care with a focus on the big data phenomenon that is sweeping healthcare . with the vast amount of digital medical information that has accumulated in emrs , the challenge is the transformation of the copious data into usable and useful medical knowledge .",
"we are experiencing a rapidly expanding collection of vast amounts of clinical data from routine practice and ambulatory monitoring .",
"while the wetware of the human mind is a wonderful instrument for this purpose , we must design better data systems to support and improve those components of this data integration process that exceed human abilities .",
"clinical data have been notorious for their variable interoperability and quality , but a holistic use of the massive data sources available ( vital signs , clinical notes , laboratory results , treatments including medications and procedures ) can lead to new perspectives on challenging problems .",
"clinicians must already make sense of a diverse variety of data input streams in order to make clinical decisions ."
],
[
"but the value of many treatments and interventions in the icu is unproven , with many standard treatments being ineffective , minimally effective , questionably effective , or even harmful to the patient . in a setting where the effects of every intervention are subject to patient and clinical context - specific factors , the ability to use data for decision support becomes very attractive and closer to essential as increasing complexity transcends typical cognitive capabilities .",
"the increasing need for intensive care has spiked the ratio of icu beds to hospital beds as the icu plays an expanding role in acute hospital care .",
"an example of collected data being used to infer high - level information is the icu scoring systems in use today .",
"decisions in the intensive care unit ( icu ) are frequently made in the setting of a high degree of uncertainty , and clinical staff may have only minutes or even seconds to make those decisions .",
"icu physicians have embraced the value of collecting and storing electronic clinical records , and this has led to partnerships between industrial and academic entities .",
"in contrast to these commercial databases , the multiparameter intelligent monitoring in intensive care ( mimic ) database is open and publicly accessible ( figure 2 ) . over the past decade , the mimic database"
],
[
"medicine is ultimately based on knowledge , and each of the many ways to establish knowledge has certain advantages and pitfalls . here , we focus on the randomized controlled trial ( rct ) , observational studies and what we have termed dynamic clinical data mining ( dcdm ) ( figure 3).figure 3 \n dynamic clinical data mining .",
"clinical care optimization : a big data model for efficient targeting of tests and treatments and vigilance for adverse events ( figure courtesy of kai - ou tang and edward moseley , from with permission ) . \n ",
"rcts are the gold - standard for clinical knowledge discovery . but 65 years after the first rct was published , only 1020% of medical decisions are based on rct - supported evidence . when examining the validity of a variety of medical interventions , about half of systematic reviews report insufficient evidence to support the intervention in question ."
],
[
"computer science , public health , informatics , biomedical research , health technology , statistics and epidemiology gathered and discussed the pitfalls and challenges of big data in healthcare .",
"the associated critical data conference addressed growing concerns that big data will only augment the problem of unreliable research . thought leaders from academia , government and industry across disciplines including clinical medicine ,",
"this event fostered collaboration between clinicians and data scientists that will support ongoing research in the icu setting .",
"this amalgamation of individual knowledge should allow each clinician to address gaps in their knowledge , with the confidence that their decisions are supported by evidence in clinical practice . in january 2014 , the inaugural critical data marathon and conference was held at the massachusetts institute of technology . in the data marathon ,"
],
[
"the warning parable told to illustrate this is google s flu trends . in 2008 , google launched its flu trends , which used the search terms typed into google to track the progression of influenza epidemics over time .",
"in a recent analysis of data - driven healthcare by the mit technology review , the authors noted that medicine has entered its data age . driven by the promise of an estimated $ 300 to $ 450 billion a year , companies of all sizes are beginning to fight in earnest to capture and tame the data explosion .",
"key innovations fall into three major areas : more and more data , especially resulting from mobile monitoring ; better analytics using new machine learning and other techniques ; and meaningful recommendations that focus on prediction , description , and prevention of poor health outcomes ( that are finally captured in an easily accessible format ) .",
"the way that current literature is designed , generated , and published creates sequential statistically significant discoveries from restricted datasets ."
],
[
"the benefits of the data explosion far outweigh the risks for the careful researcher . as target populations subdivide along combinations of comorbid conditions and countless genetic polymorphisms , as diagnostic and monitoring device including wearable sensors become more ubiquitous , and as therapeutic options expand beyond the evaluation of individual interventions including drugs and procedures , it is clear that the traditional approach to knowledge discovery can not scale to match the exponential growth of medical complexity . rather than taking turns hyping and disparaging big data , we need organizations and researchers to create methods and processes that address some of our most pressing concerns , e. g. , who is in charge of shared data , who ",
"owns clinical data , and how do we best combine heterogeneous and superficially non - interoperable data sources ? we need to use big data in a different way than we have traditionally used data collaboratively . by creating a culture of transparency and reproducibility"
]
] | this article is one of ten reviews selected from the annual update in intensive care and emergency medicine 2015 and co - published as a series in critical care . other articles in the series can be found online at http://ccforum.com/series/annualupdate2015 . further information about the annual update in intensive care and emergency medicine is available from http://www.springer.com/series/8901 . |
[
[
"these findings suggest that cquiobp1 is involved in the detection of multiple oviposition attractants and plays a key role in the sensitivity of the mosquito olfactory system .",
"odorant binding proteins ( obps ) were identified almost three decades ago ( vogt and riddiford 1981 ) , but their roles in insect olfaction are still a matter of considerable debate . that obps are involved in odorant reception was disputed after odorant receptors ( ors ) were demonstrated to respond to semiochemicals when expressed in heterologous systems these expression systems , however , have limitations in addressing the role(s ) of obps in olfaction . the heterologous expression system that uses drosophila empty neurons ( dobritsa et al .",
"recently , it was shown that addition of a recombinant pbp to a heterologous system that expresses a pheromone receptor from antheraea polyphemus increases both sensitivity and selectivity ( forstner et al . 2009 ) .",
"thus , ultimately the role(s ) of obps in insect olfaction must be addressed by examining insects with reduced levels ( knockdowns ) or devoid of a test obp ( knockouts ) . in drosophila ,",
"we then focused on cquiobp1 , which is highly expressed in the antennae of the southern house mosquito culex pipiens quinquefasciatus ( = cx ."
],
[
"eag responses of at least three of rnai - treated and water - injected mosquitoes were recorded .",
"data presented are from a pool of mosquitoes injected and tested in three different batches on different days . in each session ,",
"cquiobp1 expression was normalized to the expression levels of an endogenous control , the ribosomal protein that encodes gene s7 ( cquirps7 ) .",
"cquiobp1 rna interference full - length cquiobp1 dsrna was synthesized by in vitro transcription from purified pcr product that contained t7 promoter sequences in inverted orientations and purified by using rneasy minelute cleanup kit ( qiagen ) .",
"approximately 100 nl ( 350 ng ) of dsrna were injected through the intersegmental thorax membranes into 1-to-48 h - old cx .",
"non quantitative pcr was carried out from the same cdnas by using 2u gotaq dna polymerase ( promega ) in a final volume of 25 l ."
],
[
"we employed a combination of rt - pcr and real - time quantitative pcr ( qpcr ) to examine mrna levels of cquiobp1 in heads of rnai ( dsrna - injected ) and control ( water - injected , non - injected ) mosquitoes using cquirps7 as a control gene .",
"by contrast , the reduced levels of cquiobp1 transcripts affected the responses of compounds with higher thresholds , thus allowing us to conclude that cquiobp1 is indeed involved in the detection of oviposition attractants , and that high levels of obps expression are essential for the sensitivity of the insect s olfactory system .",
"these rnai experiments are the first evidence in vivo that cquiobp1 is involved in the reception of culex mosquito oviposition attractants . although it is tempting to speculate that cquiobp1 is selective because responses to nonanal were not significantly different in sham- and rnai - treated mosquitoes ( fig . "
]
] | odorant - binding proteins ( obps ) were discovered almost three decades ago , but there is still considerable debate regarding their role(s ) in insect olfaction , particularly due to our inability to knockdown obps and demonstrate their direct phenotypic effects . by using rna interference ( rnai ) , we reduced transcription of a major obp gene , cquiobp1 , in the antennae of the southern house mosquito , culex quinquefasciatus . previously , we had demonstrated that the mosquito oviposition pheromone ( mop ) binds to cquiobp1 , which is expressed in mop - sensitive sensilla . antennae of rnai - treated mosquitoes showed significantly lower electrophysiological responses to known mosquito oviposition attractants than the antennae of water - injected , control mosquitoes . while electroantennogram ( eag ) responses to mop , skatole , and indole were reduced in the knockdowns , there was no significant difference in the eag responses from rnai - treated and water - injected mosquito antennae to nonanal at all doses tested . these data suggest that cquiobp1 is involved in the reception of some oviposition attractants , and that high levels of obps expression are essential for the sensitivity of the insect s olfactory system . |
[
[
"therefore , this study aimed to compare the cost - analysis of vams versus open , laparoscopic , and robot - assisted laparoscopic radical nephrectomy ( rn ) surgery under korean medical insurance .",
"conventional open , laparoscopic , robot - assisted laparoscopic , and video - assisted minilaparotomy surgery ( vams ) have been performed as minimally invasive renal surgery .",
"minimally invasive surgery was first described by wickham in 1987 and refers to surgical techniques that are less invasive than open surgery for the same purpose .",
"however , there has been no research on the cost - effectiveness of minilaparotomy kidney surgeries such as vams .",
"many studies have compared the cost - effectiveness of laparoscopic and robot - assisted renal surgeries with that of open surgery .",
"this surgical technique was performed through minilaparotomy and patients who underwent it recovered quickly . more than 600 cases of living donor nephrectomy have been conducted successfully , and this technique is also widely used to manage renal malignancy .",
"compared the costs of open surgery and robot - assisted laparoscopic radical prostatectomy for prostate cancer ."
],
[
"twenty patients with suspected renal cell carcinoma who underwent vams , open , laparoscopic , or robot - assisted laparoscopic rn between january 2008 and december 2010 were selected .",
"the patients sampled for this study were treated between 2008 and 2010 while the insurance system applied , and the most recent 20 cases not subject to the exclusion criteria were selected .",
"routine disposable laparoscopic equipment was used . for robot - assisted laparoscopic rn , the da vinci robot ( intuitive surgical inc . ,",
"patients who met the following criteria were excluded : 1 ) those who underwent another surgery apart from rn , 2 ) those who incurred additional medical fees owing to postoperative complications , 3 ) those who underwent rn during hospitalization in another department , and 4 ) those whose final pathological finding was not renal cell carcinoma .",
"four items considered to be related to the surgery were compared from the itemized statements : procedure and operation , anesthesia , laboratory testing , and medical supply fees .",
"patient information ( age , gender , body mass index [ bmi ] , and length of hospital stay ) was retrospectively collected from medical records ."
],
[
"patient costs ( meanstandard deviation ) were 2,023,791240,757 , 2,024,246674,859 , 3,603,557870,333 , and 8,021,902330,157 korean won ( krw , the currency of south koea ) for the vams , open , laparoscopic , and robot - assisted rn groups , respectively . among them , the sum of the insured costs was 1,904,627231,957 , 1,798,127645,602 ( p=0.634 ) , 3,039,769711,792 ( p<0.01 ) , and 899,668323,508 ( p<0.01 ) krw in the vams , open , laparoscopic , and robot - assisted rn groups , respectively , whereas the sum of the uninsured costs was 119,16324,581 , 226,119215,009 , 563,788487,798 ( p<0.01 ) , and 7,122,23456,117 ( p<0.01 ) krw , respectively ( table 2 ) . in the vams group ,",
"procedure and operation fees in the open rn group , medical supply fees in the laparoscopic rn group , and procedure and operation fees in the robot - assisted laparoscopic rn group accounted for the largest percent at 33.19% ( insured cost at 33.19% ) , 60.51% ( insured cost at 45.3% and uninsured cost at 15.08% ) , and 88.24% ( insured cost at 0.98% and uninsured cost at 87.26% ) , respectively ( fig .",
"there was a significant difference in the sum of insured costs , uninsured costs , and total costs between the vams and the laparoscopic rn group ( p<0.01 ) .",
"medical supply fees accounted for the highest portion of total costs at 38.63% ( insured costs were 33.43% and uninsured costs were 5.20% ) , followed by procedure and operation fees at 29.99% ( insured costs were 29.99% ) .",
"there was a significant difference in patient age and bmi ( p<0.05 ) between the laparoscopic and the vams group .",
"1 ) . there was a significant difference between the vams and open rn groups in the laboratory test ( insured ) and surgical material fees ( insured and uninsured ; p<0.05 ) ."
],
[
"the standard method for treating small renal masses is shifting from radical to partial nephrectomy .",
"recent medical advancements , including abdominal ultrasonography , have resulted in increased discovery rates of small renal masses .",
"to fully research the cost - effectiveness of vams from different aspects , studies on other surgical techniques such as partial nephrectomy and pyeloplasty in addition to rn are necessary .",
"with patients placing importance on quality of life and decreased postoperative pain , demand for minimally invasive surgery is increasing . furthermore , along with the development of imaging and operative equipment , surgical techniques have undergone much improvement .",
"judging from the study results thus far , vams seems to be more cost - effective than laparoscopic and robot - assisted laparoscopic surgeries .",
"this increases the cost of laparoscopic and robot - assisted laparoscopic rn , making them more expensive compared with the open or vams group .",
"however , there has been no study on the cost - effectiveness of vams compared with other surgical techniques for rn . for comparison and analysis , we divided patients who were diagnosed with renal cell carcinoma and underwent rn into the open , laparoscopic , robot - assisted laparoscopic , and vams rn groups ."
],
[
"furthermore , the procedure has cost - effectiveness advantages compared with laparoscopic and robot - assisted laparoscopic rn ."
]
] | purposethis study aimed to comparatively evaluate the cost - effectiveness of four different types of radical nephrectomy ( rn ) techniques : open , laparoscopic , robot - assisted laparoscopic , and video - assisted minilaparotomy surgery ( vams).materials and methodsamong patients who were diagnosed with renal cell carcinoma and underwent rn , 20 patients were selected who received open , laparoscopic , robot - assisted laparoscopic , or vams rn between january 2008 and december 2010 . their medical fees were divided into four categories : procedure and operation , anesthesia , laboratory test , and medical supply fees . the medical costs of the patients were also divided into insured and uninsured costs.resultsthe total direct cost of vams , open , laparoscopic , and robot - assisted laparoscopic rn were 2,023,791240,757 , 2,024,246674,859 ( p=0.998 ) , 3,603,557870,333 ( p<0.01 ) , and 8,021,902330,157 ( p<0.01 ) korean won ( krw , the currency of south koea ) , respectively . the total insured cost of vams , open , laparoscopic , and robot - assisted laparoscopic rn was 1,904,627231,957 , 1,798,127645,602 ( p=0.634 ) , 3,039,769711,792 ( p<0.01 ) , and 899,668323,508 ( p<0.01 ) krw , respectively . the total uninsured cost of vams , open , laparoscopic , and robot - assisted laparoscopic rn was 119,16324,581 , 226,119215,009 , 563,788487,798 ( p<0.01 ) , and 7,122,23456,117 ( p<0.01 ) krw , respectively . medical supply fees accounted for the largest portion of the costs and amounted to 33.43% of the vams cost.conclusionsvams rn is as cost - effective as open surgery . furthermore , it is comparatively more cost - effective than laparoscopic and robot - assisted laparoscopic rn . |
[
[
"the clinical utility of most conventional chemotherapeutics is limited either by the inability to deliver therapeutic drug concentrations to the target tissues or by severe and harmful toxic effects on normal organs and tissues .",
"several techniques , such as the bangham , detergent - depletion , ether / ethanol injection , reverse phase evaporation , and emulsion methods , have been reported for preparing liposomes with high - entrapment efficiency , narrow particle size distribution , and long - term stability.17 recently , some alternative methods including dense gas and supercritical fluid techniques have been introduced for liposome preparation without using any organic solvent.1,79 due to the differences in preparation methods and lipid compositions , liposomes can be classified according to their lamellarity ( uni- and multilamellar vesicles ) , size ( small [ 100 nm ] , intermediate [ 100250 nm ] , or large [ 250 nm ] ) , and surface charge ( anionic , cationic , or neutral).1012 in clinical studies , liposomes show improved pharmacokinetics and biodistribution of therapeutic agents and thus minimize toxicity by their accumulation at the target tissue.13,14 liposomes were first discovered by bangham in 1965 and the first liposomal pharmaceutical product , doxil , ( ben venue laboratories , inc bedford , oh ) received us food and drug administration ( fda ) approval in 1995 for the treatment of chemotherapy refractory acquired immune deficiency syndrome ( aids)-related kaposi s sarcoma.1315 currently , there are about twelve liposome - based drugs approved for clinical use and more are in various stages of clinical trials ( tables 1 and 2).1362 most liposomal drug formulations , such as doxil and myocet ( gp - pharm , barcelona , spain ) , are approved for intravenous application.63 other administration routes such as intramuscular delivery have been approved for delivery of surface antigens derived from the hepatitis a or influenza virus ( epaxal [ berna biotech ltd , berne switzerland ] and inflexal v [ berna biotech espaa sa , madrid , spain]).37,38 oral delivery has also been examined ; however , this is more troublesome due to the potential for liposome breakdown following exposure to bile salts.64",
"liposomes are small , spherical , and enclosed compartments separating an aqueous medium from another by phospholipid bilayer . many hundreds of drugs , including anticancer and antimicrobial agents , chelating agents , peptide hormones , enzymes , proteins , vaccines , and genetic materials , have been incorporated into the aqueous or lipid phases of liposomes , with various sizes , compositions , and other characteristics , to provide selective delivery to the target site for in vivo application ."
],
[
"although therapeutic efficiency of liposome - based drugs may vary depending on the choice of lipids , the preparation technique , physico - chemical characteristics of the bioactive materials , and overall charge of the liposome , lyophilization is useful for the long - term storage of liposome - based drugs .",
"three commercially available lipid - based formulations of amphotericin b , amphotec and ambisome are both lyophilized products and abelcet is formulated as a suspension . therefore , lyophilization may not extend the shelf - life of products but may increase therapeutic efficacy in vivo .",
"in general , freeze - drying increases the shelf - life of liposomal formulations and preserves them in dried form as lyophilized cakes to be reconstituted with water for injection prior to administration.66 furthermore , cryoprotectants need to be added to maintain particle size distribution of liposomes after the freeze - drying - rehydration cycle . various types and concentrations of sugars have been investigated for their ability to protect liposomes against fusion and leakage during lyophilization processes.66 in commercial liposome lyophilized products , lactose has been used as a cryoprotectant in the formulations of amphotec , myocet , and visudyne , and sucrose was added in the formulations of ambisome and lep - etu to increase liposome stability during lyophilization .",
"many methods have been investigated for the stabilization of liposomes , such as lyophilization , freezing , and spraying drying . in commercial liposome - based drugs ( table 1 ) , ambisome ( gilead sciences , inc , san dimas , ca ) , amphotec ( ben venue laboratories , inc , bedford , oh ) , myocet , visudyne ( novartis pharma ag , basel , switzerland ) , and lep - etu ( liposome - entrapped paclitaxel easy - to - use"
],
[
"thermodox is currently under evaluation in clinical trials and hence the therapeutic efficacy of thermodox is still unknown .",
"liposome delivery systems offer the potential to enhance the therapeutic index of anticancer drugs , either by increasing the drug concentration in tumor cells or by decreasing the exposure in normal host tissues .",
"doxorubicin is an anthracycline widely used to treat solid and hematological tumors , but its major drawback is its related cardiotoxicity . in cardiotoxicity ,",
"both products contain doxorubicin but are different , particularly in the presence of polyethylene glycol ( peg ) coating ( figure 1 ) . in pharmacokinetic studies of doxorubicin - loaded liposomes ,"
],
[
"daunorubicin is classified as an anthracycline anticancer drug in the treatment of leukemia and a wide variety of solid tumors , but its major drawbacks are myelosuppression and cardiotoxicity.81 daunorubicin has also been incorporated into liposomes for the formulation of liposomal anticancer chemotherapy drugs .",
"daunoxome ( gilead sciences , inc ) is a commercial liposomal formulation of daunorubicin in which the drug is entrapped into small unilamellar vesicles ( 45 nm ) composed of dspc and cholesterol in 2:1 molar ratio . in animal studies with tumor models in mice",
", daunoxome increased tumor uptake of daunorubicin ten - fold when measured against free drug ( 2470.5 vs 245.1 g ",
"hr / ml for 048 hours).82 furthermore , clinical pharmacokinetic studies have demonstrated that daunoxome was 36-fold higher in auc ( 375.3 vs 10.33 g hr / ml ) in comparison with conventional daunorubicin.83 in a phase iii trial of daunox - ome versus a conventional combination of doxorubicin , bleomycin , and vincristine ( abv ) in aids - related kaposi s sarcoma , the efficacy of daunoxome was comparable to that of vincristine . response rates ( 25% vs 28% ) , time to treatment failure ( 115 vs 99 days ) , and overall survival ( 369 vs 342 days ) were similar on both treatment arms.84 moreover , patients treated with daunoxome experienced less alopecia ( 8% vs 36% ) and neuropathy ( 13% vs 41% ) and their cardiac function remained stable"
],
[
"taxol ( paclitaxel ) is a marketed product for the treatment of ovarian , breast , non - small cell lung cancer , and aids - related kaposi s sarcoma.40 however , paclitaxel is only sparingly soluble in water and , therefore , intravenous administration depends on the use of the non - ionic surfactant cremophor el ( polyethoxylated castor oil ) to achieve a clinically relevant concentrated solution .",
"unfortunately , cremophor el increases toxicity and leads to hypersensitivity reactions in certain patients.85 the lep - etu formulation of paclitaxel is being developed to potentially reduce toxicities associated with taxol by eliminating the drug formulation component polyoxyethylated castor oil .",
"the major toxicity to administration of paclitaxel is neuropathy . in the phase i study ,",
"further clinical studies are warranted to demonstrate a statistically significant survival benefit associated with endotag-1 plus gemcitabine in advanced pancreatic cancer ."
],
[
"in essence , virosomal techniques may not be able to give superior protective immunity in clinic but play an important role in preventing morbidity and lethality associated with vaccine .",
"hepatitis a virus ( hav ) vaccine epaxal , and influenza vaccine inflexal v are highly efficacious by mimicking natural viral infection . the use of virosomes to deliver hepatitis a or influenza antigens stimulates a strong immune response of immunocompetent cells .",
"in contrast to other commercially available hav vaccines , epaxal is an aluminium - free vaccine based on formalin - inactivated hepatitis a ( strain rg - sb ) antigen - incorporated virosomes . in a clinical study by usonis et al ,",
"epaxal and inflexal v are both vaccine products using the virosome - based antigen delivery system for commercial use ( table 1 ) . for the production of inflexal",
"the incorporation of viral membrane proteins or peptide antigens into liposomes has been shown to potentiate cell - mediated and humoral immune response , and generate solid and durable immunity against the pathogen ."
],
[
"verteporfin is a hydrophobic chlorin - like photosensitizer , which has been shown to be highly effective for photodynamic therapy in vivo .",
"however , verteporfin also has a tendency to undergo self - aggregation in aqueous media , which can severely limit drug bioavailability to biological systems .",
"it is important to introduce verteporfin into the bloodstream in its monomeric form and hence verteporfin was encapsulated in liposomes ( visudyne ) for intravenous drug delivery.2931 the lipid layers of visudyne are composed of unsaturated egg phosphatidylglycerol and dimyristoyl phosphatidyl choline in 3:5 molar ratio .",
"however , chowdhary et al reported that visudyne was readily destabilized in the presence of relatively low concentrations of plasma.29 therefore , the aim of future investigation of liposomal formulations in ophthalmology is to develop stable liposome structures for extending the plasma circulation time following intravenous injection .",
"visudyne was the only drug approved by the fda for the photodynamic treatment of age - related macular degeneration ."
],
[
"since the first liposomal pharmaceutical product , doxil , received fda approval in 1995 , liposomes have been widely applied as drug carriers in clinic . until now",
"furthermore , there should also be focus on the clinical therapeutic effects and toxic side effects of liposomal lipid composition .",
", the comparison of drug circulation time in blood , drug accumulation in tissues , and possible toxicity between conventional vesicles and new generations of liposomes should be investigated in preclinical animal models .",
"moreover , some of the new generation liposomes showed only comparable or even poor therapeutic efficiency compared with free drug or conventional vesicles in clinical trials . in comparison with doxil ,",
", several important types of liposomes , such as pegylated liposomes ( doxil and lipo - dox ) , temperature sensitive liposomes ( thermodox ) , cationic liposomes ( endotag1 - 1 ) , and virosomes ( expal and inflexal v ) have been investigated for clinic use .",
"in contrast with liposomal - based drugs on the market ( table 1 ) , liposome - based drugs in clinical trials ( table 2 ) focused more on the types of delivered drugs ( eg , cisplatin , blp25 lipopeptide , grb2 antisense oligodeoxynucleotide , bacteriophage t4 endonuclease 5 , etc ) and therapeutic applications ( from topical delivery systems to portable aerosol delivery systems ) . new liposomal formulations , such as pegylated liposomes , may extend blood circulation time , vary drug distribution in the body , and hence reduce the possible side effects related to the drugs ( eg , cardiotoxicity ) . however , pegylated liposomes ( doxil and lipo - dox ) displayed significant incidence of stomatitis in clinical trials , which may be related to pegylation ."
]
] | research on liposome formulations has progressed from that on conventional vesicles to new generation liposomes , such as cationic liposomes , temperature sensitive liposomes , and virosomes , by modulating the formulation techniques and lipid composition . many research papers focus on the correlation of blood circulation time and drug accumulation in target tissues with physicochemical properties of liposomal formulations , including particle size , membrane lamellarity , surface charge , permeability , encapsulation volume , shelf time , and release rate . this review is mainly to compare the therapeutic effect of current clinically approved liposome - based drugs with free drugs , and to also determine the clinical effect via liposomal variations in lipid composition . furthermore , the major preclinical and clinical data related to the principal liposomal formulations are also summarized . |
[
[
", the patient was diagnosed with \" wt and cd30 positive diffuse large b - cell lymphoma in the parotid gland . \" following the lymphoma diagnosis , a full body screen was performed .",
"a 60-year - old male patient was referred to an otorhinolaryngology clinic due to a lump on the left side of his jaw , which had grown in 2 months .",
"in addition to these findings , the left suprarenal gland showed two nodular mass lesions , which were assessed as likely adenomas ; however , this preliminary diagnosis was not confirmed by histopathology .",
"in addition to the lymphoid follicles with distinct germinal centers , infiltration of large neoplastic cells with bizarre and extremely atypical morphology was seen in the lymphoid component ( figs . 2 , 3 ) ."
],
[
"the presented case is a diffuse large b - cell lymphoma expressing cd30 positivity . to the best of our knowledge",
"this is the first case in literature describing dlbcl with expression of cd30 in wt .",
"histogenesis of the lymphoid stroma in wt has been a topic of discussion for many years .",
"saxena et al.1 state that because the lymphoid stroma of wt is part of the systemic lymphoid tissue , in patients with lymphomatous spread of wt , disseminated disease is present during the staging either at the time of the diagnosis or after . in the present case ,",
"dlbcl , small lymphocytic lymphoma , extranodal marginal zone lymphoma of mucosa associated lymphoid tissue , and mantle cell lymphoma have also been reported.4,6,8,9 a small number of t - cell lymphomas such as peripheric t - cell lymphoma and t - cell lymphoblastic lymphoma have also been described in wt.4,8,13 in summary , malignant lymphomas in wt are very rare ."
]
] | warthin 's tumor is the second most common type of salivary gland tumor . microscopically , warthin 's tumor displays a proliferative epithelial component and lymphoid stroma . carcinomas arising from the epithelial component are well known , but malignant transformations of the lymphoid stroma are rare . when they do occur , they are most commonly b - cell type non - hodgkin lymphomas . a 60-year - old male patient underwent surgical resection of a parotid mass . after superficial parotidectomy , microscopic examination indicated that the tumor was of epithelial components with basaloid and oncocytic columns of cells neighboring lymphoid components . in addition to the lymphoid follicles with distinct germinal centers , there were large , bizarre and extremely atypical neoplastic cells seen in the lymphoid component . large neoplastic cells were diffusely cd20 and cd30 positive . the patient was diagnosed with " warthin 's tumor and diffuse large b - cell lymphoma with expression of cd30 . " the histopathologic and clinical features are discussed along with a review of the literature . |
[
[
"the choice of implants used can be either a dynamic condylar screw plate ( dcs ) orproximal femoral nail ( pfn ) .",
"they almost always require open reduction and internal fixation . due to the increase in the emergence of native bone setters",
", these fractures are increasingly been managed by these spurious bone setters using native splints . as a result"
],
[
"union was achieved in 11 out of 13 patients at 12 weeks whereas two patients had delayed union which eventually healed at 18 weeks and 24 weeks .",
"here we have used a surgical grade 316 l stainless steel proximal femoral anatomical locked compression plate ( pf - lcp ) .",
"all our patients were followed up by serial radiographs at 6 , 12 , 18 , 24 weeks and thereafter at 6 months interval .",
"the average harris hip score at 1 year follow - up was excellent in eight , good in four and fair in one patient respectively .",
"we analyzed 13 patients with established non unions of subtrochanteric fractures treated in our centre by the use of the pf - lcp ."
],
[
"we conclude that in complicated non - unions , the use of pf - lcp has a definite positive role in the management of such cases ."
],
[
"hence , the frequency of non - union subtrochanteric fractures has increased in the recent past . the implant of choice has traditionally been either dcs plates or pfn . in our study",
"the interposing soft tissues along with the displacement means that these fractures necessitate open reduction . also to complicate matters ,",
"there has been a surge in the number of traditional bone setters who use native splints with massages .",
"while inter - trochanteric malunite frequently , subtrochanteric fractures most often end in non - unions .",
"clinical picture of the anatomical pf - lcp with proximal screws showing divergent screws and various angles ( 95 , 120 and 135 degrees )"
],
[
"primary bone grafting was done in two patients ( seinsheimer type iv ) i.e patients s. no . 2 and 12 [ table no .",
"all patients underwent open reduction with removal of interposing fibrous tissue , freshening of the edges and anatomical reduction .",
"2 ] to maintain poesteromedial cortical contact . wound closure and suture removal done as per standard guidelines .",
"we analyzed 19 consecutive patients with non - unions of subtrochanteric fractures who presented to our clinic .",
"eleven out of 13 patients started full weight bearing by 12 weeks with 2 patients walking full weight bearing at 18 and 24 weeks respectively .",
"all patients were started on non - weight bearing walking for 6 weeks . then weight bearing was started as tolerated .",
"serial radiographs were taken at 6 , 12 , 18 , 24 weeks follow - up and thereafter at 6 months interval ."
],
[
"two patients ( case no . 2 and 12 ) had delayed unions which healed eventually at 18 and 24 weeks respectively . they were both type iv seinsheimer fracture pattern with loss of posteromedial cortical contact .",
"we do not routinely advise or perform implant removals for any of our patients due to social and financial constraints . pre ",
"they were primarily grafted and this could be a possible reason for the delayed union .",
"there was one patient who had one case of wound dehiscence which required secondary suturing under local anaesthesia ( case no.9 ) ."
],
[
". the earlier used proximal femoral side plates namely dcs and the newly introduced pf - lcp have their own advantages in select cases .",
"liporace et al reported a case report of using a femoral fixator distractor over a i m nail to achieve length in a patient with limb length discrepancy . in our study",
"hence , we had a comparable union rate with no varus collapse or implant failure .",
"they also concluded that the complication rate was higher in those fractures fixed in varus ( > 10 degrees ) at the fracture emphasizing that correct anatomical alignment is of paramount importance in achieving union . in our study , all our patients underwent open reduction and anatomical reduction was achieved in all our patients .",
"however , we compared our results with the results of other authors [ 3 , 7 , 9 , 10 ] who used either pfn or dhs as the standard implant of choice for such fractures ."
],
[
"although the gold standard remains intramedullary devices for such fractures , we have concluded from our study that the anatomical proximal femur locked plates ( pf - lcp ) is able to provide comparable results with those of i m devices .",
"we therefore conclude that pf - lcp is a valuable tool in the arsenal of every orthopaedic surgeon .",
"although the conventional and current implant of choice is intramedullary nailing ( im / il nail ) following open reduction , the use of the pf - lcp has produced results similar to those of i m nails .",
"hence , for the appropriate patient choice , the pf - lcp is a newer and proven implant to use for excellent outcomes .",
"can be safely used with fracture extension into greater trochanter ( entry point for nail ) ."
]
] | introduction : subtrochanteric fractures have a bimodal age distribution . they are mostly due to high violence trauma in the younger age group . they almost always require open reduction and internal fixation . due to the increase in the emergence of native bone setters , these fractures are increasingly been managed by these spurious bone setters using native splints . as a result , non - union rate is high among such patients . these patients definitely need open reduction with internal fixation + /- bone grafting . the choice of implants used can be either a dynamic condylar screw plate ( dcs ) orproximal femoral nail ( pfn).case series : here we have used a surgical grade 316 l stainless steel proximal femoral anatomical locked compression plate ( pf - lcp ) . we analyzed 13 patients with established non unions of subtrochanteric fractures treated in our centre by the use of the pf - lcp . there were 10 males and 3 females . the average age was 48.23 years . all our patients were followed up by serial radiographs at 6 , 12 , 18 , 24 weeks and thereafter at 6 months interval . union was achieved in 11 out of 13 patients at 12 weeks whereas two patients had delayed union which eventually healed at 18 weeks and 24 weeks . the average harris hip score at 1 year follow - up was excellent in eight , good in four and fair in one patient respectively.conclusion:we conclude that in complicated non - unions , the use of pf - lcp has a definite positive role in the management of such cases . |
[
[
"there is a strong international momentum to improve the quality of acute stroke management.1 this is supported by high level evidence that now underpins many acute stroke interventions , including several provided by allied health professionals.2 although much of the current research on quality in stroke care has focused on factors that may influence medical interventions,37 allied health professionals are similarly interested in ways to implement best practice care.8 allied health professionals are members of multidisciplinary stroke teams and contribute to patient care from early in acute admission , through the stroke rehabilitation phase , and beyond .",
"this paper explores demographic and stroke - related factors ( predictor variables ) , including patient age , which may be associated with individual measures of quality of care provided to acute stroke patients by allied health professionals .",
"ensuring the highest quality of health care for all stroke patients is important in the current climate of scarce resources and the increasing burden of stroke to the health sector .",
"the professional composition of acute stroke teams may vary internationally . in the australian context of this study ,",
"our aim was to provide systematically determined information to guide clinical quality audits and targeted quality improvement strategies in stroke care .",
"allied health members include physiotherapists , occupational therapists , speech pathologists , social workers , dietitians , and psychologists.2 several researchers suggest that patient age is a determinant of the quality of medical and allied health care patients receive following acute stroke.35,913 we have previously reported that age and gender , on their own , are not related to an overall index of allied health care quality.14 further investigation is now required to determine whether patient age and gender are associated with individual measures of allied health care , and further , whether other variables , such as comorbidity , prestroke independence , and stroke severity , are putatively associated with allied health care . if there are differences in allied health care provided to patients with acute stroke , it is important to understand why care might differ , so that quality improvement strategies can be effectively targeted at problem areas ."
],
[
"ethical considerations and our sampling framework have been reported in detail previously.14 in summary , we conducted a retrospective clinical audit of medical records for 300 acute stroke patients from three metropolitan tertiary hospitals in adelaide , south australia , australia .",
"quality of care was determined by per patient compliance with all 20 process indicators.14 in the current study phase , compliance with each process indicator was considered individually and associations were explored with predictor variables .",
"univariate logistic regression models were constructed between : adherence with individual process indicators and age ; adherence with individual process indicators and non - age predictor variables ; the association of age with other predictor variables ; and the association between non - age variables .",
"we report relative risks for the first two of the analyses because we were examining associations between independent care predictors with dependent variables ( indicators of care quality derived from cross - sectional observational data ) .",
"we considered english proficiency in our study because it has previously been linked to stroke outcomes and the quality of health care patients receive.28,29 a simple causal pathway was constructed to assist in our understanding of how to undertake the analysis of the putative predictors of the allied health indicators of care .",
"sampled patients had been consecutively admitted to hospital prior to august 2009 , and the audit was conducted between november 2009 and april 2010 ."
],
[
"we previously reported on an overall index of 20 performance indicators of allied health service quality , identified from a literature review ( listed in table 2).14,15 although several of these indicators relate to interdisciplinary elements of stroke care which may be shared within a stroke team , the focus of this study is the ability of allied health professionals to contribute to this work , because this is largely unexplored . in our earlier study ,",
"quality of care was determined by per patient compliance with all 20 process indicators.14 in the current study phase , compliance with each process indicator was considered individually and associations were explored with predictor variables .",
"allied health professionals of interest in our research were from physiotherapy , occupational therapy , speech pathology , dietetics , social work , and psychology ."
],
[
"previous clinical audits and literature reviews of stroke provided awareness of the demographic and clinical variables that could be extracted retrospectively from medical records.1315 these variables are captured by stroke clinicians to assist diagnosis and clinical management , or for service monitoring .",
"many of these demographic and clinical variables have been associated with care quality in the stroke literature , especially for medical care,14 or as predictors of stroke outcomes . however , none of these predictor variables have previously been well explored for their influence on stroke care by allied health professionals .",
"in addition to the evidence discussed above regarding age - related differences in care , researchers have reported associations between gender and stroke care quality.1618 stroke severity is strongly linked to survival and discharge destination outcomes,19,20 and a priori reasoning suggests that it may prompt allied health care processes , such as swallow assessment , in patients with obvious risks of poor outcome .",
"we considered english proficiency in our study because it has previously been linked to stroke outcomes and the quality of health care patients receive.28,29",
"data were extracted from medical records on patient age , gender , premorbid levels of independence and accommodation type , english proficiency , comorbidity levels , weekend or weekday admission , stroke unit admission , initial stroke severity , length of stay in the acute hospital , and process indicator compliance .",
"stroke severity may also influence the ease with which specific care , such as early rehabilitation , can be achieved ."
],
[
"this approach was based on the causal modeling theory of rothman and greenland.30 we called this a simple causal pathway because we had no understanding at this point of the ongoing influence of early predictor variables on other variables which become important along the pathway .",
"a simple causal pathway was constructed to assist in our understanding of how to undertake the analysis of the putative predictors of the allied health indicators of care ."
],
[
"we undertook a series of analyses to understand the relationships between the putative predictor variables and each care process indicator , using our causal pathway as an analysis model .",
"univariate logistic regression models were constructed between : adherence with individual process indicators and age ; adherence with individual process indicators and non - age predictor variables ; the association of age with other predictor variables ; and the association between non - age variables .",
"correlations between variables were expressed as relative risks , odds ratios ( or , as appropriate ) , and 95% confidence intervals ( ci ) .",
"we report relative risks for the first two of the analyses because we were examining associations between independent care predictors with dependent variables ( indicators of care quality derived from cross - sectional observational data ) .",
"we reported or for the third and fourth analyses because we were examining the association between independent variables ."
],
[
"as reported in our earlier paper , age was most appropriately dichotomized as younger ( < 75 years ) and older ( 75 + years ) patients.14 stroke severity on admission was determined by retrospectively extracting data from medical records to complete a national institute of health stroke scale ( nihss ) for each patient .",
"it has been used in previous stroke outcome studies and has also been validity and reliability tested for retrospective data extraction.37,38 comorbidity information was extracted from the medical records to complete a cci for each patient . based on analysis reported in previous studies , patient cci scores were dichotomized as low comorbidity levels ( cci 1 ) vs high comorbidity levels ( cci > 1).38 patients admitted between 1600 hours on a friday and 2400 hours on a sunday , when access to allied health professionals was scarce , were recorded as weekend admissions .",
"the nihss is a widely used , valid , and reliable measure of stroke severity.31,32 it is also reliable and valid when data are extracted retrospectively from patient medical records.33,34 based on previous stroke studies , nihss scores were divided into three groups for analysis , ie , mild strokes ( nihss < 8) , moderate severity strokes ( nihss 816 ) , and severe strokes ( nihss > 16).35 comorbidity levels were measured using the charlson comorbidity index ( cci ) , which is a summary score of the existence or absence of 17 medical conditions , weighted to account for disease severity.36 this index has been validated as a predictive comorbidity index for patients with stroke .",
"length of stay data ( in days ) was broadly classified for analysis . for univariate analysis , length of stay",
"the cut point of 12 days was the mean length of stay for the data set and was also the average length of stay for acute stroke patients at the three data collection hospitals in 2007/08 and 2008/09.40 to provide more detailed consideration of the possible influence of length of stay on care , analysis considered length of stay in three groups divided at the data tertiles ( < 4 days , 49 days , and 10 days ) .",
"premorbid dependence level was recorded as independent or dependent , according to whether assistance was required with activities of daily living or instrumental activities of daily living.39 premorbid accommodation was recorded as a private home or a residential care facility ( nursing home or hostel ) ."
],
[
"significant correlations were found between patient age , and the predictor variables of stroke severity , comorbidity levels , premorbid accommodation , premorbid independence level , gender , english proficiency , and length of stay . in summary , compared with younger patients , patients 75 years or older were significantly more likely to have a moderate - to - severe or severe stroke ( or : 1.8 , 95% ci : 1.13.2 and or : 2.9 , 95% ci : 1.46.1 , respectively ) , to have higher comorbidity levels ( or : 2.5 , 95% ci : 1.54.2 ) , to have lived in residential care ( or : 2.6 , 95% ci : 1.16.2 ) , or been previously dependent ( or : 6.2 , 95% ci : 3.212 ) .",
"we revisit our initial causal pathway , adding in the associations found between adherence to allied health process indicators , and the early predictor variables captured in patient demographic and stroke event data .",
"this new pathway summarizes the journey for patients admitted with acute stroke and the multiple factors that can impact on the care they receive from allied health professionals .",
"only one process indicator had a significant association with age , where patients younger than 75 years were significantly more likely to receive first mobilization within 24 hours of stroke onset than older patients ."
],
[
"the sample was proportionally balanced for gender . despite similar mean ages for males and females , a larger proportion of females were in the older age groups , with 72% females aged 75 years or older , compared with",
"53% of males . a greater proportion of females suffered a moderate or severe stroke ( 28% ) than males ( 18% ) .",
"the mean length of stay in acute care was 12.5 days ( sd : 15.6 , range 198 days ) .",
"for the whole sample , there were weak relationships between increasing age and increasing stroke severity ( r = 0.21 ) and comorbidity levels ( r = 0.20 ) .",
"mean age at stroke onset was 74.7 years ( standard deviation [ sd ] : 13.5 , range 18100 years ) ."
],
[
"compliance with each process indicator was generally poor ( table 2 , columns 2 and 3 ) . for 16 of the process indicators ( 80% ) ,"
],
[
"only one process indicator had a significant association with age , where patients younger than 75 years were significantly more likely to receive first mobilization within 24 hours of stroke onset than older patients .",
"the outcome of univariate logistic regression models , associating process indicator adherence with age , is reported as relative risks in table 2 , column 4 ."
],
[
"compliance with 12 of the 20 process indicators ( 60% ) was significantly correlated with non - age variables .",
"the only variables which were not associated with any process indicator compliance were previous accommodation type and english proficiency . for 30% of the process indicators"
],
[
"significant correlations were found between patient age , and the predictor variables of stroke severity , comorbidity levels , premorbid accommodation , premorbid independence level , gender , english proficiency , and length of stay . in summary , compared with younger patients , patients 75 years or older were significantly more likely to have a moderate - to - severe or severe stroke ( or : 1.8 , 95% ci : 1.13.2 and or : 2.9 , 95% ci : 1.46.1 , respectively ) , to have higher comorbidity levels ( or : 2.5 , 95% ci : 1.54.2 ) , to have lived in residential care ( or : 2.6 , 95% ci : 1.16.2 ) , or been previously dependent ( or : 6.2 , 95% ci : 3.212 ) .",
"older patients were also more likely to be female ( or : 2.2 , 95% ci : 1.43.6 ) , to have a length of stay of 59 days ( or : 0.6 , 95% ci : 0.30.9 ) , and to have poor english proficiency ( or : 3.2 , 95% ci : 1.19.7 ) ."
],
[
"females were less likely than males to have been previously independent ( or : 2.2 , 95% ci : 1.43.7 ) , more likely to have a moderate or severe ( nihss 8) stroke ( or : 0.4 , 95% ci : 0.20.6 ) , and a length of stay 10 days ( or : 0.4 , 95% ci : 0.20.7 ) .",
"patients who suffered a moderate - to - severe stroke ( nihss 8) were more likely to have lived previously in residential care ( or : 0.3 , 95% ci : 0.10.7 ) , to have high comorbidity levels ( or : 0.6 , 95% ci : 0.40.98 ) , and to have a length of stay 10 days ( or : 2.6 , 95% ci : 1.54.7 ) . compared with patients having low comorbidity ,",
"we revisit our initial causal pathway , adding in the associations found between adherence to allied health process indicators , and the early predictor variables captured in patient demographic and stroke event data .",
"this new pathway summarizes the journey for patients admitted with acute stroke and the multiple factors that can impact on the care they receive from allied health professionals .",
"this analysis also demonstrated the potential redundancy in considering some non - age variables for their relevance to quality of allied health care ."
],
[
"this paper provides new data regarding the possible predictors of allied health care quality for patients with acute stroke .",
"allied health professional decision - making regarding the care delivered to patients with stroke has not been well explored . there may be complex influences on the decisions they make about the care they provide to patients with acute stroke , underpinned by their perspectives of the role of non - age predictor variables on patient outcome . our causal pathway ( figures 1 and 2 ) suggests that many factors can not be adjusted because they are a priori to the stroke .",
"based on our findings , we suggest that the quality of acute stroke care contributed by allied health in multidisciplinary settings could be improved .",
"some medical literature suggest that the age of an acute stroke patient is a determinant of the quality of medical care for stroke.35,912 in allied health care , we suggest that other factors may be at work ."
],
[
"to understand fully the important factors influencing the quality of care provided to acute stroke patients by allied health professionals will require further investigations into their perspectives on the capacity of stroke patients to improve , and how they make care decisions .",
"the associations identified between independent variables , including patient age , indicate that there are unlikely to be simple explanations for why some patients receive recommended care and others do not .",
"ensuring the highest quality of allied health care for all stroke patients is important in the current climate of scarce resources and the increasing burden of stroke to the health sector ."
]
] | background : we recently indicated that patient age on its own is not a determinant of quality of allied health care received after an acute stroke . it has not been tested whether other non - age variables influence care decisions made by allied health professionals . this paper explores demographic and stroke - related variables that are putatively associated with the quality of care provided to acute stroke patients by allied health professionals.methods:data were retrospectively audited from 300 acute stroke patient records regarding allied health care . compliance with each of 20 indicators of allied health care quality was established . the influence of various demographic and stroke - related variables on each performance indicator was examined . we undertook a series of analyses using univariate logistic regression models to establish the influence of these variables on care quality.results:patient age had a significant correlation with only one process indicator ( early mobilization ) . seven variables , including stroke severity and level of dependence , were associated with patient age . the majority of these age proxies had significant associations with process indicator compliance . correlations between non - age variables , in particular stroke severity and comorbidity , suggest the potential for complex confounding relationships between non - age variables and quality of allied health care.conclusion:compliance with individual indicators of allied health care was significantly associated with variables other than patient age , and included stroke severity , previous independence , comorbidities , day of admission , stroke unit admission , and length of stay . the inter - relationships between these non - age variables suggest that their influence on quality of care is complex . |
[
[
"thus , dbs could become an exciting method in the treatment of depression and obsessive compulsive disorder ( ocd ) and offers unique possibilities to gain more insight into the underlying neurobiology of psychiatric disorders .",
"different modalities of neuromodulation such as repetitive transcranial magnetic stimulation ( schlaepfer et al . , 2003 ;",
"both clinically and scientifically the most promising method of neuromodulation might be deep brain stimulation ( dbs ) .",
"fortunately , the safety of the stereotactic operation technique has been extremely improved in the last years with the help of neuroimaging .",
"on the other hand , dbs has many advantages over traditional therapy methods : clinical effects can be achieved without irreversible lesioning , stereotactic operation is the most minimal neurosurgical method and electrodes can be completely removed if necessary ."
],
[
"thus , dbs could become an exciting method in the treatment of depression and obsessive compulsive disorder ( ocd ) and offers unique possibilities to gain more insight into the underlying neurobiology of psychiatric disorders .",
"different modalities of neuromodulation such as repetitive transcranial magnetic stimulation ( schlaepfer et al . , 2003 ;",
"both clinically and scientifically the most promising method of neuromodulation might be deep brain stimulation ( dbs ) .",
"fortunately , the safety of the stereotactic operation technique has been extremely improved in the last years with the help of neuroimaging .",
"on the other hand , dbs has many advantages over traditional therapy methods : clinical effects can be achieved without irreversible lesioning , stereotactic operation is the most minimal neurosurgical method and electrodes can be completely removed if necessary ."
],
[
"as ocd is a heterogeneous disease , there might be different optimal targets for different symptom clusters .",
"the main focus of studies on the underlying neurobiology of major depression ( md ) has focused on the description of biological differences between patients and healthy subjects such as alterations of monoaminergic or endocrine systems .",
"in contrast to some neurological disorders , the pathological interplay of several brain regions contributes to the behavioral , emotional , and cognitive symptoms of psychiatric disorders .",
"obsessive compulsive disorder is characterized by obsessions ( anxiety - provoking thoughts ) and compulsions ( repeated , time - consuming behaviors ; stein , 2002 ) . as in most psychiatric disorders , a complex interplay of genetic factors , neurotransmitter changes and psychosocial characteristics contribute to the development of this disease ."
],
[
"the high mortality , low quality of life , and the social burden of inadequately treated serious psychiatric illness favor the use of dbs for treatment - resistant patients .",
"fundamental ethical concerns are generally applicable to all clinical interventions ( e.g. , pharmacotherapy , psychotherapy ) including dbs in neurological disorders .",
"more problematic is the danger of misuse , such as for mind control or for over - enhancement of normal ( healthy ) cognitive function ( brain doping ; fuchs , 2006 ; ford , 2007 ) . as clinical researchers in psychiatry ,",
"more practical ethical concerns are the availability of alternative treatment methods ( e.g. , pharmacotherapy , ect , psychotherapy ) . taking to account that dbs is used only with treatment - resistant patients , who have already shown no benefit with other treatment approaches currently available , the apparent reversibility of dbs and its robust potential benefits , as described by prior pilot studies , are strong ethical arguments for considering dbs treatment for resistant psychiatric disorders ( synofzik and schlaepfer , 2008 , 2010 ) . however , there are also some notable risks with dbs , particularly intracerebral bleeding and wound infection and its efficacy is not yet formally and extensively established in controlled trials .",
"our aim is to help patients to lead a normal life , including normal cognitive function and personal autonomy .",
"foremost , are patients able to give conformed consent ? it has been demonstrated that depressed patients show few impairments in decision - making capacity related to clinical treatment research ( appelbaum et al . , 1999 ) .",
"long - term effects of dbs can not be evaluated yet , but in comparison to pharmacotherapy , brain stimulation is a more specific and reversible intervention ."
],
[
", 2009a,2009b,2009c ) and combining these data with functional neuroimaging in order to map the spatiotemporal unfolding of dbs - elicited whole brain activity will lead to a much broader knowledge on functional and dysfunctional circuits processing affective stimuli revealing fundamental mechanisms of brain function .",
"nonetheless , the duration of the battery limits the choice of stimulation parameters , increases the risk of infection , and raises treatment costs .",
"there are no fundamental ethic objections to its use in psychiatric disorders , but until substantial clinical data is available , mandatory standards are needed for patient and target selection , quality of research center , and study protocol .",
"deep brain stimulation is a unique and very promising method for the treatment of therapy resistant psychiatric patients .",
"before , much more information about the therapeutic effect , individual predictors of response , possible short and long - time side effects , and neuroethical issues have to be gained .",
"a particular advantage of dbs is , that it allows recording signals from the stimulating electrodes ( cohen et al .",
"it is very important to point out that in the actual stage of research ; dbs for psychiatric diseases is clinical research on therapeutics ."
],
[
"the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest ."
]
] | most patients suffering from psychiatric disorders respond to combinations of psycho- and psychopharmacotherapy ; however there are patients who profit little if anything even after many years of treatment . since about a decade different modalities of targeted neuromodulation among them most prominently deep brain stimulation ( dbs ) are being actively researched as putative approaches to very treatment - resistant forms of those disorders . recently , promising pilot data have been reported both for major depression ( md ) and obsessive compulsive disorder ( ocd ) . given the fact that patients included in dbs studies had been treated unsuccessfully for many years with conventional treatment methods , renders these findings remarkable . remarkable is the fact , that in case of the long - term studies underway for md , patients show a stable response . this gives hope to a substantial percentage of therapy resistant psychiatric patients requiring new therapy approaches . there are no fundamental ethic objections to its use in psychiatric disorders , but until substantial clinical data is available , mandatory standards are needed . dbs is a unique and very promising method for the treatment of therapy resistant psychiatric patients . the method allows manipulating pathological neuronal networks in a very precise way . |
[
[
"currently , several studies have reported on the high success rate of redo pyeloplasty . however , to our knowledge , the factors affecting functional outcomes after redo pyeloplasty have not yet been reported . accordingly , the aim of this retrospective study was to evaluate changes in differential renal function ( drf ) , as a functional outcome , in children who underwent redo pyeloplasty for the management of failed pyeloplasty and to outline the factors associated therewith .",
"if left untreated , ureteropelvic junction obstruction ( upjo ) can lead to hydronephrosis and progressive impairment of renal function . with success rates exceeding 98% ,"
],
[
"the patients were followed up postoperatively by use of serial ultrasound and renal scintigraphy for evaluating long - term functional outcomes .",
"redo pyeloplasty depended on the presence of symptoms ( e.g. , urinary tract infection , flank pain ) , functional loss ( deterioration of drf of more than 5% ) , and an aggravated obstruction pattern on a renogram or a huge urinoma .",
"with approval from the institutional review broad of severance hospital ( 4 - 2014 - 0081 ) , medical records were obtained from a database of patients who had undergone redo pyeloplasty between january 2002 and november 2010 at severance hospital in seoul , korea . during this period ,",
"a total of 21 children underwent redo pyeloplasty by a single surgeon ( s.w.h . ) at sevrance hospital .",
"follow - up ultrasound was performed at 4 to 6 weeks after the operation and was then repeated every 1 to 6 months thereafter , according to the results of a previous study .",
"information on preoperative drf and renal cortical thickness ( rct ) was not available for 3 patients who had undergone renal scintigraphy or ultrasound at other institutions , and these patients were excluded from the analysis .",
"the degree of hydronephrosis was graded from 0 to 4 according to the society for fetal urology ( sfu ) classification scheme ."
],
[
"therefore , we performed double j stent insertion at 1 month after the redo operation .",
"when we evaluated hydronephrosis grade with serial ultrasound after redo pyeloplasty , all patients showed an improvement in hydronephrosis grade compared with that before redo pyeloplasty .",
"in the decrease in drf group , drf was significantly decreased between before and after initial pyeloplasty ( p=0.028 ) ; in the no decrease in drf group , the difference was not significant ( p=0.397 ) .",
"the mean follow - up duration between operations was 13.6612.40 months in the decrease in drf group and 13.666.77 months in the no decrease in drf group ( p=0.682 ) .",
"the mean ages were 55.5072.1 months in the decrease in drf group and 55.5047.15 months in the no decrease in drf group ( p=0.616 ) .",
"the mean drf before initial pyeloplasty was 45.16%5.60% in the decrease in drf group and was not significantly different from that ( 46.08%6.41% ) in the no decrease in drf group ( p=0.604 ) ."
],
[
"drf on renal scintigraphy worsened after the initial pyeloplasty in 6 patients , who showed deterioration of renal function ( decrease of more than 5% ) ; was stable in 11 patients ; and slightly increased in 1 patient .",
"the mean drf of diseased kidneys before and after initial pyeloplasty was 45.77%6.05% and 38.72%15.44% , respectively . at approximately 6 months after redo pyeloplasty , the mean drf increased to only 40.50%15.12% , a difference that was not significant .",
"after redo pyeloplasty , prevention of further functional deterioration was recorded in two - thirds of the patients but not in the remaining one - third ( fig ."
],
[
"before redo pyeloplasty , 14 patients were hydronephrosis grade 4 and the others were hydronephrosis grade 3 . when we evaluated hydronephrosis grade with serial ultrasound after redo pyeloplasty , all patients showed an improvement in hydronephrosis grade compared with that before redo pyeloplasty ."
],
[
"finally , we noted a significant positive correlation between drct and ddrf ( differences between before and after the initial operation ; p<0.001 ; r2 linear=0.716 ) . patients without deterioration of renal function showed almost no change in rct .",
"meanwhile , patients with a decline in drf of more than 5% showed greater decreases in rct ( fig .",
"the mean ages were 55.5072.1 months in the decrease in drf group and 55.5047.15 months in the no decrease in drf group ( p=0.616 ) .",
"the mean follow - up duration between operations was 13.6612.40 months in the decrease in drf group and 13.666.77 months in the no decrease in drf group ( p=0.682 ) ."
],
[
"during the follow - up period , we observed one complication associated with redo pyeloplasty .",
"therefore , we performed double j stent insertion at 1 month after the redo operation .",
"the patient showed no change in hydronephrosis grade ( sfu grade 3 ) and reported experiencing flank pain after redo pyeloplasty ."
],
[
"therefore , in the present study , we set out to evaluate changes in drf and rct by use of serial renal scintigraphy and ultrasound .",
"in doing so , we found that , after redo pyeloplasty , drf on renal scintigraphy was similar to that after failed pyeloplasty , reflecting the difficulties of recovering initial renal function .",
"accordingly , we believe that our study is important to establishing the concept of a renal functional outcome for predicting improvement after redo pyeloplasty . such a concept would better equip physicians for proper counseling of patients before surgery and for making successful surgical decisions .",
"severely reduced drf after a failed pyeloplasty , we attempted to assess rct as another factor of recoverability of renal function .",
"we discerned this to mean that severe reductions in renal function after an initial surgery may greatly affect the likelihood of recovering initial renal function after redo pyeloplasty . for detecting"
],
[
"redo pyeloplasty should be considered in cases of failed pyeloplasty in order to preserve renal function and to offer relief from symptoms . in patients who underwent redo pyeloplasty , ddrf and drct",
"were shown to be factors affecting the functional outcomes of this procedure . meanwhile , in patients who show severe deteriorations in drf or decreases in rct after initial pyeloplasty , recovery of initial drf after redo pyeloplasty may be difficult .",
"therefore , redo pyeloplasty should be performed before severe deterioration of drf or decreases in rct ."
],
[
"the title of this article implicates the author 's conclusive mind that delayed redo pyeloplasty fails to recover lost renal function .",
"reoperation is a psychologically large burden on the operator , and the reoperation itself is more difficult than the initial operation because of the adhesive surgical field and poor tissue condition of the renal pelvis and ureter .",
"first , after initial pyeloplasty , the postoperative result is not as simple and conclusive as \" surgical failure . \" sometimes , it is not easy for the surgeon to decide on reoperation .",
"discrepancies may exist in the imaging studies between the sonographic findings and excretion and renal function in the diuretic renogram .",
"the authors suggest that one should not hesitate to perform reoperation in cases of postoperative findings such as sonographic changes and loss of renal function . although it is not easy for surgeons to recommend reoperation during follow - up , it is worse to delay the decision for reoperation in cases showing definite deterioration . eventually , the deterioration causes superimposed urinary tract infection and flank pain and finally leads to decreased renal function .",
", functional improvement can be achieved only in the case of an acute high - grade obstruction ."
]
] | purposeto evaluate changes in differential renal function ( drf ) , as a functional outcome , in children who underwent redo pyeloplasty for management of failed pyeloplasty and to examine the factors that affect functional outcomes.materials and methodsbetween january 2002 and november 2010 , a total of 18 patients who underwent redo pyeloplasty for persistent ureteropelvic junction obstruction after failed pyeloplasty were enrolled in this study . we assessed perioperative factors and evaluated changes in renal cortical thickness ( rct ) , renal function , and hydronephrosis by use of serial ultrasound and diuretic renography.resultsthe mean follow - up period was 44.8328.86 months . after redo pyeloplasty , prevention of further functional deterioration was observed in only 12 of the 18 patients . after dividing the patients according to this observation , we discovered significant differences in both change in drf ( ddrf ) and change in rct ( drct ) ( difference between before and after initial pyeloplasty ) between the two groups ( p<0.001 ) . additionally , we noted a significant positive correlation between drct and ddrf . all patients showed improvements in hydronephrosis grade and relief of symptoms compared with before redo pyeloplasty.conclusionsredo pyeloplasty should be considered in cases of failed pyeloplasty to preserve renal function and obtain relief from symptoms . if patients show severe deterioration of drf or a decrease in rct after initial pyeloplasty , preservation of drf in these patients after redo pyeloplasty could be difficult . therefore , redo pyeloplasty should be performed before severe deterioration of drf or decrease in rct . |
[
[
"the aim of this paper is to provide an overview of the published cases of the hydatid cyst in unusual body sites from iran to delineate the most important demographic findings and locations of the disease in this hyperendemic country .",
"the hydatid cyst is a zoonosis caused by adult or larval stages of tapeworms belonging to the genus echinococcus granulosus .",
"echinococcosis / hydatidosis is one of the most important zoonotic diseases inasmuch as it occurs in different parts of iran ."
],
[
"the published cases of the hydatid cyst in unusual body sites from iran were reviewed via a search in pubmed , scopus , google scholar , iranmedex , scientific information database ( sid ) , magiran , and irandoc ( 1990 - 2011 ) , using the keywords of hydatid cyst and iran and echinococcus granulosus and iran .",
"the following inclusion criteria were employed : 1 ) articles must be written in english and farsi ; 2 ) articles must have been published between 1990 and 2011 ; 3 ) studies must be from iran and contain case report(s ) , diagnosing the hydatid cyst in unusual locations ( i.e. other than the liver and lung ) ; and 4 ) cases must have been pathologically confirmed postoperatively ."
],
[
"these cases may remain asymptomatic until reaching a large size , and the clinical signs vary according to the site . the parapharyngeal hydatid cyst in a 41-year - old female , and the nasolabial hydatid cyst in an 11-year - old adolescent , were the last two extremely rare case reports in this review from iran .",
"the published cases of the hydatid cyst with unusual locations from iran the most common locations were the central nervous system ( brain , spinal cord , and orbit ) , musculoskeletal system , heart , and kidney , whereas some less common locations were the spleen , pancreas , appendix , thyroid , salivary gland , adrenal gland , breast , and ovary .",
"in the last 20 years , about 463 cases of the hydatid cyst located in different parts of the body , excluding the liver and lung , have been published from iran .",
"omentum and retroperitoneum \n seven cases of the mesenteric , diaphragmatic , omental , pelvic , and retroperitoneal hydatid cyst have been reported from iran in the last 20 years .",
"seven cases , 5 males and 2 females with a mean age of 28.7 years , of the mediastinal hydatid cyst were reported from iran .",
"central nervous system \n in the last 20 years , about 256 cases of the hydatid cyst in the brain , spinal cord , and orbit have been reported form different geographical areas of iran ."
],
[
"our results demonstrated that the most common locations of the hydatid cyst , after the lung and liver , were the central nervous system , orbit , musculoskeletal system , cardiovascular system , kidney , and urinary tract .",
"there were also reports of the spleen , uterus , ovary , pancreas , salivary gland , breast , adrenal , appendix , mediastinum , omentum , and retroperitoneum hydatid cysts .",
"the clinical manifestations in the hydatid cyst of most parts of the body are too nonspecific to make a diagnosis based on the signs and symptoms before surgery . in all of the previous reports from iran and all around the world",
", it has been shown that serologic tests have many false - negative results , but imaging modalities such as ultrasonography , ct scan , and mri have been the methods of choice , especially the latter , which has been the diagnostic method of choice for the preoperative diagnosis of the hydatid cyst in most unusual locations . \n the best treatment for the hydatid cyst is surgical excision , accompanied by postoperative medical therapy .",
"the mediastinal hydatid cyst is uncommon but it should be included in the differential diagnosis of the mediastinal cyst in endemic parts of the world .",
"central nervous system , spinal cord , and orbit \n the cerebral and spinal cord hydatid cysts are very rare .",
"this cyst site accounted for the third common site of the hydatid cyst after the lung and liver ."
],
[
"these unusual locations often produce nonspecific symptoms ; consequently , it is advisable that the hydatid cyst be considered in the differential diagnosis of all cysts of the body , especially in endemic countries such as iran .",
"the hydatid cyst can present in any part of the body and no site is immune ."
]
] | hydatid disease is caused by echinococcus granulosus and is endemic in many parts of the world , including iran . this parasitic tapeworm can produce cysts in almost every organ of the body , with the liver and lung being the most frequently targeted organs . however , the cyst tends to appear in different and sometimes unusual body sites in various geographical areas of the world.this review provides information on the reported cases of the unusual body sites of the hydatid cyst from iran in the last 20 years . a literature search was performed through pubmed , scopus , google scholar , iranmedex , society information display ( sid ) , magiran , and irandoc using the keywords of hydatid cyst and iran and echinococcus granulosus and iran , and 463 published cases of the hydatid cyst in unusual body sites from iran were reviewed , evaluated , and discussed . the most common locations were the central nervous system ( brain , spinal cord , and orbit ) , musculoskeletal system , heart , and kidney , while some less common locations were the spleen , pancreas , appendix , thyroid , salivary gland , adrenal gland , breast , and ovary . |
[
[
"these studies indicate that sp signaling contributes to granuloma development and proinflammatory cytokine production in t. crassiceps infection and suggests a potential role for this mediator in human cysticercosis .",
"we also demonstrated that levels of il-2 , ifn- , il-4 , and il-10 protein were significantly higher in granulomas from infected wt mice than granulomas from infected spp - knockout or the sp - receptor ( neurokinin 1 , nk1 ) nk1-knockout mice [ 16 , 17 ] .",
"the current studies were aimed at determining if sp and nk1 contributed to granuloma development and/or to production of il-1 , tnf- , and il-6 in cysticercosis .",
"we previously detected substance p ( sp ) protein within granulomas associated with t. crassiceps infection [ 16 , 17 ] .",
"in addition , we detected mrna for il-1 , il-1 , il-1 receptor antagonist , and tnf- in all granulomas derived from infected wt mice .",
"sp injection induced recruitment of leukocytes into the pleural cavity of mice and into the skin of humans [ 1929 ] and stimulated the migration of human fibroblasts and peripheral blood lymphocytes in studies using modified boyden chambers or micropore filter analysis , respectively [ 1929 ] . in the current studies , we determined granuloma size and measured levels of il-1 , tnf- , and il-6 protein within granuloma obtained from t. crassiceps - infected wt and mice deficient in spp or nk1 ."
],
[
"female mice were infected by intraperitoneal inoculation with 10 cysts of the orf strain of t. crassiceps , as described in [ 16 , 17 ] .",
"cytokine protein levels were determined in 1215 granulomas derived from t. crassiceps infected wt mice , 46 granulomas derived from t. crassiceps infected spp - knockout mice , and 9 - 10 granulomas derived from t. crassiceps - infected nk1-knockout mice .",
"granulomas associated with dying cysts were removed from the peritoneal cavity of each of the infected mice that were euthanized .",
"granulomas associated with parasites were identified visually , removed from the peritoneal cavity , and either used for quantifying cytokine proteins by elisa or used for size determinations .",
"three groups of mice were included in the experiments : ( 1 ) wild type c57bl/6 mice ; ( 2 ) preprotachykinin or spp - knockout mice ( jackson laborotories , maine , usa , bred > 10 generations onto the c57bl/6 background ) ; ( 3 ) nk1-knockout mice provided by dr .",
"the volume of granuloma within each section was calculated by multiplying the area times 7 microns and the volume of granuloma within each section totaled to give the total granuloma volume .",
"intact granuloma was obtained from t. crassiceps - infected wt mice ( 2 granulomas ) , spp - knockout mice ( 4 granulomas ) , and nk1-knockout mice ( 3 granulomas ) , fixed with 4% paraformaldehyde , paraffin imbedded and completely sectioned by microtome into 7 micron sections .",
"a portion of each granuloma was homogenized in pbs , followed by centrifugation at 16,000 g. total protein in the supernatant was quantitated using the bradford method ( cat no .",
"three to 8 infected mice from each of the 3 groups were used for this study ; 415 granulomas per mouse group were used for this study .",
"the area of granuloma within each section was measured using image j software ( nih ) ."
],
[
"il-1 is the primary mediator of granuloma formation in the s. mansoni pulmonary granuloma model .",
"tnf- mediates granuloma growth in the s. mansoni pulmonary granuloma model and is required for granuloma formation in a mouse model of tuberculosis .",
"to begin to examine the contribution of sp signaling to granuloma formation in ncc , we measured granuloma volume in mice with normal and deficient sp signaling .",
"also , intratracheal injection of agarose beads coupled to recombinant il-1 induced pulmonary granulomas in mice . to determine if decreased production of il-1 in spp- and nk1-knockout mice contributed to reduced granuloma size in these animals , we measured il-1 protein levels in the granulomas derived from each group of mice ."
],
[
"the current studies were performed to determine the contribution of sp and its specific receptor , nk1 , to granuloma development and proinflammatory cytokine production within granulomas arising in mice infected with t. crassiceps .",
"thus , sp signaling contributes to granuloma formation , in part , through induction of il-1 and tnf- , key mediators of granuloma formation .",
"the current studies demonstrating that sp signaling contributes to granuloma formation in taenia crassiceps infection , together with other published observations , suggest the possibility that diminishing granuloma formation in ncc by blocking sp , which contributes to granuloma formation and epileptogenic responses , may be beneficial in the treatment of this disease .",
"our findings extend these observations and indicate that sp signaling contributes to granuloma formation and production of il-1 , tnf- , and il-6 protein within granuloma formed in response to t. crassiceps infection ."
]
] | cysticercosis is an infection with larval cysts of the cestode taenia solium . through pathways that are incompletely understood , dying parasites initiate a granulomatous reaction that , in the brain , causes seizures . substance p ( sp ) , a neuropeptide involved in pain - transmission , contributes to inflammation and previously was detected in granulomas associated with dead t. crassiceps cysts . to determine if sp contributes to granuloma formation , we measured granuloma - size and levels of il-1 , tnf- , and il-6 within granulomas in t. crassiceps - infected wild type ( wt ) mice and mice deficient in sp - precursor ( spp ) or the sp - receptor ( neurokinin 1 , nk1 ) . granuloma volumes of infected spp- and nk1-knockout mice were reduced by 31 and 36% , respectively , compared to wt mice ( p < .05 for both ) and produced up to 5-fold less il-1 , tnf- , and il-6 protein . thus , sp signaling contributes to granuloma development and proinflammatory cytokine production in t. crassiceps infection and suggests a potential role for this mediator in human cystercercosis . |
[
[
"a few studies have assessed the prevalence of chd at birth by the echocardiographic screening of an in - hospital population .",
", we aimed to investigate the prevalence of chd in langfang district by analyzing data collected by hospitals located in the counties of the district , as supported a public health campaign focusing on chd treatment .",
"langfang district in hebei province is one of the prefecture - level cities with an area of 6429 square kilometers , and the population is approximately 4.4 million , mainly to the han nationality .",
"in developing countries , congenital heart disease ( chd ) is the most common congenital malformation , and it presents high mortality and morbidity . the prevalence of chd has been reported to range from 4 to 50 cases per 1000 live births .",
"no large - sample , population - based study on chd using echocardiography has been conducted in langfang district .",
"most chd prevalence data are based on population - based birth defect registries or clinical symptoms ."
],
[
"this cross - sectional study took place in the langfang district 's 11 maternal and child health certificate registries responsible for the diagnosis of chd as commissioned by the health administrative department of district . according to the schedule of the public health campaign ,",
"half of the cost of echocardiography ( approximately rmb 245 yuan ) was supported by the local government , and the maternity and child care institutions prescribed an echocardiography application form for every infant while distributing birth certificates or at the time of vaccination or physical examination . along with the echocardiography application form , a data collection form was also provided to infants parents .",
"once the echocardiography was completed , the data will be entered into an online data collection system designed specifically for this public health campaign by trained staff from the maternity and child healthcare institutions . to standardize the diagnosis , echocardiography expert from general hospital of beijing military region are in charge of confirmation of chd and providing technical support . to facilitate reassessment of echocardiography diagnosis",
"meanwhile , a self - administered standard questionnaire was designed to investigate socio - demographic characteristics , including maternal age , residence , infant gender , birth weight , gestational age , etc .",
"all 3-month - old infants in the district were encouraged to participate , but only those with willingness to undergo echocardiography in the outpatient department received an ultrasound examination . from july 19 , 2012 to july 18 , 2014 , it is reported that there were totally 77,836 3-month - old infants in the district . among those ,",
"infants diagnosed with chd were followed up at 1 year of age , and their parents were invited to complete a questionnaire then .",
"2011 - 98 ) , and written informed consent regarding the the protocol of chd screening in langfang district was signed by the parents of the infants . in this study ,",
"the data collection form was used to collect the demographic information and to record the echocardiography result and referral information .",
"the screening group comprised a pediatrician who was responsible for the clinical examination , an echocardiographic doctor who conducted the echo - diagnosis and a cardiologist who explained the abnormality or outcome ."
],
[
"all 3-month - old infants in the district were encouraged to participate , but only those with willingness to undergo echocardiography in the outpatient department received an ultrasound examination . from july 19 , 2012 to july 18 , 2014 , it is reported that there were totally 77,836 3-month - old infants in the district . among those ,",
"the reasons for nonparticipating were not surveyed , but as speculated by the local health staff involved in the public health campaign , feeling unnecessary may be a key reason .",
"this cross - sectional study took place in the langfang district 's 11 maternal and child health certificate registries responsible for the diagnosis of chd as commissioned by the health administrative department of district . according to the schedule of the public health campaign ,",
"67,718 ( 87% ) joined the campaign and had received an ultrasound examination , whereas the remaining 10,118 did not .",
"infants diagnosed with chd were followed up at 1 year of age , and their parents were invited to complete a questionnaire then ."
],
[
"2011 - 98 ) , and written informed consent regarding the the protocol of chd screening in langfang district was signed by the parents of the infants .",
"the study was approved by the general hospital of beijing military region ethics committee ( no ."
],
[
"in this study , diagnosis was made by echocardiography , and in all of the 11 hospitals , the sonosite m - turbo ultrasonic diagnostic instrument equipped with a pediatric probe ( frequency 48 mhz ) was used for the examination . cardiac structure and function",
"were observed along the standard parasternal long - axis , short - axis , suprasternal , subcostal , and apical four - chamber views .",
"all infants were scanned by a senior echocardiographic doctor with more than 5 years of echocardiographic experience to ensure quality .",
"meanwhile , a self - administered standard questionnaire was designed to investigate socio - demographic characteristics , including maternal age , residence , infant gender , birth weight , gestational age , etc .",
"the screening group comprised a pediatrician who was responsible for the clinical examination , an echocardiographic doctor who conducted the echo - diagnosis and a cardiologist who explained the abnormality or outcome ."
],
[
"patent foramen oval and atrial septal defect ( asd ) ( defect < 4 mm in diameter ) were excluded from chd to avoid overestimation .",
"chd was classified on the basis of the international classification of diseases , ninth revision , and the clinical modification code ."
],
[
"to improve the participation rate , half of the cost of echocardiography ( approximately rmb 245 yuan ) was supported by the local government , and the maternity and child care institutions prescribed an echocardiography application form for every infant while distributing birth certificates or at the time of vaccination or physical examination . along with the echocardiography application form , a data collection form was also provided to infants parents .",
"once the echocardiography was completed , the data will be entered into an online data collection system designed specifically for this public health campaign by trained staff from the maternity and child healthcare institutions . to standardize the diagnosis , echocardiography expert from general hospital of beijing military region are in charge of confirmation of chd and providing technical support . to facilitate reassessment of echocardiography diagnosis",
"the data collection form was used to collect the demographic information and to record the echocardiography result and referral information .",
", all image graphs were required to be stored in the computer . to avoid misdiagnosis and omissions"
],
[
"the data used in this study were directly exported from the data collection system in the form of an excel spreadsheet .",
"chicago illinois , usa ) . the chi - square test was used to compare rates . the value of p < 0.05 was considered statistically significant ."
],
[
"the top five most common cardiac abnormalities were the following : asd ( 605 cases , 8.93 ) ; ventricular septal defect ( vsd , 550 cases , 8.12 ) ; patent ductus arteriosus ( pda , 228 cases , 3.37 ) ; pulmonary stenosis ( ps , 66 cases , 0.97 ) ; and tetralogy of fallot ( tof , 32 cases , 0.47 ) .",
"of the 77,836 3-month - old infants who were born during the study , 67,718 were examined by echocardiography ( coverage rate : 67,718/77 , 836 = 87% ) , including 61,505 full - term infants and 6213 preterm infants ( < 37 weeks ) .",
"the chd prevalence differed by gender in this study ( = 23.498 , p < 0.001 ) , and there were more females with asd ( = 56.62 ) ; however , this was not true of vsd ( = 0.01 ) or pda ( = 0.86 ) [ table 1 ] .",
"regional differences in prevalence were also found ( = 24.602 , p < 0.001 ) ; a higher prevalence was found in urban areas ( 32.2 cases per 1000 live births ) than in rural areas ( 21.1 cases per 1000 live births ) . there was a significant difference in the prevalence of chd in preterm versus full - term infants ( = 133.443 , p < 0.001 ) .",
"a total of 1554 infants were diagnosed with chd during the 2-year ( 42.5% boys , 57.5% girls ) .",
"prevalence of chd in infants of maternal aged 35 years or over was significantly higher ( = 86.917 , p < 0.001 ) ."
],
[
"of the 77,836 3-month - old infants who were born during the study , 67,718 were examined by echocardiography ( coverage rate : 67,718/77 , 836 = 87% ) , including 61,505 full - term infants and 6213 preterm infants ( < 37 weeks ) ."
],
[
"the top five most common cardiac abnormalities were the following : asd ( 605 cases , 8.93 ) ; ventricular septal defect ( vsd , 550 cases , 8.12 ) ; patent ductus arteriosus ( pda , 228 cases , 3.37 ) ; pulmonary stenosis ( ps , 66 cases , 0.97 ) ; and tetralogy of fallot ( tof , 32 cases , 0.47 ) .",
"a total of 1554 infants were diagnosed with chd during the 2-year ( 42.5% boys , 57.5% girls ) .",
"the chd prevalence differed by gender in this study ( = 23.498 , p < 0.001 ) , and there were more females with asd ( = 56.62 ) ; however , this was not true of vsd ( = 0.01 ) or pda ( = 0.86 ) [ table 1 ] .",
"regional differences in prevalence were also found ( = 24.602 , p < 0.001 ) ; a higher prevalence was found in urban areas ( 32.2 cases per 1000 live births ) than in rural areas ( 21.1 cases per 1000 live births ) . there was a significant difference in the prevalence of chd in preterm versus full - term infants ( = 133.443 , p < 0.001 ) .",
"prevalence of chd in infants of maternal aged 35 years or over was significantly higher ( = 86.917 , p < 0.001 ) .",
"chd distribution by gender asd : atrial septal defect ; vsd : ventricular septal defect ; pda : patent ductus arteriosus ; ps : pulmonary stenosis ; tof : tetralogy of fallot ; dorv : double - outlet right ventricle ; sv : single ventricle ; iaa : interrupted aortic arch ; chd : congenital heart disease ."
],
[
"a total of 67,718 3-month - old infants were diagnosed using echocardiography in langfang district during 20122014 , and 1554 infants were found to have chd .",
"the chd prevalence differed by gender , regional , gestational , and maternal age . in this study , we used echocardiography as a diagnosis tool to investigate the prevalence of chd in langfang district in china ; the overall prevalence of chd was found to be 22.9 cases per 1000 live births .",
"currently , echocardiography has become the most important , noninvasive and standard diagnostic method for chd and is helpful in early diagnosis and in reducing mortality .",
"echocardiography is a reliable and simple imaging examination method that can be used in the diagnosis of chd , particularly for measuring intracardiac structure and blood flow .",
"the order of chd in langfang district as follow : asd , vsd , pda , pa , and tof .",
"our data indicate that asd is the most frequent type of chd , followed by vsd , pda , ps , and tof , in that order ."
],
[],
[]
] | background : congenital heart disease ( chd ) is the most common congenital malformations with high mortality and morbidity . the prevalence of chd reported previously ranged from 4 per 1000 live births to 50 per 1000 live births . in this cross - sectional study , we aimed to document the prevalence of chd in langfang district of hebei province , china by analyzing data collected by hospitals located in 11 the counties of the district , as supported by a public health campaign.methods:a total of 67,718 consecutive 3-month - old infants were included from july 19 , 2012 to july 18 , 2014 . structural abnormalities were diagnosed based on echocardiography findings , including two - dimensional and color doppler echocardiography results.results:of the 67,718 infants , 1554 were found to have cardiac structural abnormalities . the total prevalence of chd was 22.9 per 1000 live births , a value significantly higher than the previously reported prevalence of 8 cases per 1000 live births . the top five most common cardiac abnormalities were as follows : atrial septal defect ( asd , 605 cases , 8.93 ) ; ventricular septal defect ( 550 cases , 8.12 ) ; patent ductus arteriosus ( 228 cases , 3.37 ) ; pulmonary stenosis ( 66 cases , 0.97 ) ; and tetralogy of fallot ( 32 cases , 0.47 ) . the chd prevalence differed by gender in this study ( 2 = 23.498 , p < 0.001 ) , and the majority of asd cases were females . regional differences in prevalence were also found ( 2 = 24.602 , p < 0.001 ) ; a higher prevalence was found in urban areas ( 32.2 cases per 1000 live births ) than in rural areas ( 21.1 cases per 1000 live births ) . there was a significant difference in the prevalence of chd in preterm versus full - term infants ( 2 = 133.443 , p < 0.001 ) . prevalence of chd in infants of maternal aged 35 years or over was significantly higher ( 2 = 86.917 , p < 0.001).conclusions : the prevalence of chd in langfang district was within the range reported using echocardiography . echocardiography can be used to early diagnose the chd . |
[
[
"renal transplantation rates are low among patients highly sensitized to human leukocyte antigen ( hla ) because of the high rate of antibody - mediated rejection and subsequent graft loss .",
"it was recently reported , however , that preoperative desensitization using an anti - cd 20 antibody ( rituximab ) and intravenous immunoglobulin improved transplantation rates in patients highly sensitized to hla . in contrast , the significance of a positive lymphocytotoxic crossmatch in living donor liver transplantation ( ldlt ) is controversial .",
"successful ldlt using a liver graft in which the lymphocytotoxic crossmatch was highly positive is reported ."
],
[
"for preoperative desensitization , the patient was first infused with rituximab 2 weeks before the scheduled surgery ( due to a catheter - associated infection , however , the operation was postponed and ldlt was performed 21 days after initiation of the rituximab therapy ) . as the antibody to hepatitis b core antigen was positive , entecavir ( 0.5 mg / day ) was administered for 3 weeks preoperatively to prevent a possible hepatitis b virus breakthrough .",
"the recipient was a 41-year - old woman with end - stage liver disease due to alcoholic liver cirrhosis ( model for end - stage liver disease score 21 ) . at the age of 20 , she was gravida one , para one .",
"she was considered a candidate for liver transplantation because of repeated episodes of encephalopathy . because of the severe shortage of cadaveric donor grafts in japan , we planned an ldlt , and her husband was willing to donate his partial liver .",
"one year after the ldlt , the lymphocytotoxic crossmatch remained negative and the patient has been well with good graft function.fig . ",
"acr acute cellular rejection , alt alanine aminotransferase , mmf mycophenolate mofetil , mp methylprednisolone , pe plasma exchange , tb total bilirubin , pod postoperative day the clinical profile of the present patient .",
"acr acute cellular rejection , alt alanine aminotransferase , mmf mycophenolate mofetil , mp methylprednisolone , pe plasma exchange , tb total bilirubin , pod postoperative day"
],
[
"the impact of a lymphocytotoxic crossmatch - positive liver graft on acute cellular rejection and graft survival remains controversial , both in deceased donor liver transplantation [ 3 , 4 ] and in ldlt [ 57 ] .",
"perioperative desensitization using plasmapheresis and rituximab may provide significant benefits for reducing anti - hla antibodies .",
"although the significance of a quantitative assessment of the lymphocytotoxic crossmatch has not been reported , the high titer in our present patient led to the need for perioperative desensitization to prevent early graft loss due to antibody - mediated rejection . after considering the results in the present patient ,",
"in contrast , our previous results showed that if the titer is low ( no more than 32 ) , a positive lymphocytotoxic crossmatch does not adversely affect the graft or survival in patients without desensitization .",
"preoperative desensitization using rituximab was introduced in abo - incompatible ldlt in 2003 and has dramatically improved the outcomes of abo - incompatible ldlt .",
"mild acute cellular rejection occurred about 3 weeks after the ldlt , but response to the steroid recycle therapy was prompt , and the lymphocytotoxic crossmatch was negative during this episode . in summary , we report a successful ldlt using a lymphocytotoxic crossmatch highly positive graft ."
]
] | we describe a successful living donor liver transplantation ( ldlt ) using a lymphocytotoxic crossmatch highly positive graft . a 41-year - old woman with alcoholic liver cirrhosis was referred as a potential candidate for ldlt , and her husband was willing to donate his partial liver . as the t - lymphocytotoxic crossmatch titer was over 10,000 , the patient was first infused with rituximab for preoperative desensitization , and then five rounds of plasmapheresis were performed . after the third plasmapheresis , the lymphocytotoxic crossmatch test was negative . a left liver graft including the caudate lobe was implanted , and anti - cd25 antibody ( basiliximab ) was administered on postoperative days 1 and 4 . the postoperative course was uneventful except for an episode of mild acute cellular rejection on postoperative day 27 . although the impact of a lymphocytotoxic crossmatch - positive liver graft on acute cellular rejection and graft survival in ldlt remains controversial , perioperative desensitization may provide benefits when using a highly sensitized liver graft . |
[
[
"erythropoietin ( epo ) , a 30-kda glycoprotein hormone , is produced by the kidney to regulate the hematopoiesis in bone marrow , and recombinant human epo has been widely used in the treatment of anemia , especially in end - stage renal disease and certain hematologic diseases.6 interestingly , there is considerable evidence indicating that epo acts as a novel renoprotective agent against ischemic , toxic , and septic aki in animal experiments by reducing apoptosis , stimulating cell proliferation and eliciting its antioxidative and anti - inflammatory functions.7,8 recently , a few randomized controlled trials ( rcts ) analyzed the role of epo to prevent aki in patients within the icu or after surgery who were at high risk of aki.918 however , the results from these trials were inconsistent , partly because they involved single - site studies with small - scale samples .",
"therefore , we conducted a systematic review and meta - analysis of rcts to determine whether the use of epo in patients with critical illness or perioperative care could ameliorate the incidence of aki and assess its adverse event .",
"acute kidney injury ( aki ) , defined as an abrupt drop of renal function within a short period , is a frequent and serious complication in the intensive care unit ( icu ) or after surgery , with an incidence of 7.7%42% in patients with previous normal renal function.1,2 aki or even a minor increase in serum creatinine level from baseline was independently associated with increased length of hospitalization , health care costs , cardiovascular events , and mortality.3,4 although there have been many clinical studies on the protection of kidney function in patients with critical illness or perioperative care , such as the administration of n - acetylcysteine , atrial natriuretic peptide , and fenoldopam , the results of such interventions are somewhat contradictory or unproven.5 consequently , it is paramount that more attention should be paid to explore effective preventative and therapeutic strategies for the management of aki ."
],
[
"this systematic review and meta - analysis was conducted according to the preferred reporting items for systematic reviews and meta - analyses ( prisma ) statement recommendations.19 a comprehensive search was conducted in medline ( through ovid ) , embase ( through ovid ) , the cochrane central registry of controlled trials , and the web of science from inception to october 2014 .",
"in addition , other potentially relevant studies were searched from the clinical trials database ( http://clinicaltrials.gov/ ) for completed trials and the references cited in the retrieved articles and pertinent reviews .",
"the risk of bias in the eligible trials was assessed according to the cochrane collaboration tool ( version 5.1.0),20 which included 7 items : random sequence generation , allocation concealment , blinding of participants and personnel , blinding of outcome assessment , incomplete outcome data , selective reporting , and other bias . in each item , an answer of low risk of bias suggested sufficient and correct information , high risk of bias indicated that the item was reported incorrectly , and unclear risk of bias meant insufficient or unmentioned details for judgment . for dichotomous outcomes ( the incidence of aki , dialysis requirement , and mortality ) ,",
"the primary outcome was the incidence of aki , the secondary outcomes included dialysis requirement , 30-day mortality , and the adverse events .",
"studies were included when the following inclusion criteria were met : ( 1 ) rcts , ( 2 ) adult patients ( age 18 years ) with critical illness or perioperative care , ( 3 ) use of epo for prevention at least in 1 treatment group , ( 4 ) control group receiving placebo or usual treatment , ( 5 ) reported incidences of aki in both groups , and ( 6 ) for more than 1 publication on the same trial , data from the most recent or complete report were used .",
"subgroup analysis was performed based on ( 1 ) entirely perioperative care , ( 2 ) no use of epo previously , ( 3 ) at least 2 doses of epo , and ( 4 ) patients at high risk for aki according to each study ."
],
[
"in addition , other potentially relevant studies were searched from the clinical trials database ( http://clinicaltrials.gov/ ) for completed trials and the references cited in the retrieved articles and pertinent reviews .",
"medical subject headings , entry terms , and text word searches included the following terms : critical illness , critical care , intensive care , ",
"a comprehensive search was conducted in medline ( through ovid ) , embase ( through ovid ) , the cochrane central registry of controlled trials , and the web of science from inception to october 2014 .",
"icu , severely ill , perioperative care , perioperative period , erythropoietin , epoetin , epo , erythropoiesis stimulating protein , darbepoetin , acute kidney injury , acute renal injury , acute renal insufficiency , acute kidney insufficiency , acute renal failure , acute kidney failure , acute tubular necrosis , aki , ",
"arf , and atn . there was no restriction on language or publication date ."
],
[
"studies were included when the following inclusion criteria were met : ( 1 ) rcts , ( 2 ) adult patients ( age 18 years ) with critical illness or perioperative care , ( 3 ) use of epo for prevention at least in 1 treatment group , ( 4 ) control group receiving placebo or usual treatment , ( 5 ) reported incidences of aki in both groups , and ( 6 ) for more than 1 publication on the same trial , data from the most recent or complete report were used .",
"all titles , abstracts , and full articles were independently searched and evaluated using predesigned inclusion and exclusion criteria by 2 investigators ( c.z . and z.c.l . ) .",
"any discrepancies were resolved by consensus with a third investigator ( q.m.l . ) if necessary , which was infrequent .",
"exclusion criteria were as follows : ( 1 ) nonrandomized or pseudo - randomized design , retrospective study , case report , and case series ; ( 2 ) enrolled participants undergoing chronic dialysis therapy , nephrectomy , or transplant surgery ( heart , liver , or kidney ) due to their complex situations ; ( 3 ) lack of a control group ; ( 4 ) studies not addressing the target outcome as mentioned above ; and ( 5 ) use of epo as a treatment agent after the occurrence of aki ."
],
[
"data included the first author , publication year , nation of origin , study participants , sample size , whether epo was used previously , mean age , proportions of male patients , hypertension , and diabetes mellitus , mean baseline hemoglobin and serum creatinine levels , mean blood transfusion volume , treatment regimens of the epo - based intervention and control groups , definition of aki , and outcomes measured .",
"the primary outcome was the incidence of aki , the secondary outcomes included dialysis requirement , 30-day mortality , and the adverse events .",
"two investigators ( q.m.l . and x.x . ) independently extracted data from all eligible trials and assessed the risk of bias .",
"when the study had several dosage intervention arms,14 all epo intervention arms were combined as one arm by weighted means . in the case of missing or incomplete data , the corresponding author of the original trial was contacted by e - mail for additional information .",
"the risk of bias in the eligible trials was assessed according to the cochrane collaboration tool ( version 5.1.0),20 which included 7 items : random sequence generation , allocation concealment , blinding of participants and personnel , blinding of outcome assessment , incomplete outcome data , selective reporting , and other bias . in each item , an answer of low risk of bias suggested sufficient and correct information , high risk of bias indicated that the item was reported incorrectly , and unclear risk of bias meant insufficient or unmentioned details for judgment ."
],
[
"for dichotomous outcomes ( the incidence of aki , dialysis requirement , and mortality ) , data were pooled as risk ratio ( rr ) with 95% confidence interval ( ci ) .",
"if there was significant heterogeneity among studies ( pq - statistic < 0.10 and i > 50% ) , the random effect model ( dersimonian and laird method ) was adopted to pool the results ; otherwise , the fixed effect model ( mantel - haenszel method ) was used .",
"sensitivity analysis was conducted to assess the influence of individual studies on the pooled estimate of effects by withdrawing 1 study at a time .",
"subgroup analysis was performed based on ( 1 ) entirely perioperative care , ( 2 ) no use of epo previously , ( 3 ) at least 2 doses of epo , and ( 4 ) patients at high risk for aki according to each study .",
"the between - study heterogeneity was quantified by cochran 's q - statistic and the inconsistency index ( i ) .",
"the assessment for the risk of bias was performed with review manager software ( version 5.3 from http://tech.cochrane.org/revman ) ."
],
[
"forest plots of rr estimates with the corresponding 95% ci for ( a ) the incidence of aki , ( b ) dialysis requirement , and ( c ) mortality in patients receiving epo therapy versus control .",
"all ten eligible rcts reported that the overall incidence of aki was 10.57% ( 147 of 1391 participants ) in the epo - based intervention group and 10.38% ( 142 of the 1368 participants ) in the control group .",
"pooled analysis using a fixed effect model showed that there was no significant difference for preventing the development of aki between the epo and control groups ( rr , 0.97 ; 95% ci , 0.791.19 ; p = 0.782 ) , as shown in figure 3a . meanwhile , the test for between - study heterogeneity among the included trials was not significant ( i = 20.2% and p = 0.257 ) .",
"the intention to treat of participants in 1 study included aki patients on randomization,11 and for the objective of this meta - analysis , the data of the subgroup not aki on randomization were used in this analysis ."
],
[
"the intention to treat of participants in 1 study included aki patients on randomization,11 and for the objective of this meta - analysis , the data of the subgroup not aki on randomization were used in this analysis .",
"the included studies spanned from 2002 to 2014 , and with the exception of 2 articles,9,10 the sample size of all other studies was relatively small ( 63108 participants ) .",
"four trials were conducted in korea,12,13,16,17 2 in the united states,9,10 and the others in new zealand,11 switzerland,14 thailand,15 and sweden.18 napolitano et al10 reanalyzed the data from critically ill trauma patients in epo-2 trial,9 which had been included in this meta - analysis , so only the part of epo-3 trial was included in this analysis .",
"the participants in 6 studies received only a single administration of epo1214,1618 ; however , participants received at least 2 doses in the other studies . two studies provided supplementary iron therapy to both the intervention and control groups,9,10 and 1 study provided an iron sucrose supplement only to the intervention group.12 there was considerable variation in the definition of aki across these studies , which was not clear in 2 studies.9,10",
"the one - time epo dosage was either fixed as 20,000 units or 40,000 units in 3 studies9,10,14 or was based on participant weight ranging from 100 units / kg to 500 units / kg in the other 7 studies .",
"one study13 was the follow - up of a previous trial21 ; therefore , the incidence of aki was extracted from the former , and the baseline data were extracted from the latter . all studies enrolled participants from single - site center except 3.911 with respect to the participants setting , 8 studies were performed in perioperative period , 6 of which were conducted in patients with elective cardiac surgery,1216,18 one assessed patients undergoing thoracic aorta surgery with hypothermic cardiac arrest,17 and the rest one partly included patients with scheduled cardiothoracic surgery.11 baseline clinical characteristics of included studies six studies excluded patients who used epo previously,9,10,13,15,17,18 whereas other studies did not specify this issue . in 3 of the 10 studies , a high risk for developing aki , the definitions of which were not the same , was included in the enrollment criteria.11,14,16 in 8 studies , baseline end - stage renal disease or dialysis was set as a compulsory exclusion criterion.913,15,16,18 when reported , mean baseline hemoglobin levels ranged from 9.3 to 13.1 g / dl,9,10,1215,18 and mean baseline serum creatinine levels varied from 0.92 to 1.35 mg / dl.1316,18 the type of erythropoiesis - stimulating agent used in all of the intervention groups was epo - alpha or -beta , but not darbepoietin ."
],
[
"all ten studies reported randomization , but 7 studies described the methods of randomization,912,14,16,18 and only 4 studies showed the details of concealed allocation.11,13,15,18 all studies reported double blinding and no or few missing outcome data with the reason .",
"eight studies provided the clinical trial registration number online with a low risk of bias in selective outcome reporting.10,11,1318 because of the unbalanced use of iron supplementation in 2 groups , 1 study exhibited a high risk of bias in the item other biases.12 risk of bias in included studies .",
"a , risk of bias graph demonstrates the percentages of included studies for each item in the tool ; ( b ) risk of bias summary illustrates the review author 's judgments with a cross - tabulation for each eligible study ."
],
[
"all ten eligible rcts reported that the overall incidence of aki was 10.57% ( 147 of 1391 participants ) in the epo - based intervention group and 10.38% ( 142 of the 1368 participants ) in the control group .",
"forest plots of rr estimates with the corresponding 95% ci for ( a ) the incidence of aki , ( b ) dialysis requirement , and ( c ) mortality in patients receiving epo therapy versus control .",
"the funnel plots for publication bias tests of studies assessing the effect of epo on ( a ) the incidence of aki and ( b ) mortality .",
"the sensitivity analysis by removing each individual study at a time is shown on the pooled effect size of the incidence of aki .",
"pooled analysis using a fixed effect model showed that there was no significant difference for preventing the development of aki between the epo and control groups ( rr , 0.97 ; 95% ci , 0.791.19 ; p = 0.782 ) , as shown in figure 3a ."
],
[
"the dialysis requirement was reported in 7 studies11,1318 totaling 590 analyzable patients , and in 3 of these studies , no patient was treated with dialysis in either group.13,14,18 the overall incidence of dialysis was 2.65% ( 8 of the 302 participants ) in the epo - based intervention group and 3.82% ( 11 of the 288 participants ) in the control group . by meta - analysis for 4 studies using a fixed effect model,11,1517",
"there was no significant difference of mortality between the epo and control groups ( rr , 0.72 ; 95% ci , 0.311.70 ; p = 0.457 ) without significant between - study heterogeneity ( i = 0% , p = 0.662 ) , as shown in figure 3b .",
"because there were only 4 articles in the literature with the effective data , the publication bias was not investigated ."
],
[
"the ten included studies demonstrated that overall mortality was 11.07% ( 154 of the 1391 participants ) in the epo - based intervention group and 11.40% ( 156 of the 1368 participants ) in the control group .",
"mortality was ascertained in - hospital in 3 studies,13,15,16 at 30 days in 5 studies,912,14 and unclear in the remaining study.17,18 pooled analysis using a fixed effect model showed that there was no significant difference of mortality between the epo and control groups ( rr , 0.96 ; 95% ci , 0.781.18 ; p = 0.705 ) without significant between - study heterogeneity ( i = 0% , p = 0.562 ) , as shown in figure 3c .",
"meanwhile , there was no evidence of publication bias for the mortality outcome ( fig ."
],
[
"six studies demonstrated that none of the patients who received the epo intervention suffered from adverse events , which were associated with the use of drug , throughout the study period , such as hypertension , symptomatic thrombosis , myocardial infarction , stroke , headache , and seizures.1216,18 one study did not report adverse events,17 and 1 study reported adverse events for the entire participants without specifically describing the specific group.11 corwin et al9 showed that the incidence of deep thrombophlebitis was 2.15% ( 14/650 ) among the epo intervention group and 2.30% ( 15/652 ) in the control group without significant difference .",
"napolitano et al10 reported that the incidence of clinically relevant thrombovascular events was 16.42% ( 66/402 ) in the epo intervention group and 12.53% ( 49/391 ) in the control group with an rr of 1.31 ( 95% ci , 0.931.85 ) ."
],
[
"in this present meta - analysis of 10 rcts with 2759 participants , we found that compared with placebo , prophylactic epo therapy for patients who are critically ill or under perioperative care was not associated with a significant reduction in the incidence of aki , dialysis requirement , or mortality .",
"meanwhile , the effect of epo on aki prevention was consistent with the above result for the stratified analyses on patients with entirely perioperative care , no previous epo use , or more than 1 dose of epo .",
"in addition , epo therapy was not associated with adverse events in these studies , which appeared to be safe in this kind of patients .",
"an accepted uniform epo study protocol would reduce the degree of variation among the studies ."
],
[
"in summary , this meta - analysis , based on currently available rct evidence , suggests that prophylactic epo treatment of patients with critical illness or under perioperative care does not reduce the incidence of aki , dialysis requirement , or death .",
"considering the limitations of this study , larger scale , well - designed multicenter rct studies using optimal doses and administration times are needed to investigate the role of epo in aki prevention ."
]
] | objective : the aim was to investigate the efficacy and safety of erythropoietin ( epo ) to prevent acute kidney injury ( aki ) in patients with critical illness or perioperative care.methods:randomized controlled trials comparing epo with placebo for aki prevention in adult patients with critical illness or perioperative care were searched in medline , embase , the cochrane central register of controlled trials , the web of science , and clinical trials.gov until october 2014 . the outcomes of interest included the incidence of aki , dialysis requirement , mortality , and adverse event . fixed effect model was used to calculate the pooled risk ratio ( rr ) and 95% confidence interval ( ci ) for eligible studies.results:ten randomized controlled trials involving 2759 participants were identified and included in the analysis . compared with placebo , epo administration did not reduce the incidence of aki ( rr , 0.97 ; 95% ci , 0.791.19 ; p = 0.782 ) , dialysis requirement ( rr , 0.72 ; 95% ci , 0.311.70 ; p = 0.457 ) , or mortality ( rr , 0.96 ; 95% ci , 0.781.18 ; p = 0.705 ) . moreover , epo had no effect on the risk of adverse events , but estimations of rr were difficult due to their relatively infrequent occurrence.conclusions:this meta - analysis suggests that prophylactic administration of epo in patients with critical illness or perioperative care does not prevent aki , dialysis requirement , or mortality . |
[
[
"the purpose of this study was to examine the long - term patterns of brain reorganization following limb amputation . to systematically characterize brain reorganization",
", we first used a combined tract - based spatial statistics ( tbss ) and tractography analysis , which enables a precise characterization of both whole - brain wm and specific anatomical fiber tracts , to assess the microstructural changes in patients with unilateral amputation in the lower limb .",
"we then performed surface - based morphometry across the whole brain gm and regions of interest ( roi ) focusing on the sensorimotor cortices .",
"fractional anisotropy ( fa ) is the most often used dti index of wm integrity , and reduced fa in amputees has been reported in the corpus callosum ( cc ) and corticospinal tract . although these studies have been carried out to determine the effects of missing limbs on brain reorganization , little is known about the associations between gm and wm changes after amputation ."
],
[
"analyses of covariance ( ancova ) adjusting for age and sex were used to explore the group differences in the mean fa value for each of the fiber tracts generated by pdt and in the mean cortical thickness for each of the selected sensorimotor regions in both hemispheres . finally , the relationships between the wm and gm changes were investigated using partial correlation analyses ( adjusted for age and sex ) .",
"a false discovery rate ( fdr ) corrected threshold of 0.05 was considered as significant for these analyses .",
"regional differences between amputees and controls were assessed using a vertex - by - vertex general linear model controlling for the potential confounding effects of age , sex , and tiv .",
"randomize tool , which is specifically designed for permutation testing with nonparametric values . age and sex",
"the wm labels atlas and tractography atlas implemented in fsl were used for the structural identification .",
"finally , using the brodmann areas ( ba ) atlas in freesurfer ( https://surfer.nmr.mgh.harvard.edu/fswiki/brodmannareamaps ) , we measured the individual mean cortical thickness values in the sensorimotor regions , including the bilateral ba 1 , 2 , 3a , 3b , 4a , 4p , and 6 . in order to avoid the overlap among these labels ,"
],
[
"no significant associations were found between the cortical thickness in the affected regions ( as shown in table 4 ) and the dti parameters of the fiber tracts generated from the pdt in the amputees . however , partial correlation analyses revealed that the fa value of the ifof ( as shown in figure 1(d ) ) was negatively correlated to the time since amputation ( r = 0.55 , p = 0.03 ) .",
"there were no significant differences in sex ratio , age , education , and mmse scores between the amputees and controls . compared with controls , the amputees showed a decreased fa in the right superior corona radiata and wm regions underlying the right temporal lobe and left premotor cortex ( pmc ) ( figures 1(a ) , 1(c ) , and 1(e ) ; table 2 ) .",
"pdt from the above clusters revealed that the contributing wm tracts were the commissural fibers connecting the bilateral premotor cortices and the association fibers that exactly overlapped with the inferior frontooccipital fasciculus ( ifof ) ( figures 1(b ) and 1(d ) ) ."
],
[
"cortical thickness and fa values were used as measures to evaluate the gm and wm microstructural changes across the whole brain compared with normal controls . as a consequence , we found that patients with amputation at the right lower limb exhibited cortical thinning in the left premotor area and the right visual - to - motor regions . additionally , the integrity of the fiber tracts connecting the bilateral pmc and those underlying the right visual - to - motor regions was also significantly reduced in the patients .",
"in the present study , we explored brain structural reorganization in lower limb amputees without plp .",
"our study demonstrates that cortical reorganization occurs in lower limb amputees , even in the absence of plp .",
"left lower limb amputation might result in different morphological and functional changes , especially with respect to the contralateral pmc and the structures in the visual stream .",
"we observed a thinning trend in different cerebral lobules , especially in the pmc contralateral to the affected side ."
],
[
"in this study , we combined high - resolution brain structural mri and dti to investigate the existence and extent of cortical and wm plasticity in subjects with right lower limb amputation . in summary , we found specific motor and somatosensory plastic changes in amputees without plp and provided an update on the plasticity of the human brain involving both gm and underlying wm after limb injury ."
]
] | accumulating evidence has indicated that amputation induces functional reorganization in the sensory and motor cortices . however , the extent of structural changes after lower limb amputation in patients without phantom pain remains uncertain . we studied 17 adult patients with right lower limb amputation and 18 healthy control subjects using t1-weighted magnetic resonance imaging and diffusion tensor imaging . cortical thickness and fractional anisotropy ( fa ) of white matter ( wm ) were investigated . in amputees , a thinning trend was seen in the left premotor cortex ( pmc ) . smaller clusters were also noted in the visual - to - motor regions . in addition , the amputees also exhibited a decreased fa in the right superior corona radiata and wm regions underlying the right temporal lobe and left pmc . fiber tractography from these wm regions showed microstructural changes in the commissural fibers connecting the bilateral premotor cortices , compatible with the hypothesis that amputation can lead to a change in interhemispheric interactions . finally , the lower limb amputees also displayed significant fa reduction in the right inferior frontooccipital fasciculus , which is negatively correlated with the time since amputation . in conclusion , our findings indicate that the amputation of lower limb could induce changes in the cortical representation of the missing limb and the underlying wm connections . |